Gene Literature Dashboard

Viewing September 2023 — 645 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← August 2023 October 2023 →
STAU1PTGIS
Also flagged:ovarian cancerdeathgynecologic cancerHigh-grade serous carcinomaovarian tumorsp53
Journal Article 2023-09-30 ✓ 3 Snippets Wisztorski M, Aboulouard S, Roussel L, Duhamel M, Saudemont P, Cardon T, Narducci F, Robin YM, Lemaire AS, Bertin D, Hajjaji N, Kobeissy F, Leblanc E, Fournier I, Salzet M.
In-Text Gene Mentions

…NA-binding staufen homolog-1 (STAU1), and D-3-phosphoglycerate de…

STAU1has been previously…

…as well asPTGIS(Prostacyclin synthase) and…

Show Full Abstract

Ovarian cancer is the leading cause of death from gynecologic cancer worldwide. High-grade serous carcinoma (HGSC) is the most common and deadliest subtype of ovarian cancer. While the origin of ovarian tumors is still debated, it has been suggested that HGSC originates from cells in the fallopian tube epithelium (FTE), specifically the epithelial cells in the region of the tubal-peritoneal junction. Three main lesions, p53 signatures, STILs, and STICs, have been defined based on the immunohistochemistry (IHC) pattern of p53 and Ki67 markers and the architectural alterations of the cells, using the Sectioning and Extensively Examining the Fimbriated End Protocol. In this study, we performed an in-depth proteomic analysis of these pre-neoplastic epithelial lesions guided by mass spectrometry imaging and IHC. We evaluated specific markers related to each preneoplastic lesion. The study identified specific lesion markers, such as CAVIN1, Emilin2, and FBLN5. We also used SpiderMass technology to perform a lipidomic analysis and identified the specific presence of specific lipids signature including dietary Fatty acids precursors in lesions. Our study provides new insights into the molecular mechanisms underlying the progression of ovarian cancer and confirms the fimbria origin of HGSC.

Also flagged:Cognitive ImpairmentcognitionAlzheimerdementiacognitive declineAlzheimer's disease and related dementia
Journal Article 2023-09-30 No Snippets Baker LD, Snyder HM, Espeland MA, Whitmer RA, Kivipelto M, Woolard N, Katula J, Papp KV, Ventrelle J, Graef S, Hill MA, Rushing S, Spell J, Lovato L, Felton D, Williams BJ, Ghadimi Nouran M, Raman R, Ngandu T, Solomon A, Wilmoth S, Cleveland ML, Williamson JD, Lambert KL, Tomaszewski Farias S, Day CE, Tangney CC, Gitelman DR, Matongo O, Reynolds T, Pavlik VN, Yu MM, Alexander AS, Elbein R, McDonald AM, Salloway S, Wing RR, Antkowiak S, Morris MC, Carrillo MC, U.S. POINTER Study Group.
Show Full Abstract

<h4>Introduction</h4>The U.S. study to protect brain health through lifestyle intervention to reduce risk (U.S. POINTER) is conducted to confirm and expand the results of the Finnish Geriatric Intervention Study to Prevent Cognitive Impairment and Disability (FINGER) in Americans.<h4>Methods</h4>U.S. POINTER was planned as a 2-year randomized controlled trial of two lifestyle interventions in 2000 older adults at risk for dementia due to well-established factors. The primary outcome is a global cognition composite that permits harmonization with FINGER.<h4>Results</h4>U.S. POINTER is centrally coordinated and conducted at five clinical sites (ClinicalTrials.gov: NCT03688126). Outcomes assessments are completed at baseline and every 6 months. Both interventions focus on exercise, diet, cognitive/social stimulation, and cardiovascular health, but differ in intensity and accountability. The study partners with a worldwide network of similar trials for harmonization of methods and data sharing.<h4>Discussion</h4>U.S. POINTER is testing a potentially sustainable intervention to support brain health and Alzheimer's prevention for Americans. Impact is strengthened by the targeted participant diversity and expanded scientific scope through ancillary studies.

Also flagged:RNA-Binding ProteinsNeurotoxicityneurodegenerative diseasesneurogenerative diseasesdeathgene expression
Journal Article 2023-09-30 No Snippets Ocharán-Mercado A, Loaeza-Loaeza J, Castro-Coronel Y, Acosta-Saavedra LC, Hernández-Kelly LC, Hernández-Sotelo D, Ortega A.
Show Full Abstract

Despite sustained efforts to treat neurodegenerative diseases, little is known at the molecular level to understand and generate novel therapeutic approaches for these malignancies. Therefore, it is not surprising that neurogenerative diseases are among the leading causes of death in the aged population. Neurons require sophisticated cellular mechanisms to maintain proper protein homeostasis. These cells are generally sensitive to loss of gene expression control at the post-transcriptional level. Post-translational control responds to signals that can arise from intracellular processes or environmental factors that can be regulated through RNA-binding proteins. These proteins recognize RNA through one or more RNA-binding domains and form ribonucleoproteins that are critically involved in the regulation of post-transcriptional processes from splicing to the regulation of association of the translation machinery allowing a relatively rapid and precise modulation of the transcriptome. Neurotoxicity is the result of the biological, chemical, or physical interaction of agents with an adverse effect on the structure and function of the central nervous system. The disruption of the proper levels or function of RBPs in neurons and glial cells triggers neurotoxic events that are linked to neurodegenerative diseases such as spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), fragile X syndrome (FXS), and frontotemporal dementia (FTD) among many others. The connection between RBPs and neurodegenerative diseases opens a new landscape for potentially novel therapeutic targets for the intervention of these neurodegenerative pathologies. In this contribution, a summary of the recent findings of the molecular mechanisms involved in the plausible role of RBPs in RNA processing in neurodegenerative disease is discussed.

OLFM4
Also flagged:IFNγStat1agingMHC class IIinterferon gammaantigen presentation
Journal Article 2023-09-30 ✓ 5 Snippets Omrani O, Krepelova A, Rasa SMM, Sirvinskas D, Lu J, Annunziata F, Garside G, Bajwa S, Reinhardt S, Adam L, Käppel S, Ducano N, Donna D, Ori A, Oliviero S, Rudolph KL, Neri F.
In-Text Gene Mentions

…BL6/J, Lgr5-ki-eGFP-creER, andOlfm4-ki-eGFP-creER mice were group…

…the Lgr5-eGFP andOlfm4-eGFP ISCs, the freshly…

…Lgr5-eGFP hi orOlfm4-eGFP ISCs were sorted…

…with primary antibodies: anti-Olfm4(Cell Signaling, D6Y5A,…

…analysis utilizing theOlfm4-eGFP-CreERT2 reporter mice 29…

Show Full Abstract

The influence of aging on intestinal stem cells and their niche can explain underlying causes for perturbation in their function observed during aging. Molecular mechanisms for such a decrease in the functionality of intestinal stem cells during aging remain largely undetermined. Using transcriptome-wide approaches, our study demonstrates that aging intestinal stem cells strongly upregulate antigen presenting pathway genes and over-express secretory lineage marker genes resulting in lineage skewed differentiation into the secretory lineage and strong upregulation of MHC class II antigens in the aged intestinal epithelium. Mechanistically, we identified an increase in proinflammatory cells in the lamina propria as the main source of elevated interferon gamma (IFNγ) in the aged intestine, that leads to the induction of Stat1 activity in intestinal stem cells thus priming the aberrant differentiation and elevated antigen presentation in epithelial cells. Of note, systemic inhibition of IFNγ-signaling completely reverses these aging phenotypes and reinstalls regenerative capacity of the aged intestinal epithelium.

HTT
Also flagged:serotonin transporterserotoninextracellularHTR1AHTR2AMAOA
Journal Article 2023-09-30 ✓ 5 Snippets Bruzzone SEP, Nasser A, Aripaka SS, Spies M, Ozenne B, Jensen PS, Knudsen GM, Frokjaer VG, Fisher PM.
In-Text Gene Mentions

BDNF is a common neurotrophin mediating neurodevelopmental, survival and plasticity functions whose activity levels can affect serotonin release 27 as well as 5-HTT expression in animal models28, while 5-HT2A is a core regulator of excitatory serotonin neurotransmission.

These findings suggest that genetic variants other than those in the SLC6A4 gene may indirectly modulate 5-HTT availability by affecting serotonergic signaling via other pathways.In this framework, serotonin receptor 1A (5-HT1A, encoded by gene HTR1A), which is the principal inhibitory serotonin receptor that can inhibit serotonin release29, and monoamine oxidase A (MAOA, encoded by gene MAOA), the main enzyme involved in serotonin degradation30 can directly affect serotonin levels, which may in turn affect 5-HTT levels via its downregulation 31.

The serotonin transporter (5-HTT) critically shapes serotonin neurotransmission as it facilitates serotonin reuptake, thereby regulating extracellular serotonin levels and associated receptor signaling1.

MAOA rs1137070 has been linked to increased MAOA mRNA levels and higher enzymatic activity, suggesting that this variant may directly affect serotonin levels35 and it was associated to SSRI treatment outcome36,37, suggesting a possible interaction with 5-HTT.

The serotonin transporter (5-HTT) critically shapes serotonin neurotransmission by regulating extracellular brain serotonin levels; it remains unclear to what extent 5-HTT levels in the human brain are genetically determined.

Show Full Abstract

The serotonin transporter (5-HTT) critically shapes serotonin neurotransmission by regulating extracellular brain serotonin levels; it remains unclear to what extent 5-HTT levels in the human brain are genetically determined. Here we applied [<sup>11</sup>C]DASB positron emission tomography to image brain 5-HTT levels and evaluated associations with five common serotonin-related genetic variants that might indirectly regulate 5-HTT levels (BDNF rs6265, SLC6A4 5-HTTLPR, HTR1A rs6295, HTR2A rs7333412, and MAOA rs1137070) in 140 healthy volunteers. In addition, we explored whether these variants could predict in vivo 5-HTT levels using a five-fold cross-validation random forest framework. MAOA rs1137070 T-carriers showed significantly higher brain 5-HTT levels compared to C-homozygotes (2-11% across caudate, putamen, midbrain, thalamus, hippocampus, amygdala and neocortex). We did not observe significant associations for the HTR1A rs6295 and HTR2A rs7333412 genotypes. Our previously observed lower subcortical 5-HTT availability for rs6265 met-carriers remained in the presence of these additional variants. Despite this significant association, our prediction models showed that genotype moderately improved prediction of 5-HTT in caudate, but effects were not statistically significant after adjustment for multiple comparisons. Our observations provide additional evidence that serotonin-related genetic variants modulate adult human brain serotonin neurotransmission.

Also flagged:AutophagyOsteoarthritisjoint diseaseagingdeathrelated
Journal Article 2023-09-30 No Snippets Arias C, Salazar LA.
Show Full Abstract

Osteoarthritis is a multifactorial joint disease characterized by degeneration, and aging stands as a significant risk factor. Autophagy, a crucial cellular homeostasis mechanism, is influenced by aging and closely linked to cartilage health. This correlation between autophagy, cell death, and OA underscores its relevance in disease progression. MicroRNAs have emerged as autophagy regulators, with miRNA-based interventions showing promise in preclinical models. Remarkably, the ethanolic extract of propolis exhibits positive effects on autophagy-related proteins and healthy cartilage markers in an in vitro osteoarthritis model. The aim of this brief report was to evaluate through in silico analysis and postulate five microRNAs that could regulate autophagy proteins (AKT1, ATG5, and LC3) and assess whether the ethanolic extract of propolis could regulate the expression of these microRNAs. Among the examined miRNAs (miR-19a, miR-125b, miR-181a, miR-185, and miR-335), the ethanolic extract of propolis induced significant changes in four of them. Specifically, miR-125b responded to EEP by counteracting IL-1β-induced effects, while miR-181a, miR-185, and miR-335 exhibited distinct patterns of expression under EEP treatment. These findings unveil a potential link between miRNAs, EEP, and autophagy modulation in OA, offering promising therapeutic insights. Nevertheless, further validation and clinical translation are warranted to substantiate these promising observations.

OLFM4
Also flagged:EFALBCRISP2LCNL1PTGDSmale
Journal Article 2023-09-30 ✓ 5 Snippets Cichowska AW, Wisniewski J, Bromke MA, Olejnik B, Mogielnicka-Brzozowska M.
In-Text Gene Mentions

…and Olfactomedin 4 (OLFM4) ( Figure 1…

…0.05) and betweenOLFM4content and ALH…

…0.05), and alsoOLFM4and STR (r…

…CLU, GALNT6, andOLFM4, which are important…

OLFM4is a glycoprotein…

Show Full Abstract

Sperm maturation in the epididymis is based on interactions with proteins from epididymal fluid (EF). The aim of the study was to profile canine EF proteome and investigate correlations between EF protein content and epididymal spermatozoa (ES) motion parameters. Twenty-three male dogs were divided into two groups: good sperm motility (GSM) and poor sperm motility (PSM). The total motility and progressive motility differed significantly (<i>p</i> = 0.031; <i>p</i> < 0.001, respectively) between the GSM group and the PSM group. The semen samples were centrifuged to separate the EF apart from the ES. The canine EF proteins were analyzed using nano-liquid chromatography, which was coupled with quadrupole time-of-flight mass spectrometry (NanoUPLC-Q-TOF/MS) and bioinformatic tools for the first time. A total of 915 proteins were identified (GSM-506; PSM-409, respectively). UniProt identification resulted in six unique proteins (UPs) in the GSM group of dogs and four UPs in the PSM group. A semi-quantitative analysis showed a higher abundance (<i>p</i> < 0.05) of four differentially expressed proteins in the GSM group (ALB, CRISP2, LCNL1, PTGDS). Motility-dependent variations were detected in the EF proteome and were related to important metabolic pathways, which might suggest that several proteins could be potential ES motility biomarkers.

DCC
Also flagged:Colorectal CancerToll-likevitamin DtumorsToll-like and vitamin D receptortumor
Journal Article 2023-09-30 ✓ 1 Snippet Messaritakis I, Psaroudaki E, Vogiatzoglou K, Sfakianaki M, Topalis P, Iliopoulos I, Mavroudis D, Tsiaoussis J, Gouvas N, Tzardi M, Souglakos J.
In-Text Gene Mentions

…, BIRC5 ,DCC, GSK3B ,…

Show Full Abstract

<h4>Background</h4>This study aimed to investigate the molecular profiles of 237 stage III CRC patients from the international IDEA study. It also sought to correlate these profiles with Toll-like and vitamin D receptor polymorphisms, clinicopathological and epidemiological characteristics, and patient outcomes.<h4>Methods</h4>Whole Exome Sequencing and PCR-RFLP on surgical specimens and blood samples, respectively, were performed to identify molecular profiling and the presence of Toll-like and vitamin D polymorphisms. Bioinformatic analysis revealed mutational status.<h4>Results</h4>Among the enrolled patients, 63.7% were male, 66.7% had left-sided tumors, and 55.7% received CAPOX as adjuvant chemotherapy. Whole exome sequencing identified 59 mutated genes in 11 different signaling pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) CRC panel. On average, patients had 8 mutated genes (range, 2-21 genes). Mutations in <i>ARAF</i> and <i>MAPK10</i> emerged as independent prognostic factors for reduced DFS (<i>p</i> = 0.027 and <i>p</i> < 0.001, respectively), while RAC3 and <i>RHOA</i> genes emerged as independent prognostic factors for reduced OS (<i>p</i> = 0.029 and <i>p</i> = 0.006, respectively). Right-sided tumors were also identified as independent prognostic factors for reduced DFS (<i>p</i> = 0.019) and OS (<i>p</i> = 0.043). Additionally, patients with tumors in the transverse colon had mutations in genes related to apoptosis, <i>PIK3</i>-<i>Akt</i>, <i>Wnt</i>, and <i>MAPK</i> signaling pathways.<h4>Conclusions</h4>Molecular characterization of tumor cells can enhance our understanding of the disease course. Mutations may serve as promising prognostic biomarkers, offering improved treatment options. Confirming these findings will require larger patient cohorts and international collaborations to establish correlations between molecular profiling, clinicopathological and epidemiological characteristics and clinical outcomes.

PRDX6
Also flagged:Non-Small-Cell Lung Cancerextracellularchemotaxiscell proliferationNSCLCPD-L1
Journal Article 2023-09-30 ✓ 5 Snippets Lin X, Dong Y, Gu Y, Wei F, Peng J, Su Y, Wang Y, Yang C, Neira SV, Kapoor A, Tang D.
In-Text Gene Mentions

PRDX6, MAGOHB, NUCKS1, DCAF13, and TXN displayed opposite trends on their potential facilitation of CTL function as well as correlations with immune checkpoints and TILs (tumor-infiltrating lymphocytes) compared to ITGAL, ITGAX, and TMEM119 in NSCLC.

The above inference is supported by the opposite correlations of PRDX6, MAGOHB, NUCKS1, DCAF13, and TXN genes, the human counterparts of murine genes upregulated in taxifolin-treated LL2 tumors (Table S2A), with NSCLC-associated immune cells.

PRDX6 (peroxiredoxin 6) and TXN (thioredoxin) are known for their antioxidant activities, and TXN enhances NK cell-derived anti-cancer immunity in the tumor microenvironment (TME) [55], suggesting a potential for their inductions to contribute to taxifolin’s antioxidant actions.

Consistent with this notion, the mouse homologous genes of human PRDX6, MAGOHB, NUCKS1, DCAF13, and TXN were upregulated by taxifolin in LL2 LC tumors (Table S2A) and facilitated CTL-derived toxicity towards cancer cells (Figure S4A).

In addition to the taxifolin-downregulated genes discussed above, we noticed five genes (Prdx6, Magohb, Nucks1, Dcaf13, and Txn1) being upregulated by taxifolin in LL2 tumors (Table S2A); their human homologous genes, PRDX6, MAGOHB, NUCKS1, DCAF13, and TXN, possessed negative T cell dysfunction values < −1 in all five TIDE datasets (Figure S4A), indicating their actions in facilitating CTL function.

Show Full Abstract

Using an LL2 cell-based syngeneic mouse LC model, taxifolin suppressed allografts along with the appearance of 578 differentially expressed genes (DEGs). These DEGs were associated with enhancement of processes related to the extracellular matrix and lymphocyte chemotaxis as well as the reduction in pathways relevant to cell proliferation. From these DEGs, we formulated 12-gene (TxflSig) and 7-gene (TxflSig1) panels; both predicted response to ICB (immune checkpoint blockade) therapy more effectively in non-small-cell lung cancer (NSCLC) than numerous well-established ICB biomarkers, including PD-L1. In both panels, the mouse counterparts of <i>ITGAL</i>, <i>ITGAX</i>, and <i>TMEM119</i> genes were downregulated by taxifolin. They were strongly associated with immune suppression in LC, evidenced by their robust correlations with the major immunosuppressive cell types (MDSC, Treg, and macrophage) and multiple immune checkpoints in NSCLC and across multiple human cancer types. ITGAL, ITGAX, and IIT (ITGAL-ITGAX-TMEM119) effectively predicted NSCLC's response to ICB therapy; IIT stratified the mortality risk of NSCLC. The stromal expressions of ITGAL and ITGAX, together with tumor expression of TMEM119 in NSCLC, were demonstrated. Collectively, we report multiple novel ICB biomarkers-TxflSig, TxflSig1, IIT, ITGAL, and ITGAX-and taxifolin-derived attenuation of immunosuppressive activities in NSCLC, suggesting the inclusion of taxifolin in ICB therapies for NSCLC.

Also flagged:Glycolipidslipaseacyl chloridesugarestersugar fatty acid ester
Journal Article 2023-09-30 No Snippets Verboni M, Perinelli DR, Buono A, Campana R, Sisti M, Duranti A, Lucarini S.
Show Full Abstract

Glycolipids are biocompatible and biodegradable amphiphilic compounds characterized by a great scientific interest for their potential applications in various technological areas, including pharmaceuticals, cosmetics, agriculture, and food production. This report summarizes the available synthetic methodologies, physicochemical properties, and biological activity of sugar fatty acid ester surfactants, with a particular focus on 6-<i>O</i>-glucose, 6-<i>O</i>-mannose, 6-<i>O</i>-sucrose, and 6'-<i>O</i>-lactose ones. In detail, the synthetic approaches to this class of compounds, such as enzymatic lipase-catalyzed and traditional chemical (e.g., acyl chloride, Steglich, Mitsunobu) esterifications, are reported. Moreover, aspects related to the surface activity of these amphiphiles, such as their ability to decrease surface tension, critical micelle concentration, and emulsifying and foaming ability, are described. Biological applications with a focus on the permeability-enhancing effect across the skin or mucosa, antimicrobial and antifungal activities, as well as antibiofilm properties, are also presented. The information reported here on sugar-based ester surfactants is helpful to broaden the interest and the possible innovative applications of this class of amphiphiles in different technological fields in the future.

Also flagged:Para-Aminobenzoic AcidaminocarboxylAminobenzoic acids4-aminobenzoic acidfolate
Journal Article 2023-09-30 No Snippets Haroon F, Farwa U, Arif M, Raza MA, Sandhu ZA, El Oirdi M, Farhan M, Alhasawi MAI.
Show Full Abstract

A "building block" is a key component that plays a substantial and critical function in the pharmaceutical research and development industry. Given its structural versatility and ability to undergo substitutions at both the amino and carboxyl groups, para-aminobenzoic acid (PABA) is a commonly used building block in pharmaceuticals. Therefore, it is great for the development of a wide range of novel molecules with potential medical applications. Anticancer, anti-Alzheimer's, antibacterial, antiviral, antioxidant, and anti-inflammatory properties have been observed in PABA compounds, suggesting their potential as therapeutic agents in future clinical trials. PABA-based therapeutic chemicals as molecular targets and their usage in biological processes are the primary focus of this review study. PABA's unique features make it a strong candidate for inclusion in a massive chemical database of molecules having drug-like effects. Based on the current literature, further investigation is needed to evaluate the safety and efficacy of PABA derivatives in clinical investigations and better understand the specific mechanism of action revealed by these compounds.

POU3F2
Also flagged:cell developmentpediatric cancer neuroblastomaneuroblastomaSOX2anaplastic lymphoma kinaseALK
Journal Article 2023-09-30 ✓ 2 Snippets Van Haver S, Fan Y, Bekaert SL, Everaert C, Van Loocke W, Zanzani V, Deschildre J, Maestre IF, Amaro A, Vermeirssen V, De Preter K, Zhou T, Kentsis A, Studer L, Speleman F, Roberts SS.
In-Text Gene Mentions

…found upregulation ofPOU3F2, POU3F3 ,…

…the POU proteinsPOU3F2( BRN2 )…

Show Full Abstract

Studies defining normal and disrupted human neural crest cell development have been challenging given its early timing and intricacy of development. Consequently, insight into the early disruptive events causing a neural crest related disease such as pediatric cancer neuroblastoma is limited. To overcome this problem, we developed an <i>in vitro</i> differentiation model to recapitulate the normal <i>in vivo</i> developmental process of the sympathoadrenal lineage which gives rise to neuroblastoma. We used human <i>in vitro</i> pluripotent stem cells and single-cell RNA sequencing to recapitulate the molecular events during sympathoadrenal development. We provide a detailed map of dynamically regulated transcriptomes during sympathoblast formation and illustrate the power of this model to study early events of the development of human neuroblastoma, identifying a distinct subpopulation of cell marked by SOX2 expression in developing sympathoblast obtained from patient derived iPSC cells harboring a germline activating mutation in the anaplastic lymphoma kinase (ALK) gene.

Also flagged:oxygenmethylene bluetitanium dioxideBodPSnanostructures
Journal Article 2023-09-30 No Snippets Demirel Topel S.
Show Full Abstract

This study aimed to investigate the photocatalytic and photodynamic actions of a 2,6-diiodinated-BODIPY (2,6-diI<sub>2</sub>-Bod) photosensitizer (PS) covalently linked to TiO<sub>2</sub> nanoparticles (NPs). The TiO<sub>2</sub> NPs were synthesized utilizing the hydrothermal technique, yielding an average particle size of 4-5 nm as ascertained by transmission electron microscopy and 6.4 nm as determined by dynamic light scattering measurements. The integration of the nonsoluble Bod PS to TiO<sub>2</sub> NPs provided increased dispersibility in physiological media, making it more applicable to photodynamic therapy applications. Bod-TiO<sub>2</sub> NPs exhibited moderate efficiency of 56.9% in singlet oxygen generation. Additionally, the photocatalytic behavior of the TiO<sub>2</sub> NPs was evaluated using methylene blue and 83.8% photodegradation efficiency was observed. The loading efficiency and loading content of the Bod PS were found to be 90.8% and 54.5%, respectively. These results suggest that Bod-TiO<sub>2</sub> NPs possess higher dispersibility in aqueous solutions, moderate photocatalytic activity, and potential for photodynamic therapy applications.

CCPG1
Also flagged:AZI2TBK1autophagyIFNproteinRB1CC1
Journal Article 2023-09-29 ✓ 1 Snippet Yeo SK, Haas M, Manupati K, Hao M, Yang F, Chen S, Guan JL.
In-Text Gene Mentions

…SQSTM1/p62, CALCOCO2, TAX1BP1,CCPG1, NBR1 and OPTN…

Show Full Abstract

Most breast cancers do not respond to immune checkpoint inhibitors and there is an urgent need to identify novel sensitization strategies. Herein, we uncovered that activation of the TBK-IFN pathway that is mediated by the TBK1 adapter protein AZI2 is a potent strategy for this purpose. Our initial observations showed that RB1CC1 depletion leads to accumulation of AZI2, in puncta along with selective macroautophagy/autophagy cargo receptors, which are both required for TBK1 activation. Specifically, disrupting the selective autophagy function of RB1CC1 was sufficient to sustain AZI2 puncta accumulation and TBK1 activation. AZI2 then mediates downstream activation of DDX3X, increasing its interaction with IRF3 for transcription of pro-inflammatory chemokines. Consequently, we performed a screen to identify inhibitors that can induce the AZI2-TBK1 pathway, and this revealed Lys05 as a pharmacological agent that induced pro-inflammatory chemokine expression and CD8<sup>+</sup> T cell infiltration into tumors. Overall, we have identified a distinct AZI2-TBK1-IFN signaling pathway that is responsive to selective autophagy blockade and can be activated to make breast cancers more immunogenic.<b>Abbreviations:</b> AZI2/NAP1: 5-azacytidine induced 2; CALCOCO2: calcium binding and coiled-coil domain 2; DDX3X: DEAD-box helicase 3 X-linked; FCCP: carbonyl cyanide p-triflouromethoxyphenylhydrazone; a protonophore that depolarizes the mitochondrial inner membrane; ICI: immune checkpoint inhibitor; IFN: interferon; NBR1: NBR1 autophagy cargo receptor; OPTN: optineurin; RB1CC1/FIP200: RB1 inducible coiled-coil 1; SQSTM1/p62: sequestosome 1; TAX1BP1: Tax1 binding protein 1; TBK1: TANK binding kinase 1.

Also flagged:cancertumorpyropheophorbide-aToll-like receptor 7resiquimoddeath
Journal Article 2023-09-29 No Snippets Qu H, Li L, Chen H, Tang M, Cheng W, Lin TY, Li L, Li B, Xue X.
Show Full Abstract

Although immunotherapies have made progress in cancer treatment, their clinical response rates vary widely and are typically low due to sparse immune cell infiltration (immune "cold") and suppressive tumor immune microenvironment (TIME). A simple yet effective approach that integrates a variety of immune-stimulating and TIME-modulating functions could potentially address this clinical challenge. Herein, we conjugate two small molecules, including a photosensitizer (pyropheophorbide-a, PA) and a Toll-like receptor 7/8 agonist (resiquimod, R848), into prodrug (PA-R848) that self-assembles into PA-R848 esterase responsive nanoparticles (PARE NPs) with 100% drug composition and synergistic photo-/immune- therapeutic effects. In PARE NPs, PA exhibits strong phototherapeutic effects which ablate the primary tumor directly and elicits immunogenic cell death (ICD) to promote the immune response. R848 effectively polarizes the M2-type tumor-associated macrophage (TAM) to M1-type TAM, consequently reversing the "cold" and suppressive TIME when working together with phototherapy. The PARE NPs can efficiently pare down the tumor development by two synergisms, including i) synergistic immunotherapy between ICD and TAM polarization; ii) and the antitumor effects between phototherapy and immunotherapy. On a head-neck squamous cell carcinoma mouse model, PARE NPs combined with PD-1 antibody eliminate primary tumors, and significantly inhibit the progress of distant tumors thanks to the robust antitumor immunity enhanced by the PARE NPs.

SERPINC1
Also flagged:brain tumorsmeningiomastranslationalmeningiomatumorGlioma
Journal Article 2023-09-29 ✓ 1 Snippet Halder A, Biswas D, Chauhan A, Saha A, Auromahima S, Yadav D, Nissa MU, Iyer G, Parihari S, Sharma G, Epari S, Shetty P, Moiyadi A, Ball GR, Srivastava S.
In-Text Gene Mentions

…apolipoprotein B, andantithrombin-IIIhave been reported…

Show Full Abstract

<h4>Background</h4>Meningiomas are the most prevalent primary brain tumors. Due to their increasing burden on healthcare, meningiomas have become a pivot of translational research globally. Despite many studies in the field of discovery proteomics, the identification of grade-specific markers for meningioma is still a paradox and requires thorough investigation. The potential of the reported markers in different studies needs further verification in large and independent sample cohorts to identify the best set of markers with a better clinical perspective.<h4>Methods</h4>A total of 53 fresh frozen tumor tissue and 51 serum samples were acquired from meningioma patients respectively along with healthy controls, to validate the prospect of reported differentially expressed proteins and claimed markers of Meningioma mined from numerous manuscripts and knowledgebases. A small subset of Glioma/Glioblastoma samples were also included to investigate inter-tumor segregation. Furthermore, a simple Machine Learning (ML) based analysis was performed to evaluate the classification accuracy of the list of proteins.<h4>Results</h4>A list of 15 proteins from tissue and 12 proteins from serum were found to be the best segregator using a feature selection-based machine learning strategy with an accuracy of around 80% in predicting low grade (WHO grade I) and high grade (WHO grade II and WHO grade III) meningiomas. In addition, the discriminant analysis could also unveil the complexity of meningioma grading from a segregation pattern, which leads to the understanding of transition phases between the grades.<h4>Conclusions</h4>The identified list of validated markers could play an instrumental role in the classification of meningioma as well as provide novel clinical perspectives in regard to prognosis and therapeutic targets.

Also flagged:gene expressionlong-term potentiationlong-term depressionprotein synthesismembranetranscription factors
Journal Article 2023-09-29 No Snippets Ma H, Khaled HG, Wang X, Mandelberg NJ, Cohen SM, He X, Tsien RW.
Show Full Abstract

Excitation-transcription coupling (E-TC) links synaptic and cellular activity to nuclear gene transcription. It is generally accepted that E-TC makes a crucial contribution to learning and memory through its role in underpinning long-lasting synaptic enhancement in late-phase long-term potentiation and has more recently been linked to late-phase long-term depression: both processes require de novo gene transcription, mRNA translation and protein synthesis. E-TC begins with the activation of glutamate-gated N-methyl-D-aspartate-type receptors and voltage-gated L-type Ca<sup>2+</sup> channels at the membrane and culminates in the activation of transcription factors in the nucleus. These receptors and ion channels mediate E-TC through mechanisms that include long-range signalling from the synapse to the nucleus and local interactions within dendritic spines, among other possibilities. Growing experimental evidence links these E-TC mechanisms to late-phase long-term potentiation and learning and memory. These advances in our understanding of the molecular mechanisms of E-TC mean that future efforts can focus on understanding its mesoscale functions and how it regulates neuronal network activity and behaviour in physiological and pathological conditions.

SOX6
Also flagged:Oxidation Resistance 1arginineOXR1cell cyclemethylationcerebellar atrophy
Journal Article 2023-09-29 ✓ 1 Snippet Lin X, Wang W, Yang M, Damseh N, de Sousa MML, Jacob F, Lång A, Kristiansen E, Pannone M, Kissova M, Almaas R, Kuśnierczyk A, Siller R, Shahrour M, Al-Ashhab M, Abu-Libdeh B, Tang W, Slupphaug G, Elpeleg O, Bøe SO, Eide L, Sullivan GJ, Rinholm JE, Song H, Ming GL, van Loon B, Edvardson S, Ye J, Bjørås M.
In-Text Gene Mentions

…neurons via the Shh-FOXA1/2-SOX6pathway by using…

Show Full Abstract

<h4>Background</h4>Oxidation Resistance 1 (OXR1) gene is a highly conserved gene of the TLDc domain-containing family. OXR1 is involved in fundamental biological and cellular processes, including DNA damage response, antioxidant pathways, cell cycle, neuronal protection, and arginine methylation. In 2019, five patients from three families carrying four biallelic loss-of-function variants in OXR1 were reported to be associated with cerebellar atrophy. However, the impact of OXR1 on cellular functions and molecular mechanisms in the human brain is largely unknown. Notably, no human disease models are available to explore the pathological impact of OXR1 deficiency.<h4>Results</h4>We report a novel loss-of-function mutation in the TLDc domain of the human OXR1 gene, resulting in early-onset epilepsy, developmental delay, cognitive disabilities, and cerebellar atrophy. Patient lymphoblasts show impaired cell survival, proliferation, and hypersensitivity to oxidative stress. These phenotypes are rescued by TLDc domain replacement. We generate patient-derived induced pluripotent stem cells (iPSCs) revealing impaired neural differentiation along with dysregulation of genes essential for neurodevelopment. We identify that OXR1 influences histone arginine methylation by activating protein arginine methyltransferases (PRMTs), suggesting OXR1-dependent mechanisms regulating gene expression during neurodevelopment. We model the function of OXR1 in early human brain development using patient-derived brain organoids revealing that OXR1 contributes to the spatial-temporal regulation of histone arginine methylation in specific brain regions.<h4>Conclusions</h4>This study provides new insights into pathological features and molecular underpinnings associated with OXR1 deficiency in patients.

CACNA1EDCC
Also flagged:BMPoptic neuropathiesglaucomatranscription factorTFNEUROG2
Journal Article 2023-09-29 ✓ 2 Snippets Agarwal D, Dash N, Mazo KW, Chopra M, Avila MP, Patel A, Wong RM, Jia C, Do H, Cheng J, Chiang C, Jurlina SL, Roshan M, Perry MW, Rho JM, Broyer R, Lee CD, Weinreb RN, Gavrilovici C, Oesch NW, Welsbie DS, Wahlin KJ.
In-Text Gene Mentions

…ROBO2/3 andDCC receptorsreceptors, which mediate…

…/Cav2.1, CACNA1B /Cav2.2,CACNA1E/Cav2.3) that regulate…

Show Full Abstract

In optic neuropathies, including glaucoma, retinal ganglion cells (RGCs) die. Cell transplantation and endogenous regeneration offer strategies for retinal repair, however, developmental programs required for this to succeed are incompletely understood. To address this, we explored cellular reprogramming with transcription factor (TF) regulators of RGC development which were integrated into human pluripotent stem cells (PSCs) as inducible gene cassettes. When the pioneer factor NEUROG2 was combined with RGC-expressed TFs (ATOH7, ISL1, and POU4F2) some conversion was observed and when pre-patterned by BMP inhibition, RGC-like induced neurons (RGC-iNs) were generated with high efficiency in just under a week. These exhibited transcriptional profiles that were reminiscent of RGCs and exhibited electrophysiological properties, including AMPA-mediated synaptic transmission. Additionally, we demonstrated that small molecule inhibitors of DLK/LZK and GCK-IV can block neuronal death in two pharmacological axon injury models. Combining developmental patterning with RGC-specific TFs thus provided valuable insight into strategies for cell replacement and neuroprotection.

Also flagged:cancertumorgliomastumorsCancersvision
Journal Article 2023-09-29 No Snippets Dent A, Faust K, Lam KHB, Alhangari N, Leon AJ, Tsang Q, Kamil ZS, Gao A, Pal P, Lheureux S, Oza A, Diamandis P.
Show Full Abstract

Intratumoral heterogeneity can wreak havoc on current precision medicine strategies because of challenges in sufficient sampling of geographically separated areas of biodiversity distributed across centimeter-scale tumor distances. To address this gap, we developed a deep learning pipeline that leverages histomorphologic fingerprints of tissue to create "Histomic Atlases of Variation Of Cancers" (HAVOC). Using a number of objective molecular readouts, we demonstrate that HAVOC can define regional cancer boundaries with distinct biology. Using larger tumor specimens, we show that HAVOC can map biodiversity even across multiple tissue sections. By guiding profiling of 19 partitions across six high-grade gliomas, HAVOC revealed that distinct differentiation states can often coexist and be regionally distributed within these tumors. Last, to highlight generalizability, we benchmark HAVOC on additional tumor types. Together, we establish HAVOC as a versatile tool to generate small-scale maps of tissue heterogeneity and guide regional deployment of molecular resources to relevant biodiverse niches.

PRDX6
Also flagged:membranecytosollumenconjugationdeathtumor
Journal Article 2023-09-29 ✓ 1 Snippet Bikorimana JP, El-Hachem N, Moreau M, Lawson C, Tai LH, Gonçalves M, Abusarah J, Beaudoin S, Stanga D, Plouffe S, Rafei M.
In-Text Gene Mentions

…ROS production (PRDX6, PRNP ,…

Show Full Abstract

The Accum™ technology was initially designed to enhance the bioaccumulation of a given molecule in target cells. It does so by triggering endosomal membrane damages allowing endocytosed products to enter the cytosol, escaping the harsh environmental cues of the endosomal lumen. In an attempt to minimize manufacturing hurdles associated with Accum™ conjugation, we tested whether free Accum™ admixed with antigens could lead to outcomes similar to those obtained with conjugated products. Surprisingly, unconjugated Accum™ was found to promote cell death in vitro, an observation further confirmed on various murine tumor cell lines (EL4, CT-26, B16, and 4 T1). At the molecular level, unconjugated Accum™ triggers the production of reactive oxygen species and elicits immunogenic cell death while retaining its innate ability to cause endosomal damages. When administered as a monotherapy to animals with pre-established EL4 T-cell lymphoma, Accum™ controlled tumor growth in a dose-dependent manner, and its therapeutic effect relies on CD4 and CD8 T cells. Although unconjugated Accum™ synergizes with various immune checkpoint inhibitors (anti-CTLA4, anti-PD-1, or anti-CD47) at controlling tumor growth, its therapeutic potency could not be further enhanced when combined with all three tested immune checkpoint inhibitors at once due to its dependency on a specific dosing regimen. In sum, we report in this study an unprecedented new function for unconjugated Accum™ as a novel anticancer molecule. These results could pave the path for a new line of investigation aimed at exploring the pro-killing properties of additional Accum™ variants as a mean to develop second-generation anticancer therapeutics.

TRIM38
Also flagged:Outer membrane proteinTLRdegradationToll-like receptorsTLRsinnate immunity
Journal Article 2023-09-29 ✓ 1 Snippet Murugan S, Nandi BR, Mazumdar V, Joshi K, Nandini P, Namani S, Jakka P, Radhakrishnan GK.
In-Text Gene Mentions

…SOCS-2, SOCS-3, andTRIM38have been reported…

Show Full Abstract

Toll-like receptors (TLRs) are essential components of innate immunity that serves as the first line of defense against the invaded microorganisms. However, successful infectious pathogens subvert TLR signaling to suppress the activation of innate and adaptive responses. Brucella species are infectious intracellular bacterial pathogens causing the worldwide zoonotic disease, brucellosis, that impacts economic growth of many countries. Brucella species are considered as stealthy bacterial pathogens as they efficiently evade or suppress host innate and adaptive immune responses for their chronic persistence. However, the bacterial effectors and their host targets for modulating the immune responses remain obscure. Brucella encodes various outer membrane proteins (Omps) that facilitate their invasion, intracellular replication, and immunomodulation. Outer membrane protein 25 (Omp25) of Brucella plays an important role in the immune modulation through suppression of proinflammatory cytokines. However, the mechanism and the signaling pathways that are targeted by Omp25 to attenuate the production of proinflammatory cytokines remain obscure. Here, we report that Omp25 and its variants, viz. Omp25b, Omp25c, and Omp25d, suppress production of proinflammatory cytokines that are mediated by various TLRs. Furthermore, we demonstrate that Omp25 and its variants promote enhanced ubiquitination and degradation of TLRs and their adaptor proteins to attenuate the expression of proinflammatory cytokines. Targeting multiple TLRs and adaptor proteins enables Omp25 to effectively suppress the expression of proinflammatory cytokines that are induced by diverse pathogen-associated molecular patterns. This can contribute to the defective adaptive immune response and the chronic persistence of Brucella in the host.

Also flagged:Innate immunityinfectionsaggressionsinfectionpattern recognition receptorscytoplasm
Journal Article 2023-09-29 No Snippets Zheng W, Chen N, Meurens F, Zheng W, Zhu J.
Show Full Abstract

cGAS is a cytosolic DNA sensor that activates innate immune responses by producing the second messenger 2'3'-cGAMP, which activates the adaptor STING. cGAS senses dsDNA in a length-dependent but sequence-independent manner, meaning it cannot discriminate self-DNA from foreign DNA. In normal physiological conditions, cellular DNA is sequestered in the nucleus by a nuclear envelope and in mitochondria by a mitochondrial membrane. When self-DNA leaks into the cytosol during cellular stress or mitosis, the cGAS can be exposed to self-DNA and activated. Recently, many studies have investigated how cGAS keeps inactive and avoids being aberrantly activated by self-DNA. Thus, this narrative review aims to summarize the mechanisms by which cGAS avoids sensing self-DNA under normal physiological conditions.

Also flagged:genetic diseases of theEpidermolysis bullosaichthyosisgenetic diseases of the skincutaneoussquamous cell carcinoma
Journal Article 2023-09-29 No Snippets King AD, Deirawan H, Klein PA, Dasgeb B, Dumur CI, Mehregan DR.
Show Full Abstract

Over the past decade, Next-Generation Sequencing (NGS) has advanced our understanding, diagnosis, and management of several areas within dermatology. NGS has emerged as a powerful tool for diagnosing genetic diseases of the skin, improving upon traditional PCR-based techniques limited by significant genetic heterogeneity associated with these disorders. Epidermolysis bullosa and ichthyosis are two of the most extensively studied genetic diseases of the skin, with a well-characterized spectrum of genetic changes occurring in these conditions. NGS has also played a critical role in expanding the mutational landscape of cutaneous squamous cell carcinoma, enhancing our understanding of its molecular pathogenesis. Similarly, genetic testing has greatly benefited melanoma diagnosis and treatment, primarily due to the high prevalence of BRAF hot spot mutations and other well-characterized genetic alterations. Additionally, NGS provides a valuable tool for measuring tumor mutational burden, which can aid in management of melanoma. Lastly, NGS demonstrates promise in improving the sensitivity of diagnosing cutaneous T-cell lymphoma. This article provides a comprehensive summary of NGS applications in the diagnosis and management of genodermatoses, cutaneous squamous cell carcinoma, melanoma, and cutaneous T-cell lymphoma, highlighting the impact of NGS on the field of dermatology.

TNFSF4
Also flagged:lung squamous cell carcinomatumorLUSCnonsmall cell lung cancerNSCLClung adenocarcinoma
Journal Article 2023-09-29 ✓ 2 Snippets Wu R, Ma R, Duan X, Zhang J, Li K, Yu L, Zhang M, Liu P, Wang C.
In-Text Gene Mentions

…CD48, CD244, TNFSF18,TNFSF4, CD28, ICOS, PD-1…

…apart from TNFSF18,TNFSF4, CD274, LAG3, and…

Show Full Abstract

<h4>Introduction</h4>Lung squamous cell carcinoma (LUSC) is a unique subform of nonsmall cell lung cancer (NSCLC). The lack of specific driver genes as therapeutic targets leads to worse prognoses in patients with LUSC, even with chemotherapy, radiotherapy, or immune checkpoint inhibitors. Furthermore, research on the LUSC-specific prognosis genes is lacking. This study aimed to develop a comprehensive LUSC-specific differentially expressed genes (DEGs) signature for prognosis correlated with tumor progression, immune infiltration,and stem index.<h4>Methods</h4>RNA sequencing data for LUSC and lung adenocarcinoma (LUAD) were extracted from The Cancer Genome Atlas (TCGA) data portal, and DEGs analyses were conducted in TCGA-LUSC and TCGA-LUAD cohorts to identify specific DEGs associated with LUSC. Functional analysis and protein-protein interaction network were performed to annotate the roles of LUSC-specific DEGs and select the top 100 LUSC-specific DEGs. Univariate Cox regression and least absolute shrinkage and selection operator regression analyses were performed to select prognosis-related DEGs.<h4>Results</h4>Overall, 1,604 LUSC-specific DEGs were obtained, and a validated seven-gene signature was constructed comprising FGG, C3, FGA, JUN, CST3, CPSF4, and HIST1H2BH. FGG, C3, FGA, JUN, and CST3 were correlated with poor LUSC prognosis, whereas CPSF4 and HIST1H2BH were potential positive prognosis markers in patients with LUSC. Receiver operating characteristic analysis further confirmed that the genetic profile could accurately estimate the overall survival of LUSC patients. Analysis of immune infiltration demonstrated that the high risk (HR) LUSC patients exhibited accelerated tumor infiltration, relative to low risk (LR) LUSC patients. Molecular expressions of immune checkpoint genes differed significantly between the HR and LR cohorts. A ceRNA network containing 19 lncRNAs, 50 miRNAs, and 7 prognostic DEGs was constructed to demonstrate the prognostic value of novel biomarkers of LUSC-specific DEGs based on tumor progression, stemindex, and immune infiltration. In vitro experimental models confirmed that LUSC-specific DEG FGG expression was significantly higher in tumor cells and correlated with immune tumor progression, immune infiltration, and stem index. <i>In vitro</i> experimental models confirmed that LUSC-specific DEG FGG expression was significantly higher in tumor cells and correlated with immune tumor progression, immune infiltration, and stem index.<h4>Conclusion</h4>Our study demonstrated the potential clinical implication of the 7- DEGs signature for prognosis prediction of LUSC patients based on tumor progression, immune infiltration, and stem index. And the FGG could be an independent prognostic biomarker of LUSC promoting cell proliferation, migration, invasion, THP-1 cell infiltration, and stem cell maintenance.

SOX6
Also flagged:PITX1pituitary homeobox 1cancerp53cell cycletumors
Journal Article 2023-09-29 ✓ 1 Snippet Zhao J, Xu Y.
In-Text Gene Mentions

…of Foxp4, Snai1,Sox6, Sox8, and Sox9,…

Show Full Abstract

PITX1, also known as the pituitary homeobox 1 gene, has emerged as a key regulator in animal growth and development, attracting significant research attention. Recent investigations have revealed the implication of dysregulated PITX1 expression in tumorigenesis, highlighting its involvement in cancer development. Notably, PITX1 interacts with p53 and exerts control over crucial cellular processes including cell cycle progression, apoptosis, and chemotherapy resistance. Its influence extends to various tumors, such as esophageal, colorectal, gastric, and liver cancer, contributing to tumor progression and metastasis. Despite its significance, a comprehensive review examining PITX1's role in oncology remains lacking. This review aims to address this gap by providing a comprehensive overview of PITX1 in different cancer types, with a particular focus on its clinicopathological significance.

TNFSF4
Also flagged:TIMP1colorectal cancerGene ExpressionferroptosisSPP1MMP1
Journal Article 2023-09-29 ✓ 4 Snippets Qiu X, Quan G, Ou W, Wang P, Huang X, Li X, Shen Y, Yang W, Wang J, Wu X.
In-Text Gene Mentions

…(CTLA-4, LAG3, HAVCR2,TNFSF4, and CD160) in…

…HAVCR2, LAG3, andTNFSF4( Figure 7E…

…HAVCR2, LAG3, andTNFSF4in CRC tissues…

…HAVCR2, LAG3, andTNFSF4.…

Show Full Abstract

<b>Background:</b> The pathogenic genes of colorectal cancer (CRC) have not yet been fully elucidated, and there is currently a lack of effective therapeutic targets. This study used bioinformatics methods to explore and experimentally validate the most valuable biomarkers for colorectal cancer and further investigate their potential as targets. <b>Methods:</b> We analyzed differentially expressed genes (DEGs) based on the Gene Expression Omnibus (GEO) dataset and screened out hub genes. ROC curve and univariate Cox analysis of The Cancer Genome Atlas (TCGA) dataset revealed the most diagnostically and prognostically valuable genes. Immunohistochemistry (IHC) experiments were then conducted to validate the expression level of these selected genes in colorectal cancer. Gene set enrichment analysis (GSEA) was performed to evaluate the enriched signaling pathways associated with the gene. Using the CIBERSORT algorithm in R software, we analyzed the immune infiltrating cell abundance in both high and low gene expression groups and examined the gene's correlation with immune cells and immune checkpoints. Additionally, we performed drug sensitivity analysis utilizing the DepMap database, and explored the correlation between gene expression levels and ferroptosis based on the The Cancer Genome Atlas dataset. <b>Results:</b> The study identified a total of 159 DEGs, including 7 hub genes: SPP1, MMP1, CXCL8, CXCL1, TIMP1, MMP3, and CXCL10. Further analysis revealed TIMP1 as the most valuable diagnostic and prognostic biomarker for colorectal cancer, with IHC experiments verifying its high expression. Additionally, GSEA results showed that the high TIMP1 expression group was involved in many cancer signaling pathways. Analysis of the TCGA database revealed a positive correlation between TIMP1 expression and infiltration of macrophages (M0, M1, M2) and neutrophils, as well as the expression of immune checkpoint genes, including CTLA-4 and HAVCR2. Drug sensitivity analysis, conducted using the DepMap database, revealed that colorectal cancer cell lines exhibiting elevated levels of TIMP1 expression were more responsive to certain drugs, such as CC-90003, Pitavastatin, Atuveciclib, and CT7001, compared to those with low levels of TIMP1. Furthermore, TIMP1 expression was positively correlated with that of ferroptosis-related genes, such as GPX4 and HSPA5. <b>Conclusion:</b> TIMP1 can be used as a biomarker for colorectal cancer and is associated with the immunological microenvironment, drug sensitivity, and ferroptosis inhibition in this disease.

Also flagged:Carbondigestiondegradationnitrogenphosphoruspotassium
Journal Article 2023-09-29 No Snippets Zaki MT, Rowles LS, Adjeroh DA, Orner KD.
Show Full Abstract

Municipal and agricultural organic waste can be treated to recover energy, nutrients, and carbon through resource recovery and carbon capture (RRCC) technologies such as anaerobic digestion, struvite precipitation, and pyrolysis. Data science could benefit such technologies by improving their efficiency through data-driven process modeling along with reducing environmental and economic burdens via life cycle assessment (LCA) and techno-economic analysis (TEA), respectively. We critically reviewed 616 peer-reviewed articles on the use of data science in RRCC published during 2002-2022. Although applications of machine learning (ML) methods have drastically increased over time for modeling RRCC technologies, the reviewed studies exhibited significant knowledge gaps at various model development stages. In terms of sustainability, an increasing number of studies included LCA with TEA to quantify both environmental and economic impacts of RRCC. Integration of ML methods with LCA and TEA has the potential to cost-effectively investigate the trade-off between efficiency and sustainability of RRCC, although the literature lacked such integration of techniques. Therefore, we propose an integrated data science framework to inform efficient and sustainable RRCC from organic waste based on the review. Overall, the findings from this review can inform practitioners about the effective utilization of various data science methods for real-world implementation of RRCC technologies.

BTN2A1
Also flagged:infectionsgene expressionimmune responseTriaenophorus nodulosus plerocercoid infectionJUNSIK1
Journal Article 2023-09-29 ✓ 1 Snippet Taube K, Noreikiene K, Kahar S, Gross R, Ozerov M, Vasemägi A.
In-Text Gene Mentions

…, SYTL3 ,BTN2A1), kinase binding…

Show Full Abstract

Determining the physiological effects of parasites and characterizing genes involved in host responses to infections are essential to improving our understanding of host-parasite interactions and their ecological and evolutionary consequences. This task, however, is complicated by high diversity and complex life histories of many parasite species. The use of transcriptomics in the context of wild-caught specimens can help ameliorate this by providing both qualitative and quantitative information on gene expression patterns in response to parasites in specific host organs and tissues. Here, we evaluated the physiological impact of the widespread parasite, the pike tapeworm (<i>Triaenophorus nodulosus),</i> on its second intermediate host, the Eurasian perch (<i>Perca fluviatilis</i>). We used an RNAseq approach to analyse gene expression in the liver, the target organ of <i>T. nodulosus</i> plerocercoids, and spleen which is one of the main immune organs in teleost fishes. We compared perch collected from multiple lakes consisting of individuals with (n = 8) and without (n = 6) <i>T. nodulosus</i> plerocercoids in the liver. Results revealed a small number of differentially expressed genes (DEGs, adjusted p-value ≤0.05) in both spleen (n = 22) and liver (n = 10). DEGs in spleen consisted of mostly upregulated immune related genes (e.g., <i>JUN</i>, <i>SIK1</i>, <i>THSB1</i>), while those in the liver were often linked to metabolic functions (e.g., <i>FABP1</i>, <i>CADM4, CDAB</i>). However, Gene Ontology (GO) analysis showed lack of functional enrichment among DEGs. This study demonstrates that Eurasian perch displays a subtle response at a gene expression level to <i>T. nodulosus</i> plerocercoid infection. Given that plerocercoids are low-metabolic activity transmission stages, our results suggest that moderate <i>T. nodulosus</i> plerocercoid infection most likely does not provoke an extensive host immune response and have relatively low physiological costs for the host. Our findings illustrate that not all conspicuous infections have severe effects on host gene regulation.

Also flagged:diseases of the central nervous systemamyotrophic lateral sclerosisepilepsymigrainepathogenesiscatalase
Journal Article 2023-09-29 No Snippets Korczowska-Łącka I, Słowikowski B, Piekut T, Hurła M, Banaszek N, Szymanowicz O, Jagodziński PP, Kozubski W, Permoda-Pachuta A, Dorszewska J.
Show Full Abstract

In diseases of the central nervous system, such as Alzheimer's disease (AD), Parkinson's disease (PD), stroke, amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and even epilepsy and migraine, oxidative stress load commonly surpasses endogenous antioxidative capacity. While oxidative processes have been robustly implicated in the pathogenesis of these diseases, the significance of particular antioxidants, both endogenous and especially exogenous, in maintaining redox homeostasis requires further research. Among endogenous antioxidants, enzymes such as catalase, superoxide dismutase, and glutathione peroxidase are central to disabling free radicals, thereby preventing oxidative damage to cellular lipids, proteins, and nucleic acids. Whether supplementation with endogenously occurring antioxidant compounds such as melatonin and glutathione carries any benefit, however, remains equivocal. Similarly, while the health benefits of certain exogenous antioxidants, including ascorbic acid (vitamin C), carotenoids, polyphenols, sulforaphanes, and anthocyanins are commonly touted, their clinical efficacy and effectiveness in particular neurological disease contexts need to be more robustly defined. Here, we review the current literature on the cellular mechanisms mitigating oxidative stress and comment on the possible benefit of the most common exogenous antioxidants in diseases such as AD, PD, ALS, HD, stroke, epilepsy, and migraine. We selected common neurological diseases of a basically neurodegenerative nature.

Also flagged:Ion ChannelNeuropathicperipheral nerve disorderspainful neuropathyion channelsvoltage-gated sodium channel
Journal Article 2023-09-29 No Snippets Ślęczkowska M, Misra K, Santoro S, Gerrits MM, Hoeijmakers JGJ, PainNet Study Group.
Show Full Abstract

Neuropathic pain (NP) is a typical symptom of peripheral nerve disorders, including painful neuropathy. The biological mechanisms that control ion channels are important for many cell activities and are also therapeutic targets. Disruption of the cellular mechanisms that govern ion channel activity can contribute to pain pathophysiology. The voltage-gated sodium channel (VGSC) is the most researched ion channel in terms of NP; however, VGSC impairment is detected in only <20% of painful neuropathy patients. Here, we discuss the potential role of the other peripheral ion channels involved in sensory signaling (transient receptor potential cation channels), neuronal excitation regulation (potassium channels), involuntary action potential generation (hyperpolarization-activated cyclic nucleotide-gated channels), thermal pain (anoctamins), pH modulation (acid sensing ion channels), and neurotransmitter release (calcium channels) related to pain and their prospective role as therapeutic targets for painful neuropathy.

Also flagged:hydrogenperoxideinfectionsinfectionpolymerase
Journal Article 2023-09-29 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

bioRxiv 2023-09-29 Preprint (No Snippets API) Xing X, Markus R, Ghosh T, Buxton S, Nieves DJ, Wojciechowska M, Brook JD.
Show Full Abstract

Myotonic dystrophy type 1 (DM1) is a progressive, multisystemic disorder caused by an expansion of CTG repeats in the 3’ untranslated region of the DMPK gene. When transcribed the mutant RNAs accumulate in affected tissues appearing as distinct foci when visualised by in situ hybridisation. The RNA foci are aggregates of CUG repeat-containing RNAs that sequester RNA-binding proteins, particularly muscleblind-like (MBNL) proteins, leading to their dysfunction and causing downstream molecular and cellular defects. Here we show the double knock-out of MBNL1 and 2 prevents RNA foci formation and nuclear retention of mutant DMPK mRNA in DM1 cells as well as promoting their degradation and nuclear export. Using stochastic optical reconstruction microscopy (STORM), we find the presence of both large foci and micro foci in DM1 cells. Large foci consist of multiple DMPK transcripts, while many micro foci are (CUG)n fragments. The absence of MBNL proteins not only prevents the aggregation of multiple DMPK transcripts into large foci, but also promotes their degradation and nuclear processing. However, although a substantial amount of MBNL1 proteins are bound to the mutant transcripts, the pools of free MBNL1 proteins are similar in DM1 nuclei to those in controls. Furthermore, we have identified several factors that are involved in the control of mutant DMPK mRNA turnover, including XRN2, EXOSC10, UPF1 and STAU1. Our study indicates that these factors are implicated in the RNA foci accumulation and the degradation of mutant DMPK mRNA. UPF1 and STAU1 may have additional roles beyond degradation, impacting the nuclear processing of mutant DMPK mRNA. Our study also highlights the critical role of MBNL proteins in regulating mutant DMPK mRNA metabolism: the absence of MBNLs in DM1 appears to expedite the processing of mutant DMPK mRNA mediated by these RNA decay factors. <h4>Significance statement</h4> Our investigations uncovered valuable data on the RNA foci dynamics in DM1, revealing the intricate mechanisms that underlie their formation, stability, and turnover. Our findings also contributed to delineate the complex pathways involved in the transportation and degradation of the mutant mRNA and provided insights into the critical role played by MBNL proteins in these processes. Studying the degradation mechanism of mutant DMPK mRNA in myotonic dystrophy may provide a foundation for comprehending the mechanisms of RNA degradation in other diseases caused by short tandem repeat (STR) mutations, such as Huntington’s disease, Fragile X syndrome, and several types of ataxia. Additionally, the use of cutting-edge STORM technology can provide a valuable tool for investigating RNA foci in other STR expansion disorders.

MLLT10
Also flagged:NPM1nucleoluslocalizationnucleuscytosolRNA binding protein
Journal Article 2023-09-28 ✓ 2 Snippets Izzo A, Akol I, Villarreal A, Lebel S, Garcia-Miralles M, Cheffer A, Bovio P, Heidrich S, Vogel T.
In-Text Gene Mentions

Like NPM1, DOT1L has been implicated in the pathogenesis of AML, bearing the MLL-AF9 (MLLT3)/ AF10 (MLLT10) fusion proteins.

…MLL-AF9 (MLLT3)/ AF10 (MLLT10) fusion proteins.…

Show Full Abstract

<h4>Background</h4>NPM1 is a phosphoprotein highly abundant in the nucleolus. However, additional nuclear functions have been attributed to NPM1, probably through interaction with other nuclear factors. DOT1L is one interaction partner of NPM1 that catalyzes methylation of histone H3 at lysine 79 (H3K79). DOT1L, playing functional roles in several biological processes, is known for its capability to organize and regulate chromatin. For example, DOT1L modulates DNA repeats expression within peri-nucleolar heterochromatin. NPM1 also affects peri-nucleolar heterochromatin spatial organization. However, it is unclear as of yet whether NPM1 and DOT1L functionally synergize to preserve nucleoli organization and genome stability, and generally, which molecular mechanisms would be involved.<h4>Results</h4>We characterized the nuclear function of NPM1 on peri-nucleolar heterochromatin organization. We show that (i) monomeric NPM1 interacts preferentially with DOT1L in the nucleus; (ii) NPM1 acts in concert with DOT1L to maintain each other's protein homeostasis; (iii) NPM1 depletion results in H3K79me2 upregulation and differential enrichment at chromatin binding genes including Ezh2; (iv) NPM1 and DOT1L modulate DNA repeats expression and peri-nucleolar heterochromatin organization via epigenetic mechanisms dependent on H3K27me3.<h4>Conclusions</h4>Our findings give insights into molecular mechanisms employed by NPM1 and DOT1L to regulate heterochromatin activity and structural organization around the nucleoli and shed light on one aspect of the complex role of both proteins in chromatin dynamics.

SERPINC1
Also flagged:myeloproliferative neoplasmJanus kinase 2JAK2ETsystemic thrombosisextra-portal vein thrombosis
Journal Article 2023-09-28 ✓ 1 Snippet Yakami Y, Yagyu T, Bando T, Hanada M.
In-Text Gene Mentions

…or S deficiency,ATIIIdeficiency, anti-phospholipid …

Show Full Abstract

BACKGROUND Essential thrombocytosis (ET) is a myeloproliferative neoplasm variant that leads to excessive platelet production in the bone marrow. Janus kinase 2 (JAK2) mutation is observed in 60% of ET cases. The risk of thrombosis increases with the presence of this mutation. ET can cause systemic thrombosis, including extra-portal vein thrombosis (EHPVT). In patients with ET-induced EHPVT, varied symptoms generally occur. However, our case was asymptomatic. This condition is relatively rare. CASE REPORT A 49-year-old woman presented to our hospital for a detailed clinical examination 1 month after a health examination, and blood tests revealed microcytic anemia and thrombocytosis. The patient had no current concerns and had no relevant medical or alcohol consumption history. Esophagogastroduodenoscopy demonstrated esophageal varices, with portal hypertension suspected as the underlying cause. Contrast-enhanced computed tomography scans revealed a thrombus in the portal vein, but liver cirrhosis and a tumor were ruled out. JAK2 mutation was positive, which led to myeloproliferative neoplasms being considered as the differential diagnosis. Bone marrow biopsy demonstrated many mature megakaryocytes with large and irregular nuclei and platelet aggregation in the field of view, leading to the diagnosis of ET. CONCLUSIONS This case study describes a patient with EHPVT caused by JAK2-positive ET. This case report emphasizes that physicians should consider myeloproliferative neoplasms as part of their differential diagnosis when presented with EHPVT.

Also flagged:dosage compensationSex differentiationsex chromosomesDNA-binding proteinchromosomeDC
Journal Article 2023-09-28 No Snippets Kalita AI, Marois E, Kozielska M, Weissing FJ, Jaouen E, Möckel MM, Rühle F, Butter F, Basilicata MF, Keller Valsecchi CI.
Show Full Abstract

The Anopheles mosquito is one of thousands of species in which sex differences play a central part in their biology, as only females need a blood meal to produce eggs. Sex differentiation is regulated by sex chromosomes, but their presence creates a dosage imbalance between males (XY) and females (XX). Dosage compensation (DC) can re-equilibrate the expression of sex chromosomal genes. However, because DC mechanisms have only been fully characterized in a few model organisms, key questions about its evolutionary diversity and functional necessity remain unresolved<sup>1</sup>. Here we report the discovery of a previously uncharacterized gene (sex chromosome activation (SOA)) as a master regulator of DC in the malaria mosquito Anopheles gambiae. Sex-specific alternative splicing prevents functional SOA protein expression in females. The male isoform encodes a DNA-binding protein that binds the promoters of active X chromosomal genes. Expressing male SOA is sufficient to induce DC in female cells. Male mosquitoes lacking SOA or female mosquitoes ectopically expressing the male isoform exhibit X chromosome misregulation, which is compatible with viability but causes developmental delay. Thus, our molecular analyses of a DC master regulator in a non-model organism elucidates the evolutionary steps that lead to the establishment of a chromosome-specific fine-tuning mechanism.

OLFM4
Also flagged:MRTF-Aactin-regulated transcription factorSRFActa2Myocardin-related transcription factor AMAL
Journal Article 2023-09-28 ✓ 5 Snippets Singh AK, Rai A, Weber A, Gericke M, Janssen KP, Moser M, Posern G.
In-Text Gene Mentions

…Agilent Dako) andOlfm4(1:500, #39141, Cell…

…Muc2 (goblet cells),Olfm4(stem cells) and…

…Of note,Olfm4-positive stem cells were…

…Axin2, Lgr5 andOlfm4, which are considered…

…In the crypts,Olfm4-positive stem cells and…

Show Full Abstract

The actin-regulated transcription factor MRTF-A represents a central relay in mechanotransduction and controls a subset of SRF-dependent target genes. However, gain-of-function studies in vivo are lacking. Here we characterize a conditional MRTF-A transgenic mouse model. While MRTF-A gain-of-function impaired embryonic development, induced expression of constitutively active MRTF-A provoked rapid hepatocyte ballooning and liver failure in adult mice. Specific expression in the intestinal epithelium caused an erosive architectural distortion, villus blunting, cryptal hyperplasia and colonic inflammation, resulting in transient weight loss. Organoids from transgenic mice repeatedly induced in vitro showed impaired self-renewal and defective cryptal compartments. Mechanistically, MRTF-A gain-of-function decreased proliferation and increased apoptosis, but did not induce fibrosis. MRTF-A targets including Acta2 and Pai-1 were induced, whereas markers of stem cells and differentiated cells were reduced. Our results suggest that activated MRTF-A in the intestinal epithelium shifts the balance between proliferation, differentiation and apoptosis.

VRK2
Also flagged:sleepdepressionobesitycardiovascular diseasemajor depressive disorderanxiety
Journal Article 2023-09-28 ✓ 2 Snippets Austin-Zimmerman I, Levey DF, Giannakopoulou O, Deak JD, Galimberti M, Adhikari K, Zhou H, Denaxas S, Irizar H, Kuchenbaecker K, McQuillin A, Million Veteran Program, Concato J, Buysse DJ, Gaziano JM, Gottlieb DJ, Polimanti R, Stein MB, Bramon E, Gelernter J.
In-Text Gene Mentions

…or near theVRK2and PAX8 genes…

VRK2encodes a serine/threonine…

Show Full Abstract

Sleep duration has been linked to a wide range of negative health outcomes and to reduced life expectancy. We present genome-wide association studies of short ( ≤ 5 h) and long ( ≥ 10 h) sleep duration in adults of European (N = 445,966), African (N = 27,785), East Asian (N = 3141), and admixed-American (N = 16,250) ancestry from UK Biobank and the Million Veteran Programme. In a cross-population meta-analysis, we identify 84 independent loci for short sleep and 1 for long sleep. We estimate SNP-based heritability for both sleep traits in each ancestry based on population derived linkage disequilibrium (LD) scores using cov-LDSC. We identify positive genetic correlation between short and long sleep traits (r<sub>g</sub> = 0.16 ± 0.04; p = 0.0002), as well as similar patterns of genetic correlation with other psychiatric and cardiometabolic phenotypes. Mendelian randomisation reveals a directional causal relationship between short sleep and depression, and a bidirectional causal relationship between long sleep and depression.

TNFSF4
Also flagged:Cutaneous melanomaskin cancermelanomadysplastic nevimultiple neviimmune system deficiency
Journal Article 2023-09-28 ✓ 1 Snippet Zhang M, Zuo Y, Guo J, Yang L, Wang Y, Tan M, Guo X.
In-Text Gene Mentions

…TNFSF15, TIGIT, CD274,TNFSF4, CD86, HHLA2, CD70,…

Show Full Abstract

Anoikis is a unique form of apoptosis associated with vascularization and distant metastasis in cancer. Eliminating anoikis resistance in tumor cells could be a promising target for improving the prognosis of terminal cancer patients. However, current studies have not elaborated on the prognosis effect of anoikis-related long non-coding RNAs (lncRNAs) in cutaneous melanoma. Pre-processed data, including RNA sequences and clinical information, were retrieved from TCGA and GTEx databases. After a series of statistical analyses, anoikis-related lncRNAs with prognostic significance were identified, and a unique risk signature was constructed. Risk scores were further analyzed in relation to the tumor microenvironment, tumor immune dysfunction and exclusion, immune checkpoint genes, and RNA methylation genes. The indicators were also used to predict the potentially sensitive anti-cancer drugs. An anoikis-related lncRNAs risk signature consisting of LINC01711, POLH-AS1, MIR205HG, and LINC02416 was successfully established in cutaneous melanoma. Overall survival and progression-free survival of patients were strongly linked with the risk score, independently of other clinical factors. The low-risk group exhibited a more beneficial immunological profile, was less affected by RNA methylation, and was more sensitive to the majority of anti-cancer drugs, all of which indicated a better prognostic outcome. The 4 hub lncRNAs may be fundamental to studying the mechanism of anoikis in cutaneous melanoma and provide personalized therapy for salvaging drug resistance.

Also flagged:Transcription Factor 4TCF4transcription factorpsychiatric disordersautism spectrum disordermajor depression
Journal Article 2023-09-28 No Snippets Chen HY, Phan BN, Shim G, Hamersky GR, Sadowski N, O'Donnell TS, Sripathy SR, Bohlen JF, Pfenning AR, Maher BJ.
Show Full Abstract

Transcription factor 4 (TCF4) is a basic helix-loop-helix transcription factor that is implicated in a variety of psychiatric disorders including autism spectrum disorder (ASD), major depression, and schizophrenia. Autosomal dominant mutations in TCF4 are causal for a specific ASD called Pitt-Hopkins Syndrome (PTHS). However, our understanding of etiological and pathophysiological mechanisms downstream of TCF4 mutations is incomplete. Single cell sequencing indicates TCF4 is highly expressed in GABAergic interneurons (INs). Here, we performed cell-type specific expression analysis (CSEA) and cellular deconvolution (CD) on bulk RNA sequencing data from 5 different PTHS mouse models. Using CSEA we observed differentially expressed genes (DEGs) were enriched in parvalbumin expressing (PV+) INs and CD predicted a reduction in the PV+ INs population. Therefore, we investigated the role of TCF4 in regulating the development and function of INs in the Tcf4<sup>+/tr</sup> mouse model of PTHS. In Tcf4<sup>+/tr</sup> mice, immunohistochemical (IHC) analysis of subtype-specific IN markers and reporter mice identified reductions in PV+, vasoactive intestinal peptide (VIP+), and cortistatin (CST+) expressing INs in the cortex and cholinergic (ChAT+) INs in the striatum, with the somatostatin (SST+) IN population being spared. The reduction of these specific IN populations led to cell-type specific alterations in the balance of excitatory and inhibitory inputs onto PV+ and VIP+ INs and excitatory pyramidal neurons within the cortex. These data indicate TCF4 is a critical regulator of the development of specific subsets of INs and highlight the inhibitory network as an important source of pathophysiology in PTHS.

BTN2A1
Also flagged:GlioblastomaGBMbrain tumorgliomamalignant tumorsCD3
Journal Article 2023-09-28 ✓ 5 Snippets Wang Y, Ji N, Zhang Y, Chu J, Pan C, Zhang P, Ma W, Zhang X, Xi JJ, Chen M, Zhang Y, Zhang L, Sun T.
In-Text Gene Mentions

In addition, a more convenient method to detect BTN2A1 and BTN3A1 expression would be necessary.Dysregulation of the mevalonate pathway is common in tumor cells, leading to the accumulation of both DMAPP and IPP, which could be recognized by Vγ9Vδ2 T cells [38–40].

Intriguingly, Vγ9Vδ2 T cells elicited a strong antitumor effect in 23.1% of PTCs, which was significantly associated with higher expression levels of BTN2A1 and BTN3A.

Protein expression of BTN2A1 and BTN3A1, along with gene expression related to lipid metabolism and glioma inflammatory response pathways, is analyzed in matched tumor tissue samples.

Since Vγ9Vδ2 T cells can recognize tumor cells expressing BTN2A1 and BTN3A1 [12, 31, 32], we compared the expression of these two molecules in different GBM cell lines by flow cytometry and matched tumor samples of PTCs using IHC staining.

These results suggest that Vγ9Vδ2 T cells may inhibit GBM growth by targeting BTN2A1 and BTN3A1 on GBM tumor cells.

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is a highly aggressive primary brain tumor with a poor prognosis. This study investigates the therapeutic potential of human Vγ9Vδ2 T cells in GBM treatment. The sensitivity of different glioma specimens to Vγ9Vδ2 T cell-mediated cytotoxicity is assessed using a patient-derived tumor cell clusters (PTCs) model.<h4>Methods</h4>The study evaluates the anti-tumor effect of Vγ9Vδ2 T cells in 26 glioma cases through the PTCs model. Protein expression of BTN2A1 and BTN3A1, along with gene expression related to lipid metabolism and glioma inflammatory response pathways, is analyzed in matched tumor tissue samples. Additionally, the study explores two strategies to re-sensitize tumors in the weak anti-tumor effect (WAT) group: utilizing a BTN3A1 agonistic antibody or employing bisphosphonates to inhibit farnesyl diphosphate synthase (FPPS). Furthermore, the study investigates the efficacy of genetically engineered Vγ9Vδ2 T cells expressing Car-B7H3 in targeting diverse GBM specimens.<h4>Results</h4>The results demonstrate that Vγ9Vδ2 T cells display a stronger anti-tumor effect (SAT) in six glioma cases, while showing a weaker effect (WAT) in twenty cases. The SAT group exhibits elevated protein expression of BTN2A1 and BTN3A1, accompanied by differential gene expression related to lipid metabolism and glioma inflammatory response pathways. Importantly, the study reveals that the WAT group GBM can enhance Vγ9Vδ2 T cell-mediated killing sensitivity by incorporating either a BTN3A1 agonistic antibody or bisphosphonates. Both approaches support TCR-BTN mediated tumor recognition, which is distinct from the conventional MHC-peptide recognition by αβ T cells. Furthermore, the study explores an alternative strategy by genetically engineering Vγ9Vδ2 T cells with Car-B7H3, and both non-engineered and Car-B7H3 Vγ9Vδ2 T cells demonstrate promising efficacy in vivo, underscoring the versatile potential of Vγ9Vδ2 T cells for GBM treatment.<h4>Conclusions</h4>Vγ9Vδ2 T cells demonstrate a robust anti-tumor effect in some glioma cases, while weaker in others. Elevated BTN2A1 and BTN3A1 expression correlates with improved response. WAT group tumors can be sensitized using a BTN3A1 agonistic antibody or bisphosphonates. Genetically engineered Vγ9Vδ2 T cells, i.e.,  Car-B7H3, show promising efficacy. These results together highlight the versatility of Vγ9Vδ2 T cells for GBM treatment.

CACNA1E
Also flagged:CDKL5genetic epilepsiesdeficiency disorderinfantile-onset epilepsiesinfantile-onset epilepsyepilepsy
Journal Article 2023-09-28 ✓ 1 Snippet Daniels C, Greene C, Smith L, Pestana-Knight E, Demarest S, Zhang B, Benke TA, Poduri A, Olson HE, CDKL5 Study Group.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<h4>Aim</h4>To differentiate phenotypic features of individuals with CDKL5 deficiency disorder (CDD) from those of individuals with other infantile-onset epilepsies.<h4>Method</h4>We performed a retrospective cohort study and ascertained individuals with CDD and comparison individuals with infantile-onset epilepsy who had epilepsy gene panel testing. We reviewed records, updated variant classifications, and compared phenotypic features. Wilcoxon rank-sum tests and χ<sup>2</sup> or Fisher's exact tests were performed for between-cohort comparisons.<h4>Results</h4>We identified 137 individuals with CDD (110 females, 80.3%; median age at last follow-up 3 year 11 months) and 313 individuals with infantile-onset epilepsies (156 females, 49.8%; median age at last follow-up 5 years 2 months; 35% with genetic diagnosis). Features reported significantly more frequently in the CDD group than in the comparison cohort included developmental and epileptic encephalopathy (81% vs 66%), treatment-resistant epilepsy (95% vs 71%), sequential seizures (46% vs 6%), epileptic spasms (66% vs 42%, with hypsarrhythmia in 30% vs 48%), regression (52% vs 29%), evolution to Lennox-Gastaut syndrome (23% vs 5%), diffuse hypotonia (72% vs 36%), stereotypies (69% vs 11%), paroxysmal movement disorders (29% vs 17%), cerebral visual impairment (94% vs 28%), and failure to thrive (38% vs 22%).<h4>Interpretation</h4>CDD, compared with other suspected or confirmed genetic epilepsies presenting in the first year of life, is more often characterized by a combination of treatment-resistant epilepsy, developmental and epileptic encephalopathy, sequential seizures, spasms without hypsarrhythmia, diffuse hypotonia, paroxysmal movement disorders, cerebral visual impairment, and failure to thrive. Defining core phenotypic characteristics will improve precision diagnosis and treatment.

HTT
Also flagged:synapseHDcytoplasmicceramidesphingomyelinmonogalactosyldiacylglycerol
Journal Article 2023-09-28 ✓ 5 Snippets Shing K, Sapp E, Boudi A, Liu S, Seeley C, Marchionini D, DiFiglia M, Kegel-Gleason KB.
In-Text Gene Mentions

The CAG-repeat expansion encodes a polyglutamine expansion in HTT, which causes protein accumulation and aggregation and has pleiomorphic effects that contribute to HD pathology ranging from mitochondrial dysfunction, transcriptional defects, cholesterol mishandling, altered palmitoylation, and metabolic changes from altered signaling in the hypothalamus (Nopoulos, 2016; Petersen and Bjorkqvist, 2006).

The effects of lowering total Htt or mHtt alone on striatal proteins and behavioral and psychiatric measures have been investigated in HD mouse models after delivery of reagents to the striatum or lateral ventricle (Southwell et al., 2018; Zeitler et al., 2019).

Huntington’s disease (HD) is a heritable neurodegenerative disease caused by a CAG expansion in the huntingtin (HTT) gene.

…The mutantHTTprotein (mHTT) has…

…1 of theHTTgene causes Huntington’s…

Show Full Abstract

Expansion of a triplet repeat tract in exon 1 of the HTT gene causes Huntington's disease (HD). The mutant HTT protein (mHTT) has numerous aberrant interactions with diverse, pleiomorphic effects. Lowering mHTT is a promising approach to treat HD, but it is unclear when lowering should be initiated, how much is necessary, and what duration should occur to achieve benefits. Furthermore, the effects of mHTT lowering on brain lipids have not been assessed. Using a mHtt-inducible mouse model, we analyzed mHtt lowering initiated at different ages and sustained for different time-periods. mHTT protein in cytoplasmic and synaptic compartments of the striatum was reduced 38-52%; however, there was minimal lowering of mHTT in nuclear and perinuclear regions where aggregates formed at 12 months of age. Total striatal lipids were reduced in 9-month-old LacQ140 mice and preserved by mHtt lowering. Subclasses important for white matter structure and function including ceramide (Cer), sphingomyelin (SM), and monogalactosyldiacylglycerol (MGDG), contributed to the reduction in total lipids. Phosphatidylinositol (PI), phosphatidylserine (PS), and bismethyl phosphatidic acid (BisMePA) were also changed in LacQ140 mice. Levels of all subclasses except ceramide were preserved by mHtt lowering. mRNA expression profiling indicated that a transcriptional mechanism contributes to changes in myelin lipids, and some but not all changes can be prevented by mHtt lowering. Our findings suggest that early and sustained reduction in mHtt can prevent changes in levels of select striatal proteins and most lipids, but a misfolded, degradation-resistant form of mHTT hampers some benefits in the long term.

Also flagged:HDAC5Craniofacial Neuropathic PainHDAC4axonhypersensitivitytrigeminal neuropathic pain
Journal Article 2023-09-28 No Snippets Westlund KN, Montera M, Goins AE, Shilling MW, Afaghpour-Becklund M, Alles SRA, Elise Hui S.
Show Full Abstract

Identifying and resolving molecular complexities underlying chronic neuropathic pain is a significant challenge. Among the numerous classes of histone deacetylases, Class I (HDAC 1-3) and Class III (sirtuins) have been best studied in experimental pain models where inhibitor pre-treatments but not post-treatments abrogate the development of pain-related behaviors. Post-treatment here in week 3 with less well-studied Class IIa HDAC4/5 selective inhibitor LMK235 diminishes the trigeminal ganglia increases of HDAC5 RNA and protein in two chronic orofacial neuropathic pain models to levels measured in naïve mice at week 10 post-model induction. HDAC4 RNA reported in lower limb inflammatory pain models is not evident in the trigeminal models. Many other gene alterations persisting at week 10 in the trigeminal ganglia (TG) are restored to naïve levels in mice treated with LMK235. Important pain-related upregulated genes Hoxc8,b9,d8; P2rx4, Cckbr, growth hormone (Gh), and schlafen (Slfn4) are greatly reduced in LMK235-treated mice. Fold increase in axon regeneration/repair genes Sostdc1, TTr, and Folr1 after injury are doubled by LMK235 treatment. LMK235 reduces the excitability of trigeminal ganglia neurons in culture isolated from nerve injured mice compared to vehicle-treated controls, with no effect on neurons from naïve mice. Electrophysiological characterization profile includes a shift where ∼20% of the small neurons recorded under LMK235-treated conditions are high threshold, whereas none of the neurons under control conditions have high thresholds. LMK235 reverses long-standing mechanical and cold hypersensitivity in chronic trigeminal neuropathic pain models in males and females (5,10 mg/kg), preventing development of anxiety- and depression-like behaviors. PERSPECTIVE: Data here support HDAC5 as key epigenetic factor in chronic trigeminal neuropathic pain persistence, validated with the study of RNA alterations, TG neuronal excitability, and pain-related behaviors. HDAC5 inhibitor given in week 3 restores RNA balance at 10 weeks, while upregulation remains for response to wound healing and chronic inflammation RNAs.

HFE
Also flagged:IronSigma receptorsphencyclidine receptorsprogesteronehememembrane
Journal Article 2023-09-28 ✓ 2 Snippets Nguyen NT, Jaramillo-Martinez V, Mathew M, Suresh VV, Sivaprakasam S, Bhutia YD, Ganapathy V.
In-Text Gene Mentions

…disease progression inhemochromatosisand cancer.…

…diseases, such ashemochromatosisand cancer.…

Show Full Abstract

Sigma receptors are non-opiate/non-phencyclidine receptors that bind progesterone and/or heme and also several unrelated xenobiotics/chemicals. They reside in the plasma membrane and in the membranes of the endoplasmic reticulum, mitochondria, and nucleus. Until recently, the biology/pharmacology of these proteins focused primarily on their role in neuronal functions in the brain/retina. However, there have been recent developments in the field with the discovery of unexpected roles for these proteins in iron/heme homeostasis. Sigma receptor 1 (S1R) regulates the oxidative stress-related transcription factor NRF2 and protects against ferroptosis, an iron-induced cell death process. Sigma receptor 2 (S2R), which is structurally unrelated to S1R, complexes with progesterone receptor membrane components PGRMC1 and PGRMC2. S2R, PGRMC1, and PGRMC2, either independently or as protein-protein complexes, elicit a multitude of effects with a profound influence on iron/heme homeostasis. This includes the regulation of the secretion of the iron-regulatory hormone hepcidin, the modulation of the activity of mitochondrial ferrochelatase, which catalyzes iron incorporation into protoporphyrin IX to form heme, chaperoning heme to specific hemoproteins thereby influencing their biological activity and stability, and protection against ferroptosis. Consequently, S1R, S2R, PGRMC1, and PGRMC2 potentiate disease progression in hemochromatosis and cancer. These new discoveries usher this intriguing group of non-traditional progesterone receptors into an unchartered territory in biology and medicine.

PRDX6
Also flagged:PolyacrylamideBreast CancertumoroncogenetumorsJTB
Journal Article 2023-09-28 ✓ 5 Snippets Jayathirtha M, Jayaweera T, Whitham D, Petre BA, Neagu AN, Darie CC.
In-Text Gene Mentions

Sixteen downregulated DEPs with anti-tumorigenic potential (YWHAZ, TUBB2A, HSPB1/HSP27, HNRNPK, PCBP2, MCCC2, UGDH, TPI1, ATP5F1B, DLST, FTL, HYOU1, PRDX6, RPL31, RPL7A, and RPS3) were submitted for protein–protein interaction (PPI) network construction with the STRING database (https://string-db.org/, accessed on 19 September 2023) to emphasize the specific interaction network associated with JTBhigh condition in the MCF7 BC cell line (Figure 1).

We identified 6 differentially expressed proteins (4 upregulated and 2 downregulated) related to JTBhigh condition vs. control that emphasize a pro-tumorigenic (PT) role (RBBP4, SET, ABRACL, NCKAP1, GSN, and PRDM5), while 21 proteins, which are known to be usually overexpressed in cancer cells, emphasized an anti-tumorigenic role when low expression occurs as happened in this experiment (UBA1, YWHAZ, TUBB2A, ITGB5, HSPB1, PCBP2, MCCC2, UGDH, TPI1, ATP5F1B, DLSI, FTL, HYOU1, PRDX6, NRDC1, and HNRNPK), as well as three ribosomal proteins (RPL7A, RPL31, and RPS3).

Peroxiredoxin 6 (PRDX6), an antioxidant enzyme involved in the ROS pathway, is overexpressed in various cancers [106], such as cervical cancer [107], CRC [108], as well as in MDA-MB-231 HM BC cell line [109].

…DLST, FTL, HYOU1,PRDX6, NRDC1, PRDM5, DKK1,…

…DLST, FTL, HYOU1,PRDX6, RPL31, RPL7A, and…

Show Full Abstract

The identification of new genes/proteins involved in breast cancer (BC) occurrence is widely used to discover novel biomarkers and understand the molecular mechanisms of BC initiation and progression. The jumping translocation breakpoint (<i>JTB</i>) gene may act both as a tumor suppressor or oncogene in various types of tumors, including BC. Thus, the JTB protein could have the potential to be used as a biomarker in BC, but its neoplastic mechanisms still remain unknown or controversial. We previously analyzed the interacting partners of JTB<sup>high</sup> protein extracted from transfected MCF7 BC cell line using SDS-PAGE complemented with in-solution digestion, respectively. The previous results suggested the JTB contributed to the development of a more aggressive phenotype and behavior for the MCF7 BC cell line through synergistic upregulation of epithelial-mesenchymal transition (EMT), mitotic spindle, and fatty acid metabolism-related pathways. In this work, we aim to complement the previously reported JTB proteomics-based experiments by investigating differentially expressed proteins (DEPs) and tumorigenic pathways associated with JTB overexpression using two-dimensional polyacrylamide gel electrophoresis (2D-PAGE). Statistically different gel spots were picked for protein digestion, followed by nanoliquid chromatography-tandem mass spectrometry (nLC-MS/MS) analysis. We identified six DEPs related to the JTB<sup>high</sup> condition vs. control that emphasize a pro-tumorigenic (PT) role. Twenty-one proteins, which are known to be usually overexpressed in cancer cells, emphasize an anti-tumorigenic (AT) role when low expression occurs. According to our previous results, proteins that have a PT role are mainly involved in the activation of the EMT process. Interestingly, JTB overexpression has been correlated here with a plethora of significant upregulated and downregulated proteins that sustain JTB tumor suppressive functions. Our present and previous results sustain the necessity of the complementary use of different proteomics-based methods (SDS-PAGE, 2D-PAGE, and in-solution digestion) followed by tandem mass spectrometry to avoid their limitations, with each method leading to the delineation of specific clusters of DEPs that may be merged for a better understanding of molecular pathways and neoplastic mechanisms related to the JTB's role in BC initiation and progression.

UNC13C
Also flagged:tetralogy of Fallotcongenital heart diseasepathogenesiscell cyclechromatincalcium
Journal Article 2023-09-28 ✓ 5 Snippets Harvey DC, Verma R, Sedaghat B, Hjelm BE, Morton SU, Seidman JG, Kumar SR.
In-Text Gene Mentions

UNC13C's centrality in synaptic transmission adds to the evidence of a potential link directly between CHD and nervous system development and autism which has also been associated with synaptic dysfunction (102).

…, CLUH ,UNC13C, and WASHC5…

…in mitochondrial regulation,UNC13Cis a membrane…

…CLUH andUNC13Crepresent novel candidate…

…CLUH andUNC13Crepresent novel, putative…

Show Full Abstract

<h4>Objective</h4>Eighty percent of patients with a diagnosis of tetralogy of Fallot (TOF) do not have a known genetic etiology or syndrome. We sought to identify key molecular pathways and biological processes that are enriched in non-syndromic TOF, the most common form of cyanotic congenital heart disease, rather than single driver genes to elucidate the pathogenesis of this disease.<h4>Methods</h4>We undertook exome sequencing of 362 probands with non-syndromic TOF and their parents within the Pediatric Cardiac Genomics Consortium (PCGC). We identified rare (minor allele frequency <1 × 10<sup>-</sup>4), <i>de novo</i> variants to ascertain pathways and processes affected in this population to better understand TOF pathogenesis. Pathways and biological processes enriched in the PCGC TOF cohort were compared to 317 controls without heart defects (and their parents) from the Simons Foundation Autism Research Initiative (SFARI).<h4>Results</h4>A total of 120 variants in 117 genes were identified as most likely to be deleterious, with <i>CHD7</i>, <i>CLUH</i>, <i>UNC13C</i>, and <i>WASHC5</i> identified in two probands each. Gene ontology analyses of these variants using multiple bioinformatic tools demonstrated significant enrichment in processes including cell cycle progression, chromatin remodeling, myocyte contraction and calcium transport, and development of the ventricular septum and ventricle. There was also a significant enrichment of target genes of <i>SOX9</i>, which is critical in second heart field development and whose loss results in membranous ventricular septal defects related to disruption of the proximal outlet septum. None of these processes was significantly enriched in the SFARI control cohort.<h4>Conclusion</h4>Innate molecular defects in cardiac progenitor cells and genes related to their viability and contractile function appear central to non-syndromic TOF pathogenesis. Future research utilizing our results is likely to have significant implications in stratification of TOF patients and delivery of personalized clinical care.

Also flagged:CRISPRCas9infectious diseaseslipiddegradationgenetic diseases
Journal Article 2023-09-28 No Snippets Dubey AK, Mostafavi E.
Show Full Abstract

The use of biomaterials in delivering CRISPR/Cas9 for gene therapy in infectious diseases holds tremendous potential. This innovative approach combines the advantages of CRISPR/Cas9 with the protective properties of biomaterials, enabling accurate and efficient gene editing while enhancing safety. Biomaterials play a vital role in shielding CRISPR/Cas9 components, such as lipid nanoparticles or viral vectors, from immunological processes and degradation, extending their effectiveness. By utilizing the flexibility of biomaterials, tailored systems can be designed to address specific genetic diseases, paving the way for personalized therapeutics. Furthermore, this delivery method offers promising avenues in combating viral illnesses by precisely modifying pathogen genomes, and reducing their pathogenicity. Biomaterials facilitate site-specific gene modifications, ensuring effective delivery to infected cells while minimizing off-target effects. However, challenges remain, including optimizing delivery efficiency, reducing off-target effects, ensuring long-term safety, and establishing scalable production techniques. Thorough research, pre-clinical investigations, and rigorous safety evaluations are imperative for successful translation from the laboratory to clinical applications. In this review, we discussed how CRISPR/Cas9 delivery using biomaterials revolutionizes gene therapy and infectious disease treatment, offering precise and safe editing capabilities with the potential to significantly improve human health and quality of life.

PRDX6
Also flagged:tumordetoxificationdeathdendriticMIFhepatoma
Journal Article 2023-09-28 ✓ 2 Snippets Zhang S, Li X, Zheng Y, Liu J, Hu H, Zhang S, Kuang W.
In-Text Gene Mentions

…HMOX1, POR, SOD1,PRDX6, P4HB, GPX4, PRDX3,…

…in HCC patients,PRDX6, P4HB, and POR…

Show Full Abstract

<b>Background:</b> Hepatocellular Carcinoma (HCC) is a common lethal digestive system tumor. The oxidative stress mechanism is crucial in the HCC genesis and progression. <b>Methods:</b> Our study analyzed single-cell and bulk sequencing data to compare the microenvironment of non-tumor liver tissues and HCC tissues. Through these analyses, we aimed to investigate the effect of oxidative stress on cells in the HCC microenvironment and identify critical oxidative stress response-related genes that impact the survival of HCC patients. <b>Results:</b> Our results showed increased oxidative stress in HCC tissue compared to non-tumor tissue. Immune cells in the HCC microenvironment exhibited higher oxidative detoxification capacity, and oxidative stress-induced cell death of dendritic cells was attenuated. HCC cells demonstrated enhanced communication with immune cells through the MIF pathway in a highly oxidative hepatoma microenvironment. Meanwhile, using machine learning and Cox regression screening, we identified PRDX1 as a predictor of early occurrence and prognosis in patients with HCC. The expression level of PRDX1 in HCC was related to dysregulated ribosome biogenesis and positively correlated with the expression of immunological checkpoints (PDCD1LG2, CTLA4, TIGIT, LAIR1). High PRDX1 expression in HCC patients correlated with better sensitivity to immunotherapy agents such as sorafenib, IGF-1R inhibitor, and JAK inhibitor. <b>Conclusion:</b> In conclusion, our study unveiled variations in oxidative stress levels between non-tumor liver and HCC tissues. And we identified oxidative stress gene markers associated with hepatocarcinogenesis development, offering novel insights into the oxidative stress response mechanism in HCC.

Also flagged:Astaxanthinlipidxanthophyll carotenoidsbiosynthesiscarotenoidesters
Journal Article 2023-09-28 No Snippets Nishida Y, Berg PC, Shakersain B, Hecht K, Takikawa A, Tao R, Kakuta Y, Uragami C, Hashimoto H, Misawa N, Maoka T.
Show Full Abstract

Astaxanthin (AX), a lipid-soluble pigment belonging to the xanthophyll carotenoids family, has recently garnered significant attention due to its unique physical properties, biochemical attributes, and physiological effects. Originally recognized primarily for its role in imparting the characteristic red-pink color to various organisms, AX is currently experiencing a surge in interest and research. The growing body of literature in this field predominantly focuses on AXs distinctive bioactivities and properties. However, the potential of algae-derived AX as a solution to various global environmental and societal challenges that threaten life on our planet has not received extensive attention. Furthermore, the historical context and the role of AX in nature, as well as its significance in diverse cultures and traditional health practices, have not been comprehensively explored in previous works. This review article embarks on a comprehensive journey through the history leading up to the present, offering insights into the discovery of AX, its chemical and physical attributes, distribution in organisms, and biosynthesis. Additionally, it delves into the intricate realm of health benefits, biofunctional characteristics, and the current market status of AX. By encompassing these multifaceted aspects, this review aims to provide readers with a more profound understanding and a robust foundation for future scientific endeavors directed at addressing societal needs for sustainable nutritional and medicinal solutions. An updated summary of AXs health benefits, its present market status, and potential future applications are also included for a well-rounded perspective.

NEGR1
Also flagged:Cell Adhesion MoleculesaxonalsynapseOpioid Binding Protein/Cell Adhesion Molecule LikeOPCML
Journal Article 2023-09-28 ✓ 5 Snippets Salluzzo M, Vianello C, Abdullatef S, Rimondini R, Piccoli G, Carboni L.
In-Text Gene Mentions

Another patient affected by microdeletion 1p31, including NEGR1, showed moderate intellectual disability [102].

NEGR1 is able to interact with Niemann–Pick disease type C2 protein, increase its stability, and thus modulate cholesterol accumulation and influence its homeostasis.

An association of NEGR1 with dyslexia emerged in a copy number variation analysis in Indian families.

Recently, NEGR1 has been indicated among the principal players in the genetic correlations between obesity and a number of psychiatric disorders, including major depression, schizophrenia, and anorexia nervosa [72].

NEGR1 knock-out mice showed altered serotonergic and dopaminergic neurotransmission [64] and subtle alterations in social behaviour and in learning, as well as increased susceptibility to pentylenetetrazol-induced seizures [59].

Show Full Abstract

In the brain, cell adhesion molecules (CAMs) are critical for neurite outgrowth, axonal fasciculation, neuronal survival and migration, and synapse formation and maintenance. Among CAMs, the IgLON family comprises five members: Opioid Binding Protein/Cell Adhesion Molecule Like (OPCML or OBCAM), Limbic System Associated Membrane Protein (LSAMP), neurotrimin (NTM), Neuronal Growth Regulator 1 (NEGR1), and IgLON5. IgLONs exhibit three N-terminal C2 immunoglobulin domains; several glycosylation sites; and a glycosylphosphatidylinositol anchoring to the membrane. Interactions as homo- or heterodimers in <i>cis</i> and in <i>trans</i>, as well as binding to other molecules, appear critical for their functions. Shedding by metalloproteases generates soluble factors interacting with cellular receptors and activating signal transduction. The aim of this review was to analyse the available data implicating a role for IgLONs in neuropsychiatric disorders. Starting from the identification of a pathological role for antibodies against IgLON5 in an autoimmune neurodegenerative disease with a poorly understood mechanism of action, accumulating evidence links IgLONs to neuropsychiatric disorders, albeit with still undefined mechanisms which will require future thorough investigations.

bioRxiv 2023-09-28 Preprint (No Snippets API) McGlacken-Byrne SM, del Valle I, Xenakis T, Simcock IC, Suntharalingham JP, Buonocore F, Crespo B, Moreno N, Liptrot D, Niola P, Brooks T, Conway GS, Dattani MT, Arthurs OJ, Solanky N, Achermann JC.
Show Full Abstract

The complex genetic mechanisms underlying human ovary development can give rise to clinical phenotypes if disrupted, such as Primary Ovarian Insufficiency and Differences of Sex Development. Through a clinically-focused lens, we combine single-nuclei RNA sequencing, bulk RNA sequencing, and micro-focus computed tomography to elucidate the anatomy and transcriptional landscape of the human fetal ovary across key developmental timepoints (Carnegie Stage 22 until 20 weeks post conception). We show the marked growth and distinct morphological changes within the fetal ovary at the critical timepoint of germ cell expansion, and demonstrate that the fetal ovary becomes more transcriptomically distinct from the testis with age. We describe novel ovary developmental pathways, relating to neuroendocrine signalling, energy homeostasis, mitochondrial networks, piRNA processes, and inflammasome regulation. We define transcriptional regulators and candidate genes for meiosis within the developing ovary. Together, this work advances our fundamental understanding of human ovary development and clinical ovarian insufficiency phenotypes.

bioRxiv 2023-09-28 Preprint (No Snippets API) Rutowicz K, Lüthi J, de Groot R, Holtackers R, Yakimovich Y, Pazmiño DM, Gandrillon O, Pelkmans L, Baroux C.
Show Full Abstract

Plant protoplasts constitute the starting material to induce pluripotent cell masses in vitro competent for tissue regeneration. Dedifferentiation is associated with large-scale chromatin reorganisation and massive transcriptome reprogramming, characterized by stochastic gene expression. How this cellular variability reflects on chromatin organisation in individual cells and what are the factors influencing chromatin transitions during culturing is largely unknown. High-throughput imaging and a custom, supervised image analysis protocol extracting over 100 chromatin features unravelled a rapid, multiscale dynamics of chromatin patterns which trajectory strongly depends on nutrients availability. Decreased abundance in H1 (linker histones) is hallmark of chromatin transitions. We measured a high heterogeneity of chromatin patterns indicating an intrinsic entropy as hallmark of the initial cultures. We further measured an entropy decline over time, and an antagonistic influence by external and intrinsic factors, such as phytohormones and epigenetic modifiers, respectively. Collectively, our study benchmarks an approach to understand the variability and evolution of chromatin patterns underlying plant cell reprogramming in vitro .

Also flagged:serinesynthesisERbreast cancermetastatic diseaseRNA binding protein
Journal Article 2023-09-27 No Snippets Petri BJ, Piell KM, Wilt AE, Howser AD, Winkler L, Whitworth MR, Valdes BL, Lehman NL, Clem BF, Klinge CM.
Show Full Abstract

Despite the successful combination of therapies improving survival of estrogen receptor α (ER+) breast cancer patients with metastatic disease, mechanisms for acquired endocrine resistance remain to be fully elucidated. The RNA binding protein HNRNPA2B1 (A2B1), a reader of N(6)-methyladenosine (m6A) in transcribed RNA, is upregulated in endocrine-resistant, ER+ LCC9 and LY2 cells compared to parental MCF-7 endocrine-sensitive luminal A breast cancer cells. The miRNA-seq transcriptome of MCF-7 cells overexpressing A2B1 identified the serine metabolic processes pathway. Increased expression of two key enzymes in the serine synthesis pathway (SSP), phosphoserine aminotransferase 1 (PSAT1) and phosphoglycerate dehydrogenase (PHGDH), correlates with poor outcomes in ER+ breast patients who received tamoxifen (TAM). We reported that PSAT1 and PHGDH were higher in LCC9 and LY2 cells compared to MCF-7 cells and their knockdown enhanced TAM sensitivity in these-resistant cells. Here we demonstrate that stable, modest overexpression of A2B1 in MCF-7 cells increased PSAT1 and PHGDH and endocrine resistance. We identified four miRNAs downregulated in MCF-7-A2B1 cells that directly target the PSAT1 3'UTR (miR-145-5p and miR-424-5p), and the PHGDH 3'UTR (miR-34b-5p and miR-876-5p) in dual luciferase assays. Lower expression of miR-145-5p and miR-424-5p in LCC9 and ZR-75-1-4-OHT cells correlated with increased PSAT1 and lower expression of miR-34b-5p and miR-876-5p in LCC9 and ZR-75-1-4-OHT cells correlated with increased PHGDH. Transient transfection of these miRNAs restored endocrine-therapy sensitivity in LCC9 and ZR-75-1-4-OHT cells. Overall, our data suggest a role for decreased A2B1-regulated miRNAs in endocrine resistance and upregulation of the SSP to promote tumor progression in ER+ breast cancer.

VRK2
Also flagged:CYP26B1retinoic acidskullcraniosynostosisencephalocelehearing
Journal Article 2023-09-27 ✓ 1 Snippet Silveira KC, Fonseca IC, Oborn C, Wengryn P, Ghafoor S, Beke A, Dreseris ES, Wong C, Iacovone A, Soltys CL, Babul-Hirji R, Artigalas O, Antolini-Tavares A, Gingras AC, Campos E, Cavalcanti DP, Kannu P.
In-Text Gene Mentions

…PDZD8, PKMYT1, andVRK2proteins—most of which…

Show Full Abstract

CYP26B1 metabolizes retinoic acid in the developing embryo to regulate its levels. A limited number of individuals with pathogenic variants in CYP26B1 have been documented with a varied phenotypic spectrum, spanning from a severe manifestation involving skull anomalies, craniosynostosis, encephalocele, radio-humeral fusion, oligodactyly, and a narrow thorax, to a milder presentation characterized by craniosynostosis, restricted radio-humeral joint mobility, hearing loss, and intellectual disability. Here, we report two families with CYP26B1-related phenotypes and describe the data obtained from functional studies of the variants. Exome and Sanger sequencing were used for variant identification in family 1 and family 2, respectively. Family 1 reflects a mild phenotype, which includes craniofacial dysmorphism with brachycephaly (without craniosynostosis), arachnodactyly, reduced radioulnar joint movement, conductive hearing loss, learning disability-and compound heterozygous CYP26B1 variants: (p.[(Pro118Leu)];[(Arg234Gln)]) were found. In family 2, a stillborn fetus presented a lethal phenotype with spina bifida occulta, hydrocephalus, poor skeletal mineralization, synostosis, limb defects, and a synonymous homozygous variant in CYP26B1: c.1083C > A. A minigene assay revealed that the synonymous variant created a new splice site, removing part of exon 5 (p.Val361_Asp382del). Enzymatic activity was assessed using a luciferase assay, demonstrating a notable reduction in exogenous retinoic acid metabolism for the variant p.Val361_Asp382del. (~ 3.5 × decrease compared to wild-type); comparatively, the variants p.(Pro118Leu) and p.(Arg234Gln) demonstrated a partial loss of metabolism (1.7× and 2.3× reduction, respectively). A proximity-dependent biotin identification assay reaffirmed previously reported ER-resident protein interactions. Additional work into these interactions is critical to determine if CYP26B1 is involved with other biological events on the ER. Immunofluorescence assay suggests that mutant CYP26B1 is still localized in the endoplasmic reticulum. These results indicate that novel pathogenic variants in CYP26B1 result in varying levels of enzymatic activity that impact retinoic acid metabolism and relate to the distinct phenotypes observed.

PRDX6
Also flagged:prelamin A/CLmnaglutamate dehydrogenase 1Glud1Actincytoplasmic 1
Journal Article 2023-09-27 ✓ 1 Snippet Haneef K, Salim A, Hashim Z, Ilyas A, Syed B, Ahmed A, Zarina S.
In-Text Gene Mentions

…nase (Mdh1), Peroxiredoxin-6 (Prdx6), Superoxide dismutase (Sod1)…

Show Full Abstract

Increasing evidence has demonstrated that mesenchymal stem cells (MSCs) have been linked to tissue regeneration both in vitro and in vivo. However, poor engraftment and low survival rate of transplanted MSCs are still a major concern. It has been found that the proliferation, survival, and migration of MSCs are all increased by hypoxic preconditioning. However, the molecular mechanism through which hypoxic preconditioning enhances these beneficial properties of MSCs remains to be fully investigated. Therefore, the present study is aimed to investigate the mechanism by which hypoxic preconditioning enhances the survival of MSCs. We used proteomic analysis to explore the molecules that may contribute to the survival and proliferation of hypoxic preconditioned (HP) MSCs. The analysis revealed a higher expression of prelamin A/C (Lmna), glutamate dehydrogenase 1(Glud1), Actin, cytoplasmic 1(Actb), Alpha-enolase (Eno1), Glucose-6-phosphate 1-dehydrogenase (G6pd), Protein disulfide-isomerase A3 (Pdia3), Malate dehydrogenase (Mdh1), Peroxiredoxin-6 (Prdx6), Superoxide dismutase (Sod1), and Annexin A2 (Anxa2) in HP-MSCs. These proteins are possibly involved in cellular survival and proliferation through various cellular pathways. This research could aid in understanding the processes involved in hypoxic preconditioning of MSCs and designing of cell-based therapeutic strategies for tissue regeneration.

Also flagged:NAFLDNASHcirrhosisliver diseaseobesitycardiovascular diseases
Journal Article 2023-09-27 No Snippets Mao T, Sun Y, Xu X, He K.
Show Full Abstract

NAFLD is the most common chronic liver disease worldwide, characterized by lipid accumulation in the liver, and usually evolves from steatohepatitis to fibrosis, cirrhosis, or even HCC. Its incidence is rapidly rising in parallel with the increasing prevalence of obesity and metabolic syndrome. Current therapies are limited to lifestyle changes including dietary intervention and exercise, in which dietary modification exerts an important part in losing weight and preventing NAFLD. In this review, we briefly discuss the roles and mechanisms of dietary components including fructose, non-nutritive sweeteners, fat, proteins, and vitamins in the progression or prevention of NAFLD. We also summarize several popular dietary patterns such as calorie-restricted diets, intermittent fasting, ketogenic diets, Mediterranean diets, and dietary approach to stop hypertension diets and compare the effects of low-fat and low-carbohydrate diets in preventing the development of NAFLD. Moreover, we summarize the potential drugs targeting metabolic-related targets in NAFLD.

Also flagged:PDneurodegenerative disorderagingpathogenesisneurodegenerative diseaseAlzheimer disease
Journal Article 2023-09-27 No Snippets Khanna A, Jones G.
Show Full Abstract

Parkinson disease (PD) is a complex neurodegenerative disorder that afflicts over 10 million people worldwide, resulting in debilitating motor and cognitive impairment. In the United States alone (with approximately 1 million cases), the economic burden for treating and caring for persons with PD exceeds US $50 billion and myriad therapeutic approaches are under development, including both symptomatic- and disease-modifying agents. The challenges presented in addressing PD are compounded by observations that numerous, statistically distinct patient phenotypes present with a wide variety of motor and nonmotor symptomatic profiles, varying responses to current standard-of-care symptom-alleviating medications (L-DOPA and dopaminergic agonists), and different disease trajectories. The existence of these differing phenotypes highlights the opportunities in personalized approaches to symptom management and disease control. The prodromal period of PD can span across several decades, allowing the potential to leverage the unique array of composite symptoms presented to trigger early interventions. This may be especially beneficial as disease progression in PD (alongside Alzheimer disease and Huntington disease) may be influenced by biological processes such as oxidative stress, offering the potential for individual lifestyle factors to be tailored to delay disease onset. In this viewpoint, we offer potential scenarios where emerging diagnostic and monitoring strategies might be tailored to the individual patient under the tenets of P4 medicine (predict, prevent, personalize, and participate). These approaches may be especially relevant as the causative factors and biochemical pathways responsible for the observed neurodegeneration in patients with PD remain areas of fluid debate. The numerous observational patient cohorts established globally offer an excellent opportunity to test and refine approaches to detect, characterize, control, modify the course, and ultimately stop progression of this debilitating disease. Such approaches may also help development of parallel interventive strategies in other diseases such as Alzheimer disease and Huntington disease, which share common traits and etiologies with PD. In this overview, we highlight near-term opportunities to apply P4 medicine principles for patients with PD and introduce the concept of composite orthogonal patient monitoring.

HTT
Also flagged:posttranslational modificationslipidmodificationslocalizationWntmTOR
Journal Article 2023-09-27 ✓ 1 Snippet Anwar MU, van der Goot FG.
In-Text Gene Mentions

…with Huntington proteinHTT( Huang et…

Show Full Abstract

With a limited number of genes, cells achieve remarkable diversity. This is to a large extent achieved by chemical posttranslational modifications of proteins. Amongst these are the lipid modifications that have the unique ability to confer hydrophobicity. The last decade has revealed that lipid modifications of proteins are extremely frequent and affect a great variety of cellular pathways and physiological processes. This is particularly true for S-acylation, the only reversible lipid modification. The enzymes involved in S-acylation and deacylation are only starting to be understood, and the list of proteins that undergo this modification is ever-increasing. We will describe the state of knowledge on the enzymes that regulate S-acylation, from their structure to their regulation, how S-acylation influences target proteins, and finally will offer a perspective on how alterations in the balance between S-acylation and deacylation may contribute to disease.

Also flagged:YIPF3YIPF4ATG8Golgitransmembraneamino
Journal Article 2023-09-27 No Snippets Hickey KL, Swarup S, Smith IR, Paoli JC, Miguel Whelan E, Paulo JA, Harper JW.
Show Full Abstract

During nutrient stress, macroautophagy degrades cellular macromolecules, thereby providing biosynthetic building blocks while simultaneously remodelling the proteome<sup>1,2</sup>. Although the machinery responsible for initiation of macroautophagy has been well characterized<sup>3,4</sup>, our understanding of the extent to which individual proteins, protein complexes and organelles are selected for autophagic degradation, and the underlying targeting mechanisms, is limited. Here we use orthogonal proteomic strategies to provide a spatial proteome census of autophagic cargo during nutrient stress in mammalian cells. We find that macroautophagy has selectivity for recycling membrane-bound organelles (principally Golgi and endoplasmic reticulum). Through autophagic cargo prioritization, we identify a complex of membrane-embedded proteins, YIPF3 and YIPF4, as receptors for Golgiphagy. During nutrient stress, YIPF3 and YIPF4 interact with ATG8 proteins through LIR motifs and are mobilized into autophagosomes that traffic to lysosomes in a process that requires the canonical autophagic machinery. Cells lacking YIPF3 or YIPF4 are selectively defective in elimination of a specific cohort of Golgi membrane proteins during nutrient stress. Moreover, YIPF3 and YIPF4 play an analogous role in Golgi remodelling during programmed conversion of stem cells to the neuronal lineage in vitro. Collectively, the findings of this study reveal prioritization of membrane protein cargo during nutrient-stress-dependent proteome remodelling and identify a Golgi remodelling pathway that requires membrane-embedded receptors.

Also flagged:pulmonary hypertensionPHright-sided heart failureprostacyclinendothelin receptorphosphodiesterase type 5
Journal Article 2023-09-27 No Snippets Zheng R, Xu T, Wang X, Yang L, Wang J, Huang X.
Show Full Abstract

Pulmonary hypertension (PH) is a progressive disease characterised by elevated pulmonary arterial pressure and right-sided heart failure. While conventional drug therapies, including prostacyclin analogues, endothelin receptor antagonists and phosphodiesterase type 5 inhibitors, have been shown to improve the haemodynamic abnormalities of patients with PH, the 5-year mortality rate remains high. Thus, novel therapies are urgently required to prolong the survival of patients with PH. Stem cell therapies, including mesenchymal stem cells, endothelial progenitor cells and induced pluripotent stem cells, have shown therapeutic potential for the treatment of PH and clinical trials on stem cell therapies for PH are ongoing. This review aims to present the latest preclinical achievements of stem cell therapies, focusing on the therapeutic effects of clinical trials and discussing the challenges and future perspectives of large-scale applications.

BTN2A1
Also flagged:infectionstumourstumourdegranulationgranzyme Bpeptides
Journal Article 2023-09-27 ✓ 1 Snippet Sandoz PA, Kuhnigk K, Szabo EK, Thunberg S, Erikson E, Sandström N, Verron Q, Brech A, Watzl C, Wagner AK, Alici E, Malmberg KJ, Uhlin M, Önfelt B.
In-Text Gene Mentions

…with at leastBTN2A1in a complex…

Show Full Abstract

γδ T cells play a pivotal role in protection against various types of infections and tumours, from early childhood on and throughout life. They consist of several subsets characterised by adaptive and innate-like functions, with Vγ9Vδ2 being the largest subset in human peripheral blood. Although these cells show signs of cytotoxicity, their modus operandi remains poorly understood. Here we explore, using live single-cell imaging, the cytotoxic functions of γδ T cells upon interactions with tumour target cells with high temporal and spatial resolution. While γδ T cell killing is dominated by degranulation, the availability of lytic molecules appears tightly regulated in time and space. In particular, the limited co-occurrence of granzyme B and perforin restrains serial killing of tumour cells by γδ T cells. Thus, our data provide new insights into the cytotoxic arsenal and functions of γδ T cells, which may guide the development of more efficient γδ T cell based adoptive immunotherapies.

Also flagged:Systemic inflammationgene-expressionTNF-αgene expressionpro-inflammatory cytokinesIL-1
Journal Article 2023-09-27 No Snippets Michaeli JC, Albers S, de la Torre C, Schreiner Y, Faust S, Michaeli T, Michaeli DT, Liying A, Krämer BK, Stach K, Yard BA.
Show Full Abstract

Systemic inflammation affects the whole vasculature, yet whether arterial and venous endothelial cells differ in their abilities to mediate inflammation and to return to homeostasis after an inflammatory stimulus has not been addressed thoroughly. We assessed gene-expression profiles in isolated endothelial cells from human umbilical arteries (HUAEC) or veins (HUVEC) under basal conditions, after TNF-α stimulation and various time points after TNF-α removal to allow reinstatement of homeostasis. TNF-α regulates the expression of different sets of transcripts that are significantly changed only in HUAEC, only in HUVEC or changed in both. We identified three types of gene regulation, i.e. genes that were significantly regulated after 24 h of TNF-α stimulation but no longer when TNF-α was removed (homeostatic regulation), genes that maintained significantly regulated after TNF-α removal (not homeostatic regulation) and genes that were only significantly regulated when TNF-α was removed (post-regulation). HUAEC and HUVEC quantitatively differed in these types of gene regulation, with relatively more genes being post-regulated in HUAEC. In conclusion our data demonstrate that HUAEC and HUVEC respond intrinsically different to an inflammatory insult. Whether this holds true for all endothelial cells and its relevance for inflammatory insults in different organs during systemic inflammation warrants further studies.

POU3F2
Also flagged:Celf4neurodevelopmental disorderssynapsepolysomesynapticRNA binding protein
Journal Article 2023-09-27 ✓ 1 Snippet Salamon I, Park Y, Miškić T, Kopić J, Matteson P, Page NF, Roque A, McAuliffe GW, Favate J, Garcia-Forn M, Shah P, Judaš M, Millonig JH, Kostović I, De Rubeis S, Hart RP, Krsnik Ž, Rasin MR.
In-Text Gene Mentions

…UNC5D, SATB2, PRSS12,POU3F2, CUX1, CUX2, TLE3,…

Show Full Abstract

Abnormalities in neocortical and synaptic development are linked to neurodevelopmental disorders. However, the molecular and cellular mechanisms governing initial synapse formation in the prenatal neocortex remain poorly understood. Using polysome profiling coupled with snRNAseq on human cortical samples at various fetal phases, we identify human mRNAs, including those encoding synaptic proteins, with finely controlled translation in distinct cell populations of developing frontal neocortices. Examination of murine and human neocortex reveals that the RNA binding protein and translational regulator, CELF4, is expressed in compartments enriched in initial synaptogenesis: the marginal zone and the subplate. We also find that Celf4/CELF4-target mRNAs are encoded by risk genes for adverse neurodevelopmental outcomes translating into synaptic proteins. Surprisingly, deleting Celf4 in the forebrain disrupts the balance of subplate synapses in a sex-specific fashion. This highlights the significance of RNA binding proteins and mRNA translation in evolutionarily advanced synaptic development, potentially contributing to sex differences.

Also flagged:TERF2LNPKinterneuron migrationinterneuroncell migrationtelomere
Journal Article 2023-09-27 No Snippets Meng X, Yao D, Imaizumi K, Chen X, Kelley KW, Reis N, Thete MV, Arjun McKinney A, Kulkarni S, Panagiotakos G, Bassik MC, Pașca SP.
Show Full Abstract

The assembly of cortical circuits involves the generation and migration of interneurons from the ventral to the dorsal forebrain<sup>1-3</sup>, which has been challenging to study at inaccessible stages of late gestation and early postnatal human development<sup>4</sup>. Autism spectrum disorder and other neurodevelopmental disorders (NDDs) have been associated with abnormal cortical interneuron development<sup>5</sup>, but which of these NDD genes affect interneuron generation and migration, and how they mediate these effects remains unknown. We previously developed a platform to study interneuron development and migration in subpallial organoids and forebrain assembloids<sup>6</sup>. Here we integrate assembloids with CRISPR screening to investigate the involvement of 425 NDD genes in human interneuron development. The first screen aimed at interneuron generation revealed 13 candidate genes, including CSDE1 and SMAD4. We subsequently conducted an interneuron migration screen in more than 1,000 forebrain assembloids that identified 33 candidate genes, including cytoskeleton-related genes and the endoplasmic reticulum-related gene LNPK. We discovered that, during interneuron migration, the endoplasmic reticulum is displaced along the leading neuronal branch before nuclear translocation. LNPK deletion interfered with this endoplasmic reticulum displacement and resulted in abnormal migration. These results highlight the power of this CRISPR-assembloid platform to systematically map NDD genes onto human development and reveal disease mechanisms.

CSE1L
Also flagged:RBDREAMp53NSCLCp21RB1
Journal Article 2023-09-27 ✓ 5 Snippets Duan L, Tadi MJ, Maki CG.
In-Text Gene Mentions

In the current study we identified CSE1L as a novel inhibitor of RB-DREAM and target for its activation in p53 WT NSCLCs.

To test this, we first compared mRNA levels of CSE1L, AURKA, INCENP, MKI67, NUSAP1, and PLK1 in 9 p53 WT NSCLC cell lines using the Cancer Cell Line Encyclopedia (CCLE) RNAseq database (Fig. 5A).

High expression of CSE1L and DREAM target genes could serve as a biomarker to identify p53 wild-type NSCLCs most responsive to this HDAC1/2 inhibitor.

The results imply that a gene signature based on CSE1L and AURK pathway gene expression similar to the one we developed here could be used to identify p53 WT NSCLC tumors that will be most sensitive/responsive to mocetinostat plus PTX.

Results from the current study show CSE1L represses RB/RBL2 activity to maintain AURK pathway genes, and that CSE1L knockdown or mocetinostat treatment reverses these effects.

Show Full Abstract

P53 represses transcription by activating p21 expression and promoting formation of RB1-E2F1 and RBL1/RBL2-DREAM transcription repressor complexes. The DREAM complex is composed of DP1, RB-family proteins RBL1 or RBL2 (p107/p130), E2F4/5, and MuvB. We recently reported RBL2-DREAM contributes to improved therapy responses in p53 wild-type NSCLC cells and improved outcomes in NSCLC patients whose tumors express wild-type p53. In the current study we identified CSE1L as a novel inhibitor of the RBL2-DREAM pathway and target to activate RBL2-DREAM in NSCLC cells. CSE1L is an oncoprotein that maintains repression of genes that can be reactivated by HDAC inhibitors. Mocetinostat is a HDAC inhibitor in clinical trials with selectivity against HDACs 1 and 2. Knockdown of CSE1L in NSCLC cells or treatment with mocetinostat increased p21, activated RB1 and RBL2, repressed DREAM target genes, and induced toxicity in a manner that required wild-type p53. Lastly, we found high levels of CSE1L and specific DREAM-target genes are candidate markers to identify p53 wild-type NSCLCs most responsive to mocetinostat. Thus, we identified CSE1L as a critical negative regulator of the RB-DREAM pathway in p53 wild-type NSCLC that can be indirectly targeted with HDAC1/2 inhibitors (mocetinostat) in current clinical trials. High expression of CSE1L and DREAM target genes could serve as a biomarker to identify p53 wild-type NSCLCs most responsive to this HDAC1/2 inhibitor.

PRDX6
Also flagged:metabolic diseasesdioxinspolybrominated diphenyl etherswaterPFASdyslipidemia
Journal Article 2023-09-27 ✓ 1 Snippet Ho TC, Wan HT, Lee WK, Lam TKY, Lin X, Chan TF, Lai KP, Wong CKC.
In-Text Gene Mentions

…peroxiredoxin 6 (Prdx6) ( Figure…

Show Full Abstract

Prenatal exposure to perfluorooctanesulfonate (PFOS) increases fetus' metabolic risk; however, the investigation of the underlying mechanism is limited. In this study, pregnant mice in the gestational days (GD, 4.5-17.5) were exposed to PFOS (0.3 and 3 μg/g of body weight). At GD 17.5, PFOS perturbed maternal lipid metabolism and upregulated metabolism-regulating hepatokines (<i>Angptl4, Angptl8, and Selenop</i>). Mass-spectrometry imaging and whole-genome bisulfite sequencing revealed, respectively, selective PFOS localization and deregulation of gene methylation in fetal livers, involved in inflammation, glucose, and fatty acid metabolism. PCR and Western blot analysis of lipid-laden fetal livers showed activation of AMPK signaling, accompanied by significant increases in the expression of glucose transporters (<i>Glut2/4</i>), hexose-phosphate sensors (<i>Retsat</i> and <i>ChREBP</i>), and the key glycolytic enzyme, pyruvate kinase (<i>Pk</i>) for glucose catabolism. Additionally, PFOS modulated the expression levels of PPARα and PPARγ downstream target genes, which simultaneously stimulated fatty acid oxidation (<i>Cyp4a14, Acot</i>, and <i>Acox</i>) and lipogenesis (<i>Srebp1c</i>, <i>Acaca</i>, and <i>Fasn</i>). Using human normal hepatocyte (MIHA) cells, the underlying mechanism of PFOS-elicited nuclear translocation of ChREBP, associated with a fatty acid synthesizing pathway, was revealed. Our finding implies that <i>in utero</i> PFOS exposure altered the epigenetic landscape associated with dysregulation of fetal liver metabolism, predisposing postnatal susceptibility to metabolic challenges.

KLHL20
Also flagged:ALSAmyotrophic Lateral SclerosismetabolismSMNTDP-43FUS
Journal Article 2023-09-27 ✓ 1 Snippet Garcia-Vaquero ML, Heim M, Flix B, Pereira M, Palin L, Marques TM, Pinto FR, de Las Rivas J, Voigt A, Besse F, Gama-Carvalho M.
In-Text Gene Mentions

…(PAK1/2/3) and dbo (KLHL20indirect, via regulation…

Show Full Abstract

<h4>Background</h4>Spinal Muscular Atrophy (SMA) and Amyotrophic Lateral Sclerosis (ALS) share phenotypic and molecular commonalities, including the fact that they can be caused by mutations in ubiquitous proteins involved in RNA metabolism, namely SMN, TDP-43 and FUS. Although this suggests the existence of common disease mechanisms, there is currently no model to explain the resulting motor neuron dysfunction. In this work we generated a parallel set of Drosophila models for adult-onset RNAi and tagged neuronal expression of the fly orthologues of the three human proteins, named Smn, TBPH and Caz, respectively. We profiled nuclear and cytoplasmic bound mRNAs using a RIP-seq approach and characterized the transcriptome of the RNAi models by RNA-seq. To unravel the mechanisms underlying the common functional impact of these proteins on neuronal cells, we devised a computational approach based on the construction of a tissue-specific library of protein functional modules, selected by an overall impact score measuring the estimated extent of perturbation caused by each gene knockdown.<h4>Results</h4>Transcriptome analysis revealed that the three proteins do not bind to the same RNA molecules and that only a limited set of functionally unrelated transcripts is commonly affected by their knock-down. However, through our integrative approach we were able to identify a concerted effect on protein functional modules, albeit acting through distinct targets. Most strikingly, functional annotation revealed that these modules are involved in critical cellular pathways for motor neurons, including neuromuscular junction function. Furthermore, selected modules were found to be significantly enriched in orthologues of human neuronal disease genes.<h4>Conclusions</h4>The results presented here show that SMA and ALS disease-associated genes linked to RNA metabolism functionally converge on neuronal protein complexes, providing a new hypothesis to explain the common motor neuron phenotype. The functional modules identified represent promising biomarkers and therapeutic targets, namely given their alteration in asymptomatic settings.

TNFSF4
Also flagged:PI3KAKTtautauopathiesextracellularfocal adhesion kinase
Journal Article 2023-09-27 ✓ 1 Snippet Wang P, Anderson DE, Ye Y.
In-Text Gene Mentions

…pathway (Tnf, Tnfsf1b,Tnfsf4, Tnfsf8, Tnfsf9, Tnfsf15,…

Show Full Abstract

<h4>Background</h4>Microtubule-binding protein tau is a misfolding-prone protein associated with tauopathies. As tau undergoes cell-to-cell transmission, extracellular tau aggregates convert astrocytes into a pro-inflammatory state via integrin activation, causing them to release unknown neurotoxic factors.<h4>Results</h4>Here, we combine transcriptomics with isotope labeling-based quantitative mass spectrometry analysis of mouse primary astrocyte secretome to establish PI3K-AKT as a critical differentiator between pathogenic and physiological integrin activation; simultaneous activation of PI3K-AKT and focal adhesion kinase (FAK) in tau fibril-treated astrocytes changes the output of integrin signaling, causing pro-inflammatory gene upregulation, trans-Golgi network restructuring, and altered secretory flow. Furthermore, NCAM1, as a proximal signaling component in tau-stimulated integrin and PI3K-AKT activation, facilitates the secretion of complement C3 as a main neurotoxic factor. Significantly, tau fibrils-associated astrogliosis and C3 secretion can be mitigated by FAK or PI3K inhibitors.<h4>Conclusions</h4>These findings reveal an unexpected function for PI3K-AKT in tauopathy-associated reactive astrogliosis, which may be a promising target for anti-inflammation-based Alzheimer's therapy.

SOX6
Also flagged:lysyl oxidasepreadipocyte factor 1energy homeostasissex-determining region Y (SRY)-box6transcription factorbinding
Journal Article 2023-09-27 ✓ 5 Snippets Du SY, Hu L, Zhou BH, Zhang Z, Li MC, Chang D, Xu CJ, Dou X.
In-Text Gene Mentions

Our findings suggest that Sox6 is a key regulator of MSC commitment to adipocytes; therefore, targeting the Sox6-mediated regulation of this process could offer potential therapeutic avenues for addressing obesity and related metabolic disorders.

Sox6impairs the adipogenic…

…the role ofSox6sex-determining region Y…

…region Y (SRY)-box6 (Sox6), a transcription factor…

…the role ofSox6in regulating the…

Show Full Abstract

The commitment of mesenchymal stem cells (MSCs) to preadipocytes and the termination of differentiation to adipocytes are critical for maintaining systemic energy homeostasis. However, our knowledge of the molecular mechanisms governing the commitment of MSCs to preadipocytes and the subsequent termination of their differentiation into adipocytes remain limited. Additionally, the role of Sox6 sex-determining region Y (SRY)-box6 (Sox6), a transcription factor that regulates gene transcription, is reportedly involved in various cellular processes, including adipogenesis; however, its function in regulating preadipocyte development and the factors involved in the termination of adipogenic differentiation remain unexplored. Therefore, we investigated the role of Sox6 in regulating the differentiation of adipocytes by monitoring the effects of its overexpression in C3H10T1/2 cells (in vitro) and C57BL/6J mouse (in vivo) models of adipogenesis. We observed lower Sox6 expression in the adipose tissue of obese mice than that in control mice. Sox6 overexpression inhibited the differentiation of MSC by directly binding to the lysyl oxidase (Lox) and preadipocyte factor 1 (Pref1) promoters, which was potentiated by histone deacetylase-1(HDAC1). Our findings suggest that Sox6 is a key regulator of MSC commitment to adipocytes; therefore, targeting the Sox6-mediated regulation of this process could offer potential therapeutic avenues for addressing obesity and related metabolic disorders.

Also flagged:oxaliplatingallbladder cancergene expressionP-glycoproteinPD-L1ERK1
Journal Article 2023-09-27 No Snippets Guo H, Zhi Y, Wang K, Li N, Yu D, Ji Z, Chen B.
Show Full Abstract

Acquired resistance to chemotherapeutic drugs in gallbladder cancer (GBC) results in therapy failure. This study is aimed to establish oxaliplatin (OXA)-resistant GBC cell lines and uncover their gene expression profiles. First, two OXA-resistant GBC cell lines (GBC-SD/OXA and SGC996/OXA) were established by gradually increasing the drug concentration, and the resistance index was 4-5. The two resistant cell lines showed slower proliferation and higher stemness, colony formation, and migration abilities. Epithelial mesenchymal transformation and increased levels of P-glycoprotein were also detected. Next RNA-sequence analysis identified 4,675 dysregulated genes (DGs) in resistant cells, and most of the 12 randomly selected DGs were verified to be consistent with the sequence results. Kyoto Encyclopedia of Genes and Genomes analysis indicated that several DGs were involved in resistance- and phenotype-related pathways, of which the activations of PD-L1 and ERK1/2 were both verified in resistant cell lines. In conclusion, this study is the first to report the gene expression profile of OXA-resistant GBC cells and provides a useful database for target development.

DCC
Also flagged:c-Kit Receptorstype III receptor tyrosine kinasehematopoiesisc-KITpathogenesiscancers
Journal Article 2023-09-27 ✓ 1 Snippet Abdellateif MS, Bayoumi AK, Mohammed MA.
In-Text Gene Mentions

It can present in children as a cutaneous lesion, which undergoes spontaneous regression at puberty, whereas it commonly presents in adults as a more aggressive systemic MC that can lead to multiorgan failure.154,155 More than 90% of systemic MC in adults is associated with c-KIT missense mutations affecting exon 17, codon 816, in which aspartate is substituted by valine (KIT D816V).5 This mutation (KIT D816V) renders c-KIT 586-fold more active than the native c-KIT, which is responsible for imatinib resistance and a poor clinical prognosis.70,71 Similarly, the D816V mutation is detected in 42% of children with systemic MC.16 Other less frequent types of c-KIT mutation that occur in systemic MC and are imatinib sensitive include those occurring in exons 17 and 18 (eg D820G or N822I/K), exon 10 (eg F522C), exon 11 (eg V560G/I), exon 8 (eg deletion of codon 419), and/or exon 9 (deletion of codon p.A502_Y503dup).72 Therefore, the treatment of MC is highly individualized according to the type of mutation detected.154 Patients who have the KIT D816V mutation, which is the most common oncogenic driver for MC, usually experience primary resistance to the TKIs imatinib and masitinib.156,157 Similarly, nilotinib and dasatinib have low clinical significance for these patients.158,159 Imatinib is currently approved by the US FDA for patients with systemic MC who are negative for KIT D816V, have unknown KIT mutation status, or have the previously mentioned imatinib-sensitive KIT mutations.160 Midostaurin is a multikinase/KIT inhibitor that confers a suppressive activity against D816V mutant MC.74 It is approved by the FDA, the European Medicines Agency (EMA), and Agenzia Italiana del Farmaco (AIFA) as a targeted therapy for the treatment of patients with advanced systemic MC, indolent systemic MC, and severe MC mediator-release symptoms (MCMRS).7,75 It is also approved as a first-line treatment for patients with mast cell leukemia (MCL), or as a maintenance therapy after allogeneic stem cell transplantation (ASCT).161 Another available drug that is approved by the FDA and EMA for the treatment of advanced systemic MC is avapritinib.74 Avapritinib is a small molecule kinase inhibitor of the activation-loop mutations of c-KIT, including KIT D816V.74 Another investigational drug that is now under trial (NCT02571036) for the treatment of MC is ripretinib (DCC-2618), which is a type II switch pocket control inhibitor of c-KIT exon 17.76

Show Full Abstract

c-Kit is a type III receptor tyrosine kinase (RTK) that has an essential role in various biological functions including gametogenesis, melanogenesis, hematopoiesis, cell survival, and apoptosis. c-KIT aberrations, either overexpression or loss-of-function mutations, have been implicated in the pathogenesis and development of many cancers, including gastrointestinal stromal tumors, mastocytosis, acute myeloid leukemia, breast, thyroid, and colorectal cancer, making c-KIT an attractive molecular target for the treatment of cancers. Therefore, a lot of effort has been put into investigating the utility of tyrosine kinase inhibitors for the management of c-KIT mutated tumors. This review of the literature illustrates the role of c-KIT mutations in many cancers, aiming to provide insights into the role of TKIs as a therapeutic option for cancer patients with c-KIT aberrations. In conclusion, c-KIT is implicated in different types of cancer, and it could be a successful molecular target; however, proper detection of the underlying mutation type is required before starting the appropriate personalized therapy.

PRDX6
Also flagged:Phosphofructokinase-LPhosphofructokinasePFKLamino acidscarbohydratecitrate
Journal Article 2023-09-27 ✓ 1 Snippet Sivadas A, McDonald EF, Shuster SO, Davis CM, Plate L.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Phosphofructokinase is the central enzyme in glycolysis and constitutes a highly regulated step. The liver isoform (PFKL) compartmentalizes during activation and inhibition in vitro and in vivo, respectively. Compartmentalized PFKL is hypothesized to modulate metabolic flux consistent with its central role as the rate limiting step in glycolysis. PFKL tetramers self-assemble at two interfaces in the monomer (interface 1 and 2), yet how these interfaces contribute to PFKL compartmentalization and drive protein interactions remains unclear. Here, we used site-specific incorporation of noncanonical photocrosslinking amino acids to identify PFKL interactors at interface 1, 2, and the active site. Tandem mass tag-based quantitative interactomics reveals interface 2 as a hotspot for PFKL interactions, particularly with cytoskeletal, glycolytic, and carbohydrate derivative metabolic proteins. Furthermore, PFKL compartmentalization into puncta was observed in human cells using citrate inhibition. Puncta formation attenuated crosslinked protein-protein interactions with the cytoskeleton at interface 2. This result suggests that PFKL compartmentalization sequesters interface 2, but not interface 1, and may modulate associated protein assemblies with the cytoskeleton.

HFE
Also flagged:fatty liver diseasetype 2 diabetes mellitusdiabetic peripheral neuropathydysfunction-associated fatty liver diseasediabetic retinopathytriglyceride
Journal Article 2023-09-27 ✓ 1 Snippet Dang SW, Gao L, Li YJ, Zhang R, Xu J.
In-Text Gene Mentions

…hyroidism, Cushing’s syndrome,hemochromatosis; (VII) participation in…

Show Full Abstract

<h4>Aim</h4>To assess the metabolic characteristics of non-obese metabolic dysfunction-associated fatty liver disease (MAFLD) compared with obese MAFLD and the relationship of MAFLD with diabetic peripheral neuropathy and diabetic retinopathy in patients with Type 2 diabetes mellitus (T2DM).<h4>Methods</h4>Data were obtained from 536 T2DM patients (355 women, 181 men; age 58.2 ± 12.0 years). We explored the difference in clinical characteristics between obese MAFLD (body mass index ≥25 kg/m<sup>2</sup>) and non-obese MAFLD (body mass index <25 kg/m<sup>2</sup>) in T2DM patients. One-way analysis of variance (ANOVA) was used to compare the means of continuous variables, and the Chi-squared test was used to compare the differences in frequencies of categorical variables. Logistic regression models were adopted to calculate odds ratios.<h4>Results</h4>The prevalence of MAFLD in hospitalized Chinese T2DM patients was calculated to be 42.7%. Both obese and non-obese MAFLD patients had higher levels of body mass index (BMI), waist circumfere nce, triglyceride, alanine aminotransferase, aspar tate aminotransferase, γ-glutamyltransferase, you nger age, higher prevalence of hyperlipidemia and shorter duration of T2DM and lower incidence of diabetic retinopathy, compared with participants with out MAFLD in the same weight group. Uric acid levels were positively correlated with the risk of MAFLD only in non-obese subjects but not in obese subjects. In non-obese patients with T2DM, a negative correlation was found between the prevalence of MAFLD and diabetic retinopathy.<h4>Conclusion</h4>Even in non-obese patients with T2DM, BMI was found to be an independent risk factor for MAFLD. These findings support a more structured, risk-factor-based approach to MAFLD management, particularly in patients with T2DM. Non-obese MAFLD has unique results in metabolic characteristics and the correlation with diabetic retinopathy and diabetic peripheral neuropathy, which should be further explored.

SERPINC1
Also flagged:thrombotic microangiopathyantithrombin deficiencydiabetesdeficiencyantithrombin-III deficiencymicroangiopathic hemolytic anemia
Journal Article 2023-09-27 ✓ 5 Snippets Li B, Zhang X, Lv H, Yang X, Gao Y, Hu Z, Ma C.
In-Text Gene Mentions

Case report: A case of new mutation in <i>SERPINC1</i> leading to thrombotic microangiopathy.

…caused by decreasedantithrombin-IIIactivity due to…

…secondary to hereditaryantithrombin-IIIdeficiency.…

…repeated findings ofantithrombin-IIIactivity less than…

…new mutation inSERPINC1leading to thrombotic…

Show Full Abstract

<b>Introduction:</b> Hereditary antithrombin-III deficiency can significantly increase the risk for thrombosis, which is common in limb deep vein and pulmonary cases. However, thrombotic microangiopathy (TMA) caused by hereditary antithrombin deficiency is rare. <b>Case Presentation:</b> We reported the case of a 32-year-old Chinese female patient with TMA with renal injury caused by decreased antithrombin-III activity due to a new mutation (chr1-173884049 c.50A>G) in <i>SERPINC1</i>, which encodes antithrombin-III. In this case, the patient had no history of relevant drug use, diabetes, or monoclonal plasma cells in the bone marrow puncture. Consequently, TMA of the kidney was considered secondary to hereditary antithrombin-III deficiency. Gene detection was the only clue that led us to suspect that TMA was caused by hereditary antithrombin deficiency. <b>Conclusion:</b> Our findings indicated that for patients with repeated findings of antithrombin-III activity less than 50%, the possibility of antithrombin-III deficiency and complete gene detection must be considered immediately after excluding the use of anticoagulants and lack of availability to facilitate early detection, diagnosis, and intervention.

HFE
Also flagged:16S16S rRNApeptidespolyunsaturated fatty acidsmineralspolysaccharides
Journal Article 2023-09-27 ✓ 1 Snippet Cabrita ARJ, Guilherme-Fernandes J, Spínola M, Maia MRG, Yergaliyev T, Camarinha-Silva A, Fonseca AJM.
In-Text Gene Mentions

…hepatocytes can causehemochromatosis, fibrosis and cirrhosis,…

Show Full Abstract

The current trend of dog owners increasingly favoring the functional value of food to assure preventive health and wellbeing of their pets has been raising the interest in microalgae as natural additives with bioactive properties. However, scientific studies addressing the effects of microalgae supplementation in diets for dogs are scarce. This study aimed to evaluate the effects of dietary supplementation with three microalgae species (<i>Chlorella vulgaris</i>, <i>Nannochloropsis oceanica</i>, and <i>Tetradesmus obliquus</i>) on diet palatability, total tract digestibility, metabolizable energy content, fecal metabolites and microbiota of dogs. Twelve adult Beagle dogs were used in three two-bowl tests to compare the palatability of a commercial complete diet for adult dogs without (reference diet) and with 1.5% supplementation of each microalgae. From the results obtained, three digestibility trials were performed according to a replicated Latin square 3 × 3, with six adult Beagle dogs, three experimental periods of 10 days each, and three dietary supplementation levels of microalgae (0.5, 1.0, and 1.5%). In each trial, effects of microalgae supplementation levels on total tract digestibility, metabolizable energy content, fecal metabolites and microbiota of dogs were evaluated. First diet approached or tasted was not significantly affected by microalgae inclusion, but dogs showed a preference for the reference diet over the diets with 1.5% inclusion of <i>C. vulgaris</i> and <i>N. oceanica</i>, no difference being observed with 1.5% <i>T. obliquus</i>. In all digestibility trials, dietary supplementation with microalgae up to 1.5% did not greatly affected the dietary chemical composition and kept unaffected food intake, fecal output and metabolites, and digestibility of nutrients and energy. Compared with the reference diet, supplementation with <i>C. vulgaris</i> increased protein digestibility. Fecal characteristics and metabolites were affected by microalgae supplementation, being the effects dependent on the species. Fecal microbiota composition of dogs fed with microalgae-supplemented diets was modified by promoting the beneficial <i>Turicibacter</i> and <i>Peptococcus</i> genera associated with gut health and activation of the immune system. Overall, the results support <i>C. vulgaris</i>, <i>N. oceanica</i>, and <i>T. obliquus</i> as sustainable functional supplements that potentially enhance gastrointestinal health of dogs through the selective stimulation of microbiota without detrimental effects on food intake and digestibility.

DCC
Also flagged:Syntaxin-1UNC5A-CNetrin-1axonalaxonsgrowth cones
Journal Article 2023-09-27 ✓ 5 Snippets Martínez-Mármol R, Muhaisen A, Cotrufo T, Roselló-Busquets C, Ros O, Hernaiz-Llorens M, Pérez-Branguli F, Andrés RM, Parcerisas A, Pascual M, Ulloa F, Soriano E.
In-Text Gene Mentions

…in Colorectal Cancer (DCC) receptors ( Keino-Masu…

…al., 1996 ), Neogenin/DCClike molecule (…

…UNC5 and eitherDCCor DSCAM receptors…

…of its receptorDCCto the plasma…

…directly interacts withDCCand is required…

Show Full Abstract

<h4>Introduction</h4>Brain connectivity requires correct axonal guidance to drive axons to their appropriate targets. This process is orchestrated by guidance cues that exert attraction or repulsion to developing axons. However, the intricacies of the cellular machinery responsible for the correct response of growth cones are just being unveiled. Netrin-1 is a bifunctional molecule involved in axon pathfinding and cell migration that induces repulsion during postnatal cerebellar development. This process is mediated by UNC5 homolog receptors located on external granule layer (EGL) tracts.<h4>Methods</h4>Biochemical, imaging and cell biology techniques, as well as syntaxin-1A/B (Stx1A/B) knock-out mice were used in primary cultures and brain explants.<h4>Results and discussion</h4>Here, we demonstrate that this response is characterized by enhanced membrane internalization through macropinocytosis, but not clathrin-mediated endocytosis. We show that UNC5A, UNC5B, and UNC5C receptors form a protein complex with the t-SNARE syntaxin-1. By combining botulinum neurotoxins, an shRNA knock-down strategy and Stx1 knock-out mice, we demonstrate that this SNARE protein is required for Netrin1-induced macropinocytosis and chemorepulsion, suggesting that Stx1 is crucial in regulating Netrin-1-mediated axonal guidance.

CACNA1E
Also flagged:Epilepsyneurological disorderdevelopmental delayhead injurystrokeepilepsies
Journal Article 2023-09-27 ✓ 2 Snippets Rastin C, Schenkel LC, Sadikovic B.
In-Text Gene Mentions

In a retrospective study of nearly 2000 patients with neurodevelopmental disorders and with epilepsy, 33 genes were observed to have significant enrichment of de novo variants, three of which had limited or no previous evidence of disease association: CACNA1E, SNAP25, and GABRB2 [9].

…of disease association:CACNA1E, SNAP25 ,…

Show Full Abstract

Epilepsy is a highly prevalent neurological disorder, affecting between 5-8 per 1000 individuals and is associated with a lifetime risk of up to 3%. In addition to high incidence, epilepsy is a highly heterogeneous disorder, with variation including, but not limited to the following: severity, age of onset, type of seizure, developmental delay, drug responsiveness, and other comorbidities. Variable phenotypes are reflected in a range of etiologies including genetic, infectious, metabolic, immune, acquired/structural (resulting from, for example, a severe head injury or stroke), or idiopathic. This review will focus specifically on epilepsies with a genetic cause, genetic testing, and biomarkers in epilepsy.

Also flagged:Gene Expressiondifferentiationovariogenesistestis developmentcell proliferationcoagulation
Journal Article 2023-09-27 No Snippets Luo H, Zhou H, Jiang S, He C, Xu K, Ding J, Liu J, Qin C, Chen K, Zhou W, Wang L, Yang W, Zhu W, Meng H.
Show Full Abstract

Despite the notable progress made in recent years, the understanding of the genetic control of gonadal sex differentiation and asymmetrical ovariogenesis in chicken during embryonic development remains incomplete. This study aimed to identify potential key genes and speculate about the mechanisms associated with ovary and testis development via an analysis of the results of PacBio and Illumina transcriptome sequencing of embryonic chicken gonads at the initiation of sexual differentiation (E4.5, E5.5, and E6.5). PacBio sequencing detected 328 and 233 significantly up-regulated transcript isoforms in females and males at E4.5, respectively. Illumina sequencing detected 95, 296 and 445 DEGs at E4.5, E5.5, and E6.5, respectively. Moreover, both sexes showed asymmetrical expression in gonads, and more DEGs were detected on the left side. There were 12 DEGs involved in cell proliferation shared between males and females in the left gonads. GO analysis suggested that coagulation pathways may be involved in the degradation of the right gonad in females and that blood oxygen transport pathways may be involved in preventing the degradation of the right gonad in males. These results provide a comprehensive expression profile of chicken embryo gonads at the initiation of sexual differentiation, which can serve as a theoretical basis for further understanding the mechanism of bird sex determination and its evolutionary process.

DCC
Also flagged:ClusterinColorectal cancercancerlung cancerCLUchaperone
Journal Article 2023-09-27 ✓ 1 Snippet Téllez T, Martin-García D, Redondo M, García-Aranda M.
In-Text Gene Mentions

While transformation from adenoma to carcinoma is usually caused by mutations in TP53, K-RAS and DCC 18q genes [64], progression to metastasis is normally associated with the accumulation of genetic changes in APC-KRAS-TP53 (Adenomatous Polyposis Coli–Kirsten rat sarcoma viral oncogene- the tumor suppressor p53), according to the Vogelstein model [65].

Show Full Abstract

Colorectal cancer is the third most diagnosed cancer, behind only breast and lung cancer. In terms of overall mortality, it ranks second due to, among other factors, problems with screening programs, which means that one of the factors that directly impacts survival and treatment success is early detection of the disease. Clusterin (CLU) is a molecular chaperone that has been linked to tumorigenesis, cancer progression and resistance to anticancer treatments, which has made it a promising drug target. However, it is still necessary to continue this line of research and to adjust the situations in which its use is more favorable. The aim of this paper is to review the current genetic knowledge on the role of CLU in tumorigenesis and cancer progression in general, and discuss its possible use as a therapeutic target in colorectal cancer.

Also flagged:ProteasesProteasepeptidesdigestionlactationCathepsin D
Journal Article 2023-09-27 No Snippets Thesbjerg MN, Nielsen SD, Sundekilde UK, Poulsen NA, Larsen LB.
Show Full Abstract

The presence of proteases and their resulting level of activity on human milk (HM) proteins may aid in the generation of indigenous peptides as part of a pre-digestion process, of which some have potential bioactivity for the infant. The present study investigated the relative abundance of indigenous peptides and their cleavage products in relation to the abundance of observed proteases and protease inhibitors. The proteomes and peptidomes in twelve HM samples, representing six donors at lactation months 1 and 3, were profiled. In the proteome, 39 proteases and 29 protease inhibitors were identified in 2/3 of the samples. Cathepsin D was found to be present in higher abundance in the proteome compared with plasmin, while peptides originating from plasmin cleavage were more abundant than peptides from cathepsin D cleavage. As both proteases are present as a system of pro- and active- forms, their activation indexes were calculated. Plasmin was more active in lactation month 3 than month 1, which correlated with the total relative abundance of the cleavage product ascribed to plasmin. By searching the identified indigenous peptides in the milk bioactive peptide database, 283 peptides were ascribed to 10 groups of bioactivities. Antimicrobial peptides were significantly more abundant in month 1 than month 3; this group comprised 103 peptides, originating from the β-CN C-terminal region.

Also flagged:secretionmetabolic disorderspathogenesismetabolismmetabolic diseasesobesity
Journal Article 2023-09-27 No Snippets Ford H, Liu Q, Fu X, Strieder-Barboza C.
Show Full Abstract

Adipose tissue is a major modulator of metabolic function by regulating energy storage and by acting as an endocrine organ through the secretion of adipokines. With the advantage of next-generation sequencing-based single-cell technologies, adipose tissue has been studied at single-cell resolution, thus providing unbiased insight into its molecular composition. Recent single-cell RNA sequencing studies in human and mouse models have dissected the transcriptional cellular heterogeneity of subcutaneous (SAT), visceral (VAT), and intramuscular (IMAT) white adipose tissue depots and revealed unique populations of adipose tissue progenitor cells, mature adipocytes, immune cell, vascular cells, and mesothelial cells that play direct roles on adipose tissue function and the development of metabolic disorders. In livestock species, especially in bovine, significant gaps of knowledge remain in elucidating the roles of adipose tissue cell types and depots on driving the pathogenesis of metabolic disorders and the distinct fat deposition in VAT, SAT, and IMAT in meat animals. This review summarizes the current knowledge on the transcriptional and functional cellular diversity of white adipose tissue revealed by single-cell approaches and highlights the depot-specific function of adipose tissue in different mammalian species, with a particular focus on recent findings and future implications in cattle.

Also flagged:Bloodstream infectioninfectionpolymeraseagarosealbuminBSA
Journal Article 2023-09-27 No Snippets Wang R, Liu Y, Chen S, Bai L, Guo K, Pang Y, Qian F, Li Y, Ding L, Wang Y.
Show Full Abstract

Bloodstream infection is a major health problem worldwide, with extremely high mortality. Detecting infection in the early stage is challenging due to the extremely low concentration of bacteria in the blood. Digital PCR provides unparalleled sensitivity and can achieve absolute quantification, but it is time-consuming. Moreover, the presence of unavoidable background signals in negative controls poses a significant challenge for single-molecule detection. Here, we propose a novel strategy called "Ultrafast flexible thin tube-based droplet digital PCR (utPCR)" that can shorten the digital PCR process from 2 h to only 5 min, with primer annealing/extension time reduced from minutes to only 5 s. Importantly, the ultrafast PCR eliminates nonspecific amplification and thus enables single-molecule detection. The utPCR enabled the sensitive detection and digital quantification of <i>E. coli</i> O157 in the high background of a 10<sup>6</sup>-fold excess of <i>E. coli</i> K12 cells. Moreover, this method also displayed the potential to detect rare pathogens in blood samples, and the limit of detection (LOD) could be as low as 10 CFU per mL of blood without false positive results. Considered ultrafast (<5 min) and highly sensitive (single-molecule detection), the utPCR holds excellent prospects in the next generation of molecular diagnosis.

SERPINC1
Also flagged:Infertilitymale infertilityanxietydepressionIDAcrosin
Journal Article 2023-09-27 ✓ 2 Snippets Pacheco RI, Cristo MI, Anjo SI, Silva AF, Sousa MI, Tavares RS, Sousa AP, Almeida Santos T, Moura-Ramos M, Caramelo F, Manadas B, Ramalho-Santos J, Amaral SG.
In-Text Gene Mentions

…1-antitrypsin (A1AT/SERPINA1),antithrombin-III(ANT3/SERPINC1), ANXA2 and…

…INA1), antithrombin-III (ANT3/SERPINC1), ANXA2 and clusterin,…

Show Full Abstract

The global trend of rising (male) infertility is concerning, and the unidentifiable causes in half of the cases, the so-called unknown origin male infertility (UOMI), demands a better understanding and assessment of both external/internal factors and mechanisms potentially involved. In this work, it was our aim to obtain new insight on UOMI, specifically on idiopathic (ID) and Unexplained male infertility (UMI), relying on a detailed evaluation of the male gamete, including functional, metabolic and proteomic aspects. For this purpose, 1114 semen samples, from males in couples seeking infertility treatment, were collected at the Reproductive Medicine Unit from the Centro Hospitalar e Universitário de Coimbra (CHUC), from July 2018-July 2022. Based on the couples' clinical data, seminal/hormonal analysis, and strict eligibility criteria, samples were categorized in 3 groups, control (CTRL), ID and UMI. Lifestyle factors and anxiety/depression symptoms were assessed via survey. Sperm samples were evaluated functionally, mitochondrially and using proteomics. The results of Assisted Reproduction Techniques were assessed whenever available. According to our results, ID patients presented the worst sperm functional profile, while UMI patients were similar to controls. The proteomic analysis revealed 145 differentially expressed proteins, 8 of which were specifically altered in ID and UMI samples. Acrosin (ACRO) and sperm acrosome membrane-associated protein 4 (SACA4) were downregulated in ID patients while laminin subunit beta-2 (LAMB2), mannose 6-phosphate isomerase (MPI), ATP-dependent 6-phosphofructokinase liver type (PFKAL), STAR domain-containing protein 10 (STA10), serotransferrin (TRFE) and exportin-2 (XPO2) were downregulated in UMI patients. Using random forest analysis, SACA4 and LAMB2 were identified as the sperm proteins with a higher chance of distinguishing ID and UMI patients, and their function and expression variation were in accordance with the functional results. No alterations were observed in terms of lifestyle and psychological factors among the 3 groups. These findings obtained in an experimental setting based on 3 well-defined groups of subjects, might help to validate new biomarkers for unknown origin male infertility (ID and UMI) that, in the future, can be used to improve diagnostics and treatments.

Also flagged:steroidnephrotic syndromesteroid-sensitive nephrotic syndromeHLA-DQA1HLA-DQB1GSDMA
Journal Article 2023-09-27 No Snippets Chan H, Ni F, Zhao B, Jiang H, Ding J, Wang L, Wang X, Cui J, Feng S, Gao X, Yang X, Chi H, Lee H, Chen X, Li X, Jiao J, Wu D, Zhang G, Wang M, Cun Y, Ruan X, Yang H, Li Q.
Show Full Abstract

Dissecting the genetic components that contribute to the two main subphenotypes of steroid-sensitive nephrotic syndrome (SSNS) using genome-wide association studies (GWAS) strategy is important for understanding the disease. We conducted a multicenter cohort study (360 patients and 1835 controls) combined with a GWAS strategy to identify susceptibility variants associated with the following two subphenotypes of SSNS: steroid-sensitive nephrotic syndrome without relapse (SSNSWR, 181 patients) and steroid-dependent/frequent relapse nephrotic syndrome (SDNS/FRNS, 179 patients). The distribution of two single-nucleotide polymorphisms (SNPs) in <i>ANKRD36</i> and <i>ALPG</i> was significant between SSNSWR and healthy controls, and that of two SNPs in <i>GAD1</i> and <i>HLA-DQA1</i> was significant between SDNS/FRNS and healthy controls. Interestingly, rs1047989 in <i>HLA-DQA1</i> was a candidate locus for SDNS/FRNS but not for SSNSWR. No significant SNPs were observed between SSNSWR and SDNS/FRNS. Meanwhile, chromosome 2:171713702 in <i>GAD1</i> was associated with a greater steroid dose (>0.75 mg/kg/d) upon relapse to first remission in patients with SDNS/FRNS (odds ratio = 3.14; 95% confidence interval, 0.97-9.87; <i>P</i> = 0.034). rs117014418 in <i>APOL4</i> was significantly associated with a decrease in eGFR of greater than 20% compared with the baseline in SDNS/FRNS patients (<i>P</i> = 0.0001). Protein-protein intersection network construction suggested that HLA-DQA1 and HLA-DQB1 function together through GSDMA. Thus, SSNSWR belongs to non-HLA region-dependent nephropathy, and the HLA-DQA/DQB region is likely strongly associated with disease relapse, especially in SDNS/FRNS. The study provides a novel approach for the GWAS strategy of SSNS and contributes to our understanding of the pathological mechanisms of SSNSWR and SDNS/FRNS.

Research Square 2023-09-27 Preprint (No Snippets API) Sheikh JA, Akhter H, Mustafa F.
Show Full Abstract

This paper investigates and studies the Cell Free massive Multiple Input Multiple Output ( MIMO ) in which Access pints are aided by the optimized multiple antenna system. The proposed cell-free network has the ability to address many of the interference problems that currently affect cellular networks. More importantly in such networks a major issue and the research problem is to practically achieve cell free operation and desired computing efficiency. Fronthaul needs and scalability for larger networks are other challenges which needs due consideration. To address such challenging issues, we incorporate the concept of dynamic cooperation cluster to develop a new framework for scalable CF-Massive-MIMO system. The A* Algorithm has been exploited to enhance the signal-to-noise-plus-interference ratio (SNIR), capacity and throughput. Moreover, the traditional channel estimation, pre-coding, and combining techniques have also been scaled in the proposed technique. A new Uplink and Downlink duality based on vector combining is demonstrated for the heuristic creation of precoding vectors.

GPR52
Also flagged:orphan G protein-coupled receptorsschizophreniadopamineG protein-coupled receptorsGPCRsGPCR
Journal Article 2023-09-26 ✓ 2 Snippets Lu Y, Hatzipantelis CJ, Langmead CJ, Stewart GD.
In-Text Gene Mentions

This review discusses centrally expressed orphan GPCRs: GPR3, GPR6, GPR12, GPR52, GPR85, GPR88 and GPR139 and their relationship to schizophrenia.

…GPR3, GPR6, GPR12,GPR52, GPR85, GPR88 and…

Show Full Abstract

Schizophrenia remains a sizable socio-economic burden that continues to be treated with therapeutics based on 70-year old science. All currently approved therapeutics primarily target the dopamine D<sub>2</sub> receptor to achieve their efficacy. Whilst dopaminergic dysregulation is a key feature in this disorder, the targeting of dopaminergic machinery has yielded limited efficacy and an appreciable side effect burden. Over the recent decades, numerous drugs that engage non-dopaminergic G protein-coupled receptors (GPCRs) have yielded a promise of efficacy without the deleterious side effect profile, yet none have successfully completed clinical studies and progressed to the market. More recently, there has been increased attention around non-dopaminergic GPCR-targeting drugs, which demonstrated efficacy in some schizophrenia symptom domains. This provides renewed hope that effective schizophrenia treatment may lie outside of the dopaminergic space. Despite the potential for muscarinic receptor- (and other well-characterised GPCR families) targeting drugs to treat schizophrenia, they are often plagued with complications such as lack of receptor subtype selectivity and peripheral on-target side effects. Orphan GPCR studies have opened a new avenue of exploration with many demonstrating schizophrenia-relevant mechanisms and a favourable expression profile, thus offering potential for novel drug development. This review discusses centrally expressed orphan GPCRs: GPR3, GPR6, GPR12, GPR52, GPR85, GPR88 and GPR139 and their relationship to schizophrenia. We review their expression, signalling mechanisms and cellular function, in conjunction with small molecule development and structural insights. We seek to provide a snapshot of the growing evidence and development potential of new classes of schizophrenia therapeutics. LINKED ARTICLES: This article is part of a themed issue Therapeutic Targeting of G Protein-Coupled Receptors: hot topics from the Australasian Society of Clinical and Experimental Pharmacologists and Toxicologists 2021 Virtual Annual Scientific Meeting. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v181.14/issuetoc.

HFE
Also flagged:ironneurological diseasesmitochondrialcytochrome CNrf2nuclear factor-erythroid 2 related factor
Journal Article 2023-09-26 ✓ 5 Snippets Helmuth TB, Kumari R, Palsa K, Neely EB, Slagle-Webb B, Simon SD, Connor JR.
In-Text Gene Mentions

…of the H63DHFEmutation in a…

…Mutation in theHFEGene Modifies Recovery…

…iron regulatory (HFE )) gene, prevalent…

…murine homolog, H67DHFE, on ICH.…

HFE

Show Full Abstract

<h4>Background</h4>Intracerebral hemorrhage (ICH) is characterized by bleeding into the brain parenchyma. During an ICH, iron released from the breakdown of hemoglobin creates a cytotoxic environment in the brain through increased oxidative stress. Interestingly, the loss of iron homeostasis is associated with the pathological process of other neurological diseases. However, we have previously shown that the H63D mutation in the homeostatic iron regulatory (<i>HFE</i>) gene, prevalent in 28% of the White population in the United States, acts as a disease modifier by limiting oxidative stress. The following study aims to examine the effects of the murine homolog, H67D HFE, on ICH.<h4>Methods</h4>An autologous blood infusion model was utilized to create an ICH in the right striatum of H67D and wild-type mice. The motor recovery of each animal was assessed by rotarod. Neurodegeneration was measured using fluorojade-B and mitochondrial damage was assessed by immunofluorescent numbers of CytC+ (cytochrome C) neurons and CytC+ astrocytes. Finally, the molecular antioxidant response to ICH was quantified by measuring Nrf2 (nuclear factor-erythroid 2 related factor), GPX4 (glutathione peroxidase 4), and FTH1 (H-ferritin) levels in the ICH-affected and nonaffected hemispheres via immunoblotting.<h4>Results</h4>At 3 days post-ICH, H67D mice demonstrated enhanced performance on rotarod compared with wild-type animals despite no differences in lesion size. Additionally, H67D mice displayed higher levels of Nrf2, GPX4, and FTH1 in the ICH-affected hemisphere; however, these levels were not different in the contralateral, non-ICH-affected hemisphere. Furthermore, H67D mice showed decreased degenerated neurons, CytC+ Neurons, and CytC+ astrocytes in the perihematomal area.<h4>Conclusions</h4>Our data suggest that the H67D mutation induces a robust antioxidant response 3 days following ICH through Nrf2, GPX4, and FTH1 activation. This activation could explain the decrease in degenerated neurons, CytC+ neurons, and CytC+ astrocytes in the perihematomal region, leading to the improved motor recovery. Based on this study, further investigation into the mechanisms of this neuroprotective response and the effects of the H63D HFE mutation in a population of patients with ICH is warranted.

OLFM4
Also flagged:Gene Expressionpathogenesiscardiomyopathychildhood canceranthracyclinesanthracycline
Journal Article 2023-09-26 ✓ 1 Snippet Singh P, Shah DA, Jouni M, Cejas RB, Crossman DK, Magdy T, Qiu S, Wang X, Zhou L, Sharafeldin N, Hageman L, McKenna DE, Armenian SH, Balis FM, Hawkins DS, Keller FG, Hudson MM, Neglia JP, Ritchey AK, Ginsberg JP, Landier W, Bhatia R, Burridge PW, Bhatia S.
In-Text Gene Mentions

…, MMP8 ,OLFM4, ENSG00000274173 ,…

Show Full Abstract

Background Anthracycline-induced cardiomyopathy is a leading cause of premature death in childhood cancer survivors, presenting a need to understand the underlying pathogenesis. We sought to examine differential blood-based mRNA expression profiles in anthracycline-exposed childhood cancer survivors with and without cardiomyopathy. Methods and Results We designed a matched case-control study (Children's Oncology Group-ALTE03N1) with mRNA sequencing on total RNA from peripheral blood in 40 anthracycline-exposed survivors with cardiomyopathy (cases) and 64 matched survivors without (controls). DESeq2 identified differentially expressed genes. Ingenuity Pathway Analyses (IPA) and Gene Set Enrichment Analyses determined the potential roles of altered genes in biological pathways. Functional validation was performed by gene knockout in human-induced pluripotent stem cell-derived cardiomyocytes using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) technology. Median age at primary cancer diagnosis for cases and controls was 8.2 and 9.7 years, respectively. Thirty-six differentially expressed genes with fold change ≥±2 were identified; 35 were upregulated. IPA identified "hepatic fibrosis" and "iron homeostasis" pathways to be significantly modulated by differentially expressed genes, including toxicology functions of myocardial infarction, cardiac damage, and cardiac dilation. Leading edge analysis from Gene Set Enrichment Analyses identified lactate dehydrogenase A (<i>LDHA</i>) and cluster of differentiation 36 (<i>CD36</i>) genes to be significantly upregulated in cases. Interleukin 1 receptor type 1, 2 (<i>IL1R1</i>, <i>IL1R2</i>), and matrix metalloproteinase 8, 9 (<i>MMP8, MMP9</i>) appeared in multiple canonical pathways. <i>LDHA</i>-knockout human-induced pluripotent stem cell-derived cardiomyocytes showed increased sensitivity to doxorubicin. Conclusions We identified differential mRNA expression profiles in peripheral blood of anthracycline-exposed childhood cancer survivors with and without cardiomyopathy. Upregulation of <i>LDHA</i> and <i>CD36</i> genes suggests metabolic perturbations in a failing heart. Dysregulation of proinflammatory cytokine receptors <i>IL1R1</i> and <i>IL1R2</i> and matrix metalloproteinases, <i>MMP8</i> and <i>MMP9</i> indicates structural remodeling that accompanies the clinical manifestation of symptomatic cardiotoxicity.

Also flagged:membranecoronavirus disease 2019COVID-19Piezo1cationchannel
Journal Article 2023-09-26 No Snippets Kwak K, Sohn H, George R, Torgbor C, Manzella-Lapeira J, Brzostowski J, Pierce SK.
Show Full Abstract

The demand for a vaccine for coronavirus disease 2019 (COVID-19) highlighted gaps in our understanding of the requirements for B cell responses to antigens, particularly to membrane-presented antigens, as occurs in vivo. We found that human B cell responses to membrane-presented antigens required the function of Piezo1, a plasma membrane mechanosensitive cation channel. Simply making contact with a glass probe induced calcium (Ca<sup>2+</sup>) fluxes in B cells that were blocked by the Piezo1 inhibitor GsMTx4. When placed on glass surfaces, the plasma membrane tension of B cells increased, which stimulated Ca<sup>2+</sup> influx and spreading of B cells over the glass surface, which was blocked by the Piezo1 inhibitor OB-1. B cell responses to membrane-presented antigens but not to soluble antigens were inhibited both by Piezo1 inhibitors and by siRNA-mediated knockdown of Piezo1. Thus, the activation of Piezo1 defines an essential event in B cell activation to membrane-presented antigens that may be exploited to improve the efficacy of vaccines.

Also flagged:schizophreniabrain disorderbehaviouralresponse to threateningSLC6A4serotonin transporter
Journal Article 2023-09-26 No Snippets Quarto T, Lella A, Di Carlo P, Rampino A, Paladini V, Papalino M, Romano R, Fazio L, Marvulli D, Popolizio T, Blasi G, Pergola G, Bertolino A.
Show Full Abstract

<h4>Background</h4>Among healthy participants, the interindividual variability of brain response to facial emotions is associated with genetic variation, including common risk variants for schizophrenia, a heritable brain disorder characterized by anomalies in emotion processing. We aimed to identify genetic variants associated with heritable brain activity during processing of facial emotions among healthy participants and to explore the impact of these identified variants among patients with schizophrenia.<h4>Methods</h4>We conducted a data-driven stepwise study including samples of healthy twins, unrelated healthy participants and patients with schizophrenia. Participants approached or avoided pictures of faces with negative emotional valence during functional magnetic resonance imaging (fMRI).<h4>Results</h4>We investigated 3 samples of healthy participants - including 28 healthy twin pairs, 289 unrelated healthy participants (genome-wide association study [GWAS] discovery sample) and 90 unrelated healthy participants (replication sample) - and 1 sample of 48 patients with schizophrenia. Among healthy twins, we identified the amygdala as the brain region with the highest heritability during processing of angry faces (heritability estimate 0.54, <i>p</i> < 0.001). Subsequent GWAS in both discovery and replication samples of healthy non-twins indicated that amygdala activity was associated with a polymorphism in the <i>miR-137</i> locus (rs1198575), a micro-RNA strongly involved in risk for schizophrenia. A significant effect in the same direction was found among patients with schizophrenia (<i>p</i> = 0.03).<h4>Limitations</h4>The limited sample size available for GWAS analyses may require further replication of results.<h4>Conclusion</h4>Our data-driven approach shows preliminary evidence that amygdala activity, as evaluated with our task, is heritable. Our genetic associations preliminarily suggest a role for <i>miR-137</i> in brain activity during explicit processing of facial emotions among healthy participants and patients with schizophrenia, pointing to the amygdala as a brain region whose activity is related to <i>miR-137</i>.

HTT
Also flagged:metabolismneurotransmitter receptorsgene expressionmyelintransportersoxygen
Journal Article 2023-09-26 ✓ 1 Snippet Shafiei G, Fulcher BD, Voytek B, Satterthwaite TD, Baillet S, Misic B.
In-Text Gene Mentions

…5-HT2a, 5-HT4, 5-HT6, 5-HTT), histamine (H3), dopamine…

Show Full Abstract

Systematic spatial variation in micro-architecture is observed across the cortex. These micro-architectural gradients are reflected in neural activity, which can be captured by neurophysiological time-series. How spontaneous neurophysiological dynamics are organized across the cortex and how they arise from heterogeneous cortical micro-architecture remains unknown. Here we extensively profile regional neurophysiological dynamics across the human brain by estimating over 6800 time-series features from the resting state magnetoencephalography (MEG) signal. We then map regional time-series profiles to a comprehensive multi-modal, multi-scale atlas of cortical micro-architecture, including microstructure, metabolism, neurotransmitter receptors, cell types and laminar differentiation. We find that the dominant axis of neurophysiological dynamics reflects characteristics of power spectrum density and linear correlation structure of the signal, emphasizing the importance of conventional features of electromagnetic dynamics while identifying additional informative features that have traditionally received less attention. Moreover, spatial variation in neurophysiological dynamics is co-localized with multiple micro-architectural features, including gene expression gradients, intracortical myelin, neurotransmitter receptors and transporters, and oxygen and glucose metabolism. Collectively, this work opens new avenues for studying the anatomical basis of neural activity.

Also flagged:breast cancerdeathcancercarbohydratesmineralscoumarins
Journal Article 2023-09-26 No Snippets Zarban A, Azaryan E, Binabaj MM, Karbasi S, Naseri M.
Show Full Abstract

<h4>Background</h4>One of the most common types of cancer in women is breast cancer. There are numerous natural plant-based products, which exert anti-tumoral effects including Elaeagnus Angustifolia (EA). It modulates cell-cycle process, heat-shock proteins expression, anti-proliferative properties, apoptosis induction, blocking of angiogenesis, and cell invasion inhibition. The current study aimed to synthesize and evaluate the anticancer effects of hydroalcoholic EA extract (HEAE), Nanohydroxyapatite (nHAp) and nHAp synthesized trough EA (nHA-EA) in MCF-7 breast cancer cell line.<h4>Methods</h4>In the present study, HEAE preparation and green synthesis of nHA-EA was done and phase composition, functional groups, and crystallin phase of nHA-EA and nHAp were determined using Fourier-transform infrared (FTIR) and X-ray diffraction (XRD). The characteristics of synthesized nanoparticles including structural and morphological parameters were investigated using scanning electron microscopy (SEM) and Transmission electron microscopy (TEM) techniques. Then, by using MTT-assay (Dimethylthiazoldiphenyltetrazolium), the in vitro cytotoxic and half maximal inhibitory concentration (IC<sub>50</sub>) of EA extract, nHAp, and nHA-EA in the MCF-7 breast cancer cell line was evaluated. Next, we assessed the expression of apoptosis-related genes Bax, Bcl2 and p53 using quantitative reverse-transcriptase polymerase-chain-reaction (qRT-PCR) and migration of MCF-7 cells by scratch assay.<h4>Results</h4>The FTIR results demonstrated formation of nHAp and its interaction with HEAE during synthesis process. The XRD results of the synthesized nanoparticles showed similar XRD pattern of nHA-EA and nHAp and purity of synthesized nanomaterials. The average IC<sub>50</sub> of HEAE, nHAp, and nHA-EA extract after treatment of cancer cells for 24 h was 400 µg/mL, 200 µg/mL, and 100 µg/mL, respectively. Our results revealed that nHA-EA significantly reduced the migration and invasion of the MCF-7 cells, in comparison to the nHAp and EA extract. Moreover, level of Bax/Bcl2 and p53 was significantly higher in the nHA-EA extract group in comparison to the EA extract and nHAp group.<h4>Conclusion</h4>Taken together, our results demonstrated that bioactive constituents of EA medicinal plant in form of nHA-EA particles, can effectively exerts potential anticancer and chemo preventive effect against breast cancer growth and can be proposed as a promising beneficial candidate for BC therapy. However, further investigations are required to discover what bioactive compounds are responsible for the chemo preventive effect of this extract.

Also flagged:ubiquitin-specific protease 12USP12Ubiquitinationpost-translational modificationscell proliferationautophagy
Journal Article 2023-09-26 No Snippets Niu K, Shi Y, Lv Q, Wang Y, Chen J, Zhang W, Feng K, Zhang Y.
Show Full Abstract

Ubiquitination is one of the most significant post-translational modifications that regulate almost all physiological processes like cell proliferation, autophagy, apoptosis, and cell cycle progression. Contrary to ubiquitination, deubiquitination removes ubiquitin from targeted protein to maintain its stability and thus regulate cellular homeostasis. Ubiquitin-Specific Protease 12 (USP12) belongs to the biggest family of deubiquitinases named ubiquitin-specific proteases and has been reported to be correlated with various pathophysiological processes. In this review, we initially introduce the structure and biological functions of USP12 briefly and summarize multiple substrates of USP12 as well as the underlying mechanisms. Moreover, we discuss the influence of USP12 on tumorigenesis, tumor immune microenvironment (TME), disease, and related signaling pathways. This study also provides updated information on the roles and functions of USP12 in different types of cancers and other diseases, including prostate cancer, breast cancer, lung cancer, liver cancer, cardiac hypertrophy, multiple myeloma, and Huntington's disease. Generally, this review sums up the research advances of USP12 and discusses its potential clinical application value which deserves more exploration in the future.

HTT
Also flagged:Rapamycinneurodegenerative diseaseHDchaperoninpathogenesischorea
Journal Article 2023-09-26 ✓ 5 Snippets Roth JR, de Moraes RCM, Xu BP, Crawley SR, Khan MA, Melkani GC.
In-Text Gene Mentions

Rapamycin reduces Htt-PQ72 aggregation in the brain and ameliorates flight muscle performance.

These results demonstrate the role of neuronal Htt-PQ in dysfunction in models of HD, suggest that brain-periphery crosstalk could be important to the pathogenesis of HD, and show that rapamycin reduces mutant huntingtin aggregation in the brain.

HD is monogenic and is caused by a CAG repeat expansion in exon 1 of the HTT gene, leading to a polyglutamine (PQ) expansion in the huntingtin protein.

HD is characterized by muscle dysfunction, and we have previously found that Htt-PQ72 causes dysfunction in cardiac and skeletal muscle (Melkani et al., 2013; Barwell et al., 2023).

Rapamycin treatment reduces Htt-PQ72 aggregation in the brain and ameliorates locomotor performance

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disease characterized by movement and cognitive dysfunction. HD is caused by a CAG expansion in exon 1 of the <i>HTT</i> gene that leads to a polyglutamine (PQ) repeat in the huntingtin protein, which aggregates in the brain and periphery. Previously, we used <i>Drosophila</i> models to determine that Htt-PQ aggregation in the heart causes shortened lifespan and cardiac dysfunction that is ameliorated by promoting chaperonin function or reducing oxidative stress. Here, we further study the role of neuronal mutant huntingtin and how it affects peripheral function. We overexpressed normal (<i>Htt-PQ25</i>) or expanded mutant (<i>Htt-PQ72</i>) exon 1 of huntingtin in <i>Drosophila</i> neurons and found that mutant huntingtin caused age-dependent Htt-PQ aggregation in the brain and could cause a loss of synapsin. To determine if this neuronal dysfunction led to peripheral dysfunction, we performed a negative geotaxis assay to measure locomotor performance and found that neuronal mutant huntingtin caused an age-dependent decrease in locomotor performance. Next, we found that rapamycin reduced Htt-PQ aggregation in the brain. These results demonstrate the role of neuronal Htt-PQ in dysfunction in models of HD, suggest that brain-periphery crosstalk could be important to the pathogenesis of HD, and show that rapamycin reduces mutant huntingtin aggregation in the brain.

Also flagged:Breast Cancertriple-negative breast cancercancerorganizationcytoskeletonmembrane
Journal Article 2023-09-26 No Snippets Starodubtseva MN, Shkliarava NM, Chelnokova IA, Villalba MI, Krylov AY, Nadyrov EA, Kasas S.
Show Full Abstract

Cells of two molecular genetic types of breast cancer-hormone-dependent breast cancer (ZR-75 cell line) and triple-negative breast cancer (BT-20 cell line)-were studied using atomic force microscopy and an optical nanomotion detection method. Using the Peak Force QNM and Force Volume AFM modes, we revealed the unique patterns of the dependence of Young's modulus on the indentation depth for two cancer cell lines that correlate with the features of the spatial organization of the actin cytoskeleton. Within a 200-300 nm layer just under the cell membrane, BT-20 cells are stiffer than ZR-75 cells, whereas in deeper cell regions, Young's modulus of ZR-75 cells exceeds that of BT-20 cells. Two cancer cell lines also displayed a difference in cell nanomotion dynamics upon exposure to cytochalasin D, a potent actin polymerization inhibitor. The drug strongly modified the nanomotion pattern of BT-20 cells, whereas it had almost no effect on the ZR-75 cells. We are confident that nanomotion monitoring and measurement of the stiffness of cancer cells at various indentation depths deserve further studies to obtain effective predictive parameters for use in clinical practice.

Also flagged:metabolismlocomotionmyogenesisdevelopmenttranscription factorsmitochondrial
Journal Article 2023-09-26 No Snippets Yang Y, Wu J, Liu W, Zhao Y, Chen H.
Show Full Abstract

Animal skeletal muscle growth is regulated by a complex molecular network including some non-coding RNAs (ncRNAs). In this paper, we review the non-coding RNAs related to the growth and development of common animal skeletal muscles, aiming to provide a reference for the in-depth study of the role of ncRNAs in the development of animal skeletal muscles, and to provide new ideas for the improvement of animal production performance.

Also flagged:Glioblastomacancers of the braincancercell proliferationMAPKPI3K
Journal Article 2023-09-26 No Snippets Tirpe A, Streianu C, Tirpe SM, Kocijancic A, Pirlog R, Pirlog B, Busuioc C, Pop OL, Berindan-Neagoe I.
Show Full Abstract

Glioblastoma remains one of the most aggressive cancers of the brain, warranting new methods for early diagnosis and more efficient treatment options. Circular RNAs (circRNAs) are rather new entities with increased stability compared to their linear counterparts that interact with proteins and act as microRNA sponges, among other functions. Herein, we provide a critical overview of the recently described glioblastoma-related circRNAs in the literature, focusing on their roles on glioblastoma cancer cell proliferation, survival, migration, invasion and metastasis, metabolic reprogramming, and therapeutic resistance. The main roles of circRNAs in regulating cancer processes are due to their regulatory roles in essential oncogenic pathways, including MAPK, PI3K/AKT/mTOR, and Wnt, which are influenced by various circRNAs. The present work pictures the wide implication of circRNAs in glioblastoma, thus highlighting their potential as future biomarkers and therapeutic targets/agents.

CCPG1
Also flagged:reproductionlipidmetabolismfatty acidmatingsex chromosomes
Journal Article 2023-09-26 ✓ 1 Snippet Yin S, Li Z, Yang F, Guo H, Zhao Q, Zhang Y, Yin Y, Wu X, He J.
In-Text Gene Mentions

…in pigs, andCCPG1[ 46 ],…

Show Full Abstract

Ningxiang pigs are a renowned indigenous pig breed in China, known for their meat quality, disease resistance, and environmental adaptability. In recent decades, consumer demand for meats from indigenous breeds has grown significantly, fueling the selection and crossbreeding of Ningxiang pigs (NXP). The latter has raised concerns about the conservation and sustainable use of Ningxiang pigs as an important genetic resource. To address these concerns, we conducted a comprehensive genomic study using 2242 geographically identified Ningxiang pigs. The estimated genomic breed composition (GBC) suggested 2077 pigs as purebred Ningxiang pigs based on a ≥94% NXP-GBC cut-off. The remaining 165 pigs were claimed to be crosses, including those between Duroc and Ningxiang pigs and between Ningxiang and Shaziling pigs, and non-Ningxiang pigs. Runs of homozygosity (ROH) were identified in the 2077 purebred Ningxiang pigs. The number and length of ROH varied between individuals, with an average of 32.14 ROH per animal and an average total length of 202.4 Mb per animal. Short ROH (1-5 Mb) was the most abundant, representing 66.5% of all ROH and 32.6% of total ROH coverage. The genomic inbreeding estimate was low (0.089) in purebred Ningxiang pigs compared to imported western pig breeds. Nine ROH islands were identified, pinpointing candidate genes and QTLs associated with economic traits of interest, such as reproduction, carcass and growth traits, lipid metabolism, and fat deposition. Further investigation of these ROH islands and candidate genes is anticipated to better understand the genomics of Ningxiang pigs.

Also flagged:biopolymerswaterlipidoxygencarbon dioxidepolysaccharides
Journal Article 2023-09-26 No Snippets Perez-Vazquez A, Barciela P, Carpena M, Prieto MA.
Show Full Abstract

In the past years, consumers have increased their interest in buying healthier food products, rejecting those products with more additives and giving preference to the fresh ones. Moreover, the current environmental situation has made society more aware of the importance of reducing the production of plastic and food waste. In this way and considering the food industry's need to reduce food spoilage along the food chain, edible coatings have been considered eco-friendly food packaging that can replace traditional plastic packaging, providing an improvement in the product's shelf life. Edible coatings are thin layers applied straight onto the food material's surface that are made of biopolymers that usually incorporate other elements, such as nanoparticles or essential oils, to improve their physicochemical properties. These materials must provide a barrier that can prevent the passage of water vapor and other gasses, microbial growth, moisture loss, and oxidation so shelf life can be extended. The aim of this review was to compile the current data available to give a global vision of the formulation process and the different ways to improve the characteristics of the coats applied to both fruits and vegetables. In this way, the suitability of compounds in by-products produced in the food industry chain were also considered for edible coating production.

DCC
Also flagged:Intrahepatic CholangiocarcinomatumorneoplasmCholangiocarcinomacancerscholangitis
Journal Article 2023-09-26 ✓ 1 Snippet Gorji L, Aoun H, Critchfield J, Al Hallak N, Beal EW.
In-Text Gene Mentions

AEs—adverse events, AJCC—American Joint Committee on Cancer, ALT—alanine aminotransferase, AST—aspartate aminotransferase, CA 19-9—Carbohydrate Antigen 19-9, CCA—cholangiocarcinoma, CEUS—contrast-enhanced ultrasound, ChT—systemic chemotherapy, CI—contraindications, Cis—cisplatin, CRC LM—colorectal cancer with liver metastasis, cTACE—Conventional Transarterial Embolization, DCC—distal cholangiocarcinoma, DEB—drug-eluting bead, DEBDOX—doxorubicin microsphere drug-eluting beads, DEB-TACE—drug-eluting bead transarterial chemoembolization, DFS—disease-free survival, Dsx—disease, DVT—deep vein thrombosis, EBRT—external beam radiation therapy, EC—exclusion criteria, ECOG—Eastern Cooperative Oncology Group performance status, ERCP—endoscopic retrograde cholangiopancreatography, EUS—endoscopic ultrasound, FDG-PET—fluorodeoxyglucose-positron emission testing, Gbq—gigabecquerel, GEMOX—gemcitabine oxaliplatin, Gy—gray, HAI—hepatic artery infusion pump, HCC—hepatocellular carcinoma, Ho-166—Homium-166, HR—hazard ratio, IC—inclusion criteria, ICC—Intrahepatic Cholangiocarcinoma, iDEB-TACE—Irinotecan Drug-Eluting bead transarterial chemoembolization, LIFDOX—polyethylene glycol drug-eluting beads, MC—most common, Mo—months, MRCP—magnetic resonance cholangiopancreatography, MS—median survival, MVI—microvascular invasion, MWA—microwave ablation, NAFLD—non-alcoholic fatty liver disease, NCCN—National Comprehensive Cancer Network, N/L—neutrophil-to-lymph node, OEM-TACE—oxaliplatin-eluting microsphere transarterial chemoembolization, ORR—objective response rate, OS—overall survival, PCC—perihilar cholangiocarcinoma, PD—progressive disease, PEG—polyethylene glycol drug-eluting microsphere, PES—post-embolization syndrome, PH—partial hepatectomy, PFS—progression-free survival, PMCT—percutaneous microwave coagulation therapy, PP—patient population, p-TACE—postoperative trans-arterial embolization, TARE—transarterial radioembolization, PSC—primary sclerosis cholangitis, Pts—patients, PR—partial response, REILD—radioembolization-induced liver disease, RFA—radiofrequency ablation, SD—stable disease, SE—side effects, SIRT—selective internal radiation therapy, RR—recurrence rate, TACE—transarterial chemoembolization, TAE—transarterial embolization, TB—tumor burden, Tc-MAA—99mTc-macroaggregated albumin, TP—tumor progression, TTP—time-to-progression, UK—United Kingdom, USA—United States of America, Y-90—Yttrium-90, ΔTLG—total lesion glycolysis.

Show Full Abstract

Intrahepatic cholangiocarcinoma (ICC) is a rare disease with a rising incidence. While surgical resection is the only curative option, the disease process is often identified in advanced stages, as this malignancy often remains clinically silent in early development. Only one-third of patients are eligible for resection at the time of diagnosis. For patients who cannot undergo resection, intra-arterial therapies are reasonable palliative treatment options; in rare occasions, these may be bridging therapies, as well. The premise of bland embolization and most chemoembolization intra-arterial therapies is that the arterial supply of the tumor is occluded to induce tumor necrosis, while radioembolization utilizes the arterial flow of the tumor to deliver radiation therapy. In this review, we discuss the use of transarterial embolization, transarterial chemoembolization, and selective internal radiation therapy for the treatment of ICC. Phase III randomized controlled clinical trials are difficult to tailor to this extremely rare and aggressive disease, but ultimately, further investigation should be pursued to define the patient population that will derive the greatest benefit from each modality.

SHISA6
Also flagged:PONVpropofoldesfluraneNauseaCNTN5RBFOX1
Journal Article 2023-09-26 ✓ 5 Snippets Nishizawa D, Morino R, Inoue R, Ohka S, Kasai S, Hasegawa J, Ebata Y, Nakayama K, Sumikura H, Hayashida M, Yokota M, Ikeda K.
In-Text Gene Mentions

In another GWAS conducted only on patients who received propofol, rs7212072 and rs12444143 SNPs in the SHISA6 and RBFOX1 gene regions, respectively, were significantly associated with the frequency of nausea as well as the rs2776262 SNP, and the rs45574836 and rs1752136 SNPs in the ATP8B3 and LOC105370198 gene regions, respectively, were significantly associated with vomiting.

For SHISA6 and RBFOX1, although no relationships with PONV have been reported, two SNPs in these genes, rs2908972 and rs10500355, respectively, were interestingly shown to be strongly associated with myopia (p = 5.000 × 10−24 for rs2908972; p = 2.000 × 10−63 for rs10500355) [48] according to the Phenotype-Genotype Integrator (PheGenI), which is available in the NCBI database.

…, CNTN5 ,SHISA6, RBFOX1 ,…

…SNPs in theSHISA6and RBFOX1 gene…

…member 6 (SHISA6) and RNA…

Show Full Abstract

Considerable individual differences are widely observed in the incidence of postoperative nausea and vomiting (PONV). We conducted a genome-wide association study (GWAS) to identify potential candidate single-nucleotide polymorphisms (SNPs) that contribute to PONV by utilizing whole-genome genotyping arrays with more than 950,000 markers. The subjects were 806 patients who provided written informed consent and underwent elective surgery under general anesthesia with propofol or desflurane. The GWAS showed that two SNPs, rs2776262 and rs140703637, in the <i>LOC100506403</i> and <i>CNTN5</i> gene regions, respectively, were significantly associated with the frequency of nausea. In another GWAS conducted only on patients who received propofol, rs7212072 and rs12444143 SNPs in the <i>SHISA6</i> and <i>RBFOX1</i> gene regions, respectively, were significantly associated with the frequency of nausea as well as the rs2776262 SNP, and the rs45574836 and rs1752136 SNPs in the <i>ATP8B3</i> and <i>LOC105370198</i> gene regions, respectively, were significantly associated with vomiting. Among these SNPs, clinical and SNP data were available for the rs45574836 SNP in independent subjects who underwent laparoscopic gynecological surgery, and the association was replicated in these subjects. These results indicate that these SNPs could serve as markers that predict the vulnerability to PONV. Our findings may provide valuable information for achieving satisfactory prophylactic treatment for PONV.

Also flagged:Synthesisα-glucosidaseepoxidebenzopyranesterhydroxy
Journal Article 2023-09-26 No Snippets Oh C, Im JH, Bae M, Jung JW.
Show Full Abstract

2,2-Dimethyl-3-hydroxy-4-(1'-angeloyloxy)-6-acetylchromane is a natural product isolated from <i>Ageratina grandifolia</i> that exhibits inhibitory activity against yeast α-glucosidase. Initially, its structure was proposed to be 4-hydroxy-3-((<i>S</i>)-1'-angeloyloxy-(<i>R</i>)-2',3'-epoxy-3'-methyl)butylacetophenone with an epoxide, but the structure was later revised to 2,2-dimethyl-3<i>R</i>-hydroxy-4<i>S</i>-(1-angeloyloxy)-6-acetylchromane. In this study, we present a total synthesis of 2,2-dimethyl-3-hydroxy-4-(1'-angeloyloxy)-6-acetylchromane from <i>A. gradifolia</i> and its stereoisomers. The key features of their synthesis include Sharpless asymmetric dihydroxylation of a readily available benzopyran substrate and subsequent Mitsunobu or Steglich reaction to provide both cis- and trans-isomers with chiral control. The absolute stereochemistry of the natural product was determined to be 2,2-dimethyl-3<i>S</i>-hydroxy-4<i>R</i>-(1'-angeloyloxy)-6-acetylchromane based on optical rotations of the synthesized compounds. The absolute configuration of the synthesized stereoisomers was confirmed by Mosher ester analysis. In addition, we provided ECD spectra for the four stereoisomers, which will allow verification of the absolute configuration of the natural product. Synthesis of all four stereoisomers of 2,2-dimethyl-3-hydroxy-4-(1'-angeloyloxy)-6-acetylchromane would facilitate the exploration of their potential biomedical applications.

SOX6
Also flagged:atrial fibrillationpathogenesisAFGene Expressionprotein kinase BKLF10
Journal Article 2023-09-26 ✓ 1 Snippet Chen X, Tang H, Lu K, Niu Z, Sheng W, Hwang HY, Pang PYK, Phillips JD, Khoynezhad A, Qu X, Li B, Han W.
In-Text Gene Mentions

…mRNAs, ZFAND5 ,SOX6, and KLF10…

Show Full Abstract

<h4>Background</h4>Atrial fibrillation (AF) is the most common complication in patients undergoing cardiac surgery. However, the pathogenesis of postoperative AF (POAF) is elusive, and research related to this topic is sparse. Our study aimed to identify key gene modules and genes and to conduct a circular RNA (circRNA)-microRNA (miRNA)-messenger RNA (mRNA) regulatory network analysis of POAF on the basis of bioinformatic analysis.<h4>Methods</h4>The GSE143924 and GSE97455 data sets from the Gene Expression Omnibus (GEO) database were analyzed. Weighted gene co-expression network analysis (WGCNA) was used to identify the key gene modules and genes related to POAF. A circRNA-miRNA-mRNA regulatory network was also built according to differential expression analysis. Functional enrichment analysis was further performed according to Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis.<h4>Results</h4>WGCNA identified 2 key gene modules and 44 key genes that were significantly related to POAF. Functional enrichment analysis of these key genes implicated the following important biological processes (BPs): endosomal transport, protein kinase B signaling, and transcription regulation. The circRNA-miRNA-mRNA regulatory network suggested that <i>KLF10</i> may take critical part in POAF. Moreover, 2 novel circRNAs, hsa_circRNA_001654 and hsa_circRNA_005899, and 2 miRNAs, hsa-miR-19b-3p and hsa-miR-30a-5p, which related with <i>KLF10</i>, were involved in the network.<h4>Conclusions</h4>Our study provides foundational expression profiles following POAF based on WGCNA. The circRNA-miRNA-mRNA network offers insights into the BPs and underlying mechanisms of POAF.

OLFM4
Also flagged:cancercytoplasmicmembranetumorlung cancerion channels
Journal Article 2023-09-26 ✓ 1 Snippet Zhu W, Wang J, Luo H, Luo B, Li X, Liu S, Li C.
In-Text Gene Mentions

…IL1R2, IL18R1, IL18RAP,OLFM4, TLR5, CPA3, FCER1A,…

Show Full Abstract

Biological parameters extracted from electrical signals from various body parts have been used for many years to analyze the human body and its behavior. In addition, electrical signals from cancer cell lines, normal cells, and viruses, among others, have been widely used for the detection of various diseases. Single-cell parameters such as cell and cytoplasmic conductivity, relaxation frequency, and membrane capacitance are important. There are many techniques available to characterize biomaterials, such as nanotechnology, microstrip cavity resonance measurement, etc. This article reviews single-cell isolation and sorting techniques, such as the micropipette separation method, separation and sorting system (dual electrophoretic array system), DEPArray sorting system (dielectrophoretic array system), cell selector sorting system, and microfluidic and valve devices, and discusses their respective advantages and disadvantages. Furthermore, it summarizes common single-cell electrical manipulations, such as single-cell amperometry (SCA), electrical impedance sensing (EIS), impedance flow cytometry (IFC), cell-based electrical impedance (CEI), microelectromechanical systems (MEMS), and integrated microelectrode array (IMA). The article also enumerates the application and significance of single-cell electrochemical analysis from the perspectives of CTC liquid biopsy, recombinant adenovirus, tumor cells like lung cancer DTCs (LC-DTCs), and single-cell metabolomics analysis. The paper concludes with a discussion of the current limitations faced by single-cell analysis techniques along with future directions and potential application scenarios.

HTT
Also flagged:oligonucleotidesOligonucleotideneurodegenerative disorderscalciumneurodegenerative diseaseimmune responses
Journal Article 2023-09-26 ✓ 1 Snippet Benatti HR, Prestigiacomo RD, Taghian T, Miller R, King R, Gounis MJ, Celik U, Bertrand S, Tuominen S, Bierfeldt L, Parsley E, Gallagher J, Hall EF, McElroy AW, Sena-Esteves M, Khvorova A, Aronin N, Gray-Edwards HL.
In-Text Gene Mentions

…translation of theHttprotein coding mRNA,…

Show Full Abstract

Oligonucleotide therapeutics offer great promise in the treatment of previously untreatable neurodegenerative disorders; however, there are some challenges to overcome in pre-clinical studies. (1) They carry a well-established dose-related acute neurotoxicity at the time of administration. (2) Repeated administration into the cerebrospinal fluid may be required for long-term therapeutic effect. Modifying oligonucleotide formulation has been postulated to prevent acute toxicity, but a sensitive and quantitative way to track seizure activity in pre-clinical studies is lacking. The use of intracerebroventricular (i.c.v.) catheters offers a solution for repeated dosing; however, fixation techniques in large animal models are not standardized and are not reliable. Here we describe a novel surgical technique in a sheep model for i.c.v. delivery of neurotherapeutics based on the fixation of the i.c.v. catheter with a 3D-printed anchorage system composed of plastic and ceramic parts, compatible with magnetic resonance imaging, computed tomography, and electroencephalography (EEG). Our technique allowed tracking electrical brain activity in awake animals via EEG and video recording during and for the 24-h period after administration of a novel oligonucleotide in sheep. Its anchoring efficiency was demonstrated for at least 2 months and will be tested for up to a year in ongoing studies.

Research Square 2023-09-26 Preprint (No Snippets API) Litchfield K, Simpson B, Cha H, Castro A, Bentham R, Ryan L, Dietzen M, Thol K, Kinnersley B, Martin A, Chubb D, Cornish A, Coulton A, Thakkar K, Bailey C, Jennings C, Kaye D, Bansal D, Humphries M, Wright A, Colquhoun C, Stankeviciute G, Helliwell J, Arumugam P, Treanor D, McGranahan N, Larkin J, Turajlic S, Swanton C, Greenig J, Hiley C, GEL Genomics England Research Consortium.
Show Full Abstract

<title>Abstract</title> <p>Checkpoint inhibitors (CPI), ameliorate the anti-tumour response by blocking inhibitory immune checkpoint receptors, and have revolutionised the treatment of advanced cancers. However, the prediction of treatment response is suboptimal, and there remains a strong reliance on tumour mutation burden (TMB). Studies to date are limited to whole exome sequencing (WES), with no data yet reported on the utility of whole genome sequencing (WGS) in a pan-cancer cohort. Here we report a pan-cancer cohort of 318 tumour/normal genomes from the Genomics England 100,000 Genomes Project cohort treated with CPIs. Pan-cancer biomarkers previously reported from WES such as clonal TMB, total neoantigen burden and TMB had continued utility in predicting treatment response. Clonal TMB remained the strongest univariate predictor of positive treatment outcome, followed by infiltrating T cell fraction, and tobacco/UV mutational signatures. using whole genome assay, we additionally detected novel signatures associated with poor outcomes, including markers reflecting chemotherapy-induced mutations. Patients treated with chemotherapy prior to CPI displayed reduced survival irrespective of tumour type and had more subclonal mutations. Structural variants (SVs) were also predictive of poor therapeutic response and were enriched with non-coding intronic breakpoints, generating significantly fewer neoantigens than expected by chance. Global genomic features such as telomere length were associated with poor survival following CPI treatment, particularly in renal and bladder cancers. Together, these validated and novel biomarkers showed collective utility when combined to predict CPI outcomes. Our results highlight the value of WGS in detecting biomarkers of treatment resistance and highlight the promise of WGS for use in clinical practice.</p>

Also flagged:fructosaminepolydimethylsiloxanesiliconsecretionquininecalcium
Journal Article 2023-09-25 No Snippets Kayirangwa Y, Mohibullah M, Easley CJ.
Show Full Abstract

The development of microfluidic systems for biological assays presents challenges, particularly in adapting traditional optical absorbance assays to smaller volumes or to microfluidic formats. This often requires assay modification or translation to a fluorescence version, which can be impractical. To address this issue, our group has developed the μChopper device, which uses microfluidic droplet formation as a surrogate for an optical beam chopper, allowing for lock-in analysis and improved limits of detection with both absorbance and fluorescence optics without modifying the optical path length. Here, we have adapted the μChopper to low-cost optics using a light-emitting diode (LED) source and photodiode detector, and we have fabricated the pnuematically valved devices entirely by 3D printing instead of traditional photolithography. Using a hybrid device structure, fluidic channels were made in polydimethylsiloxane (PDMS) by moulding onto a 3D-printed master then bonding to a prefabricated thin layer, and the pneumatic layer was directly made of 3D-printed resin. This hybrid structure allowed an optical slit to be fabricated directly under fluidic channels, with the LED interfaced closely above the channel. Vacuum-operated, normally closed valves provided precise temporal control of droplet formation from 0.6 to 2.0 Hz. The system was validated against the standard plate reader format using a colorimetric fructosamine assay and by quantifying fructosamine in human serum from normal and diabetic patients, where strong correlation was shown. Showing a standard benefit of microfluidics in analysis, the device required 6.4-fold less serum volume for each assay. This μChopper device and lower cost optical system should be applicable to various absorbance based assays in low volumes, and the reliance on inexpensive 3D printers makes it more accessible to users without cleanroom facilities.

TNFSF4PCDH17
Also flagged:STAT3methylationEndothelial dysfunctionlipopolysaccharideSOCS3IL-6
Journal Article 2023-09-25 ✓ 2 Snippets Ramos RB, Martino N, Chuy D, Lu S, Zuo MXG, Balasubramanian U, Di John Portela I, Vincent PA, Adam AP.
In-Text Gene Mentions

TNFSF4

PCDH17

Show Full Abstract

Endothelial dysfunction is a crucial factor in promoting organ failure during septic shock. However, the underlying mechanisms are unknown. Here, we show that kidney injury after lipopolysaccharide (LPS) insult leads to strong endothelial transcriptional and epigenetic responses. Furthermore, SOCS3 loss leads to an aggravation of the responses, demonstrating a causal role for the STAT3-SOCS3 signaling axis in the acute endothelial response to LPS. Experiments in cultured endothelial cells demonstrate that IL-6 mediates this response. Furthermore, bioinformatics analysis of in vivo and in vitro transcriptomics and epigenetics suggests a role for STAT, AP1 and interferon regulatory family (IRF) transcription factors. Knockdown of STAT3 or the AP1 member JunB partially prevents the changes in gene expression, demonstrating a role for these transcription factors. In conclusion, endothelial cells respond with a coordinated response that depends on overactivated IL-6 signaling via STAT3, JunB and possibly other transcription factors. Our findings provide evidence for a critical role of IL-6 signaling in regulating shock-induced epigenetic changes and sustained endothelial activation, offering a new therapeutic target to limit vascular dysfunction.

Also flagged:tryptophaninfectionTGFβCD69inflammatory disordersCD4
Journal Article 2023-09-25 No Snippets Wojciech L, Png CW, Koh EY, Kioh DYQ, Deng L, Wang Z, Wu LZ, Hamidinia M, Tung DW, Zhang W, Pettersson S, Chan ECY, Zhang Y, Tan KS, Gascoigne NR.
Show Full Abstract

The large intestine harbors microorganisms playing unique roles in host physiology. The beneficial or detrimental outcome of host-microbiome coexistence depends largely on the balance between regulators and responder intestinal CD4<sup>+</sup> T cells. We found that ulcerative colitis-like changes in the large intestine after infection with the protist Blastocystis ST7 in a mouse model are associated with reduction of anti-inflammatory Treg cells and simultaneous expansion of pro-inflammatory Th17 responders. These alterations in CD4<sup>+</sup> T cells depended on the tryptophan metabolite indole-3-acetaldehyde (I3AA) produced by this single-cell eukaryote. I3AA reduced the Treg subset in vivo and iTreg development in vitro by modifying their sensing of TGFβ, concomitantly affecting recognition of self-flora antigens by conventional CD4<sup>+</sup> T cells. Parasite-derived I3AA also induces over-exuberant TCR signaling, manifested by increased CD69 expression and downregulation of co-inhibitor PD-1. We have thus identified a new mechanism dictating CD4<sup>+</sup> fate decisions. The findings thus shine a new light on the ability of the protist microbiome and tryptophan metabolites, derived from them or other sources, to modulate the adaptive immune compartment, particularly in the context of gut inflammatory disorders.

HFE
Also flagged:Type 2 Diabetesleft ventricular dysfunctionaortic stenosisASphosphorusphosphocreatine
Journal Article 2023-09-25 ✓ 1 Snippet Jex N, Greenwood JP, Cubbon RM, Rider OJ, Chowdhary A, Thirunavukarasu S, Kotha S, Giannoudi M, McGrane A, Maccannell A, Conning-Rowland M, Straw S, Procter H, Papaspyros S, Evans B, Javangula K, Ferrara A, Elmahdy W, Kaul P, Xue H, Swoboda P, Kellman P, Valkovič L, Roberts L, Beech D, Kearney MT, Plein S, Dweck MR, Levelt E.
In-Text Gene Mentions

…accumulation diseases [eg,hemochromatosis, Fabry disease], or…

Show Full Abstract

<h4>Background</h4>Type 2 diabetes (T2D) is associated with an increased risk of left ventricular dysfunction after aortic valve replacement (AVR) in patients with severe aortic stenosis (AS). Persistent impairments in myocardial energetics and myocardial blood flow (MBF) may underpin this observation. Using phosphorus magnetic resonance spectroscopy and cardiovascular magnetic resonance, this study tested the hypothesis that patients with severe AS and T2D (AS-T2D) would have impaired myocardial energetics as reflected by the phosphocreatine to ATP ratio (PCr/ATP) and vasodilator stress MBF compared with patients with AS without T2D (AS-noT2D), and that these differences would persist after AVR.<h4>Methods</h4>Ninety-five patients with severe AS without coronary artery disease awaiting AVR (30 AS-T2D and 65 AS-noT2D) were recruited (mean, 71 years of age [95% CI, 69, 73]; 34 [37%] women). Thirty demographically matched healthy volunteers (HVs) and 30 patients with T2D without AS (T2D controls) were controls. One month before and 6 months after AVR, cardiac PCr/ATP, adenosine stress MBF, global longitudinal strain, NT-proBNP (N-terminal pro-B-type natriuretic peptide), and 6-minute walk distance were assessed in patients with AS. T2D controls underwent identical assessments at baseline and 6-month follow-up. HVs were assessed once and did not undergo 6-minute walk testing.<h4>Results</h4>Compared with HVs, patients with AS (AS-T2D and AS-noT2D combined) showed impairment in PCr/ATP (mean [95% CI]; HVs, 2.15 [1.89, 2.34]; AS, 1.66 [1.56, 1.75]; <i>P</i><0.0001) and vasodilator stress MBF (HVs, 2.11 mL min g [1.89, 2.34]; AS, 1.54 mL min g [1.41, 1.66]; <i>P</i><0.0001) before AVR. Before AVR, within the AS group, patients with AS-T2D had worse PCr/ATP (AS-noT2D, 1.74 [1.62, 1.86]; AS-T2D, 1.44 [1.32, 1.56]; <i>P</i>=0.002) and vasodilator stress MBF (AS-noT2D, 1.67 mL min g [1.5, 1.84]; AS-T2D, 1.25 mL min g [1.22, 1.38]; <i>P</i>=0.001) compared with patients with AS-noT2D. Before AVR, patients with AS-T2D also had worse PCr/ATP (AS-T2D, 1.44 [1.30, 1.60]; T2D controls, 1.66 [1.56, 1.75]; <i>P</i>=0.04) and vasodilator stress MBF (AS-T2D, 1.25 mL min g [1.10, 1.41]; T2D controls, 1.54 mL min g [1.41, 1.66]; <i>P</i>=0.001) compared with T2D controls at baseline. After AVR, PCr/ATP normalized in patients with AS-noT2D, whereas patients with AS-T2D showed no improvements (AS-noT2D, 2.11 [1.79, 2.43]; AS-T2D, 1.30 [1.07, 1.53]; <i>P</i>=0.0006). Vasodilator stress MBF improved in both AS groups after AVR, but this remained lower in patients with AS-T2D (AS-noT2D, 1.80 mL min g [1.59, 2.0]; AS-T2D, 1.48 mL min g [1.29, 1.66]; <i>P</i>=0.03). There were no longer differences in PCr/ATP (AS-T2D, 1.44 [1.30, 1.60]; T2D controls, 1.51 [1.34, 1.53]; <i>P</i>=0.12) or vasodilator stress MBF (AS-T2D, 1.48 mL min g [1.29, 1.66]; T2D controls, 1.60 mL min g [1.34, 1.86]; <i>P</i>=0.82) between patients with AS-T2D after AVR and T2D controls at follow-up. Whereas global longitudinal strain, 6-minute walk distance, and NT-proBNP all improved after AVR in patients with AS-noT2D, no improvement in these assessments was observed in patients with AS-T2D.<h4>Conclusions</h4>Among patients with severe AS, those with T2D demonstrate persistent abnormalities in myocardial PCr/ATP, vasodilator stress MBF, and cardiac contractile function after AVR; AVR effectively normalizes myocardial PCr/ATP, vasodilator stress MBF, and cardiac contractile function in patients without T2D.

HTT
Also flagged:neurotransmitter receptorglucosemetabolismorganizationneurodevelopmental disordersgene expression
Journal Article 2023-09-25 ✓ 2 Snippets Hansen JY, Shafiei G, Voigt K, Liang EX, Cox SML, Leyton M, Jamadar SD, Misic B.
In-Text Gene Mentions

The receptors/transporters span 9 neurotransmitter systems including: dopamine (D1, D2, DAT), norepinephrine (NET), serotonin (5-HT1A, 5-HT1B, 5-HT2, 5-HT4, 5-HT6, 5-HTT), acetylcholine (α4β2, M1, VAChT), glutamate (mGluR5), GABA (GABAA), histamine (H3), cannabinoid (CB1), and opioid (MOR).

…5-HT2, 5-HT4, 5-HT6, 5-HTT), acetylcholine ( α…

Show Full Abstract

The brain is composed of disparate neural populations that communicate and interact with one another. Although fiber bundles, similarities in molecular architecture, and synchronized neural activity all reflect how brain regions potentially interact with one another, a comprehensive study of how all these interregional relationships jointly reflect brain structure and function remains missing. Here, we systematically integrate 7 multimodal, multiscale types of interregional similarity ("connectivity modes") derived from gene expression, neurotransmitter receptor density, cellular morphology, glucose metabolism, haemodynamic activity, and electrophysiology in humans. We first show that for all connectivity modes, feature similarity decreases with distance and increases when regions are structurally connected. Next, we show that connectivity modes exhibit unique and diverse connection patterns, hub profiles, spatial gradients, and modular organization. Throughout, we observe a consistent primacy of molecular connectivity modes-namely correlated gene expression and receptor similarity-that map onto multiple phenomena, including the rich club and patterns of abnormal cortical thickness across 13 neurological, psychiatric, and neurodevelopmental disorders. Finally, to construct a single multimodal wiring map of the human cortex, we fuse all 7 connectivity modes and show that the fused network maps onto major organizational features of the cortex including structural connectivity, intrinsic functional networks, and cytoarchitectonic classes. Altogether, this work contributes to the integrative study of interregional relationships in the human cerebral cortex.

HTT
Also flagged:Autophagydegradationorganellesagingneurodegenerative diseasesautophagy receptor
Journal Article 2023-09-25 ✓ 1 Snippet Jiang Z, Kuo YH, Arkin MR.
In-Text Gene Mentions

This result is reasonableas the cytoplasmic presence of truncated TP53INP2 has been shown totrigger the LC3-II production and autophagosome formation.42 Furthermore, we assessed if the ubiquitin–proteasomesystem (UPS) contributed to the AceTAC degraders by treatment of carfilzomib,an irreversible proteasome inhibitor.43 Upon carfilzomib-treatment, no significant difference was observedbetween the degraders and the control group for HTT-103Q degradation(Figure S29).

Show Full Abstract

Autophagy is responsible for the degradation of large intracellular contents, such as unwanted protein aggregates and organelles. Impaired autophagy can therefore lead to the accumulation of pathological aggregates, correlating with aging and neurodegenerative diseases. However, a broadly applicable methodology is not available for the targeted degradation of protein aggregates or organelles in mammalian cells. Herein, we developed a series of autophagy receptor-inspired targeting chimeras (AceTACs) that can induce the targeted degradation of aggregation-prone proteins and protein aggregates (e.g., huntingtin, TDP-43, and FUS mutants), as well as organelles (e.g., mitochondria, peroxisomes, and endoplasmic reticulum). These antibody-fusion-based AceTAC degraders were designed to mimic the function of autophagy receptors, simultaneously binding with the cellular targets and the LC3 proteins on the autophagosomal membrane, eventually transporting the target to the autophagy-lysosomal process for degradation. The AceTAC degradation system provides design principles for antibody-based degradation through autophagy, largely expanding the scope of intracellular targeted degradation technologies.

Also flagged:psychiatric disorders5Serotonin5-HT 2A Receptor5-Hydroxytryptamine (5-HT 2A ) receptors
Journal Article 2023-09-25 No Snippets Chavan LN, Voll R, Sanchez MM, Nye JA, Goodman MM.
Show Full Abstract

5-Hydroxytryptamine (5-HT<sub>2A</sub>) receptors play an important role in several psychiatric disorders. In order to investigate the serotonin (5-HT) receptor <i>in vivo</i>, reliable syntheses are required for positron emission tomography (PET) 5-HT radioligands. Owing to the excellent <i>in vivo</i> properties of [<sup>18</sup>F]MDL100907 for PET, there has been great interest to develop a novel synthetic route for [<sup>18</sup>F]MDL100907. Here, we report a highly efficient, scalable, and expedient synthesis for [<sup>18</sup>F]MDL100907. The radiofluorination was performed on a <sup>18</sup>F-labeling boron pinacol ester precursor, which is synthesized using the Liebeskind-Srogl cross-coupling reaction as a key step. Our method is practically more suitable to employ late-stage Cu-mediated radiofluorination and facilitate the production of the [<sup>18</sup>F]MDL100907 radioligand in excellent decay-corrected RCY of 32 ± 10% (<i>n</i> = 7) within 60 min. We prepared [<sup>18</sup>F]MDL100907 in high molar activity (2.1 Ci/μmol) and compared it to [<sup>11</sup>C]MDL100907 in the brain of a nonhuman primate.

GPR52
Also flagged:sucraloseβ-arrestinG protein-coupled receptorsugarsmetabolismG protein-coupled receptors
Journal Article 2023-09-25 ✓ 5 Snippets Power ME, Fernandez NR, Oni OP, Kalia A, Rourke JL.
In-Text Gene Mentions

GPR52 was the sole receptor that significantly responded to a mixture of sucralose and saccharin.

GPR52 constitutively activates CRE pathways; however, we show that sucralose-induced activation of GPR52 does not further activate this pathway.

Identification of this novel sucralose-GPCR interaction supports the notion that sucralose elicits off-target signaling through the activation of GPR52, calling into question sucralose's assumed lack of bioactivity.

…G protein-coupled receptorGPR52.…

GPR52was the sole…

Show Full Abstract

Non-nutritive sweeteners are popular food additives owing to their low caloric density and powerful sweetness relative to natural sugars. Their lack of metabolism contributes to evidence proclaiming their safety, yet several studies contradict this, demonstrating that sweeteners activate sweet taste G protein-coupled receptors (GPCRs) and elicit deleterious metabolic functions through unknown mechanisms. We hypothesize that activation of GPCRs, particularly orphan receptors due to their abundance in metabolically active tissues, contributes to the biological activity of sweeteners. We quantified the response of 64 orphans to the sweeteners saccharin and sucralose using a high-throughput β-arrestin-2 recruitment assay (PRESTO-Tango). GPR52 was the sole receptor that significantly responded to a mixture of sucralose and saccharin. Subsequent experiments revealed sucralose as the activating sweetener. Activation of GPR52 was concentration-dependent, with an EC<sub>50</sub> of 0.23 mmol/L and an Emax of 3.43 ± 0.24 fold change at 4 mmol/L. GPR52 constitutively activates CRE pathways; however, we show that sucralose-induced activation of GPR52 does not further activate this pathway. Identification of this novel sucralose-GPCR interaction supports the notion that sucralose elicits off-target signaling through the activation of GPR52, calling into question sucralose's assumed lack of bioactivity.

CACNA1E
Also flagged:Movement Disordersepileptic encephalopathiesgenetic diseasesdystoniachoreaataxia
Journal Article 2023-09-25 ✓ 1 Snippet van der Veen S, Tse GTW, Ferretti A, Garone G, Post B, Specchio N, Fung VSC, Trivisano M, Scheffer IE.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<h4>Background and objectives</h4>Movement disorders (MDs) are underrecognized in the developmental and epileptic encephalopathies (DEEs). There are now more than 800 genes implicated in causing the DEEs; relatively few of these rare genetic diseases are known to be associated with MDs. We identified patients with genetic DEEs who had MDs, classified the nature of their MDs, and asked whether specific patterns correlated with the underlying mechanism.<h4>Methods</h4>We classified the type of MDs associated with specific genetic DEEs in a large international cohort of patients and analyzed whether specific patterns of MDs reflected the underlying biological dysfunction.<h4>Results</h4>Our cohort comprised 77 patients with a genetic DEE with a median age of 9 (range 1-38) years. Stereotypies (37/77, 48%) and dystonia (34/77, 44%) were the most frequent MDs, followed by chorea (18/77, 23%), myoclonus (14/77, 18%), ataxia (9/77, 12%), tremor (7/77, 9%), and hypokinesia (6/77, 8%). In 47% of patients, a combination of MDs was seen. The MDs were first observed at a median age of 18 months (range day 2-35 years). Dystonia was more likely to be observed in nonambulatory patients, while ataxia was less likely. In 46% of patients, therapy was initiated with medication (34/77, 44%), deep brain stimulation (1/77, 1%), or intrathecal baclofen (1/77, 1%). We found that patients with channelopathies or synaptic vesicle trafficking defects were more likely to experience dystonia; whereas, stereotypies were most frequent in individuals with transcriptional defects.<h4>Discussion</h4>MDs are often underrecognized in patients with genetic DEEs, but recognition is critical for the management of these complex neurologic diseases. Distinguishing MDs from epileptic seizures is important in tailoring patient treatment. Understanding which MDs occur with different biological mechanisms will inform early diagnosis and management.

HFE
Also flagged:REPIN1ironmetabolismOsteoporosisDNA binding protein-overload
Journal Article 2023-09-25 ✓ 1 Snippet Xia Y, Ge G, Xiao H, Wu M, Wang T, Gu C, Yang H, Geng D.
In-Text Gene Mentions

…liver diseases andhemochromatosis[ 38 –…

Show Full Abstract

Osteoporosis is not well treated due to the difficulty of finding commonalities between the various types of it. Iron homeostasis is a vital component in supporting biochemical functions, and iron overload is recognized as a common risk factor for osteoporosis. In this research, we found that there is indeed evidence of iron accumulation in the bone tissue of patients with osteoporosis and REPIN1, as an origin specific DNA binding protein, may play a key role in this process. We revealed that sh-Repin1 therapy can rescue bone loss in an iron-overload-induced osteoporosis mouse model. Knockdown of Repin1 can inhibit apoptosis and enhance the resistance of osteoblasts to iron overload toxicity. REPIN1 promoted apoptosis by regulating iron metabolism in osteoblasts. Mechanistically, knockdown of Repin1 decreased the expression of Lcn2, which ameliorated the toxic effects of intracellular iron overload. The anti-iron effect of lentivirus sh-Repin1 was partially reversed or replicated by changing LCN2 expression level via si-RNA or plasmid, which indirectly verified the key regulatory role of LCN2 as a downstream target. Furthermore, the levels of BCL2 and BAX, which play a key role in the mitochondrial apoptosis pathway, were affected. In summary, based on the results of clinical specimens, animal models and in vitro experiments, for the first time, we proved the key role of REPIN1 in iron metabolism-related osteoporosis.

CSE1LSTAU1
Also flagged:cancercolorectal cancerAKTPREX1gene expressioncancers
Journal Article 2023-09-25 ✓ 5 Snippets Ying P, Chen C, Lu Z, Chen S, Zhang M, Cai Y, Zhang F, Huang J, Fan L, Ning C, Li Y, Wang W, Geng H, Liu Y, Tian W, Yang Z, Liu J, Huang C, Yang X, Xu B, Li H, Zhu X, Li N, Li B, Wei Y, Zhu Y, Tian J, Miao X.
In-Text Gene Mentions
⭐ same-sentence co-mention

To investigate the potential roles of PREX1, CSE1L and STAU1 in CRC pathogenesis, we first compared the expression of these three genes in tumor and adjacent normal tissues in GEO and our own CRC tissues.

⭐ same-sentence co-mention

Interestingly, the group within overexpression of three genes PREX1, CSE1L and STAU1 presented a largest tumor volume among all tested groups (Figs. 6d and S15c).

⭐ same-sentence co-mention

Similarly, H&E staining and immunohistochemical analysis (Ki67, PREX1, CSE1L and STAU1) also support the synergistic effect of three genes on tumor growth (Figs. 6d and S15c).

⭐ same-sentence co-mention

In accordance with results in cell lines, the results showed that the growth of xenograft tumors with PREX1, CSE1L or STAU1 overexpression is substantially increased, compared with that of control tumors.

⭐ same-sentence co-mention

Results showed that PREX1, CSE1L and STAU1 were significantly overexpressed in tumor tissues than in normal tissues in both cohorts (Fig. S14).

Show Full Abstract

Genome-wide association studies have identified numerous variants associated with human complex traits, most of which reside in the non-coding regions, but biological mechanisms remain unclear. However, assigning function to the non-coding elements is still challenging. Here we apply Activity-by-Contact (ABC) model to evaluate enhancer-gene regulation effect by integrating multi-omics data and identified 544,849 connections across 20 cancer types. ABC model outperforms previous approaches in linking regulatory variants to target genes. Furthermore, we identify over 30,000 enhancer-gene connections in colorectal cancer (CRC) tissues. By integrating large-scale population cohorts (23,813 cases and 29,973 controls) and multipronged functional assays, we demonstrate an ABC regulatory variant rs4810856 associated with CRC risk (Odds Ratio = 1.11, 95%CI = 1.05-1.16, P = 4.02 × 10<sup>-5</sup>) by acting as an allele-specific enhancer to distally facilitate PREX1, CSE1L and STAU1 expression, which synergistically activate p-AKT signaling. Our study provides comprehensive regulation maps and illuminates a single variant regulating multiple genes, providing insights into cancer etiology.

SOX6
Also flagged:Angularosteochondrosischromosomeangiogenesischondrocyte proliferationpathogenesis
Journal Article 2023-09-25 ✓ 5 Snippets Becker GM, Shira KA, Woods JL, Khilji SF, Schauer CS, Webb BT, Stewart WC, Murdoch BM.
In-Text Gene Mentions

…bone growth, includingSOX6, SOX9 and RUNX2.…

…at rs427563170 andSOX6at rs416810983.…

…expression of SOX5,SOX6and SOX9 transcription…

…downregulation of SOX5,SOX6, SOX9 and collagen…

…The predictedSOX6TFBS showed loss…

Show Full Abstract

Angular limb deformity (ALD) affects many species of livestock and companion animals. The mechanisms of ALD development are not well understood, but previous research suggests the involvement of genetic risk factors. A case-control genome-wide association study (GWAS) was conducted with 40 ALD-affected and 302 unaffected Rambouillet rams and 40,945 single nucleotide polymorphisms (SNPs). Forelimbs of 6 ALD-affected rams were examined and diagnosed with osteochondrosis. Genome-wide or chromosome-wide significant SNPs were positioned exonic, intronic or within the 3'UTR of genes TSPAN18, NRG3 and NOVA2, respectively. These genes have previously described roles related to angiogenesis and osteoblast, osteoclast and chondrocyte proliferation and differentiation, which suggests the possibility for their involvement in the pathogenesis of osteochondrosis. Functional consequences of SNPs were evaluated through transcription factor binding site analysis, which predicted binding sites for transcription factors of known importance to bone growth, including SOX6, SOX9 and RUNX2. The identification of genetic risk factors for ALD may help to improve animal welfare and production in Rambouillet, a breed known to be at risk for ALD development. This study proposes genes TSPAN18, NRG3 and NOVA2 as targets for further research towards understanding the etiology of ALD in Rambouillet sheep.

Also flagged:MBPGFPisopropylampicillinureamercaptoethanol
Journal Article 2023-09-25 No Snippets Linsenmeier M, Faltova L, Morelli C, Capasso Palmiero U, Seiffert C, Küffner AM, Pinotsi D, Zhou J, Mezzenga R, Arosio P.
Show Full Abstract

The maturation of liquid-like protein condensates into amyloid fibrils has been associated with several neurodegenerative diseases. However, the molecular mechanisms underlying this liquid-to-solid transition have remained largely unclear. Here we analyse the amyloid formation mediated by condensation of the low-complexity domain of hnRNPA1, a protein involved in amyotrophic lateral sclerosis. We show that phase separation and fibrillization are connected but distinct processes that are modulated by different regions of the protein sequence. By monitoring the spatial and temporal evolution of amyloid formation we demonstrate that the formation of fibrils does not occur homogeneously inside the droplets but is promoted at the interface of the condensates. We further show that coating the interface of the droplets with surfactant molecules inhibits fibril formation. Our results reveal that the interface of biomolecular condensates of hnRNPA1 promotes fibril formation, therefore suggesting interfaces as a potential novel therapeutic target against the formation of aberrant amyloids mediated by condensation.

DCC
Also flagged:IL-12Interleukin-12IL-12 receptorIL-12Rexperimental autoimmune encephalomyelitismultiple sclerosis
Journal Article 2023-09-25 ✓ 1 Snippet Andreadou M, Ingelfinger F, De Feo D, Cramer TLM, Tuzlak S, Friebel E, Schreiner B, Eede P, Schneeberger S, Geesdorf M, Ridder F, Welsh CA, Power L, Kirschenbaum D, Tyagarajan SK, Greter M, Heppner FL, Mundt S, Becher B.
In-Text Gene Mentions

…( Pak5 ,Dcc, Ephb1 ,…

Show Full Abstract

Interleukin-12 (IL-12) is a potent driver of type 1 immunity. Paradoxically, in autoimmune conditions, including of the CNS, IL-12 reduces inflammation. The underlying mechanism behind these opposing properties and the involved cellular players remain elusive. Here we map IL-12 receptor (IL-12R) expression to NK and T cells as well as neurons and oligodendrocytes. Conditionally ablating the IL-12R across these cell types in adult mice and assessing their susceptibility to experimental autoimmune encephalomyelitis revealed that the neuroprotective role of IL-12 is mediated by neuroectoderm-derived cells, specifically neurons, and not immune cells. In human brain tissue from donors with multiple sclerosis, we observe an IL-12R distribution comparable to mice, suggesting similar mechanisms in mice and humans. Combining flow cytometry, bulk and single-nucleus RNA sequencing, we reveal an IL-12-induced neuroprotective tissue adaption preventing early neurodegeneration and sustaining trophic factor release during neuroinflammation, thereby maintaining CNS integrity in mice.

PEBP1
Also flagged:metastasis suppressor geneMSGtumormitogen-activated protein kinaseG-protein-coupled receptorsNM23
Journal Article 2023-09-25 ✓ 1 Snippet Gelman IH.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Since the identification of NM23 (now called NME1) as the first metastasis suppressor gene (MSG), a small number of other gene products and non-coding RNAs have been identified that suppress specific parameters of the metastatic cascade, yet which have little or no ability to regulate primary tumor initiation or maintenance. MSG can regulate various pathways or cell biological functions such as those controlling mitogen-activated protein kinase pathway mediators, cell-cell and cell-extracellular matrix protein adhesion, cytoskeletal architecture, G-protein-coupled receptors, apoptosis, and transcriptional complexes. One defining facet of this gene class is that their expression is typically downregulated, not mutated, in metastasis, such that any effective therapeutic intervention would involve their re-expression. This review will address the therapeutic targeting of MSG, once thought to be a daunting task only facilitated by ectopically re-expressing MSG in metastatic cells in vivo. Examples will be cited of attempts to identify actionable oncogenic pathways that might suppress the formation or progression of metastases through the re-expression of specific metastasis suppressors.

HFE
Also flagged:estrogen receptor-αfatty liver diseaseFLDliver diseasemenopausepatatin-like phospholipase domain-containing 3
Journal Article 2023-09-25 ✓ 1 Snippet Cherubini A, Ostadreza M, Jamialahmadi O, Pelusi S, Rrapaj E, Casirati E, Passignani G, Norouziesfahani M, Sinopoli E, Baselli G, Meda C, Dongiovanni P, Dondossola D, Youngson N, Tourna A, Chokshi S, Bugianesi E, EPIDEMIC Study Investigators, Della Torre S, Prati D, Romeo S, Valenti L.
In-Text Gene Mentions

…drug-induced liver injury,hemochromatosis, α 1 -antitrypsin…

Show Full Abstract

Fatty liver disease (FLD) caused by metabolic dysfunction is the leading cause of liver disease and the prevalence is rising, especially in women. Although during reproductive age women are protected against FLD, for still unknown and understudied reasons some develop rapidly progressive disease at the menopause. The patatin-like phospholipase domain-containing 3 (PNPLA3) p.I148M variant accounts for the largest fraction of inherited FLD variability. In the present study, we show that there is a specific multiplicative interaction between female sex and PNPLA3 p.I148M in determining FLD in at-risk individuals (steatosis and fibrosis, P < 10<sup>-10</sup>; advanced fibrosis/hepatocellular carcinoma, P = 0.034) and in the general population (P < 10<sup>-7</sup> for alanine transaminase levels). In individuals with obesity, hepatic PNPLA3 expression was higher in women than in men (P = 0.007) and in mice correlated with estrogen levels. In human hepatocytes and liver organoids, PNPLA3 was induced by estrogen receptor-α (ER-α) agonists. By chromatin immunoprecipitation and luciferase assays, we identified and characterized an ER-α-binding site within a PNPLA3 enhancer and demonstrated via CRISPR-Cas9 genome editing that this sequence drives PNPLA3 p.I148M upregulation, leading to lipid droplet accumulation and fibrogenesis in three-dimensional multilineage spheroids with stellate cells. These data suggest that a functional interaction between ER-α and PNPLA3 p.I148M variant contributes to FLD in women.

HTT
Also flagged:sepsisinfectionRNA binding proteinRBPgene expressionDDX24
Journal Article 2023-09-25 ✓ 1 Snippet Tuerdimaimaiti D, Abuduaini B, Kang S, Jiao J, Li M, Madeniyati W, Tuerdi B, Aili G, Tuerhong R, Kulaxi A.
In-Text Gene Mentions

…including SHISA5, IFI27,HTT, MCL1, NR3C1, DELE1,…

Show Full Abstract

<h4>Background</h4>An increasing body of evidence now shows that the long-term mortality of patients with sepsis are associated with various sepsis-related immune cell defects. Alternative splicing (AS), as a sepsis-related immune cell defect, is considered as a potential immunomodulatory therapy target to improve patient outcomes. However, our understanding of the role AS plays in sepsis is currently insufficient.<h4>Aim</h4>This study investigated possible associations between AS and the gene regulatory networks affecting immune cells. We also investigated apoptosis and AS functionality in sepsis pathophysiology.<h4>Methods</h4>In this study, we assessed publicly available mRNA-seq data that was obtained from the NCBI GEO dataset (GSE154918), which included a healthy group (HLTY), a mild infection group (INF1), asepsis group (Seps), and a septic shock group (Shock). A total of 79 samples (excluding significant outliers) were identified by a poly-A capture method to generate RNA-seq data. The variable splicing events and highly correlated RNA binding protein (RBP) genes in each group were then systematically analyzed.<h4>Results</h4>For the first time, we used systematic RNA-seq analysis of sepsis-related AS and identified 1505 variable AS events that differed significantly (p <= 0.01) across the four groups. In the sepsis group, the genes related to significant AS events, such as, SHISA5 and IFI27, were mostly enriched in the cell apoptosis pathway. Furthermore, we identified differential splicing patterns within each of the four groups. Significant differences in the expression of RNA Binding Protein(RBP) genes were observed between the control group and the sepsis group. RBP gene expression was highly correlated with variant splicing events in sepsis, as determined by co-expression analysis; The expression of DDX24, CBFA2T2, NOP, ILF3, DNMT1, FTO, PPRC1, NOLC1 RBPs were significant reduced in sepsis compared to the healthy group. Finally, we constructed an RBP-AS functional network.<h4>Conclusion</h4>Analysis indicated that the RBP-AS functional network serves as a critical post-transcriptional mechanism that regulates the development of sepsis. AS dysregulation is associated with alterations in the regulatory gene expression network that is involved in sepsis. Therefore, the RBP-AS expression network could be useful in refining biomarker predictions in the development of new therapeutic targets for the pathogenesis of sepsis.

ZNF644
Also flagged:myopiahigh myopiaOPN1LWRP2GPR143FRMD7
Journal Article 2023-09-25 ✓ 1 Snippet Zi F, Li Z, Cheng W, Huang X, Sheng X, Rong W.
In-Text Gene Mentions

…been identified, includingZNF644[ 6 ],…

Show Full Abstract

<h4>Purpose</h4>To report novel pathogenic variants of X-linked genes in five Chinese families with early-onset high myopia (eoHM) by using whole-exome sequencing and analyzing the phenotypic features.<h4>Methods</h4>5 probands with X-linked recessive related eoHM were collected in Ningxia Eye Hospital from January 2021 to June 2022. The probands and their family members received comprehensive ophthalmic examinations,and DNA was abstracted from patients and family members. Whole-exome sequencing was performed on probands to screen the causative variants, and all suspected pathogenic variants were determined by Sanger sequencing and co-segregation analysis was performed on available family members. The pathogenicity of novel variants was predicted using silico analysis and evaluated according to ACMG guidelines. RT-qPCR was used to detect differences in the relative mRNAs expression of candidate gene in mRNAs available with the proband and family members in the pedigree 2. The relationship between genetic variants and clinical features was analyzed.<h4>Results</h4>All probands were male, and all pedigrees conformed to an X-linked recessive inheritance pattern. They were diagnosed with high myopia at their first visits between 4 and 7 years old. Spherical equivalent ranged between - 6.00D and - 11.00D.The five novel hemizygous variants were found in the probands, containing frameshift deletion variant c.797_801del (p.Val266Alafs*75) of OPN1LW gene in the pedigree 1, nonsense variant c.513G > A (p.Trp171Ter)of RP2 gene in the pedigree 2, missense variant c.98G > T (p.Cys33Phe) of GPR143 gene in the pedigree 3, frameshift deletion variant c.1876_1877del (p.Met626Valfs*22) of FRMD7 gene in the pedigree 4 and inframe deletion variant c.670_ 675del (p.Glu192_ Glu193del) of HMGB3 gene in the pedigree 5. All variants were classified as pathogenic or likely pathogenic by the interpretation principles of HGMD sequence variants and ACMG guidelines. In family 2, RT-qPCR showed that the mRNA expression of RP2 gene was lower in the proband than in other normal family members, indicating that such variant caused an effect on gene function at the mRNA expression level. Further clinical examination showed that pedigrees 1, 2, 3, and 4 were diagnosed as X-linked recessive hereditary eye disease with early-onset high myopia, including quiescent cone dysfunction, retinitis pigmentosa, ocular albinism, and idiopathic congenital nystagmus respectively. The pedigree 5 had eoHM in the right eye and ptosis in both eyes.<h4>Conclusion</h4>In this paper,we are the first to report five novel hemizygous variants in OPN1LW, RP2, GPR143, FRMD7, HMGB3 genes are associated with eoHM. Our study extends the genotypic spectrums for eoHM and better assists ophthalmologists in assessing, diagnosing, and conducting genetic screening for eoHM.

LRRC7ARFGEF2
Also flagged:Agap3gene expressionGTPaseankyrin repeataminohydroxy
Journal Article 2023-09-25 ✓ 2 Snippets Højgaard K, Szöllősi B, Henningsen K, Minami N, Nakanishi N, Kaadt E, Tamura M, Morris RGM, Takeuchi T, Elfving B.
In-Text Gene Mentions

…, Nsf ,Lrrc7, Ppp1r9a , Dpysl3…

…genes, including Tnik,Arfgef2, Cfl1, Rasgrf2, Wasf1,…

Show Full Abstract

Novelty-induced memory consolidation is a well-established phenomenon that depends on the activation of a locus coeruleus-hippocampal circuit. It is associated with the expression of activity-dependent genes that may mediate initial or cellular memory consolidation. Several genes have been identified to date, however, to fully understand the mechanisms of memory consolidation, additional candidates must be identified. In this cross-species study, we used a contextual novelty-exploration paradigm to identify changes in gene expression in the dorsal hippocampus of both mice and rats. We found that changes in gene expression following contextual novelty varied between the two species, with 9 genes being upregulated in mice and 3 genes in rats. Comparison across species revealed that ArfGAP with a GTPase domain, an ankyrin repeat and PH domain 3 (Agap3) was the only gene being upregulated in both, suggesting a potentially conserved role for Agap3. AGAP3 is known to regulate α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-type glutamate receptor trafficking in the synapse, which suggests that increased transcription of Agap3 may be involved in maintaining functional plasticity. While we identified several genes affected by contextual novelty exploration, we were unable to fully reverse these changes using SCH 23390, a dopamine D<sub>1</sub>/D<sub>5</sub> receptor antagonist. Further research on the role of AGAP3 in novelty-induced memory consolidation could lead to better understanding of this process and guide future research.

Also flagged:Endometrial cancercancerendometroidendometrial carcinomaendometrial carcinomasendometroid carcinomas
Journal Article 2023-09-25 No Snippets Navaridas R, Vidal-Sabanés M, Ruiz-Mitjana A, Ruiz-Mitjana A, Altés G, Perramon-Güell A, Yeramian A, Egea J, Encinas M, Gatius S, Matias-Guiu X, Dolcet X.
Show Full Abstract

Phosphatase and TENsin homolog (Pten) and p53 are two of the most frequently mutated tumor suppressor genes in endometrial cancer. However, the functional consequences and histopathological manifestation of concomitant p53 and Pten loss of function alterations in the development of endometrial cancer is still controversial. Here, it is demonstrated that simultaneous Pten and p53 deletion is sufficient to cause epithelial to mesenchymal transition phenotype in endometrial organoids. By a novel intravaginal delivery method using HIV1 trans-activator of transcription cell penetrating peptide fused with a Cre recombinase protein (TAT-Cre), local ablation of both p53 and Pten is achieved specifically in the uterus. These mice developed high-grade endometrial carcinomas and a high percentage of uterine carcinosarcomas resembling those found in humans. To further demonstrate that carcinosarcomas arise from epithelium, double Pten/p53 deficient epithelial cells are mixed with wild type stromal and myometrial cells and subcutaneously transplanted to Scid mice. All xenotransplants resulted in the development of uterine carcinosarcomas displaying high nuclear pleomorphism and metastatic potential. Accordingly, in vivo CRISPR/Cas9 disruption of Pten and p53 also triggered the development of metastatic carcinosarcomas. The results unfadingly demonstrate that simultaneous deletion of p53 and Pten in endometrial epithelial cells is enough to trigger epithelial to mesenchymal transition that is consistently translated to the formation of uterine carcinosarcomas in vivo.

NEGR1
Also flagged:neurofibromastumorneurofibromatosis type 1NF1diffuse neurofibromascutaneous neurofibromas
Journal Article 2023-09-25 ✓ 5 Snippets McLean DT, Meudt JJ, Lopez Rivera LD, Schomberg DT, Pavelec DM, Duellman TT, Buehler DG, Schwartz PB, Graham M, Lee LM, Graff KD, Reichert JL, Bon-Durant SS, Konsitzke CM, Ronnekleiv-Kelly SM, Shanmuganayagam D, Rubinstein CD.
In-Text Gene Mentions

Loss of NEGR1 in development is associated with decreased numbers of synapses and dendritic length, resulting in anxiety and depression-like behaviors in mice (100).

…These genes includedNEGR1, MYOC, EPHA3, COL15A1,…

…Specifically, EPHA3 andNEGR1are primarily expressed…

…Loss ofNEGR1in development is…

…include CRLF1, SERPINE2,NEGR1, GRIA2, NRXN1, SOX9…

Show Full Abstract

Neurofibromatosis Type 1 (NF1) is one of the most common genetically inherited disorders that affects 1 in 3000 children annually. Clinical manifestations vary widely but nearly always include the development of cutaneous, plexiform and diffuse neurofibromas that are managed over many years. Recent single-cell transcriptomics profiling efforts of neurofibromas have begun to reveal cell signaling processes. However, the cell signaling networks in mature, non-cutaneous neurofibromas remain unexplored. Here, we present insights into the cellular composition and signaling within mature neurofibromas, contrasting with normal adjacent tissue, in a porcine model of NF1 using single-cell RNA sequencing (scRNA-seq) analysis and histopathological characterization. These neurofibromas exhibited classic diffuse-type histologic morphology and expected patterns of S100, SOX10, GFAP, and CD34 immunohistochemistry. The porcine mature neurofibromas closely resemble human neurofibromas histologically and contain all known cellular components of their human counterparts. The scRNA-seq confirmed the presence of all expected cell types within these neurofibromas and identified novel populations of fibroblasts and immune cells, which may contribute to the tumor microenvironment by suppressing inflammation, promoting M2 macrophage polarization, increasing fibrosis, and driving the proliferation of Schwann cells. Notably, we identified tumor-associated <i>IDO1</i> <sup>+</sup>/CD274<sup>+</sup> (<i>PD-L1)</i> <sup>+</sup> dendritic cells, which represent the first such observation in any NF1 animal model and suggest the role of the upregulation of immune checkpoints in mature neurofibromas. Finally, we observed that cell types in the tumor microenvironment are poised to promote immune evasion, extracellular matrix reconstruction, and nerve regeneration.

Also flagged:ExtracellularVesiclesextracellular vesiclesinflammatory responsesbirth-associatedmembrane
Journal Article 2023-09-25 No Snippets Russo E, Alberti G, Corrao S, Borlongan CV, Miceli V, Conaldi PG, Di Gaudio F, La Rocca G.
Show Full Abstract

The potential of perinatal tissues to provide cellular populations to be used in different applications of regenerative medicine is well established. Recently, the efforts of researchers are being addressed regarding the evaluation of cell products (secreted molecules or extracellular vesicles, EVs) to be used as an alternative to cellular infusion. The data regarding the effective recapitulation of most perinatal cells' properties by their secreted complement point in this direction. EVs secreted from perinatal cells exhibit key therapeutic effects such as tissue repair and regeneration, the suppression of inflammatory responses, immune system modulation, and a variety of other functions. Although the properties of EVs from perinatal derivatives and their significant potential for therapeutic success are amply recognized, several challenges still remain that need to be addressed. In the present review, we provide an up-to-date analysis of the most recent results in the field, which can be addressed in future research in order to overcome the challenges that are still present in the characterization and utilization of the secreted complement of perinatal cells and, in particular, mesenchymal stromal cells.

Also flagged:Calcium phosphateapatitehydroxyapatitemineralcationsanions
Journal Article 2023-09-25 No Snippets Anwar A, Kanwal Q, Sadiqa A, Razaq T, Khan IH, Javaid A, Khan S, Tag-Eldin E, Ouladsmane M.
Show Full Abstract

Continuous microwave-assisted flow synthesis has been used as a simple, more efficient, and low-cost route to fabricate a range of nanosized (<100 nm) strontium-substituted calcium phosphates. In this study, fine nanopowder was synthesized via a continuous flow synthesis with microwave assistance from the solutions of calcium nitrate tetrahydrate (with strontium nitrate as Sr<sup>2+</sup> ion source) and diammonium hydrogen phosphate at pH 10 with a time duration of 5 min. The morphological characterization of the obtained powder has been carried out by employing techniques such as transmission electron microscopy, X-ray diffraction, and Brunauer-Emmett-Teller surface area analysis. The chemical structural analysis to evaluate the surface properties was made by using X-ray photoelectron spectroscopy. Zeta potential analysis was performed to evaluate the colloidal stability of the particles. Antimicrobial studies were performed for all the compositions using four bacterial strains and an opportunistic human fungal pathogen <i>Macrophomina phaseolina</i>. It was found that the nanoproduct with high strontium content (15 wt% of strontium) showed pronounced antibacterial potential against <i>M. luteus</i> while it completely arrested the fungal growth after 48 h by all of its concentrations. Thus the synthesis strategy described herein facilitated the rapid production of nanosized Sr-substituted CaPs with excellent biological performance suitable for a bone replacement application.

Also flagged:Calcium IonsHydroxyapatitecalcium phosphatestricalcium phosphateCalciumsynthesis
Journal Article 2023-09-25 No Snippets Szałaj U, Chodara A, Gierlotka S, Wojnarowicz J, Łojkowski W.
Show Full Abstract

Synthetic calcium phosphates, e.g., hydroxyapatite (HAP) and tricalcium phosphate (TCP), are the most commonly used bone-graft materials due to their high chemical similarity to the natural hydroxyapatite-the inorganic component of bones. Calcium in the form of a free ion or bound complexes plays a key role in many biological functions, including bone regeneration. This paper explores the possibility of increasing the Ca<sup>2+</sup>-ion release from HAP nanoparticles (NPs) by reducing their size. Hydroxyapatite nanoparticles were obtained through microwave hydrothermal synthesis. Particles with a specific surface area ranging from 51 m<sup>2</sup>/g to 240 m<sup>2</sup>/g and with sizes of 39, 29, 19, 11, 10, and 9 nm were used in the experiment. The structure of the nanomaterial was also studied by means of helium pycnometry, X-ray diffraction (XRD), and transmission-electron microscopy (TEM). The calcium-ion release into phosphate-buffered saline (PBS) was studied. The highest release of Ca<sup>2+</sup> ions, i.e., 18 mg/L, was observed in HAP with a specific surface area 240 m<sup>2</sup>/g and an average nanoparticle size of 9 nm. A significant increase in Ca<sup>2+</sup>-ion release was also observed with specific surface areas of 183 m<sup>2</sup>/g and above, and with nanoparticle sizes of 11 nm and below. No substantial size dependence was observed for the larger particle sizes.

TNFSF4
Also flagged:pyroptosisovarian cancerreverse transcriptionMYCNOSUSP30ZNF32
Journal Article 2023-09-25 ✓ 1 Snippet Xu H, Lu M, Liu Y, Ren F, Zhu L.
In-Text Gene Mentions

…PDCD1LG2, TNFSF8, TNFRSF8,TNFSF4, CD86 and CD44…

Show Full Abstract

<b>Aim:</b> To identify the pyroptosis-related long non-coding RNAs (lncRNAs) in ovarian cancer and construct a prognostic signature based on them. <b>Methods:</b> Expression data from TCGA was used to explore differentially expressed pyroptosis-related lncRNAs in ovarian cancer. A risk signature was established by LASSO and cox regression analysis and then validated. Databases such as ESTIMATE, CIBERSORT, TIMER, XCELL were used to identify the relation between this signature and the immune microenvironment of ovarian cancer. Gene Set Enrichment Analysis was introduced to identify the pathways and functions that the signature may participate in. Based on miRcode and starBase databases, microRNAs related to the lncRNAs in our signature and the positively co-expressed pyroptosis- related genes were screened and a competing endogenous RNA (ceRNA) network was then constructed. Quantitative reverse transcription PCR was conducted to validate the expression levels of two lncRNAs in this ceRNA network. <b>Results:</b> A 13 pyroptosis-related lncRNA prognostic signature (MYCNOS, AL161772.1, USP30-AS1, ZNF32-AS2, AC068733.3, AC012236.1, AC015802.5, KIAA1671-AS1, AC013403.2, MIR223HG, KRT7-AS, PTPRD-AS1 and LINC01094) was constructed. Patients in high-risk group had a significantly worse prognosis than that of low-risk (P<0.0001). Immune infiltration analysis found that patients identified as high-risk had a higher infiltration of macrophages and tumor-associated fibroblasts. Further pathway analysis revealed that the signature may be involved in epithelial mesenchymal transition, extracellular matrix receptor interaction, and focal adhesion. Finally, a competitive endogenous inhibition relationship was discovered between LINC01094, KRT7-AS, MYCNOS, ZNF32-AS2, AC012236.1 and pyroptosis- related genes such as <i>IRF1</i>, <i>NOD1</i>, <i>GSDMC</i>, <i>NLRP1</i>, <i>PLCG1</i>, <i>GSDME</i> and <i>GZMB</i>, in which LINC01094 and KRT7-AS were found to be overexpressed in three ovarian cancer cell lines. <b>Conclusion:</b> We constructed a pyroptosis-related lncRNA signature and correlate it to the immune microenvironment. A ceRNA regulatory network related to pyroptosis was also constructed, which provides novel insights useful for the study of pyroptosis in ovarian cancer.

HTT
Also flagged:Neurodegenerative DiseasesmetabolismMSAmyotrophic Lateral SclerosisADPD
Journal Article 2023-09-25 ✓ 1 Snippet Ramos V, Reis M, Ferreira L, Silva AM, Ferraz R, Vieira M, Vasconcelos V, Martins R.
In-Text Gene Mentions

It is caused by the expansion of a cytosine–adenine–guanine (GAG) trinucleotide repeat in the huntingtin (HTT) gene, resulting in a mutant huntingtin protein (mHTT) with an abnormally long polyQ tract.

Show Full Abstract

Neurodegenerative diseases (NDs) are characterized by progressive and irreversible neuronal loss, accompanied by a range of pathological pathways, including aberrant protein aggregation, altered energy metabolism, excitotoxicity, inflammation, and oxidative stress. Some of the most common NDs include Alzheimer's Disease (AD), Parkinson's Disease (PD), Multiple Sclerosis (MS), Amyotrophic Lateral Sclerosis (ALS), and Huntington's Disease (HD). There are currently no available cures; there are only therapeutic approaches that ameliorate the progression of symptoms, which makes the search for new drugs and therapeutic targets a constant battle. Cyanobacteria are ancient prokaryotic oxygenic phototrophs whose long evolutionary history has resulted in the production of a plethora of biomedically relevant compounds with anti-inflammatory, antioxidant, immunomodulatory, and neuroprotective properties, that can be valuable in this field. This review summarizes the major NDs and their pathophysiology, with a focus on the anti-neurodegenerative properties of cyanobacterial compounds and their main effects.

Also flagged:acute myeloid leukemiaKMT2A
Journal Article 2023-09-25 No Snippets Mrózek K.
Show Full Abstract

No abstract available.

SOX6
Also flagged:gene expressionmembraneaxondendritesorganizationtau
Journal Article 2023-09-25 ✓ 1 Snippet Olson RH, Cohen Kalafut N, Wang D.
In-Text Gene Mentions

…latent space (e.g.,SOX6and sp_width) may…

Show Full Abstract

Single-cell techniques like Patch-seq have enabled the acquisition of multimodal data from individual neuronal cells, offering systematic insights into neuronal functions. However, these data can be heterogeneous and noisy. To address this, machine learning methods have been used to align cells from different modalities onto a low-dimensional latent space, revealing multimodal cell clusters. The use of those methods can be challenging without computational expertise or suitable computing infrastructure for computationally expensive methods. To address this, we developed a cloud-based web application, MANGEM (multimodal analysis of neuronal gene expression, electrophysiology, and morphology). MANGEM provides a step-by-step accessible and user-friendly interface to machine learning alignment methods of neuronal multimodal data. It can run asynchronously for large-scale data alignment, provide users with various downstream analyses of aligned cells, and visualize the analytic results. We demonstrated the usage of MANGEM by aligning multimodal data of neuronal cells in the mouse visual cortex.

Also flagged:bladder cancerAPOBEC3APOBECtumorsmetabolic disorderscancer
Journal Article 2023-09-25 No Snippets Meng XY, Wang QL, Shi MJ, Zhang HY.
Show Full Abstract

<h4>Background</h4>The rationale for ethnic differences in bladder cancer (BCa) susceptibility is an important open question. In this study, we raised the hypothesis that the APOBEC3-rs1014971 variant associated with BCa risk and APOBEC-mutagenesis probably contribute to ethnic differences.<h4>Methods</h4>We calculated the ethnicity-stratified 5-year age-adjusted incidence rates of BCa using the US SEER database. We performed somatic mutational-signature analyses and compared the APOBEC-related mutational contribution across BCa tumors in patients of different ethnicities. We analyzed the allele frequency distribution of APOBEC3-related rs1014971 in contemporary populations of different ethnicities and in ancient human genomes. We also analyzed the natural selection profiles and ages of the investigated SNPs.<h4>Results</h4>We validated the ethnic difference in BCa risk using US SEER data, revealing Caucasians to be at >2-fold greater risk than Asians / Pacific islanders. In contemporary populations, we observed a coherent ethnic distribution in terms not only of the allele frequency of APOBEC3-related rs1014971, but also the mutational contribution of APOBEC-mediated mutagenesis in BCa tumors. Population genetics and ancient genome analyses further suggested that the diverse ethnic distribution of rs1014971 could be rooted in human evolution.<h4>Conclusions</h4>It is possible that APOBEC3-related rs1014971 is involved in the different BCa incidence across ethnic groups, and this difference is potentially derived from human evolution. Our findings suggested an evolutionary link between contemporary population-level variations in malignancy susceptibility and pathogen-driven selection in the past, not unlike previously reported cases of certain autoimmune and metabolic disorders.

bioRxiv 2023-09-25 Preprint (No Snippets API) Angelis N, Baulies A, Kucharska A, Kelly G, Sopena ML, Boeing S, Li VS.
Show Full Abstract

<h4>Summary</h4> Intestinal stem cells (ISCs) at the crypt base divide and give rise to progenitor cells that have the capacity to proliferate and differentiate into various mature epithelial cell types in the transit-amplifying (TA) zone. Here, we identified the transcription factor ARID3A as a novel regulator of intestinal epithelial cell proliferation and differentiation at the TA compartment. We show that ARID3A forms an expression gradient from villus tip to the early progenitors at the crypts mediated by TGF-β and WNT signalling. Intestinal epithelial-specific deletion of Arid3a reduces proliferation of TA cells. Bulk and single cell transcriptomic analysis shows increased enterocyte differentiation and reduced secretory cells in the Arid3a cKO intestine. Interestingly, upper-villus gene signatures of both enterocytes and secretory cells are enriched in the mutant intestine. We find that the enhanced enterocyte differentiation in the Arid3a cKO intestine is caused by increased binding of HNF1 and HNF4. Finally, we show that loss of Arid3a impairs irradiation-induced regenerative process by altering the dynamics of proliferation and apoptosis. Our findings imply that ARID3A may play a gatekeeping role in the TA compartment to maintain the “just-right” proliferation-to-differentiation ratio for tissue homeostasis and plasticity.

Preprints.org 2023-09-25 Preprint (No Snippets API) Wan H, Teh M, Mastroianni G, Ahmad US.
Show Full Abstract

The role of desmoglein-3 (DSG3) in oncogenesis is unclear. This study aimed to uncover molecular mechanisms through comparative transcriptome analysis in oral cancer cells, defining potential key genes and associated biological processes related to DSG3 expression. Four mRNA libraries of oral squamous carcinoma H413 cell lines were sequenced and 599 candidate genes exhibited differential expression between DSG3-overexpressing and matched control lines, with 12 genes highly significantly differentially expressed, including 9 upregulated and 3 downregulated. Genes with known implications in cancer, such as MMP-13, KRT84, OLFM4, GJA1, AMOT, and ADAMTS1, were strongly linked to DSG3 overexpression. Gene ontology analysis indicated that the DSG3-associated candidate gene products participated in crucial cellular processes such as junction assembly, focal adhesion, extracellular matrix formation, intermediate filament organization, and keratinocyte differentiation. Validation of RNA-Seq was performed through qRT-PCR, Western blotting, and immunofluorescence analyses. Furthermore, transmission electron microscopy meticulously examined desmosome morphology, revealing slightly immature desmosome structure in DSG3-overexpressing cells compared to controls. No changes in desmosome frequency and diameter were observed between the two conditions. This study underscores intricate and multifaceted alterations associated with DSG3 in oral squamous carcinoma cells, implying a potential oncogenic role of this gene in biological processes that enable cell communication, motility and survival.

Also flagged:Status epilepticusSEpeptideG-protein-coupled FPRpeptidespilocarpine
Journal Article 2023-09-24 No Snippets de Melo IS, Sabino-Silva R, Costa MA, Vaz ER, Anselmo-E-Silva CI, de Paula Soares Mendonça T, Oliveira KB, de Souza FMA, Dos Santos YMO, Pacheco ALD, Freitas-Santos J, Caixeta DC, Goulart LR, de Castro OW.
Show Full Abstract

Status epilepticus (SE) is described as continuous and self-sustaining seizures, which triggers hippocampal neurodegeneration, inflammation, and gliosis. N-formyl peptide receptor (FPR) has been associated with inflammatory process. N-formyl-methionyl-leucyl-phenylalanine (fMLP) peptide plays an anti-inflammatory role, mediated by the activation of G-protein-coupled FPR. Here, we evaluated the influence of fMLP peptides on the behavior of limbic seizures, memory consolidation, and hippocampal neurodegeneration process. Male Wistar rats (Rattus norvegicus) received microinjections of pilocarpine in hippocampus (H-PILO, 1.2 mg/μL, 1 μL) followed by fMLP (1 mg/mL, 1 μL) or vehicle (VEH, saline 0.9%, 1 μL). During the 90 min of SE, epileptic seizures were analyzed according to the Racine's Scale. After 24 h of SE, memory impairment was assessed by the inhibitory avoidance test and the neurodegeneration process was evaluated in hippocampal areas. There was no change in latency and number of wet dog shake (WDS) after administration of fMLP. However, our results showed that the intrahippocampal infusion of fMLP reduced the severity of seizures, as well as the number of limbic seizures. In addition, fMLP infusion protected memory dysfunction followed by SE. Finally, the intrahippocampal administration of fMLP attenuated the process of neurodegeneration in both hippocampi. Taken together, our data suggest a new insight into the functional role of fMLP peptides, with important implications for their potential use as a therapeutic agent for the treatment of brain disorders, such as epilepsy. Schematic drawing on the neuroprotective and anticonvulsant role of fMLP during status epilepticus. Initially, a cannula was implanted in hippocampus and pilocarpine/saline was administered into the hippocampus followed by fMLP/saline (A-C). fMLP reduced seizure severity and neuronal death in the hippocampus, as well as protecting against memory deficit (D).

MLLT10
Also flagged:PICALMacute leukaemiasleukaemiaT-cell acute lymphoblastic leukaemiaALLacute myeloid leukaemia
Journal Article 2023-09-24 ✓ 5 Snippets Mark C, Meshinchi S, Joyce B, Gibson B, Harrison C, Bergmann AK, Goemans BF, Pronk CJH, Lapillonne H, Leverger G, Antoniou E, Schneider M, Attarbaschi A, Dworzak M, Stary J, Tomizawa D, Ebert S, Lejman M, Kolb EA, Schmiegelow K, Hasle H, Abla O.
In-Text Gene Mentions

The prognostic impact of PICALM::MLLT10 status in childhood leukaemia is not well described.

…outcomes of childhood PICALM::MLLT10acute leukaemias.…

…prognostic impact of PICALM::MLLT10status in childhood…

…presence of the PICALM::MLLT10fusion gene was…

…for children with PICALM::MLLT10ALL were reasonable:…

Show Full Abstract

The prognostic impact of PICALM::MLLT10 status in childhood leukaemia is not well described. Ten International Berlin Frankfurt Münster-affiliated study groups and the Children's Oncology Group collaborated in this multicentre retrospective study. The presence of the PICALM::MLLT10 fusion gene was confirmed by fluorescence in situ hybridization and/or RNA sequencing at participating sites. Ninety-eight children met the study criteria. T-cell acute lymphoblastic leukaemia (T-ALL) and acute myeloid leukaemia (AML) predominated 55 (56%) and 39 (40%) patients, respectively. Most patients received a chemotherapy regimen per their disease phenotype: 58% received an ALL regimen, 40% an AML regimen and 1% a hybrid regimen. Outcomes for children with PICALM::MLLT10 ALL were reasonable: 5-year event-free survival (EFS) 67% and 5-year overall survival (OS) 76%, but children with PICALM::MLLT10 AML had poor outcomes: 5-year EFS 22% and 5-year OS 26%. Haematopoietic stem cell transplant (HSCT) did not result in a significant improvement in outcomes for PICALM::MLLT10 AML: 5-year EFS 20% for those who received HSCT versus 23% for those who did not (p = 0.6) and 5-year OS 37% versus 36% (p = 0.7). In summary, this study confirms that PICALM::MLLT10 AML is associated with a dismal prognosis and patients cannot be salvaged with HSCT; exploration of novel therapeutic options is warranted.

Also flagged:TAZYES-associated proteinTranscriptional Co-Activatortumorcell proliferationcancer
Journal Article 2023-09-24 No Snippets Thrash HL, Pendergast AM.
Show Full Abstract

The Hippo pathway transcriptional co-activators, YES-associated protein (YAP) and Transcriptional Co-Activator with PDZ Binding Motif (TAZ), have both been linked to tumor progression and metastasis. These two proteins possess overlapping and distinct functions, and their activities lead to the expression of genes involved in multiple cellular processes, including cell proliferation, survival, and migration. The dysregulation of YAP/TAZ-dependent cellular processes can result in altered tumor growth and metastasis. In addition to their well-documented roles in the regulation of cancer cell growth, survival, migration, and invasion, the YAP/TAZ-dependent signaling pathways have been more recently implicated in cellular processes that promote metastasis and therapy resistance in several solid tumor types. This review highlights the role of YAP/TAZ signaling networks in the regulation of tumor cell plasticity mediated by hybrid and reversible epithelial-mesenchymal transition (EMT) states, and the promotion of cancer stem cell/progenitor phenotypes. Mechanistically, YAP and TAZ regulate these cellular processes by targeting transcriptional networks. In this review, we detail recently uncovered mechanisms whereby YAP and TAZ mediate tumor growth, metastasis, and therapy resistance, and discuss new therapeutic strategies to target YAP/TAZ function in various solid tumor types. Understanding the distinct and overlapping roles of YAP and TAZ in multiple cellular processes that promote tumor progression to metastasis is expected to enable the identification of effective therapies to treat solid tumors through the hyper-activation of YAP and TAZ.

Also flagged:tissue developmenttissue growthorganogenesistumoradhesionsextracellular
Journal Article 2023-09-24 No Snippets Yousafzai MS, Hammer JA.
Show Full Abstract

The increasing popularity of 3D cell culture models is being driven by the demand for more in vivo-like conditions with which to study the biochemistry and biomechanics of numerous biological processes in health and disease. Spheroids and organoids are 3D culture platforms that self-assemble and regenerate from stem cells, tissue progenitor cells or cell lines, and that show great potential for studying tissue development and regeneration. Organ-on-a-chip approaches can be used to achieve spatiotemporal control over the biochemical and biomechanical signals that promote tissue growth and differentiation. These 3D model systems can be engineered to serve as disease models and used for drug screens. While culture methods have been developed to support these 3D structures, challenges remain to completely recapitulate the cell-cell and cell-matrix biomechanical interactions occurring in vivo. Understanding how forces influence the functions of cells in these 3D systems will require precise tools to measure such forces, as well as a better understanding of the mechanobiology of cell-cell and cell-matrix interactions. Biosensors will prove powerful for measuring forces in both of these contexts, thereby leading to a better understanding of how mechanical forces influence biological systems at the cellular and tissue levels. Here, we discussed how biosensors and mechanobiological research can be coupled to develop accurate, physiologically relevant 3D tissue models to study tissue development, function, malfunction in disease, and avenues for disease intervention.

SERPINC1
Also flagged:GlycocalyxObesityMetabolic Syndromepolysaccharidemembranebound
Journal Article 2023-09-24 ✓ 1 Snippet Hayden MR.
In-Text Gene Mentions

…products; AQP4, aquaporin-4;ATIII, antithrombin three; BBB,…

Show Full Abstract

The brain endothelial cell (BEC) glycocalyx (ecGCx) is a BEC surface coating consisting of a complex interwoven polysaccharide (sweet husk) mesh-like network of membrane-bound proteoglycans, glycoproteins, and glycosaminoglycans (GAGs) covering the apical luminal layer of the brain endothelial cells. The ecGCx may be considered as the first barrier of a tripartite blood-brain barrier (BBB) consisting of (1) ecGCx; (2) BECs; and (3) an extravascular compartment of pericytes, the extracellular matrix, and perivascular astrocytes. Perturbations of this barrier allow for increased permeability in the postcapillary venule that will be permissive to both fluids, solutes, and proinflammatory peripherally derived leukocytes into the perivascular spaces (PVS) which result in enlargement as well as increased neuroinflammation. The ecGCx is known to have multiple functions, which include its physical and charge barrier, mechanical transduction, regulation of vascular permeability, modulation of inflammatory response, and anticoagulation functions. This review discusses each of the listed functions in detail and utilizes multiple transmission electron micrographs and illustrations to allow for a better understanding of the ecGCx structural and functional roles as it relates to enlarged perivascular spaces (EPVS). This is the fifth review of a quintet series that discuss the importance of EPVS from the perspective of the cells of brain barriers. Attenuation and/or loss of the ecGCx results in brain barrier disruption with increased permeability to proinflammatory leukocytes, fluids, and solutes, which accumulate in the postcapillary venule perivascular spaces. This accumulation results in obstruction and results in EPVS with impaired waste removal of the recently recognized glymphatic system. Importantly, EPVS are increasingly being regarded as a marker of cerebrovascular and neurodegenerative pathology.

bioRxiv 2023-09-24 Preprint (No Snippets API) Veeraraghavan P, Engmann AK, Hatch JJ, Itoh Y, Nguyen D, Addison T, Macklis JD.
Show Full Abstract

Molecular mechanisms that cells employ to compartmentalize function via localization of function-specific RNA and translation are only partially elucidated. We investigate long-range projection neurons of the cerebral cortex as highly polarized exemplars to elucidate dynamic regulation of RNA localization, stability, and translation within growth cones (GCs), leading tips of growing axons. Comparison of GC-localized transcriptomes between two distinct subtypes of projection neurons– interhemispheric-callosal and corticothalamic– across developmental stages identifies both distinct and shared subcellular machinery, and intriguingly highlights enrichment of genes associated with neurodevelopmental and neuropsychiatric disorders. Developmental context-specific components of GC-localized transcriptomes identify known and novel potential regulators of distinct phases of circuit formation: long-distance growth, target area innervation, and synapse formation. Further, we investigate mechanisms by which transcripts are enriched and dynamically regulated in GCs, and identify GC-enriched motifs in 3 ’ untranslated regions. As one example, we identify cytoplasmic adenylation element binding protein 4 (CPEB4), an RNA binding protein regulating localization and translation of mRNAs encoding molecular machinery important for axonal branching and complexity. We also identify RNA binding motif single stranded interacting protein 1 (RBMS1) as a dynamically expressed regulator of RNA stabilization that enables successful callosal circuit formation. Subtly aberrant associative and integrative cortical circuitry can profoundly affect cortical function, often causing neurodevelopmental and neuropsychiatric disorders. Elucidation of context-specific subcellular RNA regulation for GC- and soma-localized molecular controls over precise circuit development, maintenance, and function offers generalizable insights for other polarized cells, and might contribute substantially to understanding neurodevelopmental and behavioral-cognitive disorders and toward targeted therapeutics.

GPR52
Also flagged:G protein-coupled receptorsGPCRsorphan receptorsGPR61rhodopsinbiogenic amine receptors 3
Journal Article 2023-09-23 ✓ 3 Snippets Lees JA, Dias JM, Rajamohan F, Fortin JP, O'Connor R, Kong JX, Hughes EAG, Fisher EL, Tuttle JB, Lovett G, Kormos BL, Unwalla RJ, Zhang L, Dechert Schmitt AM, Zhou D, Moran M, Stevens KA, Fennell KF, Varghese AE, Maxwell A, Cote EE, Zhang Y, Han S.
In-Text Gene Mentions

…several receptors, includingGPR52, GPR21, and GPR12…

…similar mutants ofGPR52, GPR21, and GPR12,…

…ECL2 reported forGPR52, GPR21, and GPR12…

Show Full Abstract

GPR61 is an orphan GPCR related to biogenic amine receptors. Its association with phenotypes relating to appetite makes it of interest as a druggable target to treat disorders of metabolism and body weight, such as obesity and cachexia. To date, the lack of structural information or a known biological ligand or tool compound has hindered comprehensive efforts to study GPR61 structure and function. Here, we report a structural characterization of GPR61, in both its active-like complex with heterotrimeric G protein and in its inactive state. Moreover, we report the discovery of a potent and selective small-molecule inverse agonist against GPR61 and structural elucidation of its allosteric binding site and mode of action. These findings offer mechanistic insights into an orphan GPCR while providing both a structural framework and tool compound to support further studies of GPR61 function and modulation.

NEGR1
Also flagged:ManganeseAmmoniaarseniccortisolHSP 70gene expression
Journal Article 2023-09-23 ✓ 1 Snippet Kumar N, Thorat ST, Singh AK, Kochewad SA, Reddy KS.
In-Text Gene Mentions

…growth hormone (GH),growth hormone regulator 1hormone regulator 1…

Show Full Abstract

Ammonia and arsenic pollution, along with the impact of climate change, represent critical factors influencing both the quantity and quality of aquaculture production. Recent developments have underscored the significance of these issues, as they not only disrupt aquatic ecosystems but also have far reaching consequences for human health. To addressed above challenges, an experiment was conducted to delineate the potential of manganese nanoparticles (Mn-NPs) to mitigate arsenic and ammonia pollution as well as high temperature stress in Pangasianodon hypophthalmus. The fish were exposed to different combination of arsenic and ammonia pollution as well as high temperature stress, while simultaneously incorporating diets enriched with Mn-NPs. The inclusion of Mn-NPs at 3 mg kg<sup>-1</sup> in the diet led to a noteworthy downregulation of cortisol and HSP 70 gene expression, indicating their potential in mitigating stress responses. Furthermore, immune related gene expressions were markedly altered in response to the stressors but demonstrated improvement with the Mn-NPs diet. Interestingly, the expression of inducible nitric oxide synthase (iNOS), caspase (CAS), metallothionine (MT) and cytochrome P450 (CYP450) genes expression were prominently upregulated, signifying a stress response. Whereas, Mn-NPs at 3 mg kg<sup>-1</sup> diet was significantly downregulated theses gene expression and reduces the stress. In addition to stress-related genes, we evaluated the growth-related gene expressions such as growth hormone (GH), growth hormone regulator 1 (GHR1 and GHRβ), Insulin like growth factor (IGF1 and IGF2) were significantly upregulated whereas, myostatin and somatostatin were downregulated upon the supplementation of dietary Mn-NPs with or without stressors in fish. The gene expression of DNA damage inducible protein and DNA damage in response to head DNA % and tail DNA % was protected by Mn-NPs diets. Furthermore, Mn-NPs demonstrated a capacity to enhance the detoxification of arsenic in different fish tissues, resulting in reduced bioaccumulation of arsenic in muscle and other tissues. This finding highlights Mn-NPs as a potential solution for addressing bioaccumulation associated risks. Our study aimed to comprehensively examined the role of dietary Mn-NPs in mitigating the multiple stressors using gene regulation mechanisms, with enhancing the productive performance of P. hypophthalmus.

ARFGEF2
Also flagged:tumorkinasestumorscancergene expressioncancers
Journal Article 2023-09-23 ✓ 1 Snippet Hafstað V, Häkkinen J, Persson H.
In-Text Gene Mentions

…pseudogene (RAB22A-MY09B andARFGEF2-SULF2) and the third…

Show Full Abstract

<h4>Background</h4>In cancer, genomic rearrangements can create fusion genes that either combine protein-coding sequences from two different partner genes or place one gene under the control of the promoter of another gene. These fusion genes can act as oncogenic drivers in tumor development and several fusions involving kinases have been successfully exploited as drug targets. Expressed fusions can be identified in RNA sequencing (RNA-Seq) data, but fusion prediction software often has a high fraction of false positive fusion transcript predictions. This is problematic for both research and clinical applications.<h4>Results</h4>We describe a method for validation of fusion transcripts detected by RNA-Seq in matched whole-genome sequencing (WGS) data. Our pipeline uses discordant read pairs to identify supported fusion events and analyzes soft-clipped read alignments to determine genomic breakpoints. We have tested it on matched RNA-Seq and WGS data for both tumors and cancer cell lines and show that it can be used to validate both new predicted gene fusions and experimentally validated fusion events. It was considerably faster and more sensitive than using BreakDancer and Manta, software that is instead designed to detect many different types of structural variants on a genome-wide scale.<h4>Conclusions</h4>We have developed a fast and very sensitive pipeline for validation of gene fusions detected by RNA-Seq in matched WGS data. It can be used to identify high-quality gene fusions for further bioinformatic and experimental studies, including validation of genomic breakpoints and studies of the mechanisms that generate fusions. In a clinical setting, it could help find expressed gene fusions for personalized therapy.

Also flagged:G proteinG protein-coupled receptorsGPCRsextracellularG proteinss
Journal Article 2023-09-23 No Snippets Masuho I, Kise R, Gainza P, Von Moo E, Li X, Tany R, Wakasugi-Masuho H, Correia BE, Martemyanov KA.
Show Full Abstract

G protein-coupled receptors (GPCRs) convert extracellular stimuli into intracellular signaling by coupling to heterotrimeric G proteins of four classes: G<sub>i/o</sub>, G<sub>q</sub>, G<sub>s</sub>, and G<sub>12/13</sub>. However, our understanding of the G protein selectivity of GPCRs is incomplete. Here, we quantitatively measure the enzymatic activity of GPCRs in living cells and reveal the G protein selectivity of 124 GPCRs with the exact rank order of their G protein preference. Using this information, we establish a classification of GPCRs by functional selectivity, discover the existence of a G<sub>12/13</sub>-coupled receptor, G<sub>15</sub>-coupled receptors, and a variety of subclasses for G<sub>i/o</sub>-, G<sub>q</sub>-, and G<sub>s</sub>-coupled receptors, culminating in development of the predictive algorithm of G protein selectivity. We further identify the structural determinants of G protein selectivity, allowing us to synthesize non-existent GPCRs with de novo G protein selectivity and efficiently identify putative pathogenic variants.

TNFSF4
Also flagged:Type Cutaneous Chronic Graft-Versus-Host DiseaseT Helper 1chronic graft-versus-host diseaseatopic dermatitissystemic sclerosisOX40
Journal Article 2023-09-23 ✓ 3 Snippets Kim M, Renert-Yuval Y, Stepensky P, Even-Or E, Zaidman I, Fachler T, Neumark M, Zamir M, NandyMazumdar M, Gour D, Facheris P, Carroll B, Liu Y, Yu Ekey ML, Andrews E, Meariman M, Angelov M, Bose S, Estrada YD, Molho-Pessach V, Guttman-Yassky E.
In-Text Gene Mentions

Several markers related to the TSLP-OX40 axis were significantly upregulated relative to those in both controls and lesional atopic dermatitis, including TNFSF4/OX40L, TSLP, and IL33, as well as fibroinflammatory signatures characterized in a prior study in systemic sclerosis.

…atopic dermatitis, includingTNFSF4/OX40L, TSLP , and…

TNFSF4

Show Full Abstract

Sclerotic-type cutaneous chronic graft-versus-host disease is a severe complication of allogeneic hematopoietic stem cell transplantation, with profound morbidity. A dearth of effective, targeted treatment options necessitates further investigation into the molecular mechanisms underlying this T-cell-mediated disease. In this study, we compared the transcriptome in skin biopsies from pediatric and young adult (aged <25 years) patients with sclerotic-type cutaneous chronic graft-versus-host disease (n = 7) with that in demographically matched healthy controls (n = 8) and patients with atopic dermatitis (n = 10) using RNA sequencing with RT-PCR and immunohistochemistry validation. Differential expression was defined as fold change > 1.5 and false discovery rate < 0.05. Sclerotic-type cutaneous chronic graft-versus-host disease exhibited strong and significant T helper (Th)1 skewing through key related cytokines and chemokines (CXCL9/10/11, IFNG/IFN-γ, STAT1/signal transducer and activator of transcription 1). Several markers related to the TSLP-OX40 axis were significantly upregulated relative to those in both controls and lesional atopic dermatitis, including TNFSF4/OX40L, TSLP, and IL33, as well as fibroinflammatory signatures characterized in a prior study in systemic sclerosis. Gene set variation analysis reflected marker-level findings, showing the greatest enrichment of the Th1 and fibroinflammatory pathways, with no global activation identified in Th2 or Th17/Th22. Cell-type deconvolution revealed a significant representation of macrophages and vascular endothelial cells. Sclerotic-type cutaneous chronic graft-versus-host disease in young patients may therefore be characterized by strong Th1-related upregulation with a unique TSLP-OX40 signature, suggesting new therapeutic avenues for this devastating disease.

Also flagged:Liver Injuryliver diseasedeathmenopausemineralsallergy
Journal Article 2023-09-23 No Snippets Dadlani A, Anudu A, Marginean EC.
Show Full Abstract

MenoFit is a widely available over-the-counter synbiotic supplement, which is marketed for use in relieving menopausal symptoms. So far, there is no published data on liver injury because of its use. We present the first reported case of MenoFit-induced liver injury in a patient who presented with 1 week of jaundice and abnormal liver biochemical tests in the absence of other risk factors and negative comprehensive workup for known etiologies of liver disease.

Also flagged:MalariaacylaminophenylCYP3A4chloroquineOxadiazoles
Journal Article 2023-09-23 No Snippets Hochegger P, Hermann T, Dolensky J, Seebacher W, Saf R, Pferschy-Wenzig EM, Kaiser M, Mäser P, Weis R.
Show Full Abstract

The 4-substituted 3-amino-1,2,5-oxadiazole <b>1</b> from the Malaria Box Project of the Medicines for Malaria Venture foundation shows very promising selectivity and in vitro activity against <i>Plasmodium falciparum</i>. Within the first series of new compounds, various 3-acylamino analogs were prepared. This paper now focuses on the investigation of the importance of the aromatic substituent in ring position 4. A number of new structure-activity relationships were elaborated, showing that antiplasmodial activity and selectivity strongly depend on the substitution pattern of the 4-phenyl moiety. In addition, physicochemical parameters relevant for drug development were calculated (logP and ligand efficiency) or determined experimentally (CYP3A4-inhibition and aqueous solubility). <i>N</i>-[4-(3-ethoxy-4-methoxyphenyl)-1,2,5-oxadiazol-3-yl]-3-methylbenzamide <b>51</b> showed high in vitro activity against the chloroquine-sensitive strain NF54 of <i>P. falciparum</i> (<i>Pf</i>NF54 IC<sub>50</sub> = 0.034 µM), resulting in a very promising selectivity index of 1526.

bioRxiv 2023-09-23 Preprint (No Snippets API) Bergwell M, Park J, Kirkland JG.
Show Full Abstract

Chromatin regulators are a group of proteins that can alter the physical properties of chromatin to make it more or less permissive to transcription by modulating another protein’s access to a specific DNA sequence through changes in nucleosome occupancy or histone modifications at a particular locus. Mammalian SWI/SNF complexes (mSWI/SNF) are a group of ATPase-dependent chromatin remodelers that alter chromatin states. In mouse embryonic stem cells (mESCs), there are three primary forms of mSWI/SNF: canonical BAF (cBAF), polybromo-associated BAF (pBAF), and GLTSCR-associated BAF (gBAF or ncBAF). While cBAF and gBAF contain the SS18 protein subunit, pBAF lacks SS18. Previous studies used a novel dCas9-mediated inducible recruitment (FIRE-Cas9) of mSWI/SNF complexes via SS18 to the Nkx2.9 locus. Nkx2.9 is a developmentally regulated gene that requires mSWI/SNF for transcriptional activation during neural differentiation. However, in mESCs, Nkx2.9 is bivalent, meaning nucleosomes at the locus have both active and polycomb-associated repressive modifications. Upon recruitment of SS18-containing complexes, polycomb-associated histone marks are removed, followed by transcriptional activation of Nkx2.9 . However, since both cBAF and gBAF share the SS18 subunit, it is unclear whether one or both complexes oppose the polycomb repressive marks. The ability of pBAF to do the same also remains unknown. In this study, we used unique subunits to recruit each of the three complexes to the Nkx2.9 locus individually. Here, we show that cBAF most effectively opposes polycomb repressive marks at Nkx2.9 , leading to transcriptional activation of the gene. Recruitment of cBAF complexes leads to a significant loss of the polycomb repressive-2 H3K27me3 and polycomb repressive-1 H2AK119ub histone marks, whereas gBAF and pBAF do not. Moreover, nucleosome occupancy alone cannot explain the loss of these marks. Our results demonstrate that cBAF has a unique role in the direct opposition of polycomb-associated histone modifications that gBAF and pBAF do not share. Cell Cycle and Cancer Biology Program, Oklahoma Medical Research Foundation, Oklahoma City, OK, 73104 Department of Cell Biology, University of Oklahoma Health Science Center, Oklahoma City, OK, 73104

Also flagged:HIV infectionCD8peptideMHC-Idegranulationdeath
Journal Article 2023-09-22 No Snippets Copertino DC, Holmberg CS, Weiler J, Ward AR, Howard JN, Levinger C, Pang AP, Corley MJ, Dündar F, Zumbo P, Betel D, Gandhi RT, McMahon DK, Bosch RJ, Linden N, Macatangay BJ, Cyktor JC, Eron JJ, Mellors JW, Kovacs C, Benko E, Bosque A, Jones RB, AIDS Clinical Trials Group (ACTG) A5321 Team.
Show Full Abstract

IL-15 is under clinical investigation toward the goal of curing HIV infection because of its abilities to reverse HIV latency and enhance immune effector function. However, increased potency through combination with other agents may be needed. 3-Hydroxy-1,2,3-benzotriazin-4(3H)-one (HODHBt) enhances IL-15-mediated latency reversal and NK cell function by increasing STAT5 activation. We hypothesized that HODHBt would also synergize with IL-15, via STAT5, to directly enhance HIV-specific cytotoxic T cell responses. We showed that ex vivo IL-15 + HODHBt treatment markedly enhanced HIV-specific granzyme B-releasing T cell responses in PBMCs from antiretroviral therapy-suppressed (ART-suppressed) donors. We also observed upregulation of antigen processing and presentation in CD4+ T cells and increased surface MHC-I. In ex vivo PBMCs, IL-15 + HODHBt was sufficient to reduce intact proviruses in 1 of 3 ART-suppressed donors. Our findings reveal the potential for second-generation IL-15 studies incorporating HODHBt-like therapeutics. Iterative studies layering on additional latency reversal or other agents are needed to achieve consistent ex vivo reservoir reductions.

HTT
Also flagged:neurodegenerative diseasesMicrogliaExtracellular vesiclesautophagyphagocytosissynthesis
Journal Article 2023-09-22 ✓ 5 Snippets Gao C, Jiang J, Tan Y, Chen S.
In-Text Gene Mentions

Aggregated mHTT is typically observed as inclusion bodies in the cytoplasm or nucleus,436 and N-terminal htt fragments are widely believed to play a role in HD pathogenesis, with smaller N-terminal htt fragments showing greater neurotoxicity than large-sized fragments.437 Postmortem examination shows 95 percent of HD patients’ brains had bilateral striatal atrophy.438 Indeed, it has been demonstrated that neuron cell death in the cerebral cortex is diverse, explaining the various symptom profiles observed in HD.439,440 Reactive gliosis is routinely found in the striatum of HD patients, together with reactive fibrillary astrocytosis and reactive microglia.441 In vivo PET investigations have demonstrated significant microglial activation in affected areas of the HD brain, and this pathological phenomenon is more pronounced in severe cases of HD.44211C(R)-PK11195 PET detected microglial activation in HD patients even before the onset of clinical symptoms.443 Expression of mHTT in neurons leads to microglial activation in cortico-striatal brain slice and primary neuronal culture models.

CAG repetition lengths over 40 are linked to a definite HD onset during a typical lifespan.430 Correlative studies have revealed an inverse relationship between the age of onset and CAG repeat length.431 The incidence of HD in the Western population is 4–10 per 100,000 people, and the average age of onset is 40 years.432 Pathogenic mutant huntingtin (mHTT) is expressed in various types of neurons in the brain.433 It causes selective loss of medium spiny neurons (MSNs) in the striatum, as well as caudate and putamen atrophy.434 R6/2 and N171-Q82 mouse models expressing truncated N-terminal segments of HTT are commonly used in research.

The mutation leads to an abnormally long polyglutamine (polyQ) expansion in the huntingtin (HTT) protein, which confers the protein propensity to misfold.429 The length of the CAG repeat is critical for developing HD.

The HTT-targeting ASO IONIS-HTTRx (also known as ISIS 443139 and RG6042), which is thought to act through the RNase H1 mechanism, has completed a Phase 1/2a clinical trial (NCT02519036, NCT03342053) and is currently undergoing a large multicenter worldwide efficacy study.

…mutant huntingtin RNA (HttRNA), which could…

Show Full Abstract

Microglia activation is observed in various neurodegenerative diseases. Recent advances in single-cell technologies have revealed that these reactive microglia were with high spatial and temporal heterogeneity. Some identified microglia in specific states correlate with pathological hallmarks and are associated with specific functions. Microglia both exert protective function by phagocytosing and clearing pathological protein aggregates and play detrimental roles due to excessive uptake of protein aggregates, which would lead to microglial phagocytic ability impairment, neuroinflammation, and eventually neurodegeneration. In addition, peripheral immune cells infiltration shapes microglia into a pro-inflammatory phenotype and accelerates disease progression. Microglia also act as a mobile vehicle to propagate protein aggregates. Extracellular vesicles released from microglia and autophagy impairment in microglia all contribute to pathological progression and neurodegeneration. Thus, enhancing microglial phagocytosis, reducing microglial-mediated neuroinflammation, inhibiting microglial exosome synthesis and secretion, and promoting microglial conversion into a protective phenotype are considered to be promising strategies for the therapy of neurodegenerative diseases. Here we comprehensively review the biology of microglia and the roles of microglia in neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, multiple system atrophy, amyotrophic lateral sclerosis, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, dementia with Lewy bodies and Huntington's disease. We also summarize the possible microglia-targeted interventions and treatments against neurodegenerative diseases with preclinical and clinical evidence in cell experiments, animal studies, and clinical trials.

Also flagged:OAchronic degenerative joint diseaseinflammatory disorderchondrocyte hypertrophyangiogenesisextracellular
Journal Article 2023-09-22 No Snippets Zhao S, Xiu G, Wang J, Wen Y, Lu J, Wu B, Wang G, Yang D, Ling B, Du D, Xu J.
Show Full Abstract

Osteoarthritis (OA) is a degenerative joint disease involving cartilage. Exosomes derived from Mesenchymal stem cells (MSCs) therapy improves articular cartilage repair, but subcutaneous fat (SC) stromal cells derived exosomes (MSCs<sup>SC</sup>-Exos), especially engineering MSCs<sup>SC</sup>-Exos for drug delivery have been rarely reported in OA therapy. This objective of this study was to clarify the underlying mechanism of MSCs<sup>SC</sup>-Exos on cartilage repair and therapy of engineering MSCs<sup>SC</sup>-Exos for drug delivery in OA. MSCs<sup>SC</sup>-Exos could ameliorate the pathological severity degree of cartilage via miR-199a-3p, a novel molecular highly enriched in MSCs<sup>SC</sup>-Exos, which could mediate the mTOR-autophagy pathway in OA rat model. Intra-articular injection of antagomiR-199a-3p dramatically attenuated the protective effect of MSCs<sup>SC</sup>-Exos-mediated on articular cartilage in vivo. Furthermore, to achieve the superior therapeutic effects of MSCs<sup>SC</sup>-Exos on injured cartilage, engineering exosomes derived from MSCs<sup>SC</sup> as the chondrocyte-targeting miR-199a-3p delivery vehicles were investigated in vitro and in vivo. The chondrocyte-binding peptide (CAP) binding MSCs<sup>SC</sup>-Exos could particularly deliver miR-199a-3p into the chondrocytes in vitro and into deep articular tissues in vivo, then exert the excellent protective effect on injured cartilage in DMM-induced OA mice. As it is feasible to obtain human subcutaneous fat from healthy donors by liposuction operation in clinic, meanwhile engineering MSCs<sup>SC</sup>-Exos to realize targeted delivery of miR-199a-3p into chondrocytes exerted excellent therapeutic effects in OA animal model in vivo. Through combining MSCs<sup>SC</sup>-Exos therapy and miRNA therapy via an engineering approach, we develop an efficient MSCs<sup>SC</sup>-Exos-based strategy for OA therapy and promote the application of targeted-MSCs<sup>SC</sup>-Exos for drug delivery in the future.

Also flagged:polycystic ovary syndromePCOSmetabolismobesitytype 2 diabeteshyperandrogenism
Journal Article 2023-09-22 No Snippets Escobar-Morreale HF, Martínez-García MÁ, Insenser M, Cañellas N, Correig X, Luque-Ramírez M.
Show Full Abstract

<h4>Background</h4>The polycystic ovary syndrome (PCOS) is associated with insulin resistance, obesity and cardiometabolic comorbidities. We here challenged the hypothesis, using state-of-the-art proton nuclear magnetic resonance spectrometry (<sup>1</sup>H-NMRS) metabolomics profiling, that androgen excess in women induces a certain masculinization of postprandial metabolism that is modulated by obesity.<h4>Materials and methods</h4>Participants were 53 Caucasian young adults, including 17 women with classic PCOS consisting of hyperandrogenism and ovulatory dysfunction, 17 non-hyperandrogenic women presenting with regular menses, and 19 healthy men, selected to be similar in terms of age and body mass index (BMI). Half of the subjects had obesity. Patients were submitted to isocaloric separate glucose, lipid and protein oral challenges in alternate days and fasting and postprandial serum samples were submitted to <sup>1</sup>H-NMRS metabolomics profiling for quantification of 36 low-molecular-weight polar metabolites.<h4>Results</h4>The largest postprandial changes were observed after glucose and protein intake, with lipid ingestion inducing smaller differences. Changes after glucose intake consisted of a marked increase in carbohydrates and byproducts of glycolysis, and an overall decrease in byproducts of proteolysis, lipolysis and ketogenesis. After the protein load, most amino acids and derivatives increased markedly, in parallel to an increase in pyruvate and a decrease in 3-hydroxybutyric acid and glycerol. Obesity increased β- and D-glucose and pyruvate levels, with this effect being observed mostly after glucose ingestion in women with PCOS. Regardless of the type of macronutrient, men presented increased lysine and decreased 3-hydroxybutyric acid. In addition, non-obese men showed increased postprandial β-glucose and decreased pyroglutamic acid, compared with non-obese control women. We observed a common pattern of postprandial changes in branched-chain and aromatic amino acids, where men showed greater amino acids increases after protein intake than control women and patients with PCOS but only within the non-obese participants. Conversely, this increase was blunted in obese men but not in obese women, who even presented a larger increase in some amino acids compared with their non-obese counterparts. Interestingly, regardless of the type of macronutrient, only obese women with PCOS showed increased leucine, lysine, phenylalanine and tryptophan levels compared with non-obese patients.<h4>Conclusions</h4>Serum <sup>1</sup>H-NMRS metabolomics profiling indicated sexual dimorphism in the responses to oral macronutrient challenges, which were apparently driven by the central role of postprandial insulin effects with obesity, and to a lesser extent PCOS, exerting modifying roles derived from insulin resistance. Hence, obesity impaired metabolic flexibility in young adults, yet sex and sex hormones also influenced the regulation of postprandial metabolism.

OLFM4
Also flagged:extracellularpsoriasisdegranulationpro-inflammatory cytokineschemokineslactate
Journal Article 2023-09-22 ✓ 5 Snippets Chen J, Bai Y, Xue K, Li Z, Zhu Z, Li Q, Yu C, Li B, Shen S, Qiao P, Li C, Luo Y, Qiao H, Dang E, Yin W, Gudjonsson JE, Wang G, Shao S.
In-Text Gene Mentions

However, the frequency of CD177+ and OLFM4+ neutrophils is not elevated in psoriasis patients compared to healthy controls (Supplementary Fig. 16a, b), and the actual degree of heterogeneity of neutrophils in psoriasis and the underlying mechanisms remain unclear.

Similarly, studies in circulating human neutrophils have characterized discrete phenotypic subsets, including a population of CD177+ neutrophils in patients with bacterial infections28,36 and in a variety of autoimmune diseases including systemic lupus erythematosus (SLE)37, or OLFM4 observed in sepsis38.

…12 , ofactomedin-4 (OLFM4) 13 , and…

…37 , orOLFM4observed in sepsis…

…CD177 + andOLFM4+ neutrophils is…

Show Full Abstract

Neutrophils have a pathogenic function in inflammation via releasing pro-inflammatory mediators or neutrophil extracellular traps (NETs). However, their heterogeneity and pro-inflammatory mechanisms remain unclear. Here, we demonstrate that CXCR4<sup>hi</sup> neutrophils accumulate in the blood and inflamed skin in human psoriasis, and correlate with disease severity. Compared to CXCR4<sup>lo</sup> neutrophils, CXCR4<sup>hi</sup> neutrophils have enhanced NETs formation, phagocytic function, neutrophil degranulation, and overexpression of pro-inflammatory cytokines and chemokines in vitro. This is accompanied by a metabolic shift in CXCR4<sup>hi</sup> neutrophils toward glycolysis and lactate release, thereby promoting vascular permeability and remodeling. CXCR4 expression in neutrophils is dependent on CREB1, a transcription factor activated by TNF and CXCL12, and regulated by de novo synthesis. In vivo, CXCR4<sup>hi</sup> neutrophil infiltration amplifies skin inflammation, whereas blockade of CXCR4<sup>hi</sup> neutrophils through CXCR4 or CXCL12 inhibition leads to suppression of immune responses. In this work, our study identifies CREB1 as a critical regulator of CXCR4<sup>hi</sup> neutrophil development and characterizes the contribution of CXCR4<sup>hi</sup> neutrophils to vascular remodeling and inflammatory responses in skin.

Also flagged:Sickle cell diseaseHbbeta globinhaemoglobin Shaemoglobin Camino acid
Journal Article 2023-09-22 No Snippets Smart LR, Segbefia CI, Latham TS, Stuber SE, Amissah-Arthur KN, Dzefi-Tettey K, Lane AC, Dei-Adomakoh YA, Ware RE.
Show Full Abstract

<h4>Background</h4>Haemoglobin SC (HbSC) is a common form of sickle cell disease (SCD), especially among individuals of West African ancestry. Persons with HbSC disease suffer from the same clinical complications and reduced quality of life that affect those with sickle cell anaemia (HbSS/Sβ<sup>0</sup>). Retrospective anecdotal data suggest short-term safety and benefits of hydroxyurea for treating HbSC, yet rigorous prospective data are lacking regarding optimal dosing, clinical and laboratory effects, long-term safety and benefits, and appropriate endpoints to monitor. Prospective Investigation of Variables as Outcomes for Treatment (PIVOT) was designed with three aims: (1) to measure the toxicities of hydroxyurea treatment on laboratory parameters, (2) to assess the effects of hydroxyurea treatment on sickle-related clinical and laboratory parameters, and (3) to identify study endpoints suitable for a future definitive phase III trial of hydroxyurea treatment of HbSC disease.<h4>Methods</h4>PIVOT is a randomised, placebo-controlled, double blind clinical trial of hydroxyurea. Approximately 120 children and 120 adults ages 5-50 years with HbSC disease will be enrolled, screened for 2 months, and then randomised 1:1 to once-daily oral hydroxyurea or placebo. Study treatment will be prescribed initially at 20 ± 5 mg/kg/day with an opportunity to escalate the dose twice over the first 6 months. After 12 months of blinded study treatment, all participants will be offered open-label hydroxyurea for up to 4 years. Safety outcomes include treatment-related cytopenias, whole blood viscosity, and adverse events. Efficacy outcomes include a variety of laboratory and clinical parameters over the first 12 months of randomised treatment, including changes in haemoglobin and fetal haemoglobin, intracranial arterial velocities measured by transcranial Doppler ultrasound, cerebral oxygenation using near infrared spectrometry, spleen volume and kidney size by ultrasound, proteinuria, and retinal imaging. Exploratory outcomes include functional erythrocyte analyses with ektacytometry for red blood cell deformability and point-of-sickling, patient-reported outcomes using the PROMIS questionnaire, and 6-min walk test.<h4>Discussion</h4>For children and adults with HbSC disease, PIVOT will determine the safety of hydroxyurea and identify measurable changes in laboratory and clinical parameters, suitable for future prospective testing in a definitive multi-centre phase III clinical trial.<h4>Trial registration</h4>PACTR, PACTR202108893981080. Registered 24 August 2021, https://pactr.samrc.ac.za.

GPR52
Also flagged:GPCRspeptidesorphan GPCRsadrenoceptorsGPCRextracellular
Journal Article 2023-09-22 ✓ 5 Snippets Nie Y, Qiu Z, Chen S, Chen Z, Song X, Ma Y, Huang N, Cyster JG, Zheng S.
In-Text Gene Mentions

In the GPR52‒Gs complex, the tri-leucine pocket in Gs moves downward to avoid steric clash with C5.66 (equivalent to the position 5.65 in other GPCRs due to an extra residue in TM5 of GPR52), making the cytoplasmic end of TM6 in GPR52 flexible (Fig. 6f).

…GPR12), III (GPR21,GPR52).…

…GPR21 andGPR52with 71% sequence…

…of GPR21 andGPR52have not been…

…surrogate agonists forGPR52show high lipophilicity…

Show Full Abstract

Many orphan G protein-coupled receptors (GPCRs) remain understudied because their endogenous ligands are unknown. Here, we show that a group of class A/rhodopsin-like orphan GPCRs including GPR61, GPR161 and GPR174 increase the cAMP level similarly to fully activated D1 dopamine receptor (D1R). We report cryo-electron microscopy structures of the GPR61‒G<sub>s</sub>, GPR161‒G<sub>s</sub> and GPR174‒G<sub>s</sub> complexes without any exogenous ligands. The GPR174 structure reveals that endogenous lysophosphatidylserine (lysoPS) is copurified. While GPR174 fails to respond to exogenous lysoPS, likely owing to its maximal activation by the endogenous ligand, GPR174 mutants with lower ligand binding affinities can be specifically activated by lysoPS but not other lipids, in a dose-dependent manner. Moreover, GPR174 adopts a non-canonical G<sub>s</sub> coupling mode. The structures of GPR161 and GPR61 reveal that the second extracellular loop (ECL2) penetrates into the orthosteric pocket, possibly contributing to constitutive activity. Our work definitively confirms lysoPS as an endogenous GPR174 ligand and suggests that high constitutive activity of some orphan GPCRs could be accounted for by their having naturally abundant ligands.

SOX6
Also flagged:MORC2NUDT21polyadenylationgene expressionkidney renal clear cell carcinomachromatin
Journal Article 2023-09-22 ✓ 1 Snippet Tan Y, Zheng T, Su Z, Chen M, Chen S, Zhang R, Wang R, Li K, Na N.
In-Text Gene Mentions

…5C ), includingSOX6, DAPK1, PDZK1, TXNIP,…

Show Full Abstract

Alternative polyadenylation (APA), a posttranscriptional mechanism of gene expression via determination of 3'UTR length, has an emerging role in carcinogenesis. Although abundant APA reprogramming is found in kidney renal clear cell carcinoma (KIRC), which is one of the major malignancies, whether APA functions in KIRC remains unknown. Herein, we found that chromatin modifier MORC2 gained oncogenic potential in KIRC among the genes with APA reprogramming, and moreover, its oncogenic potential was enhanced by 3'UTR shortening through stabilization of MORC2 mRNA. MORC2 was found to function in KIRC by downregulating tumor suppressor DAPK1 via DNA methylation. Mechanistically, MORC2 recruited DNMT3A to facilitate hypermethylation of the DAPK1 promoter, which was strengthened by 3'UTR shortening of MORC2. Furthermore, loss of APA regulator NUDT21, which was induced by DNMT3B-mediated promoter methylation, was identified as responsible for 3'UTR shortening of MORC2 in KIRC. Additionally, NUDT21 was confirmed to act as a tumor suppressor mainly depending on downregulation of MORC2. Finally, we designed an antisense oligonucleotide (ASO) to enhance NUDT21 expression and validated its antitumor effect in vivo and in vitro. This study uncovers the DNMT3B/NUDT21/APA/MORC2/DAPK1 regulatory axis in KIRC, disclosing the role of APA in KIRC and the crosstalk between DNA methylation and APA.

Also flagged:Major depressive disordermental disordersbehavioralDepressionanxietyCOVID-19
Journal Article 2023-09-22 No Snippets Lin Z, Cheng L, Han X, Wang H, Liao Y, Guo L, Shi J, Fan B, Teopiz KM, Jawad MY, Zhang H, Chen Y, Lu C, McIntyre RS.
Show Full Abstract

<h4>Background</h4>Many people living with major depressive disorder (MDD) in China do not receive treatment owing to a lack of mental health services, along with significant stigma toward mental illness. Internet-based cognitive behavioral therapy (ICBT) has been proposed to increase access to mental health care for people with MDD.<h4>Objective</h4>The aims of this study were to (1) evaluate the efficacy of ICBT for depressive symptoms in patients with MDD; (2) evaluate the effect of ICBT on anxiety symptoms, nonspecific psychological distress, general self-efficacy, depression stigma, social function, and health-related quality of life (HRQoL); and (3) explore the acceptability of and satisfaction with the ICBT program among participants.<h4>Methods</h4>Patients with MDD were enrolled and randomized to the ICBT group or the waiting-list control (WLC) group. The ICBT group received ICBT delivered through a WeChat mini-program with general support by nonspecialists. Participants in the 2 groups were self-evaluated online at baseline and posttreatment for changes in the primary outcome (ie, depressive symptoms) and secondary outcomes (ie, anxiety symptoms, nonspecific psychological distress, general self-efficacy, depression stigma, social functional impairment, and HRQoL). Changes in outcomes were measured by changes in overall scores on respective scales, and response and remission rates were calculated based on depressive symptoms. The acceptability of and satisfaction with the ICBT program were measured by treatment adherence and participants' feelings (ie, modules seriously completed, perceived benefit, and satisfaction).<h4>Results</h4>We included 40 patients who were randomly assigned to the ICBT group and 44 who were assigned to the WLC group. Compared with the WLC group, the ICBT group had fewer depressive symptoms, fewer anxiety symptoms, less nonspecific psychological distress, and greater general self-efficacy. Moreover, the ICBT group had higher response (18/31, 58%) and remission rates (17/31, 55%). The adherence rate in the ICBT group was 78% (31/40), and the majority of participants who completed all ICBT modules were satisfied with the ICBT program.<h4>Conclusions</h4>ICBT demonstrated greater improvements in depressive symptoms, anxiety symptoms, nonspecific psychological distress, and general self-efficacy among selected patients with MDD in comparison with the findings in waiting-list controls. The ICBT program in this study had good acceptability and satisfaction among participants.<h4>Trial registration</h4>Chinese Clinical Trial Registry (ChiCTR2100046425); https://tinyurl.com/bdcrj4zv.

Also flagged:lung cancerCTSLAPOEcancerdeathcancers
Journal Article 2023-09-22 No Snippets Xu J, Xu W, Choi J, Brhane Y, Christiani DC, Kothari J, McKay J, Field JK, Davies MPA, Liu G, Amos CI, Hung RJ, Briollais L.
Show Full Abstract

Common genetic variants associated with lung cancer have been well studied in the past decade. However, only 12.3% heritability has been explained by these variants. In this study, we investigate the contribution of rare variants (RVs) (minor allele frequency <0.01) to lung cancer through two large whole exome sequencing case-control studies. We first performed gene-based association tests using a novel Bayes Factor statistic in the International Lung Cancer Consortium, the discovery study (European, 1042 cases vs. 881 controls). The top genes identified are further assessed in the UK Biobank (European, 630 cases vs. 172 864 controls), the replication study. After controlling for the false discovery rate, we found two genes, CTSL and APOE, significantly associated with lung cancer in both studies. Single variant tests in UK Biobank identified 4 RVs (3 missense variants) in CTSL and 2 RVs (1 missense variant) in APOE stongly associated with lung cancer (OR between 2.0 and 139.0). The role of these genetic variants in the regulation of CTSL or APOE expression remains unclear. If such a role is established, this could have important therapeutic implications for lung cancer patients.

Also flagged:ferroptosisKidney diseasesdeathrenal diseasesironpathogenesis
Journal Article 2023-09-22 No Snippets Li J, Zheng S, Fan Y, Tan K.
Show Full Abstract

Kidney diseases remain one of the leading causes of human death and have placed a heavy burden on the medical system. Regulated cell death contributes to the pathology of a plethora of renal diseases. Recently, with in-depth studies into kidney diseases and cell death, a new iron-dependent cell death modality, known as ferroptosis, has been identified and has attracted considerable attention among researchers in the pathogenesis of kidney diseases and therapeutics to treat them. The majority of studies suggest that ferroptosis plays an important role in the pathologies of multiple kidney diseases, such as acute kidney injury (AKI), chronic kidney disease, and renal cell carcinoma. In this review, we summarize recently identified regulatory molecular mechanisms of ferroptosis, discuss ferroptosis pathways and mechanisms of action in various kidney diseases, and describe the protective effect of ferroptosis inhibitors against kidney diseases, especially AKI. By summarizing the prominent roles of ferroptosis in different kidney diseases and the progress made in studying ferroptosis, we provide new directions and strategies for future research on kidney diseases. In summary, ferroptotic factors are potential targets for therapeutic intervention to alleviate different kidney diseases, and targeting them may lead to new treatments for patients with kidney diseases.

HTT
Also flagged:Mendelian disordersgenetic disordershaploinsufficiency disordersRett syndrome 1protein toxicity disordersspinocerebellar ataxia
Journal Article 2023-09-22 ✓ 1 Snippet Deisseroth CA, Lee WS, Kim J, Jeong HH, Dhindsa RS, Wang J, Zoghbi HY, Liu Z.
In-Text Gene Mentions

HTT

Show Full Abstract

In the effort to treat Mendelian disorders, correcting the underlying molecular imbalance may be more effective than symptomatic treatment. Identifying treatments that might accomplish this goal requires extensive and up-to-date knowledge of molecular pathways-including drug-gene and gene-gene relationships. To address this challenge, we present "parsing modifiers via article annotations" (PARMESAN), a computational tool that searches PubMed and PubMed Central for information to assemble these relationships into a central knowledge base. PARMESAN then predicts putatively novel drug-gene relationships, assigning an evidence-based score to each prediction. We compare PARMESAN's drug-gene predictions to all of the drug-gene relationships displayed by the Drug-Gene Interaction Database (DGIdb) and show that higher-scoring relationship predictions are more likely to match the directionality (up- versus down-regulation) indicated by this database. PARMESAN had more than 200,000 drug predictions scoring above 8 (as one example cutoff), for more than 3,700 genes. Among these predicted relationships, 210 were registered in DGIdb and 201 (96%) had matching directionality. This publicly available tool provides an automated way to prioritize drug screens to target the most-promising drugs to test, thereby saving time and resources in the development of therapeutics for genetic disorders.

PEBP1
Also flagged:Inflammatory cytokinethyroid cancernuclear exportcancerendocrine neoplasmtumor
Journal Article 2023-09-22 ✓ 3 Snippets Ma C, Zhang N, Wang T, Guan H, Huang Y, Huang L, Zheng Y, Zhang L, Han L, Huo Y, Yang Y, Zheng H, Yang M.
In-Text Gene Mentions

Loss of LNCPTCTS in tumors leads to accumulation of Snail in the nucleus, suppressed transcription of E-cadherin and PEBP1, reduced E-cadherin and PEBP1 protein levels, and activated epithelial-mesenchymal transition and MAPK signaling.

…of E-cadherin andPEBP1, reduced E-cadherin and…

…reduced E-cadherin andPEBP1protein levels, and…

Show Full Abstract

Lymph node metastases are commonly observed in diverse malignancies where they promote cancer progression and poor outcomes, although the molecular basis is incompletely understood. Thyroid cancer is the most prevalent endocrine neoplasm characterized by high frequency of lymph node metastases. Here, we uncover an inflammatory cytokines-controlled epigenetic program during thyroid cancer progression. LNCPTCTS acts as a novel tumor suppressive lncRNA with remarkably decreased expression in thyroid cancer specimens, especially in metastatic lymph nodes. Inflammatory cytokines TNFα or CXCL10, which are released from tumor microenvironment (TME), impair binding capabilities of the transcription factor (TF) EGR1 to the LNCPTCTS promoter and reduce the lncRNA expression in cells. Notably, LNCPTCTS binds to eEF1A2 protein and facilitates the interaction between eEF1A2 and Snail, which promotes Snail nucleus export via the RanGTP-Exp5-aa-tRNA-eEF1A2 complex. Loss of LNCPTCTS in tumors leads to accumulation of Snail in the nucleus, suppressed transcription of E-cadherin and PEBP1, reduced E-cadherin and PEBP1 protein levels, and activated epithelial-mesenchymal transition and MAPK signaling. Our results reveal what we believe to be a novel paradigm between TME and epigenetic reprogram in cancer cells which drives lymph node metastases, therefore illuminating the suitability of LNCPTCTS as a targetable vulnerability in thyroid cancer.

Also flagged:Neonatalhypoxic-ischemic encephalopathyHIEdeathneurodevelopmental impairmentErythropoietin
Journal Article 2023-09-22 No Snippets Gonzalez FF, Voldal E, Comstock BA, Mayock DE, Goodman AM, Cornet MC, Wu TW, Redline RW, Heagerty P, Juul SE, Wu YW.
Show Full Abstract

<h4>Objective</h4>We aimed to examine the association between placental abnormalities and neurodevelopmental outcomes in a multicenter cohort of newborn infants with hypoxic-ischemic encephalopathy (HIE) that underwent therapeutic hypothermia. We hypothesized that subjects with acute placental abnormalities would have reduced risk of death or neurodevelopmental impairment (NDI) at 2 years of age after undergoing therapeutic hypothermia compared to subjects without acute placental changes.<h4>Study design</h4>Among 500 subjects born at ≥36 weeks gestation with moderate or severe HIE enrolled in the High-dose Erythropoietin for Asphyxia and Encephalopathy (HEAL) Trial, a placental pathologist blinded to clinical information reviewed clinical pathology reports to determine the presence of acute only, chronic only, or both acute and chronic histologic abnormalities. We calculated adjusted relative risks (aRRs) for associations between placental pathologic abnormalities and death or NDI at age 2 years, adjusting for HIE severity, treatment assignment, and site.<h4>Result</h4>321/500 subjects (64%) had available placental pathology reports. Placental abnormalities were characterized as acute only (20%), chronic only (21%), both acute and chronic (43%), and none (15%). The risk of death or NDI was not statistically different between subjects with and without an acute placental abnormality (46 vs. 53%, aRR 1.1, 95% confidence interval (CI): 0.9, 1.4). Subjects with two or more chronic lesions were more likely to have an adverse outcome than subjects with no chronic abnormalities, though this did not reach statistical significance (55 vs. 45%, aRR 1.24, 95% CI: 0.99, 1.56).<h4>Conclusion</h4>Placental pathologic findings were not independently associated with risk of death or NDI in subjects with HIE. The relationship between multiple chronic placental lesions and HIE outcomes deserves further study.

SOX6
Also flagged:small ubiquitin-likeconjugationSUMOylationtranslational modificationtranscription factorsSOX1
Journal Article 2023-09-22 ✓ 1 Snippet Queiroz LY, Kageyama R, Cimarosti HI.
In-Text Gene Mentions

…SOX1, SOX2, SOX3,SOX6, Bmi1, and Nanog,…

Show Full Abstract

SUMO (small ubiquitin-like modifier) conjugation or SUMOylation, a post-translational modification, is a crucial regulator of protein function and cellular processes. In the context of neural stem cells (NSCs), SUMOylation has emerged as a key player, affecting their proliferation, differentiation, and survival. By modifying transcription factors, such as SOX1, SOX2, SOX3, SOX6, Bmi1, and Nanog, SUMOylation can either enhance or impair their transcriptional activity, thus impacting on NSCs self-renewal. Moreover, SUMOylation regulates neurogenesis and neuronal differentiation by modulating key proteins, such as Foxp1, Mecp2, MEF2A, and SOX10. SUMOylation is also crucial for the survival and proliferation of NSCs in both developing and adult brains. By regulating the activity of transcription factors, coactivators, and corepressors, SUMOylation acts as a molecular switch, inducing cofactor recruitment and function during development. Importantly, dysregulation of NSCs SUMOylation has been implicated in various disorders, including embryonic defects, ischemic cerebrovascular disease, glioma, and the harmful effects of benzophenone-3 exposure. Here we review the main findings on SUMOylation-mediated regulation of NSCs self-renewal, differentiation and survival. Better understanding NSCs SUMOylation mechanisms and its functional consequences might provide new strategies to promote neuronal differentiation that could contribute for the development of novel therapies targeting neurodegenerative diseases.

HTT
Also flagged:behavioralNeurodevelopmental disordersbrain developmentattention deficit and hyperactivity disorderADHDautism spectrum disorder
Journal Article 2023-09-22 ✓ 1 Snippet Harper KM, Harp SJ, Moy SS.
In-Text Gene Mentions

…6 member 4;5-HTT), encodes the serotonin…

Show Full Abstract

Neurodevelopmental disorders (NDDs) are complex conditions characterized by heterogeneous clinical profiles and symptoms that arise in infancy and childhood. NDDs are often attributed to a complicated interaction between genetic risk and environmental factors, suggesting a need for preclinical models reflecting the combined impact of heritable susceptibility and environmental effects. A notable advantage of "two-hit" models is the power to reveal underlying vulnerability that may not be detected in studies employing only genetic or environmental alterations. In this review, we summarize existing literature that investigates detrimental interactions between prenatal stress (PNS) and genes associated with NDDs, with a focus on behavioral phenotyping approaches in mouse models. A challenge in determining the overall role of PNS exposure in genetic models is the diversity of approaches for inducing stress, variability in developmental timepoints for exposure, and differences in phenotyping regimens across laboratories. Identification of optimal stress protocols and critical windows for developmental effects would greatly improve the use of PNS in gene × environment mouse models of NDDs.

Also flagged:carbonethylenehydrogenpropanemethaneformaldehyde
Journal Article 2023-09-22 No Snippets Zhang S, Shi C, Di L.
Show Full Abstract

By effective utilization of the dynamic mesh and coordinate transformation techniques, an ultrasonic horn is physically integrated in the chamber of an internal combustion engine. The consequences of multiple ultrasonic-fed strategies on the flow field, combustion process, and emission formation under the same working conditions are studied by numerical simulation. Based precisely on the bench test data, GT-Power and CONVERGE set up the original engine one-dimension (1d) and three-dimension (3d) simulation models. The chamber pressure and heat release rate of the 1d and 3d models under a full load condition of 3000 r·min<sup>-1</sup> were validated, and the maximum relative error is less than 5%, proving the accuracy of the model. By reforming the 3d numerical model, ultrasonics is added to the gasoline engine's combustion chamber. Six different ultrasonic-fed schemes with 20 kHz amplitude of 30-300 μm are typically selected for in-depth research. The larger the amplitude, the stronger the turbulent kinetic energy (TKE), and the maximum TKE exceeds 46.6% at the ignition time. Stronger TKE can energetically encourage the generation of OH, O, and H radicals and improve the combustion reaction rate, and the peak pressure (<i>P</i><sub>MAX</sub>) is increased by 1.9 MPa compared with scheme No. However, NO<sub><i>X</i></sub> and HC emissions gradually increase, reaching a maximum of 32.4 and 43.8%, respectively, while CO and soot emissions decrease, reaching a maximum of 11.4 and 11%, respectively. Four groups of ultrasonic-fed schemes with an amplitude of 100 μm and frequency of 20-50 kHz are scientifically studied. The findings indicated that the TKE level steadily increases as the frequency increases and the in-cylinder TKE increases by 16.4% at ignition time. The increase in ultrasonic frequency can promote the generation of active free radicals and meaningfully improve the combustion reaction rate to a certain extent. The <i>P</i><sub>MAX</sub> can be increased up to 1 MPa compared with scheme No. At the same time, the NO<sub><i>X</i></sub>, HC, and soot also increased considerably, reaching 31.8, 17.9, and 21.9%, respectively. The CO showed a downward trend but gradually slowed, with a maximum decline of 6.5% at 20 kHz. The above simulation analysis is based on the full load condition of 3000 r·min<sup>-1</sup>, sufficiently proving that ultrasonics has a regulation effect on emissions and can achieve specific emissions through later optimization.

Also flagged:Nrf2Canceragingtranscription factordetoxificationgene expression
Journal Article 2023-09-22 No Snippets Lin L, Wu Q, Lu F, Lei J, Zhou Y, Liu Y, Zhu N, Yu Y, Ning Z, She T, Hu M.
Show Full Abstract

Cancer is a borderless global health challenge that continues to threaten human health. Studies have found that oxidative stress (OS) is often associated with the etiology of many diseases, especially the aging process and cancer. Involved in the OS reaction as a key transcription factor, Nrf2 is a pivotal regulator of cellular redox state and detoxification. Nrf2 can prevent oxidative damage by regulating gene expression with antioxidant response elements (ARE) to promote the antioxidant response process. OS is generated with an imbalance in the redox state and promotes the accumulation of mutations and genome instability, thus associated with the establishment and development of different cancers. Nrf2 activation regulates a plethora of processes inducing cellular proliferation, differentiation and death, and is strongly associated with OS-mediated cancer. What's more, Nrf2 activation is also involved in anti-inflammatory effects and metabolic disorders, neurodegenerative diseases, and multidrug resistance. Nrf2 is highly expressed in multiple human body parts of digestive system, respiratory system, reproductive system and nervous system. In oncology research, Nrf2 has emerged as a promising therapeutic target. Therefore, certain natural compounds and drugs can exert anti-cancer effects through the Nrf2 signaling pathway, and blocking the Nrf2 signaling pathway can reduce some types of tumor recurrence rates and increase sensitivity to chemotherapy. However, Nrf2's dual role and controversial impact in cancer are inevitable consideration factors when treating Nrf2 as a therapeutic target. In this review, we summarized the current state of biological characteristics of Nrf2 and its dual role and development mechanism in different tumor cells, discussed Keap1/Nrf2/ARE signaling pathway and its downstream genes, elaborated the expression of related signaling pathways such as AMPK/mTOR and NF-κB. Besides, the main mechanism of Nrf2 as a cancer therapeutic target and the therapeutic strategies using Nrf2 inhibitors or activators, as well as the possible positive and negative effects of Nrf2 activation were also reviewed. It can be concluded that Nrf2 is related to OS and serves as an important factor in cancer formation and development, thus provides a basis for targeted therapy in human cancers.

Also flagged:Inflammatory joint diseasesosteoarthritisrheumatoid arthritisjoint diseasejoint diseasesInflammatory diseases of the joints
Journal Article 2023-09-22 No Snippets Eremeev A, Pikina A, Ruchko Y, Bogomazova A.
Show Full Abstract

Inflammatory joint diseases, among which osteoarthritis and rheumatoid arthritis are the most common, are characterized by progressive degeneration of the cartilage tissue, resulting in the threat of limited or lost joint functionality in the absence of treatment. Currently, treating these diseases is difficult, and a number of existing treatment and prevention measures are not entirely effective and are complicated by the patients' conditions, the multifactorial nature of the pathology, and an incomplete understanding of the etiology. Cellular technologies based on induced pluripotent stem cells (iPSCs) can provide a vast cellular resource for the production of artificial cartilage tissue for replacement therapy and allow the possibility of a personalized approach. However, the question remains whether a number of etiological abnormalities associated with joint disease are transmitted from the source cell to iPSCs and their chondrocyte derivatives. Some data state that there is no difference between the iPSCs and their derivatives from healthy and sick donors; however, there are other data indicating a dissimilarity. Therefore, this topic requires a thorough study of the differentiation potential of iPSCs and the factors influencing it, the risk factors associated with joint diseases, and a comparative analysis of the characteristics of cells obtained from patients. Together with cultivation optimization methods, these measures can increase the efficiency of obtaining cell technology products and make their wide practical application possible.

TAOK3DCC
Also flagged:MethylationHead and neck squamous cell carcinomaHNSCCcancerpathogenesisimmune responses
Journal Article 2023-09-22 ✓ 2 Snippets Burkitt K.
In-Text Gene Mentions

Differentially methylated genes between responders and non-responders were associated with several molecular pathways, including axon guidance (e.g., BMPR1B, CAMK2D, EPHNA6, NTNG1), hippo signaling (AFP, BMP7, GLI 1), pathways in cancer (IL2RA, MAPK10, IGF1R, AKT3, MLH1, COL4A1), and MAP signaling (e.g., TAOK3, STK3, IL1RAP, MAP3K1).

Among these genes, EDNRD and DCC hypermethylation identified dysplastic/cancer with a sensitivity of 46% and specificity of 72%, which were similar to the sensitivity of 56% and specificity of 66% in the case of identification by expert clinicians based on lesion examination.

Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide and is associated with high mortality. The main reasons for treatment failure are a low rate of early diagnosis, high relapse rates, and distant metastasis with poor outcomes. These are largely due to a lack of diagnostic, prognostic, and predictive biomarkers in HNSCC. DNA methylation has been demonstrated to play an important role in the pathogenesis of HNSCC, and recent studies have also valued DNA methylation as a potential biomarker in HNSCC. This review summarizes the current knowledge on DNA methylation profiles in HPV-positive and HPV-negative HNSCC and how these may contribute to the pathogenesis of HNSCC. It also summarizes the potential value of DNA methylation as a biomarker in the diagnosis, prognosis, and prediction of the response to therapy. With the recent immunotherapy era in head and neck treatment, new strategies to improve immune responses by modulating TIMEs have been intensely investigated in early-phase trials. Therefore, this study additionally summarizes the role of DNA methylation in the regulation of TIMEs and potential predictive immunotherapy response biomarkers. Finally, this study reviews ongoing clinical trials using DNA methylation inhibitors in HNSCC.

HFE
Also flagged:Anemiaoxygenblood disorderchronic diseaseiron deficiency anemiaErythropoiesis
Journal Article 2023-09-22 ✓ 1 Snippet Kondo S, Ferdousi F, Zhao J, Suidasari S, Yokozawa M, Yamauchi K, Tominaga KI, Isoda H.
In-Text Gene Mentions

…intake can causehemochromatosis[ 7 ].…

Show Full Abstract

Natural resources have recently received considerable attention as complementary or alternative hematinic agents. In this regard, olive leaf extract, which is rich in bioactive phenolic compounds, has been reported to induce erythroid differentiation in human hematopoietic stem cells. Therefore, in the present study, we aimed to explore the potential hematinic properties of aqueous olive leaf extract (WOL) in vivo. After 24 days of administering WOL to healthy mice orally, red blood cell (RBC), hematocrit, reticulocyte, and reticulocyte hemoglobin content (CHr) showed a significant increase. Additionally, WOL promoted plasma iron levels and the expression of splenic ferroportin (Fpn), an iron transporter. Additionally, a single-arm pilot study involving a limited number of healthy volunteers was conducted to assess WOL's feasibility, compliance, and potential benefits. Following an 8-week intervention with WOL, RBC count and hemoglobin level were significantly increased. Notably, there were no significant changes in the safety measures related to liver and kidney functions. Furthermore, we identified oleuropein and oleuroside as the active components in WOL to induce erythroid differentiation in the K562 cell line. Altogether, our study presents evidence of the hematinic potential of WOL in the in vivo studies, opening up exciting possibilities for future applications in preventing or treating anemia.

SERPINC1
Also flagged:Traumatic Brain Injurytraumatic brain injuriescell adhesioncollagenlamininresponse to stress
Journal Article 2023-09-22 ✓ 2 Snippets Saei AA, Gharibi H, Lyu H, Nilsson B, Jafari M, Von Holst H, Zubarev RA.
In-Text Gene Mentions

…beta chain (C3),antithrombin-III(SERPINC1), plasma kallikrein…

…chain (C3), antithrombin-III (SERPINC1), plasma kallikrein (KLKB1),…

Show Full Abstract

We investigated the immediate molecular consequences of traumatic brain injuries (TBIs) using a novel proteomics approach. We simulated TBIs using an innovative laboratory apparatus that employed a 5.1 kg dummy head that held neuronal cells and generated a ≤4000 g-force acceleration upon impact. A Proteome Integral Solubility Alteration (PISA) assay was then employed to monitor protein solubility changes in a system-wide manner. Dynamic impacts led to both a reduction in neuron viability and massive solubility changes in the proteome. The affected proteins mapped not only to the expected pathways, such as those of cell adhesion, collagen, and laminin structures, as well as the response to stress, but also to other dense protein networks, such as immune response, complement, and coagulation cascades. The cellular effects were found to be mainly due to the shockwave rather than the g-force acceleration. Soft materials could reduce the impact's severity only until they were fully compressed. This study shows a way of developing a proteome-based meter for measuring irreversible shockwave-induced cell damage and provides a resource for identifying protein biomarkers of TBIs and potential drug targets for the development of products aimed at primary prevention and intervention.

Also flagged:cadherinaxonsynapseaxons/guidance proteinCadherin-8
Journal Article 2023-09-22 No Snippets Mesías RE, Zaki Y, Guevara CA, Friedman LG, Hussein A, Therrien K, Magee AR, Tzavaras N, Del Valle P, Baxter MG, Huntley GW, Benson DL.
Show Full Abstract

Action-outcome associations depend on prefrontal cortex (PFC) projections to the dorsal striatum. To assess how these projections form, we measured PFC axon patterning, synapse formation, and functional maturation in the postnatally developing mouse striatum. Using Hotspot analysis, we show that PFC axons form an adult-like pattern of clustered terminations in the first postnatal week that remains largely stable thereafter. PFC-striatal synaptic strength is adult-like by P21, while excitatory synapse density increases until adulthood. We then tested how the targeted deletion of a candidate adhesion/guidance protein, Cadherin-8 (Cdh8), from corticostriatal neurons regulates pathway development. Mutant mice showed diminished PFC axon targeting and reduced spontaneous glutamatergic synaptic activity in the dorsal striatum. They also exhibited impaired behavioral performance in action-outcome learning. The data show that PFC-striatal axons form striatal territories through an early, directed growth model and they highlight essential contributions of Cdh8 to the anatomical and functional features critical for the formation of action-outcome associations.

Also flagged:MembraneL-lactic acidmembranesgraftinfectionmaxillary sinusitis
Journal Article 2023-09-22 No Snippets Yamaguchi K, Munakata M, Sato D, Kataoka Y, Kawamata R.
Show Full Abstract

Maxillary sinus augmentation with a lateral approach (MSA) is a well-established treatment. In this prospective study, we evaluated risk factors for postoperative bone graft displacement and reported the clinical application of long-term resorbable L-lactic acid/-caprolactone (PLA/PCL) as a barrier membrane to cover the open window in the lateral wall in MSA. Twenty-four patients underwent MSA according to the relevant criteria; CT data obtained before and 1 week (1 w) and 5-6 months (5 m) post-MSA, bone height changes, bone height reduction rates at 1 w and 5 m post-MSA, bone graft displacement measurements, and risk factors were examined. All patients showed bone height increments (<i>p</i> < 0.005). However, no difference was observed between 1 w and 5 m post-MSA. Bone graft displacement was observed in eight patients; the reduction rate from 1 w to 5 m post-MSA was 8.38% ± 4.88%. Sex, septa, maxillary sinus floor-palatal bone distance, and maxillary sinus floor-maxillary ostium distance were associated with bone graft displacement (<i>p</i> < 0.05). The height from the maxillary sinus floor to the palatal bone and the sinus angle influenced the augmentation degree (<i>p</i> < 0.05). The PLA/PCL membrane is compared favorably with other membranes and may be useful as a barrier membrane for the MSA open window.

CACNA1E
Also flagged:DexamethasoneImpairmentcognitive dysfunctionlipopolysaccharideion channelscalcium
Journal Article 2023-09-22 ✓ 2 Snippets Shishkina GT, Kalinina TS, Lanshakov DA, Bulygina VV, Komysheva NP, Bannova AV, Drozd US, Dygalo NN.
In-Text Gene Mentions

…calcium channels (Cacna1eand Cacna2d1 ),…

…analysis showed thatCacna1e, Creb1 ,…

Show Full Abstract

Inflammatory activation within the brain is linked to a decrease in cognitive abilities; however, the molecular mechanisms implicated in the development of inflammatory-related cognitive dysfunction and its prevention are poorly understood. This study compared the responses of hippocampal transcriptomes 3 months after the striatal infusion of lipopolysaccharide (LPS; 30 µg), resulting in memory loss, or with dexamethasone (DEX; 5 mg/kg intraperitoneal) pretreatment, which abolished the long-term LPS-induced memory impairment. After LPS treatment, a significant elevation in the expression of immunity/inflammatory-linked genes, including chemokines (<i>Cxcl13</i>), cytokines (<i>Il1b</i> and <i>Tnfsf13b</i>), and major histocompatibility complex (MHC) class II members (<i>Cd74</i>, <i>RT1-Ba</i>, <i>RT1-Bb</i>, <i>RT1-Da</i>, and <i>RT1-Db1</i>) was observed. DEX pretreatment did not change the expression of these genes, but significantly affected the expression of genes encoding ion channels, primarily calcium and potassium channels, regulators of glutamate (<i>Slc1a2</i>, <i>Grm5</i>, <i>Grin2a</i>), and GABA (<i>Gabrr2</i>, <i>Gabrb2</i>) neurotransmission, which enriched in such GO biological processes as "Regulation of transmembrane transport", "Cognition", "Learning", "Neurogenesis", and "Nervous system development". Taken together, these data suggest that (1) pretreatment with DEX did not markedly affect LPS-induced prolonged inflammatory response; (2) DEX pretreatment can affect processes associated with glutamatergic signaling and nervous system development, possibly involved in the recovery of memory impairment induced by LPS.

HTT
Also flagged:lactationCDH2MAPK1ITGB1CAMSAP2MAPKAPK5
Journal Article 2023-09-22 ✓ 2 Snippets Sahito JZA, Deng S, Qin L, Xiao L, Zhang D, Huang B.
In-Text Gene Mentions

… chi_circ_0001486 up-regulatesHTT, chi_circ_0001509 up-regulate…

HTTand MAPK1 genes…

Show Full Abstract

Circular RNAs (circRNAs) are a type of non-coding RNA that play a crucial role in the development and lactation of mammary glands in mammals. A total of 107 differentially expressed circRNAs (DE circRNAs) were found, of which 52 were up-regulated and 55 were down-regulated. We also found that DE circRNA host genes were mainly involved in GO terms related to the development process of mammary epithelial cells and KEGG pathways were mostly related to mammary epithelial cells, lactation, and gland development. Protein network analysis found that DE circRNAs can competitively bind to miRNAs as key circRNAs by constructing a circRNA-miRNA-mRNA network. CircRNAs competitively bind to miRNAs (miR-10b-3p, miR-671-5p, chi-miR-200c, chi-miR-378-3p, and chi-miR-30e-5p) involved in goat mammary gland development, mammary epithelial cells, and lactation, affecting the expression of core genes (<i>CDH2</i>, <i>MAPK1</i>, <i>ITGB1</i>, <i>CAMSAP2</i>, and <i>MAPKAPK5</i>). Here, we generated CiMECs and systematically explored the differences in the transcription profile for the first time using whole-transcriptome sequencing. We also analyzed the interaction among mRNA, miRNA, and cirRNA and predicted that circRNA plays an important role in the maintenance of mammary epithelial cells.

OLFM4
Also flagged:Colorectal cancercancercolorectal adenocarcinomaAPCp53KRAS
Journal Article 2023-09-22 ✓ 1 Snippet Maurya NS, Kushwaha S, Vetukuri RR, Mani A.
In-Text Gene Mentions

…KRT19, A2M, EIF3C,OLFM4, CA2, CEACAM5, GAPDH,…

Show Full Abstract

Colorectal cancer affects the colon or rectum and is a common global health issue, with 1.1 million new cases occurring yearly. The study aimed to identify gene signatures for the early detection of CRC using machine learning (ML) algorithms utilizing gene expression data. The TCGA-CRC and GSE50760 datasets were pre-processed and subjected to feature selection using the LASSO method in combination with five ML algorithms: Adaboost, Random Forest (RF), Logistic Regression (LR), Gaussian Naive Bayes (GNB), and Support Vector Machine (SVM). The important features were further analyzed for gene expression, correlation, and survival analyses. Validation of the external dataset GSE142279 was also performed. The RF model had the best classification accuracy for both datasets. A feature selection process resulted in the identification of 12 candidate genes, which were subsequently reduced to 3 (CA2, CA7, and ITM2C) through gene expression and correlation analyses. These three genes achieved 100% accuracy in an external dataset. The AUC values for these genes were 99.24%, 100%, and 99.5%, respectively. The survival analysis showed a significant logrank <i>p</i>-value of 0.044 for the final gene signatures. The analysis of tumor immunocyte infiltration showed a weak correlation with the expression of the gene signatures. CA2, CA7, and ITM2C can serve as gene signatures for the early detection of CRC and may provide valuable information for prognostic and therapeutic decision making. Further research is needed to fully understand the potential of these genes in the context of CRC.

Also flagged:Synthesisβ-keto estersketo estermetabolismexcretionquorum-sensing
Journal Article 2023-09-22 No Snippets Martínez-Cifuentes M, Soto-Tapia E, Linares-Pipón C, Bradshaw B, Valenzuela-Hormazabal P, Ramírez D, Muñoz-Torres P, Parra C.
Show Full Abstract

This work proposes the design of β-keto esters as antibacterial compounds. The design was based on the structure of the autoinducer of bacterial quorum sensing, <i>N</i>-(3-oxo-hexanoyl)-l-homoserine lactone (3-oxo-C6-HSL). Eight β-keto ester analogues were synthesised with good yields and were spectroscopically characterised, showing that the compounds were only present in their β-keto ester tautomer form. We carried out a computational analysis of the reactivity and ADME (absorption, distribution, metabolism, and excretion) properties of the compounds as well as molecular docking and molecular dynamics calculations with the LasR and LuxS quorum-sensing (QS) proteins, which are involved in bacterial resistance to antibiotics. The results show that all the compounds exhibit reliable ADME properties and that only compound <b>7</b> can present electrophile toxicity. The theoretical reactivity study shows that compounds <b>6</b> and <b>8</b> present a differential local reactivity regarding the rest of the series. Compound <b>8</b> presents the most promising potential in terms of its ability to interact with the LasR and LuxS QS proteins efficiently according to its molecular docking and molecular dynamics calculations. An initial in vitro antimicrobial screening was performed against the human pathogenic bacteria <i>Pseudomonas aeruginosa</i> and <i>Staphylococcus aureus</i> as well as the phytopathogenic bacteria <i>Pseudomonas syringae</i> and <i>Agrobacterium tumefaciens</i>. Compounds <b>6</b> and <b>8</b> exhibit the most promising results in the in vitro antimicrobial screening against the panel of bacteria studied.

Also flagged:Hydrogelswaterdegradationwound healinghydrogendeath
Journal Article 2023-09-22 No Snippets Hu B, Gao J, Lu Y, Wang Y.
Show Full Abstract

Hydrogels are particularly suitable materials for loading drug delivery agents; their high water content provides a biocompatible environment for most biomolecules, and their cross-linked nature protects the loaded agents from damage. During delivery, the delivered substance usually needs to be released gradually over time, which can be achieved by degradable cross-linked chains. In recent years, biodegradable hydrogels have become a promising technology in new methods of disease treatment and drug delivery methods due to their many advantageous properties. This review briefly discusses the degradation mechanisms of different types of biodegradable hydrogel systems and introduces the specific applications of degradable hydrogels in several new methods of disease treatment and drug delivery methods.

HTT
Also flagged:chaperoneautophagydegradationcentral nervous system diseasesdeathneurodegenerative diseases
Journal Article 2023-09-22 ✓ 1 Snippet Jia Q, Li J, Guo X, Li Y, Wu Y, Peng Y, Fang Z, Zhang X.
In-Text Gene Mentions

…of α-synuclein andHTT, cause neurotoxicity in…

Show Full Abstract

<h4>Abstract</h4>Chaperone-mediated autophagy is one of three types of autophagy and is characterized by the selective degradation of proteins. Chaperone-mediated autophagy contributes to energy balance and helps maintain cellular homeostasis, while providing nutrients and support for cell survival. Chaperone-mediated autophagy activity can be detected in almost all cells, including neurons. Owing to the extreme sensitivity of neurons to their environmental changes, maintaining neuronal homeostasis is critical for neuronal growth and survival. Chaperone-mediated autophagy dysfunction is closely related to central nervous system diseases. It has been shown that neuronal damage and cell death are accompanied by chaperone-mediated autophagy dysfunction. Under certain conditions, regulation of chaperone-mediated autophagy activity attenuates neurotoxicity. In this paper, we review the changes in chaperone-mediated autophagy in neurodegenerative diseases, brain injury, glioma, and autoimmune diseases. We also summarize the most recent research progress on chaperone-mediated autophagy regulation and discuss the potential of chaperone-mediated autophagy as a therapeutic target for central nervous system diseases.

Also flagged:-cell-cell communicationextracellularMrgpra3adenosine Adora2breceptor
Journal Article 2023-09-22 No Snippets Lian Y, Wu C, Liu L, Li X.
Show Full Abstract

No abstract available.

Also flagged:COVID-19coronavirus disease of 2019infectionacute respiratory distress syndromeARDSprimary immunodeficiencies
Journal Article 2023-09-22 No Snippets Vlasova-St Louis I, Fang D, Amer Y, Mohei H.
Show Full Abstract

During the COVID-19 pandemic, it became apparent that precision medicine relies heavily on biological multi-omics discoveries. High throughput omics technologies, such as host genomics, transcriptomics, proteomics, epigenomics, metabolomics/lipidomics, and microbiomics, have become an integral part of precision diagnostics. The large number of data generated by omics technologies allows for the identification of vulnerable demographic populations that are susceptible to poor disease outcomes. Additionally, these data help to pinpoint the omics-based biomarkers that are currently driving advancements in precision and preventive medicine, such as early diagnosis and disease prognosis, individualized treatments, and vaccination. This report summarizes COVID-19-omic studies, highlights the results of completed and ongoing omics investigations in individuals who have experienced severe disease outcomes, and examines the impact that repurposed/novel antiviral drugs, targeted immunotherapeutics, and vaccines have had on individual and public health.

bioRxiv 2023-09-22 Preprint (No Snippets API) Lowe SA, Wilson AD, Aughey G, Banarjee A, Goble T, Simon-Batsford N, Sanderson A, Kratschmer P, Balogun M, Gao H, Aw SS, Jepson JE.
Show Full Abstract

<h4>SUMMARY</h4> Gain-of-function mutations in BK potassium channels (BK GOF) cause debilitating involuntary limb movements. BK channels modulate action potential shape and neurotransmission in mature neurons, yet some BK GOF mutations also cause neurodevelopmental morbidities. Thus, whether BK GOF impairs limb control by altering the excitation/inhibition of mature motor circuits, or by disrupting their development, remains unclear. To address this issue, we developed a genetic method enabling spatiotemporal control of BK channel expression in neurons of the fruit fly, Drosophila . In concert with high-resolution measurements of limb kinematics, we demonstrate that GOF BK channels act during a narrow neurodevelopmental period to perturb limb control in adult flies. During this period, BK GOF alters synaptic localisation of the key active zone protein Bruchpilot and suppresses excitatory neurotransmission. In a wild-type background, we find that reducing neural activity during neurodevelopment yields similar motor defects to those observed in BK GOF flies. Conversely, enhancing neural excitability during development rescues alterations in limb kinematics in BK GOF flies. Collectively, our results suggest that BK GOF perturbs limb control largely by disrupting activity-dependent aspects of neuronal development.

bioRxiv 2023-09-22 Preprint (No Snippets API) Turvey GL, de Alba EL, Stewart E, Byrom L, Cook H, Sofi S, Alalti A, Ainscough JF, Mason A, Antson AA, Coverley D.
Show Full Abstract

CIZ1 is a nuclear matrix protein that is part of the large RNA-dependent supramolecular assembly complexes (SMACs) that form at the inactive X chromosome (Xi) in female cells, and smaller assemblies throughout the nucleus in males and females. It plays a role in maintenance of epigenetic state and gene expression in differentiated cells, via stabilisation of histone post-translational modifications H2AK119ub1 and H3K27me3, added by polycomb repressive complexes (PRC) 1 and 2. Here, we show that expression of the N-terminal replication domain (RD) and C-terminal anchor domain (AD) of human CIZ1 transcript is uncoupled, with consistently elevated AD in early stage breast cancers, and sporadically elevated AD in other common solid tumours. At the protein level CIZ1-Xi SMACs are corrupted in female breast cancers cells, and this is accompanied by elevated AD-encoding transcripts. We modelled the effect of AD fragments in primary murine embryonic fibroblasts and observed dominant-negative interference with CIZ1 SMACs during their assembly in early G1 phase. Mutagenesis identified the matrin 3 homology domain as essential for self-interaction to form stable homodimers in vitro , and as a determinant of its dominant-negative effect in cells, implicating the dimerization interface in CIZ1 SMAC integrity. SMAC disruption was coincident with depletion of PRC1-dependent H2AK119ub1 from Xi chromatin, in a manner abrogated by the PR-deubiquitinase inhibitor PR619, suggesting that CIZ1 SMACs normally stabilise H2AK119ub1 by shielding Xi chromatin from attack by deubiquitinases. Moreover, SMAC disruption was accompanied by changes in gene expression within days. Together, the data suggest that inappropriate expression of CIZ1 AD fragments could drive epigenetic instability in early stage breast cancers by destabilizing the CIZ1 SMACs that normally protect repressed chromatin. <h4>Abstract Figure</h4>

bioRxiv 2023-09-22 Preprint (No Snippets API) Huang RJ, Wichmann IA, Su A, Sathe A, Shum MV, Grimes SM, Meka R, Almeda A, Bai X, Shen J, Nguyen Q, Amieva MR, Hwang JH, Ji HP.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Objective</h4> Gastric intestinal metaplasia ( GIM ) is a precancerous lesion that increases gastric cancer ( GC ) risk. The Operative Link on GIM ( OLGIM ) is a combined clinical-histopathologic system to risk-stratify patients with GIM. The identification of molecular biomarkers that are indicators for advanced OLGIM lesions may improve cancer prevention efforts. <h4>Methods</h4> This study was based on clinical and genomic data from four cohorts: 1) GAPS, a GIM cohort with detailed OLGIM severity scoring (N=303 samples); 2) the Cancer Genome Atlas (N=198); 3) a collation of in-house and publicly available scRNA-seq data (N=40), and 4) a spatial validation cohort (N=5) consisting of annotated histology slides of patients with either GC or advanced GIM. We used a multi-omics pipeline to identify, validate and sequentially parse a highly-refined signature of 26 genes which characterize high-risk GIM. <h4>Results</h4> Using standard RNA-seq, we analyzed two separate, non-overlapping discovery (N=88) and validation (N=215) sets of GIM. In the discovery phase, we identified 105 upregulated genes specific for high-risk GIM (defined as OLGIM III-IV), of which 100 genes were independently confirmed in the validation set. Spatial transcriptomic profiling revealed 36 of these 100 genes to be expressed in metaplastic foci in GIM. Comparison with bulk GC sequencing data revealed 26 of these genes to be expressed in intestinal-type GC. Single-cell profiling resolved the 26-gene signature to both mature intestinal lineages (goblet cells, enterocytes) and immature intestinal lineages (stem-like cells). A subset of these genes was further validated using single-molecule multiplex fluorescence in situ hybridization. We found certain genes ( TFF3 and ANPEP ) to mark differentiated intestinal lineages, whereas others ( OLFM4 and CPS1 ) localized to immature cells in the isthmic/crypt region of metaplastic glands, consistent with the findings from scRNAseq analysis. <h4>Conclusions</h4> using an integrated multi-omics approach, we identified a novel 26-gene expression signature for high-OLGIM precursors at increased risk for GC. We found this signature localizes to aberrant intestinal stem-like cells within the metaplastic microenvironment. These findings hold important translational significance for future prevention and early detection efforts.

Authorea Preprints 2023-09-22 Preprint (No Snippets API) Nurman I, Mujihartini N, Ibrahim N, Mansyur M, Fadilah F, Erlina L.
Show Full Abstract

Cognitive processes play a role in decision making, which involves processing stimuli, memory of experiences and working memory. Cognitive processes involve the role of neurotransmitters that support physiological and executive processes. In decision making there is also a role for neurotransmitters such as dopamine, serotonin, noradrenaline and glutamate. This research was carried out using a molecular mechanism prediction approach using machine learning with protein-protein interactions from the GeneCards database followed by interactions using Cytoscape and enrichment analysis. The results of predictions of molecular mechanisms in decision making show that there are 21 genes encoding neurotransmitter, serotonin, intention process, prefrontal cortex, frontal asymmetry and decision making functions. Enrichment analysis and intersections between genes involved in the functions above show that HTR2A, SCL6A4 and COMT are genes that influence decision making. That biological process, cellular component and molecular function have three protein HTR2A, SLC6A4, COMT. The gene encoding the serotonin transporter (SLC6A4), the serotonin 2A receptor gene (HTR2A). The 5-HTT (SLC6A4) is mainly located in the pre-synaptic membrane of the raphe nuclei neurons, which innervate many areas of the brain involved in cognition, mood and behaviour and the relationship between decision-making and executive function is sensitive to genetic factors—particularly COMT provide support for the cross-task adaptation of executive functions to domain-general cognitive ability. The conclusion of the prediction results is that the serotonergic system within corticolimbic structures, HTT and HTR2A, with a few exceptions, is involved in various forms of decision making.

HTT
Also flagged:agingHuntington's diseaseHuntingtinenhanced green fluorescent proteinHDarginine
Journal Article 2023-09-21 ✓ 3 Snippets Pradhan SS, R SS, Kanikaram SP, V M DD, Pargaonkar A, Dandamudi RB, Sivaramakrishnan V.
In-Text Gene Mentions

Overall our results highlight arginine as a critical metabolite that modulates the aggregation of mutant HTT and disease progression in HD.Communicated by Ramaswamy H. Sarma.

Huntington's disease is associated with increased CAG repeat resulting in an expanded polyglutamine tract in the protein Huntingtin (HTT) leading to its aggregation resulting in neurodegeneration.

…the protein Huntingtin (HTT) leading to its…

Show Full Abstract

Huntington's disease is associated with increased CAG repeat resulting in an expanded polyglutamine tract in the protein Huntingtin (HTT) leading to its aggregation resulting in neurodegeneration. Previous studies have shown that N-terminal HTT with 46Q aggregated in the stationary phase but not the logarithmic phase in the yeast model of HD. We carried out a metabolomic analysis of logarithmic and stationary phase yeast model of HD expressing different polyQ lengths attached to N-terminal HTT tagged with enhanced green fluorescent protein (EGFP). The results show significant changes in the metabolic profile and deregulated pathways in stationary phase cells compared to logarithmic phase cells. Comparison of metabolic pathways obtained from logarithmic phase 46Q versus 25Q with those obtained for presymptomatic HD patients from our previous study and drosophila model of HD showed considerable overlap. The arginine biosynthesis pathway emerged as one of the key pathways that is common in stationary phase yeast compared to logarithmic phase and HD patients. Treatment of yeast with arginine led to a significant decrease, while transfer to arginine drop-out media led to a significant increase in the size of protein aggregates in both logarithmic and stationary phase yeast model of HD. Knockout of arginine transporters in the endoplasmic reticulum and vacuole led to a significant decrease in mutant HTT aggregation. Overall our results highlight arginine as a critical metabolite that modulates the aggregation of mutant HTT and disease progression in HD.Communicated by Ramaswamy H. Sarma.

Also flagged:oxadiazolesynthesisClostridioides difficile InfectionC. difficile infectionoxadiazolesphenyl
Journal Article 2023-09-21 No Snippets Qian Y, Birhanu BT, Yang J, Ding D, Janardhanan J, Mobashery S, Chang M.
Show Full Abstract

<i>Clostridioides difficile</i> is an anaerobic Gram-positive bacterium that colonizes the gut of patients treated with broad-spectrum antibiotics. The normal gut microflora prevents <i>C</i>. <i>difficile</i> colonization; however, dysbiosis by treatment with broad-spectrum antibiotics causes recurrent <i>C</i>. <i>difficile</i> infection (CDI) in 25% of patients. There are no fully effective antibiotics for multiple recurrent CDIs. We report herein that oxadiazole antibiotics exhibit bactericidal activity against <i>C</i>. <i>difficile</i> vegetative cells. We screened a library of 75 oxadiazoles against <i>C</i>. <i>difficile</i> ATCC 43255. The findings from this collection served as the basis for the syntheses of an additional 58 analogs, which were tested against the same strain. We report a potent (MIC<sub>50</sub> = 0.5 μg/mL and MIC<sub>90</sub> = 1 μg/mL values for 101 <i>C</i>. <i>difficile</i> strains) and narrow-spectrum oxadiazole (3-(4-(cyclopentyloxy)phenyl)-5-(4-nitro-1<i>H</i>-imidazol-2-yl)-1,2,4-oxadiazole; compound <b>57</b>), which is not active against common gut bacteria or other tested organisms. Compound <b>57</b> is selectively bactericidal against <i>C</i>. <i>difficile</i> and targets cell-wall synthesis.

NEGR1
Also flagged:neurodevelopmental disorderbrain developmentsynapsesRELNNLGN3NLGN4
Journal Article 2023-09-21 ✓ 2 Snippets Nicotera AG, Amore G, Saia MC, Vinci M, Musumeci A, Chiavetta V, Federico C, Spoto G, Saccone S, Di Rosa G, Calì F.
In-Text Gene Mentions

…cell adhesion moleculeNEGR1are apparently implicated…

…to a defectiveNEGR1-FGFR2 complex (which in…

Show Full Abstract

Autism spectrum disorder (ASD) is a long-known complex neurodevelopmental disorder, and over the past decades, with the enhancement of the research genomic techniques, has been the object of intensive research activity, and many genes involved in the development and functioning of the central nervous system have been related to ASD genesis. Herein, we report a patient with severe ASD carrying a G > A de novo variant in the FGFR2 gene, determining a missense mutation. FGFR2 encodes for the ubiquitous fibroblast growth factor receptor (FGFR) type 2, a tyrosine kinase receptor implicated in several biological processes. The mutated version of this protein is known to be responsible for several variable overlapping syndromes. Even if there still is only sparse and anecdotal data, recent research highlighted a potential role of FGFR2 on neurodevelopment. Our findings provide new insights into the potential causative role of FGFR2 gene in complex neurodevelopmental disorders.

Also flagged:PIWInucleusheterochromatinmetabolismArgonaute3Ago3
Journal Article 2023-09-21 No Snippets Kiuchi T, Shoji K, Izumi N, Tomari Y, Katsuma S.
Show Full Abstract

PIWI-interacting RNAs (piRNAs) guide PIWI proteins to target transposons in germline cells, thereby suppressing transposon activity to preserve genome integrity in metazoans' gonadal tissues. Piwi, one of three Drosophila PIWI proteins, is expressed in the nucleus and suppresses transposon activity by forming heterochromatin in an RNA cleavage-independent manner. Recently, Piwi was reported to control cell metabolism in Drosophila fat body, providing an example of piRNAs acting in non-gonadal somatic tissues. However, mutant flies of the other two PIWI proteins, Aubergine (Aub) and Argonaute3 (Ago3), show no apparent phenotype except for infertility, blurring the importance of the piRNA pathway in non-gonadal somatic tissues. The silkworm, Bombyx mori, possesses two PIWI proteins, Siwi (Aub homolog) and BmAgo3 (Ago3 homolog), whereas B. mori does not have a Piwi homolog. Siwi and BmAgo3 are mainly expressed in gonadal tissues and play a role in repressing transposon activity by cleaving transposon RNA in the cytoplasm. Here, we generated Siwi and BmAgo3 loss-of-function mutants of B. mori and found that they both showed delayed larval growth and failed to become adult moths. They also exhibited defects in wing development and sexual differentiation. Transcriptome analysis revealed that loss of somatic piRNA biogenesis pathways results in abnormal expression of not only transposons but also host genes, presumably causing severe growth defects. Our results highlight the roles of non-gonadal somatic piRNAs in B. mori development.

HTT
Also flagged:ferroptosisirondeathlipidcancerneurodegenerative disease
Journal Article 2023-09-21 ✓ 1 Snippet Sun S, Shen J, Jiang J, Wang F, Min J.
In-Text Gene Mentions

HD, a hereditary neurodegenerative disease due to an abnormally high number of CAG repeats in the huntingtin (HTT) gene,55 has also been linked to ferroptosis in animal models.56 Excess iron remains a major cause of oxidative stress in neurons, which directly induces ferroptosis during the pathogenesis of HD.57 Interestingly, similar to PD, reduced levels of GSH have also been observed in HD.58 Together, these findings suggest that ferroptosis may be involved in the pathogenesis of HD.

Show Full Abstract

Ferroptosis is an iron-dependent form of regulated cell death with distinct characteristics, including altered iron homeostasis, reduced defense against oxidative stress, and abnormal lipid peroxidation. Recent studies have provided compelling evidence supporting the notion that ferroptosis plays a key pathogenic role in many diseases such as various cancer types, neurodegenerative disease, diseases involving tissue and/or organ injury, and inflammatory and infectious diseases. Although the precise regulatory networks that underlie ferroptosis are largely unknown, particularly with respect to the initiation and progression of various diseases, ferroptosis is recognized as a bona fide target for the further development of treatment and prevention strategies. Over the past decade, considerable progress has been made in developing pharmacological agonists and antagonists for the treatment of these ferroptosis-related conditions. Here, we provide a detailed overview of our current knowledge regarding ferroptosis, its pathological roles, and its regulation during disease progression. Focusing on the use of chemical tools that target ferroptosis in preclinical studies, we also summarize recent advances in targeting ferroptosis across the growing spectrum of ferroptosis-associated pathogenic conditions. Finally, we discuss new challenges and opportunities for targeting ferroptosis as a potential strategy for treating ferroptosis-related diseases.

TNFSF4
Also flagged:tumorDouble-stranded RNA-binding proteinsinnate immunitycervical cancerCCHPV infection
Journal Article 2023-09-21 ✓ 1 Snippet Li J, Wan C, Li X, Quan C, Li X, Wu X.
In-Text Gene Mentions

…TNFSF14, TNFSF18, andTNFSF4, were more abundant…

Show Full Abstract

<h4>Background</h4>Cervical cancer is one of the most common gynecological cancers threatening women's health worldwide. Double-stranded RNA-binding proteins (dsRBPs) regulate innate immunity and are therefore believed to be involved in virus-related malignancies, however, their role in cervical cancer is not well known.<h4>Methods</h4>We performed RNA-seq of tumor samples from cervical cancer patients in local cohort and also assessed the RNA-seq and clinical data derived from public datasets. By using single sample Gene Set Enrichment Analysis (ssGSEA) and univariate Cox analysis, patients were stratified into distinct dsRBP clusters. Stepwise Cox and CoxBoost were performed to construct a risk model based on optimal dsRBPs clusters-related differentially expressed genes (DEGs), and GSE44001 and CGCI-HTMCP-CC were employed as two external validation cohorts. Single cell RNA sequencing data from GSE168652 and Scissor algorithm were applied to evaluated the signature-related cell population.<h4>Results</h4>The expression of dsRBP features was found to be associated with HPV infection and carcinogenesis in CESC. However, only Adenosine deaminases acting on RNA (ADAR) and Dicer, Drosha, and Argonautes (DDR) exhibited significant correlations with the overall survival (OS) of CESC patients. Based on these findings, CESC patients were divided into three dsRBP clusters. Cluster 3 showed superior OS but lower levels of ADAR and DDR. Additionally, Cluster 3 demonstrated enhanced innate immunity, with significantly higher activity in cancer immunity cycles, immune scores, and levels of tumor-infiltrating immune cells, particularly CD8+ T cells. Furthermore, a risk model based on nine dsRBP cluster-related DEGs was established. The accuracy of survival prediction for 1 to 5 years was consistently above 0.78, and this model's robust predictive capacity was confirmed by two external validation sets. The low-risk group exhibited significantly higher levels of immune checkpoints, such as PDCD1 and CTLA4, as well as a higher abundance of CD8+ T cells. Analysis of single-cell sequencing data revealed a significant association between the dsRBP signature and glycolysis. Importantly, low-risk patients showed improved OS and a higher response rate to immunotherapy, along with enduring clinical benefits from concurrent chemoradiotherapy.<h4>Conclusions</h4>dsRBP played a crucial role in the regulation of prognosis and tumor immunology in cervical cancer, and its prognostic signature provides a strategy for risk stratification and immunotherapy evaluation.

OLFM4
Also flagged:BRAFcolorectal cancerstissue homeostasischolesterolbiosynthesisatorvastatin
Journal Article 2023-09-21 ✓ 4 Snippets Rzasa P, Whelan S, Farahmand P, Cai H, Guterman I, Palacios-Gallego R, Undru SS, Sandford L, Green C, Andreadi C, Mintseva M, Parrott E, Jin H, Hey F, Giblett S, Sylvius NB, Allcock NS, Straatman-Iwanowska A, Feuda R, Tufarelli C, Brown K, Pritchard C, Rufini A.
In-Text Gene Mentions

…as LGR5 andOLFM42 , 3…

…stem cells markerOlfm42 , we…

…identify a persistentOlfm4+ population localized at…

…genes Lgr5 andOlfm4in BVE mice…

Show Full Abstract

BRAF mutations occur early in serrated colorectal cancers, but their long-term influence on tissue homeostasis is poorly characterized. We investigated the impact of short-term (3 days) and long-term (6 months) expression of Braf<sup>V600E</sup> in the intestinal tissue of an inducible mouse model. We show that Braf<sup>V600E</sup> perturbs the homeostasis of intestinal epithelial cells, with impaired differentiation of enterocytes emerging after prolonged expression of the oncogene. Moreover, Braf<sup>V600E</sup> leads to a persistent transcriptional reprogramming with enrichment of numerous gene signatures indicative of proliferation and tumorigenesis, and signatures suggestive of metabolic rewiring. We focused on the top-ranking cholesterol biosynthesis signature and confirmed its increased expression in human serrated lesions. Functionally, the cholesterol lowering drug atorvastatin prevents the establishment of intestinal crypt hyperplasia in Braf<sup>V600E</sup>-mutant mice. Overall, our work unveils the long-term impact of Braf<sup>V600E</sup> expression in intestinal tissue and suggests that colorectal cancers with mutations in BRAF might be prevented by statins.

HTT
Also flagged:PPP2R2BSCA12neurodegenerative diseaseNGN2neuroblastomacaspase 3
Journal Article 2023-09-21 ✓ 1 Snippet Zhou C, Liu HB, Jahanbakhsh F, Deng L, Wu B, Ying M, Margolis RL, Li PP.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Spinocerebellar ataxia type 12 (SCA12) is a neurodegenerative disease caused by expansion of a CAG repeat in the PPP2R2B gene.<h4>Objective</h4>In this study, we tested the hypothesis that the PPP2R2B antisense (PPP2R2B-AS1) transcript containing a CUG repeat is expressed and contributes to SCA12 pathogenesis.<h4>Methods</h4>Expression of PPP2R2B-AS1 transcript was detected in SCA12 human induced pluripotent stem cells (iPSCs), iPSC-derived NGN2 neurons, and SCA12 knock-in mouse brains using strand-specific reverse transcription polymerase chain reaction. The tendency of expanded PPP2R2B-AS1 (expPPP2R2B-AS1) RNA to form foci, a marker of toxic processes involving mutant RNAs, was examined in SCA12 cell models by fluorescence in situ hybridization. The apoptotic effect of expPPP2R2B-AS1 transcripts on SK-N-MC neuroblastoma cells was evaluated by caspase 3/7 activity. Western blot was used to examine the expression of repeat associated non-ATG-initiated translation of expPPP2R2B-AS1 transcript in SK-N-MC cells.<h4>Results</h4>The repeat region in the PPP2R2B gene locus is bidirectionally transcribed in SCA12 iPSCs, iPSC-derived NGN2 neurons, and SCA12 mouse brains. Transfected expPPP2R2B-AS1 transcripts induce apoptosis in SK-N-MC cells, and the apoptotic effect may be mediated, at least in part, by the RNA secondary structure. The expPPP2R2B-AS1 transcripts form CUG RNA foci in SK-N-MC cells. expPPP2R2B-AS1 transcript is translated in the alanine open reading frame (ORF) via repeat-associated non-ATG translation, which is diminished by single-nucleotide interruptions within the CUG repeat and MBNL1 overexpression.<h4>Conclusions</h4>These findings suggest that PPP2R2B-AS1 contributes to SCA12 pathogenesis and may therefore provide a novel therapeutic target for the disease. © 2023 International Parkinson and Movement Disorder Society.

Also flagged:Inflammatory bowel diseasechronic diseaseCrohn's diseaseulcerative colitiscolorectal cancerimmune responses
Journal Article 2023-09-21 No Snippets Macedo MH, Dias Neto M, Pastrana L, Gonçalves C, Xavier M.
Show Full Abstract

Inflammatory bowel disease causes a major burden to patients and healthcare systems, raising the need to develop effective therapies. Technological advances in cell culture, allied with ethical issues, have propelled in vitro models as essential tools to study disease aetiology, its progression, and possible therapies. Several cell-based in vitro models of intestinal inflammation have been used, varying in their complexity and methodology to induce inflammation. Immortalized cell lines are extensively used due to their long-term survival, in contrast to primary cultures that are short-lived but patient-specific. Recently, organoids and organ-chips have demonstrated great potential by being physiologically more relevant. This review aims to shed light on the intricate nature of intestinal inflammation and cover recent works that report cell-based in vitro models of human intestinal inflammation, encompassing diverse approaches and outcomes.

OLFM4
Also flagged:gefitinibFBP1SBK1AURKAlung adenocarcinomaLUAD
Journal Article 2023-09-21 ✓ 3 Snippets Guo Q, Li K, Jiang N, Zhou R, Rao XR, Wu CY.
In-Text Gene Mentions

The levels of OLFM4, CDH7, CRABP1, RAB3B, SLC13A5, IGF2BP1, INHA, ABCC2, DKK1, KRT6A, MAGEC1, FGA, SPX, HOXA13, KRT6C, UPK1B, CPS1, and EVX1 in normal tissues and LUAD tissues are shown in a heatmap and histogram (Figure 8B, 8C).

…expression levels ofOLFM4, CDH7, CRABP1, RAB3B,…

…The levels ofOLFM4, CDH7, CRABP1, RAB3B,…

Show Full Abstract

<h4>Purpose</h4>Gefitinib, an anticancer drug, has been reported to potentially improve the prognosis of patients with lung adenocarcinoma (LUAD). This study aims to investigate the roles and mechanisms of Gefitinib.<h4>Methods</h4>The effects of Gefitinib on the growth and migration of LUAD cells were assessed using various methods, including CCK-8, flow cytometry, wound healing, and Transwell assays. To analyze the function and mechanisms of the differentially expressed Gefitinib target genes (GTGs), data from the TCGA database were utilized. Kaplan-Meier survival and ROC analysis identified prognostic-related GTGs and constructed a prognostic nomogram in LUAD. Consensus clustering, COX analysis and survival analysis evaluated the relationship between GTGs and the prognosis of LUAD patients. The mechanisms of the risk model involved LUAD progression, and the relationship between the risk model and immune microenvironment were investigated.<h4>Results</h4>Gefitinib could inhibit proliferation, migration and invasion and promote cell apoptosis. 84 DEGTGs were involved in RAS, MAPK, ERBB pathways. The DEGTGs (FBP1, SBK1, and AURKA) were the independent risk factors for dismal prognosis of LUAD patients and were used to establish risk model and nomogram. Gefitinib could promote the expression of FBP1 and inhibit the expression of SBK1 and AURKA. High-risk LUAD patients had the dismal prognosis, and the high-risk score group was significantly associated with the immune microenvironment.<h4>Conclusion</h4>FBP1, SBK1, and AURKA are prognostic risk factors, and the risk model and nomogram of FBP1, SBK1 and AURKA are associated with dismal prognosis and immune cell infiltration, and have huge prospects for application in evaluating the prognosis in LUAD.

BTN3A3
Also flagged:tumorPD-1hematologic malignanciesRichter syndromeB cell lymphomachronic lymphocytic leukemia
Journal Article 2023-09-21 ✓ 1 Snippet Parry EM, Lemvigh CK, Deng S, Dangle N, Ruthen N, Knisbacher BA, Broséus J, Hergalant S, Guièze R, Li S, Zhang W, Johnson C, Long JM, Yin S, Werner L, Anandappa A, Purroy N, Gohil S, Oliveira G, Bachireddy P, Shukla SA, Huang T, Khoury JD, Thakral B, Dickinson M, Tam C, Livak KJ, Getz G, Neuberg D, Feugier P, Kharchenko P, Wierda W, Olsen LR, Jain N, Wu CJ.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

Unlike many other hematologic malignancies, Richter syndrome (RS), an aggressive B cell lymphoma originating from indolent chronic lymphocytic leukemia, is responsive to PD-1 blockade. To discover the determinants of response, we analyze single-cell transcriptome data generated from 17 bone marrow samples longitudinally collected from 6 patients with RS. Response is associated with intermediate exhausted CD8 effector/effector memory T cells marked by high expression of the transcription factor ZNF683, determined to be evolving from stem-like memory cells and divergent from terminally exhausted cells. This signature overlaps with that of tumor-infiltrating populations from anti-PD-1 responsive solid tumors. ZNF683 is found to directly target key T cell genes (TCF7, LMO2, CD69) and impact pathways of T cell cytotoxicity and activation. Analysis of pre-treatment peripheral blood from 10 independent patients with RS treated with anti-PD-1, as well as patients with solid tumors treated with anti-PD-1, supports an association of ZNF683<sup>high</sup> T cells with response.

DNAH10
Also flagged:GBMglioblastomatumorDMDDNAH12HUWE1
Journal Article 2023-09-21 ✓ 1 Snippet Chang IY, Tsai HC, Chen CH, Chen HC, Huang CW, Cox GF, Huang FM, Lin YY, Chen KT, Lin YJ, Wei KC.
In-Text Gene Mentions

…, DNAH8 ,DNAH10, DNAH11 ,…

Show Full Abstract

<h4>Background</h4>A previous phase 1 dose-escalation study in Taiwan indicated CAN008 (asunercept) with standard concurrent chemoradiotherapy (CCRT) improved progression-free survival (PFS) in newly diagnosed glioblastoma (GBM) patients. This study evaluates the efficacy of CAN008 in promoting overall survival (OS) and identifies genetic alterations associated with treatment responses.<h4>Methods</h4>We compared OS of 5-year follow-ups from 9 evaluable CAN008 cohort patients (6 received high-dose and 3 received low-dose) to a historical Taiwanese GBM cohort with 164 newly diagnosed patients. CAN008 treatment response-associated genetic alterations were identified by whole-exome sequencing and comparing variant differences between response groups. Associations among patient survival, tumor mutational burden (TMB), and genetic alterations were analyzed using CAN008 cohort and TCGA-GBM dataset.<h4>Results</h4>OS for high-dose CAN008 patients at 2 and 5 years was 83% and 67%, respectively, and 40.1% and 8.8% for the historical GBM cohort, respectively. Better OS was observed in the high-dose CAN008 cohort (without reaching the median survival) than the historical GBM cohort (median OS: 20 months; p = 0.0103). Five high-dose CAN008 patients were divided into good and poor response groups based on their PFS. A higher variant count and TMB were observed in good response patients, whereas no significant association was observed between TMB and patient survival in the newly diagnosed TCGA-GBM dataset, suggesting TMB may modulate patient CAN008 response.<h4>Conclusion</h4>CAN008 combined with standard CCRT treatment prolonged the PFS and OS of newly diagnosed GBM patients compared to standard therapy alone. Higher treatment efficacy was associated with higher TMB.

Also flagged:liver cirrhosisAlcoholalcoholic hepatitisAHsimple steatosissteatohepatitis
Journal Article 2023-09-21 No Snippets Ait Ahmed Y, Lafdil F, Tacke F.
Show Full Abstract

Alcohol-associated liver disease (ALD) represents a major public health issue worldwide and is a leading etiology of liver cirrhosis. Alcohol-related liver injuries include a range of manifestations including alcoholic hepatitis (AH), simple steatosis, steatohepatitis, hepatic fibrosis, cirrhosis and liver cancer. Liver disease occurs from several pathological disturbances such as the metabolism of ethanol, which generates reactive oxygen species (ROS) in hepatocytes, alterations in the gut microbiota, and the immune response to these changes. A common hallmark of these liver affections is the establishment of an inflammatory environment, and some (broad) anti-inflammatory approaches are used to treat AH (eg, corticosteroids). Macrophages, which represent the main innate immune cells in the liver, respond to a wide variety of (pathogenic) stimuli and adopt a large spectrum of phenotypes. This translates to a diversity of functions including pathogen and debris clearance, recruitment of other immune cells, activation of fibroblasts, or tissue repair. Thus, macrophage populations play a crucial role in the course of ALD, but the underlying mechanisms driving macrophage polarization and their functionality in ALD are complex. In this review, we explore the various populations of hepatic macrophages in alcohol-associated liver disease and the underlying mechanisms driving their polarization. Additionally, we summarize the crosstalk between hepatic macrophages and other hepatic cell types in ALD, in order to support the exploration of targeted therapeutics by modulating macrophage polarization.

Also flagged:Calcium Phosphatecalciumzinccalcium-phosphatecalcium oxidehydroxyapatite
Journal Article 2023-09-21 No Snippets Kozelskaya AI, Verzunova KN, Akimchenko IO, Frueh J, Petrov VI, Slepchenko GB, Bakina OV, Lerner MI, Brizhan LK, Davydov DV, Kerimov AA, Cherempey EG, Krylov SE, Rutkowski S, Tverdokhlebov SI.
Show Full Abstract

A promising method for improving the functional properties of calcium-phosphate coatings is the incorporation of various antibacterial additives into their structure. The microbial contamination of a superficial wound is inevitable, even if the rules of asepsis and antisepsis are optimally applied. One of the main problems is that bacteria often become resistant to antibiotics over time. However, this does not apply to certain elements, chemical compounds and drugs with antimicrobial properties. In this study, the fabrication and properties of zinc-containing calcium-phosphate coatings that were formed via micro-arc oxidation from three different electrolyte solutions are investigated. The first electrolyte is based on calcium oxide, the second on hydroxyapatite and the third on calcium acetate. By adding zinc oxide to the three electrolyte solutions, antibacterial properties of the coatings are achieved. Although the same amount of zinc oxide has been added to each electrolyte solution, the zinc concentration in the coatings obtained vary greatly. Furthermore, this study investigates the morphology, structure and chemical composition of the coatings. The antibacterial properties of the zinc-containing coatings were tested toward three strains of bacteria-Staphylococcus aureus, methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa. Coatings of calcium acetate and zinc oxide contained the highest amount of zinc and displayed the highest zinc release. Moreover, coatings containing hydroxyapatite and zinc oxide show the highest antibacterial activity toward <i>Pseudomonas aeruginosa</i>, and coatings containing calcium acetate and zinc oxide show the highest antibacterial activities toward <i>Staphylococcus aureus</i> and methicillin-resistant <i>Staphylococcus aureus</i>.

PLCL1
Also flagged:endometrial carcinomagynaecologicalcancerendometrioid cancersobesitymetabolic syndromes
Journal Article 2023-09-21 ✓ 2 Snippets Taylor AH, Konje JC, Ayakannu T.
In-Text Gene Mentions

…J3QQ66-DECOY, MYH8, PIGT,PLCL1, PMFBP1, PPM1G, PPP1R2,…

…FAM169A, HN1L, PIGT,PLCL1, PMFBP1, SARS2, SCPEP1,…

Show Full Abstract

The present study was aimed at identifying novel proteins in endometrial cancer (EC), employing proteomic analysis of tissues obtained after surgery. A differential MS-based proteomic analysis was conducted from whole tissues dissected from biopsies from post-menopausal women, histologically confirmed as endometrial cancer (two endometrioid and two serous; n = 4) or normal atrophic endometrium (n = 4), providing 888 differentially expressed proteins with 246 of these previously documented elsewhere as expressed in EC and 372 proteins not previously demonstrated to be expressed in EC but associated with other types of cancer. Additionally, 33 proteins not recorded previously in PubMed as being expressed in any forms of cancer were also identified, with only 26 of these proteins having a publication associated with their expression patterns or putative functions. The putative functions of the 26 proteins (GRN, APP, HEXA, CST3, CAD, QARS, SIAE, WARS, MYH8, CLTB, GOLIM4, SCARB2, BOD1L1, C14orf142, C9orf142, CCDC13, CNPY4, FAM169A, HN1L, PIGT, PLCL1, PMFBP1, SARS2, SCPEP1, SLC25A24 and ZC3H4) in other tissues point towards and provide a basis for further investigation of these previously unrecognised novel EC proteins. The developmental biology, disease, extracellular matrix, homeostatic, immune, metabolic (both RNA and protein), programmed cell death, signal transduction, molecular transport, transcriptional networks and as yet uncharacterised pathways indicate that these proteins are potentially involved in endometrial carcinogenesis and thus may be important in EC diagnosis, prognostication and treatment and thus are worthy of further investigation.

SERPINC1
Also flagged:translationalFAAHfatty acid amide hydrolaseN-arachidonoyl ethanolamineanandamidecannabinoid receptor 1
Journal Article 2023-09-21 ✓ 1 Snippet Bornscheuer L, Lundin A, Forsell Y, Lavebratt C, Melas PA.
In-Text Gene Mentions

…ITIH4 , andSERPINC1—as probable candidates…

Show Full Abstract

Fatty acid amide hydrolase (FAAH) is an enzyme that degrades anandamide, an endocannabinoid that modulates mesolimbic dopamine release and, consequently, influences states of well-being. Despite these known interactions, the specific role of FAAH in subjective well-being remains underexplored. Since well-being is a dynamic trait that can fluctuate over time, we hypothesized that we could provide deeper insights into the link between FAAH and well-being using longitudinal data. To this end, we analyzed well-being data collected three years apart using the WHO (Ten) Well-Being Index and genotyped a functional polymorphism in the <i>FAAH</i> gene (rs324420, Pro129Thr) in a sample of 2822 individuals. We found that the A-allele of rs324420, which results in reduced FAAH activity and elevated anandamide levels, was associated with lower well-being scores at both time points (Wave I, B: -0.52, <i>p</i> = 0.007; Wave II, B: -0.41, <i>p</i> = 0.03, adjusted for age and sex). A subsequent phenome-wide association study (PheWAS) affirmed our well-being findings in the UK Biobank (N = 126,132, alternative C-allele associated with elevated happiness, <i>p</i> = 0.008) and revealed an additional association with alcohol dependence. In our cohort, using lagged longitudinal mediation analyses, we uncovered evidence of an indirect association between rs324420 and problematic alcohol use (AUDIT-P) through the pathway of lower well-being (indirect effect Boot: 0.015, 95% CI [0.003, 0.030], adjusted for AUDIT in Wave I). We propose that chronically elevated anandamide levels might influence disruptions in the endocannabinoid system-a biological contributor to well-being-which could, in turn, contribute to increased alcohol intake, though multiple factors may be at play. Further genetic studies and mediation analyses are needed to validate and extend these findings.

Also flagged:Degradation2,4-dichlorophenoxyacetic acidcatecholstfd Itfd IIclc
Journal Article 2023-09-21 No Snippets Iasakov T.
Show Full Abstract

The <i>tfd</i> (<i>tfd</i><sub>I</sub> and <i>tfd</i><sub>II</sub>) are gene clusters originally discovered in plasmid pJP4 which are involved in the bacterial degradation of 2,4-dichlorophenoxyacetic acid (2,4-D) via the ortho-cleavage pathway of chlorinated catechols. They share this activity, with respect to substituted catechols, with clusters <i>tcb</i> and <i>clc</i>. Although great effort has been devoted over nearly forty years to exploring the structural diversity of these clusters, their evolution has been poorly resolved to date, and their classification is clearly obsolete. Employing comparative genomic and phylogenetic approaches has revealed that all <i>tfd</i> clusters can be classified as one of four different types. The following four-type classification and new nomenclature are proposed: <i>tfd</i><sub>I</sub>, <i>tfd</i><sub>II</sub>, <i>tfd</i><sub>III</sub> and <i>tfd</i><sub>IV(A,B,C)</sub>. Horizontal gene transfer between <i>Burkholderiales</i> and <i>Sphingomonadales</i> provides phenomenal linkage between <i>tfd</i><sub>I</sub>, <i>tfd</i><sub>II</sub>, <i>tfd</i><sub>III</sub> and <i>tfd</i><sub>IV</sub> type clusters and their mosaic nature. It is hypothesized that the evolution of <i>tfd</i> gene clusters proceeded within first (<i>tcb</i>, <i>clc</i> and <i>tfd</i><sub>I</sub>), second (<i>tfd</i><sub>II</sub> and <i>tfd</i><sub>III</sub>) and third (<i>tfd</i><sub>IV(A,B,C)</sub>) evolutionary lineages, in each of which, the genes were clustered in specific combinations. Their clustering is discussed through the prism of hot spots and driving forces of various models, theories, and hypotheses of cluster and operon formation. Two hypotheses about series of gene deletions and displacements are also proposed to explain the structural variations across members of clusters <i>tfd</i><sub>II</sub> and <i>tfd</i><sub>III</sub>, respectively. Taking everything into account, these findings reconstruct the phylogeny of <i>tfd</i> clusters, have delineated their evolutionary trajectories, and allow the contribution of various evolutionary processes to be assessed.

Also flagged:oxygennitrogennervous system diseasesatherosclerosisneurodegenerative disordersHyperlipidemia
Journal Article 2023-09-21 No Snippets Nouni C, Theodosis-Nobelos P, Rekka EA.
Show Full Abstract

Oxidative stress and hyperlipidemia are important factors for the initiation and progression of various cell degenerative pathological conditions, including cardiovascular and neurological diseases. A series of cinnamic acid-derived acids, such as ferulic acid, sinapic acid, 3,4-dimethoxycinnamic acid, <i>p</i>-coumaric acid, and (<i>E</i>)-3-(3,5-di-<i>tert</i>-butyl-4-hydroxyphenyl)acrylic acid, were esterified or amidated with various moieties, bearing different biological activities, and evaluated. The antioxidant and radical scavenging abilities of the compounds via inhibition of rat hepatic microsomal membrane lipid peroxidation, as well as their interaction with the stable radical 2,2-diphenyl-1-picrylhydrazyl (DPPH), were assessed. Further, their hypolipidemic activity in vivo was tested. The majority of the obtained compounds demonstrated considerable radical scavenging and antioxidant action, with a parallel decrease in Triton-induced hyperlipidemia in rats. The (<i>E</i>)-3-(3,5-di-<i>tert</i>-butyl-4-hydroxyphenyl)acrylic acid derivative with morpholine and 4-methylpiperidine (compounds <b>4</b> and <b>13</b>, respectively) significantly decreased triglycerides and total cholesterol in the plasma of hyperlipidemic rats, with an antioxidant capacity similar to that of the antioxidant Trolox. The compounds were designed to exhibit antioxidant and hypolipidemic pharmacological actions, and this succeeded for the majority of them. Thus, such agents may be of interest in conditions and diseases implicating oxidative stress and dyslipidemia.

Also flagged:CurcuminoidSynthesisestercurcuminoid chalconeschalconedegradation
Journal Article 2023-09-21 No Snippets Olender D, Józkowiak M, Piotrowska-Kempisty H, Sowa-Kasprzak K, Zaprutko L, Muszalska-Kolos I, Baranowska-Wójcik E, Szwajgier D.
Show Full Abstract

The primary purpose of this work was to design and obtain a series of curcuminoid chalcone-NSAID hybrid derivatives. The ester-type hybrid compounds with ibuprofen (<b>i</b>), ketoprofen (<b>ii</b>), and naproxen (<b>iii</b>) were obtained in two ways, using the Claisen-Schmidt reaction and the Steglich esterification reaction. The designed molecules were successfully synthesised, and FT-IR, MS, and NMR spectroscopy confirmed their structures. Moreover, the cytotoxic effect of the sonodynamic therapy and the anti-inflammatory, antioxidant, and anticholinergic properties of some curcuminoid chalcones and curcuminoid chalcones hybrids were evaluated. The curcuminoid chalcone derivatives showed promising neuroprotective activity as sonosensitisers for sonodynamic therapy in the studied cell lines. Additionally, the stability of the ester-type hybrid compounds with promising activity was determined. The RP-HPLC method was used to observe the degradation of the tested compounds. Studies have shown that structural isomers of ester-type hybrid compounds (<b>3ai</b>, <b>3bi</b>) are characterised by a similar susceptibility to degradation factors, i.e., they are extremely unstable in alkaline environments, very unstable in acidic environments, unstable in neutral environments, practically stable in oxidising environments, and photolabile in solutions and in the solid phase. These compounds maintain adequate stability in environment at pH 1.2 and 6.8, which may make them good candidates for developing formulations for oral administration.

Also flagged:Wntneurodegenerative diseasesFrizzled receptorlipoprotein receptor-related proteins 5LRP5LRP6
Journal Article 2023-09-21 No Snippets Anand AA, Khan M, V M, Kar D.
Show Full Abstract

Defective Wnt signaling is found to be associated with various neurodegenerative diseases. In the canonical pathway, the Frizzled receptor (Fzd) and the lipoprotein receptor-related proteins 5/6 (LRP5/LRP6) create a seven-pass transmembrane receptor complex to which the Wnt ligands bind. This interaction causes the tumor suppressor adenomatous polyposis coli gene product (APC), casein kinase 1 (CK1), and GSK-3<i>β</i> (glycogen synthase kinase-3 beta) to be recruited by the scaffold protein Dishevelled (Dvl), which in turn deactivates the <i>β</i>-catenin destruction complex. This inactivation stops the destruction complex from phosphorylating <i>β</i>-catenin. As a result, <i>β</i>-catenin first builds up in the cytoplasm and then migrates into the nucleus, where it binds to the Lef/Tcf transcription factor to activate the transcription of more than 50 Wnt target genes, including those involved in cell growth, survival, differentiation, neurogenesis, and inflammation. The treatments that are currently available for neurodegenerative illnesses are most commonly not curative in nature but are only symptomatic. According to all available research, restoring Wnt/<i>β</i>-catenin signaling in the brains of patients with neurodegenerative disorders, particularly Alzheimer's and Parkinson's disease, would improve the condition of several patients with neurological disorders. The importance of Wnt activators and modulators in patients with such illnesses is to mainly restore rather than overstimulate the Wnt/<i>β</i>-catenin signaling, thereby reestablishing the equilibrium between Wnt-OFF and Wnt-ON states. In this review, we have tried to summarize the significance of the Wnt canonical pathway in the pathophysiology of certain neurodegenerative diseases, such as Alzheimer's disease, cerebral ischemia, Parkinson's disease, Huntington's disease, multiple sclerosis, and other similar diseases, and as to how can it be restored in these patients.

SERPINC1
Also flagged:gangrenepurpura fulminanschylothoraxretinal detachmentprotein CPAK2
Journal Article 2023-09-21 ✓ 2 Snippets Joseph CJ, Lodha A, Thomas SR, Al Awad E, Wright NAM, Constantinescu C, Le D, Kamaluddeen M.
In-Text Gene Mentions

…PROS , andSERPINC1genes, ruling out…

…PROS , andSERPINC1genes.…

Show Full Abstract

<h4>Introduction</h4>Purpura fulminans in the neonatal population is a rare but potentially life-threatening condition complicated by thrombosis, resultant vital organ necrosis, and gangrene of the extremities. Considering the rapid evolution of the pathogenetic mechanism, an index of suspicion, early identification, and prompt intervention are imperative for improved outcomes. The majority of purpura fulminans cases have an infectious etiology, but it is essential to consider other congenital and acquired causes.<h4>Case description</h4>We present a clinical case of a female neonate to emphasize the correlation between purpura fulminans, congenital chylothorax, involvement of the <i>PAK2</i> gene, and the occurrence of retinal detachment in both eyes. After draining the congenital chylothorax, the neonate developed purpura fulminans due to a loss of protein C, S, and antithrombin factors, previously not reported in the literature. The purpuric lesions resolved after the administration of fresh frozen plasma. Subsequently, no recurring purpura fulminans lesions were noted following the normalization of the antithrombotic factor levels in the serum. Subsequently, the child also developed retinal detachment in both eyes.

Also flagged:fragile X syndromeintellectual disabilityautism spectrum disorderglutamatecalciumsynapse
Journal Article 2023-09-21 No Snippets Edwards N, Combrinck C, McCaughey-Chapman A, Connor B.
Show Full Abstract

<h4>Introduction</h4>The neurodevelopmental disorder fragile X syndrome (FXS) is the most common monogenic cause of intellectual disability associated with autism spectrum disorder. Inaccessibility to developing human brain cells is a major barrier to studying FXS. Direct-to-neural precursor reprogramming provides a unique platform to investigate the developmental profile of FXS-associated phenotypes throughout neural precursor and neuron generation, at a temporal resolution not afforded by post-mortem tissue and in a patient-specific context not represented in rodent models. Direct reprogramming also circumvents the protracted culture times and low efficiency of current induced pluripotent stem cell strategies.<h4>Methods</h4>We have developed a chemically modified mRNA (cmRNA) -based direct reprogramming protocol to generate dorsal forebrain precursors (hiDFPs) from FXS patient-derived fibroblasts, with subsequent differentiation to glutamatergic cortical neurons and astrocytes.<h4>Results</h4>We observed differential expression of mature neuronal markers suggesting impaired neuronal development and maturation in FXS- hiDFP-derived neurons compared to controls. FXS- hiDFP-derived cortical neurons exhibited dendritic growth and arborization deficits characterized by reduced neurite length and branching consistent with impaired neuronal maturation. Furthermore, FXS- hiDFP-derived neurons exhibited a significant decrease in the density of pre- and post- synaptic proteins and reduced glutamate-induced calcium activity, suggesting impaired excitatory synapse development and functional maturation. We also observed a reduced yield of FXS- hiDFP-derived neurons with a significant increase in FXS-affected astrocytes.<h4>Discussion</h4>This study represents the first reported derivation of FXS-affected cortical neurons following direct reprogramming of patient fibroblasts to dorsal forebrain precursors and subsequently neurons that recapitulate the key molecular hallmarks of FXS as it occurs in human tissue. We propose that direct to hiDFP reprogramming provides a unique platform for further study into the pathogenesis of FXS as well as the identification and screening of new drug targets for the treatment of FXS.

Also flagged:cirrhosisappendicitishepatic tumorsolid tumortumorprimary tumor
Journal Article 2023-09-20 No Snippets Watanabe A, Harimoto N, Saito H, Kawabata-Iwakawa R, Seki T, Muranushi R, Hoshino K, Hagiwara K, Ishii N, Tsukagoshi M, Igarashi T, Araki K, Ikota H, Ishige T, Mimori K, Shirabe K.
Show Full Abstract

<h4>Background</h4>Fibrolamellar hepatocellular carcinoma (HCC) (FL-HCC) is rare in Japan. FL-HCC develops in young patients with no history of cirrhosis and tends to manifest lymphatic metastasis with clinical features similar to those of HCC. We present a case of FL-HCC in a young male patient.<h4>Case presentation</h4>A 14-year-old male patient underwent abdominal computed tomography (CT) to diagnose appendicitis, wherein a hepatic tumor was detected. Dynamic enhanced CT revealed a 35-mm solid tumor, which contrasted at the early phase of dynamic enhanced study of the right hepatic segments, with occlusion of the right portal vein. We performed right hepatectomy for these lesions. The patient experienced a single lymphatic recurrence on the hepatoduodenal ligament 12 months after the initial surgery. We performed lymphadenectomy for the recurrent tumor. We performed RNA sequencing (RNA-seq) and targeted DNA sequencing of the resected specimens (primary tumor, lymphatic metastasis, and normal liver). RNA-seq detected DNAJB1-PRKACA in both primary and metastatic lesions as previously reported. Furthermore, The Cancer Genome Atlas (TCGA) database was used to compare other gene expressions in this case with those of previously reported cases of FL-HCC and HCC in young patients. Principal component analysis of differentially expressed genes in the top 10% revealed that the gene expression in our case was similar to that of previous FL-HCC cases but was a different cluster from that in HCC cases in young patients. Mutational analysis did not detect any somatic mutations associated with carcinogenesis, including previously reported mutations (Kastenhuber et al. in Proc Natl Acad Sci USA 114: 13076-84, 2017).<h4>Conclusion</h4>We encountered a case of FL-HCC, a rare hepatic tumor in an adolescent patient, and evaluated the genetic background. Our findings could contribute to the elucidation of the mechanisms underlying carcinogenesis and progression in patients with FL-HCC and thereby contribute to the development of new therapeutic strategies in the future that may improve patient prognosis.

SUDS3
Also flagged:linker histone variant H1.2NRF2nonsmall cell lung cancerNSCLCplatinumoxygen
Journal Article 2023-09-20 ✓ 1 Snippet Chen Y, Shi J, Wang X, Zhou L, Wang Q, Xie Y, Peng C, Kuang L, Yang D, Yang J, Yang C, Li X, Yuan Y, Zhou Y, Peng A, Zhang Y, Chen H, Liu X, Zheng L, Huang K, Li Y.
In-Text Gene Mentions

…the importance oflinker histoneshistones in regulating…

Show Full Abstract

Nonsmall cell lung cancer (NSCLC) is highly malignant with limited treatment options, platinum-based chemotherapy is a standard treatment for NSCLC with resistance commonly seen. NSCLC cells exploit enhanced antioxidant defense system to counteract excessive reactive oxygen species (ROS), which contributes largely to tumor progression and resistance to chemotherapy, yet the mechanisms are not fully understood. Recent studies have suggested the involvement of histones in tumor progression and cellular antioxidant response; however, whether a major histone variant H1.2 (H1C) plays roles in the development of NSCLC remains unclear. Herein, we demonstrated that H1.2 was increasingly expressed in NSCLC tumors, and its expression was correlated with worse survival. When crossing the <i>H1c</i> knockout allele with a mouse NSCLC model (<i>Kras<sup>LSL-G12D/+</sup></i>), H1.2 deletion suppressed NSCLC progression and enhanced oxidative stress and significantly decreased the levels of key antioxidant glutathione (GSH) and GCLC, the catalytic subunit of rate-limiting enzyme for GSH synthesis. Moreover, high H1.2 was correlated with the IC50 of multiple chemotherapeutic drugs and with worse prognosis in NSCLC patients receiving chemotherapy; H1.2-deficient NSCLC cells presented reduced survival and increased ROS levels upon cisplatin treatment, while ROS scavenger eliminated the survival inhibition. Mechanistically, H1.2 interacted with NRF2, a master regulator of antioxidative response; H1.2 enhanced the nuclear level and stability of NRF2 and, thus, promoted NRF2 binding to <i>GCLC</i> promoter and the consequent transcription; while NRF2 also transcriptionally up-regulated H1.2. Collectively, these results uncovered a tumor-driving role of H1.2 in NSCLC and indicate an "H1.2-NRF2" antioxidant feedforward cycle that promotes tumor progression and chemoresistance.

MMS22L
Also flagged:nucleusbrain injurytraumatic brain injurygene expressionneurogenesistranscription factors
Journal Article 2023-09-20 ✓ 1 Snippet Yang Q, Zhang L, Li M, Xu Y, Chen X, Yuan R, Ou X, He M, Liao M, Zhang L, Dai H, Lv M, Xie X, Liang W, Chen X.
In-Text Gene Mentions

…), Egfr andMms22lfor late aNSCs…

Show Full Abstract

The subventricular zone (SVZ) is a neurogenic niche that contributes to homeostasis and repair after brain injury. However, the effects of mild traumatic brain injury (mTBI) on the divergence of the regulatory DNA landscape within the SVZ and its link to functional alterations remain unexplored. In this study, we mapped the transcriptome atlas of murine SVZ and its responses to mTBI at the single-cell level. We observed cell-specific gene expression changes following mTBI and unveiled diverse cell-to-cell interaction networks that influence a wide array of cellular processes. Moreover, we report novel neurogenesis lineage trajectories and related key transcription factors, which we validate through loss-of-function experiments. Specifically, we validate the role of <i>Tcf7l1</i>, a cell cycle gene regulator, in promoting neural stem cell differentiation toward the neuronal lineage after mTBI, providing a potential target for regenerative medicine. Overall, our study profiles an SVZ transcriptome reference map, which underlies the differential cellular behavior in response to mTBI. The identified key genes and pathways that may ameliorate brain damage or facilitate neural repair serve as a comprehensive resource for drug discovery in the context of mTBI.

PTGIS
Also flagged:polymeraserheumatic diseasesFLGbiosynthesisBCRGIGYF2
Journal Article 2023-09-20 ✓ 1 Snippet Li M, Shi Y, Zhao J, Wang Q, Li M, Zhao X.
In-Text Gene Mentions

…and prostacyclin synthase (PTGIS), were identified by…

Show Full Abstract

<h4>Background</h4>Pulmonary arterial hypertension (PAH) is a rare complication of primary Sjögren's syndrome (pSS). Several genes have proven to be associated with pSS and PAH. However, there is no study specifically addressing the genetic susceptibility in pSS combined with PAH.<h4>Methods</h4>Thirty-four unrelated patients with pSS-PAH were recruited from April 2019 to July 2021 at Peking Union Medical College Hospital. Demographic and clinical data were recorded in detail, and peripheral blood samples were collected for whole-exome sequencing (WES). Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed to predict the functional effect of mutant genes. Genetic variants identified by WES were confirmed by polymerase chain reaction (PCR)-Sanger sequencing.<h4>Results</h4>We totally identified 141 pathogenic variant loci of 129 genes in these 34 pSS-PAH patients, using WES analysis. Patients with a family history of rheumatic diseases are more likely to carry FLG mutations or carry gene variations related to the biosynthesis of the amino acids pathway (p < 0.05). According to Sanger sequencing confirmation and pathogenicity validation, we totally identified five candidate pathogenic variants including FLG c.12064A > T, BCR c.3275_3278dupCCGG, GIGYF2 c.3463C > A, ITK c.1741C > T, and SLC26A4 c.919-2A > G.<h4>Conclusion</h4>Our findings provide preliminary data of exome sequencing to identify susceptibility loci for pSS-PAH and enriched our understanding of the genetic etiology for pSS-PAH. The candidate pathogenic genes may be the potential genetic markers for early warning of this disease.

HFE
Also flagged:metaphasehematological malignanciessolid tumorsbenign diseasesfertilizationmenopause
Journal Article 2023-09-20 ✓ 1 Snippet Miquel L, Liotta J, Hours A, Bottin P, Castel P, Perrin J, Guillemain C, Courbiere B.
In-Text Gene Mentions

…Thalassemia major withhemochromatosis.…

Show Full Abstract

The aim of our study was to evaluate the feasibility and efficiency of delayed ovarian stimulation and metaphase II oocyte banking for fertility preservation after fertility-impairing treatment regardless of the initial disease. We conducted a cohort study based on population of women < 40 years of age with diminished ovarian reserve caused by fertility-impairing treatment (n = 129). Three groups of women were compared according to the type of initial disease: hematological malignancies, solid tumors, and benign diseases. The primary endpoint was the number of metaphase II oocytes collected per woman. We studied the cumulative live-birth rate per cycle with fertilized metaphase II oocyte, for women who wanted to conceive. We studied 245 delayed controlled ovarian stimulation cycles in 129 women: 201 for fertility preservation and 44 for in vitro fertilization and fresh embryo transfers. The number of metaphase II oocytes collected per woman after banking was similar in the three groups, with a mean of 10.7 ± 4.6, 12.3 ± 9.1, and 10.1 ± 7.6 metaphase II oocytes (p = 0.46), respectively. In the subgroup of women who wanted to conceive, the cumulative live birth rate per woman was 38%, with 8 live births for these 21 women. After fertility-impairing treatment, practitioners should discuss a fertility preservation procedure for banking metaphase II oocytes.

Also flagged:mineralizationcraniosynostosisdiscoidin domain-containing receptor 2DDR2ossificationCTSK
Journal Article 2023-09-20 No Snippets Bok S, Yallowitz AR, Sun J, McCormick J, Cung M, Hu L, Lalani S, Li Z, Sosa BR, Baumgartner T, Byrne P, Zhang T, Morse KW, Mohamed FF, Ge C, Franceschi RT, Cowling RT, Greenberg BH, Pisapia DJ, Imahiyerobo TA, Lakhani S, Ross ME, Hoffman CE, Debnath S, Greenblatt MB.
Show Full Abstract

Craniosynostosis is a group of disorders of premature calvarial suture fusion. The identity of the calvarial stem cells (CSCs) that produce fusion-driving osteoblasts in craniosynostosis remains poorly understood. Here we show that both physiologic calvarial mineralization and pathologic calvarial fusion in craniosynostosis reflect the interaction of two separate stem cell lineages; a previously identified cathepsin K (CTSK) lineage CSC<sup>1</sup> (CTSK<sup>+</sup> CSC) and a separate discoidin domain-containing receptor 2 (DDR2) lineage stem cell (DDR2<sup>+</sup> CSC) that we identified in this study. Deletion of Twist1, a gene associated with craniosynostosis in humans<sup>2,3</sup>, solely in CTSK<sup>+</sup> CSCs is sufficient to drive craniosynostosis in mice, but the sites that are destined to fuse exhibit an unexpected depletion of CTSK<sup>+</sup> CSCs and a corresponding expansion of DDR2<sup>+</sup> CSCs, with DDR2<sup>+</sup> CSC expansion being a direct maladaptive response to CTSK<sup>+</sup> CSC depletion. DDR2<sup>+</sup> CSCs display full stemness features, and our results establish the presence of two distinct stem cell lineages in the sutures, with both populations contributing to physiologic calvarial mineralization. DDR2<sup>+</sup> CSCs mediate a distinct form of endochondral ossification without the typical haematopoietic marrow formation. Implantation of DDR2<sup>+</sup> CSCs into suture sites is sufficient to induce fusion, and this phenotype was prevented by co-transplantation of CTSK<sup>+</sup> CSCs. Finally, the human counterparts of DDR2<sup>+</sup> CSCs and CTSK<sup>+</sup> CSCs display conserved functional properties in xenograft assays. The interaction between these two stem cell populations provides a new biologic interface for the modulation of calvarial mineralization and suture patency.

HTT
Also flagged:proteostasischaperonesproteasesmotor neuron diseasesneurodegenerative disordersCOVID-19
Journal Article 2023-09-20 ✓ 1 Snippet Münch C, Kirstein J.
In-Text Gene Mentions

DNAJB1 binds with its C-terminal hinge region to the proline rich domain of Huntingtin (HTT).

Show Full Abstract

Protein quality control pathways ensure a functional proteome and rely on a complex proteostasis network (PN) that is composed of molecular chaperones and proteases. Failures in the PN can lead to a broad spectrum of diseases, including neurodegenerative disorders like Alzheimer's, Parkinson's, and a range of motor neuron diseases. The EMBO workshop "Protein quality control: from molecular mechanisms to therapeutic intervention" covered all aspects of protein quality control from underlying molecular mechanisms of chaperones and proteases to stress signaling pathways and medical implications. This report summarizes the workshop and highlights selected presentations.

Also flagged:cancercolorectal cancerTumorcancersmethylationgene expression
Journal Article 2023-09-20 No Snippets Wurm AA, Brilloff S, Kolovich S, Schäfer S, Rahimian E, Kufrin V, Bill M, Carrero ZI, Drukewitz S, Krüger A, Hüther M, Uhrig S, Oster S, Westphal D, Meier F, Pfütze K, Hübschmann D, Horak P, Kreutzfeldt S, Richter D, Schröck E, Baretton G, Heining C, Möhrmann L, Fröhling S, Ball CR, Glimm H.
Show Full Abstract

Targeted therapies are effective in treating cancer, but success depends on identifying cancer vulnerabilities. In our study, we utilize small RNA sequencing to examine the impact of pathway activation on microRNA (miRNA) expression patterns. Interestingly, we discover that miRNAs capable of inhibiting key members of activated pathways are frequently diminished. Building on this observation, we develop an approach that integrates a low-miRNA-expression signature to identify druggable target genes in cancer. We train and validate our approach in colorectal cancer cells and extend it to diverse cancer models using patient-derived in vitro and in vivo systems. Finally, we demonstrate its additional value to support genomic and transcriptomic-based drug prediction strategies in a pan-cancer patient cohort from the National Center for Tumor Diseases (NCT)/German Cancer Consortium (DKTK) Molecularly Aided Stratification for Tumor Eradication (MASTER) precision oncology trial. In conclusion, our strategy can predict cancer vulnerabilities with high sensitivity and accuracy and might be suitable for future therapy recommendations in a variety of cancer subtypes.

CSE1L
Also flagged:histone chaperone MCM2arseniccancerspolyadenylationH3histone chaperones
Journal Article 2023-09-20 ✓ 1 Snippet Wu P, Lin SJ, Chen D, Jin C.
In-Text Gene Mentions

CSE1L

Show Full Abstract

Arsenic exposure is associated with an increased risk of many cancers, and epigenetic mechanisms play a crucial role in arsenic-mediated carcinogenesis. Our previous studies have shown that arsenic exposure induces polyadenylation of H3.1 mRNA and inhibits the deposition of H3.3 at critical gene regulatory elements. However, the precise underling mechanisms are not yet understood. To characterize the factors governing arsenic-induced inhibition of H3.3 assembly through H3.1 mRNA polyadenylation, we utilized mass spectrometry to identify the proteins, especially histone chaperones, with reduced binding affinity to H3.3 under conditions of arsenic exposure and polyadenylated H3.1 mRNA overexpression. Our findings reveal that the interaction between H3.3 and the histone chaperon protein MCM2 is diminished by both polyadenylated H3.1 mRNA overexpression and arsenic treatment in human lung epithelial BEAS-2B cells. The increased binding of MCM2 to H3.1, resulting from elevated H3.1 protein levels, appears to contribute to the reduced availability of MCM2 for H3.3. To further investigate the role of MCM2 in H3.3 deposition during arsenic exposure and H3.1 mRNA polyadenylation, we overexpressed MCM2 in BEAS-2B cells overexpressing polyadenylated H3.1 or exposed to arsenic. Our results demonstrate that MCM2 overexpression attenuates H3.3 depletion at several genomic loci, suggesting its involvement in the arsenic-induced displacement of H3.3 mediated by H3.1 mRNA polyadenylation. These findings suggest that changes in the association between histone chaperone MCM2 and H3.3 due to polyadenylation of H3.1 mRNA may play a pivotal role in arsenic-induced carcinogenesis.

Also flagged:cognitive impairmentACPpost-transplant diabetes mellituskidney failurefrailtychronic kidney disease
Journal Article 2023-09-20 No Snippets Fisher MC, Chen X, Crews DC, DeGroot L, Eneanya ND, Ghildayal N, Gold M, Liu Y, Sanders JJ, Scherer JS, Segev DL, McAdams-DeMarco MA.
Show Full Abstract

<h4>Rationale & objective</h4>Because of the high risk of waitlist mortality and posttransplant complications, kidney transplant (KT) patients may benefit from advance care planning (ACP) and palliative care consultation (PCC). We quantified the prevalence and racial disparities in ACP and PCC among KT candidates and recipients.<h4>Study design</h4>Prospective cohort study.<h4>Setting & participants</h4>2,575 adult KT candidates and 1,233 adult recipients (2008-2020).<h4>Exposure</h4>Race and ethnicity.<h4>Outcomes</h4>All reports of ACP and PCC were abstracted from chart review. ACP was defined as patient self-report of an advance directive, presence of an advance directive in the medical record, or a documented goals-of-care conversation with a provider. PCC was defined as an ordered referral or a documented palliative care note in the medical record.<h4>Analytical approach</h4>Racial/ethnic disparities in ACP/PCC were estimated using adjusted logistic regression.<h4>Results</h4>21.4% of KT candidates and 34.9% of recipients engaged in ACP. There were racial/ethnic disparities in ACP among KT candidates (White, 24.4%; Black, 19.1%; Hispanic, 15%; other race and ethnicity, 21.1%; P=0.008) and recipients (White, 39.5%; Black, 31.2%; Hispanic, 26.3%; other race and ethnicity, 26.6%; P=0.007). After adjustment, Black KT recipients had a 29% lower likelihood of engaging in ACP (OR, 0.71; 95% CI, 0.55-0.91) than White KT recipients. Among older (aged≥65 years) recipients, those who were Black had a lower likelihood of engaging in ACP, but there was no racial disparity among younger recipients (P=0.020 for interaction). 4.2% of KT candidates and 5.1% of KT recipients engaged in PCC; there were no racial disparities in PCC among KT candidates (White, 5.3%; Black, 3.6%; Hispanic, 2.5%; other race and ethnicity, 2.1%; P=0.13) or recipients (White, 5.5%; Black, 5.6%; Hispanic, 0.0%; other race and ethnicity, 1.3%; P = 0.21).<h4>Limitations</h4>Generalizability may be limited to academic transplant centers.<h4>Conclusions</h4>ACP is not common among KT patients, and minoritized transplant patients are least likely to engage in ACP; PCC is less common. Future efforts should aim to integrate ACP and PCC into the KT process.<h4>Plain-language summary</h4>Kidney transplant (KT) candidates and recipients are at elevated risk of morbidity and mortality. They may benefit from completing a document or conversation with their palliative care provider that outlines their future health care wishes, known as advance care planning (ACP), which is a component of palliative care consultation (PCC). We wanted to determine how many KT candidates and recipients have engaged in ACP or PCC and identify potential racial disparities. We found that 21.4% of candidates and 34.9% of recipients engaged in ACP. After adjustment, Black recipients had a 29% lower likelihood of engaging in ACP. We found that 4.2% of KT candidates and 5.1% of KT recipients engaged in PCC, with no racial disparities found in PCC.

Also flagged:gastrointestinal stromal tumorKITkinaseRipretinibtyrosine kinaseGIST
Journal Article 2023-09-20 No Snippets Gouda MA, Janku F, Somaiah N, Hunt KK, Yedururi S, Subbiah V.
Show Full Abstract

Ripretinib is a tyrosine kinase inhibitor that was approved by the United States FDA in 2020 for treatment of advanced gastrointestinal stromal tumor (GIST) in patients who received prior treatment with three or more tyrosine kinase inhibitors. In this case report, we show the durable clinical benefit achieved in a patient with GIST by using ripretinib and repeated timely surgical resection of limited disease progression. The total time on ripretinib was 43 months which is longer than the current reported data from ripretinib clinical trials. Such approach for using multi-disciplinary disease management can improve the durability of response to tyrosine kinase inhibitors, including ripretinib, and associated clinical outcomes.

TNFSF4
Also flagged:GBP5Small Cell Lung CancercancerSCLCchemokinesTNF
Journal Article 2023-09-20 ✓ 3 Snippets Tong Q, Li D, Yin Y, Cheng L, Ouyang S.
In-Text Gene Mentions

In additional, in both cohorts (George-SCLC: Figure 3C, Jiang-SCLC: Figure 3D), the GBP5-High population exhibited significantly increased expression of cytotoxicity-related genes (CD8A, GZMA and GZMB), chemokine-related genes (CX3CL1, CXCL9 and CXCR3) and antigen presentation related gene (HLA-A) and tumor necrosis factor (TNF) family related genes (TNFRSF18, TNFRSF8, TNFRSF9, TNFSF10, TNFSF14, TNFSF18, TNFSF4 and TNFSF9) compared with GBP5-Low populations.

…TNFSF10, TNFSF14, TNFSF18,TNFSF4and TNFSF9) compared…

…TNFSF10, TNFSF14, TNFSF18,TNFSF4and TNFSF9).…

Show Full Abstract

<h4>Background</h4>The discovery and development of immune checkpoint inhibitors (ICIs) has significantly enhanced the arsenal of immunotherapy treatments available for cancer patients. The identification of biomarkers that are indicative of an individual's sensitivity to treatment with ICIs is useful for screening SCLC patients prior to commencement of any ICIs based immunotherapy. However, the relationship between GBP5 and the prognosis of SCLC immunotherapy is still unclear and requires further study.<h4>Methods</h4>We downloaded two SCLC datasets, namely the George-SCLC and Jiang-SCLC cohorts. We used the TIDE algorithm to predict the efficacy of immunotherapy for SCLC patients. The QuanTIseq, MCPcounter, and EPIC algorithms are used to calculate the proportions of immune cells in SCLC patients. Additionally, we retrospectively collected 35 SCLC samples from the first affiliated hospital of the Hengyang Medical school.<h4>Results</h4>Patients in each cohort were devided into two groups with high (GBP5-High) and low (GBP5-Low) expression of GBP5. In both cohorts, the GBP5-High population had a higher proportion of patients that responded well to immunotherapy (responders) (p < 0.05). In addition, both GBP5-High subgroups had significantly increased cytotoxicity, chemokines, antigen presenting, and TNF family related genes. We also determined that GBP5 was related to high-level infiltration of B cells, CD4+T cells, CD8+T cells and NK cells.<h4>Conclusion</h4>In this study, we found that GBP5 has the potential to be used as a biomarker of ICIs efficacy for SCLC patients. GBP5 is related to the quantity of inflammatory molecules, a high level of immune infiltration, and a highly activated immune response pathway.

HTT
Also flagged:Protein Arginine Methyltransferasesneurodegenerative diseasesmethylationarginineaxonalsynaptic maturation
Journal Article 2023-09-20 ✓ 5 Snippets Angelopoulou E, Pyrgelis ES, Ahire C, Suman P, Mishra A, Piperi C.
In-Text Gene Mentions

Indeed, a recent study demonstrated that HTT is arginine methylated by PRMT6 at R118, while loss of PRMT6-mediated arginine methylation impairs the interaction of HTT with vesicles, disrupts its scaffolding capacity, reduces anterograde axonal trafficking, and contributes to neuronal cell death [36].

Hence, it could be speculated that higher SAH levels may inhibit PRMT6 in HD, thereby suppressing HTT arginine methylation; however, the specific mechanisms of the potential PRMT6 inhibition in HD need to be investigated.

Proteomic analysis has shown that HTT can interact with several PRMTs, including PRMT1, PRMT3, and PRMT5 [96], and HTT can also form a complex with PRMT2 and PRMT6 [36], suggesting that methylation at arginine residues may represent another post-translational modification of HTT.

In agreement with this evidence, another recent study demonstrated that PRMT4 and PRMT6 interacted with the N-terminal region and methylate HTT and mHTT at multiple specific arginine residues [105].

6.3. PRMTs and Huntingtin (HTT) Methylation in HD

Show Full Abstract

During the aging of the global population, the prevalence of neurodegenerative diseases will be continuously growing. Although each disorder is characterized by disease-specific protein accumulations, several common pathophysiological mechanisms encompassing both genetic and environmental factors have been detected. Among them, protein arginine methyltransferases (PRMTs), which catalyze the methylation of arginine of various substrates, have been revealed to regulate several cellular mechanisms, including neuronal cell survival and excitability, axonal transport, synaptic maturation, and myelination. Emerging evidence highlights their critical involvement in the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal dementia-amyotrophic lateral sclerosis (FTD-ALS) spectrum, Huntington's disease (HD), spinal muscular atrophy (SMA) and spinal and bulbar muscular atrophy (SBMA). Underlying mechanisms include the regulation of gene transcription and RNA splicing, as well as their implication in various signaling pathways related to oxidative stress responses, apoptosis, neuroinflammation, vacuole degeneration, abnormal protein accumulation and neurotransmission. The targeting of PRMTs is a therapeutic approach initially developed against various forms of cancer but currently presents a novel potential strategy for neurodegenerative diseases. In this review, we discuss the accumulating evidence on the role of PRMTs in the pathophysiology of neurodegenerative diseases, enlightening their pathogenesis and stimulating future research.

Also flagged:asthmatranslationalrespiratory diseasechronic diseasebehavioralCRIM1
Journal Article 2023-09-20 No Snippets Espuela-Ortiz A, Martin-Gonzalez E, Poza-Guedes P, González-Pérez R, Herrera-Luis E.
Show Full Abstract

The astounding number of genetic variants revealed in the 15 years of genome-wide association studies of asthma has not kept pace with the goals of translational genomics. Moving asthma diagnosis from a nonspecific umbrella term to specific phenotypes/endotypes and related traits may provide insights into features that may be prevented or alleviated by therapeutical intervention. This review provides an overview of the different asthma endotypes and phenotypes and the genomic findings from asthma studies using patient stratification strategies and asthma-related traits. Asthma genomic research for treatable traits has uncovered novel and previously reported asthma loci, primarily through studies in Europeans. Novel genomic findings for asthma phenotypes and related traits may arise from multi-trait and specific phenotyping strategies in diverse populations.

DCC
Also flagged:Male breast cancercancercancersbreast cancersbreast cancertumour
Journal Article 2023-09-20 ✓ 2 Snippets Al Saati A, Vande Perre P, Plenecassagnes J, Gilhodes J, Monselet N, Cabarrou B, Lignon N, Filleron T, Telly D, Perello-Lestrade E, Feillel V, Staub A, Martinez M, Chipoulet E, Collet G, Thomas F, Gladieff L, Toulas C.
In-Text Gene Mentions

Whole exome sequencing performed on six MBC cases revealed germline variants in BRCA2, MSH5, DCC, ERBB3, NOTCH3, DIAPH1 and DNAH11, but no statistical tests were performed in this study [17].

…in BRCA2, MSH5,DCC, ERBB3, NOTCH3, DIAPH1…

Show Full Abstract

Even though male breast cancer (MBC) risk encompasses both genetic and environmental aetiologies, the primary risk factor is a germline pathogenic variant (PV) or likely pathogenic variant (LPV) in <i>BRCA2, BRCA1</i> and/or <i>PALB2</i> genes. To identify new potential MBC-specific predisposition genes, we sequenced a panel of 585 carcinogenesis genes in an MBC cohort without <i>BRCA1/BRCA2/PALB2</i> PV/LPV. We identified 14 genes carrying rare PVs/LPVs in the MBC population versus noncancer non-Finnish European men, predominantly coding for DNA repair and maintenance of genomic stability proteins. We identified for the first time PVs/LPVs in <i>PRCC</i> (pre-mRNA processing), <i>HOXA9</i> (transcription regulation), <i>RECQL4</i> and <i>WRN</i> (maintenance of genomic stability) as well as in genes involved in other cellular processes. To study the specificity of this MBC PV/LPV profile, we examined whether variants in the same genes could be detected in a female breast cancer (FBC) cohort without <i>BRCA1/BRCA2/PALB2</i> PV/LPV. Only 5/109 women (4.6%) carried a PV/LPV versus 18/85 men (21.2%) on these genes. FBC did not carry any PV/LPV on 11 of these genes. Although 5.9% of the MBC cohort carried PVs/LPVs in <i>PALLD</i> and <i>ERCC2,</i> neither of these genes were altered in our FBC cohort. Our data suggest that in addition to <i>BRCA1/BRCA2/PALB2</i>, other genes involved in DNA repair/maintenance or genomic stability as well as cell adhesion may form a specific MBC PV/LPV signature.

Also flagged:CopperNeurodegenerative diseasesdegradationmetal ionstripeptidepeptide
Journal Article 2023-09-20 No Snippets Tosto R, Vecchio G, Bellia F.
Show Full Abstract

Neurodegenerative diseases affect millions of people worldwide. The failure of the enzymatic degradation, the oxidative stress, the dyshomeostasis of metal ions, among many other biochemical events, might trigger the pathological route, but the onset of these pathologies is unknown. Multi-target and multifunctional molecules could address several biomolecular issues of the pathologies. The tripeptide GHK, a bioactive fragment of several proteins, and the related copper(II) complex have been largely used for many purposes, from cosmetic to therapeutic applications. GHK derivatives were synthesized to increase the peptide stability and improve the target delivery. Herein we report the synthesis of a new biotin-GHK conjugate (BioGHK) through orthogonal reactions. BioGHK is still capable of coordinating copper(II), as observed by spectroscopic and spectrometric measurements. The spectroscopic monitoring of the copper-induced ascorbate oxidation was used to measure the antioxidant activity Cu(II)-BioGHK complex, whereas antiglycant activity of the ligand towards harmful reactive species was investigated using MALDI-TOF. The affinity of BioGHK for streptavidin was evaluated using a spectrophotometric assay and compared to that of biotin. Finally, the antiaggregant activity towards amyloid-β was evaluated using a turn-on fluorescent dye. BioGHK could treat and/or prevent several adverse biochemical reactions that characterize neurodegenerative disorders, such as Alzheimer's disease.

HTT
Also flagged:orphanOrphan diseasesepilepsyneurodegenerative movement disorderstumorsCas9
Journal Article 2023-09-20 ✓ 1 Snippet Kioutchoukova IP, Foster DT, Thakkar RN, Foreman MA, Burgess BJ, Toms RM, Molina Valero EE, Lucke-Wold B.
In-Text Gene Mentions

Huntington’s disease (HD) is a neurodegenerative disorder resulting from the expansion of a CAG trinucleotide sequence on the HTT gene which encodes the huntingtin protein[119-121].

Show Full Abstract

Orphan diseases are rare diseases that affect less than 200000 individuals within the United States. Most orphan diseases are of neurologic and genetic origin. With the current advances in technology, more funding has been devoted to developing therapeutic agents for patients with these conditions. In our review, we highlight emerging options for patients with neurologic orphan diseases, specifically including diseases resulting in muscular deterioration, epilepsy, seizures, neurodegenerative movement disorders, inhibited cognitive development, neuron deterioration, and tumors. After extensive literature review, gene therapy offers a promising route for the treatment of neurologic orphan diseases. The use of clustered regularly interspaced palindromic repeats/Cas9 has demonstrated positive results in experiments investigating its role in several diseases. Additionally, the use of adeno-associated viral vectors has shown improvement in survival, motor function, and developmental milestones, while also demonstrating reversal of sensory ataxia and cardiomyopathy in Friedreich ataxia patients. Antisense oligonucleotides have also been used in some neurologic orphan diseases with positive outcomes. Mammalian target of rapamycin inhibitors are currently being investigated and have reduced abnormal cell growth, proliferation, and angiogenesis. Emerging innovations and the role of genetic treatments open a new window of opportunity for the treatment of neurologic orphan diseases.

NEGR1
Also flagged:obesitycanine obesityALPLKCTD8SGSM1SLC12A6
Journal Article 2023-09-20 ✓ 1 Snippet Antkowiak M, Szydlowski M.
In-Text Gene Mentions

…identified near theNEGR1, GPRC5B ,…

Show Full Abstract

Although obesity in the domestic dog (<i>Canis lupus</i> familiaris) is known to decrease well-being and shorten lifespan, the genetic risk variants associated with canine obesity remain largely unknown. In our study, which focused on the obesity-prone Labrador Retriever breed, we conducted a genome-wide analysis to identify structural variants linked to body weight and obesity. Obesity status was based on a 5-point body condition score (BCS) and the obese dog group included all dogs with a BCS of 5, along with dogs with the highest body weight within the BCS 4 group. Data from whole-gene sequencing of fifty dogs, including 28 obese dogs, were bioinformatically analyzed to identify potential structural variants that varied in frequency between obese and healthy dogs. The seven most promising variants were further analyzed by droplet digital PCR in a group of 110 dogs, including 63 obese. Our statistical evidence suggests that common structural mutations in or near six genes, specifically <i>ALPL</i>, <i>KCTD8</i>, <i>SGSM1</i>, <i>SLC12A6</i>, <i>RYR3</i>, and <i>VPS26C</i>, may contribute to the variability observed in body weight and body condition scores among Labrador Retriever dogs. These findings emphasize the need for additional research to validate the associations and explore the specific functions of these genes in relation to canine obesity.

Also flagged:chewingstrokeincisor malocclusionsdetomidine hydrochloridebutorphanolSAP
Journal Article 2023-09-20 No Snippets Sterkenburgh TR, Hartl B, Peham C, Nowak M, Kyllar M, Kau S.
Show Full Abstract

In equine dentistry, the physiological incisor occlusal surface is visually perceived as a plane with a distinct inclination to the head's coronal plane, extending rostro-ventrally to caudo-dorsally. To better understand the formation of this inclined plane and its connection to dental wear, we investigated the hypothesis that it arises from masticatory movements and the considerable distance between mandibular articular heads and the incisor occlusal surfaces, acting as the three points of support for the mandibles. Leveraging data from a large-scale clinical study involving static and dynamic orthodontic measurements in horses, we approximated the mandibular movement range where incisor occlusion and dental wear occur. By introducing and testing a segment coordinate system, we explored possible angular deviations from the occlusal plane caused by mandibular roll and pitch rotations during two lateral mandibular movement patterns, protrusion and retrusion. Theoretical biomechanical calculations and simulations confirmed the visual perception of the incisor occlusal surface as a plane. To further examine our assumptions, we employed a simple mechanical simulator to assess incisor normal occlusion and provoked malocclusions (diagonal, smile, and frown bite) by modifying temporomandibular joint (TMJ) movement patterns. The results from clinical investigations were corroborated by both the theoretical analysis and mechanical simulations, strengthening our understanding of the biomechanical basis behind the physiological incisor occlusal plane maintenance in horses. These findings have significant implications for equine dental health and contribute to a thorough understanding of TMJ dynamics.

SERPINC1
Also flagged:monkeypox diseaseARinfectious diseaseMonkeypoxviral infectioninflammatory response
Journal Article 2023-09-20 ✓ 1 Snippet Jiao Y, Shi C, Sun Y.
In-Text Gene Mentions

…inhibitor antithrombin III (ATIII) might be the…

Show Full Abstract

<h4>Introduction</h4>After COVID-19, there was an outbreak of a new infectious disease caused by monkeypox virus. So far, no specific drug has been found to treat it. Xuanbai Chengqi decoction (XBCQD) has shown effects against a variety of viruses in China.<h4>Methods</h4>We searched for the active compounds and potential targets for XBCQD from multiple open databases and literature. Monkeypox related targets were searched out from the OMIM and GeneCards databases. After determining the assumed targets of XBCQD for monkeypox treatment, we built the PPI network and used R for GO enrichment and KEGG pathway analysis. The interactions between the active compounds and the hub targets were investigated by molecular docking and molecular dynamics (MD) simulations.<h4>Results</h4>In total, 5 active compounds and 10 hub targets of XBCQD were screened out. GO enrichment and KEGG analysis demonstrated that XBCQD plays a therapeutic role in monkeypox mainly by regulating signaling pathways related to viral infection and inflammatory response. The main active compound estrone binding to target AR was confirmed to be the best therapy choice for monkeypox.<h4>Discussion</h4>This study systematically explored the interactions between the bioactive compounds of XBCQD and the monkeypox-specific XBCQD targets using network pharmacological methods, bioinformatics analyses and molecular simulations, suggesting that XBCQD could have a beneficial therapeutic effect on monkeypox by reducing the inflammatory damage and viral replication via multiple pathways. The use of XBCQD on monkeypox disease was confirmed to be best worked through the estrone-target AR interaction. Our work could provide evidence and guidance for further research on the treatment of monkeypox disease.

TNFSF4
Also flagged:fibroblast activationtumorRecessive dystrophic epidermolysis bullosaRDEBskin-blistering diseasecutaneous squamous cell carcinoma
Journal Article 2023-09-20 ✓ 1 Snippet Anderson-Crannage M, Ascensión AM, Ibanez-Solé O, Zhu H, Schaefer E, Ottomanelli D, Hochberg B, Pan J, Luo W, Tian M, Chu Y, Cairo MS, Izeta A, Liao Y.
In-Text Gene Mentions

…as Tnfsf9 (4-1BBL),Tnfsf4(OX40L), and CD86…

Show Full Abstract

Inflammation is known to play a critical role in all stages of tumorigenesis; however, less is known about how it predisposes the tissue microenvironment preceding tumor formation. Recessive dystrophic epidermolysis bullosa (RDEB), a skin-blistering disease secondary to <i>COL7A1</i> mutations and associated with chronic wounding, inflammation, fibrosis, and cutaneous squamous cell carcinoma (cSCC), models this dynamic. Here, we used single-cell RNA sequencing (scRNAseq) to analyze gene expression patterns in skin cells from a mouse model of RDEB. We uncovered a complex landscape within the RDEB dermal microenvironment that exhibited altered metabolism, enhanced angiogenesis, hyperproliferative keratinocytes, infiltration and activation of immune cell populations, and inflammatory fibroblast priming. We demonstrated the presence of activated neutrophil and Langerhans cell subpopulations and elevated expression of PD-1 and PD-L1 in T cells and antigen-presenting cells, respectively. Unsupervised clustering within the fibroblast population further revealed two differentiation pathways in RDEB fibroblasts, one toward myofibroblasts and the other toward a phenotype that shares the characteristics of inflammatory fibroblast subsets in other inflammatory diseases as well as the IL-1-induced inflammatory cancer-associated fibroblasts (iCAFs) reported in various cancer types. Quantitation of inflammatory cytokines indicated dynamic waves of IL-1α, TGF-β1, TNF, IL-6, and IFN-γ concentrations, along with dermal NF-κB activation preceding JAK/STAT signaling. We further demonstrated the divergent and overlapping roles of these cytokines in inducing inflammatory phenotypes in RDEB patients as well as RDEB mouse-derived fibroblasts together with their healthy controls. In summary, our data have suggested a potential role of inflammation, driven by the chronic release of inflammatory cytokines such as IL-1, in creating an immune-suppressed dermal microenvironment that underlies RDEB disease progression.

DCC
Also flagged:YAP1SCML2stem cell maintenancesteroidandrogentumor
Journal Article 2023-09-20 ✓ 1 Snippet Boston AM, Dwead AM, Al-Mathkour MM, Khazaw K, Zou J, Zhang Q, Wang G, Cinar B.
In-Text Gene Mentions

Briefly, LNCaP or C4-2 cells were seeded in 96-well cell culture plate in triplicates and transiently transfected with mock (scramble) or SMART-pool of SCML2 siRNA for 24h in serum-fed conditions, followed by treatment with vehicle control, androgen, and enzalutamide in androgen-depleted DCC-fed serum for 48h.

Show Full Abstract

The Polycomb group protein SCML2 and the transcriptional cofactor YAP1 regulate diverse cellular biology, including stem cell maintenance, developmental processes, and gene regulation in mammals and flies. However, their molecular and functional interactions are unknown. Here, we show that SCML2 interacts with YAP1, as revealed by immunological assays and mass spectroscopy. We have demonstrated that the steroid hormone androgen regulates the interaction of SCML2 with YAP1 in human tumor cell models. Our proximity ligation assay and GST pulldown showed that SCML2 and YAP1 physically interacted with each other. Silencing SCML2 by RNAi changed the growth behaviors of cells in response to androgen signaling. Mechanistically, this phenomenon is attributed to the interplay between distinct chromatin modifications and transcriptional programs, likely coordinated by the opposing SCML2 and YAP1 activity. These findings suggest that YAP1 and SCML2 cooperate to regulate cell growth, cell survival, and tumor biology downstream of steroid hormones.

Also flagged:norbornadieneperylenediimidesynthesiselectron transferPDIester
Journal Article 2023-09-20 No Snippets Zika W, Leng A, Weiß R, Pintér S, Schüßlbauer CM, Clark T, Hirsch A, Guldi DM.
Show Full Abstract

Through comprehensive photo-assays, this study investigates the reaction coordinate governing the interconversion between quadricyclane (QC) and norbornadiene (NBD) upon photo-irradiation up to a wavelength of 550 nm. To harness this spectroscopic range for energy release, we link the NBD-core with a highly electron-accepting perylenediimide (PDI) with broad absorption, achieving strong electronic coupling between them. We detail the successful synthesis and present extensive DFT calculations to determine the amount of stored energy. By means of transient absorption spectroscopy, an oxidative electron transfer is observed during the QC-to-NBD isomerization following the initial PDI photoexcitation. This charge-separated state is key to triggering the back-isomerization with visible light excitation.

HFE
Also flagged:gastrointestinal polyposiscorticosteroidsproton pumpcolon polypshamartomatous polypsalopecia
Journal Article 2023-09-20 ✓ 1 Snippet Nguyen LC, Thi Pham T, Nguyen TT, Nguyen NH, Van Kieu T, Anh Do G, Thi-Ngoc Doan H, Van Tran C, Vu NT.
In-Text Gene Mentions

…infection, Wilson disease,hemochromatosis diseasedisease, Addison’s disease,…

Show Full Abstract

<h4>Introduction and importance</h4>Cronkhite-Canada syndrome (CCS) is an extremely rare non-inherited syndrome first described in 1955 with only about 500 more cases reported so far. Since the aetiology of the disease remains unknown, there were no specific treatments in consensus. In many countries, CCS is a completely new condition that may confuse physicians at first encounter. Lessons should be learned from these cases by gastrointestinal specialists to be aware of this condition in any circumstances.<h4>Case presentation</h4>The authors reported a case study of a 45-year-old Vietnamese male with CCS diagnosis, which encountered at our centre for the first time.<h4>Clinical discussion</h4>The definitive diagnosis was provided by combining clinical characteristics, and endoscopic and histopathologic features, after excluding other causes of gastrointestinal polyposis. The patient responds to corticosteroids, proton pump inhibitors, and nutritional support right after treatment. After 1 year of treatment, his symptoms ameliorated completely although colon polyps insignificantly reduced.<h4>Conclusion</h4>Gastroenterologists should always be aware of patients with CCS with the following symptoms: gastrointestinal hamartomatous polyps, diarrhoea, and the dermatologic triad of alopecia, hyperpigmentation, and onychodystrophy.

Also flagged:HTR1Aserotonin receptor5-hydroxytryptamine receptor 1Aserotonin5-HT receptors5-HTR1A
Journal Article 2023-09-20 No Snippets Humińska-Lisowska K, Chmielowiec J, Chmielowiec K, Strońska A, Cięszczyk P, Spieszny M, Masiak J, Lachowicz M, Surała O, Grzywacz A.
Show Full Abstract

<i>HTR1A</i> (5-hydroxytryptamine receptor 1A) and its polymorphic variants are highly important for athletes in different aspects, allowing us to hypothesize their biological influences. Hence, to investigate at least part of the relationship mentioned in the case literature, it was decided to study the association of the selected <i>HTR1A</i> polymorphism with personality traits measured by the Temperament and Character Inventory (TCI). The participants consisted of 250 mixed martial arts (combat sport) athletes and 209 healthy male participants (control group). The personality traits were measured for the Revised Temperament and Character Inventory (TCI-R). Genetic material was isolated from whole blood collected from patients, and then all samples were genotyped using the real-time PCR method. Statistical analysis was performed using a 2 × 3 factorial ANOVA. The research revealed a statistically significant effect of a complex factor of rs6295 of the <i>HTR1A</i> serotonin receptor gene with combat sport/control and with Novelty Seeking (F<sub>2,453</sub> = 6.126; <i>p</i> = 0.0024; η<sup>2</sup> = 0.026) and Harm Avoidance (F<sub>2,453</sub> = 3.709; <i>p</i> = 0.0252; η<sup>2</sup> = 0.016). The presence of the <i>HTR1A</i> GG genotype (rs6295) was found to be associated with higher scores in self-management and lower scores in harm avoidance, indicating genetic predispositions in the strength group towards better results in combat sports.

HFE
Also flagged:organogenesiskidney diseaseorgan diseasespolycystic kidney diseasearrhythmogenic cardiomyopathycardiac channelopathies
Journal Article 2023-09-20 ✓ 1 Snippet Kwisda K.
In-Text Gene Mentions

…polycystic kidney disease,hemochromatosis, arrhythmogenic cardiomyopath…

Show Full Abstract

The last few years have seen a significant increase in the use of technology to manipulate genetic sequences and generate animals as a source of xeno-organs. This has made the generation of genetically bespoke organisms a reality. This paper will analyze the regulatory and practical aspects of such an innovative approach to xenotransplantation on the basis of a hypothetical case study applied to Germany and highlight the gaps in the current regulation. This paper thus provides the basis for legal debate within a specific country. In addition, the identified gaps also pose a barrier toward the harmonization of international regulation. This publication therefore lays the groundwork for guiding the international debate regarding the regulatory framework for solid organ xenotransplantation toward specific issues.

DCC
Also flagged:behaviore is
Journal Article 2023-09-20 ✓ 2 Snippets Cotumaccio N, Gagie T, Köppl D, Prezza N.
In-Text Gene Mentions

…ng statistics on a Wheeler DFA [DCC 2023]. …

…r et al. which was linear in k [DCC 2015]. …

Show Full Abstract

Recently, Conte et al. generalized the longest-common prefix (LCP) array from strings to Wheeler DFAs, and they showed that it can be used to efficiently determine matching statistics on a Wheeler DFA [DCC 2023]. However, storing the LCP array requires O n log n bits, n being the number of states, while the compact representation of Wheeler DFAs often requires much less space. In particular, the BOSS representation of a de Bruijn graph only requires a linear number of bits, if the size of alphabet is constant. In this paper, we propose a sampling technique that allows to access an entry of the LCP array in logarithmic time by only storing a linear number of bits. We use our technique to provide a space-time tradeoff to compute matching statistics on a Wheeler DFA. In addition, we show that by augmenting the BOSS representation of a k -th order de Bruijn graph with a linear number of bits we can navigate the underlying variable-order de Bruijn graph in time logarithmic in k , thus improving a previous bound by Boucher et al. which was linear in k [DCC 2015].

Research Square 2023-09-20 Preprint (No Snippets API) Wang L, Ma J, Liu Y, Ma J, Palagani A, Caldwell E, Foy S, Umeda M, Wilkinson M, Inaba H, Klco J, rubnitz J.
Show Full Abstract

<title>Abstract</title> <p><italic>PICALM::MLLT10</italic> fusion is a rare but recurrent genetic driver in acute leukemias. To better understand the genomic landscape of <italic>PICALM::MLLT10</italic> (PM) positive acute leukemia, we performed genomic profiling and gene expression profiling in twenty PM-positive patients, including AML (n = 10), T-ALL/LLy (n = 8), Mixed-phenotype acute leukemia (MPAL), T/B (n=1) and acute undifferentiated leukemia (AUL) (n=1). Besides confirming the known activation of <italic>HOXA</italic>, our study suggested <italic>PHF6 </italic>disruption as a key cooperating event in <italic>PICALM::MLLT10</italic>-positive leukemias. In addition, we demonstrated differences in gene expression profiles as well as remarkably different spectra of co-occurring mutations between PM-AML and PM-ALL (including T-ALL/LLy and MPAL, T/B). Alterations affecting <italic>TP53 </italic>and <italic>NF1 </italic>are hallmarks of PM-AML and are strongly associated with disease progression and relapse, whereas <italic>EZH2 </italic>alterations are highly enriched in PM-ALL. This comprehensive genomic and transcriptomic profiling provides insights into the pathogenesis and development of <italic>PICALM::MLLT10 </italic>positive acute leukemia. The dramatic differences in the landscapes of co-occurring mutations for these related acute leukemia subtypes highlight the value of performing real-time genomic profiling of acute leukemia for molecular diagnostics.</p>

DCC
Also flagged:Gnaqnucleusaxon guidanceagecognitive declineG αq
Journal Article 2023-09-19 ✓ 1 Snippet Stevenson ME, Bieri G, Kaletsky R, St Ange J, Remesal L, Pratt KJB, Zhou S, Weng Y, Murphy CT, Villeda SA.
In-Text Gene Mentions

…guidance genes (Dcc/unc-40 , Unc5c/unc-5 ,…

Show Full Abstract

Loss of cognitive function with age is devastating. EGL-30/GNAQ and G<sub>αq</sub> signaling pathways are highly conserved between C. elegans and mammals, and murine Gnaq is enriched in hippocampal neurons and declines with age. We found that activation of EGL-30 in aged worms triples memory span, and GNAQ gain of function significantly improved memory in aged mice: GNAQ(gf) in hippocampal neurons of 24-month-old mice (equivalent to 70- to 80-year-old humans) rescued age-related impairments in well-being and memory. Single-nucleus RNA sequencing revealed increased expression of genes regulating synaptic function, axon guidance, and memory in GNAQ-treated mice, and worm orthologs of these genes were required for long-term memory extension in worms. These experiments demonstrate that C. elegans is a powerful model to identify mammalian regulators of memory, leading to the identification of a pathway that improves memory in extremely old mice. To our knowledge, this is the oldest age at which an intervention has improved age-related cognitive decline.

CACNA1E
Also flagged:Pax5lymphopoiesisCRD1cell developmentB-lymphopoiesischromatin
Journal Article 2023-09-19 ✓ 1 Snippet Gruenbacher S, Jaritz M, Hill L, Schäfer M, Busslinger M.
In-Text Gene Mentions

…genes Fcrla ,Cacna1e, Dkk3 ,…

Show Full Abstract

The B cell regulator Pax5 consists of multiple domains whose function we analyzed in vivo by deletion in Pax5. While B lymphopoiesis was minimally affected in mice with homozygous deletion of the octapeptide or partial homeodomain, both sequences were required for optimal B cell development. Deletion of the C-terminal regulatory domain 1 (CRD1) interfered with B cell development, while elimination of CRD2 modestly affected B-lymphopoiesis. Deletion of CRD1 and CRD2 arrested B cell development at an uncommitted pro-B cell stage. Most Pax5-regulated genes required CRD1 or both CRD1 and CRD2 for their activation or repression as these domains induced or eliminated open chromatin at Pax5-activated or Pax5-repressed genes, respectively. Co-immunoprecipitation experiments demonstrated that the activating function of CRD1 is mediated through interaction with the chromatin-remodeling BAF, H3K4-methylating Set1A-COMPASS, and H4K16-acetylating NSL complexes, while its repressing function depends on recruitment of the Sin3-HDAC and MiDAC complexes. These data provide novel molecular insight into how different Pax5 domains regulate gene expression to promote B cell commitment and development.

Also flagged:autophagyuveal melanomaocular tumorcancerHTR2BEEF1A2
Journal Article 2023-09-19 No Snippets Jin W, Wu L, Hu L, Fu Y, Fan Z, Mou Y, Ma K.
Show Full Abstract

<h4>Purpose</h4>Uveal melanoma (UVM) is a rare yet malignant ocular tumor that metastases in approximately half of all patients, with the majority of those developing metastasis typically succumbing to the disease within a year. Hitherto, no effective treatment for UVM has been identified. Autophagy is a cellular mechanism that has been suggested as an emerging regulatory process for cancer-targeted therapy. Thus, identifying novel prognostic biomarkers of autophagy may help improve future treatment.<h4>Methods</h4>Consensus clustering and similarity network fusion approaches were performed for classifying UVM patient subgroups. Weighted correlation network analysis was performed for gene module screening and network construction. Gene set variation analysis was used to evaluate the autophagy activity of the UVM subgroups. Kaplan-Meier survival curves (Log-rank test) were performed to analyze patient prognosis. Gene set cancer analysis was used to estimate the level of immune cell infiltration.<h4>Results</h4>In this study, we employed multi-omics approaches to classify UVM patient subgroups by molecular and clinical characteristics, ultimately identifying HTR2B, EEF1A2, FEZ1, GRID1, HAP1, and SPHK1 as potential prognostic biomarkers of autophagy in UVM. High expression levels of these markers were associated with poorer patient prognosis and led to reshaping the tumor microenvironment (TME) that promotes tumor progression.<h4>Conclusion</h4>We identified six novel potential prognostic biomarkers in UVM, all of which are associated with autophagy and TME. These findings will shed new light on UVM therapy with inhibitors targeting these biomarkers expected to regulate autophagy and reshape the TME, significantly improving UVM treatment outcomes.

HFE
Also flagged:primary biliary cholangitisdeathdecompensated cirrhosisursodeoxycholic acidalkaline phosphataseALP
Journal Article 2023-09-19 ✓ 1 Snippet Ding D, Guo G, Cui L, Jia G, Wang X, Zhang M, Tian S, Zheng L, Liu Y, Hu Y, Xuan G, Yang J, Yang C, Sun R, Deng J, Guo C, Chen Y, Shang Y, Han Y.
In-Text Gene Mentions

…, IgG4-associated cholangitis,hemochromatosis, and drug liver…

Show Full Abstract

<h4>Background</h4>The role of liver stiffness measurements (LSM) in patients with primary biliary cholangitis (PBC) remains to be further elucidated.<h4>Aims</h4>To clarify the prognostic role of LSM and to validate the "novel concepts" proposed by the Baveno VII Working Group.<h4>Methods</h4>An analysis of the prognostic significance of LSM was performed involving 672 patients.<h4>Results</h4>LSM and ΔLSM/ΔT were independent risk factors for liver decompensation, liver transplantation, or liver-related death (primary outcomes, p < 0.001, both). A rule of 5 kPa for LSM (10-15-20 kPa) could be used to denote progressively higher relative risks of primary outcomes. Patients with LSM < 10 kPa have a negligible 3-year risk of primary outcomes (< 1%). Cut-off values of 10 and 15 kPa can be used to classify PBC patients into low-, medium-, and high-risk groups. A clinically significant decrease in LSM, evaluated at 6, 12, or 24 months elastography tests, was associated with a substantially reduced risk of primary outcomes (p < 0.05, all), which can be defined as a decrease in LSM of >  - 20% associated with LSM < 20 kPa or any decrease to LSM < 10 kPa. A clinically significant increase in LSM, evaluated at 6, 12, or 24 months elastography tests, was associated with a substantially raised risk of primary outcomes (p < 0.05, all), which can be defined as an increase in LSM of ≥  + 20% or any increase to LSM ≥ 15 kPa.<h4>Conclusions</h4>LSM can be used to monitor disease progression and predict long-term prognosis in patients with PBC.

Also flagged:zoonotic infectionsinfectionanxietydepressionzoonotic diseasesanaemia
Journal Article 2023-09-19 No Snippets Mateo M, Montoya A, Bailo B, Köster PC, Dashti A, Hernández-Castro C, Saugar JM, Matas P, Xiao L, Carmena D.
Show Full Abstract

<h4>Background</h4>Pet dogs and cats exert an unquestionable beneficial effect in the well-being of their owners, but can also act as a source of zoonotic infections if improperly cared.<h4>Objectives</h4>We investigated the occurrence, risk factors, genetic variability and zoonotic potential of intestinal parasites in dogs and cats attended in a clinical veterinary setting in Spain.<h4>Methods</h4>Canine (n = 252) and feline (n = 35) faecal samples were collected during 2017-2019 and analysed by coproparasitological methods. A rapid lateral immunochromatographic test (ICT) was used for detecting Giardia duodenalis and Cryptosporidium sp. Samples positive at microscopy examination and/or ICT were reassessed by molecular methods.<h4>Results</h4>Overall, 48.8% (123/252) of dogs and 48.6% (17/35) of cats were infected by enteric parasites. In dogs, G. duodenalis was the most prevalent species (40.9%), followed by Cystoisospora sp. (7.1%), and Toxocara canis (5.2%). In cats, Joyeuxiella sp. and Toxocara cati were the dominant species (20.0% each), followed by G. duodenalis (14.3%), D. caninum (5.7%) and Cystoisospora felis and Toxascaris leonina (2.9% each). Pups and kittens were more likely to harbour intestinal parasites and develop clinical signs. Sequence analyses of dog isolates revealed the presence of assemblages A (n = 1), C (n = 4), D (n = 4) and C+D (n = 1) within G. duodenalis; C. parvum (n = 1) and C. canis (n = 4) within Cryptosporidium and PtEb IX (n = 1) in Enterocytozoon bieneusi. A novel C. canis subtype family, named XXi, is reported.<h4>Conclusions</h4>Our results highlight that (i) well-cared dogs carry zoonotic enteric protozoan parasites of public health relevance, (ii) proper hygiene practices and routine veterinary treatment are essential to prevent zoonotic infections, (iii) vulnerable populations should avoid contact with pups/kittens with diarrhoea and (iv) infected dogs might be major contributors to the environmental contamination with soil-transmitted helminths (STHs) eggs.

Also flagged:translation initiationimmune responsemitochondrialembryogenesisnucleotidespiwi
Journal Article 2023-09-19 No Snippets Wang P, Paquet ÉR, Robert C.
Show Full Abstract

Long non-coding RNAs (lncRNAs) have been the subject of numerous studies over the past decade. First thought to come from aberrant transcriptional events, lncRNAs are now considered a crucial component of the genome with roles in multiple cellular functions. However, the functional annotation and characterization of bovine lncRNAs during early development remain limited. In this comprehensive analysis, we review lncRNAs expression in bovine ovarian follicles and early embryos, based on a unique database comprising 468 microarray hybridizations from a single platform designed to target 7,724 lncRNA transcripts, of which 5,272 are intergenic (lincRNA), 958 are intronic, and 1,524 are antisense (lncNAT). Compared to translated mRNA, lncRNAs have been shown to be more tissue-specific and expressed in low copy numbers. This analysis revealed that protein-coding genes and lncRNAs are both expressed more in oocytes. Differences between the oocyte and the 2-cell embryo are also more apparent in terms of lncRNAs than mRNAs. Co-expression network analysis using WGCNA generated 25 modules with differing proportions of lncRNAs. The modules exhibiting a higher proportion of lncRNAs were found to be associated with fewer annotated mRNAs and housekeeping functions. Functional annotation of co-expressed mRNAs allowed attribution of lncRNAs to a wide array of key cellular events such as meiosis, translation initiation, immune response, and mitochondrial related functions. We thus provide evidence that lncRNAs play diverse physiological roles that are tissue-specific and associated with key cellular functions alongside mRNAs in bovine ovarian follicles and early embryos. This contributes to add lncRNAs as active molecules in the complex regulatory networks driving folliculogenesis, oogenesis and early embryogenesis all of which are necessary for reproductive success.

Also flagged:gene expressiongenetic disordersHemophilianeurological diseasespoly-Q diseasescancers
Journal Article 2023-09-19 No Snippets Liao X, Zhu W, Zhou J, Li H, Xu X, Zhang B, Gao X.
Show Full Abstract

Repetitive DNA sequences playing critical roles in driving evolution, inducing variation, and regulating gene expression. In this review, we summarized the definition, arrangement, and structural characteristics of repeats. Besides, we introduced diverse biological functions of repeats and reviewed existing methods for automatic repeat detection, classification, and masking. Finally, we analyzed the type, structure, and regulation of repeats in the human genome and their role in the induction of complex diseases. We believe that this review will facilitate a comprehensive understanding of repeats and provide guidance for repeat annotation and in-depth exploration of its association with human diseases.

Also flagged:ethanolphenolsflavonoidsanthocyaninschromosomescaffold proteins
Journal Article 2023-09-19 No Snippets Villani V, Di Marco G, Iacovelli F, Pietrucci D, Canini A, Gismondi A.
Show Full Abstract

Malva sylvestris L. (common mallow) is a plant species widely used in phytotherapy and ethnobotanical practices since time immemorial. Characterizing the components of this herb might promote a better comprehension of its biological effects on the human body but also favour the identification of the molecular processes that occur in the plant tissues. Thus, in the present contribution, the scientific knowledge about the metabolomic profile of the common mallow was expanded. In particular, the phytocomplex of leaves and flowers from this botanical species and the extraction capacity of different concentrations of ethanol (i.e., 95%, 70%, 50%, and 0%; v/v in ddH<sub>2</sub>O) for it were investigated by spectrophotometric and chromatographic approaches. In detail, 95% ethanol extracts showed the worst capacity in isolating total phenols and flavonoids, while all the hydroalcoholic samples revealed a specific ability in purifying the anthocyanins. HPLC-DAD system detected and quantified 20 phenolic secondary metabolites, whose concentration in the several extracts depended on their own chemical nature and the percentage of ethanol used in the preparation. In addition, the stability of the purified phytochemicals after resuspension in pure ddH<sub>2</sub>O was also proved, considering a potential employment of them in biological/medical studies which include in vitro and in vivo experiments on mammalian models. Here, for the first time, the expressed miRNome in M. sylvestris was also defined by Next Generation Sequencing, revealing the presence of 33 microRNAs (miRNAs), 10 typical for leaves and 2 for flowers. Then, both plant and human putative mRNA targets for the detected miRNAs were predicted by bioinformatics analyses, with the aim to clarify the possible role of these small nucleic acids in the common mallow plant tissues and to try to understand if they could exert a potential cross-kingdom regulatory activity on the human health. Surprisingly, our investigations revealed that 19 miRNAs out of 33 were putatively able to modulate, in the plant cells, the expression of various chromosome scaffold proteins. In parallel, we found, in the human transcriptome, a total of 383 mRNAs involved in 5 fundamental mammalian cellular processes (i.e., apoptosis, senescence, cell-cycle, oxidative stress, and invasiveness) that theoretically could be bound and regulated by M. sylvestris miRNAs. The evidence collected in this work would suggest that the beneficial properties of the use of M. sylvestris, documented by the folk medicine, are probably linked to their content of miRNAs and not only to the action of phytochemicals (e.g., anthocyanins). This would open new perspectives about the possibility to develop gene therapies based on miRNAs isolated from medicinal plants, including M. sylvestris.

ZNF644
Also flagged:Apolipoprotein E receptor 2Apoer2very-low density lipoprotein receptorVldlrmembrane proteinsReelin
Journal Article 2023-09-19 ✓ 1 Snippet Wasser CR, Werthmann GC, Hall EM, Kuhbandner K, Wong CH, Durakoglugil MS, Herz J.
In-Text Gene Mentions

…KDM4B, ND6, RALGAPA2,ZNF644), 4 were common…

Show Full Abstract

<h4>Background</h4>ApoE4, the most significant genetic risk factor for late-onset Alzheimer's disease (AD), sequesters a pro-synaptogenic Reelin receptor, Apoer2, in the endosomal compartment and prevents its normal recycling. In the adult brain, Reelin potentiates excitatory synapses and thereby protects against amyloid-β toxicity. Recently, a gain-of-function mutation in Reelin that is protective against early-onset AD has been described. Alternative splicing of the Apoer2 intracellular domain (Apoer2-ICD) regulates Apoer2 signaling. Splicing of juxtamembraneous exon 16 alters the γ-secretase mediated release of the Apoer2-ICD as well as synapse number and LTP, and inclusion of exon 19 ameliorates behavioral deficits in an AD mouse model. The Apoer2-ICD has also been shown to alter transcription of synaptic genes. However, the role of Apoer2-ICD release upon transcriptional regulation and its role in AD pathogenesis is unknown.<h4>Methods</h4>To assess in vivo mRNA-primed ribosomes specifically in hippocampi transduced with Apoer2-ICD splice variants, we crossed wild-type, cKO, and Apoer2 cleavage-resistant mice to a Cre-inducible translating ribosome affinity purification (TRAP) model. This allowed us to perform RNA-Seq on ribosome-loaded mRNA harvested specifically from hippocampal cells transduced with Apoer2-ICDs.<h4>Results</h4>Across all conditions, we observed ~4,700 altered translating transcripts, several of which comprise key synaptic components such as extracellular matrix and focal adhesions with concomitant perturbation of critical signaling cascades, energy metabolism, translation, and apoptosis. We further demonstrated the ability of the Apoer2-ICD to rescue many of these altered transcripts, underscoring the importance of Apoer2 splicing in synaptic homeostasis. A variety of these altered genes have been implicated in AD, demonstrating how dysregulated Apoer2 splicing may contribute to neurodegeneration.<h4>Conclusions</h4>Our findings demonstrate how alternative splicing of the APOE and Reelin receptor Apoer2 and release of the Apoer2-ICD regulates numerous translating transcripts in mouse hippocampi in vivo. These transcripts comprise a wide range of functions, and alterations in these transcripts suggest a mechanistic basis for the synaptic deficits seen in Apoer2 mutant mice and AD patients. Our findings, together with the recently reported AD-protective effects of a Reelin gain-of-function mutation in the presence of an early-onset AD mutation in Presenilin-1, implicate the Reelin/Apoer2 pathway as a target for AD therapeutics.

HTT
Also flagged:sugarpolysaccharidesphenolic compoundsphytoestrogensflavonoidsisoflavonoids
Journal Article 2023-09-19 ✓ 2 Snippets Thabit S, Handoussa H, ElSayed NS, Breitinger HG, Breitinger U, Wink M.
In-Text Gene Mentions

…HA759 strain expressingHtt-Q150 within ASH neurons.…

Htt-Q150is a human…

Show Full Abstract

<h4>Background</h4>Despite its widespread uses in Chinese and European medicine, Styphnolobium japonicum (Chinese scholar tree, formerly Sophora japonicum) has not been extensively investigated for its potential to protect against neurodegenerative processes and to promote resistance to oxidative stress. In this study, we evaluated the neuroprotective activities of a hydroalcoholic extract from Chinese scholar tree fruits that could be possibly linked to its antioxidant properties using Caenorhabditis elegans as a well-established in vivo model.<h4>Methods</h4>Survival rate in mutant daf-16 and skn-1 worms, stressed by the pro-oxidant juglone and treated with the extract, was tested. Localization of the transcription factors SKN-1 and DAF-16, and expression of gst-4 were measured. For evaluation of neuroprotective effects, formation of polyglutamine (polyQ40) clusters, α-synuclein aggregates, loss of amphid sensilla (ASH) neuronal function, and amyloid β (Aβ) accumulation (as markers for Huntington's, Parkinson's, and Alzheimer's) was examined.<h4>Results</h4>The extract, which contains substantial amounts of phenolic phytochemicals, showed an increase in the survival rate of worms challenged with juglone in daf-16 mutants but not in skn-1 mutants. The transcription factor SKN-1 was activated by the extract, while DAF-16 was not affected. Upon application of the extract, a significant decline in GST-4 levels, polyQ40 cluster formation, number of lost ASH sensory neurons, α-synuclein aggregation, and paralysis resulting from Aβ accumulation was observed.<h4>Conclusions</h4>Styphnolobium japonicum fruit extract activated the SKN-1/Nrf2 pathway, resulting in oxidative stress resistance. It revealed promising pharmacological activities towards treatment of Huntington's, Parkinson's, and Alzheimer's diseases. Polyphenolics from Styphnolobium japonicum may be a promising route towards treatment of CNS disorders, but need to be tested in other in vivo systems.

HTT
Also flagged:HDdementiabehaviouralpolyglutamineproteolysiscytoplasmic
Journal Article 2023-09-19 ✓ 5 Snippets Li SH, Colson TL, Chen J, Abd-Elrahman KS, Ferguson SSG.
In-Text Gene Mentions

HD is caused by the expansion of a polyglutamine (CAG) repeat in the N-terminal region of the huntingtin (Htt) protein [3].

Mutant Htt with this expanded polyglutamine tract has been shown to be targeted for proteolysis and the cleavage of Htt at the N-terminus results in the formation of cytoplasmic and intranuclear aggregates that strongly correlate with HD symptoms and severity [4].

Huntington’s Disease (HD) is an inherited autosomal dominant neurodegenerative disorder that leads to progressive motor and cognitive impairment due to the expansion of a polyglutamine (CAG) repeat in the N-terminal region of the huntingtin (Htt) protein.

zQ175 mouse is a knock-in mouse model of HD that expresses a chimeric Htt protein containing exon 1 of mutated human Htt with roughly 188 CAG repeats.

These improvements are achieved by changing the background strain from C57BL/6 to FVB/N and removing the floxed neomycin resistance gene (Neo) upstream of the Htt locus, which increased the animal’s susceptibility to neurodegeneration and elevates mutant Htt protein levels in the brain [9].

Show Full Abstract

Huntington's Disease (HD) is an inherited autosomal dominant neurodegenerative disorder that leads to progressive motor and cognitive impairment due to the expansion of a polyglutamine (CAG) repeat in the N-terminal region of the huntingtin (Htt) protein. The creation of HD mouse models represents a critical step in the research for HD treatment. Among the currently available HD mouse models, the zQ175 knock-in mouse line is the first to display robust disease phenotype on a heterozygous background. The newer FDNQ175 mouse model is derived from the zQ175 mouse line and presents a more aggressive phenotype. Moreover, increasing evidence has implicated sex as a contributing factor in the progression of HD symptoms. Here, we compared the progression of HD phenotypes in male and female heterozygous FDNQ175 mice. We found that both male and female heterozygous mice showed deficits in forelimb grip strength and cognition as early as 6 months of age. However, female FDNQ175 mice were less vulnerable to HD-associated decline in limb coordination and movement. Neither male nor female FDNQ175 mice exhibited reduced locomotor activity in the open field or exhibit consistent differences in anxiety at 6-12 months of age. Both male and female FDNQ175 mice exhibited increased numbers of huntingtin aggregates with age and 8-month-old female FDNQ175 mice had significantly more aggregates than their male counterparts. Taken together, our results provide further evidence that sex can influence the progression of HD phenotype in preclinical animal models and must be taken into consideration for future HD research.

DCC
Also flagged:cell proliferationgraft-versus-host diseaseGVHDsecretionpro-inflammatory cytokinesCD3
Journal Article 2023-09-19 ✓ 1 Snippet Neo SH, Her Z, Othman R, Tee CA, Ong LC, Wang Y, Tan I, Tan J, Yang Y, Yang Z, Chen Q, Boyer LA.
In-Text Gene Mentions

…genes ( ST8SIA2,DCC, PHLDA1-AS1, TAGLN3, SPP1,…

Show Full Abstract

<h4>Background</h4>Mesenchymal stromal cells (MSCs) have broad potential as a cell therapy including for the treatment of drug-resistant inflammatory conditions with abnormal T cell proliferation such as graft-versus-host disease (GVHD). Clinical success, however, has been complicated by the heterogeneity of culture-expanded MSCs as well as donor variability. Here, we devise culture conditions that promote expansion of MSCs with enhanced immunomodulatory functions both in vitro and in animal models of GVHD.<h4>Methods</h4>Human bone marrow-derived MSCs were expanded at high-confluency (MSC<sub>HC</sub>) and low-confluency state (MSC<sub>LC</sub>). Their immunomodulatory properties were evaluated with in vitro co-culture assays based on suppression of activated T cell proliferation and secretion of pro-inflammatory cytokines from activated T cells. Metabolic state of these cells was determined, while RNA sequencing was performed to explore transcriptome of these MSCs. Ex vivo expanded MSC<sub>HC</sub> or MSC<sub>LC</sub> was injected into human peripheral blood mononuclear cells (PBMC)-induced GVHD mouse model to determine their in vivo therapeutic efficacy based on clinical grade scoring, human CD45<sup>+</sup> blood count and histopathological examination.<h4>Results</h4>As compared to MSC<sub>LC</sub>, MSC<sub>HC</sub> significantly reduced both the proliferation of anti-CD3/CD28-activated T cells and secretion of pro-inflammatory cytokines upon MSC<sub>HC</sub> co-culture across several donors even in the absence of cytokine priming. Mechanistically, metabolic analysis of MSC<sub>HC</sub> prior to co-culture with activated T cells showed increased glycolytic metabolism and lactate secretion compared to MSC<sub>LC</sub>, consistent with their ability to inhibit T cell proliferation. Transcriptome analysis further revealed differential expression of immunomodulatory genes including TRIM29, BPIFB4, MMP3 and SPP1 in MSC<sub>HC</sub> as well as enriched pathways including cytokine-cytokine receptor interactions, cell adhesion and PI3K-AKT signalling<sub>.</sub> Lastly, we demonstrate in a human PBMC-induced GVHD mouse model that delivery of MSC<sub>HC</sub> showed greater suppression of inflammation and improved outcomes compared to MSC<sub>LC</sub> and saline controls.<h4>Conclusion</h4>Our study provides evidence that ex vivo expansion of MSCs at high confluency alters the metabolic and transcriptomic states of these cells. Importantly, this approach maximizes the production of MSCs with enhanced immunomodulatory functions without priming, thus providing a non-invasive and generalizable strategy for improving the use of MSCs for the treatment of inflammatory diseases.

HFE
Also flagged:hepatocellular carcinomamalignant tumorNon-alcoholic fatty liver diseasemetabolic-associated fatty liver diseasealcoholic liver diseaseautoimmune hepatitis
Journal Article 2023-09-19 ✓ 2 Snippets Panneerselvam S, Wilson C, Kumar P, Abirami D, Pamarthi J, Reddy MS, Varghese J.
In-Text Gene Mentions

The HFE gene mutation leads to iron overload and the progression of HCC [162].

…oxication, genetic disorders (hemochromatosis) and metabolic disorders…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the seventh most highly prevalent malignant tumor globally and the second most common cause of mortality. HCC develops with complex pathways that occur through multistage biological processes. Non-alcoholic fatty liver disease, metabolic-associated fatty liver disease, alcoholic liver disease, autoimmune hepatitis, hepatitis B, and hepatitis C are the causative etiologies of HCC. HCC develops as a result of epigenetic changes, protein-coding gene mutations, and altered signaling pathways. Biomarkers and potential therapeutic targets for HCC open up new possibilities for treating the disease. Immune checkpoint inhibitors are included in the treatment options in combination with molecular targeted therapy.

SOX6
Also flagged:methylationmechanotransductioncell divisionactinswound healingcancer
Journal Article 2023-09-19 ✓ 1 Snippet Park SM, Lee JH, Ahn KS, Shim HW, Yoon JY, Hyun J, Lee JH, Jang S, Yoo KH, Jang YK, Kim TJ, Kim HK, Lee MR, Jang JH, Shim H, Kim HW.
In-Text Gene Mentions

…genes (Atrx, Chd5,Sox6, and Rasl11a) increased,…

Show Full Abstract

Advancing the technologies for cellular reprogramming with high efficiency has significant impact on regenerative therapy, disease modeling, and drug discovery. Biophysical cues can tune the cell fate, yet the precise role of external physical forces during reprogramming remains elusive. Here the authors show that temporal cyclic-stretching of fibroblasts significantly enhances the efficiency of induced pluripotent stem cell (iPSC) production. Generated iPSCs are proven to express pluripotency markers and exhibit in vivo functionality. Bulk RNA-sequencing reveales that cyclic-stretching enhances biological characteristics required for pluripotency acquisition, including increased cell division and mesenchymal-epithelial transition. Of note, cyclic-stretching activates key mechanosensitive molecules (integrins, perinuclear actins, nesprin-2, and YAP), across the cytoskeletal-to-nuclear space. Furthermore, stretch-mediated cytoskeletal-nuclear mechano-coupling leads to altered epigenetic modifications, mainly downregulation in H3K9 methylation, and its global gene occupancy change, as revealed by genome-wide ChIP-sequencing and pharmacological inhibition tests. Single cell RNA-sequencing further identifies subcluster of mechano-responsive iPSCs and key epigenetic modifier in stretched cells. Collectively, cyclic-stretching activates iPSC reprogramming through mechanotransduction process and epigenetic changes accompanied by altered occupancy of mechanosensitive genes. This study highlights the strong link between external physical forces with subsequent mechanotransduction process and the epigenetic changes with expression of related genes in cellular reprogramming, holding substantial implications in the field of cell biology, tissue engineering, and regenerative medicine.

Also flagged:NCOA5Nonalcoholic Steatohepatitistype 2 diabetesnonalcoholic fatty liver diseaseNAFLDinsulin resistance
Journal Article 2023-09-19 No Snippets Zhang Y, Luo Y, Liu X, Kiupel M, Li A, Wang H, Mi QS, Xiao H.
Show Full Abstract

<h4>Background & aims</h4>The nuclear receptor coactivator 5 (NCOA5) is a putative type 2 diabetes susceptibility gene. NCOA5 haploinsufficiency results in the spontaneous development of nonalcoholic fatty liver disease (NAFLD), insulin resistance, and hepatocellular carcinoma (HCC) in male mice; however, the cell-specific effect of NCOA5 haploinsufficiency in various types of cells, including macrophages, on the development of NAFLD and HCC remains unknown.<h4>Methods</h4>Control and myeloid-lineage-specific Ncoa5 deletion (Ncoa5<sup>ΔM/+</sup>) mice fed a normal diet were examined for the development of NAFLD, nonalcoholic steatohepatitis (NASH), and HCC. Altered genes and signaling pathways in the intrahepatic macrophages of Ncoa5<sup>ΔM/+</sup> male mice were analyzed and compared with those of obese human individuals. The role of platelet factor 4 (PF4) in macrophages and the underlying mechanism by which PF4 affects NAFLD/NASH were explored in vitro and in vivo. PF4 expression in HCC patient specimens and prognosis was examined.<h4>Results</h4>Myeloid-lineage-specific Ncoa5 deletion sufficiently causes spontaneous NASH and HCC development in male mice fed a normal diet. PF4 overexpression in Ncoa5<sup>ΔM/+</sup> intrahepatic macrophages is identified as a potent mediator to trigger lipid accumulation in hepatocytes by inducing lipogenesis-promoting gene expression. The transcriptome of intrahepatic macrophages from Ncoa5<sup>ΔM/+</sup> male mice resembles that of obese human individuals. High PF4 expression correlated with poor prognosis of HCC patients and increased infiltrations of M2 macrophages, regulatory T cells, and myeloid-derived suppressor cells in HCCs.<h4>Conclusions</h4>Our findings reveal a novel mechanism for the onset of NAFLD/NASH and HCC initiated by NCOA5-deficient macrophages, suggesting the NCOA5-PF4 axis in macrophages as a potential target for developing preventive and therapeutic interventions against NAFLD/NASH and HCC.

HTT
Also flagged:ubiquitinproteasomeprotein misfolding diseasesneurodegenerative diseasesendoplasmic reticulumorganelle
Journal Article 2023-09-19 ✓ 2 Snippets Kandel R, Jung J, Neal S.
In-Text Gene Mentions

…Huntingtin protein (103QHttexon 1) quickly…

…a GFP-tagged polyQHttvariant (HttQ150GFP) in…

Show Full Abstract

The ubiquitin proteasome system maintains protein homeostasis by regulating the breakdown of misfolded proteins, thereby preventing misfolded protein aggregates. The efficient elimination is vital for preventing damage to the cell by misfolded proteins, known as proteotoxic stress. Proteotoxic stress can lead to the collapse of protein homeostasis and can alter the function of the ubiquitin proteasome system. Conversely, impairment of the ubiquitin proteasome system can also cause proteotoxic stress and disrupt protein homeostasis. This review examines two impacts of proteotoxic stress, 1) disruptions to ubiquitin homeostasis (ubiquitin stress) and 2) disruptions to proteasome homeostasis (proteasome stress). Here, we provide a mechanistic description of the relationship between proteotoxic stress and the ubiquitin proteasome system. This relationship is illustrated by findings from several protein misfolding diseases, mainly neurodegenerative diseases, as well as from basic biology discoveries from yeast to mammals. In addition, we explore the importance of the ubiquitin proteasome system in endoplasmic reticulum quality control, and how proteotoxic stress at this organelle is alleviated. Finally, we highlight how cells utilize the ubiquitin proteasome system to adapt to proteotoxic stress and how the ubiquitin proteasome system can be genetically and pharmacologically manipulated to maintain protein homeostasis.

HFE
Also flagged:non-alcoholic fatty liver diseaseNAFLDADchronic plaque psoriasismelanoma in situmelanoma
Journal Article 2023-09-19 ✓ 1 Snippet Maurelli M, Gisondi P, Bellinato F, Mantovani A, Targher G, Girolomoni G.
In-Text Gene Mentions

…viral hepatitis, andhemochromatosiswere considered exclusion…

Show Full Abstract

<h4>Background</h4>There are no published studies on the prevalence of non-alcoholic fatty liver disease (NAFLD) in patients with atopic dermatitis (AD).<h4>Objectives</h4>To estimate the prevalence of NAFLD (assessed via liver ultrasonography) in adults with moderate-to-severe AD.<h4>Methods</h4>We performed a retrospective, cross-sectional, observational study including adult patients affected by moderate-to-severe AD, moderate-to-severe chronic plaque psoriasis, or a previous diagnosis of thin melanoma in situ (considered as the control group) who attended the Verona University Hospital between January 2022 and April 2023. Fatty liver was assessed via liver ultrasonography.<h4>Results</h4>A total of 144 adults with AD, 466 with chronic plaque psoriasis, and 99 with thin melanoma were included. The prevalence rates of ultrasound-detected NAFLD among patients with in situ melanoma, those with moderate-to-severe AD, and those with moderate-to-severe chronic plaque psoriasis were 23.2% (23 out of 99), 24.1% (36 out of 144), and 49.8% (228 out of 466), respectively (<i>p</i> < 0.01). Logistic regression analysis revealed that being of male sex, a higher age, a higher body mass index, and psoriasis were independently associated with NAFLD, whereas AD was not.<h4>Conclusions</h4>Our findings show that the prevalence of ultrasound-detected NAFLD in patients with moderate-to-severe AD was comparable to that of patients with a previous diagnosis of in situ melanoma. It is plausible to hypothesize that the Th2-type inflammation typically characterizing AD is not a risk factor for NAFLD. Patients with moderate-to-severe psoriasis, but not those with AD, should be screened for NAFLD and other metabolic comorbidities.

Also flagged:Amyotrophic Lateral SclerosisALSC9ORF72Frontotemporal Dementiahexanucleotideneurodegenerative disorders
Journal Article 2023-09-19 No Snippets Kortazar-Zubizarreta I, Manero-Azua A, Afonso-Agüera J, Perez de Nanclares G.
Show Full Abstract

The expanded GGGGCC hexanucleotide repeat (HRE) in the non-coding region of the <i>C9ORF72</i> gene (C9ORF72-HRE) is the most common genetic cause of familial forms of amyotrophic lateral sclerosis (ALS), FTD, and concurrent ALS and FTD (ALS-FTD), in addition to contributing to the sporadic forms of these diseases. Both syndromes overlap not only genetically, but also sharing similar clinical and neuropathological findings, being considered as a spectrum. In this paper we describe the clinical-genetic findings in a Basque family with different manifestations within the spectrum, our difficulties in reaching the diagnosis, and a narrative review, carried out as a consequence, of the main features associated with C9ORF72-HRE. Family members underwent a detailed clinical assessment, neurological examination, and genetic analysis by repeat-primed PCR. We studied 10 relatives of a symptomatic carrier of the C9ORF72-HRE expansion. Two of them presented the expansion in the pathological range, one of them was symptomatic whereas the other one remained asymptomatic at 72 years. Given the great intrafamilial clinical variability of C9ORF72-HRE, the characterization of patients and family members with particular clinical and genetic subgroups within ALS and FTD becomes a bottleneck for medication development, in particular for genetically focused medicines for ALS and FTD.

Also flagged:pathologiesperiodontitisbone resorptioncariesskeletal diseasestumors
Journal Article 2023-09-19 No Snippets Mishchenko O, Yanovska A, Kosinov O, Maksymov D, Moskalenko R, Ramanavicius A, Pogorielov M.
Show Full Abstract

Synthetic bone grafting materials play a significant role in various medical applications involving bone regeneration and repair. Their ability to mimic the properties of natural bone and promote the healing process has contributed to their growing relevance. While calcium-phosphates and their composites with various polymers and biopolymers are widely used in clinical and experimental research, the diverse range of available polymer-based materials poses challenges in selecting the most suitable grafts for successful bone repair. This review aims to address the fundamental issues of bone biology and regeneration while providing a clear perspective on the principles guiding the development of synthetic materials. In this study, we delve into the basic principles underlying the creation of synthetic bone composites and explore the mechanisms of formation for biologically important complexes and structures associated with the various constituent parts of these materials. Additionally, we offer comprehensive information on the application of biologically active substances to enhance the properties and bioactivity of synthetic bone grafting materials. By presenting these insights, our review enables a deeper understanding of the regeneration processes facilitated by the application of synthetic bone composites.

Also flagged:cancermetabolic disordersinfectious diseaseinfectioninfectionsinfectious diseases
Journal Article 2023-09-19 No Snippets Srivastava K, Pandit B.
Show Full Abstract

Inactivation or targeted disruption of a gene provides clues to assess the function of the gene in many cellular processes. Knockdown or knocking out a gene has been widely used for this purpose. However, recently CRISPR mediated genome editing has taken over the knockout/knockdown system with more precision. CRISPR technique has enabled us to perform targeted mutagenesis or genome editing to address questions in fundamental biology to biomedical research. Its application is wide in understanding the role of genes in the disease process, and response to therapy in cancer, metabolic disorders, or infectious disease. In this article, we have focused on infectious disease and how genome-wide CRISPR screens have enabled us to identify host factors involved in the process of infection. Understanding the biology of the host-pathogen interaction is of immense importance in planning host-directed therapy to improve better management of the disease. Genome-wide CRISPR screens provide strong mechanistic ways to identify the host dependency factors involved in various infections. We presented insights into genome-wide CRISPR screens conducted in the context of infectious diseases both viral and bacterial that led to better understanding of host-pathogen interactions and immune networks. We have discussed the advancement of knowledge pertaining to influenza virus, different hepatitis viruses, HIV, most recent SARS CoV2 and few more. Among bacterial diseases, we have focused on infection with life threatening <i>Mycobacteria</i>, <i>Salmonella</i>, <i>S</i>. <i>aureus</i>, etc. It appears that the CRISPR technique can be applied universally to multiple infectious disease models to unravel the role of known or novel host factors.

B4GALT5
Also flagged:immune responseinfectionsCOVID-19pathogenesisdirectedviral infections
Journal Article 2023-09-19 ✓ 2 Snippets Ivanov SM, Tarasova OA, Poroikov VV.
In-Text Gene Mentions

We found no genes that were up- or down-regulated by all nine or eight viral infections, and there were only four genes (B4GALT5, CEBPD, H2AC8, PLAUR) differentially regulated in seven viral infections, whereas direction of changes of their expression (up- or down-regulation) depended from particular infection (see Table S2).

…only four genes (B4GALT5, CEBPD, H2AC8, PLAUR)…

Show Full Abstract

<h4>Introduction</h4>There are difficulties in creating direct antiviral drugs for all viruses, including new, suddenly arising infections, such as COVID-19. Therefore, pathogenesis-directed therapy is often necessary to treat severe viral infections and comorbidities associated with them. Despite significant differences in the etiopathogenesis of viral diseases, in general, they are associated with significant dysfunction of the immune system. Study of common mechanisms of immune dysfunction caused by different viral infections can help develop novel therapeutic strategies to combat infections and associated comorbidities.<h4>Methods</h4>To identify common mechanisms of immune functions disruption during infection by nine different viruses (cytomegalovirus, Ebstein-Barr virus, human T-cell leukemia virus type 1, Hepatitis B and C viruses, human immunodeficiency virus, Dengue virus, SARS-CoV, and SARS-CoV-2), we analyzed the corresponding transcription profiles from peripheral blood mononuclear cells (PBMC) using the originally developed pipeline that include transcriptome data collection, processing, normalization, analysis and search for master regulators of several viral infections. The ten datasets containing transcription data from patients infected by nine viruses and healthy people were obtained from Gene Expression Omnibus. The analysis of the data was performed by Genome Enhancer pipeline.<h4>Results</h4>We revealed common pathways, cellular processes, and master regulators for studied viral infections. We found that all nine viral infections cause immune activation, exhaustion, cell proliferation disruption, and increased susceptibility to apoptosis. Using network analysis, we identified PBMC receptors, representing proteins at the top of signaling pathways that may be responsible for the observed transcriptional changes and maintain the current functional state of cells.<h4>Discussion</h4>The identified relationships between some of them and virus-induced alteration of immune functions are new and have not been found earlier, e.g., receptors for autocrine motility factor, insulin, prolactin, angiotensin II, and immunoglobulin epsilon. Modulation of the identified receptors can be investigated as one of therapeutic strategies for the treatment of severe viral infections.

Also flagged:Hsp70heat shock proteinsneurodegenerative diseasesbrainamyotrophic lateral sclerosisALS
Journal Article 2023-09-19 No Snippets Venediktov AA, Bushueva OY, Kudryavtseva VA, Kuzmin EA, Moiseeva AV, Baldycheva A, Meglinski I, Piavchenko GA.
Show Full Abstract

Our review seeks to elucidate the current state-of-the-art in studies of 70-kilodalton-weighed heat shock proteins (Hsp70) in neurodegenerative diseases (NDs). The family has already been shown to play a crucial role in pathological aggregation for a wide spectrum of brain pathologies. However, a slender boundary between a big body of fundamental data and its implementation has only recently been crossed. Currently, we are witnessing an anticipated advancement in the domain with dozens of studies published every month. In this review, we briefly summarize scattered results regarding the role of Hsp70 in the most common NDs including Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS). We also bridge translational studies and clinical trials to portray the output for medical practice. Available options to regulate Hsp70 activity in NDs are outlined, too.

SERPINC1
Also flagged:lactatemetabolismclear cell renal cell carcinomacancerccRCCmethylation
Journal Article 2023-09-19 ✓ 2 Snippets Li X, Du G, Li L, Peng K.
In-Text Gene Mentions

Further, we examined the promoter methylation levels of DELMRGs and found that several genes (such as OAS2, KALRN, SLC16A7, PER2) had significantly lower methylation levels in tumor samples, while several genes (SLC6A3, CDO1, and SERPINC1) were significantly higher methylated (Figure 2C).

…(SLC6A3, CDO1, andSERPINC1) were significantly higher…

Show Full Abstract

<h4>Background</h4>Although lactate metabolism-related genes (LMRGs) have attracted attention for their effects on cancer immunity, little is known about their function in clear cell renal cell carcinoma (ccRCC). The aim of this study was to examine the cellular specificity of lactate metabolism and how it affected the first-line treatment outcomes in ccRCC.<h4>Methods</h4>GSE159115 was used to examine the features of lactate metabolism at the single-cell level. Utilizing the transcriptome, methylation profile, and genomic data from TCGA-KIRC, a multi-omics study of LMRG expression characteristics was performed. A prognostic index based on a gene-pair algorithm was created to assess how LMRGs affected patients' clinical outcomes. To simulate the relationship between the prognostic index and the frontline treatment, pRRophetic and Subclass Mapping were used. E-MTAB-1980, E-MTAB-3267, Checkmate, and Javelin-101 were used for external validation.<h4>Results</h4>The variable expression of some LMRGs in ccRCC can be linked to variations in DNA copy number or promoter methylation levels. Lactate metabolism was active in tumor cells and vSMCs, and LDHA, MCT1, and MCT4 were substantially expressed in tumor cells, according to single-cell analysis. The high-risk patients would benefit from immune checkpoint blockade monotherapy (ICB) and ICB plus tyrosine kinase inhibitors (TKI) therapy, whereas the low-risk individuals responded to mTOR-targeted therapy.<h4>Conclusions</h4>At the single-cell level, our investigation demonstrated the cellular specificity of lactate metabolism in ccRCC. We proposed that the lactate-related gene pair index might be utilized to identify frontline therapy responders in ccRCC patients as well as predict prognosis.

PRDX6
Also flagged:ObesityProinflammatory cytokinesendothelial-to-mesenchymal transitionsucroseTGFβTGF-β1
Journal Article 2023-09-19 ✓ 1 Snippet Chavkin NW, Vippa T, Jung C, McDonnell S, Hirschi KK, Gokce N, Walsh K.
In-Text Gene Mentions

…acid metabolism (e.g.,Prdx6, Prdx1 ,…

Show Full Abstract

<h4>Introduction</h4>Vascular dysfunction and chronic inflammation are characteristics of obesity-induced adipose tissue dysfunction. Proinflammatory cytokines can drive an endothelial-to-mesenchymal transition (EndoMT), where endothelial cells undergo a phenotypic switch to mesenchymal-like cells that are pro-inflammatory and pro-fibrotic. In this study, we sought to determine whether obesity can promote EndoMT in adipose tissue.<h4>Methods</h4>Mice in which endothelial cells are lineage-traced with eYFP were fed a high-fat/high-sucrose (HF/HS) or Control diet for 13, 26, and 52 weeks, and EndoMT was assessed in adipose tissue depots as percentage of CD45<sup>-</sup>CD31<sup>-</sup>Acta2<sup>+</sup> mesenchymal-like cells that were eYFP <sup>+</sup>. EndoMT was also assessed in human adipose endothelial cells through cell culture assays and by the analysis of single cell RNA sequencing datasets obtained from the visceral adipose tissues of obese individuals.<h4>Results</h4>Quantification by flow cytometry showed that mice fed a HF/HS diet display a time-dependent increase in EndoMT over Control diet in subcutaneous adipose tissue (+3.0%, +2.6-fold at 13 weeks; +10.6%, +3.2-fold at 26 weeks; +11.8%, +2.9-fold at 52 weeks) and visceral adipose tissue (+5.5%, +2.3-fold at 13 weeks; +20.7%, +4.3-fold at 26 weeks; +25.7%, +4.8-fold at 52 weeks). Transcriptomic analysis revealed that EndoMT cells in visceral adipose tissue have enriched expression of genes associated with inflammatory and TGFβ signaling pathways. Human adipose-derived microvascular endothelial cells cultured with TGF-β1, IFN-γ, and TNF-α exhibited a similar upregulation of EndoMT markers and induction of inflammatory response pathways. Analysis of single cell RNA sequencing datasets from visceral adipose tissue of obese patients revealed a nascent EndoMT sub-cluster of endothelial cells with reduced <i>PECAM1</i> and increased <i>ACTA2</i> expression, which was also enriched for inflammatory signaling genes and other genes associated with EndoMT.<h4>Discussion</h4>These experimental and clinical findings show that chronic obesity can accelerate EndoMT in adipose tissue. We speculate that EndoMT is a feature of adipose tissue dysfunction that contributes to local inflammation and the systemic metabolic effects of obesity..

Geographic Liver.

HFE
Also flagged:hepatic steatosismetabolic syndromeliver steatosisnonalcoholic liver diseasenonalcoholic steatohepatitisnonalcoholic fatty liver disease
Journal Article 2023-09-19 ✓ 1 Snippet Natarajan A, Daniel AR, Mangal RK, Stead TS, Ganti L.
In-Text Gene Mentions

…[ 11 ],hemochromatosis[ 12 ],…

Show Full Abstract

The authors present the case of a man with a relatively benign clinical presentation who had a computed tomography scan that revealed a "geographic liver" pattern. The radiologic appearance of hepatic steatosis, its significance, and its association with metabolic syndrome highlight the importance of this radiologic finding.

OLFM4
Also flagged:Infectioninflammatory diseaseoxygenCD74pentraxinMyD88
Journal Article 2023-09-18 ✓ 4 Snippets Balasubramanian I, Bandyopadhyay S, Flores J, Bianchi-Smak J, Lin X, Liu H, Sun S, Golovchenko NB, Liu Y, Wang D, Patel R, Joseph I, Suntornsaratoon P, Vargas J, Green PH, Bhagat G, Lagana SM, Ying W, Zhang Y, Wang Z, Li WV, Singh S, Zhou Z, Kollias G, Farr LA, Moonah SN, Yu S, Wei Z, Bonder EM, Zhang L, Kiela PR, Edelblum KL, Ferraris R, Liu TC, Gao N.
In-Text Gene Mentions

…Seurat‐based UMAP revealed three major compartments of these 13,519 PCs: PC progenitors expressing secretory precursor markers such as Lgr5 ,Olfm4, Gkn3 , etc. (…

…Both lineages started from progenitor clusters 0 and 3 (Fig 2E ), which expressOlfm4 and Lgr5(Figs 2F and EV3B ), and developed into mature cluster 1 (primarily GF) and cluster 2 (primarily exGF+B6M), respectively (Figs 2E and EV3C ).…

…as Lgr5 ,Olfm4, Gkn3 ,…

…), which expressOlfm4and Lgr5 (Figs…

Show Full Abstract

Paneth cells (PCs), a specialized secretory cell type in the small intestine, are increasingly recognized as having an essential role in host responses to microbiome and environmental stresses. Whether and how commensal and pathogenic microbes modify PC composition to modulate inflammation remain unclear. Using newly developed PC-reporter mice under conventional and gnotobiotic conditions, we determined PC transcriptomic heterogeneity in response to commensal and invasive microbes at single cell level. Infection expands the pool of CD74<sup>+</sup> PCs, whose number correlates with auto or allogeneic inflammatory disease progressions in mice. Similar correlation was found in human inflammatory disease tissues. Infection-stimulated cytokines increase production of reactive oxygen species (ROS) and expression of a PC-specific mucosal pentraxin (Mptx2) in activated PCs. A PC-specific ablation of MyD88 reduced CD74<sup>+</sup> PC population, thus ameliorating pathogen-induced systemic disease. A similar phenotype was also observed in mice lacking Mptx2. Thus, infection stimulates expansion of a PC subset that influences disease progression.

CACNA1E
Also flagged:temozolomidetumorglioblastomabrain tumorsglioblastoma multiformeGBM
Journal Article 2023-09-18 ✓ 1 Snippet Nayak R, Mallick B.
In-Text Gene Mentions

…GNG2, RUNX2, andCACNA1E) involved in AMPK,…

Show Full Abstract

Temozolomide (TMZ) is a common alkylating chemotherapeutic agent used to treat brain tumors such as glioblastoma multiforme (GBM) and anaplastic astrocytoma. GBM patients develop resistance to this drug, which has an unclear and complicated molecular mechanism. The competing endogenous RNAs (ceRNAs) play critical roles in tumorigenesis, drug resistance, and tumor recurrence in cancers. This study aims to predict ceRNAs, their possible involvement, and underlying molecular mechanisms in TMZ resistance. Therefore, we analyzed coding and non-coding RNA expression levels in TMZ-resistant GBM samples compared to sensitive GBM samples and performed pathway analysis of mRNAs differentially expressed (DE) in TMZ-resistant samples. We next applied a mathematical model on 950 DE long non-coding RNAs (lncRNAs), 116 microRNAs (miRNAs), and 7977 mRNAs and obtained 10 lncRNA-associated ceRNAs that may be regulating potential target genes involved in cancer-related pathways by sponging 25 miRNAs in TMZ-resistant GBM. Among these, two lncRNAs named ARFRP1 and RUSC2 regulate five target genes (IRS1, FOXG1, GNG2, RUNX2, and CACNA1E) involved in AMPK, AKT, mTOR, and TGF-β signaling pathways that activate or inhibit autophagy causing TMZ resistance. The novel lncRNA-associated ceRNA network predicted in GBM offers a fresh viewpoint on TMZ resistance, which might contribute to treating this malignancy.

HTT
Also flagged:Biosynthesismelatonincognitive declineHDmitochondrialAralkylamine N-acetyltransferase
Journal Article 2023-09-18 ✓ 1 Snippet Kim J, Li W, Wang J, Baranov SV, Heath BE, Jia J, Suofu Y, Baranova OV, Wang X, Larkin TM, Lariviere WR, Carlisle DL, Friedlander RM.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative brain disorder associated with uncontrolled body movements, cognitive decline, and reduced circulating melatonin levels. Melatonin is a potent antioxidant and exogenous melatonin treatment is neuroprotective in experimental HD models. In neurons, melatonin is exclusively synthesized in the mitochondrial matrix. Thus, we investigated the integrity of melatonin biosynthesis pathways in pineal and extrapineal brain areas in human HD brain samples, in the R6/2 mouse model of HD and in full-length mutant huntingtin knock-in cells. Aralkylamine N-acetyltransferase (AANAT) is the rate-limiting step enzyme in the melatonin biosynthetic pathway. We found that AANAT expression is significantly decreased in the pineal gland and the striatum of HD patients compared to normal controls. In the R6/2 mouse forebrain, AANAT protein expression was decreased in synaptosomal, but not nonsynaptosomal, mitochondria and was associated with decreased synaptosomal melatonin levels compared to wild type mice. We also demonstrate sequestration of AANAT in mutant-huntingtin protein aggregates likely resulting in decreased AANAT bioavailability. Paradoxically, AANAT mRNA expression is increased in tissues where AANAT protein expression is decreased, suggesting a potential feedback loop that is, ultimately unsuccessful. In conclusion, we demonstrate that pineal, extrapineal, and synaptosomal melatonin levels are compromised in the brains of HD patients and R6/2 mice due, at least in part, to protein aggregation.

Also flagged:agingcognitive declinealkaloidWatermitochondrialsynthesis
Journal Article 2023-09-18 No Snippets Aktar S, Ferdousi F, Kondo S, Kagawa T, Isoda H.
Show Full Abstract

In recent years, exploring natural compounds with functional properties to ameliorate aging-associated cognitive decline has become a research priority to ensure healthy aging. In the present study, we investigated the effects of Trigonelline (TG), a plant alkaloid, on memory and spatial learning in 16-week-old senescence-accelerated mouse model SAMP8 using an integrated approach for cognitive and molecular biology aspects. After 30 days of oral administration of TG at the dose of 5 mg/kg/day, the mice were trained in Morris Water Maze task. TG-treated SAMP8 mice exhibited significant improvement in the parameters of escape latency, distance moved, and annulus crossing index. Next, we performed a whole-genome transcriptome profiling of the mouse hippocampus using microarrays. Gene ontology analyses showed that a wide range of biological processes, including nervous system development, mitochondrial function, ATP synthesis, and several signaling pathways related to inflammation, autophagy, and neurotransmitter release, were significantly enriched in TG-treated SAMP8 compared to nontreated. Further, a nonlinear dimensionality reduction technique, Uniform Manifold Approximation and Projection (UMAP), was applied to identify clusters of functions that revealed TG primarily regulated pathways related to inflammation, followed by those involved in neurotransmitter release. In addition, a protein-protein interaction network analysis indicated that TG may exert its biological effects through negatively modulating Traf6-mediated NF-κB activation. Finally, ELISA test showed that TG treatment significantly decreased proinflammatory cytokines- TNFα and IL6 and increased neurotransmitters- dopamine, noradrenaline, and serotonin in mouse hippocampus. Altogether, our integrated bio-cognitive approach highlights the potential of TG in alleviating age-related memory and spatial impairment.

LRRC7
Also flagged:tumorcancertumorsimmune responsegene expressioncancers
Journal Article 2023-09-18 ✓ 3 Snippets Amgalan B, Day CP, Przytycka TM.
In-Text Gene Mentions

For PRAD, the majority of the top-ten predictors are neurogenesis genes (NTRK2 [44], LRRC7, LMX1B, ROPN1B); the others include genes involved in inflammatory response (TMEM178A) and androgen receptor regulation (PRMT5 [45]).

…[ 44 ],LRRC7, LMX1B, ROPN1B); the…

…with neurogenesis predictors (LRRC7, LMX1B, ROPN1B) in…

Show Full Abstract

There is a growing awareness that tumor-adjacent normal tissues used as control samples in cancer studies do not represent fully healthy tissues. Instead, they are intermediates between healthy tissues and tumors. The factors that contribute to the deviation of such control samples from healthy state include exposure to the tumor-promoting factors, tumor-related immune response, and other aspects of tumor microenvironment. Characterizing the relation between gene expression of tumor-adjacent control samples and tumors is fundamental for understanding roles of microenvironment in tumor initiation and progression, as well as for identification of diagnostic and prognostic biomarkers for cancers. To address the demand, we developed and validated TranNet, a computational approach that utilizes gene expression in matched control and tumor samples to study the relation between their gene expression profiles. TranNet infers a sparse weighted bipartite graph from gene expression profiles of matched control samples to tumors. The results allow us to identify predictors (potential regulators) of this transition. To our knowledge, TranNet is the first computational method to infer such dependencies. We applied TranNet to the data of several cancer types and their matched control samples from The Cancer Genome Atlas (TCGA). Many predictors identified by TranNet are genes associated with regulation by the tumor microenvironment as they are enriched in G-protein coupled receptor signaling, cell-to-cell communication, immune processes, and cell adhesion. Correspondingly, targets of inferred predictors are enriched in pathways related to tissue remodelling (including the epithelial-mesenchymal Transition (EMT)), immune response, and cell proliferation. This implies that the predictors are markers and potential stromal facilitators of tumor progression. Our results provide new insights into the relationships between tumor adjacent control sample, tumor and the tumor environment. Moreover, the set of predictors identified by TranNet will provide a valuable resource for future investigations.

HFE
Also flagged:Liver CancerdeathcancerChronic liver diseaseschronic hepatitis Cliver cirrhosis
Journal Article 2023-09-18 ✓ 4 Snippets Omar A, Kaseb A, Elbaz T, El-Kassas M, El Fouly A, Hanno AF, El Dorry A, Hosni A, Helmy A, Saad AS, Alolayan A, Eysa BE, Hamada E, Azim H, Khattab H, Elghazaly H, Tawfik H, Ayoub H, Khaled H, Saadeldin I, Waked I, Barakat EMF, El Meteini M, Hamed Shaaban M, EzzElarab M, Fathy M, Shaker M, Sobhi M, Shaker MK, ElGharib M, Abdullah M, Mokhtar M, Elshazli M, Heikal OMK, Hetta O, ElWakil RM, Abdel Wahab S, Eid SS, Rostom Y, Egyptian Liver Cancer Committee Study Group.
In-Text Gene Mentions

This statement was supported by the AASLD guidelines that recommended HCC surveillance in patients with HH and PBC.32 In Egypt, several studies have reported the association of HCC in HCV patients carrying hemochromatosis gene (HFE) mutant alleles, such as the A allele at position 346 of the ghrelin gene or the D allele of the H63D mutation.33,34 However, other studies failed to prove the impact of HFE mutations on the risk of HCC in cirrhotic patients.35 A study conducted in Sweden reported that patients with HH have a 20 times higher risk for HCC without an increased risk for non-hepatic malignancies.36 According to the current literature, cirrhosis secondary to PBC increases the risk of HCC occurrence at a level similar to that observed in patients with HCV infection.37 Although AIH is associated with a significantly lower risk of HCC development compared to other chronic liver diseases,38 patients with cirrhosis secondary to AIH showed an annual incidence rate of >1.5%, resulting in the need to include such patients in routine HCC surveillance programs.39 Another study added that HCC occurs in 7% of patients with AIH and cirrhosis of at least a five-year duration, with an incidence rate of 1 per 350 patients-years.40 Further, a retrospective study revealed that patients with cirrhosis secondary to A1AT deficiency show a 0.88% annual incidence of HCC,41 which justifies the need for surveillance in such patients.

…HCV patients carryinghemochromatosisgene (HFE) mutant…

…arrying hemochromatosis gene (HFE) mutant alleles, such…

…the impact ofHFEmutations on the…

Show Full Abstract

Globally, hepatocellular carcinoma (HCC) is the fourth most common cause of death from cancer. The prevalence of this pathology, which has been on the rise in the last 30 years, has been predicted to continue increasing. HCC is the most common cause of cancer-related morbidity and mortality in Egypt and is also the most common cancer in males. Chronic liver diseases, including chronic hepatitis C, which is a primary health concern in Egypt, are considered major risk factors for HCC. However, HCC surveillance is recommended for patients with chronic hepatitis B virus (HBV) and liver cirrhosis; those above 40 with HBV but without cirrhosis; individuals with hepatitis D co-infection or a family history of HCC; and Nonalcoholic fatty liver disease (NAFLD) patients exhibiting significant fibrosis or cirrhosis. Several international guidelines aid physicians in the management of HCC. However, the availability and cost of diagnostic modalities and treatment options vary from one country to another. Therefore, the current guidelines aim to standardize the management of HCC in Egypt. The recommendations presented in this report represent the current management strategy at HCC treatment centers in Egypt. Recommendations were developed by an expert panel consisting of hepatologists, oncologists, gastroenterologists, surgeons, pathologists, and radiologists working under the umbrella of the Egyptian Society of Liver Cancer. The recommendations, which are based on the currently available local diagnostic aids and treatments in the country, include recommendations for future prospects.

PRDX6
Also flagged:Kidney Fibrosiskidney diseaseagingobesityRenal interstitial fibrosisN-cadherin
Journal Article 2023-09-18 ✓ 5 Snippets La Russa D, Barberio L, Marrone A, Perri A, Pellegrino D.
In-Text Gene Mentions

The interaction between S-glutathionylated catalytic Cys47 of Prdx6 and the catalytic Cys47 of GSTP1 causes the formation of a heterodimer structure which exposes the disulfide bound to GSH leading to sequential reduction/activation of both Prdx6 and GSTP catalytic cysteines [100].

…of Peroxiredoxin VI (Prdx6), a singular catalytic…

…oxidized monomer ofPrdx6resulting from reduction…

…catalytic Cys47 ofPrdx6and the catalytic…

…reduction/activation of bothPrdx6and GSTP catalytic…

Show Full Abstract

Caloric restriction is an effective intervention to protract healthspan and lifespan in several animal models from yeast to primates, including humans. Caloric restriction has been found to induce cardiometabolic adaptations associated with improved health and to delay the onset and progression of kidney disease in different species, particularly in rodent models. In both aging and obesity, fibrosis is a hallmark of kidney disease, and epithelial-mesenchymal transition is a key process that leads to fibrosis and renal dysfunction during aging. In this study, we used an aged and obese rat model to evaluate the effect of long-term (6 months) caloric restriction (-40%) on renal damage both from a structural and functional point of view. Renal interstitial fibrosis was analyzed by histological techniques, whereas effects on mesenchymal (N-cadherin, Vimentin, Desmin and α-SMA), antioxidant (SOD1, SOD2, Catalase and GSTP1) inflammatory (YM1 and iNOS) markers and apoptotic/cell cycle (BAX, BCL2, pJNK, Caspase 3 and p27) pathways were investigated using Western blot analysis. Our results clearly showed that caloric restriction promotes cell cycle division and reduces apoptotic injury and fibrosis phenotype through inflammation attenuation and leukocyte infiltration. In conclusion, we highlight the beneficial effects of caloric restriction to preserve elderly kidney function.

DCC
Also flagged:InsulinType 1 Diabeteschronic autoimmune diseaseimmune responsesglucosediabetes
Journal Article 2023-09-18 ✓ 1 Snippet Sionov RV, Ahdut-HaCohen R.
In-Text Gene Mentions

MSCs promote vascular remodeling and angiogenesis by secreting a variety of pro-survival and angiogenic factors such as VEGF, Angiopoietin-1, Angiogenin, IGF-1, Netrin-1, HGF, IL-6, IL-8, MCP-1, CXCL16, PDGF, MMP8 and MMP9.TNFα activates MSCs to secrete the pro-angiogenic cytokines IL-6 and IL-8.The conditioned medium from TNFα-activated MSCs stimulated blood perfusion and angiogenesis when injected into the ischemic hindlimb of a mouse model.MMP9 knockout mice showed similar islet mass and distribution as wild-type mice but had an impaired glucose response in vivo with lower serum insulin levels. MMP9 knockout islets also showed reduced glucose-stimulated insulin secretion in vitro. The vascular density of the MMP9 knockout islets is reduced, with the capillaries having fewer fenestrations.Angiopoietin-1 (ANG1) and angiopoietin-2 (ANG2) stimulate islet-like development from human induced pluripotent stem cells (iPSCs).Netrin-1 produced by human Wharton’s jelly MSCs, belongs to a family of laminin-like proteins that interact with DCC/Neogenin-1 and UNC5 receptors to stimulate or inhibit angiogenesis, depending on the context.Islet grafts co-transfected with MSCs showed increased vascularization and were surrounded by von Willebrand factor-expressing endothelial cells.

Show Full Abstract

Type 1 Diabetes (T1D) is a chronic autoimmune disease characterized by a gradual destruction of insulin-producing β-cells in the endocrine pancreas due to innate and specific immune responses, leading to impaired glucose homeostasis. T1D patients usually require regular insulin injections after meals to maintain normal serum glucose levels. In severe cases, pancreas or Langerhans islet transplantation can assist in reaching a sufficient β-mass to normalize glucose homeostasis. The latter procedure is limited because of low donor availability, high islet loss, and immune rejection. There is still a need to develop new technologies to improve islet survival and implantation and to keep the islets functional. Mesenchymal stem cells (MSCs) are multipotent non-hematopoietic progenitor cells with high plasticity that can support human pancreatic islet function both in vitro and in vivo and islet co-transplantation with MSCs is more effective than islet transplantation alone in attenuating diabetes progression. The beneficial effect of MSCs on islet function is due to a combined effect on angiogenesis, suppression of immune responses, and secretion of growth factors essential for islet survival and function. In this review, various aspects of MSCs related to islet function and diabetes are described.

PRDX6
Also flagged:dementiaADATPasemitochondrial-glycan
Journal Article 2023-09-18 ✓ 1 Snippet Liu P, Li L, He F, Meng F, Liu X, Su Y, Su X, Luo B, Peng G.
In-Text Gene Mentions

…peroxiredoxin isoforms (PRDX1–PRDX6), PRDX3 is the…

Show Full Abstract

Alzheimer's disease (AD) is the most prevalent form of dementia among elderly people worldwide. Cerebrospinal fluid (CSF) is the optimal fluid source for AD biomarkers, while serum biomarkers are much more achievable. To search for novel diagnostic AD biomarkers, we performed a quantitative proteomic analysis of CSF and serum samples from AD and normal cognitive controls (NC). CSF and serum proteomes were analyzed via data-independent acquisition quantitative mass spectrometry. Our bioinformatic analysis was based on Gene Ontology (GO) functional annotation analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment. In comparison to the controls, 8 proteins were more abundant in AD CSF, and 60 were less abundant in AD CSF, whereas 55 proteins were more and 10 were less abundant in the serum samples. ATPase-associated activity for CSF and mitochondrial functions for CSF and serum were the most enriched GO terms of the DEPs. KEGG enrichment analysis showed that the most significant pathways for the differentially expressed proteins were the N-glycan biosynthesis pathways. The area under the curve (AUC) values for CSF sodium-/potassium-transporting ATPase subunit beta-1 (AT1B1), serglycin (SRGN), and thioredoxin-dependent peroxide reductase, mitochondrial (PRDX3) were 0.867 (<i>p</i> = 0.004), 0.833 (<i>p</i> = 0.008), and 0.783 (<i>p</i> = 0.025), respectively. A panel of the above three CSF proteins accurately differentiated AD (AUC = 0.933, <i>p</i> = 0.001) from NC. The AUC values for serum probable phospholipid-transporting ATPase IM (AT8B4) and SRGN were moderate. The AUC of the CSF SRGN + serum SRGN was 0.842 (<i>p</i> = 0.007). These novel AD biomarker candidates are mainly associated with inflammation, ATPase activity, oxidative stress, and mitochondrial dysfunction. Further studies are needed to investigate the molecular mechanisms by which these potential biomarkers are involved in AD.

SOX6
Also flagged:dopamineneurological disordersmembranebehavioraladdictionattention deficit disorder
Journal Article 2023-09-18 ✓ 5 Snippets Otero MG, Bell S, Laperle AH, Lawless G, Myers Z, Castro MA, Villalba JM, Svendsen CN.
In-Text Gene Mentions

For instance, SOX6-expressing neurons, which have been shown to be susceptible to PD-associated degeneration [37], show three-fold enrichment in the dopamine neuron organ-chip over well culture.

…opaminergic progenitor markersSOX6, HES1 and…

…gan-chip cultures co-expressedSOX6(2D well 13.4%…

…markers KCNJ6 andSOX6[ 28 ,…

…For instance,SOX6-expressing neurons, which…

Show Full Abstract

While cells in the human body function in an environment where the blood supply constantly delivers nutrients and removes waste, cells in conventional tissue culture well platforms are grown with a static pool of media above them and often lack maturity, limiting their utility to study cell biology in health and disease. In contrast, organ-chip microfluidic systems allow the growth of cells under constant flow, more akin to the in vivo situation. Here, we differentiated human induced pluripotent stem cells into dopamine neurons and assessed cellular properties in conventional multi-well cultures and organ-chips. We show that organ-chip cultures, compared to multi-well cultures, provide an overall greater proportion and homogeneity of dopaminergic neurons as well as increased levels of maturation markers. These organ-chips are an ideal platform to study mature dopamine neurons to better understand their biology in health and ultimately in neurological disorders.

NEGR1DCC
Also flagged:Renal InjuryhTERTtelomerase reverse transcriptase40 Large T antigenAFB1immune receptors
Journal Article 2023-09-18 ✓ 4 Snippets Merrick BA, Martin NP, Brooks AM, Foley JF, Dunlap PE, Ramaiahgari S, Fannin RD, Gerrish KE.
In-Text Gene Mentions

…included Nog ,Negr1, Lhx2 ,…

…[ 60 ],Negr1[ 61 ],…

DCC Netrin 1 ReceptorNetrin 1 Receptor…

Neuronal growth regulator 1growth regulator 1…

Show Full Abstract

Renal proximal tubule epithelial cells (RPTECs) are a primary site for kidney injury. We created two RPTEC lines from CD-1 mice immortalized with hTERT (human telomerase reverse transcriptase) or SV40 LgT antigen (Simian Virus 40 Large T antigen). Our hypothesis was that low-level, repeated exposure to subcytotoxic levels of 0.25-2.5 μM cisplatin (CisPt) or 12.5-100 μM aflatoxin B1 (AFB1) would activate distinctive genes and pathways in these two differently immortalized cell lines. RNA-seq showed only LgT cells responded to AFB1 with 1139 differentially expressed genes (DEGs) at 72 h. The data suggested that AFB1 had direct nephrotoxic properties on the LgT cells. However, both the cell lines responded to 2.5 μM CisPt from 3 to 96 h expressing 2000-5000 total DEGs. For CisPt, the findings indicated a coordinated transcriptional program of injury signals and repair from the expression of immune receptors with cytokine and chemokine secretion for leukocyte recruitment; robust expression of synaptic and substrate adhesion molecules (SAMs) facilitating the expression of neural and hormonal receptors, ion channels/transporters, and trophic factors; and the expression of nephrogenesis transcription factors. Pathway analysis supported the concept of a renal repair transcriptome. In summary, these cell lines provide in vitro models for the improved understanding of repeated renal injury and repair mechanisms. High-throughput screening against toxicant libraries should provide a wider perspective of their capabilities in nephrotoxicity.

HFE
Also flagged:IronCalcium Deficiencycalciumanemiairon deficiencythyroid autoimmunity
Journal Article 2023-09-18 ✓ 1 Snippet Dera-Szymanowska A, Filipowicz D, Misan N, Szymanowski K, Chillon TS, Asaad S, Sun Q, Szczepanek-Parulska E, Schomburg L, Ruchała M.
In-Text Gene Mentions

…celiac disease, orhemochromatosis.…

Show Full Abstract

The aim of this study was to compare the iron and calcium status in singleton and twin pregnancies and to assess whether there is an increased risk for iron and calcium deficiency in twin gestation. The study included 105 singleton and 9 twin pregnancies at or above 35 weeks of gestation. Information on prenatal supplementation with iron or calcium was acquired, and adverse perinatal outcomes were recorded. Biosamples from all 114 mothers and 73 newborns (61 singleton and 12 twin newborns) were finally analyzed. Total iron and calcium concentrations in serum were measured through total reflection X-ray fluorescence analysis. The results indicated no significant differences in maternal serum iron and calcium concentrations between singleton and twin pregnancies. Similarly, iron and calcium concentrations in newborn umbilical cord serum samples were not different between singleton and twin pregnancies. The comparison of total iron and calcium between mothers and umbilical cord serum indicated significantly lower concentrations in the mothers, with the differences being not homogenous but rather pair-specific. A significant positive correlation between maternal serum and umbilical cord serum calcium concentration was noticed. Prenatal iron supplementation was associated with higher iron concentrations in both mothers and newborns, supporting the efficiency of supplementation and the quality of the study methods. Collectively, the data indicate no significant differences in serum iron and calcium concentrations with regard to singleton or twin pregnancies and the efficiency of iron supplementation during pregnancy for increasing iron status.

HTT
Also flagged:gene expressionposttraumatic stress disorderPTSDfear conditioningprotein synthesistranscription factor
Journal Article 2023-09-18 ✓ 2 Snippets Chang SH, Chang YM, Chen HY, Shaw FZ, Shyu BC.
In-Text Gene Mentions

Studies of the serotonin transporter (5-HTT) knockout rat models have shown these animals exhibited higher anxiety-like and depression-like phenotypes (Kalueff et al., 2010), and also impaired fear extinction (Nonkes et al., 2012).

…the serotonin transporter (5-HTT) knockout rat models…

Show Full Abstract

Posttraumatic stress disorder (PTSD) is a complex disorder that involves physiological, emotional, and cognitive dysregulation that may occur after exposure to a life-threatening event. In contrast with the condition of learned fear with resilience to extinction, abnormal fear with impaired fear extinction and exaggeration are considered crucial factors for the pathological development of PTSD. The prefrontal cortex (mPFC) is considered a critical region of top-down control in fear regulation, which involves the modulation of fear expression and extinction. The pathological course of PTSD is usually chronic and persistent; a number of studies have indicated temporal progression in gene expression and phenotypes may be involved in PTSD pathology. In the current study, we use a well-established modified single-prolonged stress (SPS&FS) rat model to feature PTSD-like phenotypes and compared it with a footshock fear conditioning model (FS model); we collected the frontal tissue after extreme stress exposure or fear conditioning and extracted RNA for transcriptome-level gene sequencing. We compared the genetic profiling of the mPFC at early (<2 h after solely FS or SPS&FS exposure) and late (7 days after solely FS or SPS&FS exposure) stages in these two models. First, we identified temporal differences in the expressional patterns between these two models and found pathways such as protein synthesis factor eukaryotic initiation factor 2 (EIF2), transcription factor NF-E2-related factor 2 (NRF2)-mediated oxidative stress response, and acute phase responding signaling enriched in the early stage in both models with significant <i>p</i>-values. Furthermore, in the late stage, the sirtuin signaling pathway was enriched in both models; other pathways such as STAT3, cAMP, lipid metabolism, Gα signaling, and increased fear were especially enriched in the late stage of the SPS&FS model. However, pathways such as VDR/RXR, GP6, and PPAR signaling were activated significantly in the FS model's late stage. Last, the network analysis revealed the temporal dynamics of psychological disorder, the endocrine system, and also genes related to increased fear in the two models. This study could help elucidate the genetic temporal alteration and stage-specific pathways in these two models, as well as a better understanding of the transcriptome-level differences between them.

HFE
Also flagged:invasive infectionsplenic abscessesgastroenteritisiron-overload syndromeYersinia enterocolitica infectionYersinia enterocolitica septicemia
Journal Article 2023-09-18 ✓ 1 Snippet Samnani S, Bibby H, Luft L.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>We report a case of a 47-year-old male presenting with <i>Yersinia enterocolitica</i> septicemia with no known risk factors for invasive infection, found to have multiloculated liver and splenic abscesses with an antecedent history of mild enterocolitis.<h4>Case presentation</h4>Our patient presented with septic shock in the setting of gastroenteritis with abdominal pain and fever. On work-up, he was found to have multiloculated hepatic and splenic abscesses secondary to <i>Y. enterocolitica</i>. No identifiable risk factors (ie, iron-overload syndrome or immunosuppression) for <i>Y. enterocolitica</i> septicemia were identified in our patient. Our patient was treated with a prolonged course of antibiotics until imaging resolution of his liver and splenic abscesses.<h4>Conclusion</h4>Invasive <i>Y. enterocolitica</i> in an immunocompetent host is rare. Our case highlights the pathogenicity of <i>Y. enterocolitica</i>, and important treatment and management considerations.

Also flagged:GemcitabineGlycocholic AcidGemsodium-dependent bile acid transporterASBTCancer
Journal Article 2023-09-17 No Snippets Zang W, Gao D, Yu M, Long M, Zhang Z, Ji T.
Show Full Abstract

The clinical utility of gemcitabine, an antimetabolite antineoplastic agent applied in various chemotherapy treatments, is limited due to the required intravenous injection. Although chemical structure modifications of gemcitabine result in enhanced oral bioavailability, these modifications compromise complex synthetic routes and cause unexpected side effects. In this study, gemcitabine-loaded glycocholic acid-modified micelles (Gem-PPG) were prepared for enhanced oral chemotherapy. The <i>in vitro</i> transport pathway experiments revealed that intact Gem-PPG were transported across the intestinal epithelial monolayer via an apical sodium-dependent bile acid transporter (ASBT)-mediated pathway. In mice, the pharmacokinetic analyses demonstrated that the oral bioavailability of Gem-PPG approached 81%, compared to less than 20% for unmodified micelles. In addition, the antitumor activity of oral Gem-PPG (30 mg/kg, BIW) was superior to that of free drug injection (60 mg/kg, BIW) in the xenograft model. Moreover, the assessments of hematology, blood chemistry, and histology all indicated the hypotoxicity profile of the drug-loaded micelles.

Also flagged:InfluenzaChronic Renal Insufficiencychronic kidney diseasekidney diseasediabeteschronic obstructive pulmonary disease
Journal Article 2023-09-17 No Snippets Ishigami J, Jaar BG, Charleston JB, Lash JP, Brown J, Chen J, Mills KT, Taliercio JJ, Kansal S, Crews DC, Riekert KA, Dowdy DW, Appel LJ, Matsushita K, CRIC Study Investigators.
Show Full Abstract

<h4>Rationale & objective</h4>Vaccination for influenza is strongly recommended for people with chronic kidney disease (CKD) due to their immunocompromised state. Identifying risk factors for not receiving an influenza vaccine (non-vaccination) could inform strategies for improving vaccine uptake in this high-risk population.<h4>Study design</h4>Longitudinal observational study.<h4>Setting & participants</h4>3,692 Chronic Renal Insufficiency Cohort Study (CRIC) participants.<h4>Exposure</h4>Demographic factors, social determinants of health, clinical conditions, and health behaviors.<h4>Outcome</h4>Influenza non-vaccination, which was assessed based on a receipt of influenza vaccine ascertained during annual clinic visits in a subset of participants who were under nephrology care.<h4>Analytical approach</h4>Mixed-effects Poisson models to estimate adjusted prevalence ratios (APRs).<h4>Results</h4>Between 2009 and 2020, the pooled mean vaccine uptake was 72% (mean age, 66 years; 44% female; 44% Black race). In multivariable models, factors significantly associated with influenza non-vaccination were younger age (APR, 2.16 [95% CI, 1.85-2.52] for<50 vs≥75 years), Black race (APR, 1.58 [95% CI, 1.43-1.75] vs White race), lower education (APR, 1.20 [95% CI, 1.04-1.39 for less than high school vs college graduate]), lower annual household income (APR, 1.26 [95% CI, 1.06-1.49] for <$20,000 vs >$100,000), formerly married status (APR, 1.22 [95% CI, 1.09-1.35] vs currently married), and nonemployed status (APR, 1.13 [95% CI, 1.02-1.24] vs employed). In contrast, participants with diabetes (APR, 0.80 [95% CI, 0.73-0.87] vs no diabetes), chronic obstructive pulmonary disease (COPD) (APR, 0.80 [95% CI, 0.70-0.92] vs no COPD), end-stage kidney disease (APR, 0.64 [0.56 to 0.76] vs estimated glomerular filtration rate≥60mL/min/1.73m<sup>2</sup>), frailty (APR, 0.86 [95% CI, 0.74-0.99] vs no frailty), and ideal physical activity (APR, 0.90 [95% CI, 0.82-0.99] vs. physically inactive) were less likely to have non-vaccination status.<h4>Limitations</h4>Possible residual confounding.<h4>Conclusions</h4>Among adults with CKD receiving nephrology care, younger adults, Black individuals, and those with adverse social determinants of health were more likely to have the influenza non-vaccination status. Strategies are needed to address these disparities and reduce barriers to vaccination.<h4>Plain-language summary</h4>Identifying risk factors for not receiving an influenza vaccine ("non-vaccination") in people living with kidney disease, who are at risk of influenza and its complications, could inform strategies for improving vaccine uptake. In this study, we examined whether demographic factors, social determinants of health, and clinical conditions were linked to the status of not receiving an influenza vaccine among people living with kidney disease and receiving nephrology care. We found that younger adults, Black individuals, and those with adverse social determinants of health were more likely to not receive the influenza vaccine. These findings suggest the need for strategies to address these disparities and reduce barriers to vaccination in people living with kidney disease.

SOX6
Also flagged:elesclomolmetabolismcopperdeathcuproptosismitochondria
Journal Article 2023-09-17 ✓ 1 Snippet Gao J, Wu X, Huang S, Zhao Z, He W, Song M.
In-Text Gene Mentions

For instance, aberrant activation of oncogene SOX6 in ewing sarcoma (EwS), an aggressive childhood cancer, promoted malignancy but conferred sensitivity to elesclomol by increased mitochondrial ROS.

Show Full Abstract

As an essential micronutrient for humans, the metabolism of copper is fine-tuned by evolutionarily conserved homeostatic mechanisms. Copper toxicity occurs when its concentration exceeds a certain threshold, which has been exploited in the development of copper ionophores, such as elesclomol, for anticancer treatment. Elesclomol has garnered recognition as a potent anticancer drug and has been evaluated in numerous clinical trials. However, the mechanisms underlying elesclomol-induced cell death remain obscure. The discovery of cuproptosis, a novel form of cell death triggered by the targeted accumulation of copper in mitochondria, redefines the significance of elesclomol in cancer therapy. Here, we provide an overview of copper homeostasis and its associated pathological disorders, especially copper metabolism in carcinogenesis. We summarize our current knowledge of the tumor suppressive mechanisms of elesclomol, with emphasis on cuproptosis. Finally, we discuss the strategies that may contribute to better application of elesclomol in cancer therapy.

Also flagged:polycaprolactoneceriumcalcium phosphatesdegradationextracellularpore
Journal Article 2023-09-17 No Snippets Plocon C, Evanghelidis A, Enculescu M, Isopencu G, Oprea O, Bacalum M, Raileanu M, Jinga S, Busuioc C.
Show Full Abstract

The current study reports on the fabrication of composite scaffolds based on polycaprolactone (PCL) and cerium (Ce)-containing powders, followed by their characterization from compositional, structural, morphological, optical and biological points of view. First, CeO<sub>2</sub>, Ce-doped calcium phosphates and Ce-substituted bioglass were synthesized by wet-chemistry methods (precipitation/coprecipitation and sol-gel) and subsequently loaded on PCL fibres processed by electrospinning. The powders were proven to be nanometric or micrometric, while the investigation of their phase composition showed that Ce was present as a dopant within the crystal lattice of the obtained calcium phosphates or as crystalline domains inside the glassy matrix. The best bioactivity was attained in the case of Ce-containing bioglass, while the most pronounced antibacterial effect was visible for Ce-doped calcium phosphates calcined at a lower temperature. The scaffolds were composed of either dimensionally homogeneous fibres or mixtures of fibres with a wide size distribution and beads of different shapes. In most cases, the increase in polymer concentration in the precursor solution ensured the achievement of more ordered fibre mats. The immersion in SBF for 28 days triggered an incipient degradation of PCL, evidenced mostly through cracks and gaps. In terms of biological properties, the composite scaffolds displayed a very good biocompatibility when tested with human osteoblast cells, with a superior response for the samples consisting of the polymer and Ce-doped calcium phosphates.

Also flagged:Biodegradationmagnesiumdegradationosteogenesishydrogencalcium phosphate
Journal Article 2023-09-17 No Snippets Zhou Y, Wang D, Wang D, Yang Y.
Show Full Abstract

Biodegradable magnesium (Mg) and its alloys show tremendous potential as orthopedic materials. Nevertheless, the fast degradation and insufficient osteogenic properties hinder their applications. In this study, mesoporous bioglass (MBG) with an ordered branch-like structure was synthesized via a modified sol-gel method and showed a high specific surface area of 656.45 m<sup>2</sup>/g. A Mg-based composite was prepared by introducing the MBG into a Mg matrix via powder metallurgy. Degradation tests showed that the introduction of MBG increased the adsorption sites for Ca and P ions, thus promoting the formation of a Ca-P protective layer on the Mg matrix. The Ca-P protective layer became thick and dense with an increase in the immersion time, improving the protection ability of the Mg matrix, as proven by electrochemical impedance spectroscopy measurements. Meanwhile, the Mg-based composite also exhibited excellent biocompatibility and osteogenic properties. This study demonstrated the advantages of MBG in the preparation of Mg-based bone implants and validated the feasibility of improving Mg matrix corrosion resistance and enhancing osteogenesis by introducing MBG.

SERPINC1
Also flagged:pathogenesisNTM pulmonary infectioncoagulationC1RC1SC2
Journal Article 2023-09-17 ✓ 3 Snippets Wang L, Zheng X, Ma J, Gu J, Sha W.
In-Text Gene Mentions

…significantly enriched, withSERPINC1and VTN decreased…

SERPINC1, SERPINA1, SERPINA5, FGA,…

…that IGFBP3, F5,SERPINC1, and SERPINA1 are…

Show Full Abstract

The non-tuberculous mycobacterium (NTM) is a very troublesome opportunistic pathogen, placing a heavy burden on public health. The pathogenesis of NTM pulmonary infection is not well-revealed yet, and its diagnosis is always challenging. This study aimed to use a comprehensive proteomics analysis of plasma exosomes to distinguish patients with rapidly growing NTM <i>M. abscessus</i> (MAB), slowly growing NTM <i>M. intracellulare</i> (MAC), and <i>Mycobacterium tuberculosis</i> (MTB). The identified protein components were quantified with label-free proteomics and determined with a bioinformatics analysis. The complement and coagulation were significantly enriched in patients with <i>Mycobacterium</i> infection, and a total of 24 proteins were observed with up-regulation, which included C1R, C1S, C2, MASP2, C4B, C8B, C9, etc. Of them, 18 proteins were significantly up-regulated in patients with MAB, while 6 and 10 were up-regulated in patients with MAC or MTB, respectively. Moreover, MAB infection was also related to the HIF-1 signaling pathway and phagosome processes, and MTB infection was associated with the p53 signaling pathway. This study provided a comprehensive description of the exosome proteome in the plasma of patients infected with MAB, MAC, and MTB and revealed potential diagnostic and differential diagnostic markers.

Also flagged:Hydroxyapatitecalciumhydroxyapatitesmineralshydroxylinfections
Journal Article 2023-09-17 No Snippets Murphy B, Morris MA, Baez J.
Show Full Abstract

This study introduces and explores the use of supersaturated solutions of calcium and phosphate ions to generate well-defined hydroxyapatite coatings for orthopaedic implants. The deposition of hydroxyapatite is conducted via several solutions of metastable precursors that precipitate insoluble hydroxyapatite minerals at a substrate-solution interface. Solutions of this nature are intrinsically unstable, but this paper outlines process windows in terms of time, temperature, concentration and pH in which coating deposition is controlled via the stop/go reaction. To understand the kinetics of the deposition process, comparisons based on ionic strength, particle size, electron imaging, elemental analyses and mass of the formed coating for various deposition solutions are carried out. This comprehensive dataset enables the measurement of deposition kinetics and identification of an optimum solution and its reaction mechanism. This study has established stable and reproducible process windows, which are precisely controlled, leading to the successful formation of desired hydroxyapatite films. The data demonstrate that this process is a promising and highly repeatable method for forming hydroxyapatites with desirable thickness, morphology and chemical composition at low temperatures and low capital cost compared to the existing techniques.

Also flagged:nanohydroxyapatitenanoHAPoxygencell proliferationapatite-tricalcium phosphate
Journal Article 2023-09-16 No Snippets Kurzyk A, Szwed-Georgiou A, Pagacz J, Antosik A, Tymowicz-Grzyb P, Gerle A, Szterner P, Włodarczyk M, Płociński P, Urbaniak MM, Rudnicka K, Biernat M.
Show Full Abstract

Nanohydroxyapatite (nanoHAP) is widely used in bone regeneration, but there is a need to enhance its properties to provide stimuli for cell commitment and osteoconduction. This study examines the effect of calcination at 1200 °C on the physicochemical and biological properties of nanoHAP doped with magnesium (Mg<sup>2+</sup>), strontium (Sr<sup>2+</sup>), and zinc (Zn<sup>2+</sup>). A synergistic effect of dual modification on nanoHAP biological properties was investigated. The materials were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), BET analysis, Fourier-transform spectroscopy, and thermal analysis methods. Furthermore, ion release tests and in vitro biological characterization, including cytocompatibility, reactive oxygen species production, osteoconductive potential and cell proliferation, were performed. The XRD results indicate that the ion substitution of nanoHAP has no effect on the apatite structure, and after calcination, β-tricalcium phosphate (β-TCP) is formed as an additional phase. SEM analysis showed that calcination induces the agglomeration of particles and changes in surface morphology. A decrease in the specific surface area and in the ion release rate was observed. Combining calcination and nanoHAP ion modification is beneficial for cell proliferation and osteoblast response and provide additional stimuli for cell commitment in bone regeneration.

Also flagged:Wilms tumorWTrenal malignant tumoranaplastic tumorpathogenesisGene Expression
Journal Article 2023-09-16 No Snippets Cai L, Shi B, Zhu K, Zhong X, Lai D, Wang J, Tou J.
Show Full Abstract

Wilms tumor (WT) is the most common pediatric renal malignant tumor in the world. Overall, the prognosis of Wilms tumor is very good. However, the prognosis of patients with anaplastic tumor histology or disease relapse is still poor, and their recurrence rate, metastasis rate and mortality are significantly increased compared with others. Currently, the combination of histopathological examination and molecular biology is essential to predict prognosis and guide the treatment. However, the molecular mechanism has not been well studied. Genetic profiling may be helpful in some way. Hence, we sought to identify novel promising biomarkers of WT by integrating bioinformatics analysis and to identify genes associated with the pathogenesis of WT. In the presented study, the NCBI Gene Expression Omnibus was used to download two datasets of gene expression profiles related to WT patients for the purpose of detecting overlapped differentially expressed genes (DEGs). The DEGs were then uploaded to DAVID database for enrichment analysis. In addition, the functional interactions between proteins were evaluated by simulating the protein-protein interaction (PPI) network of DEGs. The impact of selected hub genes on survival in WT patients was analyzed by using the online tool R2: Genomics Analysis and Visualization Platform. The correlation between gene expression and the degree of immune infiltration was assessed by the Estimation of Stromal and Immune cells in Malignant Tumor tissues using the Expression (ESTIMATE) algorithm and the single sample GSEA. Top 12 genes were identified for further study after constructing a PPI network and screening hub gene modules. Kinesin family member 2C (KIF2C) was identified as the most significant gene predicting the overall survival of WT patients. The expression of KIF2C in WT was further verified by quantitative real-time polymerase chain reaction and immunohistochemistry. Furthermore, we found that KIF2C was significantly correlated with immune cell infiltration in WT. Our present study demonstrated that altered expression of KIF2C may be involved in WT and serve as a potential prognostic biomarker for WT patients.

Also flagged:FerroptosisironlipidPDferroptosis-related (FrGene Expression
Journal Article 2023-09-16 No Snippets Liu L, Cui Y, Chang YZ, Yu P.
Show Full Abstract

Ferroptosis is an iron-dependent, lipid peroxidation-driven cell death pathway, while Parkinson's disease (PD) patients exhibit iron deposition and lipid peroxidation in the brain. Thus, the features of ferroptosis highly overlap with the pathophysiological features of PD. Despite this superficial connection, the possible role(s) of ferroptosis-related (Fr) proteins in dopaminergic neurons and/or glial cells in the substantia nigra (SN) in PD have not been examined in depth. To explore the correlations between the different SN cell types and ferroptosis at the single-cell level in PD patients, and to explore genes that may affect the sensitivity of dopaminergic neurons to ferroptosis, we performed in silico analysis of a single cell RNA sequence (RNA-seq) set (GSE178265) from the Gene Expression Omnibus (GEO) database. We identified differentially expressed genes (DEGs) in the different cell types in the human SN, and proceeded to perform enrichment analysis, constructing a protein-protein interaction network from the DEGs of dopaminergic neurons with the Metascape database. We examined the intersection of Fr genes present in the FerrDb database with DEGs from the GSE178265 set to identify Fr-DEGs in the different brain cells. Further, we identified Fr-DEGs encoding secreted proteins to implicate cell-cell interactions in the potential stimulation of ferroptosis in PD. The Fr-DEGs we identified were verified using the bulk RNA-seq sets (GSE49036 and GSE20164). The number of dopaminergic neurons decreased in the SN of PD patients. Interestingly, non-dopaminergic neurons possessed the fewest DEGs. Enrichment analysis of dopaminergic neurons' DEGs revealed changes in transmission across chemical synapses and ATP metabolic process in PD. The secreted Fr-DEGs identified were ceruloplasmin (CP), high mobility group box 1 (HMGB1) and transferrin (TF). The bulk RNA-seq set from the GEO database demonstrates that CP expression is increased in the PD brain. In conclusion, our results identify CP as a potential therapeutic target to protect dopaminergic neurons by reducing neurons' sensitivity to ferroptosis.

HTT
Also flagged:Serotonin SyndromeCatatoniaNeuroleptic malignant syndromeautosomal dominant neurodegenerative disorderHDchorea
Journal Article 2023-09-16 ✓ 2 Snippets Buciuc AG, Traugott P, Danger CR.
In-Text Gene Mentions

…of the huntingtin (HTT) gene.…

…of the huntingtin (HTT) gene on chromosome…

Show Full Abstract

Neuroleptic malignant syndrome (NMS) and serotonin syndrome (SS) represent serious life-threatening conditions that share phenotypic and pathophysiologic features due to intricate interactions between the dopaminergic and serotoninergic systems. Malignant catatonia's underlying pathophysiological mechanisms are poorly understood, but it is clinically difficult to distinguish it from NMS. Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder characterized by CAG expansion in exon 1 of the huntingtin (HTT) gene. Even though involuntary movements and lack of coordination are pivotal in HD, psychiatric manifestations are an integral part of it and may precede the emergence of chorea by years. The overlap in symptoms is noticeable for SS and NMS and distinguishing between the two may be challenging if exposure to both dopamine antagonists and serotoninergic agents exists. We present the case of a 48-year-old woman with an unusual presentation of serotonin syndrome and subsequent catatonia possibly overlapping with a neurodegenerative disorder, HD. This case report offers an interesting interconnection between three different syndromes that have tight pathophysiological and phenotypical associations.

NEGR1
Also flagged:Atrial fibrillationAFheart rhythm disorderstrokeheart failurepersistent AF
Journal Article 2023-09-16 ✓ 1 Snippet Sheng Y, Wang YY, Chang Y, Ye D, Wu L, Kang H, Zhang X, Chen X, Li B, Zhu D, Zhang N, Zhao H, Chen A, Chen H, Jia P, Song J.
In-Text Gene Mentions

…genes such asNEGR1, ABCA8, and ABCA6…

Show Full Abstract

<h4>Introduction</h4>Atrial fibrillation (AF) is the most prevalent cardiac arrhythmia, and it significantly increases the risk of cardiovascular complications and morbidity, even with appropriate treatment. Tissue remodeling has been a significant topic, while its systematic transcriptional signature remains unclear in AF.<h4>Objectives</h4>Our study aims to systematically investigate the molecular characteristics of AF at the cellular-level.<h4>Methods</h4>We conducted single-nuclei RNA-sequencig (snRNA-seq) analysis using nuclei isolated from the left atrial appendage (LAA) of AF patients and sinus rhythm. Pathological staining was performed to validate the key findings of snRNA-seq.<h4>Results</h4>A total of 30 cell subtypes were identified among 80, 592 nuclei. Within the LAA of AF, we observed a specific subtype of dedifferentiated cardiomyocytes (CMs) characterized by reduced expression of cardiac contractile proteins (TTN and TRDN) and heightened expression of extracellular-matrix related genes (COL1A2 and FBN1). Transcription factor prediction analysis revealed that gene expression patterns in dedifferentiated CMs were primarily regulated by CEBPG and GISLI. Additionally, we identified a distinct subtype of endothelial progenitor cells (EPCs) demonstrating elevated expression of PROM1 and KDR, a population decreased within the LAA of AF. Epicardial adipocytes disclosed a reduced release of the anti-inflammatory and anti-fibrotic factor PRG4, and an augmented secretion of VEGF signals targeting CMs. Additionally, we noted accumulation of M2-like macrophages and CD8<sup>+</sup> T cells with high pro-inflammatory score in LAA of AF. Furthermore, the analysis of intercellular communication revealed specific pathways related to AF, such as inflammation, extracellular matrix, and vascular remodeling signals.<h4>Conclusions</h4>This study has discovered the presence of dedifferentiated CMs, a decrease in endothelial progenitor cells, a shift in the secretion profile of adipocytes, and an amplified inflammatory response in AF. These findings could offer crucial insights for future research on AF and serve as valuable references for investigating novel therapeutic approaches for AF.

SOX6
Also flagged:localizationmembranemetabolismhair folliclelipidandrogen
Journal Article 2023-09-16 ✓ 3 Snippets Zhang W, Jin M, Li T, Lu Z, Wang H, Yuan Z, Wei C.
In-Text Gene Mentions

…, NR1H3 ,SOX6, GRIA2 ,…

… that the MSTRG.223165-miR-21-SOX6axis is involved…

…between miR-21 andSOX6and MSTRG.223165 has…

Show Full Abstract

Wool fineness affects the quality of wool, and some studies have identified about forty candidate genes that affect sheep wool fineness, but these genes often reveal only a certain proportion of the variation in wool thickness. We further explore additional genes associated with the fineness of sheep wool. Whole-genome resequencing of eight sheep breeds was performed to reveal selection signals associated with wool fineness, including four coarse wool and four fine/semi-fine wool sheep breeds. Multiple methods to reveal selection signals (Fst and θπ Ratio and XP-EHH) were applied for sheep wool fineness traits. In total, 269 and 319 genes were annotated in the fine wool (F vs. C) group and the coarse wool (C vs. F) group, such as <i>LGR4</i>, <i>PIK3CA</i>, and <i>SEMA3C</i> and <i>NFIB</i>, <i>OPHN1</i>, and <i>THADA</i>. In F vs. C, 269 genes were enriched in 15 significant GO Terms (<i>p</i> < 0.05) and 38 significant KEGG Pathways (<i>p</i> < 0.05), such as protein localization to plasma membrane (GO: 0072659) and Inositol phosphate metabolism (oas 00562). In C vs. F, 319 genes were enriched in 21 GO Terms (<i>p</i> < 0.05) and 16 KEGG Pathways (<i>p</i> < 0.05), such as negative regulation of focal adhesion assembly (GO: 0051895) and Axon guidance (oas 04360). Our study has uncovered genomic information pertaining to significant traits in sheep and has identified valuable candidate genes. This will pave the way for subsequent investigations into related traits.

VRK2
Also flagged:GBMGlioblastomabrain tumourtumourstranslationalIDH
Journal Article 2023-09-16 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…more essential inVRK2-methylated GBM) have recently…

Show Full Abstract

No abstract available.

Also flagged:INOSINE RNA EDITING ASSOCIATED TUMOUR MICROENVIRONMENT ASGlioblastomaGBMadenosineinosineIDH
Journal Article 2023-09-16 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:glioblastomaGBMRB1TumourPD1Nivolumab
Journal Article 2023-09-16 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:non-small cell lung cancerNSCLCbrain metastasesEGFRALKKRAS
Journal Article 2023-09-16 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:SynthesisPolyketidepolyketide synthasesPKSbiosynthesispolyketides
Journal Article 2023-09-15 No Snippets Paulsel TQ, Williams GJ.
Show Full Abstract

Polyketide natural products have significant promise as pharmaceutical targets for human health and as molecular tools to probe disease and complex biological systems. While the biosynthetic logic of polyketide synthases (PKS) is well-understood, biosynthesis of designer polyketides remains challenging due to several bottlenecks, including substrate specificity constraints, disrupted protein-protein interactions, and protein solubility and folding issues. Focusing on substrate specificity, PKSs are typically interrogated using synthetic thioesters. PKS assembly lines and their products offer a wealth of information when studied in a chemoenzymatic fashion. This review provides an overview of the past two decades of polyketide chemoenzymatic synthesis and their contributions to the field of chemical biology. These synthetic strategies have successfully yielded natural product derivatives while providing critical insights into enzymatic promiscuity and mechanistic activity.

HFE
Also flagged:AFPcancerdeathalpha-fetoproteinvitamin Kprothrombin
Journal Article 2023-09-15 ✓ 1 Snippet Beudeker BJB, Fu S, Balderramo D, Mattos AZ, Carrera E, Diaz J, Prieto J, Banales J, Vogel A, Arrese M, Oliveira J, Groothuismink ZMA, van Oord G, Hansen BE, de Man RA, Debes JD, Boonstra A.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, Wilson’s disease, alpha-1…

Show Full Abstract

<h4>Background</h4>HCC is a major cause of cancer death worldwide. Serum biomarkers such as alpha-fetoprotein (AFP), protein induced by vitamin K absence-II, and the Gender, Age, AFP-L3, AFP, Des-gamma-carboxy prothrombin (GALAD) score have been recommended for HCC surveillance. However, inconsistent recommendations in international guidelines limit their clinical utility.<h4>Methods</h4>In this multicenter study, over 2000 patient samples were collected in 6 Latin American and 2 European countries. The performance of the GALAD score was validated in cirrhotic cases, and optimized versions were tested for early-stage HCC and prediagnostic HCC detection.<h4>Results</h4>The GALAD score could distinguish between HCC and cirrhosis in Latin American patients with an AUC of 0.76, sensitivity of 70%, and specificity of 83% at the conventional cutoff value of -0.63. In a European cohort, GALAD had an AUC of 0.69, sensitivity of 66%, and specificity of 72%. Optimizing the score in the 2 large multicenter cohorts revealed that AFP-L3 contributed minimally to early-stage HCC detection. Thus, we developed a modified GALAD score without AFP-L3, the ASAP (age, sex, AFP, and protein induced by vitamin K absence-II), which showed promise for early-stage HCC detection upon validation. The ASAP score also identified patients with cirrhosis at high risk for advanced-stage HCC up to 15 months before diagnosis (p < 0.0001) and differentiated HCC from hemangiomas, with a specificity of 100% at 71% sensitivity.<h4>Conclusion</h4>Our comprehensive analysis of large sample cohorts validates the GALAD score's utility in Latin American, Spanish, and Dutch patients for early-stage HCC detection. The optimized GALAD without AFP-L3, the ASAP score, is a good alternative and shows greater promise for HCC prediction.

Also flagged:Endoplasmic reticulumorganelledegradationautophagyER kinaseactivating transcription factor 6
Journal Article 2023-09-15 No Snippets Chen X, Shi C, He M, Xiong S, Xia X.
Show Full Abstract

The endoplasmic reticulum (ER) functions as a quality-control organelle for protein homeostasis, or "proteostasis". The protein quality control systems involve ER-associated degradation, protein chaperons, and autophagy. ER stress is activated when proteostasis is broken with an accumulation of misfolded and unfolded proteins in the ER. ER stress activates an adaptive unfolded protein response to restore proteostasis by initiating protein kinase R-like ER kinase, activating transcription factor 6, and inositol requiring enzyme 1. ER stress is multifaceted, and acts on aspects at the epigenetic level, including transcription and protein processing. Accumulated data indicates its key role in protein homeostasis and other diverse functions involved in various ocular diseases, such as glaucoma, diabetic retinopathy, age-related macular degeneration, retinitis pigmentosa, achromatopsia, cataracts, ocular tumors, ocular surface diseases, and myopia. This review summarizes the molecular mechanisms underlying the aforementioned ocular diseases from an ER stress perspective. Drugs (chemicals, neurotrophic factors, and nanoparticles), gene therapy, and stem cell therapy are used to treat ocular diseases by alleviating ER stress. We delineate the advancement of therapy targeting ER stress to provide new treatment strategies for ocular diseases.

DCC
Also flagged:ESBL-Eextended-spectrum beta-lactamasecarbapenemasevancomycinECTX-M-15
Journal Article 2023-09-15 ✓ 2 Snippets van Kleef-van Koeveringe S, Matheeussen V, Jansens H, Perales Selva N, De Coninck D, De Bruyne K, Mensaert K, Kluytmans-van den Bergh M, Kluytmans J, Goossens H, Dhaeze W, i-4-1-Health Study Group.
In-Text Gene Mentions

Day care centre (DCC)attendance is an important risk factor for MDRO carriage in children and their households [ 2 ], as it may facilitate the presence and spread of such organisms through the grouping of large numbers of children who have frequent close person-to-person contact and by the use of antibiotics [ 3 – 5 ].…

…The total number of children screened in aDCCranged from 6 to 56, with a mean overall participation rate of 40.0% (range 18.3% to 58.3%) ( Table 1 ).…

Show Full Abstract

The global prevalence and spread of multidrug-resistant organisms (MDROs) represent an emerging public health threat. Day care centre (DCC) attendance is a risk factor for MDRO carriage in children and their environment. This study aimed to map the epidemiology of carriage and potential transmission of these organisms within 18 Flemish DDCs (Belgium). An MDRO prevalence survey was organised between November 2018 and February 2019 among children attending the centres. Selective chromogenic culture media were used for the detection of extended-spectrum beta-lactamase-producing <i>Enterobacterales</i> (ESBL-E), carbapenemase-producing <i>Enterobacterales</i> (CPE), and vancomycin-resistant Enterococci (VRE) in faecal swabs obtained from diapers or jars (n = 448). All isolated MDROs were subjected to resistance gene sequencing. A total of 71 of 448 samples (15.8%) yielded isolates of ESBL-E with a predominance of <i>Escherichia coli</i> (92.2% of ESBL-E) and ESBL resistance gene bla<sub>CTX-M-15</sub> (50.7% of ESBL coding genes in <i>E. coli</i>). ESBL-E prevalence varied between DCCs, ranging from 0 to 50%. Transmission, based on the clonal relatedness of ESBL-E strains, was observed. CPE was identified in only one child carrying an <i>E. coli</i> with an OXA-244 gene. VRE was absent from all samples. The observed prevalence of ESBL-E in Flemish DCCs is high compared with previous studies, and our findings re-emphasise the need for rigorous hygiene measures within such centres to control the further spread of MDROs in the community.

SOX6
Also flagged:gene expressionneurodegenerative disordershistonecell proliferationglutamatemyelin
Journal Article 2023-09-15 ✓ 1 Snippet Kozlenkov A, Vadukapuram R, Zhou P, Fam P, Wegner M, Dracheva S.
In-Text Gene Mentions

SOX6

Show Full Abstract

Oligodendrocyte precursor cells (OPCs) generate differentiated mature oligodendrocytes (MOs) during development. In adult brain, OPCs replenish MOs in adaptive plasticity, neurodegenerative disorders, and after trauma. The ability of OPCs to differentiate to MOs decreases with age and is compromised in disease. Here we explored the cell specific and age-dependent differences in gene expression and H3K27ac histone mark in these two cell types. H3K27ac is indicative of active promoters and enhancers. We developed a novel flow-cytometry-based approach to isolate OPC and MO nuclei from human postmortem brain and profiled gene expression and H3K27ac in adult and infant OPCs and MOs genome-wide. In adult brain, we detected extensive H3K27ac differences between the two cell types with high concordance between gene expression and epigenetic changes. Notably, the expression of genes that distinguish MOs from OPCs appears to be under a strong regulatory control by the H3K27ac modification in MOs but not in OPCs. Comparison of gene expression and H3K27ac between infants and adults uncovered numerous developmental changes in each cell type, which were linked to several biological processes, including cell proliferation and glutamate signaling. A striking example was a subset of histone genes that were highly active in infant samples but fully lost activity in adult brain. Our findings demonstrate a considerable rearrangement of the H3K27ac landscape that occurs during the differentiation of OPCs to MOs and during postnatal development of these cell types, which aligned with changes in gene expression. The uncovered regulatory changes justify further in-depth epigenetic studies of OPCs and MOs in development and disease.

Also flagged:Proteasomeartemisininpeptidesvinylsulfoneepoxyketone
Journal Article 2023-09-15 No Snippets Bennett JM, Ward KE, Muir RK, Kabeche S, Yoo E, Yeo T, Lam G, Zhang H, Almaliti J, Berger G, Faucher FF, Lin G, Gerwick WH, Yeh E, Fidock DA, Bogyo M.
Show Full Abstract

The <i>Plasmodium</i> proteasome is a promising antimalarial drug target due to its essential role in all parasite lifecycle stages. Furthermore, proteasome inhibitors have synergistic effects when combined with current first-line artemisinin and related analogues. Linear peptides that covalently inhibit the proteasome are effective at killing parasites and have a low propensity for inducing resistance. However, these scaffolds generally suffer from poor pharmacokinetics and bioavailability. Here we describe the development of covalent, irreversible, macrocyclic inhibitors of the <i>Plasmodium falciparum</i> proteasome. We identified compounds with excellent potency and low cytotoxicity; however, the first generation suffered from poor microsomal stability. Further optimization of an existing macrocyclic scaffold resulted in an irreversible covalent inhibitor carrying a vinyl sulfone electrophile that retained high potency and low cytotoxicity and had acceptable metabolic stability. Importantly, unlike the parent reversible inhibitor that selected for multiple mutations in the proteasome, with one resulting in a 5,000-fold loss of potency, the irreversible analogue only showed a 5-fold loss in potency for any single point mutation. Furthermore, an epoxyketone analogue of the same scaffold retained potency against a panel of known proteasome mutants. These results confirm that macrocycles are optimal scaffolds to target the malarial proteasome and that the use of a covalent electrophile can greatly reduce the ability of the parasite to generate drug resistance mutations.

HTT
Also flagged:-SplicingHuntingtinHuntington's DiseaseHDbenzamidepyrazine
Journal Article 2023-09-15 ✓ 1 Snippet Liu L, Malagu K, Haughan AF, Khetarpal V, Stott AJ, Esmieu W, Vater HD, Webster SJ, Van de Poël AJ, Clissold C, Cosgrove B, Sutton B, Spencer JA, Breccia P, Gancia E, Bonomo S, Ladduwahetty T, Lazari O, Patel H, Atton HC, Clifton S, Mota DM, Magnani D, O'Neill A, Stebbeds M, Macabuag N, Todd D, Herva ME, Mitchell P, Visser M, Compte Sancerni S, Grand Moursel L, da Silva M, Kritikou E, Heikkinen TT, Bolkvadze T, Fodale V, Spadafora D, Daldin M, Bresciani A, Mangette JE, Doherty EM, Lee MR, Herbst T, Monteagudo E, Macdonald D, Plotnikov NV, Chambers M, McAllister G, Muňoz-Sanjuan I, Dominguez C.
In-Text Gene Mentions

Huntington's disease (HD) is caused by an expanded CAG trinucleotide repeat in exon 1 of the huntingtin (<i>HTT</i>) gene.

Show Full Abstract

Huntington's disease (HD) is caused by an expanded CAG trinucleotide repeat in exon 1 of the huntingtin (<i>HTT</i>) gene. We report the design of a series of <i>HTT</i> pre-mRNA splicing modulators that lower huntingtin (HTT) protein, including the toxic mutant huntingtin (mHTT), by promoting insertion of a pseudoexon containing a premature termination codon at the exon 49-50 junction. The resulting transcript undergoes nonsense-mediated decay, leading to a reduction of <i>HTT</i> mRNA transcripts and protein levels. The starting benzamide core was modified to pyrazine amide and further optimized to give a potent, CNS-penetrant, and orally bioavailable <i>HTT</i>-splicing modulator <b>27</b>. This compound reduced canonical splicing of the <i>HTT</i> RNA exon 49-50 and demonstrated significant HTT-lowering in both human HD stem cells and mouse BACHD models. Compound <b>27</b> is a structurally diverse <i>HTT</i>-splicing modulator that may help understand the mechanism of adverse effects such as peripheral neuropathy associated with branaplam.

NEGR1
Also flagged:Cas9DNA repairDNA Repair ProteinsCtIPhost cellsreverse transcriptase
Journal Article 2023-09-15 ✓ 5 Snippets Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A.
In-Text Gene Mentions

…growth regulator 1 (Negr1), a protein with…

…33Negr1knockin differs from…

…cells will expressNegr1, 34 and some…

…efficiency on theNegr1locus compared to…

…variably expressed locusNegr1did not show…

Show Full Abstract

Cas9 targets genomic loci with high specificity. For knockin with double-strand break repair, however, Cas9 often leads to unintended on-target knockout rather than intended edits. This imprecision is a barrier for direct <i>in vivo</i> editing where clonal selection is not feasible. In this study, we demonstrate a high-throughput workflow to comparatively assess on-target efficiency and precision of editing outcomes. Using this workflow, we screened combinations of donor DNA and Cas9 variants, as well as fusions to DNA repair proteins. This yielded novel high-performance double-strand break repair editing agents and combinatorial optimizations, yielding increases in knockin efficiency and precision. Cas9-RC, a novel fusion Cas9 flanked by eRad18 and CtIP<sup>[HE]</sup>, increased knockin performance <i>in vitro</i> and <i>in vivo</i> in the developing mouse brain. Continued comparative assessment of editing efficiency and precision with this framework will further the development of high-performance editing agents for <i>in vivo</i> knockin and future genome therapeutics.

TNFSF4
Also flagged:NSCLCtumorNF-κBPD-1Lung tumortumor-associated antigen
Journal Article 2023-09-15 ✓ 1 Snippet Dykema AG, Zhang J, Cheung LS, Connor S, Zhang B, Zeng Z, Cherry CM, Li T, Caushi JX, Nishimoto M, Munoz AJ, Ji Z, Hou W, Zhan W, Singh D, Zhang T, Rashid R, Mitchell-Flack M, Bom S, Tam A, Ionta N, Aye THK, Wang Y, Sawosik CA, Tirado LE, Tomasovic LM, VanDyke D, Spangler JB, Anagnostou V, Yang S, Spicer J, Rayes R, Taube J, Brahmer JR, Forde PM, Yegnasubramanian S, Ji H, Pardoll DM, Smith KN.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Regulatory T cells (T<sub>reg</sub>) are conventionally viewed as suppressors of endogenous and therapy-induced antitumor immunity; however, their role in modulating responses to immune checkpoint blockade (ICB) is unclear. In this study, we integrated single-cell RNA-seq/T cell receptor sequencing (TCRseq) of >73,000 tumor-infiltrating T<sub>reg</sub> (TIL-T<sub>reg</sub>) from anti-PD-1-treated and treatment-naive non-small cell lung cancers (NSCLC) with single-cell analysis of tumor-associated antigen (TAA)-specific T<sub>reg</sub> derived from a murine tumor model. We identified 10 subsets of human TIL-T<sub>reg</sub>, most of which have high concordance with murine TIL-T<sub>reg</sub> subsets. Only one subset selectively expresses high levels of <i>TNFRSF4</i> (OX40) and <i>TNFRSF18</i> (GITR), whose engangement by cognate ligand mediated proliferative programs and NF-κB activation, as well as multiple genes involved in T<sub>reg</sub> suppression, including <i>LAG3</i>. Functionally, the OX40<sup>hi</sup>GITR<sup>hi</sup> subset is the most highly suppressive ex vivo, and its higher representation among total TIL-T<sub>reg</sub> correlated with resistance to PD-1 blockade. Unexpectedly, in the murine tumor model, we found that virtually all TIL-T<sub>reg</sub>-expressing T cell receptors that are specific for TAA fully develop a distinct T<sub>H</sub>1-like signature over a 2-week period after entry into the tumor, down-regulating <i>FoxP3</i> and up-regulating expression of <i>TBX21 (</i>Tbet)<i>, IFNG</i>, and certain proinflammatory granzymes. Transfer learning of a gene score from the murine TAA-specific T<sub>H</sub>1-like T<sub>reg</sub> subset to the human single-cell dataset revealed a highly analogous subcluster that was enriched in anti-PD-1-responding tumors. These findings demonstrate that TIL-T<sub>reg</sub> partition into multiple distinct transcriptionally defined subsets with potentially opposing effects on ICB-induced antitumor immunity and suggest that TAA-specific TIL-T<sub>reg</sub> may positively contribute to antitumor responses.

TNFSF4
Also flagged:cancerantigen receptorsolid tumorstumordisulfiramcopper
Journal Article 2023-09-15 ✓ 1 Snippet Wang Y, Drum DL, Sun R, Zhang Y, Chen F, Sun F, Dal E, Yu L, Jia J, Arya S, Jia L, Fan S, Isakoff SJ, Kehlmann AM, Dotti G, Liu F, Zheng H, Ferrone CR, Taghian AG, DeLeo AB, Ventin M, Cattaneo G, Li Y, Jounaidi Y, Huang P, Maccalli C, Zhang H, Wang C, Yang J, Boland GM, Sadreyev RI, Wong L, Ferrone S, Wang X.
In-Text Gene Mentions

…ICOS, KLRK1, RORC,TNFSF4, and TNFSF8, in…

Show Full Abstract

The poor efficacy of chimeric antigen receptor T-cell therapy (CAR T) for solid tumors is due to insufficient CAR T cell tumor infiltration, in vivo expansion, persistence, and effector function, as well as exhaustion, intrinsic target antigen heterogeneity or antigen loss of target cancer cells, and immunosuppressive tumor microenvironment (TME). Here we describe a broadly applicable nongenetic approach that simultaneously addresses the multiple challenges of CAR T as a therapy for solid tumors. The approach reprograms CAR T cells by exposing them to stressed target cancer cells which have been exposed to the cell stress inducer disulfiram (DSF) and copper (Cu)(DSF/Cu) plus ionizing irradiation (IR). The reprogrammed CAR T cells acquire early memory-like characteristics, potent cytotoxicity, enhanced in vivo expansion, persistence, and decreased exhaustion. Tumors stressed by DSF/Cu and IR also reprogram and reverse the immunosuppressive TME in humanized mice. The reprogrammed CAR T cells, derived from peripheral blood mononuclear cells of healthy donors or metastatic female breast cancer patients, induce robust, sustained memory and curative anti-solid tumor responses in multiple xenograft mouse models, establishing proof of concept for empowering CAR T by stressing tumor as a promising therapy for solid tumors.

PEBP1
Also flagged:Ferroptosisironoxygenmembranephospholipidslipid
Journal Article 2023-09-15 ✓ 2 Snippets Oh M, Jang SY, Lee JY, Kim JW, Jung Y, Kim J, Seo J, Han TS, Jang E, Son HY, Kim D, Kim MW, Park JS, Song KH, Oh KJ, Kim WK, Bae KH, Huh YM, Kim SH, Kim D, Han BS, Lee SC, Hwang GS, Lee EW.
In-Text Gene Mentions

…000), FSP1 (sc-377120,1:1000),PEBP1(sc-376925,1:2000) and HSP90…

…FSP1, ACSL4, LPCAT3,PEBP1, FADS1, and ELOVL5…

Show Full Abstract

Arachidonic and adrenic acids in the membrane play key roles in ferroptosis. Here, we reveal that lipoprotein-associated phospholipase A2 (Lp-PLA2) controls intracellular phospholipid metabolism and contributes to ferroptosis resistance. A metabolic drug screen reveals that darapladib, an inhibitor of Lp-PLA2, synergistically induces ferroptosis in the presence of GPX4 inhibitors. We show that darapladib is able to enhance ferroptosis under lipoprotein-deficient or serum-free conditions. Furthermore, we find that Lp-PLA2 is located in the membrane and cytoplasm and suppresses ferroptosis, suggesting a critical role for intracellular Lp-PLA2. Lipidomic analyses show that darapladib treatment or deletion of PLA2G7, which encodes Lp-PLA2, generally enriches phosphatidylethanolamine species and reduces lysophosphatidylethanolamine species. Moreover, combination treatment of darapladib with the GPX4 inhibitor PACMA31 efficiently inhibits tumour growth in a xenograft model. Our study suggests that inhibition of Lp-PLA2 is a potential therapeutic strategy to enhance ferroptosis in cancer treatment.

Also flagged:infectious pulmonary diseasesCD4adaptive immunitylipoprotein lipasepulmonary diseasepneumonia
Journal Article 2023-09-15 No Snippets Staitieh BS, Hu X, Yeligar SM, Auld SC.
Show Full Abstract

People with HIV remain at greater risk for both infectious and non-infectious pulmonary diseases even after antiretroviral therapy initiation and CD4 cell count recovery. These clinical risks reflect persistent HIV-mediated defects in innate and adaptive immunity, including in the alveolar macrophage, a key innate immune effector in the lungs. In this proof-of-concept pilot study, we leveraged paired RNA-seq and ATAC-seq analyses of human alveolar macrophages obtained with research bronchoscopy from people with and without HIV to highlight the potential for recent methodologic advances to generate novel hypotheses about biological pathways that may contribute to impaired pulmonary immune function in people with HIV. In addition to 35 genes that were differentially expressed in macrophages from people with HIV, gene set enrichment analysis identified six gene sets that were differentially regulated. ATAC-seq analysis revealed 115 genes that were differentially accessible for people with HIV. Data-driven integration of the findings from these complementary, high-throughput techniques using xMWAS identified distinct clusters involving lipoprotein lipase and inflammatory pathways. By bringing together transcriptional and epigenetic data, this analytic approach points to several mechanisms, including previously unreported pathways, that warrant further exploration as potential mediators of the increased risk of pulmonary disease in people with HIV.

NEGR1
Also flagged:agingobesitycollagenwound healingskin cancerskin
Journal Article 2023-09-15 ✓ 2 Snippets Liu M, Feng J.
In-Text Gene Mentions

MR-PRESSO analysis identified five influential outlier which were the TFAP2B variant, rs987237 (outlier test p-value < 0.017), the faim2 variant rs7138803 (outlier test p-value = 0.153), the ETV5 variant rs9816226 (outlier test p-value = 0.493), a NEGR1 obesity locus rs7531118 (outlier test p-value < 0.017), and rs527248 (outlier test p-value = 0.017) which were also shown to be a clear outlier in both scatter and leave-one-out plots (Figs. 1 and 2).

…= 0.493), aNEGR1obesity locus rs7531118…

Show Full Abstract

<h4>Background</h4>Skin, as a sociologically meaningful interface, has psychological implications different from other organs, particularly in the context of the global population aging. Growing evidence suggests that facial aging is associated with an increased risk of adiposity. Existing research, however, were observational, and while they may find some correlations, it is difficult to simply disentangle non-causal or reverse-causal links because these associations may be confounded or fail to accurately reflect true causative linkages.<h4>Objectives</h4>We conducted a 2-sample Mendelian randomization (MR) study to examine the potential effect of facial aging on the risk of broad obesity and its three major adiposity indicators, including body mass index (BMI), body fat percentage (BF%) and waist circumference (WC).<h4>Methods</h4>Genetic instruments from IEU OpenGWAS project, one of the largest available genome-wide association studies (GWAS) for facial aging (423,999 samples) were used to investigate the relation to broad obesity (32,858 cases, 65,839 controls). Using the inverse-variance weighted (IVW) technique, single nucleotide polymorphisms (SNPs) associated with adiposity indicators (BMI (461,460 samples), BF% (454,633 samples), and WC (462,166 samples)) were investigated in relationship to facial aging. Further sensitivity analyses were performed, including Mendelian randomization-Egger (MR-Egger), weighted median estimates, and leave-one-out analysis, to evaluate the consistency of the results and related potential issues in MR studies.<h4>Results</h4>We identified strong and significant correlations between adiposity and facial aging in the 17 broad obesity-associated SNPs (IVW estimate of odds ratio OR = 1.020, 95% CI 1.010-1.029, P = 7.303e - 05), 458 BMI-associated SNPs (IVW estimate of odds ratio OR = 1.047, 95% CI 1.0357-1.058, P = 1.154e - 16),for the 395 BF%-associated SNPs (OR = 1.056, 95%CI 1.040-1.072,P = 7.617e - 12), or for the 374 WC-associated SNPs (OR = 1.072, 95% CI 1057-1.087,P = 1.229e - 23). A range of complementary methodologies have been employed to evaluate horizontal pleiotropy and related potential caveats occurring in MR research.<h4>Conclusions</h4>Using Mendelian randomization as an alternative approach to investigate causality, we found a causal relationship between adiposity and facial aging, which was statistically strong and significant.

HTT
Also flagged:Huntington's diseaseHD-dominantneurodegenerative diseasepolyglutaminepathogenesis
Journal Article 2023-09-15 ✓ 4 Snippets Tong H, Yang T, Liu L, Li C, Sun Y, Jia Q, Qin Y, Chen L, Zhao X, Zhou G, Yan S, Li XJ, Li S.
In-Text Gene Mentions

In this study, HTT exon1 production was examined in the HD knock-in (KI) pig model, which more closely recapitulates neuropathology seen in HD patient brains than HD mouse models.

Huntington's disease (HD) is an autosomal-dominant inherited neurodegenerative disease caused by a CAG repeat expansion in exon1 of the huntingtin gene (HTT).

…the huntingtin gene (HTT).…

…In this study,HTTexon1 production was…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant inherited neurodegenerative disease caused by a CAG repeat expansion in exon1 of the huntingtin gene (HTT). This expansion leads to the production of N-terminal mutant huntingtin protein (mHtt) that contains an expanded polyglutamine tract, which is toxic to neurons and causes neurodegeneration. While the production of N-terminal mHtt can be mediated by proteolytic cleavage of full-length mHtt, abnormal splicing of exon1-intron1 of mHtt has also been identified in the brains of HD mice and patients. However, the proportion of aberrantly spliced exon1 mHTT in relation to normal mHTT exon remains to be defined. In this study, HTT exon1 production was examined in the HD knock-in (KI) pig model, which more closely recapitulates neuropathology seen in HD patient brains than HD mouse models. The study revealed that aberrant spliced HTT exon1 is also present in the brains of HD pigs, but it is expressed at a much lower level than the normally spliced HTT exon products. These findings suggest that careful consideration is needed when assessing the contribution of aberrantly spliced mHTT exon1 to HD pathogenesis, and further rigorous investigation is required.

Also flagged:Amyloidosesfibrilspathogenesisamyloidosispeptidesantibodies
Journal Article 2023-09-15 No Snippets Fernández Ramírez MDC, Afrin S, Saelices L.
Show Full Abstract

Amyloidoses are fatal conditions associated with the aggregation of proteins into amyloid fibrils that deposit systemically and/or locally. Possibly because the causal mechanism of protein aggregation and deposition is not fully understood, this group of diseases remains uncurable. Advances in structural biology, such as the use of nuclear magnetic resonance and cryo-electron microscopy, have enabled the study of the structures and the conformational nature of the proteins whose aggregation is associated with the underlying pathogenesis of amyloidosis. As a result, the last years of research have translated into the development of directed therapeutic strategies that target the specific conformations of precursors, fibrils, and intermediary species. Current efforts include the use of small molecules, peptides, and antibodies. This review summarizes the recent progress in developing strategies that target specific protein conformations for the treatment of amyloidoses.

HTT
Also flagged:deathneurobiological disorderpsychiatric disordersserotonin-hydroxyindoleaceticacidbinding
Journal Article 2023-09-15 ✓ 1 Snippet Sivaramakrishnan S, Venkatesan V, Paranthaman SK, Sathianathan R, Raghavan S, Pradhan P.
In-Text Gene Mentions

…human serotonin transporter (5-HTT) protein [ 7…

Show Full Abstract

<h4>Objective</h4>Suicide is a significant public health issue and a major cause of death in all ages worldwide. Previous studies have shown the involvement of genetics in suicidal behaviour. This study aimed to assess the role of the genetic variants of the serotonin transporter genes (5HTTLPR, SLC6A4 intron 2) and receptor gene (5HTR2AT102C) in individuals who died of suicide. The study compares the serum levels of serotonin between the cases and controls.<h4>Methods</h4>We conducted a case-control study with 120 cases and 126 controls. Socio-economic details of the subjects were collected using a semi-structured proforma, and psychological autopsy was used to collect details of medical and other clinical conditions. Blood was drawn after taking informed consent and serum levels of serotonin were estimated by enzyme-linked immunosorbent assay. Genotyping was performed using appropriate primers followed by polymerase chain reaction and a restriction fragment length polymorphism.<h4>Results</h4>Mean age was 32.59 ± 12.58 for cases and 33.64 ± 9.78 for controls. The risk-associated LL genotype of 5HTTLPR was higher among cases. The heterozygous 12/10 genotype of SLC6A4 intron 2 polymorphism was increased among controls. Serum levels of serotonin were lower among cases. Variant genotypes of all the 3 polymorphisms showed significant interaction (OR = 39.26) indicating that this model may increase suicidal tendency.<h4>Conclusion</h4>The findings of this study suggest that low serum levels of serotonin and two variants of the serotonin gene may influence suicide behaviour in a south Indian population.

SERPINC1
Also flagged:COVID-19coagulopathyacute kidney injurycoagulationfibrinolysisglomerular filtration
Journal Article 2023-09-15 ✓ 1 Snippet Silva BCD, Cordioli RL, Santos BFCD, Guerra JCC, Rodrigues RDR, Souza GM, Ashihara C, Midega TD, Campos NS, Carneiro BV, Campos FND, Guimarães HP, Matos GFJ, Aranda VF, Ferraz LJR, Corrêa TD.
In-Text Gene Mentions

The potential link between lower antithrombin activity and AKI remains unclear, but growing evidence from clinical and experimental data suggests such an association, as lower antithrombin activity levels have been recently linked with AKI in elderly septic patients and after cardiac surgery.(49,52) Additionally, heterozygous knockout rats for the SerpinC1 gene (which encodes antithrombin) developed AKI following a renal ischemia/reperfusion injury model.(52) Moreover, in sepsis, reduced activity of endogenous coagulation inhibitors such as antithrombin, protein C, and S leads to a procoagulant condition.(53) Decreased levels of these inhibitors could contribute to prothrombotic and inflammatory conditions, potentially setting the stage for AKI development.

Show Full Abstract

<h4>Objective</h4>The incidence of thrombotic events and acute kidney injury is high in critically ill patients with COVID-19. We aimed to evaluate and compare the coagulation profiles of patients with COVID-19 developing acute kidney injury versus those who did not, during their intensive care unit stay.<h4>Methods</h4>Conventional coagulation and platelet function tests, fibrinolysis, endogenous inhibitors of coagulation tests, and rotational thromboelastometry were conducted on days 0, 1, 3, 7, and 14 following intensive care unit admission.<h4>Results</h4>Out of 30 patients included, 13 (43.4%) met the criteria for acute kidney injury. Comparing both groups, patients with acute kidney injury were older: 73 (60-84) versus 54 (47-64) years, p=0.027, and had a lower baseline glomerular filtration rate: 70 (51-81) versus 93 (83-106) mL/min/1.73m2, p=0.004. On day 1, D-dimer and fibrinogen levels were elevated but similar between groups: 1780 (1319-5517) versus 1794 (726-2324) ng/mL, p=0.145 and 608 (550-700) versus 642 (469-722) g/dL, p=0.95, respectively. Rotational thromboelastometry data were also similar between groups. However, antithrombin activity and protein C levels were lower in patients who developed acute kidney injury: 82 (75-92) versus 98 (90-116), p=0.028 and 70 (52-82) versus 88 (78-101) µ/mL, p=0.038, respectively. Mean protein C levels were lower in the group with acute kidney injury across multiple time points during their stay in the intensive care unit.<h4>Conclusion</h4>Critically ill patients experiencing acute kidney injury exhibited lower endogenous anticoagulant levels. Further studies are needed to understand the role of natural anticoagulants in the pathophysiology of acute kidney injury within this population.

SERPINC1
Also flagged:Serine proteaseSERPINSserine proteasescoagulationformationcomplement activation
Journal Article 2023-09-15 ✓ 1 Snippet Varkoly K, Beladi R, Hamada M, McFadden G, Irving J, Lucas AR.
In-Text Gene Mentions

…to 1000-fold (AT,SERPINC1), making it a…

Show Full Abstract

Serine protease inhibitors, SERPINS, are a highly conserved family of proteins that regulate serine proteases in the central coagulation and immune pathways, representing 2-10% of circulating proteins in the blood. Serine proteases form cascades of sequentially activated enzymes that direct thrombosis (clot formation) and thrombolysis (clot dissolution), complement activation in immune responses and also programmed cell death (apoptosis). Virus-derived serpins have co-evolved with mammalian proteases and serpins, developing into highly effective inhibitors of mammalian proteolytic pathways. Through interacting with extracellular and intracellular serine and cysteine proteases, viral serpins provide a new class of highly active virus-derived coagulation-, immune-, and apoptosis-modulating drug candidates. Viral serpins have unique characteristics: (1) function at micrograms per kilogram doses; (2) selectivity in targeting sites of protease activation; (3) minimal side effects at active concentrations; and (4) the demonstrated capacity to be modified, or fine-tuned, for altered protease targeting. To date, the virus-derived serpin class of biologics has proven effective in a wide range of animal models and in one clinical trial in patients with unstable coronary disease. Here, we outline the known viral serpins and review prior studies with viral serpins, considering their potential for application as new sources for immune-, coagulation-, and apoptosis-modulating therapeutics.

Also flagged:Colorectal cancercancerdeathtumoradenomacarcinoma
Journal Article 2023-09-15 No Snippets Kasprzak A.
Show Full Abstract

Colorectal cancer (CRC) is one of the most common and severe malignancies worldwide. Recent advances in diagnostic methods allow for more accurate identification and detection of several molecular biomarkers associated with this cancer. Nonetheless, non-invasive and effective prognostic and predictive testing in CRC patients remains challenging. Classical prognostic genetic markers comprise mutations in several genes (e.g., <i>APC</i>, <i>KRAS/BRAF</i>, <i>TGF-β,</i> and <i>TP53</i>). Furthermore, CIN and MSI serve as chromosomal markers, while epigenetic markers include CIMP and many other candidates such as <i>SERP</i>, <i>p14</i>, <i>p16</i>, <i>LINE-1</i>, and <i>RASSF1A</i>. The number of proliferation-related long non-coding RNAs (e.g., SNHG1, SNHG6, MALAT-1, CRNDE) and microRNAs (e.g., miR-20a, miR-21, miR-143, miR-145, miR-181a/b) that could serve as potential CRC markers has also steadily increased in recent years. Among the immunohistochemical (IHC) proliferative markers, the prognostic value regarding the patients' overall survival (OS) or disease-free survival (DFS) has been confirmed for thymidylate synthase (TS), cyclin B1, cyclin D1, proliferating cell nuclear antigen (PCNA), and Ki-67. In most cases, the overexpression of these markers in tissues was related to worse OS and DFS. However, slowly proliferating cells should also be considered in CRC therapy (especially radiotherapy) as they could represent a reservoir from which cells are recruited to replenish the rapidly proliferating population in response to cell-damaging factors. Considering the above, the aim of this article is to review the most common proliferative markers assessed using various methods including IHC and selected molecular biology techniques (e.g., qRT-PCR, in situ hybridization, RNA/DNA sequencing, next-generation sequencing) as prognostic and predictive markers in CRC.

HTT
Also flagged:Protein misfolding disordersPMDspeptidesamyloidosistauamyloid-beta peptide
Journal Article 2023-09-15 ✓ 2 Snippets Kachkin DV, Lashkul VV, Gorsheneva NA, Fedotov SA, Rubel MS, Chernoff YO, Rubel AA.
In-Text Gene Mentions

These include tau protein and amyloid-beta peptide (Aβ) in Alzheimer’s disease (AD) [3], huntingtin (Htt) in Huntington’s disease (HD) [4], α-synuclein in Parkinson’s disease (PD) [5], islet amyloid polypeptide (IAPP), or amylin in type 2 diabetes mellitus (T2DM) [6], TDP-43 in amyotrophic lateral sclerosis (ALS) [7] and frontotemporal dementia (FTD) [7], and prion protein (PrP) in transmissible spongiform encephalopathies or TSEs [8].

…3 ], huntingtin (Htt) in Huntington’s disease…

Show Full Abstract

Numerous studies have demonstrated that people with type 2 diabetes mellitus (associated with IAPP peptide aggregation) show an increased incidence of Alzheimer's disease (associated with Aβ aggregation), but the mechanism responsible for this correlation is presently unknown. Here, we applied a yeast-based model to study the interactions of IAPP with PrP (associated with TSEs) and with the Aβ42 peptide. We demonstrated that fluorescently tagged IAPP forms detergent-resistant aggregates in yeast cells. Using the FRET approach, we showed that IAPP and Aβ aggregates co-localize and physically interact in yeast cells. We also showed that this interaction is specific and that there is no interaction between IAPP and PrP in the yeast system. Our data confirmed a direct physical interaction between IAPP and Aβ42 aggregates in a living cell. Based on these findings, we hypothesize that this interaction may play a crucial role in seeding Aβ42 aggregation in T2DM patients, thereby promoting the development of AD.

PRDX6
Also flagged:cognitive impairmentbehavioralneurodegenerative diseasesMemory ImpairmentADPD
Journal Article 2023-09-15 ✓ 1 Snippet Di Paolo M, Corsi F, Cerri C, Bisti S, Piano I, Gargini C.
In-Text Gene Mentions

…Sod1, Sod2, andPrdx6, while the down-regulated…

Show Full Abstract

A mechanism shared by most neurodegenerative diseases, like Alzheimer's disease (AD) and Parkinson's disease (PD), is neuroinflammation. It has been shown to have a link between cognitive impairment and retinal function under neuroinflammatory conditions, confirming the essential role of the retina as a window to the brain. Here, we characterize a mouse model of LPS-induced neuroinflammation describing the parallel deterioration of both memory and visual function. Then, we demonstrate, using the Novel Object Recognition test (NOR) and electroretinogram (ERG) recordings, that preventive, chronic treatment with saffron Repron<sup>®</sup> is able to reduce the neuroinflammation process and prevent the impairment of both cognitive and visual function. The improvement in behavioral and visual function is confirmed by the pattern of expression of neuroinflammation-related genes and related proteins where pre-treatment with Repron<sup>®</sup> saffron presents a positive modulation compared with that obtained in animals treated with LPS alone. These results hold for retinal tissue and partially in the brain, where it appears that the onset of damage was delayed. This trend underlines the critical role of the retina as a most sensitive portion of the central nervous system to LPS-induced damage and could be used as a "sensor" for the early detection of neurodegenerative diseases such as Alzheimer's.

VRK2
Also flagged:epilepsyCOVID-19COVID-19 infectiongeneralized epilepsyfocal epilepsySMEK2
Journal Article 2023-09-15 ✓ 5 Snippets You M, Yuan P, Li L, Li B, Peng Z, Xu H.
In-Text Gene Mentions

Further, FUMA analysis identified six overlapping genes, including SMEK2, PNPT1, EFEMP1, CCDC85A, VRK2, and BCL11A, shared between COVID-19 and epilepsy.

The VRK2 gene, primarily expressed in the brain, functions as a mediator of signaling pathways that regulate tumor cell growth and apoptosis.

While the impact of SMEK2, PNPT1, EFEMP1, CCDC85A, VRK2, and BCL11A risk genes on the causal relationship between COVID-19 and epilepsy remains uncertain, this study’s findings offer valuable insights for future mechanistic research, as these genes could be involved in the shared genetic and etiological basis of the two conditions.

Of these, 6 genes were found to be shared between COVID-19 and epilepsy, including SMEK2, PNPT1, EFEMP1, CCDC85A, VRK2, and BCL11A, all located on chromosome 2 (Figure 4).

Since apoptosis plays a crucial role in the development of both COVID-19 and epilepsy (Henshall and Simon, 2005; Aghagoli et al., 2021), VRK2 may contribute to the disease mechanism through its apoptosis mechanism.

Show Full Abstract

<h4>Objective</h4>A multitude of observational studies have underscored a substantial comorbidity between COVID-19 and epilepsy. This study was aimed at establishing a conclusive causal link between these two conditions.<h4>Methods</h4>We employed Mendelian randomization (MR) to evaluate the causal link between COVID-19 and epilepsy, as well as its focal and generalized subtypes. The GWAS for epilepsy and its subtypes database were abstracted from both FinnGen consortium and ILAE. Additionally, we leveraged functional mapping and annotation (FUMA) to integrate information from genome-wide association studies (GWAS) results.<h4>Results</h4>The MR analyses revealed that genetic liability to COVID-19 infection conferred a causal effect on epilepsy [FinnGen: OR: 1.5306; 95% confidence interval (CI): 1.1676-2.0062, <i>P</i><sub><i>FDR</i></sub> (false discovery rate) = 0.0076; ILAE: OR: 1.3440; 95% CI: 1.0235-1.7649, <i>P<sub><i>FDR</i></sub></i> = 0.0429], and generalized epilepsy (FinnGen: OR: 2.1155; 95% CI: 1.1734-3.8139, <i>P<sub><i>FDR</i></sub></i> = 0.0327; ILAE: OR: 1.1245; 95% CI: 1.0444-1.2108, <i>P<sub><i>FDR</i></sub></i> = 0.0114). Genetic liability to COVID-19 hospitalization conferred a causal effect on epilepsy (FinnGen: OR: 1.0934; 95% CI: 1.0097-1.1841, <i>P<sub><i>FDR</i></sub></i> = 0.0422; ILAE: OR: 1.7381; 95% CI: 1.0467-2.8862, <i>P<sub><i>FDR</i></sub></i> = 0.0451), focal epilepsy (ILAE: OR: 1.7549; 95% CI: 1.1063-2.7838, <i>P<sub><i>FDR</i></sub></i> = 0.0338), and generalized epilepsy (ILAE: OR: 1.1827; 95% CI: 1.0215-1.3693, <i>P<sub><i>FDR</i></sub></i> = 0.0406). Genetic liability to COVID-19 severity conferred a causal effect on epilepsy (FinnGen consortium: OR: 1.2454; 95% CI: 1.0850-1.4295, <i>P<sub><i>FDR</i></sub></i> = 0.0162; ILAE: OR: 1.2724; 95% CI: 1.0347-1.5647, <i>P<sub><i>FDR</i></sub></i> = 0.0403), focal epilepsy (FinnGen: OR: 1.6818; 95% CI: 1.1478-2.4642, <i>P<sub><i>FDR</i></sub></i> = 0.0231; ILAE: OR: 1.6598; 95% CI: 1.2572-2.1914, <i>P<sub><i>FDR</i></sub></i> = 0.0054), and generalized epilepsy (FinnGen: OR: 1.1486; 95% CI: 1.0274-1.2842, <i>P<sub><i>FDR</i></sub></i> = 0.0335; ILAE: OR: 1.0439; 95% CI: 1.0159-1.0728, <i>P<sub><i>FDR</i></sub></i> = 0.0086). In contrast, no causal linkage of epilepsy on COVID-19 was observed. Further, FUMA analysis identified six overlapping genes, including <i>SMEK2</i>, <i>PNPT1</i>, <i>EFEMP1</i>, <i>CCDC85A</i>, <i>VRK2</i>, and <i>BCL11A</i>, shared between COVID-19 and epilepsy. Tissue-specific expression analyses revealed that the disease-gene associations of COVID-19 were significantly enriched in lung, ovary, and spleen tissue compartments, while being significantly enriched in brain tissue for epilepsy.<h4>Conclusion</h4>Our study demonstrates that COVID-19 can be a contributing factor to epilepsy, but we found no evidence that epilepsy contributes to COVID-19.

Also flagged:head and neck squamous cell carcinomaHNSCChead and neck cancertumorsDendrimersCancer
Journal Article 2023-09-15 No Snippets Sun Q, Chen X, Luo H, Meng C, Zhu D.
Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is the major pathological type of head and neck cancer (HNC). The disease ranks sixth among the most common malignancies worldwide, with an increasing incidence rate yearly. Despite the development of therapy, the prognosis of HNSCC remains unsatisfactory, which may be attributed to the resistance to traditional radio-chemotherapy, relapse, and metastasis. To improve the diagnosis and treatment, the targeted therapy for HNSCC may be successful as that for some other tumors. Nanocarriers are the most effective system to deliver the anti-cancerous agent at the site of interest using passive or active targeting approaches. The system enhances the drug concentration in HCN target cells, increases retention, and reduces toxicity to normal cells. Among the different techniques in nanotechnology, quantum dots (QDs) possess multiple fluorescent colors emissions under single-source excitation and size-tunable light emission. Dendrimers are the most attractive nanocarriers, which possess the desired properties of drug retention, release, unaffecting by the immune system, blood circulation time enhancing, and cells or organs specific targeting properties. In this review, we have discussed the up-to-date knowledge of the Cancer Stem Cells of Head and Neck Squamous Cell Carcinoma. Although a lot of data is available, still much more efforts remain to be made to improve the treatment of HNSCC.

Also flagged:Neurogenesisneurological disordersbrain developmentneurodevelopmental diseasesneurodegenerative diseasesmood disorders
Journal Article 2023-09-15 No Snippets Zhang R, Quan H, Wang Y, Luo F.
Show Full Abstract

Neurogenesis, the process of generating neurons from neural stem cells, occurs during both embryonic and adult stages, with each stage possessing distinct characteristics. Dysfunction in either stage can disrupt normal neural development, impair cognitive functions, and lead to various neurological disorders. Recent technological advancements in single-cell multiomics and gene-editing have facilitated investigations into primate neurogenesis. Here, we provide a comprehensive overview of neurogenesis across rodents, non-human primates, and humans, covering embryonic development to adulthood and focusing on the conservation and diversity among species. While non-human primates, especially monkeys, serve as valuable models with closer neural resemblance to humans, we highlight the potential impacts and limitations of non-human primate models on both physiological and pathological neurogenesis research.

SERPINC1
Also flagged:lung cancerbronchial lung cancercoagulationlung adenocarcinomalung squamous cell carcinomaepidermal growth factor receptor
Journal Article 2023-09-15 ✓ 3 Snippets Xu K, Wang H, Li S, Zhao L, Liu X, Liu Y, Ye L, Liu X, Li L, He Y.
In-Text Gene Mentions

…antithrombin III activity (ATIII:A, 105.0% [94.0–115.0%] vs.…

…s) and lowATIII:A (104.0% [94.0–114.0%]) valu…

…[1.02–1.08]) and highATIII:A (109.0% [99.5–120.3%]) valu…

Show Full Abstract

<h4>Background</h4>Although examinations and therapies for bronchial lung cancer, also called lung cancer (LC), have become more effective and precise, the morbidity and mortality of LC remain high worldwide. Describing the changing profile of LC characteristics over time is indispensable. This study aimed to understand the changes in real-world settings of LC and its characteristics in China.<h4>Methods</h4>In this study, 119,785 patients were enrolled from 2012 to 2020 in the Shanghai Pulmonary Hospital. The patients' medical records were extracted from the hospital's database. Demographic characteristics, general clinicopathological information, and blood coagulation indices at the initial diagnoses were analyzed using the Kruskal-Wallis, Nemenyi, chi-squared, and Bonferroni tests. Changes in demographic characteristics during the 8-year study period, namely dynamic changes among different stages and different pathological types, were evaluated.<h4>Results</h4>The percentages of female (from 38.50% [323/839] in 2012 to 48.29% [5112/10,585] in 2020) and non-smoking LC (from 69.34% [475/685] to 80.48% [8055/10,009]) patients increased significantly during the study period, with a trend toward a younger age at diagnosis (from 3.58% [30/839] to 8.99% [952/10,585]). Over the study period, the proportion and absolute number of lung adenocarcinoma cases increased (from 67.97% [433/637] to 76.31% [6606/8657]) while the proportion of lung squamous cell carcinoma decreased (from 21.19% [135/637] to 12.08% [1046/8657]). Comprehensive driver gene mutation examination became more common, and epidermal growth factor receptor (<i>EGFR</i>) mutation occurred more frequently in female <i>vs.</i> male (62.03% [12793/20625] <i>vs.</i> 29.90% [8207/27,447]) and non-smoking <i>vs.</i> smoking (53.54% [17,203/32,134] <i>vs.</i> 23.73% [3322/13,997]) patients (both <i>P</i> < 0.001). The distribution of the common driver genes differed among different stages of LC. <i>EGFR</i> mutation was detected most frequently at each stage, and other driver gene alterations were more common in advanced stages (<i>P</i> <0.001). The combination of chemotherapy, targeted therapy, and immunotherapy, as a comprehensive management regimen, gradually became predominant over the study period (P < 0.001). A hypercoagulable state was shown in advanced-stage LC patients and patients with the anaplastic lymphoma kinase fusion, indicated by significantly elevated levels of d-dimer, fibrinogen, and fibrinogen degradation products.<h4>Conclusions</h4>This study comprehensively depicted the changing characteristics of Chinese LC patients over an 8-year period to provide preliminary insights into LC treatment.Trial registration: ClinicalTrials.gov, NCT05423236.

Research Square 2023-09-15 Preprint (No Snippets API) de Paiva IHR, Silva RSd, Mendonça IP, Maciel LM, de Souza JRB, Peixoto CA.
Show Full Abstract

<title>Abstract</title> <p>Newly conducted research suggests that metabolic disorders, like diabetes and obesity, play a significant role as risk factors for psychiatric disorders. This connection presents a potential avenue for creating novel antidepressant medications by repurposing drugs originally developed to address antidiabetic conditions. Earlier investigations have shown that GLP-1 analogs exhibit neuroprotective qualities in various models of neurological diseases, encompassing conditions such as Alzheimer's disease, Parkinson's disease, and stroke. Moreover, GLP-1 analogs have demonstrated the capability to enhance neurogenesis, a process recognized for its significance in memory formation and the cognitive and emotional aspects of information processing. Nonetheless, whether semaglutide holds efficacy as both an antidepressant and anxiolytic agent remains uncertain. To address this, our study focused on a mouse model of depression linked to type 2 diabetes induced by a High Fat Diet (HFD). In this model, we administered semaglutide (0.05mg/Kg intraperitoneally) on a weekly basis to evaluate its potential as a therapeutic option for depression and anxiety. Diabetic mice had higher blood glucose, lipidic profile, and insulin resistance. Moreover, mice fed HFD showed higher serum IL-1β and LPS associated with impaired humor and cognition. The analysis of behavioral responses revealed that the administration of Semaglutide effectively mitigated depressive- and anxiety-like behaviors, concurrently demonstrating an enhancement in cognitive function. Additionally, Semaglutide treatment protected synaptic plasticity and reversed the hippocampal neuroinflammation induced by HFD fed, improving activation of the insulin pathway, demonstrating the protective effects of Semaglutide. We also found that Semaglutide treatment decreased astrogliosis and microgliosis in the dentate gyrus region of the hippocampus. In addition, Semaglutide prevented the DM2-induced impairments of POMC, and GPR43 and simultaneously increased the NeuN + and GLP-1R + neurons in the hippocampus. Our data also showed that Semaglutide increased the 5-HT and its receptor (5-HTT) and glutamatergic receptors in the hippocampus. At last, Semaglutide changed the gut microbiota profile (increasing Bacterioidetes, Bacteroides acidifaciens, and Blautia coccoides) and decreased leaky gut, improving the gut-brain axis. Taken together, Semaglutide has the potential to act as a therapeutic tool for depression and anxiety.</p>

Research Square 2023-09-15 Preprint (No Snippets API) LI X, CHEN L, DAI P, LIU L, CHEN Y, LU Y, Zheng L, WANG H, YUAN Q.
Show Full Abstract

<title>Abstract</title> <p>Abnormalities in ether lipid metabolism as well as neutrophil extracellular trap formation are recently identified as adverse factors affecting tumorigenesis and progression. However, the role of abnormal ether lipid metabolism in colorectal cancer (CRC) evolution has not been reported. Here, we show that the lipid metabolism-related gene, enoyl-CoA delta isomerase 2 (ECI2), plays a tumor-suppressive role in CRC and is negatively associated with poor prognosis in CRC patients. Mechanistically, we demonstrate that ECI2 inhibits ether lipogenesis by restraining the peroxisomal localization of AGPS, the rate-limiting enzyme in ether lipid synthesis. This subsequently suppresses IL-8-mediated neutrophil recruitment and extracellular trap formation, ultimately leading to inhibition of CRC proliferation and metastasis. These findings not only enhance our comprehension of the role of metabolic reprogramming and neutrophil interactions in CRC development, but also offer novel insights for identifying potential diagnostic markers and therapeutic targets for CRC.</p>

Also flagged:visionVEGFverteporfinAge‐Related Macular DegenerationChoroidal neovascularizationwet age‐related macular degeneration
Journal Article 2023-09-14 No Snippets Xu S, Cui K, Long K, Li J, Fan N, Lam WC, Liang X, Wang W.
Show Full Abstract

Choroidal neovascularization (CNV) is the key pathological event of wet age-related macular degeneration (wAMD) leading to irreversible vision loss. Currently, anti-angiogenic therapy with anti-vascular endothelial growth factor (VEGF) agents has become the standard treatment for wAMD, while it is still subject to several limitations, including the safety concerns of monthly intravitreal administration and insufficient efficacy for neovascular occlusion. Combined therapy with photodynamic therapy (PDT) and anti-angiogenic agents has emerged as a novel treatment paradigm. Herein, a novel and less-invasive approach is reported to achieve anti-angiogenic and photodynamic combination therapy of wAMD by intravenous administration of a photoactivatable nanosystem (Di-DAS-VER NPs). The nanosystem is self-assembled by reactive oxygen species (ROS)-sensitive dasatinib (DAS) prodrug and photosensitizer verteporfin (VER). After red-light irradiation to the diseased eyes, intraocular release of anti-angiogenic DAS is observed, together with selective neo-vessels occlusion by VER-generated ROS. Notably, Di-DAS-VER NPs demonstrates promising therapeutic efficacy against CNV with minimized systemic toxicity. The study enables an efficient intravenous wAMD therapy by integrating a photoactivation process with combinational therapeutics into one simple nanosystem.

Also flagged:elastin-like polypeptidesvesiclesPolypeptidemetabolismreproductiontranslation-associated proteins
Journal Article 2023-09-14 No Snippets de Haas RJ, Ganar KA, Deshpande S, de Vries R.
Show Full Abstract

Biomolecular condensates are macromolecular complexes formed by liquid-liquid phase separation. They regulate key biological functions by reversibly compartmentalizing molecules in cells, in a stimulus-dependent manner. Designing stimuli-responsive synthetic condensates is crucial for engineering compartmentalized synthetic cells that are able to mimic spatiotemporal control over the biochemical reactions. Here, we design and test a family of condensate-forming, pH-responsive elastin-like polypeptides (ELPs) that form condensates above critical pH values ranging between 4 and 7, for temperatures between 20 and at 37 °C. We show that the condensation occurs rapidly, in sharp pH intervals (ΔpH < 0.3). For eventual applications in engineering synthetic cell compartments, we demonstrate that multiple types of pH-responsive ELPs can form mixed condensates inside micron-sized vesicles. When genetically fused with enzymes, receptors, and signaling molecules, these pH-responsive ELPs could be potentially used as pH-switchable functional condensates for spatially controlling biochemistry in engineered synthetic cells.

Also flagged:immunodeficiencyopportunistic infectionsCD4severeAIDSinfection
Journal Article 2023-09-14 No Snippets Sornillo JB, Ditangco R, Kinikar A, Wati DK, Du QT, Nguyen DQ, Khol V, Nguyen LV, Puthanakit T, Ounchanum P, Kurniati N, Chokephaibulkit K, Jamal Mohamed TA, Sudjaritruk T, Fong SM, Kumarasamy N, Kosalaraksa P, Nallusamy RA, Nik Yusoff NK, Sohn AH, Kariminia A, TREAT Asia Pediatric HIV Observational Database of IeDEA Asia-Pacific.
Show Full Abstract

Despite improvements in HIV testing and earlier antiretroviral therapy (ART) initiation in children living with HIV through the years, a considerable proportion start treatment with advanced disease. We studied characteristics of children and adolescents living with HIV and their level of immunodeficiency at ART initiation using data from a multi-country Asian cohort. We included children and adolescents who were ART-naïve and <18 years of age at ART initiation from 2011 to 2020 at 17 HIV clinics in six countries. Incidence rates of opportunistic infections (OIs) in the first two years of triple-drug ART (≥3 antiretrovirals) was also reported. Competing risk regression analysis was performed to identify factors associated with first occurrence of OI. In 2,027 children and adolescents (54% males), median age at ART initiation increased from 4.5 years in 2011-2013 to 6.7 in 2017-2020, median CD4 count doubled from 237 cells/μl to 466 cells/μl, and proportion of children who initiated ART as severely immunodeficient decreased from 70% to 45%. During follow-up, 275 (14%) children who received triple-drug ART as first treatment and had at least one clinic visit, developed at least one OI in the first two years of treatment (9.40 per 100 person-years). The incidence rate of any first OI declined from 12.52 to 7.58 per 100 person-years during 2011-2013 and 2017-2020. Lower hazard of OIs were found in those with age at first ART 2-14 years, current CD4 ≥200 cells/μl, and receiving ART between 2017 and 2020. The analysis demonstrated increasing number of children and adolescents starting ART with high CD4 count at ART start. The rate of first OI markedly decreased in children who started ART in more recent years. There remains a clear need for improvement in HIV control strategies in children, by promoting earlier diagnosis and timely treatment.

HTT
Also flagged:TRpolymeraseschizophreniabipolar disorderABCA7WDR7
Journal Article 2023-09-14 ✓ 2 Snippets Ichikawa K, Kawahara R, Asano T, Morishita S.
In-Text Gene Mentions

To date, several disease-associated complex TRs have been reported, including 400–2000 copies of AAAAG, AAAGG, AAGAG, and AGAGC in RFC1, which are associated with cerebellar ataxia, neuropathy, vestibular areflexia syndrome (CANVAS)25; the loss of CAA and CCA in (CAG)m CAA CAG CCA (CCG)n, the motif structure of HTT gene, are associated with Huntington’s disease (HD)26, CAG and ACT in ATXN8 are with spinocerebellar ataxia type 8 (SCA8)27, CAGG, CA, and CAGA in CNBP with myotonic dystrophy type 2 (DM2)28, and TTTCA and TTTTA in SAMD12 with benign adult familial myoclonic epilepsy (BAFME)29.

…motif structure ofHTTgene, are associated…

Show Full Abstract

Markedly expanded tandem repeats (TRs) have been correlated with ~60 diseases. TR diversity has been considered a clue toward understanding missing heritability. However, haplotype-resolved long TRs remain mostly hidden or blacked out because their complex structures (TRs composed of various units and minisatellites containing >10-bp units) make them difficult to determine accurately with existing methods. Here, using a high-precision algorithm to determine complex TR structures from long, accurate reads of PacBio HiFi, an investigation of 270 Japanese control samples yields several genome-wide findings. Approximately 322,000 TRs are difficult to impute from the surrounding single-nucleotide variants. Greater genetic divergence of TR loci is significantly correlated with more events of younger replication slippage. Complex TRs are more abundant than single-unit TRs, and a tendency for complex TRs to consist of <10-bp units and single-unit TRs to be minisatellites is statistically significant at loci with ≥500-bp TRs. Of note, 8909 loci with extended TRs (>100b longer than the mode) contain several known disease-associated TRs and are considered candidates for association with disorders. Overall, complex TRs and minisatellites are found to be abundant and diverse, even in genetically small Japanese populations, yielding insights into the landscape of long TRs.

Also flagged:tumortumorsPurpurinporphyrinlanthanideHER2 receptor
Journal Article 2023-09-14 No Snippets Juengpanich S, Li S, Yang T, Xie T, Chen J, Shan Y, Lee J, Lu Z, Chen T, Zhang B, Cao J, Hu J, Yu J, Wang Y, Topatana W, Gu Z, Cai X, Chen M.
Show Full Abstract

Phototherapy of deep tumors still suffers from many obstacles, such as limited near-infrared (NIR) tissue penetration depth and low accumulation efficiency within the target sites. Herein, stimuli-sensitive tumor-targeted photodynamic nanoparticles (STPNs) with persistent luminescence for the treatment of deep tumors are reported. Purpurin 18 (Pu18), a porphyrin derivative, is utilized as a photosensitizer to produce persistent luminescence in STPNs, while lanthanide-doped upconversion nanoparticles (UCNPs) exhibit bioimaging properties and possess high photostability that can enhance photosensitizer efficacy. STPNs are initially stimulated by NIR irradiation before intravenous administration and accumulate at the tumor site to enter the cells through the HER2 receptor. Due to Pu18 afterglow luminescence properties, STPNs can continuously generate ROS to inhibit NFκB nuclear translocation, leading to tumor cell apoptosis. Moreover, STPNs can be used for diagnostic purposes through MRI and intraoperative NIR navigation. STPNs exceptional antitumor properties combined the advantages of UCNPs and persistent luminescence, representing a promising phototherapeutic strategy for deep tumors.

NEGR1
Also flagged:obesitySEC16BTMEM18GNPDA2FTOcardiometabolic diseases
Journal Article 2023-09-14 ✓ 4 Snippets Viljakainen H, Sorlí JV, Dahlström E, Agrawal N, Portolés O, Corella D.
In-Text Gene Mentions

…close to genesNEGR1, SEC16B, TMEM18, GNPDA2,…

…rs11165643, TNNI3K rs1514175,NEGR1rs2815752, SEC16B rs543874,…

…in these tissues):NEGR1(brain), SEC16B (liver/pancrea…

…or near genesNEGR1(rs2815752), SEC16B (rs543874)…

Show Full Abstract

Diet modulates the genetic risk of obesity, but the modulation has been rarely studied using genetic risk scores (GRSs) in children. Our objectives were to identify single nucleotide polymorphisms (SNPs) that drive the interaction of specific foods with obesity and combine these into GRSs. Genetic and food frequency data from Finnish Health in Teens study was utilized. In total, 1142 11-year-old subjects were genotyped on the Metabochip array. BMI-GRS with 30 well-known SNPs was computed and the interaction of individual SNPs with food items and their summary dietary scores were examined in relation to age- and sex-specific BMI z-score (BMIz). The whole BMI-GRS interacted with several foods on BMIz. We identified 7-11 SNPs responsible for each interaction and these were combined into food-specific GRS. The most predominant interaction was witnessed for pizza (p < 0.001): the effect on BMIz was b - 0.130 (95% CI - 0.23; - 0.031) in those with low-risk, and 0.153 (95% CI 0.072; 0.234) in high-risk. Corresponding, but weaker interactions were verified for sweets and chocolate, sugary juice drink, and hamburger and hotdog. In total 5 SNPs close to genes NEGR1, SEC16B, TMEM18, GNPDA2, and FTO were shared between these interactions. Our results suggested that children genetically prone to obesity showed a stronger association of unhealthy foods with BMIz than those with lower genetic susceptibility. Shared SNPs of the interactions suggest common differences in metabolic gene-diet interactions, which warrants further investigation.

SOX6
Also flagged:nucleotidespeptidesSOXSOXAtrypan blueChromium
Journal Article 2023-09-14 ✓ 1 Snippet Lamanna F, Hervas-Sotomayor F, Oel AP, Jandzik D, Sobrido-Cameán D, Santos-Durán GN, Martik ML, Stundl J, Green SA, Brüning T, Mößinger K, Schmidt J, Schneider C, Sepp M, Murat F, Smith JJ, Bronner ME, Rodicio MC, Barreiro-Iglesias A, Medeiros DM, Arendt D, Kaessmann H.
In-Text Gene Mentions

…, GBX1 andSOX6(Fig. 4c,d,g ),…

Show Full Abstract

The vertebrate brain emerged more than ~500 million years ago in common evolutionary ancestors. To systematically trace its cellular and molecular origins, we established a spatially resolved cell type atlas of the entire brain of the sea lamprey-a jawless species whose phylogenetic position affords the reconstruction of ancestral vertebrate traits-based on extensive single-cell RNA-seq and in situ sequencing data. Comparisons of this atlas to neural data from the mouse and other jawed vertebrates unveiled various shared features that enabled the reconstruction of cell types, tissue structures and gene expression programs of the ancestral vertebrate brain. However, our analyses also revealed key tissues and cell types that arose later in evolution. For example, the ancestral brain was probably devoid of cerebellar cell types and oligodendrocytes (myelinating cells); our data suggest that the latter emerged from astrocyte-like evolutionary precursors in the jawed vertebrate lineage. Altogether, our work illuminates the cellular and molecular architecture of the ancestral vertebrate brain and provides a foundation for exploring its diversification during evolution.

Also flagged:fibrilADpeptidesfibrilsfibril formation
Journal Article 2023-09-14 No Snippets Upadhyay A, Chhangani D, Rao NR, Kofler J, Vassar R, Rincon-Limas DE, Savas JN.
Show Full Abstract

<h4>Background</h4>The accumulation of amyloid beta (Aβ) peptides in fibrils is prerequisite for Alzheimer's disease (AD). Our understanding of the proteins that promote Aβ fibril formation and mediate neurotoxicity has been limited due to technical challenges in isolating pure amyloid fibrils from brain extracts.<h4>Methods</h4>To investigate how amyloid fibrils form and cause neurotoxicity in AD brain, we developed a robust biochemical strategy. We benchmarked the success of our purifications using electron microscopy, amyloid dyes, and a large panel of Aβ immunoassays. Tandem mass-spectrometry based proteomic analysis workflows provided quantitative measures of the amyloid fibril proteome. These methods allowed us to compare amyloid fibril composition from human AD brains, three amyloid mouse models, transgenic Aβ42 flies, and Aβ42 seeded cultured neurons.<h4>Results</h4>Amyloid fibrils are primarily composed by Aβ42 and unexpectedly harbor Aβ38 but generally lack Aβ40 peptides. Multidimensional quantitative proteomics allowed us to redefine the fibril proteome by identifying 20 new amyloid-associated proteins. Notably, we confirmed 57 previously reported plaque-associated proteins. We validated a panel of these proteins as bona fide amyloid-interacting proteins using antibodies and orthogonal proteomic analysis. One metal-binding chaperone metallothionein-3 is tightly associated with amyloid fibrils and modulates fibril formation in vitro. Lastly, we used a transgenic Aβ42 fly model to test if knock down or over-expression of fibril-interacting gene homologues modifies neurotoxicity. Here, we could functionally validate 20 genes as modifiers of Aβ42 toxicity in vivo.<h4>Conclusions</h4>These discoveries and subsequent confirmation indicate that fibril-associated proteins play a key role in amyloid formation and AD pathology.

Also flagged:cervicalcervical cancerHPV infectionpathogenesiscervical lesionsprecancerous
Journal Article 2023-09-14 No Snippets Ye J, Zheng L, He Y, Qi X.
Show Full Abstract

Human papillomavirus (HPV) is the most prevalent sexually transmitted virus globally. Persistent high-risk HPV infection can result in cervical precancerous lesions and cervical cancer, with 70% of cervical cancer cases associated with high-risk types HPV16 and 18. HPV infection imposes a significant financial and psychological burden. Therefore, studying methods to eradicate HPV infection and halt the progression of precancerous lesions remains crucial. This review comprehensively explores the mechanisms underlying HPV-related cervical lesions, including the viral life cycle, immune factors, epithelial cell malignant transformation, and host and environmental contributing factors. Additionally, we provide a comprehensive overview of treatment methods for HPV-related cervical precancerous lesions and cervical cancer. Our focus is on immunotherapy, encompassing HPV therapeutic vaccines, immune checkpoint inhibitors, and advanced adoptive T cell therapy. Furthermore, we summarize the commonly employed drugs and other nonsurgical treatments currently utilized in clinical practice for managing HPV infection and associated cervical lesions. Gene editing technology is currently undergoing clinical research and, although not yet employed officially in clinical treatment of cervical lesions, numerous preclinical studies have substantiated its efficacy. Therefore, it holds promise as a precise treatment strategy for HPV-related cervical lesions.

HFE
Also flagged:degenerative diseasescalcium pyrophosphate dihydrateproprioceptioncord compressiontumorscervical myelopathy
Journal Article 2023-09-14 ✓ 1 Snippet Afzal S, Komlakh K, Targhi NZ, Fard SB, Shafizadeh E, Athari M.
In-Text Gene Mentions

…disorder, such ashemochromatosis, hyperparathyroidism, or hypo…

Show Full Abstract

<h4>Introduction</h4>Symptomatic calcification of ligamentum flavum (CLF) is a rare condition of the cervical spine compared to other degenerative diseases. CLF manifests as myelopathic symptoms due to the compression of the spinal cord. Calcium pyrophosphate dihydrate (CPPD) deposition disease is the most prevalent cause of CLF. This is the first reported case of CLF caused by CPPD in the Middle East.<h4>Presentation of case</h4>A 75-year-old female patient presented with gait disturbance for two years. The imaging studies demonstrated two symmetric bulging masses with a density similar to bone between the inferior border of the C5 laminae and the superior border of the C6 laminae. Histologic evaluation of the resected tissue confirmed the CLF and CPPD disease pathology. The patient underwent a C5-C6 laminectomy. The symptoms resolved, and in a six-month follow-up period, the walking improved.<h4>Discussion</h4>The diagnosis of CLF due to CPPD is based on the interpretation of the symptoms concurrent with MRI, CT scan, and histopathological examination. Due to the high reoccurrence rates of the condition following the pharmacological treatment and sub-optimal response in those with negative inflammatory markers, open decompression with either cervical laminectomy or laminoplasty is considered the gold-standard therapeutic option in CFL due to CPPD deposition disease.<h4>Conclusion</h4>CLF is a rare cervical spine disorder that compresses the spinal cord and manifests as myelopathic symptoms. Early surgical intervention, preferably in the first five months of the disease initiation, is associated with favorable outcomes.

MRPL39
Also flagged:OuabainRhoAROCKadherens junctionsErk1MYO9A
Journal Article 2023-09-14 ✓ 3 Snippets Martínez-Rendón J, Hinojosa L, Xoconostle-Cázares B, Ramírez-Pool JA, Castillo A, Cereijido M, Ponce A.
In-Text Gene Mentions

Dysregulation or mutations in MRPL39 can lead to mitochondrial dysfunction, associated with various human diseases such as metabolic disorders, neurodegenerative diseases, and cancer [48].

MRPL39is a nuclear…

…or mutations inMRPL39can lead to…

Show Full Abstract

Ouabain, an organic compound with the ability to strengthen the contraction of the heart muscle, was originally derived from plants. It has been observed that certain mammalian species, including humans, naturally produce ouabain, leading to its classification as a new type of hormone. When ouabain binds to Na<sup>+</sup>/K<sup>+</sup>-ATPase, it elicits various physiological effects, although these effects are not well characterized. Previous studies have demonstrated that ouabain, within the concentration range found naturally in the body (10 nmol/L), affects the polarity of epithelial cells and their intercellular contacts, such as tight junctions, adherens junctions, and gap junctional communication. This is achieved by activating signaling pathways involving cSrc and Erk1/2. To further investigate the effects of ouabain within the hormonally relevant concentration range (10 nmol/L), mRNA-seq, a high-throughput sequencing technique, was employed to identify differentially expressed transcripts. The discovery that the transcript encoding MYO9A was among the genes affected prompted an exploration of whether RhoA and its downstream effector ROCK were involved in the signaling pathways through which ouabain influences cell-to-cell contacts in epithelial cells. Supporting this hypothesis, this study reveals the following: (1) Ouabain increases the activation of RhoA. (2) Treatment with inhibitors of RhoA activation (Y27) and ROCK (C3) eliminates the enhancing effect of ouabain on the tight junction seal and intercellular communication via gap junctions. These findings further support the notion that ouabain acts as a hormone to emphasize the epithelial phenotype.

Also flagged:Acute myeloid leukemiaAMLacute leukemiasFMS-like tyrosine kinase 3FLT3transmembrane ligand-activated receptor tyrosine kinase
Journal Article 2023-09-14 No Snippets Czogała M, Czogała W, Pawińska-Wąsikowska K, Książek T, Bukowska-Strakova K, Sikorska-Fic B, Łaguna P, Fałkowska A, Drabko K, Muszyńska-Rosłan K, Krawczuk-Rybak M, Kozłowska M, Irga-Jaworska N, Zielezińska K, Urasiński T, Bartoszewicz N, Styczyński J, Skalska-Sadowska J, Wachowiak J, Rodziewicz-Konarska A, Kałwak K, Ciebiera M, Chaber R, Mizia-Malarz A, Chodała-Grzywacz A, Karolczyk G, Bobeff K, Młynarski W, Mycko K, Badowska W, Tomaszewska R, Szczepański T, Machnik K, Zamorska N, Balwierz W, Skoczeń S.
Show Full Abstract

<h4>Background</h4>The FMS-like tyrosine kinase 3 (FLT3) gene mutated in 10-15% of pediatric acute myeloid leukemia (AML) is associated with an inferior outcome. The aim of the study was to analyze the outcome and characteristics of FLT3-ITD-positive pediatric AML.<h4>Methods</h4>We retrospectively analyzed the nationwide pediatric AML database from between 2005 and 2022. FLT3-ITD was found in 54/497 (10.7%) patients with available analysis. Three consecutive treatment protocols were used (AML-BFM 2004 Interim, AML-BFM 2012 Registry, AML-BFM 2019 recommendations).<h4>Results</h4>Probabilities of 5-year overall (OS), event-free (EFS) and relapse-free survival were significantly lower in the FLT3-ITD-positive patients compared to FLT3-ITD-negative (0.54 vs. 0.71, <i>p</i> = 0.041; 0.36 vs. 0.59, <i>p</i> = 0.0004; 0.47 vs. 0.70, <i>p</i> = 0.0029, accordingly). An improvement in the outcome was found in the analyzed period of time, with a trend of better survival in patients treated under the AML-BFM 2012 and AML-BFM 2019 protocols compared to the AML-BFM 2004 protocol (5-year EFS 0.52 vs. 0.27, <i>p</i> = 0.069). There was a trend of improved outcomes in patients treated with FLT3 inhibitors (n = 9, 2-year EFS 0.67 vs. 0.33, <i>p</i> = 0.053) and those who received stem cell transplantation (SCT) (n = 26; 5-year EFS 0.70 vs. 0.27, <i>p</i> = 0.059). The co-occurrence of the WT1 mutation had a dismal impact on the prognosis (5-year EFS 0.23 vs. 0.69, <i>p</i> = 0.002), while the NPM1 mutation improved survival (5-year OS 1.0 vs. 0.44, <i>p</i> = 0.036).<h4>Conclusions</h4>It seems that SCT and FLT3 inhibitors have a beneficial impact on the prognosis. Additional genetic alterations, like the WT1 and NPM1 mutations, significantly influence the outcome.

PRDX6
Also flagged:Non-Alcoholic SteatohepatitisNAFLDmetabolic dysfunction-associated steatotic liver diseasesteatohepatitisNASHhepatocellular carcinoma
Journal Article 2023-09-14 ✓ 2 Snippets Kakehashi A, Suzuki S, Wanibuchi H.
In-Text Gene Mentions

Among proteins involved in the development of liver tissue cellular defense against oxidative stress, oxidative DNA damage, inflammation, and steatohepatitis, peroxiredoxins 1 (Prx1) and 6 (Prdx6) and sestrin 2 (SESN2) were considered promising potential diagnostic biomarkers for the early stage of NAFLD/NASH, which may also influence the mTOR [27,28] (Table 1 and Table 2).

In another NASH model containing mice fed with a methionine and choline-deficient diet (MCD), proteomic analysis of livers revealed significant elevation of peroxiredoxins 1 (Prdx1) and 6 (Prdx6) in correlation with TGFβ1, TNFα, and TLR4, CYP2E1, cytokeratin 8 (CK8), cytokeratin 18 (CK18), fructose-1,6-bisphosphatase 1 and vimentin, and downregulation of proteins involved in methionine (Met) metabolism and oxidative stress in NAFLD/NASH [27].

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) or metabolic dysfunction-associated steatotic liver disease (MASLD) and steatohepatitis (NASH) are chronic hepatic conditions leading to hepatocellular carcinoma (HCC) development. According to the recent "multiple-parallel-hits hypothesis", NASH could be caused by abnormal metabolism, accumulation of lipids, mitochondrial dysfunction, and oxidative and endoplasmic reticulum stresses and is found in obese and non-obese patients. Recent translational research studies have discovered new proteins and signaling pathways that are involved not only in the development of NAFLD but also in its progression to NASH, cirrhosis, and HCC. Nevertheless, the mechanisms of HCC developing from precancerous lesions have not yet been fully elucidated. Now, it is of particular importance to start research focusing on the discovery of novel molecular pathways that mediate alterations in glucose and lipid metabolism, which leads to the development of liver steatosis. The role of mTOR signaling in NASH progression to HCC has recently attracted attention. The goals of this review are (1) to highlight recent research on novel genetic and protein contributions to NAFLD/NASH; (2) to investigate how recent scientific findings might outline the process that causes NASH-associated HCC; and (3) to explore the reliable biomarkers/targets of NAFLD/NASH-associated hepatocarcinogenesis.

HTT
Also flagged:neurodegenerative disorderHDchoreadystoniagene expressionvesicle
Journal Article 2023-09-14 ✓ 3 Snippets Sneha NP, Dharshini SAP, Taguchi YH, Gromiha MM.
In-Text Gene Mentions

Huntington’s disease (HD) is a progressive neurodegenerative disorder caused due to a CAG repeat expansion in the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

…caused by theHTTgene, which encodes…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder caused due to a CAG repeat expansion in the huntingtin (<i>HTT</i>) gene. The primary symptoms of HD include motor dysfunction such as chorea, dystonia, and involuntary movements. The primary motor cortex (BA4) is the key brain region responsible for executing motor/movement activities. Investigating patient and control samples from the BA4 region will provide a deeper understanding of the genes responsible for neuron degeneration and help to identify potential markers. Previous studies have focused on overall differential gene expression and associated biological functions. In this study, we illustrate the relationship between variants and differentially expressed genes/transcripts. We identified variants and their associated genes along with the quantification of genes and transcripts. We also predicted the effect of variants on various regulatory activities and found that many variants are regulating gene expression. Variants affecting miRNA and its targets are also highlighted in our study. Co-expression network studies revealed the role of novel genes. Function interaction network analysis unveiled the importance of genes involved in vesicle-mediated transport. From this unified approach, we propose that genes expressed in immune cells are crucial for reducing neuron death in HD.

PEBP1
Also flagged:brain tumorgliomasGBMcentral nervous system tumorsbrain tumorsglioblastoma
Journal Article 2023-09-14 ✓ 5 Snippets El-Baba C, Ayache Z, Goli M, Hayar B, Kawtharani Z, Pisano C, Kobeissy F, Mechref Y, Darwiche N.
In-Text Gene Mentions

ST1926 treatment down-regulated a group of oncogenic proteins (SLC2A1, SLC25A6, CBX3, DEK, DDX39B) and up-regulated a group of presumably tumor-suppressing proteins (PEBP1, HspBP1); PADI2 and CMPK1, of unknown function in GBM, were also up-regulated.

Our in silico analysis showed PEBP1 down-regulation in GBM at the mRNA and protein levels compared to normal brain tissues.

In hepatocellular carcinoma, the down-regulation of PEBP1 resulted in aggressive tumor behavior and poor prognosis [44].

It is widely recognized that PEBP1 inhibits the metastatic dissemination of tumor cells.

The down-regulated expression of PEBP1 is observed in several human cancers, which has defined it as a metastasis suppressor gene.

Show Full Abstract

Glioblastoma Multiforme (GBM) is the most aggressive form of malignant brain tumor. The median survival rate does not exceed two years, indicating an imminent need to develop novel therapies. The atypical adamantyl retinoid ST1926 induces apoptosis and growth inhibition in different cancer types. We have shown that ST1926 is an inhibitor of the catalytic subunit of DNA polymerase alpha (POLA1), which is involved in initiating DNA synthesis in eukaryotic cells. POLA1 levels are elevated in GBM versus normal brain tissues. Therefore, we studied the antitumor effects of ST1926 in several human GBM cell lines. We further explored the global protein expression profiles in GBM cell lines using liquid chromatography coupled with tandem mass spectrometry to identify new targets of ST1926. Low sub-micromolar concentrations of ST1926 potently decreased cell viability, induced cell damage and apoptosis, and reduced POLA1 protein levels in GBM cells. The proteomics profiles revealed 197 proteins significantly differentially altered upon ST1926 treatment of GBM cells involved in various cellular processes. We explored the differential gene and protein expression of significantly altered proteins in GBM compared to normal brain tissues.

Also flagged:chromatinnucleosomeMNasenucleotidechromosomechromosomes
Journal Article 2023-09-14 No Snippets Carter JL, Stevens H, Ridge PG, Johnson SM.
Show Full Abstract

Much of today's molecular science revolves around next-generation sequencing. Frequently, the first step in analyzing such data is aligning sequencing reads to a reference genome. This step is often taken for granted, but any analysis downstream of the alignment will be affected by the aligner's ability to correctly map sequences. In most cases, for research into chromatin structure and nucleosome positioning, ATAC-seq, ChIP-seq, and MNase-seq experiments use short read lengths. How well aligners manage these reads is critical. Most aligner programs will output mapped reads and unmapped reads. However, from a biological point of view, reads will fall into one of three categories: correctly mapped, incorrectly mapped, and unmapped. While increased sequencing depth can often compensate for unmapped reads, incorrectly and correctly mapped reads appear algorithmically identical but can produce biologically significant alterations in the results. For this reason, we are benchmarking various alignment programs to determine their propensity to incorrectly map short reads. As short-read alignment is an important step in ATAC-seq, ChIP-seq, and MNase-seq experiments, caution should be taken in mapping reads to ensure that the most accurate conclusions can be made from the data generated. Our analysis is intended to help investigators new to the field pick the alignment program best suited for their experimental conditions. In general, the aligners we tested performed well. BWA, Bowtie2, and Chromap were all exceptionally accurate, and we recommend using them. Furthermore, we show that longer read lengths do in fact lead to more accurate mappings.

SOX6
Also flagged:signal processinginterneuron migrationorganizationneuropsychiatric disordersepilepsyintellectual disability
Journal Article 2023-09-14 ✓ 2 Snippets Toudji I, Toumi A, Chamberland É, Rossignol E.
In-Text Gene Mentions

…box transcription factorSox6, acting downstream…

…with viruses expressingSox6did not rescue…

Show Full Abstract

Cortical GABAergic interneurons are critical components of neural networks. They provide local and long-range inhibition and help coordinate network activities involved in various brain functions, including signal processing, learning, memory and adaptative responses. Disruption of cortical GABAergic interneuron migration thus induces profound deficits in neural network organization and function, and results in a variety of neurodevelopmental and neuropsychiatric disorders including epilepsy, intellectual disability, autism spectrum disorders and schizophrenia. It is thus of paramount importance to elucidate the specific mechanisms that govern the migration of interneurons to clarify some of the underlying disease mechanisms. GABAergic interneurons destined to populate the cortex arise from multipotent ventral progenitor cells located in the ganglionic eminences and pre-optic area. Post-mitotic interneurons exit their place of origin in the ventral forebrain and migrate dorsally using defined migratory streams to reach the cortical plate, which they enter through radial migration before dispersing to settle in their final laminar allocation. While migrating, cortical interneurons constantly change their morphology through the dynamic remodeling of actomyosin and microtubule cytoskeleton as they detect and integrate extracellular guidance cues generated by neuronal and non-neuronal sources distributed along their migratory routes. These processes ensure proper distribution of GABAergic interneurons across cortical areas and lamina, supporting the development of adequate network connectivity and brain function. This short review summarizes current knowledge on the cellular and molecular mechanisms controlling cortical GABAergic interneuron migration, with a focus on tangential migration, and addresses potential avenues for cell-based interneuron progenitor transplants in the treatment of neurodevelopmental disorders and epilepsy.

ZNFX1
Also flagged:osteoarthritisobesityOAarthritisacetaminophenibuprofen
Journal Article 2023-09-14 ✓ 2 Snippets Zhang X, Liu Q, Zhang J, Song C, Han Z, Wang J, Shu L, Liu W, He J, Wang P.
In-Text Gene Mentions

LncRNA ZNFX1 antisense 1 (ZFAS1) reduced anti-oxidative stress via sponge of miR-1323 in osteoarthritis (Gu et al., 2022).

…LncRNAZNFX1 antisense 1antisense 1 (ZFAS1)…

Show Full Abstract

Osteoarthritis impairs the functions of various joints, such as knees, hips, hands and spine, which causes pain, swelling, stiffness and reduced mobility in joints. Multiple factors, including age, joint injuries, obesity, and mechanical stress, could contribute to osteoarthritis development and progression. Evidence has demonstrated that genetics and epigenetics play a critical role in osteoarthritis initiation and progression. Noncoding RNAs (ncRNAs) have been revealed to participate in osteoarthritis development. In this review, we describe the pivotal functions and molecular mechanisms of numerous lncRNAs in osteoarthritis progression. We mention that long noncoding RNAs (lncRNAs) could be biomarkers for osteoarthritis diagnosis, prognosis and therapeutic targets. Moreover, we highlight the several compounds that alleviate osteoarthritis progression in part via targeting lncRNAs. Furthermore, we provide the future perspectives regarding the potential application of lncRNAs in diagnosis, treatment and prognosis of osteoarthritis.

TNFSF4
Also flagged:tumorgliomaGliomasbrain tumorglioblastomasGBM
Journal Article 2023-09-14 ✓ 1 Snippet Hou Y, Qiu W, Ling Y, Qi X, Liu J, Yang H, Chu L.
In-Text Gene Mentions

…IGHA2, IGHV4-31, IGLV7-43,TNFSF4, PF4, PTX3, and…

Show Full Abstract

Gliomas are the leading cause in more than 50% of malignant brain tumor cases. Prognoses, recurrences, and mortality are usually poor for gliomas that have malignant features. In gliomas, there are four grades, with grade IV gliomas known as glioblastomas (GBM). Currently, the primary methods employed for glioma treatment include surgical removal, followed by chemotherapy after the operation, and targeted therapy. However, the outcomes of these treatments are unsatisfactory. Gliomas have a high number of tumor-associated macrophages (TAM), which consist of brain microglia and macrophages, making them the predominant cell group in the tumor microenvironment (TME). The glioma cohort was analyzed using single-cell RNA sequencing to quantify the genes related to TAMs in this study. Furthermore, the ssGSEA analysis was utilized to assess the TAM-associated score in the glioma group. In the glioma cohort, we have successfully developed a prognostic model consisting of 12 genes, which is derived from the TAM-associated genes. The glioma cohort demonstrated the predictive significance of the TAM-based risk model through survival analysis and time-dependent ROC curve. Furthermore, the correlation analysis revealed the significance of the TAM-based risk model in the application of immunotherapy for individuals diagnosed with GBM. Ultimately, the additional examination unveiled the prognostic significance of PTX3 in the glioma group, establishing it as the utmost valuable prognostic indicator in patients with GBM. The PCR assay revealed the PTX3 is significantly up-regulated in GBM cohort. Additionally, the assessment of cell growth further confirms the involvement of PTX3 in the GBM group. The analysis of cell proliferation showed that the increased expression of PTX3 enhanced the ability of glioma cells to proliferate. The prognosis of glioblastomas and glioma is influenced by the proliferation of tumor-associated macrophages.

Also flagged:asthmachronic respiratory diseaseviral infectionsTSLPORMDL3sphingolipid
Journal Article 2023-09-14 No Snippets Zhang Y.
Show Full Abstract

Asthma is a chronic respiratory disease, and clinically, asthma exacerbations remain difficult to treat. The disease is caused by combinations of and interactions between genetic and environmental factors. Genomic and genetic approaches identified many novel genes to treat asthma and brought new insights into the disease. The products of the genes have functional roles in regulating physiological or pathophysiological processes in airway structural cells and immune system cells. Genetic factors also interact with environmental factors such as air pollutants, and bacterial and viral infections to trigger the disease. Thymic stromal lymphopoietin (<i>TSLP</i>), orosomucoid-like 3 (<i>ORMDL3</i>), and gasdermin B (<i>GSDMB</i>) are three genes identified by genetic studies to have a great potential as therapeutic targets of asthma. TSLP is an important driver of type 2 inflammation. ORMDL3 mediates cell stress, sphingolipid synthesis, and viral and bacterial infections. GSDMB regulates cell pyroptosis through its N and C terminals and can bind sulfatides to influence inflammatory response. Investigating inhibitors or modulators for these pathways would bring a new landscape for therapeutics of asthma in future.

Research Square 2023-09-14 Preprint (No Snippets API) Duminuco A, Bulla A, Rosso R, Romeo M, Cambria D, Spina EL, Ximenes B, Giallongo C, Tibullo D, Romano A, Raimondo FD, Cerchione C, Palumbo GA.
Show Full Abstract

<title>Abstract</title> <p>Purpose Immune system impairment is frequently reported in patients affected by hemoglobinopathies due to various mechanisms, including iron accumulation, antigenic stimulation due to numerous transfusions, chronic hemolysis, and a hyperinflammatory state. The antigenic immune response after a vaccine could be ineffective. Methods We evaluated the anti-spike IgG production after 2 doses of vaccine for SARS-CoV-2 in patients affected by hemoglobinopathies, reporting the risk of breakthrough infections, monitoring the outcome and the risk of severe disease or complications related to the basal hematological disease. Results All 114 enrolled patients developed adequate antibody production, with a median value of serum anti-S IgG of 2184.4 BAU/mL. The amount of antibody was unrelated to any other clinical characteristics evaluated, including transfusion dependence, age, gender, disease type, ferritin, blood count, spleen status, and therapy with hydroxyurea or iron chelators (p > 0.05). Moreover, 47 (41.2%) patients developed breakthrough SARS-CoV-2 infection during the follow-up, all with a mildly symptomatic course, without requiring hospitalization or experiencing a significative drop in hemoglobin values, allowing for a slight delay in their transfusion regimen. Conclusion Vaccination has been an effective and safe tool in this category of patients, preventing severe complications. Watchful waiting in the transfusion strategy can be safely ensured, guaranteeing better management of transfusion components.</p>

PRDX6
Also flagged:proteasomePSMD926S proteasome non-ATPase regulatory subunit 9chaperonebindingpeptide
Journal Article 2023-09-13 ✓ 1 Snippet Christie J, Anthony CM, Harish M, Mudartha D, Ud Din Farooqee SB, Venkatraman P.
In-Text Gene Mentions

…ERKK), and peroxiredoxin-6 (PRDX6; containing EAKK) provided…

Show Full Abstract

Functional networks in cells are created by physical, genetic, and regulatory interactions. Mapping them and annotating their functions by available methods remains a challenge. We use affinity purification mass spectrometry (AP-MS) coupled with SLiMFinder to discern such a network involving 26S proteasome non-ATPase regulatory subunit 9 (PSMD9), a chaperone of proteasome assembly. Approximately 20% of proteins within the PSMD9 interactome carry a short linear motif (SLiM) of the type 'EXKK'. The binding of purified PSMD9 with the peptide sequence ERKK, proteins heterogeneous nuclear ribonucleoproteins A2/B1 (hnRNPA2B1; containing ERKK), and peroxiredoxin-6 (PRDX6; containing EAKK) provided proof of principle for this motif-driven network. The EXKK motif in the peptide primarily interacts with the coiled-coil N domain of PSMD9, a unique interaction not reported for any coiled-coil domain. PSMD9 knockout (KO) HEK293 cells experience endoplasmic reticulum (ER) stress and respond by increasing the unfolded protein response (UPR) and reducing the formation of aggresomes and lipid droplets. Trans-expression of PSMD9 in the KO cells rescues lipid droplet formation. Overexpression of PSMD9 in HEK293 cells results in reduced UPR, and increased lipid droplet and aggresome formation. The outcome argues for the prominent role of PSMD9 in maintaining proteostasis. Probable mechanisms involve the binding of PSMD9 to binding immunoglobulin protein (BIP/GRP78; containing EDKK), an endoplasmic reticulum chaperone and key regulator of the UPR, and fatty acid synthase (FASN; containing ELKK), involved in fatty acid synthesis/lipid biogenesis. We propose that PSMD9 acts as a buffer in the cellular milieu by moderating the UPR and enhancing aggresome formation to reduce stress-induced proteotoxicity. Akin to waves created in ponds that perpetuate to a distance, perturbing the levels of PSMD9 would cause ripples down the networks, affecting final reactions in the pathway, one of which is altered proteostasis.

DCC
Also flagged:angiogenesisuncoordinated 5SPnerve growth factorNGFsynovial fibrosis
Journal Article 2023-09-13 ✓ 5 Snippets Ma Z, Wei Y, Liao T, Jie L, Yang N, Yu L, Wang P.
In-Text Gene Mentions

…colorectal cancer deleted (DCC), uncoordinated 5 (UNC5),…

…neuronal surface receptorDCC/UNC5.…

…17 Netrin‐1/DCChas an attractive…

…opioid receptors, decreasingDCCand Netrin‐1 expression…

…KOA mice throughDCC receptorsreceptors that are…

Show Full Abstract

Synovial fibrosis is one of the most dominant histopathological changes in osteoarthritis of the knee (KOA), and activation of vascular endothelial cells in synovial fibrosis is both an important factor in mediating pain in KOA and a major contributor to the generation of pain signals. At the same time, angiogenesis and nerve fibres are more likely to underlie the pathology of pain induced by synovial fibrosis. In the present study, we established a co-culture model of human umbilical vein endothelial cells (HUVECs) with dorsal root ganglion (DRG) and detected tissue and cellular Netrin-1, vascular cell adhesion molecule-1 (VCAM-1), intercellular cell adhesion molecule-1 (ICAM-1), growth-associated protein-43 (GAP43), colorectal cancer deleted (DCC), uncoordinated 5 (UNC5), and the related expression of calcitonin gene-related peptide (CGRP), substance P (SP) and nerve growth factor (NGF) in supernatant by ELISA to investigate the intervention of vascular endothelial cell activation on sensory nerve sprouting exacerbating peripheral pain sensitivity and to investigate the effect of Netrin-1 from the perspective of Netrin-1 secretion to illustrate its effector mechanism.

HTT
Also flagged:SpliceosomePLK1decitabineacute myeloid leukemiaAMLgene expression
Journal Article 2023-09-13 ✓ 1 Snippet Croucher PJP, Ridinger M, Becker PS, Lin TL, Silberman SL, Wang ES, Zeidan AM.
In-Text Gene Mentions

…(SDF4, LBX-AS1, ZNF341,HTT, DHRS12, ATRN, ESPN,…

Show Full Abstract

PLK1 is overexpressed in acute myeloid leukemia (AML). A phase 1b trial of the PLK1 inhibitor onvansertib (ONV) combined with decitabine (DAC) demonstrated initial safety and efficacy in patients with relapsed/refractory (R/R) AML. The current study aimed to identify molecular predictors of response to ONV + DAC in R/R AML patients. A total of 44 R/R AML patients were treated with ONV + DAC and considered evaluable for efficacy. Bone marrow (BM) samples were collected at baseline for genomic and transcriptomic analysis (n = 32). A 10-gene expression signature, predictive of response to ONV + DAC, was derived from the leading-edge genes of gene set enrichment analyses (GSEA). The gene signature was evaluated in independent datasets and used to identify associated mutated genes. Twenty percent of the patients achieved complete remission, with or without hematologic count recovery (CR/CRi), and 32% exhibited a ≥50% reduction in bone marrow blasts. Patients who responded to treatment had elevated mitochondrial function and OXPHOS. The gene signature was not associated with response to DAC alone in an independent dataset. By applying the signature to the BeatAML cohort (n = 399), we identified a positive association between predicted ONV + DAC response and mutations in splicing factors (SF). In the phase 1b/2 trial, patients with SF mutations (SRSF2, SF3B1) had a higher CR/CRi rate (50%) compared to those without SF mutations (9%). PLK1 inhibition with ONV in combination with DAC could be a potential therapy in R/R AML patients, particularly those with high OXPHOS gene expression and SF mutations.

PEBP1
Also flagged:SLC2A1glucosenoradrenaline transportersolute carrier family 6 member 2SLC6A2glucose transporter
Journal Article 2023-09-13 ✓ 3 Snippets Farinella R, Falchi F, Tavanti A, Tuoni C, Di Nino MG, Filippi L, Ciantelli M, Rizzato C, Campa D.
In-Text Gene Mentions

…(PEBP), coded byPEBP1.…

…the expression ofPEBP1in a mouse…

…the modification ofPEBP1binding site (due…

Show Full Abstract

<h4>Abstract</h4>Neonatal pain is a critical issue in clinical practice. The oral administration of glucose-based solutions is currently one of the most common and effective nonpharmacologic strategies for neonatal pain relief in daily minor procedures. However, a varying degree of analgesic efficacy has been reported for this treatment. Environmental, maternal, and genetic factors may explain this variability and potentially allow for a personalized analgesic approach, maximizing therapeutic efficacy and preventing side effects. We investigated the exposome (ie, the set of clinical and anthropometric variables potentially affecting the response to the therapy) and the genetic variability of the noradrenaline transporter gene (solute carrier family 6 member 2 [ SLC6A2 ]) and 2 glucose transporter genes (solute carrier family 2 member 1 [ SLC2A1 ] and 2 [ SLC2A2 ]) in relation to the neonatal analgesic efficacy of a 33% glucose solution. The study population consisted in a homogeneous sample of more than 1400 healthy term newborns. No association for the exposome was observed, whereas a statistically significant association between the G allele of SLC2A1 -rs1105297 and a fourfold decreased probability of responding to the therapy was identified after multiple-testing correction (odds ratio of 3.98, 95% confidence interval 1.95-9.17; P = 4.05 × 10 -4 ). This allele decreases the expression of SLC2A1-AS1 , causing the upregulation of SLC2A1 in the dorsal striatum, which has been suggested to be involved in reward-related processes through the binding of opioids to the striatal mu-opioid receptors. Altogether, these results suggest the involvement of SLC2A1 in the analgesic process and highlight the importance of host genetics for defining personalized analgesic treatments.

Also flagged:Epilepsyneurological disorderγ-Aminobutyric acidporeKCC2pathogenesis
Journal Article 2023-09-13 No Snippets McMoneagle E, Zhou J, Zhang S, Huang W, Josiah SS, Ding K, Wang Y, Zhang J.
Show Full Abstract

Epilepsy is a prevalent neurological disorder characterized by unprovoked seizures. γ-Aminobutyric acid (GABA) serves as the primary fast inhibitory neurotransmitter in the brain, and GABA binding to the GABA<sub>A</sub> receptor (GABA<sub>A</sub>R) regulates Cl<sup>-</sup> and bicarbonate (HCO<sub>3</sub><sup>-</sup>) influx or efflux through the channel pore, leading to GABAergic inhibition or excitation, respectively. The neuron-specific K<sup>+</sup>-Cl<sup>-</sup> cotransporter 2 (KCC2) is essential for maintaining a low intracellular Cl<sup>-</sup> concentration, ensuring GABA<sub>A</sub>R-mediated inhibition. Impaired KCC2 function results in GABAergic excitation associated with epileptic activity. Loss-of-function mutations and altered expression of KCC2 lead to elevated [Cl<sup>-</sup>]<sub>i</sub> and compromised synaptic inhibition, contributing to epilepsy pathogenesis in human patients. KCC2 antagonism studies demonstrate the necessity of limiting neuronal hyperexcitability within the brain, as reduced KCC2 functioning leads to seizure activity. Strategies focusing on direct (enhancing KCC2 activation) and indirect KCC2 modulation (altering KCC2 phosphorylation and transcription) have proven effective in attenuating seizure severity and exhibiting anti-convulsant properties. These findings highlight KCC2 as a promising therapeutic target for treating epilepsy. Recent advances in understanding KCC2 regulatory mechanisms, particularly via signaling pathways such as WNK, PKC, BDNF, and its receptor TrkB, have led to the discovery of novel small molecules that modulate KCC2. Inhibiting WNK kinase or utilizing newly discovered KCC2 agonists has demonstrated KCC2 activation and seizure attenuation in animal models. This review discusses the role of KCC2 in epilepsy and evaluates its potential as a drug target for epilepsy treatment by exploring various strategies to regulate KCC2 activity.

TNFSF4
Also flagged:GNG7clear cell renal cell carcinomaCCRCCtumorgene expressionrenal cancer
Journal Article 2023-09-13 ✓ 3 Snippets Zheng J, Zhang W, Zhang J.
In-Text Gene Mentions

Among them, KDR, PDCD1, and HHLA2 are prognostic protective genes for CCRCC, in contrast to IL10RB, KLRK1, TNFSF4, and TNFSF14, which are risk factors for prognosis in CCRCC.

…with IL10RB, KLRK1,TNFSF4, and TNFSF14, but…

…to IL10RB, KLRK1,TNFSF4, and TNFSF14, which…

Show Full Abstract

Clear cell renal cell carcinoma (CCRCC) is a common tumor of the urological system for which surgery is the preferred treatment, but there is a lack of therapeutic options after surgery. This study aims to explore the biological role of GNG7 on CCRCC from a genetic perspective. Differences in mRNA expression and patient survival of GNG7 in patients with CCRCC and healthy patients were analyzed using the TCGA database. It was observed that GNG7 gene expression was downregulated in CCRCC tissue compared with healthy tissue, and high GNG7 predicted better prognosis for patients, and GNG7 also showed strong variability in clinical and TMN staging. The immune relevance of GNG7 and related genes was explored using renal cancer data from CCLE and TISIDB database. It was verified that the risk score constructed by 7 GNG7-related regulators might be used as an independent prognostic risk factor for CCRCC. A CCRCC prognostic model that involved 7 immune genes was further established to predict the survival probabilities of patients. At last, the GEO database and immunochemical tissue staining were used to validate GNG7 expression in CCRCC. Our study proposed a novel panel of genes to predict CCRCC OS based on GNG7-related immune genes, which may help to accurately predict the prognosis of CCRCC patients and make better clinical decisions for individual treatment.

Also flagged:gallstone diseasestrokecoronary artery diseaseGSDcardiovascular diseaseCVD
Journal Article 2023-09-13 No Snippets Zhang L, Zhang W, He L, Cui H, Wang Y, Wu X, Zhao X, Yan P, Yang C, Xiao C, Tang M, Chen L, Xiao C, Zou Y, Liu Y, Yang Y, Zhang L, Yao Y, Li J, Liu Z, Yang C, Jiang X, Zhang B.
Show Full Abstract

<h4>Background</h4>Despite epidemiological evidence associating gallstone disease (GSD) with cardiovascular disease (CVD), a dilemma remains on the role of cholecystectomy in modifying the risk of CVD. We aimed to characterize the phenotypic and genetic relationships between GSD and two CVD events - stroke and coronary artery disease (CAD).<h4>Methods</h4>We first performed a meta-analysis of cohort studies to quantify an overall phenotypic association between GSD and CVD. We then investigated the genetic relationship leveraging the largest genome-wide genetic summary statistics. We finally examined the phenotypic association using the comprehensive data from UK Biobank (UKB).<h4>Results</h4>An overall significant effect of GSD on CVD was found in meta-analysis (relative risk [RR] = 1.26, 95% confidence interval [CI] = 1.19-1.34). Genetically, a positive shared genetic basis was observed for GSD with stroke ([Formula: see text]=0.16, P = 6.00 × 10<sup>-4</sup>) and CAD ([Formula: see text]=0.27, P = 2.27 × 10<sup>-15</sup>), corroborated by local signals. The shared genetic architecture was largely explained by the multiple pleiotropic loci identified in cross-phenotype association study and the shared gene-tissue pairs detected by transcriptome-wide association study, but not a causal relationship (GSD to CVD) examined through Mendelian randomization (MR) (GSD-stroke: odds ratio [OR] = 1.00, 95%CI = 0.97-1.03; GSD-CAD: OR = 1.01, 95%CI = 0.98-1.04). After a careful adjustment of confounders or considering lag time using UKB data, no significant phenotypic effect of GSD on CVD was detected (GSD-stroke: hazard ratio [HR] = 0.95, 95%CI = 0.83-1.09; GSD-CAD: HR = 0.98, 95%CI = 0.91-1.06), further supporting MR findings.<h4>Conclusions</h4>Our work demonstrates a phenotypic and genetic relationship between GSD and CVD, highlighting a shared biological mechanism rather than a direct causal effect. These findings may provide insight into clinical and public health applications.

TAOK3
Also flagged:Esophageal Squamous Cell CarcinomaCisplatinESCCcancersTAO kinaseautophagy
Journal Article 2023-09-13 ✓ 5 Snippets Sun M, Li Z, Wang X, Zhao M, Chu Y, Zhang Z, Fang K, Zhao Z, Feng A, Leng Z, Shi J, Zhang L, Chen T, Xu M.
In-Text Gene Mentions

TAOK3 and IRGM are overexpressed in ESCC tissues and are clinically associated with tumor stage and poor prognosis.

I) IHC analysis of the expression of protein TAOK3, ETV5, and IRGM of removed tumors in sh‐TAOK3, sh‐ETV5, and sh‐IRGM groups.

In addition to the involvement in the innate immune response, IRGM is well‐known for playing an essential role in regulating autophagy in many types of diseases, including cancers.[26, 27] After the efficiency of ETV5 knockdown and overexpression was confirmed from qPCR (Figure S4A,C, Supporting Information) and western blot assays (Figure S4B,D, Supporting Information), we found that the expression of IRGM was significantly upregulated from the mRNA level when TAOK3 or ETV5 was overexpressed, and downregulated when TAOK3 or ETV5 was knocked down (Figure 3D–G, Supporting Information).

From TCGA analysis (Figure S1A–C, Supporting Information) and qPCR (Figure S1D–F, Supporting Information), and western blot (Figure S1G, Supporting Information) in ESCC tissues collected from five enrolled patients, we found that of these three TAO kinases, TAOK3 was confirmed to be overexpressed in ESCC, and its expression level in ESCC ranked high among all kinds of cancers (Figure S1H, Supporting Information).

Collectively, these data imply that under the effect of TAOK3's phosphorylation, KMT2C mediates histone methylation and transcriptionally upregulates the expression of IRGM together with ETV5, and tumor autophagy is augmented consequently.

Show Full Abstract

Esophageal squamous cell carcinoma (ESCC) is one of the deadliest cancers because of its robust aggressive phenotype and chemoresistance. TAO kinase belongs to mitogen-activated protein kinases, which mediate drug resistance in multiple cancers. However, the role of TAO kinase in ESCC progression and chemoresistance has never been explored. Here, it is reported that TAOK3 augments cell autophagy and further promotes ESCC progression and chemoresistance. Mechanistically, TAOK3 phosphorylates KMT2C at S4588 and strengthens the interaction between KMT2C and ETV5. Consequently, the nuclear translocation of KMT2C is increased, and the transcription of autophagy-relevant gene IRGM is further upregulated. Additionally, the inhibitor SBI-581 can significantly suppress cell autophagy mediated by TAOK3 and synergizes with cisplatin to treat ESCC in vitro and in vivo.

NEGR1DCC
Also flagged:sporadic amyotrophic lateral sclerosisfALSdigestionadenylate cyclaseSOD1
Journal Article 2023-09-13 ✓ 2 Snippets Gerovska D, Noer JB, Qin Y, Ain Q, Januzi D, Schwab M, Witte OW, Araúzo-Bravo MJ, Kretz A.
In-Text Gene Mentions

…, Chchd3 ,Dcc, Fhit ,…

…the IgLON family,Negr1(IgLON4) and Ntm…

Show Full Abstract

<h4>Background</h4>Numerous genes, including SOD1, mutated in familial and sporadic amyotrophic lateral sclerosis (f/sALS) share a role in DNA damage and repair, emphasizing genome disintegration in ALS. One possible outcome of chromosomal instability and repair processes is extrachromosomal circular DNA (eccDNA) formation. Therefore, eccDNA might accumulate in f/sALS with yet unknown function.<h4>Methods</h4>We combined rolling circle amplification with linear DNA digestion to purify eccDNA from the cervical spinal cord of 9 co-isogenic symptomatic hSOD1<sup>G93A</sup> mutants and 10 controls, followed by deep short-read sequencing. We mapped the eccDNAs and performed differential analysis based on the split read signal of the eccDNAs, referred as DifCir, between the ALS and control specimens, to find differentially produced per gene circles (DPpGC) in the two groups. Compared were eccDNA abundances, length distributions and genic profiles. We further assessed proteome alterations in ALS by mass spectrometry, and matched the DPpGCs with differentially expressed proteins (DEPs) in ALS. Additionally, we aligned the ALS-specific DPpGCs to ALS risk gene databases.<h4>Results</h4>We found a six-fold enrichment in the number of unique eccDNAs in the genotoxic ALS-model relative to controls. We uncovered a distinct genic circulome profile characterized by 225 up-DPpGCs, i.e., genes that produced more eccDNAs from distinct gene sequences in ALS than under control conditions. The inter-sample recurrence rate was at least 89% for the top 6 up-DPpGCs. ALS proteome analyses revealed 42 corresponding DEPs, of which 19 underlying genes were itemized for an ALS risk in GWAS databases. The up-DPpGCs and their DEP tandems mainly impart neuron-specific functions, and gene set enrichment analyses indicated an overrepresentation of the adenylate cyclase modulating G protein pathway.<h4>Conclusions</h4>We prove, for the first time, a significant enrichment of eccDNA in the ALS-affected spinal cord. Our triple circulome, proteome and genome approach provide indication for a potential importance of certain eccDNAs in ALS neurodegeneration and a yet unconsidered role as ALS biomarkers. The related functional pathways might open up new targets for therapeutic intervention.

SOX6
Also flagged:Sox11Transcription factorsSry-related HMG-boxSOXstem cellchromatin
Journal Article 2023-09-13 ✓ 2 Snippets Oprescu SN, Baumann N, Chen X, Sun Q, Zhao Y, Yue F, Wang H, Kuang S.
In-Text Gene Mentions

…For example,Sox6functions to repress…

…Sox family member,Sox6, regulates slow-muscle fiber…

Show Full Abstract

Transcription factors (TFs) play key roles in regulating differentiation and function of stem cells, including muscle satellite cells (MuSCs), a resident stem cell population responsible for postnatal regeneration of the skeletal muscle. Sox11 belongs to the Sry-related HMG-box (SOX) family of TFs that play diverse roles in stem cell behavior and tissue specification. Analysis of single-cell RNA-sequencing (scRNA-seq) datasets identify a specific enrichment of Sox11 mRNA in differentiating but not quiescent MuSCs. Consistent with the scRNA-seq data, Sox11 levels increase during differentiation of murine primary myoblasts in vitro. scRNA-seq data comparing muscle regeneration in young and old mice further demonstrate that Sox11 expression is reduced in aged MuSCs. Age-related decline of Sox11 expression is associated with reduced chromatin contacts within the topologically associating domains. Unexpectedly, Myod1<sup>Cre</sup>-driven deletion of Sox11 in embryonic myoblasts has no effects on muscle development and growth, resulting in apparently healthy muscles that regenerate normally. Pax7<sup>CreER</sup>- or Rosa26<sup>CreER</sup>- driven (MuSC-specific or global) deletion of Sox11 in adult mice similarly has no effects on MuSC differentiation or muscle regeneration. These results identify Sox11 as a novel myogenic differentiation marker with reduced expression in quiescent and aged MuSCs, but the specific function of Sox11 in myogenesis remains to be elucidated.

ZNF644
Also flagged:muscular atrophycytoskeletongene expressionsplicingTRA2BTGFBR2
Journal Article 2023-09-13 ✓ 1 Snippet Chen G, Chen J, Qi L, Yin Y, Lin Z, Wen H, Zhang S, Xiao C, Bello SF, Zhang X, Nie Q, Luo W.
In-Text Gene Mentions

…, LMOD1 andZNF644, the coverage…

Show Full Abstract

Alternative splicing (AS) disruption has been linked to disorders of muscle development, as well as muscular atrophy. However, the precise changes in AS patterns that occur during myogenesis are not well understood. Here, we employed isoform long-reads RNA-seq (Iso-seq) and single-cell RNA-seq (scRNA-seq) to investigate the AS landscape during myogenesis. Our Iso-seq data identified 61,146 full-length isoforms representing 11,682 expressed genes, of which over 52% were novel. We identified 38,022 AS events, with most of these events altering coding sequences and exhibiting stage-specific splicing patterns. We identified AS dynamics in different types of muscle cells through scRNA-seq analysis, revealing genes essential for the contractile muscle system and cytoskeleton that undergo differential splicing across cell types. Gene-splicing analysis demonstrated that AS acts as a regulator, independent of changes in overall gene expression. Two isoforms of splicing factor TRA2B play distinct roles in myogenic differentiation by triggering AS of TGFBR2 to regulate canonical TGF-β signalling cascades differently. Our study provides a valuable transcriptome resource for myogenesis and reveals the complexity of AS and its regulation during myogenesis.

DCC
Also flagged:Aginginfectioncell activationbehavioralcognitive declinelipopolysaccharide
Journal Article 2023-09-13 ✓ 1 Snippet Ince LM, Darling JS, Sanchez K, Bell KS, Melbourne JK, Davis LK, Nixon K, Gaudet AD, Fonken LK.
In-Text Gene Mentions

Dcc

Show Full Abstract

Aging is associated with a significant shift in immune system reactivity ("inflammaging"), as basal inflammation increases but protective responses to infection are compromised. The immune system exhibits considerable sex differences, which may influence the process of inflammaging, including immune cell activation and behavioral consequences of immune signaling (i.e., impaired memory). Here, we test the hypothesis that sex differences in immune aging may mediate sex differences in cognitive decline. Aged male and female rats received peripheral immune stimulation using lipopolysaccharide (LPS), then molecular, cellular, and behavioral outcomes were assessed. We observed that LPS-treated aged male rats showed cognitive impairment and increased neuroinflammatory responses relative to adult males. In contrast, aged female rats did not display these aging-related deficits. Using transcriptomic and flow cytometry analyses, we further observed significant age- and sex- dependent changes in immune cell populations in the brain parenchyma and meninges, indicating a broad shift in the neuroinflammatory environment that may potentiate these behavioral effects. Ovariectomized aged female rats were also resistant to inflammation-induced memory deficits, indicating that ovarian hormones are not required for the attenuated neuroinflammation in aged females. Overall, our results indicate that males have amplified inflammatory priming with age, which contributes to age-associated cognitive decline. Our findings highlight sexual dimorphism in mechanisms of aging, and suggest that sex is a crucial consideration for identifying therapies for aging and neuroinflammation.

Also flagged:carboxylic acidsalcoholsbenzyl alcoholssynthesisesterscarbodiimides
Journal Article 2023-09-13 No Snippets Nasiri F, Mokhtari J, Taheri S, Mirjafary Z.
Show Full Abstract

DCID (Dichloroimidazolidinedione) 2 is used as a novel coupling reagent for the esterification of carboxylic acids with alcohols at room temperature. The reaction represents the first DCID-promoted esterification under mild conditions with good to excellent yields. Reactions can proceed smoothly with those bearing electron-withdrawing and donating group(s) on the carboxylic acids and benzyl alcohols at ambient temperature. Furthermore, we proposed a plausible mechanism and confirmed it by isolating and characterizing intermediates 3a and 7. The structures of the synthesized compounds were confirmed by comparison of melting points and NMR spectra.

Also flagged:FolatemTORpolycystic kidneysrapamycinpolycystic kidney diseasepolycystic kidney
Journal Article 2023-09-13 No Snippets Pala R, Barui AK, Mohieldin AM, Zhou J, Nauli SM.
Show Full Abstract

Although rapamycin is a very effective drug for rodents with polycystic kidney disease (PKD), it is not encouraging in the clinical trials due to the suboptimal dosages compelled by the off-target side effects. We here report the generation, characterization, specificity, functionality, pharmacokinetic, pharmacodynamic and toxicology profiles of novel polycystic kidney-specific-targeting nanoparticles (NPs). We formulated folate-conjugated PLGA-PEG NPs, which can be loaded with multiple drugs, including rapamycin (an mTOR inhibitor) and antioxidant 4-hydroxy-TEMPO (a nephroprotective agent). The NPs increased the efficacy, potency and tolerability of rapamycin resulting in an increased survival rate and improved kidney function by decreasing side effects and reducing biodistribution to other organs in PKD mice. The daily administration of rapamycin-alone (1 mg/kg/day) could now be achieved with a weekly injection of NPs containing rapamycin (379 μg/kg/week). This polycystic kidney-targeting nanotechnology, for the first time, integrated advances in the use of 1) nanoparticles as a delivery cargo, 2) folate for targeting, 3) near-infrared Cy5-fluorophore for in vitro and in vivo live imaging, 4) rapamycin as a pharmacological therapy, and 5) TEMPO as a combinational therapy. The slow sustained-release of rapamycin by polycystic kidney-targeting NPs demonstrates a new era of nanomedicine in treatment for chronic kidney diseases at clinically relevant doses.

Also flagged:type I collagenmineralhydroxyapatitewatercollagenproteoglycan
Journal Article 2023-09-13 No Snippets Lázár I, Čelko L, Menelaou M.
Show Full Abstract

Aerogels are fascinating solid materials known for their highly porous nanostructure and exceptional physical, chemical, and mechanical properties. They show great promise in various technological and biomedical applications, including tissue engineering, and bone and cartilage substitution. To evaluate the bioactivity of bone substitutes, researchers typically conduct in vitro tests using simulated body fluids and specific cell lines, while in vivo testing involves the study of materials in different animal species. In this context, our primary focus is to investigate the applications of different types of aerogels, considering their specific materials, microstructure, and porosity in the field of bone and cartilage tissue engineering. From clinically approved materials to experimental aerogels, we present a comprehensive list and summary of various aerogel building blocks and their biological activities. Additionally, we explore how the complexity of aerogel scaffolds influences their in vivo performance, ranging from simple single-component or hybrid aerogels to more intricate and organized structures. We also discuss commonly used formulation and drying methods in aerogel chemistry, including molding, freeze casting, supercritical foaming, freeze drying, subcritical, and supercritical drying techniques. These techniques play a crucial role in shaping aerogels for specific applications. Alongside the progress made, we acknowledge the challenges ahead and assess the near and far future of aerogel-based hard tissue engineering materials, as well as their potential connection with emerging healing techniques.

Also flagged:myocardial infarctionheart failureangiogenesiscardiovascular diseasesischemiadeath
Journal Article 2023-09-13 No Snippets Tran T, Cruz C, Chan A, Awad S, Rajasingh J, Deth R, Gurusamy N.
Show Full Abstract

Cardiac injury, such as myocardial infarction and heart failure, remains a significant global health burden. The limited regenerative capacity of the adult heart poses a challenge for restoring its function after injury. Mesenchymal stem cells (MSCs) have emerged as promising candidates for cardiac regeneration due to their ability to differentiate into various cell types and secrete bioactive molecules. In recent years, attention has been given to noncoding RNAs derived from MSCs, particularly long noncoding RNAs (lncRNAs), and their potential role in cardiac injury and repair. LncRNAs are RNA molecules that do not encode proteins but play critical roles in gene regulation and cellular responses including cardiac repair and regeneration. This review focused on MSC-derived lncRNAs and their implications in cardiac regeneration, including their effects on cardiac function, myocardial remodeling, cardiomyocyte injury, and angiogenesis. Understanding the molecular mechanisms of MSC-derived lncRNAs in cardiac injury and repair may contribute to the development of novel therapeutic strategies for treating cardiovascular diseases. However, further research is needed to fully elucidate the potential of MSC-derived lncRNAs and address the challenges in this field.

Also flagged:Pyrenebutyrateplatinumpyrene butyric acidcisplatincancerleukemia
Journal Article 2023-09-13 No Snippets Ahmedova A, Mihaylova R, Stoykova S, Mihaylova V, Burdzhiev N, Elincheva V, Momekov G, Momekova D.
Show Full Abstract

Research on platinum-based anticancer drugs continuously strives to develop new non-classical platinum complexes. Pt(IV) prodrugs are the most promising, and their activation-by-reduction mechanism of action is being explored as a prospect for higher selectivity and efficiency. Herein, we present the anticancer potency and chemical reactivity of Pt(IV) complexes formed by linking pyrene butyric acid with cisplatin. The results from cytotoxicity screening on 10 types of cancer cell lines and non-malignant cells (HEK-293) indicated IC<sub>50</sub> values as low as 50-70 nM for the monosubstituted Pt(IV) complex against leukemia cell lines (HL-60 and SKW3) and a cisplatin-resistant derivative (HL-60/CDDP). Interestingly, the bis-substituted complex is virtually non-toxic to both healthy and cancerous cells of adherent types. Nevertheless, it shows high cytotoxicity against multidrug-resistant derivatives HL-60/CDDP and HL-60/Dox. The reactivity of the complexes with biological reductants was monitored by the NMR method. Furthermore, the platinum uptake by the treated cells was examined on two types of cellular cultures: adherent and suspension growing, and proteome profiling was conducted to track expression changes of key apoptosis-related proteins in HL-60 cells. The general conclusion points to a possible cytoskeletal entrapment of the bulkier bis-pyrene complex that could be limiting its cytotoxicity to adherent cells, both cancerous and healthy ones.

Also flagged:antibodymesothelinMSLNtumor-associated antigensolid tumorsantibodies
Journal Article 2023-09-13 No Snippets Sun Z, Chu X, Adams C, Ilina TV, Guerrero M, Lin G, Chen C, Jelev D, Ishima R, Li W, Mellors JW, Calero G, Dimitrov DS.
Show Full Abstract

Mesothelin (MSLN) has been a validated tumor-associated antigen target for several solid tumors for over a decade, making it an attractive option for therapeutic interventions. Novel antibodies with high affinity and better therapeutic properties are needed. In the current study, we have isolated and characterized a novel heavy chain variable (VH) domain 3C9 from a large-size human immunoglobulin VH domain library. 3C9 exhibited high affinity (KD [dissociation constant] <3 nM) and binding specificity in a membrane proteome array (MPA). In a mouse xenograft model, 3C9 fused to human IgG1 Fc was detected at tumor sites as early as 8 h post-infusion and remained at the site for over 10 days. Furthermore, 3C9 fused to a human Fc domain drug conjugate effectively inhibited MSLN-positive tumor growth in a mouse xenograft model. The X-ray crystal structure of full-length MSLN in complex with 3C9 reveals interaction of the 3C9 domains with two distinctive residue patches on the MSLN surface. This newly discovered VH antibody domain has a high potential as a therapeutic candidate for MSLN-expressing cancers.

SERPINC1
Also flagged:Acute pulmonary embolismacute myocardial infarctionacute leukemiaacute myeloid leukemiaAMLcoagulation
Journal Article 2023-09-13 ✓ 4 Snippets Zheng S, Luo S, Luo Y, Liu D, Zheng W, Peng Q.
In-Text Gene Mentions

…protein S, andATIIIdecreased in varying…

…no change ofATIIIlevel was observed,…

…and antithrombin III (ATIII) level of 83%…

…μg/Ml and normalATIIIlevel (88%).…

Show Full Abstract

Thrombotic complications in acute myeloid leukemia (AML) are uncommon due to coagulation dysfunction and thrombocytopenia. We report a unique case of AML presenting as concomitant pulmonary embolism and atypical acute myocardial infarction. A 67-year-old male experienced persistent bilateral chest pain. Despite an unremarkable electrocardiogram, elevated D-dimer and mildly increased troponin T levels prompted further investigation, leading to the diagnosis of simultaneous pulmonary embolism and acute myocardial infarction. The patient underwent percutaneous coronary intervention and received triple antithrombotic therapy. However, antithrombotic therapy was discontinued following a sharp decline in hemoglobin and platelet counts, and the patient subsequently developed persistent fever. AML was diagnosed via bone marrow biopsy. Chemotherapy was not initiated due to the patient's deteriorating condition, and he ultimately succumbed to presumed intracranial bleeding.

PEBP1
Also flagged:ironferroptosisglucoselipidmetabolisminflammatory responses
Journal Article 2023-09-13 ✓ 1 Snippet Ouyang J, Zhou L, Wang Q.
In-Text Gene Mentions

GLUT, glucose transporter; ALOX, arachidonate lipoxygenase; PEBP1, phosphatidylethanolamine binding protein 1; ACLS4, acyl-CoA synthetase long-chain family member 4; PUFA, polyunsaturated fatty acid; PUFA-PL-OOH, phospholipid with peroxidized polyunsaturated fatty acyl tail; ACC, acetyl-coenzyme A carboxylase; AMPK, adenosine-monophosphate-activated protein kinase; DHODH, dihydroorotate dehydrogenase; CoQ, coenzyme Q; CoA, coenzyme A; PKCβII, protein kinase C beta type isoform 2; LIP, labile iron pool; BH4, tetrahydrobiopterin; NADPH, reduced nicotinamide adenine dinucleotide phosphate; NADH, reduced nicotinamide adenine dinucleotide; FSP1, ferroptosis suppressor protein 1; GPX4, glutathione peroxidase 4; GSH, glutathione; Mst1/2, macrophage stimulating 1/2; LATS1/2, large tumor suppressor1/2; Yap, yes1 associated transcriptional regulator; system Xc-, anionic amino acid transport system.

Show Full Abstract

Iron, as the most abundant metallic element within the human organism, is an indispensable ion for sustaining life and assumes a pivotal role in governing glucose and lipid metabolism, along with orchestrating inflammatory responses. The presence of diabetes mellitus (DM) can induce aberrant iron accumulation within the corporeal system. Consequentially, iron overload precipitates a sequence of important adversities, subsequently setting in motion a domino effect wherein ferroptosis emerges as the utmost pernicious outcome. Ferroptosis, an emerging variant of non-apoptotic regulated cell death, operates independently of caspases and GSDMD. It distinguishes itself from alternative forms of controlled cell death through distinctive morphological and biochemical attributes. Its principal hallmark resides in the pathological accrual of intracellular iron and the concomitant generation of iron-driven lipid peroxides. Diabetic retinopathy (DR), established as the predominant cause of adult blindness, wields profound influence over the well-being and psychosocial strain experienced by afflicted individuals. Presently, an abundance of research endeavors has ascertained the pervasive engagement of iron and ferroptosis in the microangiopathy inherent to DR. Evidently, judicious management of iron overload and ferroptosis in the early stages of DR bears the potential to considerably decelerate disease progression. Within this discourse, we undertake a comprehensive exploration of the regulatory mechanisms governing iron homeostasis and ferroptosis. Furthermore, we expound upon the subsequent detriments induced by their dysregulation. Concurrently, we elucidate the intricate interplay linking iron overload, ferroptosis, and DR. Delving deeper, we engage in a comprehensive deliberation regarding strategies to modulate their influence, thereby effecting prospective interventions in the trajectory of DR's advancement or employing them as therapeutic modalities.

Also flagged:bone formationsodiumfluoridepositronskeletal diseasesbinding
Journal Article 2023-09-13 No Snippets Puri T, Frost ML, Moore AEB, Choudhury A, Vinjamuri S, Mahajan A, Fynbo C, Vrist M, Theil J, Kairemo K, Wong J, Zaidi H, Revheim ME, Werner TJ, Alavi A, Cook GJR, Blake GM.
Show Full Abstract

We review the rationale, methodology, and clinical utility of quantitative [<sup>18</sup>F] sodium fluoride ([<sup>18</sup>F]NaF) positron emission tomography-computed tomography (PET-CT) imaging to measure bone metabolic flux (K<sub>i</sub>, also known as bone plasma clearance), a measurement indicative of the local rate of bone formation at the chosen region of interest. We review the bone remodelling cycle and explain what aspects of bone remodelling are addressed by [<sup>18</sup>F]NaF PET-CT. We explain how the technique works, what measurements are involved, and what makes [<sup>18</sup>F]NaF PET-CT a useful tool for the study of bone remodelling. We discuss how these measurements can be simplified without loss of accuracy to make the technique more accessible. Finally, we briefly review some key clinical applications and discuss the potential for future developments. We hope that the simplified method described here will assist in promoting the wider use of the technique.

SERPINC1
Also flagged:cognitive impairmentCOVID-19mild cognitive impairmentdementia-19Dementias
Journal Article 2023-09-13 ✓ 2 Snippets Modarres MH, Kalafatis C, Apostolou P, Tabet N, Khaligh-Razavi SM.
In-Text Gene Mentions

…< 0.000) withACE-IIIand 0.77 (…

…overall accuracy ofACE-IIIon these participants…

Show Full Abstract

<h4>Background</h4>Current primary care cognitive assessment tools are either crude or time-consuming instruments that can only detect cognitive impairment when it is well established. This leads to unnecessary or late referrals to memory services, by which time the disease may have already progressed into more severe stages. Due to the COVID-19 pandemic, some memory services have adapted to the new environment by shifting to remote assessments of patients to meet service user demand. However, the use of remote cognitive assessments has been inconsistent, and there has been little evaluation of the outcome of such a change in clinical practice. Emerging research has highlighted computerized cognitive tests, such as the Integrated Cognitive Assessment (ICA), as the leading candidates for adoption in clinical practice. This is true both during the pandemic and in the post-COVID-19 era as part of healthcare innovation.<h4>Objectives</h4>The Accelerating Dementias Pathways Technologies (ADePT) Study was initiated in order to address this challenge and develop a real-world evidence basis to support the adoption of ICA as an inexpensive screening tool for the detection of cognitive impairment and improving the efficiency of the dementia care pathway.<h4>Methods</h4>Ninety-nine patients aged 55-90 who have been referred to a memory clinic by a general practitioner (GP) were recruited. Participants completed the ICA either at home or in the clinic along with medical history and usability questionnaires. The GP referral and ICA outcome were compared with the specialist diagnosis obtained at the memory clinic.Participants were given the option to carry out a retest visit where they were again given the chance to take the ICA test either remotely or face-to-face.<h4>Results</h4>The primary outcome of the study compared GP referral with specialist diagnosis of mild cognitive impairment (MCI) and dementia. Of those the GP referred to memory clinics, 78% were necessary referrals, with ~22% unnecessary referrals, or patients who should have been referred to other services as they had disorders other than MCI/dementia. In the same population the ICA was able to correctly identify cognitive impairment in ~90% of patients, with approximately 9% of patients being false negatives. From the subset of unnecessary GP referrals, the ICA classified ~72% of those as not having cognitive impairment, suggesting that these unnecessary referrals may not have been made if the ICA was in use. ICA demonstrated a sensitivity of 93% for dementia and 83% for MCI, with a specificity of 80% for both conditions in detecting cognitive impairment. Additionally, the test-retest prediction agreement for the ICA was 87.5%.<h4>Conclusion</h4>The results from this study demonstrate the potential of the ICA as a screening tool, which can be used to support accurate referrals from primary care settings, along with the work conducted in memory clinics and in secondary care. The ICA's sensitivity and specificity in detecting cognitive impairment in MCI surpassed the overall standard of care reported in existing literature.

TNFSF4
Also flagged:lactatemetabolismbladder cancerCancertumorpathogenesis
Journal Article 2023-09-13 ✓ 1 Snippet Wang X, Pan J, Guan Q, Ren N, Wang P, Wei M, Li Z.
In-Text Gene Mentions

…TNFRSF14, TNFRSF9, TNFRSF8,TNFSF4, HAVCR2, LAG3, LGALS9,…

Show Full Abstract

<b>Background:</b> Bladder cancer (BCA) has high recurrence and metastasis rates, and current treatment options show limited efficacy and significant adverse effects. It is crucial to find diagnostic markers and therapeutic targets with clinical value. This study aimed to identify lactate metabolism-related lncRNAs (LM_lncRNAs) to establish a model for evaluating bladder cancer prognosis. <b>Method:</b> A risk model consisting of lactate metabolism-related lncRNAs was developed to forecast bladder cancer patient prognosis using The Cancer Genome Atlas (TCGA) database. <i>Kaplan‒Meier</i> survival analysis, receiver operating characteristic curve (ROC) analysis and decision curve analysis (DCA) were used to evaluate the reliability of risk grouping for predictive analysis of bladder cancer patients. The results were also validated in the validation set. Chemotherapeutic agents sensitive to lactate metabolism were assessed using the Genomics of Drug Sensitivity in Cancer (GDSC) database. <b>Results:</b> As an independent prognostic factor for patients, lactate metabolism-related lncRNAs can be used as a nomogram chart that predicts overall survival time (OS). There were significant differences in survival rates between the high-risk and low-risk groups based on the <i>Kaplan‒Meier</i> survival curve. decision curve analysis and receiver operating characteristic curve analysis confirmed its good predictive capacity. As a result, 22 chemotherapeutic agents were predicted to positively affect the high-risk group. <b>Conclusion:</b> An lactate metabolism-related lncRNA prediction model was proposed to predict the prognosis for patients with bladder cancer and chemotherapeutic drug sensitivity in high-risk groups, which provided a new idea for the prognostic evaluation of the clinical treatment of bladder cancer.

SOX6
Also flagged:gene expressionVEGFInsulinMAPKHedgehogTLR
Journal Article 2023-09-13 ✓ 1 Snippet Liao L, Yao Z, Kong J, Zhang X, Li H, Chen W, Xie Q.
In-Text Gene Mentions

…formation by repressingSOX6and gga-miRNA-24-3p promoting…

Show Full Abstract

In the early stages of embryonic development, a precise and strictly controlled hierarchy of gene expression is essential to ensure proper development of all cell types and organs. To better understand this gene control process, we constructed a small RNA library from 1- to 5-day-old chick embryos, and identified 2,459 miRNAs including 827 existing, 695 known, and 937 novel miRNAs with bioinformatic analysis. There was absolute high expression of a number of miRNAs in each stage, including gga-miR-363-3p (Em1d), gga-miR-26a-5p (Em2d and Em3d), gga-miR-10a-5p (Em4d), and gga-miR-199-5p (Em5d). We evaluated enriched miRNA profiles, identifying VEGF, Insulin, ErbB, MAPK, Hedgehog, TLR and Hippo signaling pathways as primary regulatory mechanisms enabling complex morphogenetic transformations within tight temporal constraints. Pathway analysis revealed miRNAs as pivotal nodes of interaction, coordinating cascades of gene expression critical for cell fate determination, proliferation, migration, and differentiation across germ layers and developing organ systems. Weighted Gene Co-Expression Network Analysis (WGCNA) generated hub miRNAs whose modular connections spanned regulatory networks, including: gga-miR-181a-3p (blue module), coordinating immunegenesis and myogenesis; gga-miR-126-3p (brown module), regulating vasculogenesis and angiogenesis; gga-miR-302c-5p (turquoise module), enabling pluripotency and self-renew; and gga-miR-429-3p (yellow module), modulating neurogenesis and osteogenesis. The findings of this study extend the knowledge of miRNA expression in early embryonic development of chickens, providing insights into the intricate gene control process that helps ensure proper development.

HTT
Also flagged:brain atrophycognitive impairmentbrain striatal atrophyHDautosomal dominant neurodegenerative diseasecytosine
Journal Article 2023-09-13 ✓ 1 Snippet Zheng C, Tong L, Zhang Y.
In-Text Gene Mentions

HTT

Show Full Abstract

Cognitive impairment has been widely accepted as a disease progression measure prior to the onset of Huntington's disease. We propose a sophisticated measurement error correction method that can handle potentially correlated measurement errors in longitudinally collected exposures and multiple outcomes. The asymptotic theory for the proposed method is developed. A simulation study is conducted to demonstrate the satisfactory performance of the proposed two-stage fitting method and shows that the independent working correlation structure outperforms other alternatives. We conduct a comprehensive longitudinal analysis to assess how brain striatal atrophy affects impairment in various cognitive domains for Huntington's disease.

Research Square 2023-09-13 Preprint (No Snippets API) Walton M, Raghuveer G, Harahsheh A, Portman MA, Lee S, Khoury M, Dahdah N, Fabi M, Dionne A, Harris TH, Choueiter N, Garrido-Garcia LM, Jain S, Dallaire F, Misra N, Hicar MD, Giglia TM, Truong DT, Tierney ESS, Thacker D, Nowlen TT, Szmuszkovicz JR, Norozi K, Orr WB, Farid P, Manlhiot C, McCrindle BW, Alsalehi M, Ballweg JA, Barnes BT, Braunlin E, Buffone A, Bustamante-Ogando JC, Chang AJ, Corral N, Cowles H, Dancey P, de Ferranti SD, Ganzoury ME, Elias M, Elsamman N, Cooke EF, Goldenberg GL, Grcic MM, Harris KC, Jone P, Kajimoto H, Khare M, Kutty S, Lanari M, Mauriello D, McHugh KE, Merves SA, Mohandas S, Mondal T, Pagano JJ, Prasad D, Ravi P.
Show Full Abstract

<h4>Background: </h4> Kawasaki disease (KD) and Multisystem Inflammatory Syndrome in Children (MIS-C) associated with COVID-19 show clinical overlap and both lack definitive diagnostic testing, making differentiation challenging. We sought to determine how cardiac biomarkers might differentiate KD from MIS-C. <h4>Methods: </h4>: The International Kawasaki Disease Registry enrolled contemporaneous KD and MIS-C pediatric patients from 42 sites from January 2020 through June 2022. The study population included 118 KD patients who met American Heart Association KD criteria and compared them to 946 MIS-C patients who met 2020 Centers for Disease Control and Prevention case definition. All included patients had at least one measurement of amino-terminal prohormone brain natriuretic peptide(NTproBNP) or cardiac troponin I (TnI), and echocardiography. Regression analyses were used to determine associations between cardiac biomarker levels, diagnosis, and cardiac involvement. <h4>Results: </h4>: Higher NTproBNP ( > 1500 ng/L) and TnI ( > 20 ng/L) at presentation were associated with MIS-C versus KD with specificity of 77 and 89% respectively. Higher biomarker levels were associated with shock and intensive care unit admission; higher NTproBNP was associated with longer hospital length of stay. Lower left ventricular ejection fraction, more pronounced for MIS-C, was also associated with higher biomarker levels. Coronary artery involvement was not associated with either biomarker. <h4>Conclusions: </h4>: Higher NTproBNP and TnI levels are suggestive of MIS-C versus KD and may be clinically useful in their differentiation. Consideration might be given to their inclusion in the routine evaluation of both conditions.

PRDX6
Also flagged:Peroxiredoxin 6Peroxiredoxinscysteinethioredoxinhydroperoxidesphospholipid hydroperoxides
Journal Article 2023-09-12 ✓ 5 Snippets Rahaman H, Herojit K, Singh LR, Haobam R, Fisher AB.
In-Text Gene Mentions

The single C<sub>P</sub> of Prdx6 uses various external electron donors including glutathione thioredoxin, and ascorbic acid for resolution of its peroxidized state and, therefore, its peroxidase activity.

…the peroxiredoxin 6 (Prdx6) family.…

…chain hydroperoxides whilePrdx6in addition, can…

…single C<sub>P</sub> ofPrdx6uses various external…

Prdx6proteins also exhibit…

Show Full Abstract

<b>Significance:</b> Peroxiredoxins (Prdxs) with a single peroxidative cysteine (C<sub>P</sub>) in a conserved motif PXXX(T/S)XXC<sub>P</sub> within its thioredoxin fold, have been classified as the peroxiredoxin 6 (Prdx6 ) family. All Prdxs can reduce H<sub>2</sub>O<sub>2</sub> and short chain hydroperoxides while Prdx6 in addition, can reduce phospholipid hydroperoxides (PLOOH) due to its ability to interact with peroxidized phospholipid substrate. The single C<sub>P</sub> of Prdx6 uses various external electron donors including glutathione thioredoxin, and ascorbic acid for resolution of its peroxidized state and, therefore, its peroxidase activity. Prdx6 proteins also exhibit Ca<sup>2+</sup>-independent phospholipase A2 (PLA2), lysophosphatidylcholine acyltransferase (LPCAT), and chaperone activities that depend on cellular localization and the oxidation and oligomerisation states of the protein. Thus, Prdx6 is a "moonlighting" enzyme. <b>Recent Advance:</b> Physiologically, Prdx6s have been reported to play an important role in protection against oxidative stress, repair of peroxidized cell membranes, mammalian lung surfactant turnover, activation of some NADPH oxidases, the regulation of seed germination in plants, as an indicator of cellular levels of reactive O<sub>2</sub> species through Nrf-Klf9 activation, and possibly in male fertility, regulation of cell death through ferroptosis, cancer metastasis, and oxidative stress-related signalling pathways. <b>Critical Issues:</b> This review outlines Prdx6 enzyme unique structural features and explores its wide range of physiological functions. Yet, existing structural data falls short of fully revealing all of human Prdx6 multifunctional roles. Further endeavour is required to bridge this gap in its understanding. Although there are wide variations in both the structure and function of Prdx6 family members in various organisms, all Prdx6 proteins show the unique a long C-terminal extension that is also seen in Prdx1, but not in other Prdxs. <b>Future Directions:</b> As research data continues to accumulate, the potential for detailed insights into the role of C-terminal of Prdx6 in its oligomerisation and activities. There is a need for thorough exploration of structural characteristics of the various biological functions. Additionally, uncovering the interacting partners of Prdx6 and understanding its involvement in signalling pathways will significantly contribute to a more profound comprehension of its role.

HTT
Also flagged:Nuclear poreNuclear pore complexesnucleuscytoplasmnuclearenvelope
Journal Article 2023-09-12 ✓ 1 Snippet Cristi AC, Rapuri S, Coyne AN.
In-Text Gene Mentions

HTT

Show Full Abstract

Nuclear pore complexes (NPCs) play a critical role in maintaining the equilibrium between the nucleus and cytoplasm, enabling bidirectional transport across the nuclear envelope, and are essential for proper nuclear organization and gene regulation. Perturbations in the regulatory mechanisms governing NPCs and nuclear envelope homeostasis have been implicated in the pathogenesis of several neurodegenerative diseases. The ESCRT-III pathway emerges as a critical player in the surveillance and preservation of well-assembled, functional NPCs, as well as nuclear envelope sealing. Recent studies have provided insights into the involvement of nuclear ESCRT-III in the selective reduction of specific nucleoporins associated with neurodegenerative pathologies. Thus, maintaining quality control of the nuclear envelope and NPCs represents a pivotal element in the pathological cascade leading to neurodegenerative diseases. This review describes the constituents of the nuclear-cytoplasmic transport machinery, encompassing the nuclear envelope, NPC, and ESCRT proteins, and how their structural and functional alterations contribute to the development of neurodegenerative diseases.

HFE
Also flagged:translationalliver injuryDILIalanine transaminaseALTalkaline phosphatase
Journal Article 2023-09-12 ✓ 1 Snippet Grove JI, Stephens C, Lucena MI, Andrade RJ, Weber S, Gerbes A, Bjornsson ES, Stirnimann G, Daly AK, Hackl M, Khamina-Kotisch K, Marin JJG, Monte MJ, Paciga SA, Lingaya M, Forootan SS, Goldring CEP, Poetz O, Lombaard R, Stege A, Bjorrnsson HK, Robles-Diaz M, Li D, Tran TDB, Ramaiah SK, Samodelov SL, Kullak-Ublick GA, Aithal GP, TransBioLine consortium.
In-Text Gene Mentions

…metabolic liver diseases (hemochromatosis, alpha-1 antitrypsin deficien…

Show Full Abstract

A lack of biomarkers that detect drug-induced liver injury (DILI) accurately continues to hinder early- and late-stage drug development and remains a challenge in clinical practice. The Innovative Medicines Initiative's TransBioLine consortium comprising academic and industry partners is developing a prospective repository of deeply phenotyped cases and controls with biological samples during liver injury progression to facilitate biomarker discovery, evaluation, validation and qualification.In a nested case-control design, patients who meet one of these criteria, alanine transaminase (ALT) ≥ 5 × the upper limit of normal (ULN), alkaline phosphatase ≥ 2 × ULN or ALT ≥ 3 ULN with total bilirubin > 2 × ULN, are enrolled. After completed clinical investigations, Roussel Uclaf Causality Assessment and expert panel review are used to adjudicate episodes as DILI or alternative liver diseases (acute non-DILI controls). Two blood samples are taken: at recruitment and follow-up. Sample size is as follows: 300 cases of DILI and 130 acute non-DILI controls. Additional cross-sectional cohorts (1 visit) are as follows: Healthy volunteers (n = 120), controls with chronic alcohol-related or non-alcoholic fatty liver disease (n = 100 each) and patients with psoriasis or rheumatoid arthritis (n = 100, 50 treated with methotrexate) are enrolled. Candidate biomarkers prioritised for evaluation include osteopontin, glutamate dehydrogenase, cytokeratin-18 (full length and caspase cleaved), macrophage-colony-stimulating factor 1 receptor and high mobility group protein B1 as well as bile acids, sphingolipids and microRNAs. The TransBioLine project is enabling biomarker discovery and validation that could improve detection, diagnostic accuracy and prognostication of DILI in premarketing clinical trials and for clinical healthcare application.

HFE
Also flagged:AceruloplasminemiaFerritinMicrocytic Anemia
Journal Article 2023-09-12 ✓ 2 Snippets Özkalaycı H, Uluköylü Mengüç M, Güleray Lafcı N, Öztürk Kaymak A.
In-Text Gene Mentions

Although HFE gene analysis had been performed previously in another outpatient clinic, we did not suspect hemochromatosis due to low transferrin saturation.

Bone marrow biopsy had been performed before admission and the results were reported as normocellular, with an increase in depository iron, together with alpha-thalassemia and HFE gene testing.

Show Full Abstract

No abstract available.

Also flagged:ironhydrideolefinstransition metalshydrogenpyridine
Journal Article 2023-09-12 No Snippets Najera DC, Fout AR.
Show Full Abstract

<i>Para</i>hydrogen induced polarization (PHIP) can address the low sensitivity problem intrinsic to nuclear magnetic resonance spectroscopy. Using a catalyst capable of reacting with <i>para</i>hydrogen and substrate in either a hydrogenative or nonhydrogenative manner can result in signal enhancement of the substrate. This work describes the development of a rare example of an iron catalyst capable of reacting with <i>para</i>hydrogen to hyperpolarize olefins. Complexes of the form (<sup>Mes</sup>CCC)Fe(H)(L)(N<sub>2</sub>) (L = Py (Py = pyridine), PMe<sub>3</sub>, PPh<sub>3</sub>) were synthesized from the reaction of the parent complexes (<sup>Mes</sup>CCC)FeMes(L) (Mes = mesityl) with H<sub>2</sub>. The isolated low-spin iron(II) hydride compounds were characterized via multinuclear NMR spectroscopy, infrared spectroscopy, and single crystal X-ray diffraction. (<sup>Mes</sup>CCC)Fe(H)(Py)(N<sub>2</sub>) is competent in the hydrogenation of olefins and demonstrated high activity toward the hydrogenation of monosubstituted terminal olefins. Reactions with <i>p</i>-H<sub>2</sub> resulted in the first PHIP effect mediated by iron which requires diamagnetism throughout the reaction sequence. This work represents the development of a new PHIP catalyst featuring iron, unlocking potential to develop more PHIP catalysts based on first-row transition metals.

Also flagged:FluoxetineserotoninreuptakeAllergic InflammationAllergic asthmalung
Journal Article 2023-09-12 No Snippets Haque TT, Taruselli MT, Kee SA, Dailey JM, Pondicherry N, Gajewski-Kurdziel PA, Zellner MP, Stephenson DJ, MacKnight HP, Straus DB, Kankaria R, Jackson KG, Chumanevich AP, Fukuoka Y, Schwartz LB, Blakely RD, Oskeritzian CA, Chalfant CE, Martin RK, Ryan JJ.
Show Full Abstract

There is a clinical need for new treatment options addressing allergic disease. Selective serotonin reuptake inhibitors (SSRIs) are a class of antidepressants that have anti-inflammatory properties. We tested the effects of the SSRI fluoxetine on IgE-induced function of mast cells, which are critical effectors of allergic inflammation. We showed that fluoxetine treatment of murine or human mast cells reduced IgE-mediated degranulation, cytokine production, and inflammatory lipid secretion, as well as signaling mediated by the mast cell activator ATP. In a mouse model of systemic anaphylaxis, fluoxetine reduced hypothermia and cytokine production. Fluoxetine was also effective in a model of allergic airway inflammation, where it reduced bronchial responsiveness and inflammation. These data show that fluoxetine suppresses mast cell activation by impeding an FcɛRI-ATP positive feedback loop and support the potential repurposing of this SSRI for use in allergic disease.

SOX6
Also flagged:addictiongene expressionimmune responseinterferoncell motilitysubstance use
Journal Article 2023-09-12 ✓ 1 Snippet Wei J, Lambert TY, Valada A, Patel N, Walker K, Lenders J, Schmidt CJ, Iskhakova M, Alazizi A, Mair-Meijers H, Mash DC, Luca F, Pique-Regi R, Bannon MJ, Akbarian S.
In-Text Gene Mentions

…subtyping, including ALDH1A1,SOX6,and SLC17A6 (Fig.…

Show Full Abstract

Dynamic interactions of neurons and glia in the ventral midbrain mediate reward and addiction behavior. We studied gene expression in 212,713 ventral midbrain single nuclei from 95 individuals with history of opioid misuse, and individuals without drug exposure. Chronic exposure to opioids was not associated with change in proportions of glial and neuronal subtypes, however glial transcriptomes were broadly altered, involving 9.5 - 6.2% of expressed genes within microglia, oligodendrocytes, and astrocytes. Genes associated with activation of the immune response including interferon, NFkB signaling, and cell motility pathways were upregulated, contrasting with down-regulated expression of synaptic signaling and plasticity genes in ventral midbrain non-dopaminergic neurons. Ventral midbrain transcriptomic reprogramming in the context of chronic opioid exposure included 325 genes that previous genome-wide studies had linked to risk of substance use traits in the broader population, thereby pointing to heritable risk architectures in the genomic organization of the brain's reward circuitry.

HFE
Also flagged:ascorbic acidglycocalyxsepsisseptic shockvitamin Cdeath
Journal Article 2023-09-12 ✓ 1 Snippet Belousoviene E, Pranskuniene Z, Vaitkaitiene E, Pilvinis V, Pranskunas A.
In-Text Gene Mentions

…lucose-6-phosphate deficiency,hemochromatosis, or solid organ…

Show Full Abstract

Previous studies indicate supplemental vitamin C improves microcirculation and reduces glycocalyx shedding in septic animals. Our randomized, double-blind, placebo-controlled trial aimed to investigate whether a high dose of intravenous ascorbic acid (AA) might improve microcirculation and affect glycocalyx in septic patients. In our study, 23 septic patients were supplemented with a high dose (50 mg/kg every 6 h) of intravenous AA or placebo for 96 h. Sublingual microcirculation was examined using a handheld Cytocam-incident dark field (IDF) video microscope. A sidestream dark field video microscope (SDF), connected to the GlycoCheck software (GlycoCheck ICU®; Maastricht University Medical Center, Maastricht, the Netherlands), was employed to observe glycocalyx. We found a significantly higher proportion of perfused small vessels (PPV) 6 h after the beginning of the trial in the experimental group compared with placebo. As an indicator of glycocalyx thickness, the perfused boundary region was lower in capillaries of the 5-9 μm diameter in the AA group than placebo after the first dose of AA. Our data suggest that high-dose parenteral AA tends to improve microcirculation and glycocalyx in the early period of septic shock. The study was retrospectively registered in the clinicaltrials.gov database on 26/02/2021 (registration number NCT04773717).

HTT
Also flagged:HDcognitive declineAnxietybehaviouralchromosomecognition
Journal Article 2023-09-12 ✓ 1 Snippet Dale M, Eccles FJR, Melvin K, Khan Z, Jones L, Zarotti N, Kiani R, Johnson J, Wells R, Simpson J.
In-Text Gene Mentions

…of a gene (HTT) on a chromosome…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is an adult-onset genetic neurodegenerative condition associated with cognitive decline, motor impairments, and emotional difficulties. Anxiety affects up to 71% of HD gene expansion carriers (i.e., those with the version of the gene that causes HD) and can negatively impact quality of life, worsen other HD symptoms, and increase suicide risk. Therefore, helping people with their anxiety should be a clinical priority. A significant evidence base now exists for low-cost talking therapies for anxiety, such as guided self-help, and with people with other neurodegenerative conditions (e.g., Parkinson's disease). However, this type of intervention has not been specifically assessed with HD gene expansion carriers.<h4>Methods</h4>This protocol describes an exploratory randomised controlled feasibility study of a psychological intervention for anxiety for HD gene expansion carriers. The 10 session guided self-help intervention ('GUIDE-HD') is based on a blend of second and third wave cognitive behavioural models of anxiety (cognitive behaviour therapy [CBT] and acceptance and commitment therapy [ACT]) and is adapted to meet the specific needs of an HD population. This study will compare guided self-help with treatment as usual (TAU), with 15 HD gene expansion carriers randomly allocated to each group. Participants will be recruited across the UK. Quantitative data will be collected pre-intervention, immediately post-intervention, 3-month post-intervention and 6-month post-intervention. Qualitative data will be collected at one month post-intervention from participants, including HD carers. The data will be analysed to assess whether the current intervention and study design are feasible to progress to a larger randomised controlled trial. Feasibility has been defined in terms of recruitment rate, retention rate to both trial arms, intervention adherence, and acceptability of the intervention and measurement tools.<h4>Discussion</h4>Given the lack of evidenced interventions to date to support the wellbeing of people with the expanded Huntington's gene, this study will assess the feasibility of progressing this particular intervention to a full trial. To try and increase the acceptability of the intervention, a number of stakeholders, including those affected by HD and in caring roles, have been fundamental to the creation of the intervention (e.g., therapy manual, planned therapy process) to date.<h4>Trial registration</h4>Trial ID: ISRCTN47330596 . Date registered: 28/09/2022. Protocol version and date: Version 2, 09/06/22. Trial sponsor organisation and contact: Leicestershire Partnership NHS Trust (Dave Clarke). Role of sponsor: Overall responsibility for the conduct and governance of the trial. Role of funder: Review of initial research proposal.

SOX6
Also flagged:sleepdopamineparvalbuminPVNeuronal activitybehavioral
Journal Article 2023-09-12 ✓ 1 Snippet Farries MA, Faust TW, Mohebi A, Berke JD.
In-Text Gene Mentions

Sox6

Show Full Abstract

Basal ganglia (BG) circuits help guide and invigorate actions using predictions of future rewards (values). Within the BG, the globus pallidus pars externa (GPe) may play an essential role in aggregating and distributing value information. We recorded from the GPe in unrestrained rats performing both Pavlovian and instrumental tasks to obtain rewards and distinguished neuronal subtypes by their firing properties across the wake/sleep cycle and optogenetic tagging. In both tasks, the parvalbumin-positive (PV<sup>+</sup>), faster-firing "prototypical" neurons showed strong, sustained modulation by value, unlike other subtypes, including the "arkypallidal" cells that project back to striatum. Furthermore, we discovered that a distinct minority (7%) of GP cells display slower, pacemaker-like firing and encode reward prediction errors (RPEs) almost identically to midbrain dopamine neurons. These cell-specific forms of GPe value representation help define the circuit mechanisms by which the BG contribute to motivation and reinforcement learning.

HFE
Also flagged:type 2 diabetesHypertensiondiabetesneuropathynephropathybreast cancer
Journal Article 2023-09-12 ✓ 1 Snippet Crawford B, Steck SE, Sandler DP, Merchant AT, Woo JMP, Park YM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Aims</h4>We investigated the role of socioeconomic disparities in the association between diet and risk of type 2 diabetes (T2D).<h4>Methods</h4>We used prospective data from 40,243 Sister Study participants aged 35 to 74 years who were enrolled in 2003-2009. Scores for healthy eating indices (alternate Mediterranean diet, Dietary Approaches to Stop Hypertension, alternative Healthy Eating Index, and Healthy Eating Index 2015 (HEI-2015)) were calculated using data from a 110-item food frequency questionnaire completed at enrollment. Incident T2D was defined based on self-reported physician's diagnosis or use of anti-diabetic medications. Multivariable-adjusted hazard ratios (aHRs) and 95% confidence intervals (CIs) were estimated using Cox proportional hazards models.<h4>Results</h4>We observed inverse associations between all four dietary indices and incident T2D after multivariable adjustment. These associations were most pronounced among women with higher educational attainment, higher income, and lower area deprivation index (ADI) (e.g., for the HEI-2015: low ADI, aHR<sub>Q4vsQ1</sub>: 0.44, 95% CI: 0.35, 0.56 vs high ADI, aHR<sub>Q4vsQ1</sub>: 0.75, 95% CI: 0.63, 0.90; p<sub>interaction</sub>: 0.0007).<h4>Conclusions</h4>Weaker associations among women with lower socioeconomic status and higher neighborhood deprivation suggests that other factors play a larger role in T2D incidence than diet quality among individuals with low SES.

HFE
Also flagged:ulcerative colitisanemiairon deficiencychronic diseasespro-inflammatory cytokineserythropoiesis
Journal Article 2023-09-12 ✓ 1 Snippet Woźniak M, Borkowska A, Jastrzębska M, Sochal M, Małecka-Wojciesko E, Talar-Wojnarowska R.
In-Text Gene Mentions

…management, such ashemochromatosis, porphyria, or thalassemia,…

Show Full Abstract

In recent years, a steady increase in the incidence of inflammatory bowel diseases (IBD) has been observed with anemia as their most common extraintestinal symptom. Erythroferrone and Bone Morphogenetic Protein 6 (BMP-6) are recently identified cytokines involved in the process of increased erythropoiesis in anemia of various pathomechanisms. The aim of this study was to analyze the concentration of erythroferrone and BMP-6 in IBD patients in relation to clinical and laboratory data. The study comprised 148 patients: 118 with IBD, including 73 (61.85%) diagnosed with anemia (42 with Crohn's disease (CD) (66.7%) and 31 (56.4%) with ulcerative colitis (UC)) and 30 as a control group. The erythroferrone concentration was significantly higher in IBD patients with anemia (<i>p</i> = 0.009) and higher in UC patients both with and without anemia (<i>p</i> = 0.018), compared to the control group. In CD, no similar difference was observed between patients with and without anemia. Regarding BMP-6, higher levels were found in CD patients with anemia compared to the control group (<i>p</i> = 0.021). The positive correlation between BMP-6 and iron concentration in UC was also noticed. In conclusion, we confirm an increase in erythroferrone concentration in the entire group of IBD patients with anemia, while BMP-6 levels were higher only in anemic CD patients. Due to the clinical importance of anemia in IBD, this problem is worth further analysis and research projects.

SOX6
Also flagged:Neuroblastomasolid tumorgene expressioncancertumorstumor
Journal Article 2023-09-12 ✓ 2 Snippets Martínez-Pacheco ML, Hernández-Lemus E, Mejía C.
In-Text Gene Mentions

Bedoya-Reina, et al. [9] found a high expression of neurotrophic receptor NTRK2, mesenchymal COL1A2, COL6A3, and COL12A1 genes, migratory LAMA3, CLDN11, and DOCK7 genes, and progenitor BCL11A, ERBB3, RTTN, TP63, ASXL3, POU6F2, and SOX6 genes in high-risk neuroblastoma samples.

…ASXL3, POU6F2, andSOX6genes in high-risk…

Show Full Abstract

Neuroblastoma represents a neoplastic expansion of neural crest cells in the developing sympathetic nervous system and is childhood's most common extracranial solid tumor. The heterogeneity of gene expression in different types of cancer is well-documented, and genetic features of neuroblastoma have been described by classification, development stage, malignancy, and progression of tumors. Here, we aim to analyze RNA sequencing datasets, publicly available in the GDC data portal, of neuroblastoma tumor samples from various patients and compare them with normal adrenal gland tissue from the GTEx data portal to elucidate the gene expression profile and regulation networks they share. Our results from the differential expression, weighted correlation network, and functional enrichment analyses that we performed with the count data from neuroblastoma and standard normal gland samples indicate that the analysis of transcriptome data from 58 patients diagnosed with high-risk neuroblastoma shares the expression pattern of 104 genes. More importantly, our analyses identify the co-expression relationship and the role of these genes in multiple biological processes and signaling pathways strongly associated with this disease phenotype. Our approach proposes a group of genes and their biological functions to be further investigated as essential molecules and possible therapeutic targets of neuroblastoma regardless of the etiology of individual tumors.

Also flagged:estrusinseminationacetyl coenzyme A carboxylase αACACAapolipoprotein BAPOB
Journal Article 2023-09-12 No Snippets Du C, Nan L, Li C, Chu C, Wang H, Fan Y, Ma Y, Zhang S.
Show Full Abstract

Efficient reproductive management of dairy cows depends primarily upon accurate estrus identification. However, the currently available estrus detection methods, such as visual observation, are poor. Hence, there is an urgent need to discover novel biomarkers in non-invasive bodily fluids such as milk to reliably detect estrus status. Proteomics is an emerging and promising tool to identify biomarkers. In this study, the proteomics approach was performed on milk sampled from estrus and non-estrus dairy cows to identify potential biomarkers of estrus. Dairy cows were synchronized and timed for artificial insemination, and the cows with insemination leading to conception were considered to be in estrus at the day of insemination (day 0). Milk samples of day 0 (estrus group) and day -3 (non-estrus group) from dairy cows confirming to be pregnant were collected for proteomic analysis using the tandem mass tags (TMT) proteomics approach. A total of 89 differentially expressed proteins were identified, of which 33 were upregulated and 56 were downregulated in the estrus milk compared with the non-estrus milk. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis showed that acetyl coenzyme A carboxylase α (ACACA), apolipoprotein B (APOB), NAD(P)H steroid dehydrogenase-like (NSDHL), perilipin 2 (PLIN2), and paraoxonase 1 (PON1) participated in lipid binding, lipid storage, lipid localization, and lipid metabolic process, as well as fatty acid binding, fatty acid biosynthesis, and fatty acid metabolism, and these processes are well documented to be related to estrus regulation. These milk proteins are proposed as possible biomarkers of estrus in dairy cows. Further validation studies are required in a large population to determine their potential as estrus biomarkers.

Also flagged:Fatty Acidperoxidelipidamino acidsamino acidrheumatism
Journal Article 2023-09-12 No Snippets Bocanegra Morales N, Galeano Garcia P.
Show Full Abstract

This study aimed to optimize the roasting conditions for sacha inchi (<i>Plukenetia volubilis</i> L.) seeds using the central composite design (CCD) of the response surface methodology (RSM). The antioxidant activity and oxidation indicators (peroxide and TBA values) were assessed, along with the impact of roasting on the fatty acid profile and chemical characterization of the seeds using gas chromatography. The results demonstrated that roasting partially increased the indicators of lipid oxidation in the oil extracted from roasted seeds, as well as the antioxidant activity of the seeds. The optimal roasting conditions were determined using CCD and RSM, resulting in an optimized temperature of 134.28 °C and 18.84 min. The fatty acid contents were not significantly affected by the roasting intensity, whereas a higher presence of amino acids was found in the seeds roasted at 140 °C for 15 min. In conclusion, it is suggested that the optimal roasting conditions for enhancing amino acid presence, improving antioxidant activity, and maintaining oxidative stability in sacha inchi seeds fall within the temperature range of 134-140 °C and a roasting duration of 15-20 min.

ABT1
Also flagged:EndoplasmicReticulumEpithelial Ovarian Cancergynecological malignant tumorEndoplasmic reticulumtumors
Journal Article 2023-09-12 ✓ 1 Snippet Zhang M, Wang Y, Xu S, Huang S, Wu M, Chen G, Wang Y.
In-Text Gene Mentions

…Theactivator of transcription 1of transcription 1…

Show Full Abstract

Epithelial ovarian cancer (EOC) is the most lethal gynecological malignant tumor. Endoplasmic reticulum (ER) stress plays an important role in the malignant behaviors of several tumors. In this study, we established a risk classifier based on 10 differentially expressed genes related to ER stress to evaluate the prognosis of patients and help to develop novel medical decision-making for EOC cases. A total of 378 EOC cases with transcriptome data from the TCGA-OV public dataset were included. Cox regression analysis was used to establish a risk classifier based on 10 ER stress-related genes (ERGs). Then, through a variety of statistical methods, including survival analysis and receiver operating characteristic (ROC) methods, the prediction ability of the proposed classifier was tested and verified. Similar results were confirmed in the GEO cohort. In the immunoassay, the different subgroups showed different penetration levels of immune cells. Finally, we conducted loss-of-function experiments to silence <i>TRPM2</i> in the human EOC cell line. We created a 10-ERG risk classifier that displays a powerful capability of survival evaluation for EOC cases, and <i>TRPM2</i> could be a potential therapeutic target of ovarian cancer cells.

NEGR1
Also flagged:PeptidesALKNeuroblastomachildhood cancerspediatric cancersALK kinase
Journal Article 2023-09-12 ✓ 5 Snippets Pischedda F, Ghirelli A, Tripathi V, Piccoli G.
In-Text Gene Mentions

Accordingly, we observed that the Negr1 protein is downregulated in cancer-derived cell lines.

The IgLON family member Negr1 has been identified as a commonly downregulated gene in many human cancer tissues [30,33].

The Negr1-derived peptide described here demonstrated the capability to degrade ALK and slow tumor progression in vitro and in vivo.

Negr1-Derived Peptides Trigger ALK Degradation and Halt Neuroblastoma Progression In Vitro and In Vivo

Thus, we monitored the N-MYC protein level in specimens gathered from tumors generated by wild-type and Negr1-expressing cells (Figure 1H).

Show Full Abstract

Neuroblastoma is among the most common childhood cancers. Neuroblastoma in advanced stages is one of the most intractable pediatric cancers, notwithstanding the recent therapeutic advances. ALK mutations are among the leading cause of hereditary neuroblastoma and account for more than 14% of the somatically acquired alterations. ALK kinase activity is currently one of the main targets for pharmacological strategies. However, evidence from ALK fusion-positive lung cancer studies has shown that resistance to ALK inhibition arises during the therapy, causing a relapse within several years. IgLONs are membrane-bound proteins involved in cell-to-cell adhesion. The expression of the IgLON family results altered in different cancers. We found that the IgLON member Negr1 is downregulated in neuroblastoma. The ectopic overexpression of Negr1 impairs neuroblastoma growth in vitro and in vivo. Negr1 exists as a GPI-anchored membrane-bound protein and as a soluble protein released upon metalloprotease cleavage. We generated and characterized a panel of Negr1-derived peptides. The treatment with Negr1 protein and derived peptides induce ALK downregulation and halt neuroblastoma progression in vitro and in vivo.

Also flagged:calcitoninneuroendocrine neoplasmsCTmedullary thyroid carcinomatumornucleotide
Journal Article 2023-09-12 No Snippets Döring C, Peer K, Bankov K, Bollmann C, Ramaswamy A, Di Fazio P, Wild PJ, Bartsch DK.
Show Full Abstract

<h4>Introduction</h4>Calcitonin-producing pancreatic neuroendocrine neoplasms (CT-pNENs) are an extremely rare clinical entity, with approximately 60 cases reported worldwide. While CT-pNENs can mimic the clinical and diagnostic features of medullary thyroid carcinoma, their molecular profile is poorly understood.<h4>Methods</h4>Whole-exome sequencing (WES) was performed on tumor and corresponding serum samples of five patients with increased calcitonin serum levels and histologically validated calcitonin-positive CT-pNENs. cBioPortal analysis and DAVID gene enrichment analysis were performed to identify dysregulated candidate genes compared to control databases. Immunohistochemistry was used to detect the protein expression of <i>MUC4</i> and <i>MUC16</i> in CT-pNEN specimens.<h4>Results</h4>Mutated genes known in the literature in pNENs like <i>MEN1</i> (35% of cases), <i>ATRX</i> (18-20% of cases) and <i>PIK3CA</i> (1.4% of cases) were identified in cases of CT-pNENs. New somatic SNVs in <i>ATP4A, HES4</i>, and <i>CAV3</i> have not been described in CT- pNENs, yet. Pathogenic germline mutations in <i>FGFR4</i> and <i>DPYD</i> were found in three of five cases. Mutations of <i>CALCA</i> (calcitonin) and the corresponding receptor <i>CALCAR</i> were found in all five tumor samples, but none of them resulted in protein sequelae or clinical relevance. All five tumor cases showed single nucleotide variations (SNVs) in <i>MUC4</i>, and four cases showed SNVs in <i>MUC16</i>, both of which were membrane-bound mucins. Immunohistochemistry showed protein expression of <i>MUC4</i> in two cases and <i>MUC16</i> in one case, and the liver metastasis of a third case was double positive for <i>MUC4</i> and <i>MUC16</i>. The homologous recombination deficiency (HRD) score of all tumors was low.<h4>Discussion</h4>CT-pNENs have a unique molecular signature compared to other pNEN subtypes, specifically involving the <i>FGFR4, DPYD, MUC4, MUC16</i> and the <i>KRT</i> family genes. However, a major limitation of our study was the relative small number of only five cases. Therefore, our WES data should be interpreted with caution and the mutation landscape in CT-pNENs needs to be verified by a larger number of patients. Further research is needed to explain differences in pathogenesis compared with other pNENs. In particular, multi-omics data such as RNASeq, methylation and whole genome sequencing could be informative.

Also flagged:watertranspirationresponse tocarbohydratesacidificationsugars
Journal Article 2023-09-12 No Snippets Losso A, Gauthey A, Choat B, Mayr S.
Show Full Abstract

In recent years, xylem sap composition has been shown to affect xylem hydraulics. However, information on how much xylem sap composition can vary across seasons and specifically under drought stress is still limited. We measured xylem sap chemical composition ([Ca<sup>2+</sup>], [K<sup>+</sup>], [Na<sup>+</sup>], electrical conductivity EC and pH) and surface tension (<i>γ</i>) of six Australian angiosperm trees and shrubs over 1 year, which comprised of exceptional dry and wet periods. Percentage losses of hydraulic conductivity and predawn leaf water potential were also monitored. In all species, measured parameters changed considerably over the annual time course. Ions and pH tended to decrease during winter months whereas <i>γ</i> showed a slight increase. No clear correlation was found between sap and hydraulic parameters, except for pH that was higher when plants suffered higher drought stress levels. Results indicate xylem sap composition to be complex and dynamic, where most variation in its composition seems to be dictated by season, even under severe dry conditions. However, pH might play a role as signals of drought stress.

Also flagged:Kidneychronic kidney diseasekidney failureacute kidney diseasecreatinineAlbuminuria
Journal Article 2023-09-12 No Snippets Patel DM, Churilla BM, Thiessen-Philbrook H, Sang Y, Grams ME, Parikh CR, Crews DC.
Show Full Abstract

<h4>Introduction</h4>The kidney failure risk equation (KFRE) estimates a person's risk of kidney failure and has great potential utility in clinical care.<h4>Methods</h4>We used mixed methods to explore implementation of the KFRE in nephrology clinics.<h4>Results</h4>KFRE scores were integrated into the electronic health record at Johns Hopkins Medicine and were displayed to nephrology providers. Documentation of KFRE scores increased over time, reaching 25% of eligible outpatient nephrology clinic notes at month 11. Three providers documented KFRE scores in >75% of notes, whereas 25 documented scores in <10% of notes. Surveys and focus groups of nephrology providers were conducted to probe provider views on the KFRE. Survey respondents (<i>n</i> = 25) reported variability in use of KFRE for decisions such as maintaining nephrology care, referring for transplant evaluation, or providing dialysis modality education. Provider perspectives on the use of KFRE, assessed in 2 focus groups of 4 providers each, included 3 common themes as follows: (i) KFRE scores may be most impactful in the care of specific subsets of people with chronic kidney disease (CKD); (ii) there is uncertainty about KFRE risk-based thresholds to guide clinical care; and (iii) education of patients, nephrology providers, and non-nephrology providers on appropriate interpretations of KFRE scores may help maximize their utility.<h4>Conclusion</h4>Implementation of the KFRE was limited by non-uniform provider adoption of its use, and limited knowledge about utilization of the KFRE in clinical decisions.

bioRxiv 2023-09-12 Preprint (No Snippets API) Paryani F, Kwon J, Ng CW, Madden N, Ofori K, Tang A, Lu H, Li J, Mahajan A, Davidson SM, Basile A, McHugh C, Vonsattel JP, Hickman R, Zody M, Houseman DE, Goldman JE, Yoo AS, Menon V, Al-Dalahmah O.
Show Full Abstract

Huntington disease (HD) is an incurable neurodegenerative disease characterized by neuronal loss and astrogliosis. One hallmark of HD is the selective neuronal vulnerability of striatal medium spiny neurons. To date, the underlying mechanisms of this selective vulnerability have not been fully defined. Here, we employed a multi-omic approach including single nucleus RNAseq (snRNAseq), bulk RNAseq, lipidomics, HTT gene CAG repeat length measurements, and multiplexed immunofluorescence on post-mortem brain tissue from multiple brain regions of HD and control donors. We defined a signature of genes that is driven by CAG repeat length and found it enriched in astrocytic and microglial genes. Moreover, weighted gene correlation network analysis showed loss of connectivity of astrocytic and microglial modules in HD and identified modules that correlated with CAG-repeat length which further implicated inflammatory pathways and metabolism. We performed lipidomic analysis of HD and control brains and identified several lipid species that correlate with HD grade, including ceramides and very long chain fatty acids. Integration of lipidomics and bulk transcriptomics identified a consensus gene signature that correlates with HD grade and HD lipidomic abnormalities and implicated the unfolded protein response pathway. Because astrocytes are critical for brain lipid metabolism and play important roles in regulating inflammation, we analyzed our snRNAseq dataset with an emphasis on astrocyte pathology. We found two main astrocyte types that spanned multiple brain regions; these types correspond to protoplasmic astrocytes, and fibrous-like - CD44-positive, astrocytes. HD pathology was differentially associated with these cell types in a region-specific manner. One protoplasmic astrocyte cluster showed high expression of metallothionein genes, the depletion of this cluster positively correlated with the depletion of vulnerable medium spiny neurons in the caudate nucleus. We confirmed that metallothioneins were increased in cingulate HD astrocytes but were unchanged or even decreased in caudate astrocytes. We combined existing genome-wide association studies (GWAS) with a GWA study conducted on HD patients from the original Venezuelan cohort and identified a single-nucleotide polymorphism in the metallothionein gene locus associated with delayed age of onset. Functional studies found that metallothionein overexpressing astrocytes are better able to buffer glutamate and were neuroprotective of patient-derived directly reprogrammed HD MSNs as well as against rotenone-induced neuronal death in vitro . Finally, we found that metallothionein-overexpressing astrocytes increased the phagocytic activity of microglia in vitro and increased the expression of genes involved in fatty acid binding. Together, we identified an astrocytic phenotype that is regionally-enriched in less vulnerable brain regions that can be leveraged to protect neurons in HD.

bioRxiv 2023-09-12 Preprint (No Snippets API) Díez-Sánchez A, Lindholm HT, Vornewald PM, Ostrop J, Parmar N, Shaw TN, Martín-Alonso M, Oudhoff MJ.
Show Full Abstract

<h4>ABSTRACT</h4> Postnatal development of the gastrointestinal tract involves the establishment of the commensal microbiota, maturation of the intestinal epithelium, and the acquisition of immune tolerance via a balanced immune cell composition. While studies have uncovered an interplay between the commensal microbiota and immune system development, less is known about the role of the maturing epithelium. Here, we comprehensively show that intestinal-epithelial intrinsic expression of lysine-specific demethylase 1A (LSD1) is necessary for the postnatal maturation of intestinal epithelium as well as maintaining this developed epithelial state in adulthood. Although the stool microbiome was altered in animals with an intestinal-epithelial specific deletion of Lsd1 , by depleting the microbial component using antibiotics, we found that the cellular state and number of certain immune cell types were dependent on maturation of the epithelium. We found plasma cells, innate lymphoid cells (ILCs), and a specific myeloid population to be depending on epithelial LSD1 expression. We propose that LSD1 controls the expression of epithelial-derived chemokines, such as Cxcl16 , and this is a mode of action for this epithelial-immune cell interplay. For example, we show that LSD1-mediated epithelial-intrinsic CXCL16 controls the number of local ILC2s but not ILC3s. Together, our findings suggest that the maturing epithelium plays a dominant role in regulating the local immune cell composition, thereby contributing to gut homeostasis.

bioRxiv 2023-09-12 Preprint (No Snippets API) Klein P, Harley J, Crook H, Serna SE, Howe MP, Roumeliotis TI, Choudhary JS, Chakrabarti AM, Luisier R, Patani R, Ramos A.
Show Full Abstract

Neuronal differentiation requires building a complex intracellular architecture, and therefore the coordinated regulation of defined sets of genes. RNA-binding proteins (RBPs) play a key role in this regulation. However, while their action on individual mRNAs has been explored in depth, the mechanisms used to coordinate expression of the gene programs shaping neuronal morphology are poorly understood. To address this, we analysed how the paradigmatic RBP IMP1 (IGF2BP1), an essential developmental factor, selects and regulates its RNA targets during the differentiation of human neurons. We performed a combination of system-wide and molecular analyses, revealing that IMP1 developmentally transitions to and directly regulates the expression of mRNAs encoding essential regulators of the microtubule network, a key component of neuronal morphology. Furthermore, we showed that m6A methylation drives the selection of specific IMP1 mRNA targets and their protein expression during the developmental transition from neural precursors to neurons, providing a molecular principle for the onset of target selectivity.

OLFM4
Also flagged:citrullinecell cyclep53translationaldoxorubicin5‐fluorouracil
Journal Article 2023-09-11 ✓ 5 Snippets Gall L, Jardi F, Lammens L, Piñero J, Souza TM, Rodrigues D, Jennen DGJ, de Kok TM, Coyle L, Chung SW, Ferreira S, Jo H, Beattie KA, Kelly C, Duckworth CA, Pritchard DM, Pin C.
In-Text Gene Mentions

The blood and tissue sampled during this treatment showed no toxicity in Olfm4+ cells or in the crypt compartment and no changes in plasma citrulline levels, which reflects the integrity of the epithelium, at any dose or timepoint (Figure S4).

…reported numbers ofOlfm4+ cells were large…

…in humans, whereOlfm4is a robust…

…the recovery ofOlfm4+ cells reported by…

…no toxicity inOlfm4+ cells or in…

Show Full Abstract

We have built a quantitative systems toxicology modeling framework focused on the early prediction of oncotherapeutic-induced clinical intestinal adverse effects. The model describes stem and progenitor cell dynamics in the small intestinal epithelium and integrates heterogeneous epithelial-related processes, such as transcriptional profiles, citrulline kinetics, and probability of diarrhea. We fitted a mouse-specific version of the model to quantify doxorubicin and 5-fluorouracil (5-FU)-induced toxicity, which included pharmacokinetics and 5-FU metabolism and assumed that both drugs led to cell cycle arrest and apoptosis in stem cells and proliferative progenitors. The model successfully recapitulated observations in mice regarding dose-dependent disruption of proliferation which could lead to villus shortening, decrease of circulating citrulline, increased diarrhea risk, and transcriptional induction of the p53 pathway. Using a human-specific epithelial model, we translated the cytotoxic activity of doxorubicin and 5-FU quantified in mice into human intestinal injury and predicted with accuracy clinical diarrhea incidence. However, for gefitinib, a specific-molecularly targeted therapy, the mice failed to reproduce epithelial toxicity at exposures much higher than those associated with clinical diarrhea. This indicates that, regardless of the translational modeling approach, preclinical experimental settings have to be suitable to quantify drug-induced clinical toxicity with precision at the structural scale of the model. Our work demonstrates the usefulness of translational models at early stages of the drug development pipeline to predict clinical toxicity and highlights the importance of understanding cross-settings differences in toxicity when building these approaches.

TNFSF4
Also flagged:lung adenocarcinomaLUADcancerHeat shock proteinsHSPstumor
Journal Article 2023-09-11 ✓ 1 Snippet Zhou W, Zeng W, Zheng D, Yang X, Qing Y, Zhou C, Liu X.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Lung adenocarcinoma (LUAD) represents a prevalent form of cancer, with low early diagnosis rates and high mortality rates, posing a global health challenge. Heat shock proteins (HSPs) assume a crucial role within the tumor immune microenvironment (TME) of LUAD. Here, a collection of 97 HSP-related genes (HSPGs) was assembled based on prior literature reports, of which 36 HSPGs were differentially expressed in LUAD. In The Cancer Genome Atlas (TCGA) cohort, we constructed a prognostic model for risk stratification and prognosis prediction by integrating 13 HSPGs. In addition, the prognostic significance and predictive efficacy of the HSP-related riskscore were examined and validated in the Gene Expression Omnibus (GEO) cohort. To facilitate the clinical use of this riskscore, we also established a nomogram scale by verifying its effectiveness through different methods. In light of these outcomes, we concluded a significant correlation between HSPs and TME in LUAD, and the riskscore can be a reliable prognostic indicator. Furthermore, this study evaluated the differences in immunophenoscore, tumor immune dysfunction and exclusion score, and sensitivity to several common chemotherapy drugs among LUAD individuals in different risk groups, which may aid in clinical decision-making for immune therapy and chemotherapy in LUAD individuals.

HFE
Also flagged:non-alcoholic fatty liver diseaseNAFLDNonalcoholic fatty liver diseasechronic liver diseasesteatosishepatic steatosis
Journal Article 2023-09-11 ✓ 1 Snippet Nguyen VH, Le I, Ha A, Le RH, Rouillard NA, Fong A, Gudapati S, Park JE, Maeda M, Barnett S, Cheung R, Nguyen MH.
In-Text Gene Mentions

…lpha-1 antitrypsin deficiency,hemochromatosis, or Wilson’s disease.…

Show Full Abstract

<h4>Background/aims</h4>Understanding of nonalcoholic fatty liver disease (NAFLD) continues to expand, but the relationship between race and ethnicity and NAFLD outside the use of cross-sectional data is lacking. Using longitudinal data, we investigated the role of race and ethnicity in adverse outcomes in NAFLD patients.<h4>Methods</h4>Patients with NAFLD confirmed by imaging via manual chart review from any clinics at Stanford University Medical Center (1995-2021) were included. Primary study outcomes were incidence of liver events and mortality (overall and non-liver related).<h4>Results</h4>The study included 9,340 NAFLD patients: White (44.1%), Black (2.29%), Hispanic (27.9%), and Asian (25.7%) patients. For liver events, the cumulative 5-year incidence was highest among White (19.1%) patients, lowest among Black (7.9%) patients, and similar among Asian and Hispanic patients (~15%). The 5-year and 10-year cumulative overall mortality was highest for Black patients (9.2% and 15.0%, respectively, vs. 2.5-3.5% and 4.3-7.3% in other groups) as well as for non-liver mortality. On multivariable regression analysis, compared to White patients, only Asian group was associated with lower liver-related outcomes (aHR: 0.83, P=0.027), while Black patients were at more than two times higher risk of both non-liver related (aHR: 2.35, P=0.010) and overall mortality (aHR: 2.13, P=0.022) as well as Hispanic patients (overall mortality: aHR: 1.44, P=0.022).<h4>Conclusion</h4>Compared to White patients, Black patients with NAFLD were at the highest risk for overall and non-liver-related mortality, followed by Hispanic patients with Asian patients at the lowest risk for all adverse outcomes. Culturally sensitive and appropriate programs may be needed for more successful interventions.

Also flagged:bindingtranscription factorsTFSOX2chromatingene expression
Journal Article 2023-09-11 No Snippets Maresca M, van den Brand T, Li H, Teunissen H, Davies J, de Wit E.
Show Full Abstract

Genome-wide transcriptional activity involves the binding of many transcription factors (TFs) to thousands of sites in the genome. Pioneer TFs are a class of TFs that maintain open chromatin and allow non-pioneer TFs access to their target sites. Determining which TF binding sites directly drive transcription remains a challenge. Here, we use acute protein depletion of the pioneer TF SOX2 to establish its functionality in maintaining chromatin accessibility. We show that thousands of accessible sites are lost within an hour of protein depletion, indicating rapid turnover of these sites in the absence of the pioneer factor. To understand the relationship with transcription, we performed nascent transcription analysis and found that open chromatin sites that are maintained by SOX2 are highly predictive of gene expression, in contrast to all other SOX2 binding sites. We use CRISPR-Cas9 genome editing in the Klf2 locus to functionally validate a predicted regulatory element. We conclude that the regulatory activity of SOX2 is exerted mainly at sites where it maintains accessibility and that other binding sites are largely dispensable for gene regulation.

PLCL1
Also flagged:nucleusFoxg1gene expressionDlx5Nkx2-1Tbr1
Journal Article 2023-09-11 ✓ 1 Snippet Puelles L, Stühmer T, Rubenstein JLR, Diaz C.
In-Text Gene Mentions

Plcl1

Show Full Abstract

The globus pallidus (GP) of primates is divided conventionally into distinct internal and external parts. The literature repeats since 1930 the opinion that the homolog of the primate internal pallidum in rodents is the hypothalamic entopeduncular nucleus (embedded within fiber tracts of the cerebral peduncle). To test this idea, we explored its historic fundaments, checked the development and genoarchitecture of mouse entopeduncular and pallidal neurons, and examined relevant comparative connectivity data. We found that the extratelencephalic mouse entopeduncular structure consists of four different components arrayed along a dorsoventral sequence in the alar hypothalamus. The ventral entopeduncular nucleus (EPV), with GABAergic neurons expressing Dlx5&6 and Nkx2-1, lies within the hypothalamic peduncular subparaventricular area. Three other formations-the dorsal entopeduncular nucleus (EPD), the prereticular entopeduncular nucleus (EP<sub>PRt</sub> ), and the preeminential entopeduncular nucleus (EP<sub>PEm</sub> )-lie within the overlying paraventricular area, under the subpallium. EPD contains glutamatergic neurons expressing Tbr1, Otp, and Pax6. The EP<sub>PRt</sub> has GABAergic cells expressing Isl1 and Meis2, whereas the EP<sub>PEm</sub> population expresses Foxg1 and may be glutamatergic. Genoarchitectonic observations on relevant areas of the mouse pallidal/diagonal subpallium suggest that the GP of rodents is constituted as in primates by two adjacent but molecularly and hodologically differentiable telencephalic portions (both expressing Foxg1). These and other reported data oppose the notion that the rodent extratelencephalic entopeduncular nucleus is homologous to the primate internal pallidum. We suggest instead that all mammals, including rodents, have dual subpallial GP components, whereas primates probably also have a comparable set of hypothalamic entopeduncular nuclei. Remarkably, there is close similarity in some gene expression properties of the telencephalic internal GP and the hypothalamic EPV. This apparently underlies their notable functional analogy, sharing GABAergic neurons and thalamopetal connectivity.

Also flagged:agingpolysomesribosomesmembraneperiplasmcytoplasm
Journal Article 2023-09-11 No Snippets Mantovanelli L, Linnik DS, Punter M, Kojakhmetov HJ, Śmigiel WM, Poolman B.
Show Full Abstract

We have developed Simulation-based Reconstructed Diffusion (SbRD) to determine diffusion coefficients corrected for confinement effects and for the bias introduced by two-dimensional models describing a three-dimensional motion. We validate the method on simulated diffusion data in three-dimensional cell-shaped compartments. We use SbRD, combined with a new cell detection method, to determine the diffusion coefficients of a set of native proteins in Escherichia coli. We observe slower diffusion at the cell poles than in the nucleoid region of exponentially growing cells, which is independent of the presence of polysomes. Furthermore, we show that the newly formed pole of dividing cells exhibits a faster diffusion than the old one. We hypothesize that the observed slowdown at the cell poles is caused by the accumulation of aggregated or damaged proteins, and that the effect is asymmetric due to cell aging.

Also flagged:MMPmatrix metalloproteinaseMIPeptidepolymermyocardial infarction
Journal Article 2023-09-11 No Snippets Sullivan HL, Liang Y, Worthington K, Luo C, Gianneschi NC, Christman KL.
Show Full Abstract

Herein, we have developed a drug-loaded matrix metalloproteinase (MMP)-responsive micellar nanoparticle (NP) intended for minimally invasive intravenous injection during the acute phase of myocardial infarction (MI) and prolonged retention in the heart for small-molecule drug delivery. Peptide-polymer amphiphiles (PPAs) bearing a small-molecule MMP inhibitor (MMPi), PD166793, were synthesized via ring-opening metathesis polymerization (ROMP) and formulated into spherical micelles by transitioning to aqueous solution. The resulting micellar NPs underwent MMP-induced aggregation, demonstrating enzyme responsiveness. Using a rat MI model, we observed that these NPs were capable of successfully extravasating into the infarcted region of the heart where they were retained due to the active, enzyme-mediated targeting, remaining detectable after 1 week post administration without increasing macrophage recruitment. Furthermore, <i>in vitro</i> studies show that these NPs demonstrated successful drug release following MMP treatment and maintained drug bioactivity as evidenced by comparable MMP inhibition to free MMPi. This work establishes a targeted NP platform for delivering small-molecule therapeutics to the heart after MI, opening possibilities for myocardial infarction treatment.

OLFM4
Also flagged:HuRRNA-binding protein HuRmitochondriagene expressionmitochondrialmitochondrial-associated proteins
Journal Article 2023-09-11 ✓ 4 Snippets Xiao L, Warner B, Mallard CG, Chung HK, Shetty A, Brantner CA, Rao JN, Yochum GS, Koltun WA, To KB, Turner DJ, Gorospe M, Wang JY.
In-Text Gene Mentions

…ISCs, marked byOLFM4and LGR5, were…

…the numbers ofOLFM4- and LGR5-positive cells…

…, Lgr5 ,Olfm4, Rgmb ,…

…lysozyme-positive cells andOLFM4- and LGR5-positive cells…

Show Full Abstract

Rapid self-renewal of the intestinal epithelium requires the activity of intestinal stem cells (ISCs) that are intermingled with Paneth cells (PCs) at the crypt base. PCs provide multiple secreted and surface-bound niche signals and play an important role in the regulation of ISC proliferation. Here, we show that control of PC function by RNA-binding protein HuR via mitochondria affects intestinal mucosal growth by altering ISC activity. Targeted deletion of HuR in mice disrupted PC gene expression profiles, reduced PC-derived niche factors, and impaired ISC function, leading to inhibited renewal of the intestinal epithelium. Human intestinal mucosa from patients with critical surgical disorders exhibited decreased levels of tissue HuR and PC/ISC niche dysfunction, along with disrupted mucosal growth. HuR deletion led to mitochondrial impairment by decreasing the levels of several mitochondrial-associated proteins including prohibitin 1 (PHB1) in the intestinal epithelium, whereas HuR enhanced PHB1 expression by preventing microRNA-195 binding to the <i>Phb1</i> mRNA. These results indicate that HuR is essential for maintaining the integrity of the PC/ISC niche and highlight a novel role for a defective PC/ISC niche in the pathogenesis of intestinal mucosa atrophy.

TRIM38
Also flagged:SLC17A1SLC17A3TATDN2TMEM131Ltype 1 diabetesinsulin
Journal Article 2023-09-11 ✓ 5 Snippets Hebbar P, Nizam R, John SE, Antony D, Dashti M, Channanath A, Shaltout A, Al-Khandari H, Koistinen HA, Tuomilehto J, Alsmadi O, Thanaraj TA, Al-Mulla F.
In-Text Gene Mentions

…the expression ofTRIM38and IRAK2 respectively.…

…SLC17A1, SLC17A3, andTRIM38in multiple tissues…

…SLC17A1, SLC17A3, andTRIM38in multiple tissues.…

…the expression ofTRIM38in colon and…

…with the expressionTRIM38in colon tissues.…

Show Full Abstract

Type 1 diabetes (T1D) is characterized by the progressive destruction of pancreatic β-cells, leading to insulin deficiency and lifelong dependency on exogenous insulin. Higher estimates of heritability rates in monozygotic twins, followed by dizygotic twins and sib-pairs, indicate the role of genetics in the pathogenesis of T1D. The incidence and prevalence of T1D are alarmingly high in Kuwait. Consanguineous marriages account for 50-70% of all marriages in Kuwait, leading to an excessive burden of recessive allele enrichment and clustering of familial disorders. Thus, genetic studies from this Arab region are expected to lead to the identification of novel gene loci for T1D. In this study, we performed linkage analyses to identify the recurrent genetic variants segregating in high-risk Kuwaiti families with T1D. We studied 18 unrelated Kuwaiti native T1D families using whole exome sequencing data from 86 individuals, of whom 37 were diagnosed with T1D. The study identified three potential loci with a LOD score of ≥ 3, spanning across four candidate genes, namely SLC17A1 (rs1165196:pT269I), SLC17A3 (rs942379: p.S370S), TATDN2 (rs394558:p.V256I), and TMEM131L (rs6848033:p.R190R). Upon examination of missense variants from these genes in the familial T1D dataset, we observed a significantly increased enrichment of the genotype homozygous for the minor allele at SLC17A3 rs56027330_p.G279R accounting for 16.2% in affected children from 6 unrelated Kuwaiti T1D families compared to 1000 genomes Phase 3 data (0.9%). Data from the NephQTL database revealed that the rs1165196, rs942379, rs394558, and rs56027330 SNPs exhibited genotype-based differential expression in either glomerular or tubular tissues. Data from the GTEx database revealed rs942379 and rs394558 as QTL variants altering the expression of TRIM38 and IRAK2 respectively. Global genome-wide association studies indicated that SLC17A1 rs1165196 and other variants from SLC17A3 are associated with uric acid concentrations and gout. Further evidence from the T1D Knowledge portal supported the role of shortlisted variants in T1D pathogenesis and urate metabolism. Our study suggests the involvement of SLC17A1, SLC17A3, TATDN2, and TMEM131L genes in familial T1D in Kuwait. An enrichment selection of genotype homozygous for the minor allele is observed at SLC17A3 rs56027330_p.G279R variant in affected members of Kuwaiti T1D families. Future studies may focus on replicating the findings in a larger T1D cohort and delineate the mechanistic details of the impact of these novel candidate genes on the pathophysiology of T1D.

POU3F2
Also flagged:methylationschizophreniagene expressionCALHM1CCDC149synapse
Journal Article 2023-09-11 ✓ 1 Snippet Zhou J, Xia Y, Li M, Chen Y, Dai J, Liu C, Chen C.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Sex differences are pervasive in schizophrenia (SCZ), but the extent and magnitude of DNA methylation (DNAm) changes underlying these differences remain uncharacterized. In this study, sex-stratified differential DNAm analysis was performed in postmortem brain samples from 117 SCZ and 137 controls, partitioned into discovery and replication datasets. Three differentially methylated positions (DMPs) were identified (adj.p < 0.05) in females and 29 DMPs in males without overlap between them. Over 81% of these sex-stratified DMPs were directionally consistent between sexes but with different effect sizes. Females experienced larger magnitude of DNAm changes and more DMPs (based on data of equal sample size) than males, contributing to a higher dysregulation burden of DNAm in females SCZ. Additionally, despite similar proportions of female-related DMPs (fDMPs, 8%) being under genetic control compared with males (10%), significant enrichment of DMP-related single nucleotide polymorphisms (SNPs) in signals of genome-wide association studies was identified only in fDMPs. One DMP in each sex connected the SNPs and gene expression of CALHM1 in females and CCDC149 in males. PPI subnetworks revealed that both female- and male-related differential DNAm interacted with synapse-related dysregulation. Immune-related pathways were unique for females and neuron-related pathways were associated with males. This study reveals remarkable quantitative differences in DNAm-related sexual dimorphism in SCZ and that females have a higher dysregulation burden of SCZ-associated DNAm than males.

TNFSF4
Also flagged:antigen-specific receptorstranscription factorspathogenesistissue diseasesrespiratory diseasescolitis
Journal Article 2023-09-11 ✓ 3 Snippets Ryu S, Lim M, Kim J, Kim HY.
In-Text Gene Mentions

…CD252, encoded byTnfsf4) is expressed…

…( Il7raCre +/+Tnfsf4fl/fl mice) blocked…

…the intestine, andTnfsf4−/− Rag1 −/−…

Show Full Abstract

Innate lymphoid cells (ILCs) are innate lymphocytes that do not express antigen-specific receptors and largely reside and self-renew in mucosal tissues. ILCs can be categorized into three groups (ILC1-3) based on the transcription factors that direct their functions and the cytokines they produce. Their signature transcription factors and cytokines closely mirror those of their Th1, Th2, and Th17 cell counterparts. Accumulating studies show that ILCs are involved in not only the pathogenesis of mucosal tissue diseases, especially respiratory diseases, and colitis, but also the resolution of such diseases. Here, we discuss recent advances regarding our understanding of the biology of ILCs in mucosal tissue health and disease. In addition, we describe the current research on the immune checkpoints by which other cells regulate ILC activities: for example, checkpoint molecules are potential new targets for therapies that aim to control ILCs in mucosal diseases. In addition, we review approved and clinically- trialed drugs and drugs in clinical trials that can target ILCs and therefore have therapeutic potential in ILC-mediated diseases. Finally, since ILCs also play important roles in mucosal tissue homeostasis, we explore the hitherto sparse research on cell therapy with regulatory ILCs. This review highlights various therapeutic approaches that could be used to treat ILC-mediated mucosal diseases and areas of research that could benefit from further investigation.

HFE
Also flagged:agingcognitive declineP2Y12GFPP2ry12TMEM119
Journal Article 2023-09-11 ✓ 1 Snippet Li X, Li Y, Jin Y, Zhang Y, Wu J, Xu Z, Huang Y, Cai L, Gao S, Liu T, Zeng F, Wang Y, Wang W, Yuan TF, Tian H, Shu Y, Guo F, Lu W, Mao Y, Mei X, Rao Y, Peng B.
In-Text Gene Mentions

…( Fth1 andHfe) (Fig. 1g-h…

Show Full Abstract

As important immune cells, microglia undergo a series of alterations during aging that increase the susceptibility to brain dysfunctions. However, the longitudinal characteristics of microglia remain poorly understood. In this study, we mapped the transcriptional and epigenetic profiles of microglia from 3- to 24-month-old mice. We first discovered unexpected sex differences and identified age-dependent microglia (ADEM) genes during the aging process. We then compared the features of aging and reactivity in female microglia at single-cell resolution and epigenetic level. To dissect functions of aged microglia excluding the influence from other aged brain cells, we established an accelerated microglial turnover model without directly affecting other brain cells. By this model, we achieved aged-like microglia in non-aged brains and confirmed that aged-like microglia per se contribute to cognitive decline. Collectively, our work provides a comprehensive resource for decoding the aging process of microglia, shedding light on how microglia maintain brain functions.

Also flagged:oxaliplatintumorcolorectal cancerluciferaseLDHlymphopenia
Journal Article 2023-09-11 No Snippets Ma Y, Guo C, Wang X, Wei X, Ma J.
Show Full Abstract

<h4>Background</h4>Chemotherapeutic agents are used to control tumor proliferation. However, their influence in the pre-metastatic niche of target organs has not been well studied. Oxaliplatin (OXA) is a drug applied in standard treatments of colorectal cancer (CRC), while the direct effect of which on the pre-metastatic microenvironment of the liver remains unclear.<h4>Methods</h4>Models of liver metastases were established with luciferase expressing CT26 cells in BALB/c and BALB/c-nude mice. Single-cell RNA Sequencing was performed to examine the immune microenvironment in the liver elicited by OXA. Immunofluorescence and flowcytometry were utilized to confirm the changes in the number of immune cells. LDH, CellTrace CFSE Cell Proliferation and apoptosis assays were conducted to explore the impact of OXA on T cells ex vivo. The correlation between chemotherapy-related lymphopenia and metastases was assessed by meta-analysis.<h4>Results</h4>Herein we discovered that administration of OXA prior to the occurrence of liver metastasis actually accelerated tumor development and colonization in the liver. Single-cell RNA sequencing revealed that the landscape of the liver immune microenvironment had been changed to immunosuppressive phenotype. Macrophages after the treatment of OXA exhibited a high ability to inhibit the activation of T cells. Further investigation revealed a significant decrease in the number of T cells in the liver, particularly CD8<sup>+</sup> T cells with reduced capacity of proliferation, activation, and killing. When mice were treated with T cell supplementation, the OXA-induced metastasis was notably abolished, indicating that the OXA-primed liver microenvironment could be reversed by the infusion of T cells. Consistent with our findings in mice, a meta-analysis was performed to verify that chemotherapy-related lymphopenia was associated with an inferior prognosis related with high incidence of metastasis, suggesting the pivotal role of chemotherapy in pre-metastatic niche formation. Furthermore, a notable reduction in the count of both macrophages and T cells was observed in the liver of colorectal cancer (CRC) patient undergoing OXA-based chemotherapy.<h4>Conclusions</h4>Our findings proposed that immunosuppressive microenvironment in liver induced by OXA enhanced liver metastasis of colorectal cancer, which highlighted a new consideration to balance the pro metastases and anti-cancer possibility of OXA treatment.

Also flagged:extracellularNeurodegenerative diseasesvesiclesmembranesecretionpathogenesis
Journal Article 2023-09-11 No Snippets Li Z, Wang X, Wang X, Yi X, Wong YK, Wu J, Xie F, Hu D, Wang Q, Wang J, Zhong T.
Show Full Abstract

Neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease, affect millions of people worldwide. Tremendous efforts have been put into disease-related research, but few breakthroughs have been made in diagnostic and therapeutic approaches. Extracellular vesicles (EVs) are heterogeneous cell-derived membrane structures that arise from the endosomal system or are directly separated from the plasma membrane. EVs contain many biomolecules, including proteins, nucleic acids, and lipids, which can be transferred between different cells, tissues, or organs, thereby regulating cross-organ communication between cells during normal and pathological processes. Recently, EVs have been shown to participate in various aspects of neurodegenerative diseases. Abnormal secretion and levels of EVs are closely related to the pathogenesis of neurodegenerative diseases and contribute to disease progression. Numerous studies have proposed EVs as therapeutic targets or biomarkers for neurodegenerative diseases. In this review, we summarize and discuss the advanced research progress on EVs in the pathological processes of several neurodegenerative diseases. Moreover, we outline the latest research on the roles of EVs in neurodegenerative diseases and their therapeutic potential for the diseases.

OLFM4
Also flagged:hypertensionFTOobesitylipidglucoseorganization
Journal Article 2023-09-11 ✓ 1 Snippet Hosseini-Esfahani F, Rezaei M, Koochakpoor G, Daneshpour MS, Mirmiran P, Azizi F.
In-Text Gene Mentions

…genes like MC4R,OLFM4, TCF7L2, ADCY3, GNPDA2,…

Show Full Abstract

This study aimed to investigate the interaction of the healthy eating index (HEI) and the dietary approach to stop hypertension (DASH) diet scores with FTO polymorphisms in relation to change in obesity traits. A total of 4480 subjects aged ≥ 18 years were selected from participants of the Tehran lipid and glucose study and followed-up 3 years. Selected polymorphisms (rs1421085, rs1121980, rs8050136) were genotyped and genetic risk score (GRS) was computed. HEI and DASH scores were computed based on dietary data. Changes in body mass index (BMI), waist circumference (WC), waist to hip ratio (WHR) and visceral adiposity index (VAI) were measured. Higher adherence to both DASH and HEI scores were increased with higher ages. Individuals with high GRS had a lower change in BMI when they had higher adherence to HEI, compared to subjects with lower HEI score (P trend = 0.01). Change in WC in participants in the fourth quartile of HEI score in minor allele carriers of FTO variants was lower compared to the first quartile; conversely, higher adherence to the DASH score by this genotypic group was related to increase in WC. No significant interaction was seen between FTO polymorphisms and both diet scores regarding changes in any of obesity traits. In conclusion, in individuals with high GRS higher adherence to HEI score was associated with lower change in BMI and WC, while higher adherence to DASH diet was associated with higher change in WC, compared to individuals with lower adherence to both scores.

HFE
Also flagged:Thalassemiasickle cell diseasered blood cell disordersThalassemiasglobinβ-globin
Journal Article 2023-09-11 ✓ 1 Snippet Meloni A, Pistoia L, Lupi A, Righi R, Vallone A, Missere M, Renne S, Fina P, Riva A, Gamberini MR, Cecinati V, Sorrentino F, Rosso R, Messina G, Ricchi P, Positano V, Mavrogeni S, Quaia E, Cademartiri F, Pepe A.
In-Text Gene Mentions

…for patients withhemochromatosis.…

Show Full Abstract

<h4>Background</h4>The E-MIOT (Extension-Myocardial Iron Overload in Thalassemia) project is an Italian Network assuring high-quality quantification of tissue iron overload by magnetic resonance imaging (MRI). We evaluated the impact of the COVID-19 pandemic on E-MIOT services.<h4>Methods</h4>The activity of the E-MIOT Network MRI centers in the year 2020 was compared with that of 2019. A survey evaluated whether the availability of MRI slots for patients with hemoglobinopathies was reduced and why.<h4>Results</h4>The total number of MRI scans was 656 in 2019 and 350 in 2020, with an overall decline of 46.4% (first MRI: 71.7%, follow-up MRI: 36.9%), a marked decline (86.9%) in the period March-June 2020, and a reduction in the gap between the two years in the period July-September. A new drop (41.4%) was recorded in the period October-December for two centers, due to the general reduction in the total amount of MRIs/day for sanitization procedures. In some centers, patients refused MRI scans for fear of getting COVID. Drops in the MRI services >80% were found for patients coming from a region without an active MRI site.<h4>Conclusions</h4>The COVID-19 pandemic had a strong negative impact on MRI multi-organ iron quantification, with a worsening in the management of patients with hemoglobinopathies.

TNFSF4
Also flagged:tumorpancreatic cancerimmune responseCASP4TOB1CLEC2B
Journal Article 2023-09-11 ✓ 1 Snippet Xu W, Zhang W, Zhao D, Wang Q, Zhang M, Li Q, Zhu W, Xu C.
In-Text Gene Mentions

…immune checkpoints, includingTNFSF4, ICOS, CTLA4, and…

Show Full Abstract

<h4>Background</h4>In order to investigate the impact of Treg cell infiltration on the immune response against pancreatic cancer within the tumor microenvironment (TME), and identify crucial mRNA markers associated with Treg cells in pancreatic cancer, our study aims to delve into the role of Treg cells in the anti-tumor immune response of pancreatic cancer.<h4>Methods</h4>The ordinary transcriptome data for this study was sourced from the GEO and TCGA databases. It was analyzed using single-cell sequencing analysis and machine learning. To assess the infiltration level of Treg cells in pancreatic cancer tissues, we employed the CIBERSORT method. The identification of genes most closely associated with Treg cells was accomplished through the implementation of weighted gene co-expression network analysis (WGCNA). Our analysis of single-cell sequencing data involved various quality control methods, followed by annotation and advanced analyses such as cell trajectory analysis and cell communication analysis to elucidate the role of Treg cells within the pancreatic cancer microenvironment. Additionally, we categorized the Treg cells into two subsets: Treg1 associated with favorable prognosis, and Treg2 associated with poor prognosis, based on the enrichment scores of the key genes. Employing the hdWGCNA method, we analyzed these two subsets to identify the critical signaling pathways governing their mutual transformation. Finally, we conducted PCR and immunofluorescence staining <i>in vitro</i> to validate the identified key genes.<h4>Results</h4>Based on the results of immune infiltration analysis, we observed significant infiltration of Treg cells in the pancreatic cancer microenvironment. Subsequently, utilizing the WGCNA and machine learning algorithms, we ultimately identified four Treg cell-related genes (TRGs), among which four genes exhibited significant correlations with the occurrence and progression of pancreatic cancer. Among them, CASP4, TOB1, and CLEC2B were associated with poorer prognosis in pancreatic cancer patients, while FYN showed a correlation with better prognosis. Notably, significant differences were found in the HIF-1 signaling pathway between Treg1 and Treg2 cells identified by the four genes. These conclusions were further validated through <i>in vitro</i> experiments.<h4>Conclusion</h4>Treg cells played a crucial role in the pancreatic cancer microenvironment, and their presence held a dual significance. Recognizing this characteristic was vital for understanding the limitations of Treg cell-targeted therapies. CASP4, FYN, TOB1, and CLEC2B exhibited close associations with infiltrating Treg cells in pancreatic cancer, suggesting their involvement in Treg cell functions. Further investigation was warranted to uncover the mechanisms underlying these associations. Notably, the HIF-1 signaling pathway emerged as a significant pathway contributing to the duality of Treg cells. Targeting this pathway could potentially revolutionize the existing treatment approaches for pancreatic cancer.

Also flagged:deathPulmonary arterial hypertensionright ventricular failurecardiac failurepathogenesisendothelial dysfunction
Journal Article 2023-09-11 No Snippets Jiang Y, Song S, Liu J, Zhang L, Guo X, Lu J, Li L, Yang C, Fu Q, Zeng B.
Show Full Abstract

Pulmonary arterial hypertension (PAH) is a severe progressive disease that may cause early right ventricular failure and eventual cardiac failure. The pathogenesis of PAH involves endothelial dysfunction, aberrant proliferation of pulmonary artery smooth muscle cells (PASMCs), and vascular fibrosis. Hypoxia has been shown to induce elevated secretion of vascular endothelial growth factor (VEGF), leading to the development of hypoxic PAH. However, the molecular mechanisms underlying hypoxic PAH remain incompletely understood. Programmed cell death (PCD) is a natural cell death and regulated by certain genes. Emerging evidence suggests that apoptotic resistance contributes to the development of PAH. Moreover, several novel types of PCD, such as autophagy, pyroptosis, and ferroptosis, have been reported to be involved in the development of PAH. Additionally, multiple diverse epigenetic mechanisms including RNA methylation, DNA methylation, histone modification, and the non-coding RNA molecule-mediated processes have been strongly linked to the development of PAH. These epigenetic modifications affect the expression of genes, which produce important changes in cellular biological processes, including PCD. Consequently, a better understanding of the PCD processes and epigenetic modification involved in PAH will provide novel, specific therapeutic strategies for diagnosis and treatment. In this review, we aim to discuss recent advances in epigenetic mechanisms and elucidate the role of epigenetic modifications in regulating PCD in hypoxia-induced PAH.

HTT
Also flagged:cancercardiovascular diseaseviral infectioncentral nervous system diseasenucleasedegradation
Journal Article 2023-09-11 ✓ 2 Snippets Xiao L, Zhao Y, Yang M, Luan G, Du T, Deng S, Jia X.
In-Text Gene Mentions

Huntington ́s disease is an autosomal dominant genetic disease caused by the amplification of CAG repeat sequences in the Huntington ́s (HTT) gene, resulting in the selective deletion of neurons in HD (Bañez-Coronel et al., 2012).

…in the Huntington´s (HTT) gene, resulting in…

Show Full Abstract

Based on the development of nucleic acid therapeutic drugs, DNAzymes obtained through <i>in vitro</i> selection technology in 1994 are gradually being sought. DNAzymes are single-stranded DNA molecules with catalytic function, which specifically cleave RNA under the action of metal ions. Various <i>in vivo</i> and <i>in vitro</i> models have recently demonstrated that DNAzymes can target related genes in cancer, cardiovascular disease, bacterial and viral infection, and central nervous system disease. Compared with other nucleic acid therapy drugs, DNAzymes have gained more attention due to their excellent cutting efficiency, high stability, and low cost. Here, We first briefly reviewed the development and characteristics of DNAzymes, then discussed disease-targeting inhibition model of DNAzymes, hoping to provide new insights and ways for disease treatment. Finally, DNAzymes were still subject to some restrictions in practical applications, including low cell uptake efficiency, nuclease degradation and interference from other biological matrices. We discussed the latest delivery strategy of DNAzymes, among which lipid nanoparticles have recently received widespread attention due to the successful delivery of the COVID-19 mRNA vaccine, which provides the possibility for the subsequent clinical application of DNAzymes. In addition, the future development of DNAzymes was prospected.

Also flagged:Coronavirus disease 2019COVID-19deathSARS-CoV-2 infectioncancerscancer
Journal Article 2023-09-11 No Snippets Ogarek N, Oboza P, Olszanecka-Glinianowicz M, Kocelak P.
Show Full Abstract

The COVID-19 pandemic has a significant impact on public health and the estimated number of excess deaths may be more than three times higher than documented in official statistics. Numerous studies have shown an increased risk of severe COVID-19 and death in patients with cancer. In addition, the role of SARS-CoV-2 as a potential risk factor for the development of cancer has been considered. Therefore, in this review, we summarise the available data on the potential effects of SARS-CoV-2 infection on oncogenesis, including but not limited to effects on host signal transduction pathways, immune surveillance, chronic inflammation, oxidative stress, cell cycle dysregulation, potential viral genome integration, epigenetic alterations and genetic mutations, oncolytic effects and reactivation of dormant cancer cells. We also investigated the potential long-term effects and impact of the antiviral therapy used in COVID-19 on cancer development and its progression.

B4GALT5
Also flagged:Amyotrophic lateral sclerosisALSDeathinfectionsFused-in-SarcomaFUS
Journal Article 2023-09-11 ✓ 1 Snippet Castillo Bautista CM, Eismann K, Gentzel M, Pelucchi S, Mertens J, Walters HE, Yun MH, Sterneckert J.
In-Text Gene Mentions

B4GALT5is another protein…

Show Full Abstract

Aging is associated with the disruption of protein homeostasis and causally contributes to multiple diseases, including amyotrophic lateral sclerosis (ALS). One strategy for restoring protein homeostasis and protecting neurons against age-dependent diseases such as ALS is to de-repress autophagy. BECN1 is a master regulator of autophagy; however, is repressed by BCL2 via a BH3 domain-mediated interaction. We used an induced pluripotent stem cell model of ALS caused by mutant FUS to identify a small molecule BH3 mimetic that disrupts the BECN1-BCL2 interaction. We identified obatoclax as a brain-penetrant drug candidate that rescued neurons at nanomolar concentrations by reducing cytoplasmic FUS levels, restoring protein homeostasis, and reducing degeneration. Proteomics data suggest that obatoclax protects neurons via multiple mechanisms. Thus, obatoclax is a candidate for repurposing as a possible ALS therapeutic and, potentially, for other age-associated disorders linked to defects in protein homeostasis.

Also flagged:metabolismshort-chain fatty acidschronic diseasesobesitytype 2 diabetesinflammatory bowel diseases
Journal Article 2023-09-11 No Snippets Bianchetti G, De Maio F, Abeltino A, Serantoni C, Riente A, Santarelli G, Sanguinetti M, Delogu G, Martinoli R, Barbaresi S, Spirito M, Maulucci G.
Show Full Abstract

The human gut microbiome, an intricate ecosystem housing trillions of microorganisms within the gastrointestinal tract, holds significant importance in human health and the development of diseases. Recent advances in technology have allowed for an in-depth exploration of the gut microbiome, shedding light on its composition and functions. Of particular interest is the role of diet in shaping the gut microbiome, influencing its diversity, population size, and metabolic functions. Precision nutrition, a personalized approach based on individual characteristics, has shown promise in directly impacting the composition of the gut microbiome. However, to fully understand the long-term effects of specific diets and food components on the gut microbiome and to identify the variations between individuals, longitudinal studies are crucial. Additionally, precise methods for collecting dietary data, alongside the application of machine learning techniques, hold immense potential in comprehending the gut microbiome's response to diet and providing tailored lifestyle recommendations. In this study, we investigated the complex mechanisms that govern the diverse impacts of nutrients and specific foods on the equilibrium and functioning of the individual gut microbiome of seven volunteers (four females and three males) with an average age of 40.9 ± 10.3 years, aiming at identifying potential therapeutic targets, thus making valuable contributions to the field of personalized nutrition. These findings have the potential to revolutionize the development of highly effective strategies that are tailored to individual requirements for the management and treatment of various diseases.

CSE1L
Also flagged:colorectal cancercancerdeathextracellularvesiclestumor
Journal Article 2023-09-11 ✓ 1 Snippet Hussen BM, Abdullah ST, Abdullah SR, Younis YM, Hidayat HJ, Rasul MF, Mohamadtahr S.
In-Text Gene Mentions

…5-antisense RNA 1,CSE1L chromosome segregation 1 likechromosome segregation 1…

Show Full Abstract

Colorectal cancer (CRC) is ranked as the world's third-most prevalent cancer, and metastatic CRC considerably increases cancer-related fatalities globally. A number of complex mechanisms that are strictly controlled at the molecular level are involved in metastasis, which is the primary reason for death in people with CRC. Recently, it has become clear that exosomes, which are small extracellular vesicles released by non-tumorous and tumorigenic cells, play a critical role as communication mediators among tumor microenvironment (TME). To facilitate communication between the TME and cancer cells, non-coding RNAs (ncRNAs) play a crucial role and are recognized as potent regulators of gene expression and cellular processes, such as metastasis and drug resistance. NcRNAs are now recognized as potent regulators of gene expression and many hallmarks of cancer, including metastasis. Exosomal ncRNAs, like miRNAs, circRNAs, and lncRNAs, have been demonstrated to influence a number of cellular mechanisms that contribute to CRC metastasis. However, the molecular mechanisms that link exosomal ncRNAs with CRC metastasis are not well understood. This review highlights the essential roles that exosomal ncRNAs play in the progression of CRC metastatic disease and explores the therapeutic choices that are open to patients who have CRC metastases. However, exosomal ncRNA treatment strategy development is still in its early phases; consequently, additional investigation is required to improve delivery methods and find novel therapeutic targets as well as confirm the effectiveness and safety of these therapies in preclinical and clinical contexts.

PRDX6
Also flagged:Gastrointestinal Cancerscolorectal cancersPeroxiredoxin 1PRDX1peroxidescancer
Journal Article 2023-09-11 ✓ 1 Snippet Zhang Z, Zhou P, Liu M, Pei B.
In-Text Gene Mentions

…(PRDX5), and 1-Cys (PRDX6) 9 , 25…

Show Full Abstract

Esophageal, gastric, liver, and colorectal cancers represent four prevalent gastrointestinal cancers that pose substantial threats to global health due to their high morbidity and mortality rates. Peroxiredoxin 1 (PRDX1), a significant component of the PRDXs family, primarily functions to counteract the peroxides produced by metabolic activities in the body, thereby maintaining the dynamic equilibrium of peroxides <i>in vivo</i>. Intriguingly, PRDX1 expression correlates strongly with cancer's onset, progression, and prognosis. This study mainly applied bioinformatics methods to analyze PRDX1's expression, diagnosis, and prognosis in gastrointestinal cancers and to summarize current research advancements. Evidence from the bioinformatics database suggested that the high expression of PRDX1 was a prominent characteristic of these four gastrointestinal cancers, with this observation reaching statistical significance. The high expression of PRDX1 in gastrointestinal cancer cells also confirms this result. Notably, the primary alteration in PRDX1 within these cancers is the presence of genetic mutations. PRDX1 demonstrated the highest diagnostic efficacy for colorectal cancer. Nevertheless, elevated PRDX1 levels only significantly diminished the survival time of liver cancer patients, exerting no statistically significant impact on the survival duration of patients afflicted by the other three types of gastrointestinal cancers. Recent research has indicated variability in PRDX1 expression across different cancer types, with high expression being predominantly observed in these four gastrointestinal cancers and, in most instances, unfavorable prognosis. These findings broadly align with the results derived from bioinformatics. This research underscores the high expression of PRDX1 in gastrointestinal cancers, its relevance to the diagnosis and prognosis monitoring of these cancers, and its potential to guide clinical treatment for these cancers.

CSE1L
Also flagged:STARD12lung adenocarcinomaferroptosistumorSTART domain-containing proteinslipid
Journal Article 2023-09-11 ✓ 2 Snippets Zhang WD, Hu DM, Shi ZE, Wang QX, Zhang MY, Liu JY, Ji XL, Qu YQ.
In-Text Gene Mentions

Molecular mechanism study found that STARD14 may promote tumor progression via directly act on CSE1L, and associated with several multiple tumor-related signaling, including Wnt/ β - catenin signaling, PI3K / Akt signaling, Cdc42 signaling, and SAPK / JNK signaling 34.

…directly act onCSE1L, and associated with…

Show Full Abstract

<b>Background:</b> Metabolic reprogramming plays an important role in tumor progression and antitumor immunity. START domain-containing proteins (STARDs) are responsible for lipid metabolism. However, the underlying functions of STARDs in lung adenocarcinoma (LUAD) have not been clarified yet. <b>Methods:</b> Oncomine, UALCAN, TCGA and CPTAC were used to explore the expression landscape and clinicopathological characteristics of STARDs in LUAD. Diagnostic and prognostic values were assessed by Kaplan-Meier Plotter, Cox regression analysis, and ROC curve. GeneMANIA, GO, KEGG and GSEA were applied for exploring the potential biological functions. Epigenetic process, including mutation and m6A modification were analyzed by cBioPortal and TCGA. TIMER, TISIDB and TCGA cohort provided an immune signature. The correlation between STARDs expression and ferroptosis was analyzed by TCGA. Finally, the STARDs expression were confirmed by RT-qPCR and western blot. <b>Results:</b> STARD5/10/14 were overexpressed in LUAD compared with normal, while STARD4/7/8/11/12/13 were relatively low. STARD5/12/14 levels were positively related to clinical and lymph node stage. Survival analysis showed high STARD12 expression was associated with favorable overall survival, disease special survival as well as disease free survival, while STARD14 showed the opposite. GSEA analysis found STARD12 and STARD14 were associated with glycolysis, oxidative phosphorylation and tumor related signaling pathways. STARD12 co-expressed genes participated in cell cycle and DNA replication, and STARD14 were enriched in ECM-receptor interaction. Both STARD12 and STARD14 were corelated with epigenetic regulation, especially TP53 mutation and m6A modification. STARD12 expression was positively correlated with TMB level. The level of STARD12 was significantly associated with the abundance of infiltrating immune cells, including B cells, CD8+T cells, macrophages, dendritic cells, and chemokine, receptor, MHC, immunostimulatory related genes. STARD14 was negatively associated with the infiltration of CD8+T cells, while positively with CCL28 and immune checkpoints, including CTLA4 as well as PD-L2. In addition, STARD12/14 could regulate the ferroptosis related genes. <b>Conclusion:</b> STARD12 and STARD14 were expected to be potential biomarkers for LUAD, which were associated with epigenetic regulation, immune infiltration and ferroptosis.

Also flagged:Friedreich ataxiaFRDAautosomalneurodegenerative disorderfrataxinadenosine triphosphate
Journal Article 2023-09-10 No Snippets Lynch DR, Goldsberry A, Rummey C, Farmer J, Boesch S, Delatycki MB, Giunti P, Hoyle JC, Mariotti C, Mathews KD, Nachbauer W, Perlman S, Subramony SH, Wilmot G, Zesiewicz T, Weissfeld L, Meyer C.
Show Full Abstract

<h4>Objective</h4>The natural history of Friedreich ataxia is being investigated in a multi-center longitudinal study designated the Friedreich ataxia Clinical Outcome Measures Study (FACOMS). To understand the utility of this study in analysis of clinical trials, we performed a propensity-matched comparison of data from the open-label MOXIe extension (omaveloxolone) to that from FACOMS.<h4>Methods</h4>MOXIe extension patients were matched to FACOMS patients using logistic regression to estimate propensity scores based on multiple covariates: sex, baseline age, age of onset, baseline modified Friedreich Ataxia Rating scale (mFARS) score, and baseline gait score. The change from baseline in mFARS at Year 3 for the MOXIe extension patients compared to the matched FACOMS patients was analyzed as the primary efficacy endpoint using mixed model repeated measures analysis.<h4>Results</h4>Data from the MOXIe extension show that omaveloxolone provided persistent benefit over 3 years when compared to an untreated, matched cohort from FACOMS. At each year, in all analysis populations, patients in the MOXIe extension experienced a smaller change from baseline in mFARS score than matched FACOMS patients. In the primary pooled population (136 patients in each group) by Year 3, patients in the FACOMS matched set progressed 6.6 points whereas patients treated with omaveloxolone in MOXIe extension progressed 3 points (difference = -3.6; nominal p value = 0.0001).<h4>Interpretation</h4>These results suggest a meaningful slowing of Friedreich ataxia progression with omaveloxolone, and consequently detail how propensity-matched analysis may contribute to understanding of effects of therapeutic agents. This demonstrates the direct value of natural history studies in clinical trial evaluations.

SLC2A14
Also flagged:MethylationGene ExpressionMastocytosissystemic diseaseKITpathogenesis
Journal Article 2023-09-10 ✓ 2 Snippets Górska A, Urbanowicz M, Grochowalski Ł, Seweryn M, Sobalska-Kwapis M, Wojdacz T, Lange M, Gruchała-Niedoszytko M, Jarczak J, Strapagiel D, Górska-Ponikowska M, Pelikant-Małecka I, Kalinowski L, Nedoszytko B, Gutowska-Owsiak D, Niedoszytko M.
In-Text Gene Mentions

…PX domains 2A),SLC2A14(solute carrier family…

…, MFSD11 ,SLC2A14, PLSCR2 ,…

Show Full Abstract

Mastocytosis is a clinically heterogenous, usually acquired disease of the mast cells with a survival time that depends on the time of onset. It ranges from skin-limited to systemic disease, including indolent and more aggressive variants. The presence of the oncogenic KIT p. D816V gene somatic mutation is a crucial element in the pathogenesis. However, further epigenetic regulation may also affect the expression of genes that are relevant to the pathology. Epigenetic alterations are responsible for regulating the expression of genes that do not modify the DNA sequence. In general, it is accepted that DNA methylation inhibits the binding of transcription factors, thereby down-regulating gene expression. However, so far, little is known about the epigenetic factors leading to the clinical onset of mastocytosis. Therefore, it is essential to identify possible epigenetic predictors, indicators of disease progression, and their link to the clinical picture to establish appropriate management and a therapeutic strategy. The aim of this study was to analyze genome-wide methylation profiles to identify differentially methylated regions (DMRs) in patients with mastocytosis compared to healthy individuals, as well as the genes located in those regulatory regions. Genome-wide DNA methylation profiling was performed in peripheral blood collected from 80 adult patients with indolent systemic mastocytosis (ISM), the most prevalent subvariant of mastocytosis, and 40 healthy adult volunteers. A total of 117 DNA samples met the criteria for the bisulfide conversion step and microarray analysis. Genome-wide DNA methylation analysis was performed using a MethylationEPIC BeadChip kit. Further analysis was focused on the genomic regions rather than individual CpG sites. Co-methylated regions (CMRs) were assigned via the CoMeBack method. To identify DMRs between the groups, a linear regression model with age as the covariate on CMRs was performed using Limma. Using the available data for cases only, an association analysis was performed between methylation status and tryptase levels, as well as the context of allergy, and anaphylaxis. KEGG pathway mapping was used to identify genes differentially expressed in anaphylaxis. Based on the DNA methylation results, the expression of 18 genes was then analyzed via real-time PCR in 20 patients with mastocytosis and 20 healthy adults. A comparison of the genome-wide DNA methylation profile between the mastocytosis patients and healthy controls revealed significant differences in the methylation levels of 85 selected CMRs. Among those, the most intriguing CMRs are 31 genes located within the regulatory regions. In addition, among the 10 CMRs located in the promoter regions, 4 and 6 regions were found to be either hypo- or hypermethylated, respectively. Importantly, three oncogenes-<i>FOXQ1</i>, <i>TWIST1</i>, and <i>ERG</i>-were identified as differentially methylated in mastocytosis patients, for the first time. Functional annotation revealed the most important biological processes in which the differentially methylated genes were involved as transcription, multicellular development, and signal transduction. The biological process related to histone H2A monoubiquitination (GO:0035518) was found to be enriched in association with higher tryptase levels, which may be associated with more aberrant mast cells and, therefore, more atypical mast cell disease. The signal in the BAIAP2 gene was detected in the context of anaphylaxis, but no significant differential methylation was found in the context of allergy. Furthermore, increased expression of genes encoding integral membrane components (<i>GRM2</i> and <i>KRTCAP3</i>) was found in mastocytosis patients. This study confirms that patients with mastocytosis differ significantly in terms of methylation levels in selected CMRs of genes involved in specific molecular processes. The results of gene expression profiling indicate the increased expression of genes belonging to the integral component of the membrane in mastocytosis patients (<i>GRM2</i> and <i>KRTCAP3</i>). Further work is warranted, especially in relation to the disease subvariants, to identify links between the methylation status and the symptoms and novel therapeutic targets.

Also flagged:DnaAchromosomemembranemetabolismenzymesribonucleotide reductase
Journal Article 2023-09-10 No Snippets Kohiyama M, Herrick J, Norris V.
Show Full Abstract

The DnaA protein has long been considered to play the key role in the initiation of chromosome replication in modern bacteria. Many questions about this role, however, remain unanswered. Here, we raise these questions within a framework based on the dynamics of hyperstructures, alias large assemblies of molecules and macromolecules that perform a function. In these dynamics, hyperstructures can (1) emit and receive signals or (2) fuse and separate from one another. We ask whether the DnaA-based initiation hyperstructure acts as a logic gate receiving information from the membrane, the chromosome, and metabolism to trigger replication; we try to phrase some of these questions in terms of DNA supercoiling, strand opening, glycolytic enzymes, SeqA, ribonucleotide reductase, the macromolecular synthesis operon, post-translational modifications, and metabolic pools. Finally, we ask whether, underpinning the regulation of the cell cycle, there is a physico-chemical clock inherited from the first <i>protocells</i>, and whether this clock emits a single signal that triggers both chromosome replication and cell division.

Also flagged:Calcium PhosphatecalciumaragoniteLactic acidhyaluronic acidalkaline phosphatase
Journal Article 2023-09-10 No Snippets Cho E, Kim JE, Lee J, Park S, Lee S, Chung JH, Kim J, Seonwoo H.
Show Full Abstract

Three-dimensional (3D) printed calcium phosphate cement (CPC) scaffolds are increasingly being used for bone tissue repair. Traditional materials used for CPC scaffolds, such as bovine and porcine bone, generally contain low amounts of calcium phosphate compounds, resulting in reduced production rates of CPC scaffolds. On the other hand, cockle shells contain more than 99% CaCO<sub>3</sub> in the form of amorphous aragonite with excellent biocompatibility, which is expected to increase the CPC production rate. In this study, 3D-printed cockle shell powder-based CPC (CSP-CPC) scaffolds were developed by the material extrusion method. Lactic acid and hyaluronic acid were used to promote the printability. The characterization of CSP-CPC scaffolds was performed using Fourier transform infrared spectra, X-ray diffraction patterns, and scanning electron microscopy. The biocompatibility of CSP-CPC scaffolds was evaluated using cell viability, Live/Dead, and alkaline phosphatase assays. In addition, CSP-CPC scaffolds were implanted into the mouse calvarial defect model to confirm bone regeneration. This study provides an opportunity to create high value added in fishing villages by recycling natural products from marine waste.

Also flagged:influenzaanemiahepatitisflulung ailmentscardiovascular diseases
Journal Article 2023-09-10 No Snippets Tam JP, Huang J, Loo S, Li Y, Kam A.
Show Full Abstract

Coffee processing generates a huge amount of waste that contains many natural products. Here, we report the discovery of a panel of novel cell-penetrating and metal ion-binding microproteins designated coffeetide cC1a-c and cL1-6 from the husk of two popular coffee plants, <i>Coffea canephora</i> and <i>Coffea liberica</i>, respectively. Combining sequence determination and a database search, we show that the prototypic coffeetide cC1a is a 37-residue, eight-cysteine microprotein with a hevein-like cysteine motif, but without a chitin-binding domain. NMR determination of cC1a reveals a compact structure that confers its resistance to heat and proteolytic degradation. Disulfide mapping together with chemical synthesis reveals that cC1a has a ginsentide-like, and not a hevein-like, disulfide connectivity. In addition, transcriptomic analysis showed that the 98-residue micrcoproten-like coffeetide precursor contains a three-domain arrangement, like ginsentide precursors. Molecular modeling, together with experimental validation, revealed a Mg<sup>2+</sup> and Fe<sup>3+</sup> binding pocket at the N-terminus formed by three glutamic acids. Importantly, cC1a is amphipathic with a continuous stretch of 19 apolar amino acids, which enables its cell penetration to target intracellular proteins, despite being highly negatively charged. Our findings suggest that coffee by-products could provide a source of ginsentide-like bioactive peptides that have the potential to target intracellular proteins.

OLFM4
Also flagged:ovulationhypocalcaemiametritisendomiketritisprostaglandingonadotropin releasing hormone
Journal Article 2023-09-09 ✓ 1 Snippet Piibor J, Waldmann A, Dissanayake K, Andronowska A, Ivask M, Prasadani M, Kavak A, Kodithuwakku S, Fazeli A.
In-Text Gene Mentions

…(ALPL, ANXA1, B2M,OLFM4, PPIA) were significantly…

Show Full Abstract

Uterine environment is tightly and finely regulated via various signaling pathways mediated through endocrine, exocrine, autocrine, juxtacrine, and paracrine mechanisms. In utero signaling processes are paramount for normal and abnormal physiology which involves cell to cell, cells to gametes, cells to embryo, and even interkingdom communications due to presence of uterine microbiota. Extracellular vesicles (EVs) in the uterine fluid (UF) and their cargo components are known to be mediators of in utero signaling and communications. Interestingly, the changes in UF-EV proteome during the bovine estrous cycle and the effects of these differentially enriched proteins on embryo development are yet to be fully discovered. In this study, shotgun quantitative proteomics-based mass spectrometry was employed to compare UF-EV proteomes at day 0, 7, and 16 of the estrous cycle to understand the estrous cycle-dependent dynamics. Furthermore, different phase UF-EVs were supplemented in embryo cultures to evaluate their impact on embryo development. One hundred fifty-nine UF-EV proteins were differentially enriched at different time points indicating the UF-EV proteome is cycle-dependent. Overall, many identified pathways are important for normal uterine functions, early embryo development, and its nutritional needs, such as antioxidant activity, cell morphology and cycle, cellular homeostasis, cell adhesion, and carbohydrate metabolic process. Furthermore, the luteal phase UF-EVs supplementation increased in vitro blastocyst rates from 25.0 ± 5.9% to 41.0 ± 4.0% (p ≤ 0.05). Our findings highlight the importance of bovine UF-EV in uterine communications throughout the estrous cycle. Interestingly, comparison of hormone-synchronized EV proteomes to natural cycle UF-EVs indicated shift of signaling. Finally, UF-EVs can be used to improve embryo production in vitro.

PEBP1
Also flagged:MembraneFerroptosisdeath15-lipoxygenasephosphatidylethanolamine (PE)-binding protein 1hydroperoxy
Journal Article 2023-09-09 ✓ 5 Snippets Manivarma T, Kapralov AA, Samovich SN, Tyurina YY, Tyurin VA, VanDemark AP, Nowak W, Bayır H, Bahar I, Kagan VE, Mikulska-Ruminska K.
In-Text Gene Mentions

…embrane regulation of 15LOX-1/PEBP1complex prompts the…

…(PE)-binding protein 1 (PEBP1) catalyzes the generation…

…Simulations of 15LOX-1/PEBP1complex dynamics and…

…significant effect ofPEBP1is observed only…

…the significance ofPEBP1P112E mutation in…

Show Full Abstract

Ferroptosis is a regulated form of cell death, the mechanism of which is still to be understood. 15-lipoxygenase (15LOX) complex with phosphatidylethanolamine (PE)-binding protein 1 (PEBP1) catalyzes the generation of pro-ferroptotic cell death signals, hydroperoxy-polyunsaturated PE. We focused on gaining new insights into the molecular basis of these pro-ferroptotic interactions using computational modeling and liquid chromatography-mass spectrometry experiments. Simulations of 15LOX-1/PEBP1 complex dynamics and interactions with lipids revealed that association with the membrane triggers a conformational change in the complex. This conformational change facilitates the access of stearoyl/arachidonoyl-PE (SAPE) substrates to the catalytic site. Furthermore, the binding of SAPE promotes tight interactions within the complex and induces further conformational changes that facilitate the oxidation reaction. The reaction yields two hydroperoxides as products, 15-HpETE-PE and 12-HpETE-PE, at a ratio of 5:1. A significant effect of PEBP1 is observed only on the predominant product. Moreover, combined experiments and simulations consistently demonstrate the significance of PEBP1 P112E mutation in generating ferroptotic cell death signals.

DARS2
Also flagged:uncoupling protein 4UCP4Ucp2behavioralmitochondrialMMP
Journal Article 2023-09-09 ✓ 2 Snippets Wang YY, Liu H, Li SJ, Feng B, Huang YQ, Liu SB, Yang YL.
In-Text Gene Mentions

Rumyantseva et al. [37] have found that the conditional PCs-specific deletion of mitochondrial aspartyl-tRNA synthetase (DARS2) causes a massive loss of PCs and ataxia.

…ial aspartyl-tRNA synthetase (DARS2) causes a massive…

Show Full Abstract

Although uncoupling protein 4 (UCP4) is the most abundant protein reported in the brain, the biological function of UCP4 in cerebellum and pathological outcome of UCP4 deficiency in cerebellum remain obscure. To evaluate the role of Ucp4 in the cerebellar Purkinje cells (PCs), we generated the conditional knockdown of Ucp4 in PCs (Pcp2<sup>cre</sup>;Ucp4<sup>fl/fl</sup> mice) by breeding Ucp4<sup>fl/fl</sup> mice with Pcp2<sup>cre</sup> mice. Series results by Western blot, immunofluorescent staining, and triple RNAscope in situ hybridization confirmed the specific ablation of Ucp4 in PCs in Pcp2<sup>cre</sup>;Ucp4<sup>fl/fl</sup> mice, but did not affect the expression of Ucp2, the analog of Ucp4. Combined behavioral tests showed that Pcp2<sup>cre</sup>;Ucp4<sup>fl/fl</sup> mice displayed a characteristic bradykinesia in the spontaneous movements. The electromyogram recordings detection excluded the possibility of hypotonia in Pcp2<sup>cre</sup>;Ucp4<sup>fl/fl</sup> mice. And the electrical patch clamp recordings showed the altered properties of PCs in Pcp2<sup>cre</sup>;Ucp4<sup>fl/fl</sup> mice. Moreover, transmission electron microscope (TEM) results showed the increased mitochondrial circularity in PCs; ROS probe imaging showed the increased ROS generation in molecular layer; and finally, microplate reader assay showed the significant changes of mitochondrial functions, including ROS, ATP, and MMP in the isolated cerebellum tissue. The results suggested that the specific knockdown of mitochondrial protein Ucp4 could damage PCs possibly by attacking their mitochondrial function. The present study is the first to report a close relationship between UCP4 deletion with PCs impairment, and suggests the importance of UCP4 in the substantial support of mitochondrial function homeostasis in bradykinesia. UCP4 might be a therapeutic target for the cerebellar-related movement disorder.

TNFSF4
Also flagged:mitophagyclear cell renal cell carcinomacancerccRCCPTEN-induced putative kinase 1PINK1
Journal Article 2023-09-09 ✓ 1 Snippet Xiang J, Liu W, Liu S, Wang T, Tang H, Yang J.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Background</h4>The role of mitophagy in various cancer-associated biological processes is well recognized. Nonetheless, the comprehensive implications of mitophagy in clear cell renal cell carcinoma (ccRCC) necessitate further exploration.<h4>Methods</h4>Based on the transcriptomic data encompassing 25 mitophagy-related genes (MRGs), we identified the distinct mitophage patterns in 763 ccRCC samples. Subsequently, a mitophage-related predictive signature with machine learning algorithms was constructed, designated as RiskScore, to quantify the individual mitophagy status in ccRCC patients. Employing multispectral immunofluorescence (mIF) and immunohistochemistry (IHC) staining, we detected the effect of PTEN-induced putative kinase 1 (PINK1) in the prognosis and immune microenvironment of ccRCC.<h4>Results</h4>Our analysis initially encompassed a comprehensive assessment of the expression profiling, genomic variations, and interactions among the 25 MRGs in ccRCC. Subsequently, the consensus clustering algorithm was applied to stratify ccRCC patients into three clusters with distinct prognostic outcomes, tumor microenvironment (TME) characteristics, and underlying biological pathways. We screened eight pivotal genes (CLIC4, PTPRB, SLC16A12, ENPP5, FLRT3, HRH2, PDK4, and SCD5) to construct a mitophagy-related predictive signature, which showed excellent prognostic value for ccRCC patients. Moreover, patient subgroups divided by the RiskScore showed contrasting expression levels of immune checkpoints (ICPs), abundance of immune cells, and immunotherapy response. Additionally, a nomogram was established with robust predictive power integrating the RiskScore and clinical features. Notably, we observed that PINK1 expression markedly correlated with favorable treatment response and advanced maturation stages of tertiary lymphoid structures, which potentially shed light on enhancing anti-tumor immunity of ccRCC.<h4>Conclusion</h4>Collectively, this study initially developed a signature associated with mitophagy, which demonstrated an excellent ability to predict the clinical prognosis, TME characterization, and responsiveness to targeted therapy and immunotherapy for ccRCC patients. Of particular note is the pivotal role of PINK1 in mediating the treatment response and immune microenvironment for ccRCC patients.

Also flagged:cervical cancercoagulationlipidatherosclerosisHIF-1signal transduction
Journal Article 2023-09-09 No Snippets Han S, Liu X, Ju S, Mu W, Abulikemu G, Zhen Q, Yang J, Zhang J, Li Y, Liu H, Chen Q, Cui B, Wu S, Zhang Y.
Show Full Abstract

<h4>Objective</h4>Lymph node metastasis (LNM) and lymphatic vasculature space infiltration (LVSI) in cervical cancer patients indicate a poor prognosis, but satisfactory methods for diagnosing these phenotypes are lacking. This study aimed to find new effective plasma biomarkers of LNM and LVSI as well as possible mechanisms underlying LNM and LVSI through data-independent acquisition (DIA) proteome sequencing.<h4>Methods</h4>A total of 20 cervical cancer plasma samples, including 7 LNM-/LVSI-(NC), 4 LNM-/LVSI + (LVSI) and 9 LNM + /LVSI + (LNM) samples from a cohort, were subjected to DIA to identify differentially expressed proteins (DEPs) for LVSI and LNM. Subsequently, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed for DEP functional annotation. Protein-protein interaction (PPI) and weighted gene coexpression network analysis (WGCNA) were used to detect new effective plasma biomarkers and possible mechanisms.<h4>Results</h4>A total of 79 DEPs were identified in the cohort. GO and KEGG analyses showed that DEPs were mainly enriched in the complement and coagulation pathway, lipid and atherosclerosis pathway, HIF-1 signal transduction pathway and phagosome and autophagy. WGCNA showed that the enrichment of the green module differed greatly between groups. Six interesting core DEPs (SPARC, HPX, VCAM1, TFRC, ERN1 and APMAP) were confirmed to be potential plasma diagnostic markers for LVSI and LNM in cervical cancer patients.<h4>Conclusion</h4>Proteomic signatures developed in this study reflected the potential plasma diagnostic markers and new possible pathogenesis mechanisms in the LVSI and LNM of cervical cancer.

HTT
Also flagged:neurodegenerative disordersmitochondrialpathogenesisneurodegenerative diseasescalciumiron
Journal Article 2023-09-09 ✓ 2 Snippets Bustamante-Barrientos FA, Luque-Campos N, Araya MJ, Lara-Barba E, de Solminihac J, Pradenas C, Molina L, Herrera-Luna Y, Utreras-Mendoza Y, Elizondo-Vega R, Vega-Letter AM, Luz-Crawford P.
In-Text Gene Mentions

The Htt gene encoding Huntingtin protein gains increasing number of cytosine-adenine-guanine (CAG)-repeats (> 35) in the exon 1 that is normally composed by 7–35 CAG repeats [87].

BACHD transgenic rats expressing human full-length Htt (Q97) and postmortem brain samples obtained from HD patients show elevated levels of nitric oxide and S-nitrosylation in the striatum.

Show Full Abstract

Mitochondrial dysfunction is reiteratively involved in the pathogenesis of diverse neurodegenerative diseases. Current in vitro and in vivo approaches support that mitochondrial dysfunction is branded by several molecular and cellular defects, whose impact at different levels including the calcium and iron homeostasis, energetic balance and/or oxidative stress, makes it difficult to resolve them collectively given their multifactorial nature. Mitochondrial transfer offers an overall solution since it contains the replacement of damage mitochondria by healthy units. Therefore, this review provides an introducing view on the structure and energy-related functions of mitochondria as well as their dynamics. In turn, we summarize current knowledge on how these features are deregulated in different neurodegenerative diseases, including frontotemporal dementia, multiple sclerosis, amyotrophic lateral sclerosis, Friedreich ataxia, Alzheimer´s disease, Parkinson´s disease, and Huntington's disease. Finally, we analyzed current advances in mitochondrial transfer between diverse cell types that actively participate in neurodegenerative processes, and how they might be projected toward developing novel therapeutic strategies.

Also flagged:C-IGF1RmitophagytumourEpidermal Growth Factor ReceptorTyrosine KinaseEGFR
Journal Article 2023-09-09 No Snippets Wang H, Liang Y, Zhang T, Yu X, Song X, Chen Y, Mao Q, Xia W, Chen B, Xu L, Dong G, Jiang F.
Show Full Abstract

The clinical efficacy of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors (EGFR-TKIs) is limited by the emergence of drug resistance. We hypothesise that restoring dysregulated circular RNAs under initial treatment with EGFR-TKIs may enhance their effectiveness. Through high-throughput screening, we identify that combining circular RNA IGF1R (cIGF1R) with EGFR-TKIs significantly synergises to suppress tumour regrowth following drug withdrawal. Mechanistically, cIGF1R interacts with RNA helicase A (RHA) to depress insulin-like growth factor 1 receptor (IGF1R) mRNA splicing, negatively regulating the parent IGF1R signalling pathway. This regulation is similar to that of IGF1R inhibitor, which induces drug-tolerant persister (DTP) state with activated mitophagy. The cIGF1R also encodes a peptide C-IGF1R that reduces Parkin-mediated ubiquitination of voltage-dependent anion channel 1 (VDAC1) to restrict mitophagy, acting as a molecular switch that promotes the transition of DTP to apoptosis. Our study shows that combining cIGF1R with EGFR-TKIs efficiently reduces the emergence of DTP.

HFE
Also flagged:Mt2MYCTmprss6ironcarbonylSpint2
Journal Article 2023-09-09 ✓ 3 Snippets Enns CA, Weiskopf T, Zhang RH, Wu J, Jue S, Kawaguchi M, Kataoka H, Zhang AS.
In-Text Gene Mentions

Combined ablation of Tmprss6 and Hfe or Tfr2 genes shows a phenotype similar to the Tmprss6−/− mice with an inappropriately high hepcidin expression and iron deficiency anemia (42, 43).

In humans, mutations in the HFE, HJV, or TfR2 gene cause type-1, type-2A, and type-3 hemochromatosis, respectively (3, 8, 35).

…including Tmprss6, Hjv,Hfe, Tfr2, or Neo1…

Show Full Abstract

Matriptase-2 (MT2), encoded by TMPRSS6, is a membrane-anchored serine protease. It plays a key role in iron homeostasis by suppressing the iron-regulatory hormone, hepcidin. Lack of functional MT2 results in an inappropriately high hepcidin and iron-refractory iron-deficiency anemia. Mt2 cleaves multiple components of the hepcidin-induction pathway in vitro. It is inhibited by the membrane-anchored serine protease inhibitor, Hai-2. Earlier in vivo studies show that Mt2 can suppress hepcidin expression independently of its proteolytic activity. In this study, our data indicate that hepatic Mt2 was a limiting factor in suppressing hepcidin. Studies in Tmprss6<sup>-/-</sup> mice revealed that increases in dietary iron to ∼0.5% were sufficient to overcome the high hepcidin barrier and to correct iron-deficiency anemia. Interestingly, the increased iron in Tmprss6<sup>-/-</sup> mice was able to further upregulate hepcidin expression to a similar magnitude as in wild-type mice. These results suggest that a lack of Mt2 does not impact the iron induction of hepcidin. Additional studies of wild-type Mt2 and the proteolytic-dead form, fMt2<sup>S762A</sup>, indicated that the function of Mt2 is to lower the basal levels of hepcidin expression in a manner that primarily relies on its nonproteolytic role. This idea is supported by the studies in mice with the hepatocyte-specific ablation of Hai-2, which showed a marginal impact on iron homeostasis and no significant effects on iron regulation of hepcidin. Together, these observations suggest that the function of Mt2 is to set the basal levels of hepcidin expression and that this process is primarily accomplished through a nonproteolytic mechanism.

SOX6
Also flagged:BCL11AHemoglobinβ-thalassemiasickle cell diseasehereditarydisorders
Journal Article 2023-09-09 ✓ 5 Snippets Simbula M, Manchinu MF, Mingoia M, Pala M, Asunis I, Caria CA, Perseu L, Shah M, Crossley M, Moi P, Ristaldi MS.
In-Text Gene Mentions

…mediates BCL11A andSOX6erythroid-specific coregulatio…

SOX6has also been…

…BCL11A andSOX6are co-expressed and…

…nscriptional downregulation ofSOX6through activation of…

…DownregulatingSOX6by transient ectopic…

Show Full Abstract

Hemoglobin switching is a complex biological process not yet fully elucidated. The mechanism regulating the suppression of fetal hemoglobin (HbF) expression is of particular interest because of the positive impact of HbF on the course of diseases such as β-thalassemia and sickle cell disease, hereditary hemoglobin disorders that affect the health of countless individuals worldwide. Several transcription factors have been implicated in the control of HbF, of which BCL11A has emerged as a major player in HbF silencing. SOX6 has also been implicated in silencing HbF and is critical to the silencing of the mouse embryonic hemoglobins. BCL11A and SOX6 are co-expressed and physically interact in the erythroid compartment during differentiation. In this study, we observe that <i>BCL11A</i> knockout leads to post-transcriptional downregulation of SOX6 through activation of microRNA (miR)-365-3p. Downregulating SOX6 by transient ectopic expression of miR-365-3p or gene editing activates embryonic and fetal β-like globin gene expression in erythroid cells. The synchronized expression of BCL11A and SOX6 is crucial for hemoglobin switching. In this study, we identified a BCL11A/miR-365-3p/SOX6 evolutionarily conserved pathway, providing insights into the regulation of the embryonic and fetal globin genes suggesting new targets for treating β-hemoglobinopathies.

DCC
Also flagged:Von Hippel-LindauVHLcystvascular endothelial growth factorVEGFglucose
Journal Article 2023-09-09 ✓ 1 Snippet Yip-Schneider MT, Muraru R, Kim RC, Wu HH, Sherman S, Gutta A, Al-Haddad MA, Dewitt JM, Schmidt CM.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background/objectives</h4>Pancreatic serous cystic neoplasms (SCN) present a diagnostic challenge given their increasing frequency of detection and benign nature yet relatively high rate of misdiagnosis. Here, imaging and analyses associated with EUS-guided fine-needle aspiration (EUS-FNA) are evaluated for their ability to provide a correct preoperative diagnosis of SCN.<h4>Methods</h4>A surgical cohort with confirmed pathological diagnosis of SCN (n = 62) and a surveillance cohort with likely SCN (n = 31) were assessed for imaging (CT/MRI/EUS) and EUS-FNA-based analyses (cytology/DNA analysis for Von Hippel-Lindau [VHL] gene alterations/biomarkers).<h4>Results</h4>In the surgical cohort, CT/MRI and EUS respectively predicted SCN in 4 of 58(7%) and 19 of 62(31%). Cyst fluid cytology and VHL alterations predicted SCN in 1 of 51(2%) and 5 of 21(24%), respectively. High specificity cyst fluid biomarkers (vascular endothelial growth factor [VEGF]/glucose/carcinoembryonic antigen [CEA]/amylase) correctly identified SCN in 25 of 27(93%). In the surveillance cohort, cyst fluid biomarkers predicted SCN in 12 of 12(100%) while VHL alterations identified SCN 3 of 10(30%).<h4>Conclusion</h4>High specificity cyst fluid biomarkers provided the most sensitive means of diagnosing SCN preoperatively. To obtain a preoperative diagnosis of SCN at the highest level of certainty, a multidisciplinary approach should be taken to inform appropriate SCN management.

Also flagged:Estrogen receptorsbreast cancerERaromatasefulvestrantestrogen
Journal Article 2023-09-09 No Snippets Hirao-Suzuki M, Kanameda K, Takiguchi M, Sugihara N, Takeda S.
Show Full Abstract

To identify effective treatment modalities for breast cancer with acquired resistance, we first compared the responsiveness of estrogen receptor-positive breast cancer MCF-7 cells and long-term estrogen-deprived (LTED) cells (a cell model of endocrine therapy-resistant breast cancer) derived from MCF-7 cells to G-1 and 2-methoxyestradiol (2-MeO-E2), which are microtubule-destabilizing agents and agonists of the G protein-coupled estrogen receptor 1 (GPER1). The expression of GPER1 in LTED cells was low (~0.44-fold), and LTED cells displayed approximately 1.5-fold faster proliferation than MCF-7 cells. Although G-1 induced comparable antiproliferative effects on both MCF-7 and LTED cells (IC<sub>50</sub> values of >10 µM), 2-MeO-E2 exerted antiproliferative effects selective for LTED cells with an IC<sub>50</sub> value of 0.93 μM (vs. 6.79 μM for MCF-7 cells) and induced G2/M cell cycle arrest. Moreover, we detected higher amounts of β-tubulin proteins in LTED cells than in MCF-7 cells. Among the <i>β-tubulin</i> (<i>TUBB</i>) isotype genes, the highest expression of <i>TUBB2B</i> (~3.2-fold) was detected in LTED cells compared to that in MCF-7 cells. Additionally, siTUBB2B restores 2-MeO-E2-mediated inhibition of LTED cell proliferation. Other microtubule-targeting agents, i.e., paclitaxel, nocodazole, and colchicine, were not selective for LTED cells. Therefore, 2-MeO-E2 can be an antiproliferative agent to suppress LTED cell proliferation.

HFE
Also flagged:Metabolic dysfunction-associated steatohepatitischronic liver diseasehepatocellular carcinomacancerdeathobesity
Journal Article 2023-09-09 ✓ 1 Snippet Ugonabo O, Udoh US, Rajan PK, Reeves H, Arcand C, Nakafuku Y, Joshi T, Finley R, Pierre SV, Sanabria JR.
In-Text Gene Mentions

…cohol consumption), cirrhosis,hemochromatosis, primary sclerosis cholangiti…

Show Full Abstract

Metabolic dysfunction-associated steatohepatitis (MASH) is one of the major risk factors for chronic liver disease and hepatocellular carcinoma (HCC). The incidence of MASH in Western countries continues to rise, driving HCC as the third cause of cancer-related death worldwide. HCC has become a major global health challenge, partly from the obesity epidemic promoting metabolic cellular disturbances but also from the paucity of biomarkers for its early detection. Over 50% of HCC cases are clinically present at a late stage, where curative measures are no longer beneficial. Currently, there is a paucity of both specific and sensitive biological markers for the early-stage detection of HCC. The search for biological markers in the diagnosis of early HCC in high-risk populations is intense. We described the potential role of surrogates for a liver biopsy in the screening and monitoring of patients at risk for nesting HCC.

SOX6
Also flagged:ZEB2MEIS1hematopoiesiscell differentiationhematopoietic cell differentiationtranscription factors
Journal Article 2023-09-09 ✓ 5 Snippets Kitagawa Y, Ikenaka A, Sugimura R, Niwa A, Saito MK.
In-Text Gene Mentions

…ling Technology, 3608S), anti-SOX6(Abcam, ab30455), anti-SOX17…

…MEIS1, SOX17, andSOX6, were down-regulated by…

…ZEB2, SPI1, MEIS1,SOX6and SOX17 revealed…

…In contrast,SOX6, SOX17, and SPI1…

…as ERG andSOX6, or arterialization-related…

Show Full Abstract

Cell differentiation is achieved by acquiring a cell type-specific transcriptional program and epigenetic landscape. While the cell type-specific patterning of enhancers has been shown to precede cell fate decisions, it remains unclear how regulators of these enhancers are induced to initiate cell specification and how they appropriately restrict cells that differentiate. Here, using embryonic stem cell-derived hematopoietic cell differentiation cultures, we show the activation of some hematopoietic enhancers during arterialization of hemogenic endothelium, a prerequisite for hematopoiesis. We further reveal that ZEB2, a factor involved in the transcriptional regulation of arterial endothelial cells, and a hematopoietic regulator MEIS1 are independently required for activating these enhancers. Concomitantly, ZEB2 or MEIS1 deficiency impaired hematopoietic cell development. These results suggest that multiple regulators expressed from an earlier developmental stage non-redundantly contribute to the establishment of hematopoietic enhancer landscape, thereby restricting cell differentiation despite the unrestricted expression of these regulators to hematopoietic cells.

TNFSF4
Also flagged:C1qaLgals3Cd63cord injuryspinal cord injurypolymerase
Journal Article 2023-09-09 ✓ 2 Snippets Shang J, Ma C, Ding H, Gu G, Zhang J, Wang M, Fang K, Wei Z, Feng S.
In-Text Gene Mentions

TNFSF4, LAG3, JAK1, IL12B,…

…of immune checkpoints (TNFSF4, LAG3, JAK1, IL12B,…

Show Full Abstract

<h4>Background</h4>After spinal cord injury (SCI), the native immune surveillance function of the central nervous system is activated, resulting in a substantial infiltration of immune cells into the affected tissue. While numerous studies have explored the transcriptome data following SCI and revealed certain diagnostic biomarkers, there remains a paucity of research pertaining the identification of immune subtypes and molecular markers related to the immune system post-spinal cord injury using single-cell sequencing data of immune cells.<h4>Methods</h4>The researchers conducted an analysis of spinal cord samples obtained at three time points (3,10, and 21 days) following SCI using the GSE159638 dataset. The SCI subsets were delineated through pseudo-time analysis, and differentiation related genes were identified after principal component analysis (PCA), cell clustering, and annotation techniques. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were employed to assess the differentiation-related genes (DRGs) across different subsets. The molecular subtypes of SCI were determined using consensus clustering analysis. To further explore and validate the correlation between the molecular subtypes and the immune microenvironment, the CIBERSORT algorithm was employed. High-value diagnostic gene markers were identified using LASSO regression, and their diagnostic sensitivity was assessed using receiver operating characteristic curves (ROC) and quantitative real-time polymerase chain reaction (qRT-PCR).<h4>Results</h4>Three SCI subsets were obtained, and differentiation-related genes were characterized. Within these subsets, two distinct molecular subtypes, namely C1 and C2, were identified. These subtypes demonstrated significant variations in terms of immune cell infiltration levels and the expression of immune checkpoint genes. Through further analysis, three candidate biomarkers (C1qa, Lgals3 and Cd63) were identified and subsequently validated.<h4>Conclusions</h4>Our study revealed a diverse immune microenvironment in SCI samples, highlighting the potential significance of C1qa, Lgals3 and Cd63 as immune biomarkers for diagnosing SCI. Moreover, the identification of immune checkpoints corresponding to the two molecular subtypes suggests their potential as targets for immunotherapy to enhance SCI repair in future interventions.

Also flagged:stenosisspinal stenosisagingmineralizationreproductionspinal degeneration
Journal Article 2023-09-09 No Snippets Cho SH, Lee S, Park JI, La Yang Y, Kim SR, Ahn J, Jeong H, Jung HY, Gwak N, Kim KN, Kim Y.
Show Full Abstract

Aging triggers spinal degeneration, including common spinal stenosis, which causes back and leg pain in older individuals, significantly impacting their quality of life. Here, we explored aging traits in turquoise killifish spines, potentially offering a model for age-linked spinal stenosis in humans. Aged turquoise killifish exhibited body shape deformation and increased vertebral collapse, which was further accelerated by spawning. High-resolution CT scans revealed suppressed cortical bone thickness and hemal arch area in vertebrae due to spawning, and osteophyte formation was observed in both aged and breeding fish populations. Scale mineralization mirrored these changes, increasing with age but being suppressed by spawning. The expression of <i>sp7</i>, <i>sox9b</i>, <i>axin1</i>, and <i>wnt4a/b</i> genes can be utilized to monitor age- and reproduction-dependent spine deformation. This study demonstrates that turquoise killifish and humans share certain phenotypes of age-related vertebral abnormalities, suggesting that turquoise killifish could serve as a potential model for studying human spinal stenosis.

Research Square 2023-09-09 Preprint (No Snippets API) Jiang Z, Dao C, Wang J, Zhu M, Liu F, Zhao Y, Li J, Yang Y, Pan Z.
Show Full Abstract

<title>Abstract</title><p>Background Different programmed cell death (PCD) plays different roles in lung squamous cell carcinoma (LUSC). We integrated twelve programmed cell death patterns, investigated the expression patterns of PCD-related genes to identify promising PCD-related biomarkers. Methods Twelve PCD patterns (apoptosis, pyroptosis, necroptosis, cuproptosis, entotic cell death, autophagy-dependent cell death, netotic cell death, parthanatos, ferroptosis, lysosome-dependent cell death, oxeiptosis and alkaliptosis) were analyzed for model construction, resulting in 1388 PCD-related genes. We explored the expression changes of PCD-related genes in LUSC patients from TCGA database, and constructed a combined prognostic signature by Cox regression analysis and LASSO Cox regression analysis. The independent prognostic performance of the gene signature was evaluate based on consensus clustering, univariate and multivariate Cox regression and Kaplan–Meier survival. The GEO dataset was used for validation. Finally, we investigated the role of the immune microenvironment in different prognosis groups. Results We constructed a network of seven PCD-related genes (FGA, CHEK2, PTGIS, CSF2, STXBP1, NACC2, TFR2). Utilized these 7-gene network to establish a cell death index (CDI) and grouped patients using the median of CDI. We found that LUSC patients with low CDI had a better prognosis. More importantly, CDI was associated with tumor microenvironment components according to integrated analysis, and the response to immunotherapy in the low CDI group was better than that in the high CDI group. Conclusion Our study identified 7-gene network based on PCD to establish a new model of CDI to predict the clinical prognosis of LUSC patients. We proposed that CDI may serve as a new biomarker to predict the prognosis and immunotherapy efficacy in LUSC.</p>

Research Square 2023-09-09 Preprint (No Snippets API) Pant P, Pant P, Rajpal VR, Singh A, Arya H, Sonkar A, Chandra A, Raina SN.
Show Full Abstract

Mucormycosis (MM), commonly referred to as ‘Black Fungus’ was a relatively lesser-known fungal infection until the onset of Covid-19 pandemic. However, amidst the global Covid-19 outbreak, it emerged as a widespread fungal infection causing significant morbidity and mortality. In India, the recorded incidence of MM was approximately 80% higher than in the rest of the world due to a higher prevalence of specific pre-disposing factors, causal organisms, clinical manifestations, and intriguing epidemiological trends. This study compared the MM case-control studies conducted in India before the Covid-19 pandemic and during the current pandemic to comprehend the impact of Covid-19 on the surge in MM cases. Our findings demonstrate that MM is a distinct condition which is not solely dependent on Covid-19. Interestingly, the trends of association of MM with comorbidities like diabetes and its greater prevalence in male gender remains consistent in both study periods. The increased occurrence of MM in India during the current pandemic appears to be more intricately linked to challenges in management and treatment of Covid-19, leading to emergence of novel predisposing factors. The indiscriminate use of steroids, immunosuppressants, and the resultant hyperglycemic condition, especially in a population already burdened with diabetes as comorbidity contributed significantly to the current MM havoc. The study suggests that raising general awareness about preventive measures, diabetes management and the regulation of steroid drug misuse can play a crucial role in curtailing the development and spread of deadly infections like MM in future.

Also flagged:LactoseCarbosilaneGlycodendrimersGalectin-9Glycanbinding proteins
Journal Article 2023-09-08 No Snippets Müllerová M, Hovorková M, Závodná T, Červenková Št Astná L, Krupková A, Hamala V, Nováková K, Topinka J, Bojarová P, Strašák T.
Show Full Abstract

Galectins, the glycan binding proteins, and their respective carbohydrate ligands represent a unique fundamental regulatory network modulating a plethora of biological processes. The advances in galectin-targeted therapy must be based on a deep understanding of the mechanism of ligand-protein recognition. Carbosilane dendrimers, the well-defined and finely tunable nanoscaffolds with low toxicity, are promising for multivalent carbohydrate ligand presentation to target galectin receptors. The study discloses a synthetic method for two types of lactose-functionalized carbosilane glycodendrimers (Lac-CS-DDMs). Furthermore, we report their outstanding, dendritic effect-driven affinity to tandem-type galectins, especially Gal-9. In the enzyme-linked immunosorbent assay, the affinity of the third-generation multivalent dendritic ligand bearing 32 lactose units to Gal-9 reached nanomolar values (IC<sub>50</sub> = 970 nM), being a 1400-fold more effective inhibitor than monovalent lactose for this protein. This demonstrates a game-changing impact of multivalent presentation on the inhibitory effect of a ligand as simple as lactose. Moreover, using DLS hydrodynamic diameter measurements, we correlated the increased affinity of the glycodendrimer ligands to Gal-3 and Gal-8 but especially to Gal-9 with the formation of relatively uniform and stable galectin/Lac-CS-DDM aggregates.

Also flagged:Chronic complicationsdiabetesankyrin repeat domain 36WD repeat domain 77endothelial cell apoptosissmooth muscle cell proliferation
Journal Article 2023-09-08 No Snippets Yuan L, Duan J, Zhou H.
Show Full Abstract

Chronic complications of diabetes increase mortality and disability of patients. It is crucial to find potential early biomarkers and provide novel therapeutic strategies for diabetic complications. Circular RNAs (circRNAs), covalently closed RNA molecules in eukaryotes, have high stability. Recent studies have confirmed that differentially expressed circRNAs have a vital role in diabetic complications. Certain circRNAs, such as circRNA ankyrin repeat domain 36, circRNA homeodomain‑interacting protein kinase 3 (circHIPK3) and circRNA WD repeat domain 77, are associated with inflammation, endothelial cell apoptosis and smooth muscle cell proliferation, leading to vascular endothelial dysfunction and atherosclerosis. CircRNA LDL receptor related protein 6, circRNA actin related protein 2, circ_0000064, circ‑0101383, circ_0123996, hsa_circ_0003928 and circ_0000285 mediate inflammation, apoptosis and autophagy of podocytes, mesangial cell hypertrophy and proliferation, as well as tubulointerstitial fibrosis, in diabetic nephropathy by regulating the expression of microRNAs and proteins. Circ_0005015, circRNA PWWP domain containing 2A, circRNA zinc finger protein 532, circRNA zinc finger protein 609, circRNA DNA methyltransferase 3β, circRNA collagen type I α2 chain and circHIPK3 widely affect multiple biological processes of diabetic retinopathy. Furthermore, circ_000203, circ_010567, circHIPK3, hsa_circ_0076631 and circRNA cerebellar degeneration‑related protein 1 antisense are involved in the pathology of diabetic cardiomyopathy. CircHIPK3 is the most well‑studied circRNA in the field of diabetic complications and is most likely to become a biological marker and therapeutic target for diabetic complications. The applications of circRNAs may be a promising treatment strategy for human diseases at the molecular level. The relationship between circRNAs and diabetic complications is summarized in the present study. Of note, circRNA‑targeted therapy and the role of circRNAs as biomarkers may potentially be used in diabetic complications in the future.

DCC
Also flagged:immunosuppressiveToll-like receptorsTLRsenvelope glycoproteingp62binding
Journal Article 2023-09-08 ✓ 1 Snippet Moin AT, Rani NA, Ullah MA, Patil RB, Robin TB, Nawal N, Zubair T, Mahamud SI, Sakib MN, Islam NN, Khaleque MA, Absar N, Shohael AM.
In-Text Gene Mentions

…TheDCCcorrelation of the…

Show Full Abstract

Human T-lymphotropic virus (HTLV), a group of retroviruses belonging to the oncovirus family, has long been associated with various inflammatory and immunosuppressive disorders. At present, there is no approved vaccine capable of effectively combating all the highly pathogenic strains of HTLV that makes this group of viruses a potential threat to human health. To combat the devastating impact of any potential future outbreak caused by this virus group, our study employed a reverse vaccinology approach to design a novel polyvalent vaccine targeting the highly virulent subtypes of HTLV. Moreover, we comprehensively analyzed the molecular interactions between the designed vaccine and corresponding Toll-like receptors (TLRs), providing valuable insights for future research on preventing and managing HTLV-related diseases and any possible outbreaks. The vaccine was designed by focusing on the envelope glycoprotein gp62, a crucial protein involved in the infectious process and immune mechanisms of HTLV inside the human body. Epitope mapping identified T cell and B cell epitopes with low binding energies, ensuring their immunogenicity and safety. Linkers and adjuvants were incorporated to enhance the vaccine's stability, antigenicity, and immunogenicity. Initially, two vaccine constructs were formulated, and among them, vaccine construct-2 exhibited superior solubility and structural stability. Molecular docking analyses also revealed strong binding affinity between the vaccine construct-2 and both targeted TLR2 and TLR4. Molecular dynamics simulations demonstrated enhanced stability, compactness, and consistent hydrogen bonding within TLR-vaccine complexes, suggesting a strong binding affinity. The stability of the complexes was further corroborated by contact, free energy, structure, and MM-PBSA analyses. Consequently, our research proposes a vaccine targeting multiple HTLV subtypes, offering valuable insights into the molecular interactions between the vaccine and TLRs. These findings should contribute to developing effective preventive and treatment approaches against HTLV-related diseases and preventing possible outbreaks. However, future research should focus on in-depth validation through experimental studies to confirm the interactions identified in silico and to evaluate the vaccine's efficacy in relevant animal models and, eventually, in clinical trials.

SUDS3
Also flagged:euchromatinheterochromatingene expressionhistonespost-translational modificationschromatin-associated proteins
Journal Article 2023-09-08 ✓ 1 Snippet Depierre D, Perrois C, Schickele N, Lhoumaud P, Abdi-Galab M, Fosseprez O, Heurteau A, Margueron R, Cuvier O.
In-Text Gene Mentions

…expression requires notablypolycomb repressiverepressive complexes (PRC1…

Show Full Abstract

Cell type-specific barcoding of genomes requires the establishment of hundreds of heterochromatin domains where heterochromatin-associated repressive complexes hinder chromatin accessibility thereby silencing genes. At heterochromatin-euchromatin borders, regulation of accessibility not only depends on the delimitation of heterochromatin but may also involve interplays with nearby genes and their transcriptional activity, or alternatively on histone modifiers, chromatin barrier insulators, and more global demarcation of chromosomes into 3D compartmentalized domains and topological-associating domain (TADs). Here, we show that depletion of H3K36 di- or tri-methyl histone methyltransferases dMes-4/NSD or Hypb/dSet2 induces reproducible increasing levels of H3K27me3 at heterochromatin borders including in nearby promoters, thereby repressing hundreds of genes. Furthermore, dMes-4/NSD influences genes demarcated by insulators and TAD borders, within chromatin hubs, unlike transcription-coupled action of Hypb/dSet2 that protects genes independently of TADs. Insulator mutants recapitulate the increase of H3K27me3 upon dMes-4/NSD depletion unlike Hypb/dSet2. Hi-C data demonstrate how dMes-4/NSD blocks propagation of long-range interactions onto active regions. Our data highlight distinct mechanisms protecting genes from H3K27me3 silencing, highlighting a direct influence of H3K36me on repressive TADs.

HTT
Also flagged:Huntingtinmetabolismbile acidscholesterolureagene expression
Journal Article 2023-09-08 ✓ 5 Snippets Bragg RM, Coffey SR, Cantle JP, Hu S, Singh S, Legg SR, McHugh CA, Toor A, Zeitlin SO, Kwak S, Howland D, Vogt TF, Monga SP, Carroll JB.
In-Text Gene Mentions

Indeed, Htt knockout in mice results in early embryonic lethality (Duyao et al, 1995; Nasir et al, 1995; Zeitlin et al, 1995) and hypomorphic alleles that express less Htt than normal in humans cause a profound neurodevelopmental disorder whose symptoms are distinct from the HD (Rodan et al, 2014; Lopes et al, 2016).

Huntington’s disease arises from a toxic gain of function in the huntingtin (HTT) gene.

At both ages, we observe significant 18-h fasting hypoglycemia in HttLKO/LKO compared with Htt+/+ mice (Fig 2F, ages pooled for plotting, 27% reduction; N = 18 Htt+/+, 22 HttLKO/LKO, t test t(29.9) = 2.2; P = 0.036).

Hepatocyte-specific Htt knockout mice have reduced circulating glucose, elevated urea, total cholesterol, and bile acids, but normal liver enzymes, glucose disposal, insulin sensitivity, and gluconeogenesis.

A limitation of our work in extending to HTT-lowering agents in clinical trials in HD patients is that our mouse lacks HTT expression both during development and through adulthood, as the Cre driver we have used is active as early as E10.5 (Weisend et al, 2009).

Show Full Abstract

Huntington's disease arises from a toxic gain of function in the <i>huntingtin</i> (<i>HTT</i>) gene. As a result, many HTT-lowering therapies are being pursued in clinical studies, including those that reduce HTT RNA and protein expression in the liver. To investigate potential impacts, we characterized molecular, cellular, and metabolic impacts of chronic HTT lowering in mouse hepatocytes. Lifelong hepatocyte HTT loss is associated with multiple physiological changes, including increased circulating bile acids, cholesterol and urea, hypoglycemia, and impaired adhesion. HTT loss causes a clear shift in the normal zonal patterns of liver gene expression, such that pericentral gene expression is reduced. These alterations in liver zonation in livers lacking HTT are observed at the transcriptional, histological, and plasma metabolite levels. We have extended these phenotypes physiologically with a metabolic challenge of acetaminophen, for which the HTT loss results in toxicity resistance. Our data reveal an unexpected role for HTT in regulating hepatic zonation, and we find that loss of HTT in hepatocytes mimics the phenotypes caused by impaired hepatic β-catenin function.

TAOK3
Also flagged:SGLT2canagliflozinprostate cancersodium-glucose co-transporter-2diabetesheart failure
Journal Article 2023-09-08 ✓ 2 Snippets Ali A, Mekhaeil B, Biziotis OD, Tsakiridis EE, Ahmadi E, Wu J, Wang S, Singh K, Menjolian G, Farrell T, Mesci A, Liu S, Berg T, Bramson JL, Steinberg GR, Tsakiridis T.
In-Text Gene Mentions

Importantly, canagliflozin specifically opposed radiotherapy action and induced a differential downregulation of selected genes such as ROCK2, EP300, KLF11, GJA1, and TAOK3, which are involved in tumor growth and survival (Fig. 8d).

…KLF11, GJA1, andTAOK3, which are…

Show Full Abstract

Radiotherapy is a non-invasive standard treatment for prostate cancer (PC). However, PC develops radio-resistance, highlighting a need for agents to improve radiotherapy response. Canagliflozin, an inhibitor of sodium-glucose co-transporter-2, is approved for use in diabetes and heart failure, but is also shown to inhibit PC growth. However, whether canagliflozin can improve radiotherapy response in PC remains unknown. Here, we show that well-tolerated doses of canagliflozin suppress proliferation and survival of androgen-sensitive and insensitive human PC cells and tumors and sensitize them to radiotherapy. Canagliflozin blocks mitochondrial respiration, promotes AMPK activity, inhibits the MAPK and mTOR-p70<sup>S6k</sup>/4EBP1 pathways, activates cell cycle checkpoints, and inhibits proliferation in part through HIF-1α suppression. Canagliflozin mediates transcriptional reprogramming of several metabolic and survival pathways known to be regulated by ETS and E2F family transcription factors. Genes downregulated by canagliflozin are associated with poor PC prognosis. This study lays the groundwork for clinical investigation of canagliflozin in PC prevention and treatment in combination with radiotherapy.

Also flagged:PAPSS1tocisplatinestrogen receptor alphaovarian cancerplatinum
Journal Article 2023-09-08 No Snippets Sun L, Ji WX, Li Y, Li ZL, Duan CC, Xia BR, Xiao L.
Show Full Abstract

<h4>Background</h4>Cancer cells may develop resistance to cisplatin by various mechanisms. Yet, the exact mechanism of cisplatin in ovarian cancer remains unclear. Recent studies have shown that 3'-phospoadenosine 5'-phosphosulfate synthase 1 (PAPSS1) inhibition combined with low-dose cisplatin increases DNA damage. The aim of this study was to determine the value of targeting PAPSS1 as a cisplatin modulator in epithelial ovarian cancer (EOC).<h4>Results</h4>Increased expression of PAPSS1 was observed in both EOC cells and tissues. Also, its higher nuclear expression was distinctly associated with FIGO (The International Federation of Gynecology and Obstetrics) stage, histological subtype, metastasis, and recurrence. Down-regulation of the PAPSS1 gene increased the cisplatin sensitivity of EOC in vitro and in vivo. Expression of PAPSS1 was negatively correlated with estrogen receptor α (ERα) in EOC. Also, low nuclear PAPSS1 and high nuclear ERα expression in EOC were associated with longer overall survival and progression-free survival in all ovarian cancer and ovarian cancer patients who received platinum-based chemotherapy. PAPSS1 silencing increased the activity of ERα-signaling in EOC cells, thus sensitizing tumors to cisplatin.<h4>Conclusions</h4>These findings characterize a novel interplay between PAPSS1-mediated sulfation and ERα-signaling in EOC cisplatin resistance. PAPSS1 may be exploited as a cisplatin-sensitizing therapeutic target.

Also flagged:cartilage developmentalginateosteoarthritisOAdegenerative joint diseasemembrane
Journal Article 2023-09-08 No Snippets Fredrikson JP, Brahmachary PP, June RK, Cox LM, Chang CB.
Show Full Abstract

One of the main components of articular cartilage is the chondrocyte's pericellular matrix (PCM), which is critical for regulating mechanotransduction, biochemical cues, and healthy cartilage development. Here, individual primary human chondrocytes (PHC) are encapsulated and cultured in 50 µm diameter alginate microgels using drop-based microfluidics. This unique culturing method enables PCM formation and manipulation of individual cells. Over ten days, matrix formation is observed using autofluorescence imaging, and the elastic moduli of isolated cells are measured using AFM. Matrix production and elastic modulus increase are observed for the chondrons cultured in microgels. Furthermore, the elastic modulus of cells grown in microgels increases ≈ten-fold over ten days, nearly reaching the elastic modulus of in vivo PCM. The AFM data is further analyzed using a Gaussian mixture model and shows that the population of PHCs grown in microgels exhibit two distinct populations with elastic moduli averaging 9.0 and 38.0 kPa. Overall, this work shows that microgels provide an excellent culture platform for the growth and isolation of PHCs, enabling PCM formation that is mechanically similar to native PCM. The microgel culture platform presented here has the potential to revolutionize cartilage regeneration procedures through the inclusion of in vitro developed PCM.

HTT
Also flagged:neurodegenerative diseasesHuntington's diseaseHDdeathantibodylysosome
Journal Article 2023-09-08 ✓ 5 Snippets Li C, Lin Y, Chen Y, Song X, Zheng X, Li J, He J, Chen X, Huang C, Wang W, Wu J, Wu J, Gao J, Tu Z, Li XJ, Yan S, Li S.
In-Text Gene Mentions

In our study, we narrowed down the binding region of the previously developed intrabody from mEM48, a monoclonal antibody that selectively binds mHTT but not WT HTT.[14c] Therefore, we were able to generate SM3 (23 amino acids), a much smaller intrabody fragment (2.7 kDa) that maintains the property to selectively bind mHTT.

In our previous study, we found that an intrabody can be expressed in neurons and reduce the cytotoxicity of N‐terminal mutant HTT in HD mice via intra‐brain injection.[14c] We recently identified that the last 23 amino acids of the C‐terminus of the heavy chain of our published intrabody are able to bind mHTT and we named it smaller intrabody 3 (SM3).

Huntington's disease (HD) is an autosomal‐dominant neurodegenerative disease caused by a single gene mutation in the Huntingtin gene (HTT) on chromosome 4.[1] The normal HTT has less than 36 CAG repeats and encodes a polyglutamine (polyQ) repeat shorter than 36Q in huntingtin protein (HTT), but more than 36Q can lead to abnormal conformation and misfolding of the mutant HTT (mHTT).[2] Mutant HTT accumulates in the central nervous system in an age‐dependent manner and causes neuronal damage and death, leading to the development of HD.[3] In the brains of HD patients, significant neuronal loss was found in the striatum, with extreme brain atrophy in the middle and late stages of the disease,[4] a large number of mHTT aggregates accompanied by dystrophic neurites, which reflects the accumulation of misfolded mHTT that can affect intracellular transport, gene transcription, and neuronal survival.[4] Despite considerable advances in our understanding of the pathogenesis of HD, there are currently no effective treatments for HD.

Huntingtin N‐terminal 1–171 amino acid sequences, including 23/150 polyglutamine repeats, were cloned by amplification of HTT with respective polyCAG DNA as template with the primers: forward, 5′‐ GGATCCGCCATGGCTACGTTAGAGAAATTAATG‐3′ and reverse, 5′‐ GGATTCTAAT CTTCCAAGGTTACAGCTCTAGGAATTC‐3′.

Since wild type HTT is an indispensable scaffolding protein that plays an important role in normal physiological functions,[23] the selective binding of SM3 to mHTT is the key to effective and safe treatment of HD, as wild type HTT would not bind the SM3 so that its normal function would not be interfered.

Show Full Abstract

Accumulation of misfolded proteins leads to many neurodegenerative diseases that can be treated by lowering or removing mutant proteins. Huntington's disease (HD) is characterized by the intracellular accumulation of mutant huntingtin (mHTT) that can be soluble and aggregated in the central nervous system and causes neuronal damage and death. Here, an intracellular antibody (intrabody) fragment is generated that can specifically bind mHTT and link to the lysosome for degradation. It is found that delivery of this peptide by either brain injection or intravenous administration can efficiently clear the soluble and aggregated mHTT by activating the lysosomal degradation pathway, resulting in amelioration of gliosis and dyskinesia in HD knock-in (KI-140Q) mice. These findings suggest that the small intrabody peptide linked to lysosomes can effectively lower mutant proteins and provide a new approach for treating neurodegenerative diseases that are caused by the accumulation of mutant proteins.

Also flagged:metalscollagen type ICol-Icalcium phosphatenanomaterialshydroxyapatite
Journal Article 2023-09-08 No Snippets Bahir MM, Rajendran A, Pattanayak D, Lenka N.
Show Full Abstract

The fabrication of biomaterial 3D scaffolds for bone tissue engineering applications involves the usage of metals, polymers, and ceramics as the base constituents. Notwithstanding, the composite materials facilitating enhanced osteogenic differentiation/regeneration are endorsed as the ideally suited bone grafts for addressing critical-sized bone defects. Here, we report the successful fabrication of 3D composite scaffolds mimicking the ECM of bone tissue by using ∼30 wt% of collagen type I (Col-I) and ∼70 wt% of different crystalline phases of calcium phosphate (CP) nanomaterials [hydroxyapatite (HAp), beta-tricalcium phosphate (βTCP), biphasic hydroxyapatite (βTCP-HAp or BCP)], where pH served as the sole variable for obtaining these CP phases. The different Ca/P ratio and CP nanomaterials orientation in these CP/Col-I composite scaffolds not only altered the microstructure, surface area, porosity with randomly oriented interconnected pores (80-450 μm) and mechanical strength similar to trabecular bone but also consecutively influenced the bioactivity, biocompatibility, and osteogenic differentiation potential of gingival-derived mesenchymal stem cells (gMSCs). In fact, BCP/Col-I, as determined from micro-CT analysis, achieved the highest surface area (∼42.6 m<sup>2</sup> g<sup>-1</sup>) and porosity (∼85%), demonstrated improved bioactivity and biocompatibility and promoted maximum osteogenic differentiation of gMSCs among the three. Interestingly, the released Ca<sup>2+</sup> ions, as low as 3 mM, from these scaffolds could also facilitate the osteogenic differentiation of gMSCs without even subjecting them to osteoinduction, thereby attesting these CP/Col-I 3D scaffolds as ideally suited bone graft materials.

Also flagged:Methyl halide transferaseWatercell growthmethyl halidesporulationMethyl bromide
Journal Article 2023-09-08 No Snippets Song X, Kong SJ, Seo S, Prabhakar RG, Shamoo Y.
Show Full Abstract

The application of microfluidic techniques in experimental and environmental studies is a rapidly emerging field. Water-in-oil microdroplets can serve readily as controllable micro-vessels for studies that require spatial structure. In many applications, it is useful to monitor cell growth without breaking or disrupting the microdroplets. To this end, optical reporters based on color, fluorescence, or luminescence have been developed. However, optical reporters suffer from limitations when used in microdroplets such as inaccurate readings due to strong background interference or limited sensitivity during early growth stages. In addition, optical detection is typically not amenable to filamentous or biofilm-producing organisms that have significant nonlinear changes in opacity and light scattering during growth. To overcome such limitations, we show that volatile methyl halide gases produced by reporter cells expressing a methyl halide transferase (MHT) can serve as an alternative nonoptical detection approach suitable for microdroplets. In this study, an MHT-labeled <i>Streptomyces venezuelae</i> reporter strain was constructed and characterized. Protocols were established for the encapsulation and incubation of <i>S. venezuelae</i> in microdroplets. We observed the complete life cycle for <i>S. venezuelae</i> including the vegetative expansion of mycelia, mycelial fragmentation, and late-stage sporulation. Methyl bromide (MeBr) production was detected by gas chromatography-mass spectrometry (GC-MS) from <i>S. venezuelae</i> gas reporters incubated in either liquid suspension or microdroplets and used to quantitatively estimate bacterial density. Overall, using MeBr production as a means of quantifying bacterial growth provided a 100- to 1,000-fold increase in sensitivity over optical or fluorescence measurements of a comparable reporter strain expressing fluorescent proteins. IMPORTANCE Quantitative measurement of bacterial growth in microdroplets <i>in situ</i> is desirable but challenging. Current optical reporter systems suffer from limitations when applied to filamentous or biofilm-producing organisms. In this study, we demonstrate that volatile methyl halide gas production can serve as a quantitative nonoptical growth assay for filamentous bacteria encapsulated in microdroplets. We constructed an <i>S. venezuelae</i> gas reporter strain and observed a complete life cycle for encapsulated <i>S. venezuelae</i> in microdroplets, establishing microdroplets as an alternative growth environment for <i>Streptomyces</i> spp. that can provide spatial structure. We detected MeBr production from both liquid suspension and microdroplets with a 100- to 1,000-fold increase in signal-to-noise ratio compared to optical assays. Importantly, we could reliably detect bacteria with densities down to 10<sup>6</sup> CFU/mL. The combination of quantitative gas reporting and microdroplet systems provides a valuable approach to studying fastidious organisms that require spatial structure such as those found typically in soils.

Also flagged:SynthesisetherglycerolAlkylether lipidsalkenyl ether lipids
Journal Article 2023-09-08 No Snippets Gomes MAGB, Bauduin A, Le Roux C, Fouinneteau R, Berthe W, Berchel M, Couthon H, Jaffrès PA.
Show Full Abstract

Ether lipids are compounds present in many living organisms including humans that feature an ether bond linkage at the <i>sn</i>-1 position of the glycerol. This class of lipids features singular structural roles and biological functions. Alkyl ether lipids and alkenyl ether lipids (also identified as plasmalogens) correspond to the two sub-classes of naturally occurring ether lipids. In 1979 the discovery of the structure of the platelet-activating factor (PAF) that belongs to the alkyl ether class of lipids increased the interest in these bioactive lipids and further promoted the synthesis of non-natural ether lipids that was initiated in the late 60's with the development of edelfosine (an anticancer drug). More recently, ohmline, a glyco glycero ether lipid that modulates selectively SK3 ion channels and reduces in vivo the occurrence of bone metastases, and other glyco glycero ether also identified as GAEL (glycosylated antitumor ether lipids) that exhibit promising anticancer properties renew the interest in this class of compounds. Indeed, ether lipid represent a new and promising class of compounds featuring the capacity to modulate selectively the activity of some membrane proteins or, for other compounds, feature antiproliferative properties via an original mechanism of action. The increasing interest in studying ether lipids for fundamental and applied researches invited to review the methodologies developed to prepare ether lipids. In this review we focus on the synthetic method used for the preparation of alkyl ether lipids either naturally occurring ether lipids (e.g., PAF) or synthetic derivatives that were developed to study their biological properties. The synthesis of neutral or charged ether lipids are reported with the aim to assemble in this review the most frequently used methodologies to prepare this specific class of compounds.

HFE
Also flagged:Thalidomidemultiple myelomabenzimidazoleflubendazolemebendazoleglioblastoma multiforme
Journal Article 2023-09-08 ✓ 1 Snippet Chen Y, Zhang M, Li W, Wang X, Wang X, Chen X, Wu Y, Zhang H, Yang L, Han B, Tang J.
In-Text Gene Mentions

…(diabetes mellitus andhemochromatosis), and CNS diseases…

Show Full Abstract

Quercetin (QR) is a natural flavonol compound widely distributed in the plant kingdom with extensive pharmacological effects. To find the potential clinical indications of QR, 156 differentially expressed genes (DEGs) regulated by QR were obtained from the Gene Expression Omnibus database, and new potential pharmacological effects and clinical indications of QR were repurposed by integrating compounds with similar gene perturbation signatures and associated-disease signatures to QR based on the Connectivity Map and Coexpedia platforms. The results suggested QR has mainly potential therapeutic effects on multiple sclerosis (MS), osteoarthritis, type 2 diabetes mellitus, and acute leukemia. Then, MS was selected for subsequent animal experiments as a representative potential indication, and it found that QR significantly delays the onset time of classical MS model animal mice and ameliorates the inflammatory infiltration and demyelination in the central nervous system. Combined with network pharmacology technology, the therapeutic mechanism of QR on MS was further demonstrated to be related to the inhibition of the expression of inflammatory cytokines (TNF-α, IL-6, IL-1β, IFN-γ, IL-17A, and IL-2) related to TNF-α/TNFR1 signaling pathway. In conclusion, this study expanded the clinical indications of QR and preliminarily confirmed the therapeutic effect and potential mechanism of QR on MS.

SERPINC1
Also flagged:ORM1lupus nephritissystemic lupus erythematosusSLEnephritisalbumin
Journal Article 2023-09-08 ✓ 5 Snippets Kim YE, Lee EJ, Kim K, Kim DH, Jeong MR, Yu J, Hong S, Lee CK, Yoo B, Kim YG.
In-Text Gene Mentions

In the previous study, urine levels of ORM1 and SERPINC1 were elevated in newly diagnosed LN patients compared with healthy controls (HC) and systemic lupus erythematosus (SLE) patients without nephritis.

Red circle indicate that 19 protein-consisted network including SERPINA1 and ORM1 are belonged to 3 biological processes (acute-phase response, cellular oxidant detoxification and response to stress) (C) Box plots and ROC curves for SERPINC1 (upper panel) and ORM1 (lower panel) in the iLN group and SLE group; HC, healthy controls; LN, lupus nephritis groups; iLN, initial LN; SLE, systemic lupus erythematosus; DEPs, differentially expressed proteins; ROC; receiver operating characteristics.

Urine SERPINC1/ORM1 as biomarkers for early detection of lupus nephritis in MRL-lpr mice

Of the 23 proteins which increased more in the iLN group than the SLE group, 19 proteins, including ORM1 and SERPINC1, were show by protein interaction network analysis to be related to the acute phase response (FDR 8E-06), cellular oxidant detoxification (FDR 8E-03) or response to stress (FDR 4E-02).

In a comparative analysis of the iLN and SLE groups, SERPINC1 and ORM1 were more highly expressed in the iLN than the SLE group with p-values of 0.006 and 0.003 for SERPINC1 and ORM1, respectively.

Show Full Abstract

<h4>Background</h4>To evaluate the usefulness of urine SERPINC1 and ORM1 as biomarkers for early detection of lupus nephritis (LN).<h4>Methods</h4>Using proteomics, we screened for potential urine biomarkers that differentiate LN from systemic lupus erythematosus (SLE) patients without nephritis. In addition, urine levels of target biomarkers were measured by ELISA in 13- and 23-week-old MRL-lpr (murine model for LN) and MRL/MpJ mice. Histological analysis was also performed on the kidneys of 23-week-old mice.<h4>Results</h4>Urine SERPINC1 and ORM1 were elevated in SLE patients with newly diagnosed LN compared with SLE patients without LN (SERPINC1, AUC=.892, P<.001; ORM1, AUC=.886, P<.001). Levels of urine SERPINC1 and ORM1 were also significantly higher in MRL-lpr mice than in MRL/MpJ mice at 13 and 23 weeks (SERPINC1: p<.01 and p<.001 at 13 and 23 weeks, respectively; ORM1: p<.01 at 13 and 23 weeks). In contrast, a significant difference in urine albumin between the two groups was only observed at 23 weeks (p<.001) not at 13 weeks (p=.83). Regarding the kidney pathology of MPL-lpr mice, urine ORM1 and urine albumin, but not urine SERPINC1, were positively correlated with the activity index (ORM1, rho =.879, p<.001; albumin, rho =.807, p=.003) and chronicity index (ORM1, rho =.947, p<.001; albumin, rho =.869, p<.001).<h4>Conclusion</h4>We propose that urine SERPINC1 and ORM1 are novel biomarkers for early LN.

Also flagged:ActinF-actincytoskeletonmorphogenesisG-actinFoxD3
Journal Article 2023-09-08 No Snippets Bai Y, Zhao F, Wu T, Chen F, Pang X.
Show Full Abstract

Development is a complex process that occurs throughout the life cycle. F-actin, a major component of the cytoskeleton, is essential for the morphogenesis of tissues and organs during development. F-actin is formed by the polymerization of G-actin, and the dynamic balance of polymerization and depolymerization ensures proper cellular function. Disruption of this balance results in various abnormalities and defects or even embryonic lethality. Here, we reviewed recent findings on the structure of G-actin and F-actin and the polymerization of G-actin to F-actin. We also focused on the functions of actin isoforms and the underlying mechanisms of actin polymerization/depolymerization in cellular and organic morphogenesis during development. This information will extend our understanding of the role of actin polymerization in the physiologic or pathologic processes during development and may open new avenues for developing therapeutics for embryonic developmental abnormalities or tissue regeneration.

Also flagged:Prostate cancercancergene expressiontumorKLK3COX-2
Journal Article 2023-09-08 No Snippets Yu W, Wang C, Shang Z, Tian J.
Show Full Abstract

Single-cell RNA sequencing (scRNA-seq) is a cutting-edge technology that provides insights at the individual cell level. In contrast to traditional bulk RNA-seq, which captures gene expression at an average level and may overlook important details, scRNA-seq examines each individual cell as a fundamental unit and is particularly well-suited for identifying rare cell populations. Analogous to a microscope that distinguishes various cell types within a tissue sample, scRNA-seq unravels the heterogeneity and diversity within a single cell species, offering great potential as a leading sequencing method in the future. In the context of prostate cancer (PCa), a disease characterized by significant heterogeneity and multiple stages of progression, scRNA-seq emerges as a powerful tool for uncovering its intricate secrets.

Also flagged:myasthenia gravisMGMyastheniachronic autoimmune diseaseneuromuscular disordersantibodies
Journal Article 2023-09-08 No Snippets Zawadka-Kunikowska M, Rzepiński Ł, Tafil-Klawe M, Veronese N, Barbagallo M, Habek M, Gilhus NE.
Show Full Abstract

The aim of this systematic review with meta-analysis was to determine differences in cardiovascular autonomic parameters between patients with myasthenia gravis (MG) and healthy controls (HCs). Two reviewers searched four electronic databases, namely PubMed, Web of Science, EMBASE, and SCOPUS, from database inception to 7 July 2023 for studies investigating cardiovascular autonomic parameters in MG vs. HCs. A random-effects meta-analysis was performed to compute Hedges' g ± 95% confidence intervals (CI). Out of a total of 2200 records, 8 observational studies with a sample size of 301 patients with MG and 454 HCs were included in the systematic review. Meta-analysis revealed lower values of expiration/inspiration ratio (g = -0.45, I<sup>2</sup> = 74.7), baroreflex sensitivity (g = -0.56, 95%CI -0.80, -0.33; I<sup>2</sup> = 0.3), percentage of adjacent NN intervals differing by more than 50 ms (g = -1.2, I<sup>2</sup> = 82.8), square root of the mean of squared differences between successive beat intervals (g = -1.94, I<sup>2</sup> = 95.1), mean of the standard deviations of all NN intervals (g = -0.83, 95%CI -1.37, -0.28; I<sup>2</sup> = 55.5), and high frequency of HRV during tilt (g = -0.75, 95%CI -0.11, -0.39; I<sup>2</sup> = 0). MG patients vs. HCs had higher systolic blood pressure (g = 0.39; I<sup>2</sup> = 56.1), sympathovagal balance at rest/during tilt (LF/HF-RRI<sub>supine</sub>, g = 0.44; I<sup>2</sup> = 0; LF/HF-RRI<sub>tilt</sub>, g = 0.86; I<sup>2</sup> = 0; LF/HF<sub>tilt</sub>, g = 0.40; I<sup>2</sup> = 0). As a group, MG patients have altered cardiac autonomic function, including decreased parasympathetic function, lower baroreflex sensitivity, and higher sympathovagal balance at rest and during orthostatic challenges.

Also flagged:Coronary Artery Diseaselipidmetabolismpathogenesiscardiovascular disordersatherosclerosis
Journal Article 2023-09-08 No Snippets Quaye LNK, Dalzell CE, Deloukas P, Smith AJP.
Show Full Abstract

Genome-wide association studies (GWAS) have identified a large number of genetic loci for coronary artery disease (CAD), with many located close to genes associated with traditional CAD risk pathways, such as lipid metabolism and inflammation. It is becoming evident with recent CAD GWAS meta-analyses that vascular pathways are also highly enriched and present an opportunity for novel therapeutics. This review examines GWAS-enriched vascular gene loci, the pathways involved and their potential role in CAD pathogenesis. The functionality of variants is explored from expression quantitative trait loci, massively parallel reporter assays and CRISPR-based gene-editing tools. We discuss how this research may lead to novel therapeutic tools to treat cardiovascular disorders.

PTGIS
Also flagged:LipidMetabolismEndoplasmic Reticulumcancercolorectal cancerimmune response
Journal Article 2023-09-08 ✓ 2 Snippets Jin H, Xia B, Wang J, Qi S, Jing W, Deng K, Yang J.
In-Text Gene Mentions

…× (−0.06324672) +PTGIS× (−0.056664141) +…

…The overexpression ofPTGIShas been linked…

Show Full Abstract

Lipid metabolism and endoplasmic reticulum stress exhibit crosstalk in various cancer types, which are closely associated with the progression of colorectal cancer (CRC). This study constructs a prognostic signature based on lipid metabolism and endoplasmic reticulum stress-related genes (LERGs) for CRC patients, aiming to predict the prognosis and immune response. RNA sequencing and clinical data from the TCGA and GEO databases were analyzed to identify differentially expressed LERGs with prognostic relevance using univariate Cox regression. Subsequently, a risk model was developed using the LASSO regression. CRC patients were stratified into low-risk and high-risk groups based on risk scores, with the high-risk cohort demonstrating a poorer clinical prognosis in multiple databases. The risk model showed robust correlations with clinical features, gene mutations, and treatment sensitivity. Significant differences in immune cell infiltration and the expression of immune-related factors were also detected between risk groups, and elevated scores of cytokines and failure factors were detected in single-cell RNA sequencing analysis. This research indicates that lipid metabolism and endoplasmic reticulum stress in CRC are correlated with tumor progression, an immunosuppressive landscape, and alterations of drug sensitivity. The developed risk model can serve as a powerful prognostic tool, offering critical insights for refining clinical management and optimizing treatment in CRC patients.

POU3F2
Also flagged:DACH1dachshund family transcription factor 1cytokinetumorcell proliferationdiabetes
Journal Article 2023-09-08 ✓ 1 Snippet Ma Y, Wei J, Song J, Hu Z, Zhang R, Li Z, Sun Y.
In-Text Gene Mentions

…NFI/CTF, HNF-1B, Cart-1,POU3F2, R2, and RUNX1,…

Show Full Abstract

Foamy viruses are members of the <i>Retroviridae</i> family's <i>Spumaretrovirinae</i> subfamily. They induce cell vacuolation and exhibit a foamy pathogenic impact after infecting cells. DACH1 (dachshund family transcription factor 1) is a crucial cytokine linked to tumor development, and is associated with the growth of many different malignant tumor cells. Additionally, DACH1 suppresses pancreatic cell proliferation and is involved in diabetes insulin signaling. Prototype foamy viruses (PFVs) were used for the investigation of the regulatory mechanism of FVs on cellular DACH1 expression. The results show that DACH1 expression in PFV-infected cells was inconsistent at both the transcriptional and protein levels. At the transcriptional level, <i>DACH1</i> was significantly activated by PFV transactivator Tas, and dual-luciferase reporter gene tests, EMSA, and ChIP assays found a Tas response element of 21 nucleotides in the <i>DACH1</i> promoter. PFV and Tas did not boost the levels of DACH1 protein in a manner consistent with the high levels of DACH1 transcription expression. It was noted that Tas increased the expression of the Ser/Thr protein phosphatase PPM1E, causing PPM1E-mediated post-translational SUMOylation alterations of DACH1 to prompt DACH1 to degrade. The reason for DACH1 protein degradation is that DACH1 inhibits PFV replication. To sum up, these findings show that PFV upregulated the transcription of DACH1, while urging its protein into PPM1E-mediated SUMOylation, to eliminate the adverse effect of DACH1 overexpression of host cells on viral replication and promote virus survival.

HFE
Also flagged:Calcium PyrophosphateDeposition DiseaseCalciumpyrophosphatedepositionCPPD) disease of the
Journal Article 2023-09-08 ✓ 1 Snippet Florica R, Sekh MB.
In-Text Gene Mentions

…emia, hyperparathyroidism, andhemochromatosis[ 1 ,…

Show Full Abstract

Calcium pyrophosphate deposition (CPPD) disease of the joints is a form of arthritis that can present in a severely debilitating form of pseudogout. Although mostly idiopathic, pseudogout has been reported following bisphosphonate therapy in only nine cases to date with a pathophysiology that remains unclear. We present the case of a 59-year-old postmenopausal woman who developed the rare onset of acute polyarticular CPPD disease following zoledronic acid infusion for the treatment of osteoporosis.

HTT
Also flagged:deathcancerneurodegenerative diseasesHuntingtoncytosineadenine
Journal Article 2023-09-08 ✓ 1 Snippet Lotspeich SC, Ashner MC, Vazquez JE, Richardson BD, Grosser KF, Bodek BE, Garcia TP.
In-Text Gene Mentions

HTT

Show Full Abstract

The landscape of survival analysis is constantly being revolutionized to answer biomedical challenges, most recently the statistical challenge of censored covariates rather than outcomes. There are many promising strategies to tackle censored covariates, including weighting, imputation, maximum likelihood, and Bayesian methods. Still, this is a relatively fresh area of research, different from the areas of censored outcomes (i.e., survival analysis) or missing covariates. In this review, we discuss the unique statistical challenges encountered when handling censored covariates and provide an in-depth review of existing methods designed to address those challenges. We emphasize each method's relative strengths and weaknesses, providing recommendations to help investigators pinpoint the best approach to handling censored covariates in their data.

medRxiv 2023-09-08 Preprint (No Snippets API) Krzak M, Alegbe T, Taylor DL, Jones G, Ghouraba M, Strickland M, Harris BT, Satti R, Arestang K, Ramirez-Navarro L, Nishad N, Cheam KAX, Tutert M, Ozols M, Noell G, Leonard S, Przybilla MJ, Petrova V, Jones CP, Wana N, Hu MX, Skelton J, Ostermayer J, Gu Y, Garri W, Brezina B, Caballes CQ, Corridoni D, Parkes M, Iyer V, Cotobal Martin C, McIntyre RE, Raine T, Anderson CA.
Show Full Abstract

<h4>Summary</h4> Crohn’s disease (CD) is a chronic inflammatory bowel disease exhibiting substantial heterogeneity in clinical presentation and response to therapy. To explore its molecular basis, we developed IBDverse, the largest single-cell RNA sequencing (scRNA-seq) dataset of terminal ileal biopsies, profiling over 1.1 million cells from 111 CD patients and 232 healthy controls. This resource integrates discovery and replication cohorts for robust identification of CD-associated cell types, genes, and pathways. We uncovered epithelial changes marked by interferon-driven MHC-I upregulation, persisting in progenitors after macroscopic inflammation resolution. ITGA4 + macrophages were identified as key inflammatory drivers, showing enriched JAK/STAT signaling and cytokine expression (IL-6, IL-12, IL-23). Heritability analysis linked inflammatory monocytes and macrophages to CD susceptibility, implicating resident and recruited immune cells in pathogenesis. These findings establish a comprehensive cellular and molecular framework for CD, offering new insights into disease mechanisms and therapeutic opportunities.

HTT
Also flagged:pneumoniaaminopeptidase NAPNSglycosylationspike protein
Journal Article 2023-09-07 ✓ 1 Snippet Liu Y, Chen D, Wang Y, Li X, Qiu Y, Zheng M, Song Y, Li G, Song C, Liu T, Zhang Y, Guo JT, Lin H, Zhao X.
In-Text Gene Mentions

…HCoV-229Epp, SARS-CoV-2pp, andMERS-CoVppto infect 293T…

Show Full Abstract

Canine coronavirus-human pneumonia-2018 (CCoV-HuPn-2018) was recently isolated from a child with pneumonia. This novel human pathogen resulted from cross-species transmission of a canine coronavirus. It has been known that CCoV-HuPn-2018 uses aminopeptidase N (APN) from canines, felines, and porcines, but not humans, as functional receptors for cell entry. The molecular mechanism of cell entry in CCoV-HuPn-2018 remains poorly understood. In this study, we demonstrated that among the nine APN orthologs tested, the APN of the Mexican free-tailed bat could also efficiently support CCoV-HuPn-2018 spike (S) protein-mediated entry, raising the possibility that bats may also be an alternative host epidemiologically important for the transmission of this virus. The glycosylation at residue N747 of canine APN is critical for its receptor activity. The gain of glycosylation at the corresponding residues in human and rabbit APNs converted them to functional receptors for CCoV-HuPn-2018. Interestingly, the CCoV-HuPn-2018 spike protein pseudotyped virus infected multiple human cancer cell lines in a human APN-independent manner, whereas sialic acid appeared to facilitate the entry of the pseudotyped virus into human cancer cells. Moreover, while host cell surface proteases trypsin and TMPRSS2 did not promote the entry of CCoV-HuPn-2018, endosomal proteases cathepsin L and B are required for the entry of CCoV-HuPn-2018 in a pH-dependent manner. IFITMs and LY6E are host restriction factors for the CCoV-HuPn-2018 entry. Our results thus suggest that CCoV-HuPn-2018 has not yet evolved to be an efficient human pathogen. Collectively, this study helps us understand the cell tropism, receptor usage, cross-species transmission, natural reservoir, and pathogenesis of this potential human coronavirus. IMPORTANCE Viral entry is driven by the interaction between the viral spike protein and its specific cellular receptor, which determines cell tropism and host range and is the major constraint to interspecies transmission of coronaviruses. Aminopeptidase N (APN; also called CD13) is a cellular receptor for HCoV-229E, the newly discovered canine coronavirus-human pneumonia-2018 (CCoV-HuPn-2018), and many other animal alphacoronaviruses. We examined the receptor activity of nine APN orthologs and found that CCoV-HuPn-2018 utilizes APN from a broad range of animal species, including bats but not humans, to enter host cells. To our surprise, we found that CCoV-HuPn-2018 spike protein pseudotyped viral particles successfully infected multiple human hepatoma-derived cell lines and a lung cancer cell line, which is independent of the expression of human APN. Our findings thus provide mechanistic insight into the natural hosts and interspecies transmission of CCoV-HuPn-2018-like coronaviruses.

PRDX6
Also flagged:FABP4LEPIL1RNLSP1GOLM2TNFRSF6B
Journal Article 2023-09-07 ✓ 2 Snippets Yao P, Iona A, Kartsonaki C, Said S, Wright N, Lin K, Pozarickij A, Millwood I, Fry H, Mazidi M, Chen Y, Du H, Bennett D, Avery D, Schmidt D, Pei P, Lv J, Yu C, Hill M, Chen J, Peto R, Walters R, Collins R, Li L, Clarke R, Chen Z, China Kadoorie Biobank Collaborative Group.
In-Text Gene Mentions

…OGN, EFEMP1, TXNDC15,PRDX6) significantly affect levels…

PRDX6

Show Full Abstract

Adiposity is associated with multiple diseases and traits, but little is known about the causal relevance and mechanisms underlying these associations. Large-scale proteomic profiling, especially when integrated with genetic data, can clarify mechanisms linking adiposity with disease outcomes. We examined the associations of adiposity with plasma levels of 1463 proteins in 3977 Chinese adults, using measured and genetically-instrumented BMI. We further used two-sample bi-directional MR analyses to assess if certain proteins influenced adiposity, along with other (e.g. enrichment) analyses to clarify possible mechanisms underlying the observed associations. Overall, the mean (SD) baseline BMI was 23.9 (3.3) kg/m<sup>2</sup>, with only 6% being obese (i.e. BMI ≥ 30 kg/m<sup>2</sup>). Measured and genetically-instrumented BMI was significantly associated at FDR < 0.05 with levels of 1096 (positive/inverse: 826/270) and 307 (positive/inverse: 270/37) proteins, respectively, with FABP4, LEP, IL1RN, LSP1, GOLM2, TNFRSF6B, and ADAMTS15 showing the strongest positive and PON3, NCAN, LEPR, IGFBP2 and MOG showing the strongest inverse genetic associations. These associations were largely linear, in adiposity-to-protein direction, and replicated (> 90%) in Europeans of UKB (mean BMI 27.4 kg/m<sup>2</sup>). Enrichment analyses of the top > 50 BMI-associated proteins demonstrated their involvement in atherosclerosis, lipid metabolism, tumour progression and inflammation. Two-sample bi-directional MR analyses using cis-pQTLs identified in CKB GWAS found eight proteins (ITIH3, LRP11, SCAMP3, NUDT5, OGN, EFEMP1, TXNDC15, PRDX6) significantly affect levels of BMI, with NUDT5 also showing bi-directional association. The findings among relatively lean Chinese adults identified novel pathways by which adiposity may increase disease risks and novel potential targets for treatment of obesity and obesity-related diseases.

SOX6
Also flagged:transforming growth factor-β1Smad2fibroblast proliferationcollagensynthesisTGFβ-R1
Journal Article 2023-09-07 ✓ 1 Snippet Zhao Q, Yang W, Li X, Yuan H, Guo J, Wang Y, Shan Z.
In-Text Gene Mentions

…PDCD4, PACS2 andSOX6were verified to…

Show Full Abstract

<h4>Background</h4>Artial fibrosis has been recognized as a typical pathological change in atrial fibrillation. Although present evidence suggests that microRNA-499-5p (miR-499-5p) plays an important role in the development of atrial fibrosis, the specific mechanism is not fully understood. Therefore, this study attempted to assess the influence of miR-499-5p on atrial fibroblasts and explore the potential molecular mechanism.<h4>Methods</h4>Atrial fibroblasts from sprague dawley rat were respectively transfected with miR-499-5p mimic, miR-499-5p negative control and miR-499-5p inhibitor, atrial fibroblasts without any treatment were also established. Cell counting kit-8 assay and transwell assay were used to detect the proliferation and migration of atrial fibroblasts in each group. Expressions of miR-499-5p, TGF-β1, smad2, α-SMA, collagen-I and TGFβ-R1 in mRNA and protein level were subsequently detected via quantitative real-time polymerase chain reaction and western blot. Furthermore, the prediction of the binding sites of miR-499-5p and TGFβ-R1 was performed via the bioinformatics online software TargetScan and verified by dual luciferase reporter.<h4>Results</h4>By utilizing miR-499-5p-transfected atrial fibroblasts model, expression of miR-499-5p in the miR-499-5p mimic group was upregulated, while it was downregulated in the miR-499-5p inhibitors group. Upregulated miR-499-5p expression led to to a significant decrease in the proliferative and migratory ability of cultured atrial fibroblasts, while downregulated miR-499-5p expression led to a significant increase in the proliferative and migratory ability of cultured atrial fibroblasts. Additionally, upregulated miR-499-5p expression made a significant rise in TGF-β1-induced mRNA and protein expression of TGF-β1, TGFβ-R1, smad2, α-SMA and collagen-I in atrial fibroblasts. Furthermore, results from the dual luciferase reporter conformed that miR-499-5p may repress TGFβ-R1 by binding the 3'UTR of TGFβ-R1 directly.<h4>Conclusions</h4>miR-499-5p is able to inhibit the activation of transforming growth factor β-induced Smad2 signaling and eventually suppressed the proliferation, migration and invasion of atrial fibroblasts and collagen synthesis by targeting TGFβ-R1.

HTT
Also flagged:SUMOylationchromatinsilencingcellembryogenesis-
Journal Article 2023-09-07 ✓ 1 Snippet Briley SM, Ahmed AA, Steenwinkel TE, Jiang P, Hartig SM, Schindler K, Pangas SA.
In-Text Gene Mentions

HTT

Show Full Abstract

Meiotically competent oocytes in mammals undergo cyclic development during folliculogenesis. Oocytes within ovarian follicles are transcriptionally active, producing and storing transcripts required for oocyte growth, somatic cell communication and early embryogenesis. Transcription ceases as oocytes transition from growth to maturation and does not resume until zygotic genome activation. Although SUMOylation, a post-translational modification, plays multifaceted roles in transcriptional regulation, its involvement during oocyte development remains poorly understood. In this study, we generated an oocyte-specific knockout of Ube2i, encoding the SUMO E2 enzyme UBE2I, using Zp3-cre+ to determine how loss of oocyte SUMOylation during folliculogenesis affects oocyte development. Ube2i Zp3-cre+ female knockout mice were sterile, with oocyte defects in meiotic competence, spindle architecture and chromosome alignment, and a premature arrest in metaphase I. Additionally, fully grown Ube2i Zp3-cre+ oocytes exhibited sustained transcriptional activity but downregulated maternal effect genes and prematurely activated genes and retrotransposons typically associated with zygotic genome activation. These findings demonstrate that UBE2I is required for the acquisition of key hallmarks of oocyte development during folliculogenesis, and highlight UBE2I as a previously unreported orchestrator of transcriptional regulation in mouse oocytes.

Also flagged:glucosePAPInsulin resistancecholesteroltriglycerides
Journal Article 2023-09-07 No Snippets Nguyen TN, Vu HTT, Khuong LQ, van der Ploeg I, Sundberg CJ.
Show Full Abstract

The aim was to investigate the effects of physical activity on prescription (PAP) compared with standard care (SC) in adult drug-naïve T2D patients. A randomized control trial was conducted with drug-naïve T2D patients attending an out-patient clinic Vietnam. Participants were randomly assigned to the PAP group (n+=+44) or the SC group (n+=+43). The PAP group received individualized recommendations for PA, intensive face-to-face training every two weeks. The SC group received the standard recommendations according to WHO guidelines. The mean HbA1c level change was larger (-10.6±6.4 mmol/mol) in the PAP group than in the SC group (-2.4±5.8 mmol/mol) (p<0.001). A one thousand step counts per day increase was significantly associated with a decrease of -2.43 mmol/mol in HbA1c [β=-2.43, 95%CI: (-2.94, -1.92]) in the PAP group. The fasting plasma glucose levels of the PAP group decreased significantly compared with the SC group. The VO2-max increased significantly more in the PAP group than in the SC group. PAP had clear positive effects on health-related Quality of Life [mean between group difference: 9.54 (95%CI 5.84,13.23)]. Insulin resistance, BMI, waist circumference, total cholesterol, LDL cholesterol and triglycerides were significantly more decreased in the PAP group than in the control group. In conclusion, the fact that even a small change in mean step counts over three months had a beneficial effect on health-related outcomes in drug-naïve T2D patients can have large implications for treatment and management practices, not least in a middle-income country like Vietnam.

HFE
Also flagged:rashsteroidsporphyria cutanea tardahereditary haemochromatosishaemochromatosisHH
Journal Article 2023-09-07 ✓ 2 Snippets Goh JW, Ong CK, Abdullah KM.
In-Text Gene Mentions

HFE

type 1 haemochromatosis

Show Full Abstract

We present a case of a woman who presented with a photosensitive skin rash and blisters on her extremities which did not improve with steroids. These were associated with polyarthralgia and a deranged liver function test on her admission. Further workup revealed that the patient has an undiagnosed porphyria cutanea tarda (PCT) and hereditary haemochromatosis. The patient later underwent regular venesections which improved her condition. This case report not only illustrates the challenge in diagnosing PCT but also aims to highlight the association between PCT and hereditary haemochromatosis.

ZNF644
Also flagged:Acute myeloid leukemiaAMLhematological tumorcancertranslationalgene expressions
Journal Article 2023-09-07 ✓ 1 Snippet Fu J, Si L, Zhou Y, Li D, Wang R.
In-Text Gene Mentions

…of CCDC7 andZNF644.…

Show Full Abstract

Post-transcriptional methylation modifications, such as the N7-methylguanosine (m7G) modification, are increasingly acknowledged for their role in the development and resistance to chemotherapy in acute myeloid leukemia (AML). This study employed MeRIP-seq technology to investigate the m7G sites within circular RNAs (circRNAs) derived from human AML cells and drug-resistant AML cells, in order to identify these sites more comprehensively. In addition, a detailed analysis of the relationship between m7G and drug-resistant AML was conducted. The bioinformatics analysis was utilized to predict the functions of specific methylated transcripts. The findings revealed a significant difference in m7G level between AML cells and drug-resistant AML cells, suggesting a potentially critical role of m7G in circRNAs in drug-resistant AML development. The methylation of M7G could affect the circRNA-miRNA-mRNA co-expression during the development of AML resistance, which could further influence the regulation of resistance-associated target genes in AML. Furthermore, gene ontology analysis indicated that the distinct distribution pattern of circRNAs with m7G methylation in drug-resistant AML cells was correlated with metabolism-related pathways. These results suggested a potential association between drug-resistant AML and m7G methylation of circRNAs. Moreover, the results revealed a novel role of m7G RNA methylation in circRNAs in the progression of AML chemoresistance.

MLLT10
Also flagged:MeninMLLleukemiaChromatinhistoneRNA polymerase II
Journal Article 2023-09-07 ✓ 1 Snippet Gilan O, Talarmain L, Bell CC, Neville D, Knezevic K, Ferguson DT, Boudes M, Chan YC, Davidovich C, Lam EYN, Dawson MA.
In-Text Gene Mentions

…is directed byMLLT10.…

Show Full Abstract

Chromatin regulation involves the selective recruitment of chromatin factors to facilitate DNA repair, replication and transcription. Here we demonstrate the utility of coupling unbiased functional genomics with chromatin immunoprecipitation (CRISPR-ChIP) to identify the factors associated with active chromatin modifications in mammalian cells. Specifically, an integrated reporter containing a cis-regulatory element of interest and a single guide RNA provide a chromatinized template for a direct readout for regulators of histone modifications associated with actively transcribed genes such as H3K4me3 and H3K79me2. With CRISPR-ChIP, we identify all the nonredundant COMPASS complex members required for H3K4me3 and demonstrate that RNA polymerase II is dispensable for the maintenance of H3K4me3. As H3K79me2 has a putative oncogenic function in leukemia cells driven by MLL translocations, using CRISPR-ChIP we reveal a functional partitioning of H3K79 methylation into two distinct regulatory units: an oncogenic DOT1L complex directed by the MLL fusion protein in a Menin-dependent manner and a separate endogenous DOT1L complex, where catalytic activity is directed by MLLT10. Overall, CRISPR-ChIP provides a powerful tool for the unbiased interrogation of the mechanisms underpinning chromatin regulation.

PRDX6
Also flagged:atherosclerosisAScholesteroltriglyceridesIL-1βIL-18
Journal Article 2023-09-07 ✓ 1 Snippet Bai Z, Hu H, Hu F, Ji J, Ji Z.
In-Text Gene Mentions

…by modulating the Pum2/PRDX6axis [ 31…

Show Full Abstract

<h4>Objectives</h4>This study aimed to determine the effects of bone marrow mesenchymal stem cells (BMSCs)-derived exosomes (BMSC-EXO) on atherosclerosis (AS), and its related underlying mechanisms.<h4>Methods</h4>Exosomes were isolated from mouse BMSCs, and identified by transmission electron microscopy (TEM), Nanosight (NTA), and western blot. A mouse AS model was established, and exosomes were injected into the tail vein. Total cholesterol (TC) and triglycerides (TG) were detected using their corresponding assay kits. The contents of IL-1β and IL-18 in serum were detected by ELISA. The mRNA and protein expression levels of GSDMD, Caspase1, and NLRP3 were detected by qRT-PCR and Western blot. Finally, aortic tissues in the Model and BMSC-EXO groups were sent for sequencing.<h4>Results</h4>TEM, NTA, and western blot indicated successful isolation of exosomes. Compared with the control group, the TC, TG contents, IL-1β and IL-18 concentrations of the mice in the Model group were significantly increased; nonetheless, were significantly lower after injected with BMSC-EXO than those in the Model group (p < 0.05). Compared with the control group, the expressions of NLRP3, caspase-1 and GSDMD were significantly up-regulated in the Model group (p < 0.05), while the expressions of NLRP3, caspase-1, and GSDMD were significantly down-regulated by BMSC-EXO. By sequencing, a total of 3852 DEGs were identified between the Model and BMSC-EXO group and were significantly enriched in various biological processes and pathways related to mitochondrial function, metabolism, inflammation, and immune response.<h4>Conclusion</h4>AS can induce pyroptosis, and BMSC-EXO can reduce inflammation and alleviate the progression of AS by inhibiting NLRP3/Caspase-1/GSDMD in the pyroptosis pathway.

Also flagged:seedwaterperoxidasePODcatalaseCAT
Journal Article 2023-09-07 No Snippets Khan W, Shah S, Ullah A, Ullah S, Amin F, Iqbal B, Ahmad N, Abdel-Maksoud MA, Okla MK, El-Zaidy M, Al-Qahtani WH, Fahad S.
Show Full Abstract

The application of germination models in economic crop management makes them extremely useful for predicting seed germination. Hence, we examined the effect of varying water potentials (Ψs; 0. - 0.3, - 0.6, - 0.9, - 1.2 MPa) and temperatures (Ts; 20, 25, 30, 35, 40 °C) on maize germination and enzymatic antioxidant mechanism. We observed that varying Ts and Ψs significantly influenced germination percentage (GP) and germination rate (GR), and other germination parameters, including germination rate index (GRI), germination index (GI), mean germination index (MGI), mean germination time (MGT), coefficient of the velocity of germination (CVG), and germination energy (GE) (p ≤ 0.01). Maximum (87.60) and minimum (55.20) hydro-time constant (θH) were reported at 35 °C and 20 °C, respectively. In addition, base water potential at 50 percentiles was highest at 30 °C (15.84 MPa) and lowest at 20 °C (15.46 MPa). Furthermore, the optimal, low, and ceiling T (To, Tb and Tc, respectively) were determined as 30 °C, 20 °C and 40 °C, respectively. The highest θT1 and θT2 were reported at 40 °C (0 MPa) and 20 °C (- 0.9 MPa), respectively. HTT has a higher value (R2 = 0.43 at 40 °C) at sub-optimal than supra-optimal temperatures (R2 = 0.41 at 40 °C). Antioxidant enzymes, including peroxidase (POD), catalase (CAT), superoxide dismutase (SOD), ascorbate peroxidase (APX), and glutathione peroxidase (GPX), increased with decreasing Ψs. In contrast, CAT and POD were higher at 20 °C and 40 °C but declined at 25, 30, and 35 °C. The APX and GPX remained unchanged at 20, 25, 30, and 40 °C but declined at 35 °C. Thus, maintaining enzymatic activity is a protective mechanism against oxidative stress. A decline in germination characteristics may result from energy diverting to anti-stress tools (antioxidant enzymes) necessary for eliminating reactive oxygen species (ROS) to reduce salinity-induced oxidative damage. The parameters examined in this study are easily applicable to simulation models of Z. mays L. germination under extreme environmental conditions characterized by water deficits and temperature fluctuations.

HTT
Also flagged:sex chromosomesneurodevelopmental disordersADHDschizophreniaautismGene expression
Journal Article 2023-09-07 ✓ 1 Snippet Szakats S, McAtamney A, Cross H, Wilson MJ.
In-Text Gene Mentions

…Huntington gene (Htt) has pleiotropic…

Show Full Abstract

<h4>Background</h4>Sex differences pose a challenge and an opportunity in biomedical research. Understanding how sex chromosomes and hormones affect disease-causing mechanisms will shed light on the mechanisms underlying predominantly idiopathic sex-biased neurodevelopmental disorders such as ADHD, schizophrenia, and autism. Gene expression is a crucial conduit for the influence of sex on developmental processes; therefore, this study focused on sex differences in gene expression and the regulation of gene expression. The increasing interest in microRNAs (miRNAs), small, non-coding RNAs, for their contribution to normal and pathological neurodevelopment prompted us to test how miRNA expression differs between the sexes in the developing brain.<h4>Methods</h4>High-throughput sequencing approaches were used to identify transcripts, including miRNAs, that showed significantly different expression between male and female brains on day 15.5 of development (E15.5).<h4>Results</h4>Robust sex differences were identified for some genes and miRNAs, confirming the influence of biological sex on RNA. Many miRNAs that exhibit the greatest differences between males and females have established roles in neurodevelopment, implying that sex-biased expression may drive sex differences in developmental processes. In addition to highlighting sex differences for individual miRNAs, gene ontology analysis suggested several broad categories in which sex-biased RNAs might act to establish sex differences in the embryonic mouse brain. Finally, mining publicly available SNP data indicated that some sex-biased miRNAs reside near the genomic regions associated with neurodevelopmental disorders.<h4>Conclusions</h4>Together, these findings reinforce the importance of cataloguing sex differences in molecular biology research and highlight genes, miRNAs, and pathways of interest that may be important for sexual differentiation in the mouse and possibly the human brain.

Also flagged:chromatinBPgene expressionhypertensionSLC39A8ADRB2
Journal Article 2023-09-07 No Snippets van Duijvenboden S, Ramírez J, Young WJ, Olczak KJ, Ahmed F, Alhammadi MJAY, International Consortium of Blood Pressure, Bell CG, Morris AP, Munroe PB.
Show Full Abstract

Genome-wide association studies of blood pressure (BP) have identified >1,000 loci, but the effector genes and biological pathways at these loci are mostly unknown. Using published association summary statistics, we conducted annotation-informed fine-mapping incorporating tissue-specific chromatin segmentation and colocalization to identify causal variants and candidate effector genes for systolic BP, diastolic BP, and pulse pressure. We observed 532 distinct signals associated with ≥2 BP traits and 84 with all three. For >20% of signals, a single variant accounted for >75% posterior probability, 65 were missense variants in known (SLC39A8, ADRB2, and DBH) and previously unreported BP candidate genes (NRIP1 and MMP14). In disease-relevant tissues, we colocalized >80 and >400 distinct signals for each BP trait with cis-eQTLs and regulatory regions from promoter capture Hi-C, respectively. Integrating mouse, human disorder, gene expression and tissue abundance data, and literature review, we provide consolidated evidence for 436 BP candidate genes for future functional validation and discover several potential drug targets.

SUDS3
Also flagged:lipidchronic liver diseaseethanolalcoholic fatty livernucleussteatosis
Journal Article 2023-09-07 ✓ 1 Snippet Luo J, Ji Y, Chen N, Song G, Zhou S, Niu X, Yu D.
In-Text Gene Mentions

…factors such aschromatin modifiersmodifiers or RNAP…

Show Full Abstract

Alcohol-associated liver disease is a prevalent chronic liver disease caused by excessive ethanol consumption. This study aims to investigate the role of miR-150 in regulating hepatic lipid homeostasis in alcoholic fatty liver (AFL). miR-150 was mainly distributed in the nucleus of hepatocytes and correlated with the degree of liver injury. The decreased expression of miR-150 observed in AFL was a compensatory response to ethanol-induced hepatic steatosis. Overexpression of miR-150 facilitated hepatic lipid accumulation <i>in cellulo</i> and exacerbated ethanol-induced liver steatosis <i>in vivo</i>. <i>In silico</i> analysis identified perilipin-2 (<i>PLIN2</i>) as a potential target gene of miR-150. miR-150 activated <i>PLIN2</i> transcription by directly binding the RNA transcripts overlapping <i>PLIN2</i> promoter and facilitating the recruitment of DNA helicase DHX9 and RNA polymeraseⅡ. Overall, our study provides fresh insights into the homeostasis regulation of hepatic steatosis induced by ethanol and identifies miR-150 as a pro-steatosis effector driving transcriptional <i>PLIN2</i> gene activation.

Also flagged:Germinationwaterseed germinationcatalaseCATguaiacol peroxidase
Journal Article 2023-09-07 No Snippets Haq IU, Ullah S, Amin F, Nafees M, Shah W, Ali B, Iqbal R, Kaplan A, Ali MA, Elshikh MS, Ercisli S.
Show Full Abstract

Climatic changes have a direct negative impact on the growth, development, and productivity of crops. The water potential (ψ) and temperature (<i>T</i>) are important limiting factors that influence the rate of seed germination and growth indices. To examine how the germination of seed responds to changes in water potential and temperature, the hydrotime model and hydrothermal model (HTT) have been employed. The HTT calculates the concept of germination time across temperatures, between <i>T</i><sub>b</sub>-<i>T</i><sub>o</sub>, with alteration, and between <i>T</i><sub>b</sub>-<i>T</i><sub>c</sub>, in supra-optimal ranges. The seeds of <i>Cucumis melo</i> L. were germinated in the laboratory for a hydro-thermal time experiment. Seeds were sown in Petri dishes containing a double-layered filter paper at different osmotic potentials (0, -0.2, -0.4, -0.6, and -0.8 MPa) by providing PEG 6000 (drought stress enhancer) at different temperatures (15, 20, 25, 30, and 35 °C). The controlled replicate was treated with 10 mL of distilled water and the rest with 10 mL of PEG solution. Results indicated that the seed vigor index (SVI-II) was highest at 15 °C with 0 MPa and lowest at 30 °C with -0.2 MPa. However, the highest activity was shown at 15 °C by catalase (CAT) and guaiacol peroxidase (GPX) at (-0.6 MPa), while the lowest values of CAT and GPX were recorded for control at 35 °C with -0.8 MPa at 35 °C, respectively. Germination energy was positively correlated with germination index (GI), germination percentage (<i>G</i>%), germination rate index, seed vigor index-I (SVI-I), mean moisture content (MMC), and root shoot ratio (RSR) and had a negative correlation with mean germination rate, percent moisture content of shoot and root, CAT, superoxide dismutase, peroxidase ascorbate peroxidase, and GPX. In conclusion, thermal and hydrotime models correctly predicted muskmelon germination time in response to varying water potential and temperature. The agronomic attributes were found to be maximum at 30 °C and minimum at 15 °C.

CCPG1
Also flagged:necroptosispolycystic ovary syndromereproductive disorderendocrine disordersPCOSIL33
Journal Article 2023-09-07 ✓ 2 Snippets Wang M, An K, Huang J, Mprah R, Ding H.
In-Text Gene Mentions

It has been shown that the reticulophagy receptor CCPG1 mediated STAT1/STAT3-(p) RIPK1-(p) RIPK3-(p) MLKL pathway could trigger the necroptosis of GCs and be involved in the development of PCOS (12, 20).

…the reticulophagy receptorCCPG1mediated STAT1/STAT3-(p) RIPK1…

Show Full Abstract

<h4>Background</h4>Polycystic ovary syndrome (PCOS), a common endocrine and reproductive disorder, lacks precise diagnostic strategies. Necroptosis was found to be crucial in reproductive and endocrine disorders, but its function in PCOS remains unclear. We aimed to identify differentially diagnostic genes for necroptosis (NDDGs), construct a diagnostic model to assess the progression of PCOS and explore the potential therapeutic drugs.<h4>Methods</h4>Gene expression datasets were combined with weighted gene co-expression network analysis (WGCNA) and necroptosis gene sets to screen the differentially expressed genes for PCOS. Least absolute shrinkage and selection operator (LASSO) regression analysis was used to construct a necroptosis-related gene signatures. Independent risk analyses were performed using nomograms. Pathway enrichment of NDDGs was conducted with the GeneMANIA database and gene set enrichment analysis (GSEA). Immune microenvironment analysis was estimated based on ssGSEA algorithm analysis. The Comparative Toxicogenomics Database (CTD) was used to explore potential therapeutic drugs for NDDGs. The expression of NDDGs was validated in GSE84958, mouse model and clinical samples.<h4>Results</h4>Four necroptosis-related signature genes, IL33, TNFSF10, BCL2 and PYGM, were identified to define necroptosis for PCOS. The areas under curve (AUC) of receiver operating characteristic curve (ROC) for training set and validation in diagnostic risk model were 0.940 and 0.788, respectively. Enrichment analysis showed that NDDGs were enriched in immune-related signaling pathways such as B cells, T cells, and natural killer cells. Immune microenvironment analysis revealed that NDDGs were significantly correlated with 13 markedly different immune cells. A nomogram was constructed based on features that would benefit patients clinically. Several compounds, such as resveratrol, tretinoin, quercetin, curcumin, etc., were mined as therapeutic drugs for PCOS. The expression of the NDDGs in the validated set, animal model and clinical samples was consistent with the results of the training sets.<h4>Conclusion</h4>In this study, 4 NDDGs were identified to be highly effective in assessing the progression and prognosis of PCOS and exploring potential targets for PCOS treatment.

Also flagged:MitochondriaBrain Diseaseenergy homeostasispathogenesisbrain diseasesneurodegenerative disorders
Journal Article 2023-09-07 No Snippets Clemente-Suárez VJ, Redondo-Flórez L, Beltrán-Velasco AI, Ramos-Campo DJ, Belinchón-deMiguel P, Martinez-Guardado I, Dalamitros AA, Yáñez-Sepúlveda R, Martín-Rodríguez A, Tornero-Aguilera JF.
Show Full Abstract

Mitochondria play a vital role in maintaining cellular energy homeostasis, regulating apoptosis, and controlling redox signaling. Dysfunction of mitochondria has been implicated in the pathogenesis of various brain diseases, including neurodegenerative disorders, stroke, and psychiatric illnesses. This review paper provides a comprehensive overview of the intricate relationship between mitochondria and brain disease, focusing on the underlying pathological mechanisms and exploring potential therapeutic opportunities. The review covers key topics such as mitochondrial DNA mutations, impaired oxidative phosphorylation, mitochondrial dynamics, calcium dysregulation, and reactive oxygen species generation in the context of brain disease. Additionally, it discusses emerging strategies targeting mitochondrial dysfunction, including mitochondrial protective agents, metabolic modulators, and gene therapy approaches. By critically analysing the existing literature and recent advancements, this review aims to enhance our understanding of the multifaceted role of mitochondria in brain disease and shed light on novel therapeutic interventions.

HTT
Also flagged:Autophagyheat shock factor 1HSF1macroautophagychaperonemicroautophagy
Journal Article 2023-09-07 ✓ 1 Snippet Watanabe Y, Taguchi K, Tanaka M.
In-Text Gene Mentions

In addition, CMA is also reported to degrade TDP-43 and huntingtin (Htt), which are linked to amyotrophic lateral sclerosis (ALS) and Huntington’s disease (HD), respectively [35,36].

Show Full Abstract

The heat shock factor 1 (HSF1)-mediated stress response pathway and autophagy processes play important roles in the maintenance of proteostasis. Autophagy processes are subdivided into three subtypes: macroautophagy, chaperone-mediated autophagy (CMA), and microautophagy. Recently, molecular chaperones and co-factors were shown to be involved in the selective degradation of substrates by these three autophagy processes. This evidence suggests that autophagy processes are regulated in a coordinated manner by the HSF1-mediated stress response pathway. Recently, various studies have demonstrated that proteostasis pathways including HSF1 and autophagy are implicated in longevity. Furthermore, they serve as therapeutic targets for aging-related diseases such as cancer and neurodegenerative diseases. In the future, these studies will underpin the development of therapies against various diseases.

SERPINC1PTGIS
Also flagged:Venous ThromboembolismhemostasisIL1ATHBS1VWFFGB
Journal Article 2023-09-07 ✓ 3 Snippets Lunghi B, Ziliotto N, Balestra D, Rossi L, Della Valle P, Pignatelli P, Pinotti M, D'Angelo A, Marchetti G, Bernardi F.
In-Text Gene Mentions

Concerning variants causing synonymous changes (Table 2), the PTGIS rs61322884 influences mRNA level (eQTL) of SLC9A8, which encodes a Golgi sodium–hydrogen exchanger and has been associated with chronic inflammatory [44] and coronary artery [45] diseases, in turn potentially related to VTE mechanisms.

…coagulation inhibitor genes (SERPINC1, PROS, PROC).…

…2 ), thePTGISrs61322884 influences mRNA…

Show Full Abstract

Whole-exome sequencing (WES) in families with an unexplained tendency for venous thromboembolism (VTE) may favor detection of low-frequency variants in genes with known contribution to hemostasis or associated with VTE-related phenotypes. WES analysis in six family members, three of whom affected by documented VTE, filtered for MAF < 0.04 in 192 candidate genes, revealed 22 heterozygous (16 missense and six synonymous) variants in patients. Functional prediction by multi-component bioinformatics tools, implemented by a database/literature search, including ClinVar annotation and QTL analysis, prioritized 12 missense variants, three of which (<i>CRP</i> Leu61Pro, <i>F2</i> Asn514Lys and <i>NQO1</i> Arg139Trp) were present in all patients, and the frequent functional variants <i>FGB</i> Arg478Lys and <i>IL1A</i> Ala114Ser. Combinations of prioritized variants in each patient were used to infer functional protein interactions. Different interaction patterns, supported by high-quality evidence, included eight proteins intertwined in the "acute phase" (CRP, F2, SERPINA1 and IL1A) and/or in the "fibrinogen complex" (CRP, F2, PLAT, THBS1, VWF and FGB) significantly enriched terms. In a wide group of candidate genes, this approach highlighted six low-frequency variants (<i>CRP</i> Leu61Pro, <i>F2</i> Asn514Lys, <i>SERPINA1</i> Arg63Cys, <i>THBS1</i> Asp901Glu, <i>VWF</i> Arg1399His and <i>PLAT</i> Arg164Trp), five of which were top ranked for predicted deleteriousness, which in different combinations may contribute to disease susceptibility in members of this family.

STAU1
Also flagged:TDP-43transactive response (TAR) DNA-binding protein 43neurodegenerative diseasescytoplasmpost-translational modificationsphosphorylation
Journal Article 2023-09-07 ✓ 1 Snippet Gimenez J, Spalloni A, Cappelli S, Ciaiola F, Orlando V, Buratti E, Longone P.
In-Text Gene Mentions

RNA-IP and RNA pull-down assays in human neuroblastoma SH-SY5Y and embryonic kidney HEK293T cells demonstrated that TDP-43, in complex with FMRP (fragile X mental retardation protein) and STAU1 (Staufen) proteins, specifically binds to the 3′-UTR of SIRT1 mRNA and positively regulates its stability and hence its protein production [102] (Figure 2D).

Show Full Abstract

Since its initial involvement in numerous neurodegenerative pathologies in 2006, either as a principal actor or as a cofactor, new pathologies implicating transactive response (TAR) DNA-binding protein 43 (TDP-43) are regularly emerging also beyond the neuronal system. This reflects the fact that TDP-43 functions are particularly complex and broad in a great variety of human cells. In neurodegenerative diseases, this protein is often pathologically delocalized to the cytoplasm, where it irreversibly aggregates and is subjected to various post-translational modifications such as phosphorylation, polyubiquitination, and cleavage. Until a few years ago, the research emphasis has been focused particularly on the impacts of this aggregation and/or on its widely described role in complex RNA splicing, whether related to loss- or gain-of-function mechanisms. Interestingly, recent studies have strengthened the knowledge of TDP-43 activity at the chromatin level and its implication in the regulation of DNA transcription and stability. These discoveries have highlighted new features regarding its own transcriptional regulation and suggested additional mechanistic and disease models for the effects of TPD-43. In this review, we aim to give a comprehensive view of the potential epigenetic (de)regulations driven by (and driving) this multitask DNA/RNA-binding protein.

Also flagged:iminealdehydesaminesconjugationamino acidpeptides
Journal Article 2023-09-07 No Snippets Esteve F, Rahmatova F, Lehn JM.
Show Full Abstract

Imine formation under physiological conditions represents a challenging reaction due to the strong propensity of aldimines to be hydrolyzed. Herein we disclose the remarkable effect of supramolecular multivalency on increasing imine stability. A family of reactive aldehydes was synthesized bearing supramolecularly-active sites within their structure. The imine formation activity for such aldehydes was evaluated and compared with model aldehydes. The reaction of the best-performing species - containing two carboxylate groups-with a set of amines showed a significant decrease in imine yields as the degree of supramolecular multivalency between sidechains decreased. The reversible conjugation of amino acid derivatives and small peptides was also assayed, with excellent selectivities for the imine formation at the Nα position even in substrates containing competing sites. Preliminary results on protein bioconjugation revealed that a model enzyme could be dynamically inhibited upon reaction with the aldehyde, with its native activity being recovered by displacing the imine bonds with a suitable chemical effector (<i>i.e.</i>, acylhydrazide).

Also flagged:Synthesispyridinespyridinesteroidmonocyclic dihydropyridinestetrahydropyridines
Journal Article 2023-09-07 No Snippets Hammouda MM, Elattar KM, Rashed MM, Osman AMA.
Show Full Abstract

Steroidal pyridines are a class of compounds that have been the subject of extensive research in recent years due to their potential biological activities. The introduction of a pyridine ring into the steroid skeleton can significantly alter the chemical and biological properties of the compound, making it more potent and/or selective for a particular target. Different synthetic methods have been developed for the preparation of steroidal pyridines. This review provides an overview of the synthesis, biological activities, and future perspectives of steroidal monocyclic dihydropyridines, tetrahydropyridines, and pyridines from 2005 to the present. The different synthetic methods that have been developed for the preparation of these steroids are discussed, as well as the proposed mechanisms and the biological activities that have been reported. Finally, the potential of steroidal monocyclic pyridines for the development of new drugs is discussed. This review is intended to provide a comprehensive overview of the field of steroidal monocyclic pyridines for researchers and scientists who are interested in this area of research. It is also hoped that this review will stimulate further research into the synthesis and biological activities of steroidal pyridines to develop new and improved drugs for the treatment of diseases.

Research Square 2023-09-07 Preprint (No Snippets API) Zhang F, Zhao Q, Liu J, Chu M, Huang J, Tang Y.
Show Full Abstract

<h4>Background: </h4> Gastric cancer (GC) is influenced by several risk factors such as smoking and high intake of cured foods. However, the effect of some molecules on incidence of GC have not been demonstrated. In this study, Single-Variable Mendelian Randomization (SVMR) and Multi-Variable Mendelian Randomization (MVMR) were utilized for estimating the causal association between calcium voltage-gated channel subunit alpha 1E (CACNA1E), C4b binding protein alpha (C4BPA) and GC. <h4>Methods: </h4>: The Genome-Wide Association Study (GWAS) ids for GC and exposure factors were derived from Integrative Epidemiology Unit (IEU) Open GWAS database. Including 6563 GC samples and 195,745 control samples, and there were 8,885,324 Single Nucleotide Polymorphisms (SNPs) for GC. The sample size for CACNA1E was 31,684, and the number of SNPs was 18,413. The sample size for C4BPA was 14,263, and the number of SNPs was 15,879. The SVMR studies were conducted to estimate the risk of CACNA1E and C4BPA in GC using MR Egger, weighted median, inverse variance weighted (IVW), simple mode and weighted mode. Importantly, IVW was the most major method. In addition, sensitivity analysis was conducted to assess the reliability of MR results, which mainly consisted of the heterogeneity, horizontal pleiotropy and Leave-One-Out (LOO). Finally, the MVMR analysis was carried out. <h4>Results: </h4>: The SVMR indicated that CACNA1E and C4BPA are causally related to GC, with C4BPA (P=0.006, OR=1.032) as a risk factor and CACNA1E (P=0.005, OR=0.827) as a protective factor. The reliability of SVMR results was demonstrated by sensitivity analysis. The MVMR analysis was consistent with the outcome of SVMR, implicating C4BPA as a cause of GC, whereas CACNA1E is a protective factor against GC. <h4>Conclusion: </h4> A causal relationship between CACNA1E, C4BPA and GC was confirmed by our study, and increased C4BPA expression elevates the prevalence of GC and vice versa for CACNA1E.

bioRxiv 2023-09-07 Preprint (No Snippets API) Hoang TH, Vu DM, Vu GM, Nguyen TK, Do NM, Duong VC, Pham TL, Tran MH, Nguyen LTK, Han HTT, Can TT, Pham TH, Pham TD, Nguyen TH, Do HP, Vo NS, Nguyen X.
Show Full Abstract

<h4>Background</h4> Most skin-related traits have been studied from Caucasian genetic background. A comprehensive study on skin-associated genetic effects on under-represented populations like Vietnam is needed to fill the gaps in the field. <h4>Objectives</h4> To develop a computational pipeline to predict the effect of genetic factors on skin traits using public data (GWAS catalogs and whole genome sequencing (WGS) data of 1000 genomes project-1KGP) and in-house Vietnamese data (WGS and genotyping by SNP array). By using this information we may have a better understanding of the susceptibility of Vietnamese people. <h4>Methods</h4> Vietnamese cohorts of whole genome sequencing (WGS) of 1008 healthy individuals for the reference and 96 genotyping samples (which do not have any skin cutaneous issues) by Infinium Asian Screening Array-24 v1.0 BeadChip were employed to predict skin-associated genetic variants of 25 skin-related and micronutrients requirement traits in population analysis and correlation analysis. Simultaneously, we compared the landscape of cutaneous issues of Vietnamese people with other populations by assessing their genetic profiles. <h4>Results</h4> The skin-related genetic profile of Vietnamese cohorts is similar at most with East Asian (JPT: Fst=0.036, CHB: Fst=0.031, CHS: Fst=0.027, CDX: Fst=0.025) in the population study. In addition, we identified pairs of skin traits being at high risk of frequent co-occurrence (such as skin aging and wrinkles (r = 0.45, p =1.50e-5) or collagen degradation and moisturizing (r = 0.35, p = 1.1e-3). <h4>Conclusion</h4> This is the first investigation in Vietnam to explore genetic variants of facial skin. These findings could improve inadequate skin-related genetic diversity in the currently published database.

Preprints.org 2023-09-07 Preprint (No Snippets API) Baritaki S, Zaravinos A.
Show Full Abstract

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another&#039;s activity. They exhibit reciprocal control over each other&#039;s expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay&#039;s functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

HTT
Also flagged:Mitochondriaorganellessignal transductionmetabolismmitochondrialneurodegenerative disorders
Journal Article 2023-09-06 ✓ 1 Snippet Chen W, Zhao H, Li Y.
In-Text Gene Mentions

These abnormalities impact mitochondrial function, neuronal transport, and cell death, potentially accelerating the progression of HD.191 Another study found that increased mutant huntingtin (HTT)-Drp1 interaction alters Drp1 structural and functional properties, causing increased mitochondrial division and decreased ATP production, resulting in neuronal dysfunction.193

Show Full Abstract

Mitochondria are organelles that are able to adjust and respond to different stressors and metabolic needs within a cell, showcasing their plasticity and dynamic nature. These abilities allow them to effectively coordinate various cellular functions. Mitochondrial dynamics refers to the changing process of fission, fusion, mitophagy and transport, which is crucial for optimal function in signal transduction and metabolism. An imbalance in mitochondrial dynamics can disrupt mitochondrial function, leading to abnormal cellular fate, and a range of diseases, including neurodegenerative disorders, metabolic diseases, cardiovascular diseases and cancers. Herein, we review the mechanism of mitochondrial dynamics, and its impacts on cellular function. We also delve into the changes that occur in mitochondrial dynamics during health and disease, and offer novel perspectives on how to target the modulation of mitochondrial dynamics.

HTT
Also flagged:agingneurodegenerative diseaseRNA-binding proteinsamyotrophic lateral sclerosiscancerCRISPR
Journal Article 2023-09-06 ✓ 1 Snippet Gastelum S, Michael AF, Bolger TA.
In-Text Gene Mentions

HTT

Show Full Abstract

The budding yeast, Saccharomyces cerevisiae, has been used for decades as a powerful genetic tool to study a broad spectrum of biological topics. With its ease of use, economic utility, well-studied genome, and a highly conserved proteome across eukaryotes, it has become one of the most used model organisms. Due to these advantages, it has been used to study an array of complex human diseases. From broad, complex pathological conditions such as aging and neurodegenerative disease to newer uses such as SARS-CoV-2, yeast continues to offer new insights into how cellular processes are affected by disease and how affected pathways might be targeted in therapeutic settings. At the same time, the roles of RNA and RNA-based processes have become increasingly prominent in the pathology of many of these same human diseases, and yeast has been utilized to investigate these mechanisms, from aberrant RNA-binding proteins in amyotrophic lateral sclerosis to translation regulation in cancer. Here we review some of the important insights that yeast models have yielded into the molecular pathology of complex, RNA-based human diseases. This article is categorized under: RNA in Disease and Development > RNA in Disease.

Also flagged:oxygenlung injuryPaO 2acute respiratory distress syndromeARDSinjury
Journal Article 2023-09-06 No Snippets Cronin JN, Crockett DC, Perchiazzi G, Farmery AD, Camporota L, Camporota L, Formenti F.
Show Full Abstract

<h4>Background</h4>Within-breath oscillations in arterial oxygen tension (PaO<sub>2</sub>) can be detected using fast responding intra-arterial oxygen sensors in animal models. These PaO<sub>2</sub> signals, which rise in inspiration and fall in expiration, may represent cyclical recruitment/derecruitment and, therefore, a potential clinical monitor to allow titration of ventilator settings in lung injury. However, in hypovolaemia models, these oscillations have the potential to become inverted, such that they decline, rather than rise, in inspiration. This inversion suggests multiple aetiologies may underlie these oscillations. A correct interpretation of the various PaO<sub>2</sub> oscillation morphologies is essential to translate this signal into a monitoring tool for clinical practice. We present a pilot study to demonstrate the feasibility of a new analysis method to identify these morphologies.<h4>Methods</h4>Seven domestic pigs (average weight 31.1 kg) were studied under general anaesthesia with muscle relaxation and mechanical ventilation. Three underwent saline-lavage lung injury and four were uninjured. Variations in PEEP, tidal volume and presence/absence of lung injury were used to induce different morphologies of PaO<sub>2</sub> oscillation. Functional principal component analysis and k-means clustering were employed to separate PaO<sub>2</sub> oscillations into distinct morphologies, and the cardiorespiratory physiology associated with these PaO<sub>2</sub> morphologies was compared.<h4>Results</h4>PaO<sub>2</sub> oscillations from 73 ventilatory conditions were included. Five functional principal components were sufficient to explain ≥ 95% of the variance of the recorded PaO<sub>2</sub> signals. From these, five unique morphologies of PaO<sub>2</sub> oscillation were identified, ranging from those which increased in inspiration and decreased in expiration, through to those which decreased in inspiration and increased in expiration. This progression was associated with the estimates of the first functional principal component (P < 0.001, R<sup>2</sup> = 0.88). Intermediate morphologies demonstrated waveforms with two peaks and troughs per breath. The progression towards inverted oscillations was associated with increased pulse pressure variation (P = 0.03).<h4>Conclusions</h4>Functional principal component analysis and k-means clustering are appropriate to identify unique morphologies of PaO<sub>2</sub> waveform associated with distinct cardiorespiratory physiology. We demonstrated novel intermediate morphologies of PaO<sub>2</sub> waveform, which may represent a development of zone 2 physiologies within the lung. Future studies of PaO<sub>2</sub> oscillations and modelling should aim to understand the aetiologies of these morphologies.

DDX27
Also flagged:Osteosarcomabone tumortumorgene expressioncancersNAT10
Journal Article 2023-09-06 ✓ 1 Snippet Gao M, Liu W, Li T, Song Z, Wang X, Zhang X.
In-Text Gene Mentions

…ORS gene markers (NAT10/DDX27/ZNF48/C8ORF33/MOCS3/MPP6), we…

Show Full Abstract

Osteosarcoma is the most common type of primary malignant bone tumor. Due to the lack of selectivity and sensitivity of chemotherapy drugs to tumor cells, coupled with the use of large doses, chemotherapy drugs often have systemic toxicity. The use of modern sequencing technology to screen tumor markers in a large number of tumor samples is a common method for screening highly specific and selective anti-tumor drugs. This study aims to identify potential biomarkers using the latest reported gene expression signatures of oncogene-induced replication stress (ORS) in aggressive cancers, and potential anti-osteosarcoma drugs were screened in different drug databases. In this study, we obtained 89 osteosarcoma-related samples in the TARGET database, all of which included survival information. According to the median expression of each of six reported ORS gene markers (NAT10/DDX27/ZNF48/C8ORF33/MOCS3/MPP6), we divided 89 osteosarcoma gene expression datasets into a high expression group and a low expression group and then performed a differentially expressed gene (DEG) analysis. The coexisting genes of 6 groups of DEGs were used as replication stress-related genes (RSGs) of osteosarcoma. Then, key RSGs were screened using LASSO regression, a Cox risk proportional regression prognostic model and a tenfold cross-validation test. GSE21257 datasets collected from the Gene Expression Omnibus (GEO) database were used to verify the prognostic model. The final key RSGs selected were used in the L1000PWD and DGIdb databases to mine potential drugs. After further validation by the prognostic model, we identified seven genes associated with ORS in osteosarcoma as key RSGs, including transcription factor 7 like 2 (TCF7L2), solute carrier family 27 member 4 (SLC27A4), proprotein convertase subtilisin/kexin type 5 (PCSK5), nucleolar protein 6 (NOL6), coiled-coil-coil-coil-coil-helix domain containing 4 (CHCHD4), eukaryotic translation initiation factor 3 subunit B (EIF3B), and synthesis of cytochrome C oxidase 1 (SCO1). Then, we screened the seven key RSGs in two drug databases and found six potential anti-osteosarcoma drugs (D GIdb database: repaglinide, tacrolimus, sirolimus, cyclosporine, and hydrochlorothiazide; L1000PWD database: the small molecule VU-0365117-1). Seven RSGs (TCF7L2, SLC27A4, PCSK5, NOL6, CHCHD4, EIF3B, and SCO1) may be associated with the ORS gene signatures in osteosarcoma. Repaglinide, tacrolimus, sirolimus, cyclosporine, hydrochlorothiazide and the small molecule VU-0365117-1 are potential therapeutic drugs for osteosarcoma.

Also flagged:Childhood obesitymetabolic syndromeobesityinsulindyslipidemiahyperglycemia
Journal Article 2023-09-06 No Snippets González-Domínguez Á, Belmonte T, González-Domínguez R.
Show Full Abstract

The incidence of childhood obesity and metabolic syndrome has grown notably in the last years, becoming major public health burdens in developed countries. Nowadays, oxidative stress is well-recognized to be closely associated with the onset and progression of several obesity-related complications within the framework of a complex crosstalk involving other intertwined pathogenic events, such as inflammation, insulin disturbances, and dyslipidemia. Thus, understanding the molecular basis behind these oxidative dysregulations could provide new approaches for the diagnosis, prevention, and treatment of childhood obesity and associated disorders. In this respect, the transcriptomic characterization of miRNAs bares great potential because of their involvement in post-transcriptional modulation of genetic expression. Herein, we provide a comprehensive literature revision gathering state-of-the-art research into the association between childhood obesity, metabolic syndrome, and miRNAs. We put special emphasis on the potential role of miRNAs in modulating obesity-related pathogenic events, with particular focus on oxidative stress.

STAU1
Also flagged:developmental colour agnosiaColour agnosiachromosomal regionsCACNA2D4DDX25GRINA
Journal Article 2023-09-06 ✓ 5 Snippets Nijboer TCW, Hessel EVS, van Haaften GW, van Zandvoort MJ, van der Spek PJ, Troelstra C, de Kovel CGF, Koeleman BPC, van der Zwaag B, Brilstra EH, Burbach JPH.
In-Text Gene Mentions

…( MAML2 ,STAU1, TMED3 ,…

…MYO15A (myosin XVA),STAU1(staufen double-stranded RNA…

…, TMED3 ,STAU1) were predicted…

…, TMED3 ,STAU1).…

…Grina andStau1displayed wide, but…

Show Full Abstract

Colour agnosia is a disorder that impairs colour knowledge (naming, recognition) despite intact colour perception. Previously, we have identified the first and only-known family with hereditary developmental colour agnosia. The aim of the current study was to explore genomic regions and candidate genes that potentially cause this trait in this family. For three family members with developmental colour agnosia and three unaffected family members CGH-array analysis and exome sequencing was performed, and linkage analysis was carried out using DominantMapper, resulting in the identification of 19 cosegregating chromosomal regions. Whole exome sequencing resulted in 11 rare coding variants present in all affected family members with developmental colour agnosia and absent in unaffected members. These variants affected genes that have been implicated in neural processes and functions (CACNA2D4, DDX25, GRINA, MYO15A) or that have an indirect link to brain function, development or disease (MAML2, STAU1, TMED3, RABEPK), and a remaining group lacking brain expression or involved in non-neural traits (DEPDC7, OR1J1, OR8D4). Although this is an explorative study, the small set of candidate genes that could serve as a starting point for unravelling mechanisms of higher level cognitive functions and cortical specialization, and disorders therein such as developmental colour agnosia.

OLFM4
Also flagged:ischemiaI/RLgr5Gprc5acell proliferationacute intestinal ischemia
Journal Article 2023-09-06 ✓ 1 Snippet Zhang W, Zhou B, Yang X, Zhao J, Hu J, Ding Y, Zhan S, Yang Y, Chen J, Chen J, Zhang F, Zhao B, Deng F, Lin Z, Sun Q, Zhang F, Yao Z, Liu W, Li C, Liu KX.
In-Text Gene Mentions

…I/R-induced reduction inOlfm4(another ISC marker)…

Show Full Abstract

Intestinal ischemia/reperfusion (I/R) injury is a severe clinical condition without optimal diagnostic markers nor clear molecular etiological insights. Plasma exosomal circular RNAs (circRNAs) are valuable biomarkers and therapeutic targets for various diseases, but their role in intestinal I/R injury remains unknown. Here we screen the expression profile of circRNAs in intestinal tissue exosomes collected from intestinal I/R mice and identify circEZH2_005 as a significantly downregulated exosomal circRNA. In parallel, circEZH2_005 is also reduced in the plasma of clinical cardiac surgery patients who developed postoperative intestinal I/R injury. Exosomal circEZH2_005 displays a significant diagnostic value for intestinal injury induced by I/R. Mechanistically, circEZH2_005 is highly expressed in intestinal crypt cells. CircEZH2_005 upregulation promotes the proliferation of Lgr5+ stem cells by direct interaction with hnRNPA1, and enhanced Gprc5a stability, thereby alleviating I/R-induced intestinal mucosal damage. Hence, exosomal circEZH2_005 may serve as a biomarker for intestinal I/R injury and targeting the circEZH2_005/hnRNPA1/Gprc5a axis may be a potential therapeutic strategy for intestinal I/R injury.

Also flagged:amelogeninpeptidesricketsPeptidestrontiumoxygen
Journal Article 2023-09-06 No Snippets Olszewski J, Hall RA, Kootker LM, Oldham NJ, Layfield R, Shaw B, Derksen L, Manders M, Hart T, Schrader SA.
Show Full Abstract

Skeletal remains discovered in Simon's Town, South Africa, were hypothesised as being associated with a former Dutch East India Company (VOC) hospital. We report a novel combined osteological and biochemical approach to these poorly-preserved remains. A combined strontium (<sup>87</sup>Sr/<sup>86</sup>Sr), oxygen (δ<sup>18</sup>O<sub>VPDB</sub>) and carbon (δ<sup>13</sup>C<sub>VPDB</sub>) isotope analysis informed possible childhood origins and diet, while sex-specific amelogenin enamel peptides revealed biological sex. Osteological analyses presented evidence of residual rickets, a healed trauma, dental pathological conditions, and pipe notches. The combined isotope analyses yielded results for 43 individuals which suggested a diverse range of geological origins, including at least 16% of the population being non-local. The inclusion of δ<sup>13</sup>C<sub>VPDB</sub> had intriguing implications for three individuals who likely did not have origins in the Cape Town region nor in Europe. Peptide analysis on the dental enamel of 25 tested individuals confirmed they were all biologically male. We suggest that isolated enamel may provide crucial information about individuals' pathological conditions, geographical origins, diet, and biological sex. These data further demonstrated that a combined approach using multiple osteological and biochemical methods is advantageous for human remains which are poorly preserved and can contextualise a site with little direct evidence.

Also flagged:CAR virus receptorMyelodysplastic syndromesmyeloid neoplasmsanemiapathogenesisCoxsackie-Adenovirus receptor
Journal Article 2023-09-06 No Snippets Bauer K, Machherndl-Spandl S, Kazianka L, Sadovnik I, Gültekin S, Suessner S, Proell J, Lauf J, Hoermann G, Eisenwort G, Häfner N, Födermayr-Mayrleitner M, Schmolke AS, van der Kouwe E, Platzbecker U, Lion T, Weltermann A, Zach O, Webersinke G, Germing U, Gabriel C, Sperr WR, Béné MC, Staber PB, Bettelheim P, Valent P.
Show Full Abstract

Myelodysplastic syndromes (MDS) are myeloid neoplasms presenting with dysplasia in the bone marrow (BM) and peripheral cytopenia. In most patients anemia develops. We screened for genes that are expressed abnormally in erythroid progenitor cells (EP) and contribute to the pathogenesis of MDS. We found that the Coxsackie-Adenovirus receptor (CAR = CXADR) is markedly downregulated in CD45<sup>low</sup>/CD105<sup>+</sup> EP in MDS patients compared to control EP. Correspondingly, the erythroblast cell lines HEL, K562, and KU812 stained negative for CAR. Lentiviral transduction of the full-length CXADR gene into these cells resulted in an increased expression of early erythroid antigens, including CD36, CD71, and glycophorin A. In addition, CXADR-transduction resulted in an increased migration against a serum protein gradient, whereas truncated CXADR variants did not induce expression of erythroid antigens or migration. Furthermore, conditional knock-out of Cxadr in C57BL/6 mice resulted in anemia and erythroid dysplasia. Finally, decreased CAR expression on EP was found to correlate with high-risk MDS and decreased survival. Together, CAR is a functionally relevant marker that is down-regulated on EP in MDS and is of prognostic significance. Decreased CAR expression may contribute to the maturation defect and altered migration of EP and thus their pathologic accumulation in the BM in MDS.

LRRC7
Also flagged:opioid use disorderopioidopioid addictionnucleuscognitioncircadian rhythms
Journal Article 2023-09-06 ✓ 1 Snippet Puig S, Xue X, Salisbury R, Shelton MA, Kim SM, Hildebrand MA, Glausier JR, Freyberg Z, Tseng GC, Yocum AK, Lewis DA, Seney ML, MacDonald ML, Logan RW.
In-Text Gene Mentions

…hubs SYNGR3 andLRRC7; Fig. 6a ).…

Show Full Abstract

Opioid craving and relapse vulnerability is associated with severe and persistent sleep and circadian rhythm disruptions. Understanding the neurobiological underpinnings of circadian rhythms and opioid use disorder (OUD) may prove valuable for developing new treatments for opioid addiction. Previous work indicated molecular rhythm disruptions in the human brain associated with OUD, highlighting synaptic alterations in the dorsolateral prefrontal cortex (DLPFC) and nucleus accumbens (NAc)-key brain regions involved in cognition and reward, and heavily implicated in the pathophysiology of OUD. To provide further insights into the synaptic alterations in OUD, we used mass-spectrometry based proteomics to deeply profile protein expression alterations in bulk tissue and synaptosome preparations from DLPFC and NAc of unaffected and OUD subjects. We identified 55 differentially expressed (DE) proteins in DLPFC homogenates, and 44 DE proteins in NAc homogenates, between unaffected and OUD subjects. In synaptosomes, we identified 161 and 56 DE proteins in DLPFC and NAc, respectively, of OUD subjects. By comparing homogenate and synaptosome protein expression, we identified proteins enriched specifically in synapses that were significantly altered in both DLPFC and NAc of OUD subjects. Across brain regions, synaptic protein alterations in OUD subjects were primarily identified in glutamate, GABA, and circadian rhythm signaling. Using time-of-death (TOD) analyses, where the TOD of each subject is used as a time-point across a 24-h cycle, we were able to map circadian-related changes associated with OUD in synaptic proteomes associated with vesicle-mediated transport and membrane trafficking in the NAc and platelet-derived growth factor receptor beta signaling in DLPFC. Collectively, our findings lend further support for molecular rhythm disruptions in synaptic signaling in the human brain as a key factor in opioid addiction.

BTN2A1
Also flagged:Cas9BTN3A1BTN3A2extracellulartransmembranezinc
Journal Article 2023-09-06 ✓ 5 Snippets Yuan L, Ma X, Yang Y, Qu Y, Li X, Zhu X, Ma W, Duan J, Xue J, Yang H, Huang JW, Yi S, Zhang M, Cai N, Zhang L, Ding Q, Lai K, Liu C, Zhang L, Liu X, Yao Y, Zhou S, Li X, Shen P, Chang Q, Malwal SR, He Y, Li W, Chen C, Chen CC, Oldfield E, Guo RT, Zhang Y.
In-Text Gene Mentions

Notably, a double mutant (BTN2A1(R449A/R469A)) reduced the extent of BTN2A1 dimer formation (Extended Data Fig. 3f), hindered the BTN3A1–BTN2A1 association (Extended Data Fig. 3g) and blocked zoledronate-mediated γδ T cell activation (Fig. 3d and Extended Data Fig. 3e).

To disrupt the propagation of the pAg sensing signal, we introduced specific mutations (L279G, L294G, L297G, L314G, L318G and L325G) that reduce the rigidity of BTN2A1’s JM domain, resulting in a significant reduction in the γδ T cell response to zoledronate (Extended Data Fig. 7b–d).

Consistent with a previous report22, we found that BTN2A1 is required for zoledronate-induced γδ T cell activation (Extended Data Fig. 3a).

Selectively blocking BTN3A1’s binding to BTN2A1 may enable selective inhibition of aberrant Vγ9Vδ2 T cell activation in autoimmune diseases.

Disrupting the BTN3A1–BTN2A1 B30.2 association could potentially inhibit the activation of Vγ9Vδ2 T cells by natural pAgs, which would have implications for treatments of autoimmune diseases associated with γδ T cells.

Show Full Abstract

In both cancer and infections, diseased cells are presented to human Vγ9Vδ2 T cells through an 'inside out' signalling process whereby structurally diverse phosphoantigen (pAg) molecules are sensed by the intracellular domain of butyrophilin BTN3A1<sup>1-4</sup>. Here we show how-in both humans and alpaca-multiple pAgs function as 'molecular glues' to promote heteromeric association between the intracellular domains of BTN3A1 and the structurally similar butyrophilin BTN2A1. X-ray crystallography studies visualized that engagement of BTN3A1 with pAgs forms a composite interface for direct binding to BTN2A1, with various pAg molecules each positioned at the centre of the interface and gluing the butyrophilins with distinct affinities. Our structural insights guided mutagenesis experiments that led to disruption of the intracellular BTN3A1-BTN2A1 association, abolishing pAg-mediated Vγ9Vδ2 T cell activation. Analyses using structure-based molecular-dynamics simulations, <sup>19</sup>F-NMR investigations, chimeric receptor engineering and direct measurement of intercellular binding force revealed how pAg-mediated BTN2A1 association drives BTN3A1 intracellular fluctuations outwards in a thermodynamically favourable manner, thereby enabling BTN3A1 to push off from the BTN2A1 ectodomain to initiate T cell receptor-mediated γδ T cell activation. Practically, we harnessed the molecular-glue model for immunotherapeutics design, demonstrating chemical principles for developing both small-molecule activators and inhibitors of human γδ T cell function.

HFE
Also flagged:Hepatocellular Carcinomachronic hepatitis C and B viral infectionscancerviral hepatitisNAFLDalcohol-related disease
Journal Article 2023-09-06 ✓ 1 Snippet Pinheiro PS, Jones PD, Medina H, Cranford HM, Koru-Sengul T, Bungum T, Wong R, Kobetz EN, McGlynn KA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>The main causes of hepatocellular carcinoma (HCC) include chronic hepatitis C and B viral infections (HCV, HBV), nonalcoholic fatty liver disease (NAFLD), and alcohol-related disease (ALD). Etiology-specific HCC incidence rates and temporal trends on a population-basis are needed to improve HCC control and prevention.<h4>Methods</h4>All 14,420 HCC cases from the Florida statewide cancer registry were individually linked to data from the hospital discharge agency and the viral hepatitis department to determine the predominant etiology of each case diagnosed during 2010 to 2018. Age-adjusted incidence rates (AAIRs) were used to assess the intersection between etiology and detailed race-ethnicity. Etiology-specific temporal trends based on diagnosis year were assessed using Joinpoint regression.<h4>Results</h4>HCV remains the leading cause of HCC among men, but since 2017 NAFLD-HCC is the leading cause among women. HCV-HCC AAIRs are particularly high among U.S.-born minority men, including Puerto Rican (10.9 per 100,000), African American (8.0 per 100,000), and U.S.-born Mexican American men (7.6 per 100,000). NAFLD is more common among all Hispanics and Filipinos and HBV-HCC among Asian and Haitian black men. HCV-HCC surpasses HBV-HCC in Asian women. ALD-HCC is high among specific Hispanic male groups. Population-based HCV-HCC rates experienced a rapid decline since 2015 (-9.6% annually), whereas ALD-HCC (+6.0%) and NAFLD-HCC (+4.3%) are rising (P < .05).<h4>Conclusions</h4>New direct acting anti-viral drugs have impacted rates of HCV-HCC, offsetting important increases in both ALD- and NAFLD-HCC. Hispanics may be a group of concern because of higher rates for ALD- and NAFLD-HCC. HCC etiology varies remarkably and may warrant specific interventions by detailed race-ethnicity.

Also flagged:neurodegenerative illnessesCaeminaxin Acurcuminaromatic-turmeroneAmyloid betaandrographolide
Journal Article 2023-09-06 No Snippets Darwish SF, Elbadry AMM, Elbokhomy AS, Salama GA, Salama RM.
Show Full Abstract

The pathophysiology of different neurodegenerative illnesses is significantly influenced by the polarization regulation of microglia and macrophages. Traditional classifications of macrophage phenotypes include the pro-inflammatory M1 and the anti-inflammatory M2 phenotypes. Numerous studies demonstrated dynamic non-coding RNA modifications, which are catalyzed by microglia-induced neuroinflammation. Different nutraceuticals focus on the polarization of M1/M2 phenotypes of microglia and macrophages, offering a potent defense against neurodegeneration. Caeminaxin A, curcumin, aromatic-turmerone, myricetin, aurantiamide, 3,6'-disinapoylsucrose, and resveratrol reduced M1 microglial inflammatory markers while increased M2 indicators in Alzheimer's disease. Amyloid beta-induced microglial M1 activation was suppressed by andrographolide, sulforaphane, triptolide, xanthoceraside, piperlongumine, and novel plant extracts which also prevented microglia-mediated necroptosis and apoptosis. Asarone, galangin, baicalein, and <i>a</i>-mangostin reduced oxidative stress and pro-inflammatory cytokines, such as interleukin (IL)-1, IL-6, and tumor necrosis factor-alpha in M1-activated microglia in Parkinson's disease. Additionally, myrcene, icariin, and tenuigenin prevented the nod-like receptor family pyrin domain-containing 3 inflammasome and microglial neurotoxicity, while <i>a</i>-cyperone, citronellol, nobiletin, and taurine prevented NADPH oxidase 2 and nuclear factor kappa B activation. Furthermore, other nutraceuticals like plantamajoside, swertiamarin, urolithin A, kurarinone, Daphne genkwa flower, and <i>Boswellia serrata</i> extracts showed promising neuroprotection in treating Parkinson's disease. In Huntington's disease, elderberry, curcumin, iresine celosia, <i>Schisandra chinensis</i>, gintonin, and pomiferin showed promising results against microglial activation and improved patient symptoms. Meanwhile, linolenic acid, resveratrol, <i>Huperzia serrata</i>, icariin, and baicalein protected against activated macrophages and microglia in experimental autoimmune encephalomyelitis and multiple sclerosis. Additionally, emodin, esters of gallic and rosmarinic acids, Agathisflavone, and sinomenine offered promising multiple sclerosis treatments. This review highlights the therapeutic potential of using nutraceuticals to treat neurodegenerative diseases involving microglial-related pathways.

Also flagged:chronic kidney diseasetricuspid regurgitationglomerular filtrationcardiovascular diseasesCVDend-stage renal disease
Journal Article 2023-09-06 No Snippets Nguyen HTT, Do CV, Dang DTV, Do LD, Doan LH, Dang HTV.
Show Full Abstract

<h4>Background</h4>It has been a scarcity of evidence regarding differences in left ventricular (LV) and left atrial (LA) size and strain changes across stages of chronic kidney disease (CKD) and which echocardiographic parameters could be utilized to predict the decline of glomerular filtration rate (GFR).<h4>Objectives</h4>This study aimed to evaluate the alterations of LV and LA strain across the reduction of renal function and potential echocardiographic parameters which could be correlated with the GFR decline among patients with CKD.<h4>Method</h4>A cross-sectional study was conducted on 169 CKD patients at Bach Mai General Hospital, Hanoi, Vietnam from April to November 2022. Demographic, clinical and laboratory characteristics of patients were collected. Transthoracic echocardiography was performed to measure LV and LA size and strains. Jonckheere-Terpstra test was used to measure the tendency of change. Multivariate linear regression models were performed to find associations between different echocardiographic parameters and renal function reduction.<h4>Results</h4>The number of patients with CKD stages 1, 2, 3, 4, and 5 was 21 (12.4%), 28 (16.6%), 27 (16.0%), 22 (13.0%) and 71 (42.0%), respectively. CKD severity was positively associated with LV diastolic and systolic diameters, LV mass, E/e' ratio, and maximal tricuspid regurgitation velocity (TR max), and negatively correlated with the LV global longitudinal strain. Higher severity of CKD stage was associated with higher LA diameter, LA strain, and volume in four and two-chamber views, and lower LA reservoir and conduit function. Left ventricular mass (<i>β</i> = 0.068), ejection fraction (<i>β</i> = 0.112) and left atrial reservoir (<i>β</i> = -0.077) were associated with reduced GFR.<h4>Conclusion</h4>Left ventricular mass, ejection fraction, and atrial longitudinal strain by STE should be done at the earlier stages of CKD patients for better follow-up of GFR decline.

Also flagged:deathSCN5ABrugada syndromeautosomal dominant Brugada syndromecardiacsudden cardiac
Journal Article 2023-09-06 No Snippets Brlek P, Pavelić ES, Mešić J, Vrdoljak K, Skelin A, Manola Š, Pavlović N, Ćatić J, Matijević G, Brugada J, Primorac D.
Show Full Abstract

Brugada syndrome is a rare hereditary disorder characterized by distinct ECG findings, complex genetics, and a high risk of sudden cardiac death. Recognition of the syndrome is crucial as it represents a paradigm of sudden death tragedy in individuals at the peak of their lives. Notably, Brugada syndrome accounts for more than 20% of sudden cardiac deaths in individuals with structurally normal hearts. Although this syndrome follows an autosomal dominant inheritance pattern, it is more prevalent and severe in males. Diagnosis is primarily based on the characteristic ECG pattern observed in the right precordial leads. Mutations in the SCN5A gene, resulting in loss of function, are the most common genetic cause. We presented a 36-year-old proband with a family history of sudden cardiac death. Although the patient was asymptomatic for Brugada syndrome, his father had experienced sudden death at the age of 36. The proband was admitted to St. Catherine's Specialty Hospital where blood was taken and subjected to next-generation sequencing (NGS) using a "Sudden cardiac death" panel. The analysis identified a pathogenic variant in the SCN5A gene [c.4222G > A(p.Gly1408Arg)], which is associated with autosomal dominant Brugada syndrome. Based on the positive genetic test result, the patient was referred for further examination. ECG with modified precordial lead positioning confirmed the presence of the Brugada phenotype, displaying the type-2 and type-1 ECG patterns. Therefore, we made the diagnosis and decided to implant an implantable cardioverter-defibrillator (ICD) based on the results of broad genetic NGS testing, diagnostic criteria (ECG), and considering the high burden of sudden cardiac death in the patient's family, as well as his concerns that limited his everyday activities. This case shows that genetics and personalized medicine hold immense potential in the primary prevention, diagnosis, and treatment of Brugada syndrome and sudden cardiac death.

PTGIS
Also flagged:QuercetinAflatoxin B1lipidcancerdetoxificationcurcumin
Journal Article 2023-09-06 ✓ 1 Snippet Pauletto M, Giantin M, Tolosi R, Bassan I, Bardhi A, Barbarossa A, Montanucci L, Zaghini A, Dacasto M.
In-Text Gene Mentions

…prostaglandin I2 synthase (PTGIS, lfc = 3.09),…

Show Full Abstract

Aflatoxin B1 (AFB1) induces lipid peroxidation and mortality in bovine foetal hepatocyte-derived cells (BFH12), with underlying transcriptional perturbations associated mainly with cancer, cellular damage, inflammation, bioactivation, and detoxification pathways. In this cell line, curcumin and resveratrol have proven to be effective in mitigating AFB1-induced toxicity. In this paper, we preliminarily assessed the potential anti-AFB1 activity of a natural polyphenol, quercetin (QUE), in BFH12 cells. To this end, we primarily measured QUE cytotoxicity using a WST-1 reagent. Then, we pre-treated the cells with QUE and exposed them to AFB1. The protective role of QUE was evaluated by measuring cytotoxicity, transcriptional changes (RNA-sequencing), lipid peroxidation (malondialdehyde production), and targeted post-transcriptional modifications (NQO1 and CYP3A enzymatic activity). The results demonstrated that QUE, like curcumin and resveratrol, reduced AFB1-induced cytotoxicity and lipid peroxidation and caused larger transcriptional variations than AFB1 alone. Most of the differentially expressed genes were involved in lipid homeostasis, inflammatory and immune processes, and carcinogenesis. As for enzymatic activities, QUE significantly reverted CYP3A variations induced by AFB1, but not those of NQO1. This study provides new knowledge about key molecular mechanisms involved in QUE-mediated protection against AFB1 toxicity and encourages in vivo studies to assess QUE's bioavailability and beneficial effects on aflatoxicosis.

SOX6
Also flagged:OMkeratins K2K6CK4K13K31
Journal Article 2023-09-06 ✓ 2 Snippets Bardag Gorce F, Al Dahan M, Narwani K, Terrazas J, Ferrini M, Calhoun CC, Uyanne J, Royce-Flores J, Crum E, Niihara Y.
In-Text Gene Mentions

SOX6, which is…

…The expression ofSOX6, which is…

Show Full Abstract

We report in this study on the isolation and expansion of neural crest stem cells (NCSCs) from the epithelium of oral mucosa (OM) using reagents that are GMP-certified and FDA-approved for clinical use. Characterization analysis showed that the levels of keratins <i>K2</i>, <i>K6C</i>, <i>K4</i>, <i>K13</i>, <i>K31</i>, and <i>K15</i>-specific to OM epithelial cells-were significantly lower in the experimental NCSCs. While <i>SOX10</i> was decreased with no statistically significant difference, the earliest neural crest specifier genes <i>SNAI1/2</i>, <i>Ap2a</i>, <i>Ap2c</i>, <i>SOX9</i>, <i>SOX30</i>, <i>Pax3</i>, and <i>Twist1</i> showed a trend in increased expression in NCSCs. In addition, proteins of <i>Oct4</i>, <i>Nestin</i> and <i>Noth1</i> were found to be greatly expressed, confirming NCSC multipotency. In conclusion, our study showed that the epithelium of OM contains NCSCs that can be isolated and expanded with clinical-grade reagents to supply the demand for multipotent cells required for clinical applications in regenerative medicine. Supported by Emmaus Medical Inc.

Also flagged:MastitisIL-17Asecretionpro-inflammatory cytokineschemokinespeptide
Journal Article 2023-09-06 No Snippets Pang S, Shao Y, Yu Y, Sha K, Jiang Y, Zhang X, Zhong Y, Shi H, Li W.
Show Full Abstract

Lactoferrin (<i>LF</i>) is believed to be an important active protein in goat milk, which plays an anti-inflammatory role. Although <i>LF</i> has been reported to be associated with body health, its exact underlying mechanism remains unclear. Here, we aimed to elucidate the mechanism of this anti-inflammatory effect of <i>LF</i> in vitro. We first identified that <i>miR-214-5p</i> inhibited the expression of <i>LF</i> mRNA and protein in cells through the 3'UTR of <i>LF</i> mRNA. We next identified the alterations in miRNA following <i>LF</i> overexpression in goat mammary epithelial cells (GEMCs). Overexpression of <i>LF</i> significantly increased (<i>p</i> < 0.05) <i>miR-224-5p</i> expression. We further revealed that transcriptional activation of <i>ADAM17</i>, TNF-α, IL-1β, and IL-6 was efficiently decreased (<i>p</i> < 0.05) in GMECs treated by <i>miR-224-5p</i> mimic. Conversely, knockdown of <i>miR-224-5p</i> increased (<i>p</i> < 0.05) <i>ADAM17</i>, TNF-α, IL-1β, and IL-6 expression. Additionally, TNF-α, IL-1β, and IL-6 expression levels were dramatically decreased in GMECs after administration of si<i>ADAM17</i>. Herein, we indicate that the <i>miR-214-5p</i>/<i>LF</i>/<i>miR-224-5p</i>/<i>ADAM17</i> axis is involved in the immune regulation of GEMCs.

Also flagged:CyclophilinsPeptidyl–prolyl cis–trans isomerase APPIase Acyclophilin Acyclosporintumors
Journal Article 2023-09-06 No Snippets Belli V, Maiello D, Di Lorenzo C, Furia M, Vicidomini R, Turano M.
Show Full Abstract

The highly conserved family of cyclophilins comprises multifunctional chaperones that interact with proteins and RNAs, facilitating the dynamic assembly of multimolecular complexes involved in various cellular processes. Cyclophilin A (CypA), the predominant member of this family, exhibits peptidyl-prolyl cis-trans isomerase activity. This enzymatic function aids with the folding and activation of protein structures and often serves as a molecular regulatory switch for large multimolecular complexes, ensuring appropriate inter- and intra-molecular interactions. Here, we investigated the involvement of CypA in the nucleus, where it plays a crucial role in supporting the assembly and trafficking of heterogeneous ribonucleoproteins (RNPs). We reveal that CypA is enriched in the nucleolus, where it colocalizes with the pseudouridine synthase dyskerin, the catalytic component of the multifunctional H/ACA RNPs involved in the modification of cellular RNAs and telomere stability. We show that dyskerin, whose mutations cause the X-linked dyskeratosis (X-DC) and the Hoyeraal-Hreidarsson congenital ribosomopathies, can directly interact with CypA. These findings, together with the remark that substitution of four dyskerin prolines are known to cause X-DC pathogenic mutations, lead us to indicate this protein as a CypA client. The data presented here suggest that this chaperone can modulate dyskerin activity influencing all its partecipated RNPs.

SERPINC1
Also flagged:ADpathogenesisMIEN1TNFBVCAM1REG1B
Journal Article 2023-09-06 ✓ 1 Snippet Hällqvist J, Pinto RC, Heywood WE, Cordey J, Foulkes AJM, Slattery CF, Leckey CA, Murphy EC, Zetterberg H, Schott JM, Mills K, Paterson RW.
In-Text Gene Mentions

…FRMD4B, B2M, HPX,SERPINC1, OLR1).…

Show Full Abstract

As disease-modifying therapies are now available for Alzheimer's disease (AD), accessible, accurate and affordable biomarkers to support diagnosis are urgently needed. We sought to develop a mass spectrometry-based urine test as a high-throughput screening tool for diagnosing AD. We collected urine from a discovery cohort (n = 11) of well-characterised individuals with AD (n = 6) and their asymptomatic, CSF biomarker-negative study partners (n = 5) and used untargeted proteomics for biomarker discovery. Protein biomarkers identified were taken forward to develop a high-throughput, multiplexed and targeted proteomic assay which was tested on an independent cohort (n = 21). The panel of proteins identified are known to be involved in AD pathogenesis. In comparing AD and controls, a panel of proteins including MIEN1, TNFB, VCAM1, REG1B and ABCA7 had a classification accuracy of 86%. These proteins have been previously implicated in AD pathogenesis. This suggests that urine-targeted mass spectrometry has potential utility as a diagnostic screening tool in AD.

Also flagged:apatiteosteoblast proliferationtitanium oxiderutileoxidetitanium
Journal Article 2023-09-06 No Snippets Witkowska J, Borowski T, Sowińska A, Choińska E, Moszczyńska D, Morgiel J, Sobiecki J, Wierzchoń T.
Show Full Abstract

The present study elucidates the impact of glow discharge oxidation within a low-temperature plasma environment on the bioactivity characteristics of an NiTi shape memory alloy. The properties of the produced surface layers, such as structure (TEM observations), surface morphology (SEM observations), chemical and phase composition (EDS and XRD measurements), wettability (optical gonimeter), and the biological response of osteoblasts and platelets to the oxidized surface compared with the NiTi alloy without a surface layer are presented. The presented surface modification of the NiTi shape memory alloy, achieved through oxidizing in a low-temperature plasma environment, led to the creation of a continuous surface layer composed of nanocrystalline titanium oxide TiO<sub>2</sub> (rutile). The findings obtained from this study provide evidence that the oxidized layer augments the bioactivity of the shape memory alloy. This augmentation was substantiated through the spontaneous biomimetic deposition of apatite from a simulated body fluid (SBF) solution. Furthermore, the modified surface exhibited improved osteoblast proliferation, and enhanced platelet adhesion and activation. This proposed surface modification strategy holds promise as a prospective solution to enhance the biocompatibility and bioactivity of NiTi shape memory alloy intended for prolonged use in bone implant applications.

SERPINC1
Also flagged:PeptidePeptidesACEchronic diseasesdiabetescardiovascular disease
Journal Article 2023-09-06 ✓ 2 Snippets Fernandez Cunha M, Coscueta ER, Brassesco ME, Marques R, Neto J, Almada F, Gonçalves D, Pintado M.
In-Text Gene Mentions

…dipeptidyl peptidase III (DPP-III) and displayed potential…

DPP-IIIinhibitors have been…

Show Full Abstract

Identifying bioactive molecules from marine organisms is still vastly understudied. Fish remain an untapped source of bioactive molecules, even when considering species whose toxicity to other fish species has been noticed before. We assessed potential applications of crude body mucus of the Lusitanian toadfish (<i>Halobratachus didactylus</i>) and characterized its peptide fraction composition. Mucus samples from three individuals (two wild and one captive) revealed potential antioxidant, antihypertensive, and antimicrobial activities. For antioxidant activity, the best results of 2371 ± 97 µmol Trolox Equivalent/g protein for ORAC and 154 ± 6 µmol Trolox Equivalent/g protein for ABTS were obtained. For antihypertensive activity, the relevant inhibitory activity of ACE resulted in IC<sub>50</sub> of 60 ± 7 µg protein/mL. Antimicrobial activity was also identified against the pathogenic bacteria <i>Escherichia coli</i> and <i>Listeria monocytogenes</i>. The peptide profile of the crude body mucus was obtained through size exclusion chromatography, with a conspicuous peak at ca. 800 Da. LC-MS/MS allowed the detection of the most probable peptide sequences of this dominant peptide. This is the first study where the bioactive potential of mucus from the Lusitanian toadfish is demonstrated. Peptides with such properties can be applied in the food and pharmaceutical industries.

Also flagged:SynthesisBenzofuranbenzo[ b ]furanHeterocyclicnucleus
Journal Article 2023-09-06 No Snippets Arce-Ramos L, Castillo JC, Becerra D.
Show Full Abstract

The importance of the benzo[<i>b</i>]furan motif becomes evident in the remarkable results of numerous biological investigations, establishing its potential as a robust therapeutic option. This review presents an overview of the synthesis of and exhaustive biological studies conducted on benzo[<i>b</i>]furan derivatives from 2011 to 2022, accentuating their exceptional promise as anticancer, antibacterial, and antifungal agents. Initially, the discussion focuses on chemical synthesis, molecular docking simulations, and both in vitro and in vivo studies. Additionally, we provide an analysis of the intricate interplay between structure and activity, thereby facilitating comparisons and profoundly emphasizing the applications of the benzo[<i>b</i>]furan motif within the realms of drug discovery and medicinal chemistry.

PEBP1
Also flagged:membranecalciumeggshellorganic matrix proteinscalcium carbonatemembranes
Journal Article 2023-09-06 ✓ 2 Snippets Song L, Weng K, Bao Q, Wu J, Zhang Y, Xu Q, Zhang Y.
In-Text Gene Mentions

…Abmart, Shanghai, China),PEBP1, PHB1, and GAPDH…

…antibodies, named CALM1,PEBP1, and PHB1, from…

Show Full Abstract

Eggshell is a crucial indicator of egg quality. Pimpled eggs (PE) a type of eggshell defect are characterized by low eggshell strength, leading to substantial financial losses. Eggshell formation occurs in the uterine fluid (UF), which contains the required ions and matrix proteins However, the underlying mechanisms of PE formation remain poorly understood. In this study, we analyzed the egg quality of PE, and normal eggs (NE) by examining the differences in UF from hens producing PE and NE (n = 6 each). This 2-wk-long assessment involved histomorphological and proteomics analyses. The results showed that NE had better eggshell quality compared to PE, and the uterus structure in PE hens was conducive to the formation of PE. Using quantitative proteomic analysis, we identified 68 differential abundance proteins (DAPs) in the UF of PE hens, including 9 key proteins related to ion transport, protein synthesis and folding, and immunity. Downregulation of CALM1 and SCNN1G proteins in PE hens might have negatively affected the calcium signaling pathway, decreasing the calcium amount in UF. Additionally, the PHB1 and TSN proteins may affect eggshell formation by regulating immune responses. Taken together, our results provide insights into the mechanism of PE production, with potential applications for enhancing eggshell quality.

Also flagged:silverfluoridecalciumacidCPPACP
Journal Article 2023-09-06 No Snippets Joshi SS, Ninawe NS, Reddy Banda N, Gala U, Doiphode A, Honaje N.
Show Full Abstract

<h4>Aim</h4> This study aimed to compare the effects of applying various remineralizing agents before and after acid etching on the enamel-bracket shear bond strength (SBS) in vitro. These agents included silver diamine fluoride (SDF), casein phosphopeptide-amorphous calcium phosphate (CPP-ACP), and 5% sodium fluoride (5% NaF).<h4>Materials and methods</h4>All the selected teeth were divided equally into six subgroups depending on before and after acid etching and one separate control group for the in vitro study design. Eighty-four extracted premolar teeth (12 teeth in each group x seven groups, including the control group). Before acid etching, teeth in groups A1, B1, and C1 were given SDF, CPP-ACP paste, and 5% NaF, respectively. Following acid etching, all of the teeth in Groups A2, B2, and C2 received the same preventative treatments. After that, the SBS of the bonded brackets to the enamel was evaluated.<h4>Results</h4>The CPP-ACP group, control group, and SDF group had the highest values for SBS prior to acid etching.The 5% NaF group had the weakest bonds, and the difference between the groups was statistically significant. The CPP-ACP group had the highest SBS following acid etching, followed by the 5% NaF group. The least bond strength was seen in the SDF group, and the difference between the three groups was significant.<h4>Conclusion</h4>When it comes to bonding orthodontic brackets, the CPP-ACP pretreatment is superior to fluoride pretreatment in terms of effectiveness. The use of these remineralizing agents resulted in favorable values that did not have any effect on the SBS and were therefore safe to use with orthodontic brackets.

Also flagged:cardiovascular diseasesnucleotideslin-4cell proliferationcell growthmetabolism
Journal Article 2023-09-06 No Snippets Gao J, Song J, Yan Y, Gokulnath P, Vulugundam G, Li G, Zhan Q, Jiang F, Lin Y, Xiao J.
Show Full Abstract

Exercise training (ET) is an important non-drug adjuvant therapy against many human diseases, including cardiovascular diseases. The appropriate ET intensity induces beneficial adaptions and improves physiological function and cardiopulmonary fitness. The mechanisms of exercise-induced cardioprotective effects are still not fully understood. However, mounting evidence suggest that microRNAs (miRNAs) play crucial role in this process and are essential in responding to exercise-stress and mediating exercise-protective effects. Thus, this review summarizes the biogenesis of miRNAs, the mechanism of miRNA action, and specifically the miRNAs involved in exercise-induced cardio-protection used as therapeutic targets for treating cardiovascular diseases.

HFE
Also flagged:Non-ischemic cardiomyopathyatrioventricular blockheart failurecardiac conduction disorderagingcongenital heart disease
Journal Article 2023-09-06 ✓ 3 Snippets Chen Z, Jin Y, Xu N, Gao Y, Wu S, Dai Y, Chen K.
In-Text Gene Mentions

…that the symptoms/sign-basedHFEevent collected is…

…significantly higher suspectedHFErates than did…

…addition, the suspectedHFEwas mainly based…

Show Full Abstract

<h4>Background</h4>The causes of atrioventricular block (AVB) are different and diverse young patients, as compared to the old. However, little is known about the etiology distribution and clinical characteristics of AVB in the young group.<h4>Methods</h4>We retrospectively analyzed clinical information for AVB patients under 50 years of age. We summarized clinical phenotypes for patients with undetermined AVB etiology, according to AVB type and cardiac-structural change, whereas those who received pacing therapy were followed up for suspected heart failure events (HFEs).<h4>Results</h4>AVB etiology was identified in only 289 (61.4%) patients, while 38.6% still have undertermined etiology for AVB. Non-ischemic cardiomyopathy (16.6%) and complication of cardiac surgery (13.4%) were the top two etiologies. In addition, four distinct phenotypes were identified in AVB patients with undetermined etiology, of which the severe phenotype (both borderline/elevated left ventricular diameter or abnormal left ventricular ejection fraction and advanced AVB) accounted for 17%. Notably, 80.7% of patients with severe phenotype received pacing therapy. Based on a median follow-up time of 17.5 months, we found the occurrence of 16 suspected HFEs in 110 pacemaker receivers (12 were lost to follow up). Notably, the severe phenotype was associated with a higher risk of heart failure (HF) symptoms.<h4>Conclusions</h4>AVB etiology in young patients under 50 years of age is complex and underdiagnosed. In patients with undetermined etiology, severe phenotype featuring advanced AVB and abnormal Left ventricle (LV) structure/function is associated with a higher rate of HF symptoms even after pacing therapy.

bioRxiv 2023-09-06 Preprint (No Snippets API) Uzungil V, Luza S, Opazo CM, Mees I, Li S, Ang C, Williamson NA, Bush AI, Hannan AJ, Renoir T.
Show Full Abstract

Current antidepressants have limitations due to insufficient efficacy and delay before improvement in symptoms. Polymorphisms of the serotonin transporter (5-HTT) gene have been linked to depression (when combined with stressful life events) and to altered response to selective serotonergic reuptake inhibitors. We have previously revealed the antidepressant-like properties of the iron chelator deferiprone in the 5-HTT knock-out (KO) mouse model of depression. Furthermore, deferiprone was found to alter neural activity in the prefrontal cortex of both wild-type (WT) and 5-HTT KO mice. In the current study, we examined the molecular effects of acute deferiprone treatment in the prefrontal cortex of both genotypes via phosphoproteomics. In WT mice treated with deferiprone, there were 22 differentially expressed phosphosites, with gene ontology analysis implicating cytoskeletal proteins. In 5-HTT KO mice treated with deferiprone, we found 33 differentially expressed phosphosites. Gene ontology analyses revealed phosphoproteins that were predominantly involved in synaptic and glutamatergic signalling. In a drug naive cohort, the analysis revealed 21 differentially expressed phosphosites in 5-HTT KO compared to WT mice. We confirmed the deferiprone-induced increase in Tyrosine hydroxylase serine 40 residue phosphorylation (pTH-Ser40) (initially revealed in our phosphoproteomics study) by western blots, with deferiprone increasing pTH-Ser40 expression in WT and 5-HTT KO mice. As glutamatergic and synaptic signalling are dysfunctional in 5-HTT KO mice (and are the target of fast-acting antidepressant drugs such as ketamine), these molecular effects may underpin deferiprone’s antidepressant-like properties. Furthermore, dopaminergic signalling may also be involved in deferiprone’s antidepressant-like properties.

bioRxiv 2023-09-06 Preprint (No Snippets API) Sollberger G, Brenes AJ, Warner J, Arthur JSC, Howden AJ.
Show Full Abstract

<h4>Summary</h4> Neutrophils are one of the first responders to infection and are a key component of the innate immune system through their ability to phagocytose and kill invading pathogens, secrete antimicrobial molecules and produce extracellular traps. Neutrophils are produced in the bone marrow, circulate within the blood and upon immune challenge migrate to the site of infection. We wanted to understand whether this transition shapes the mouse neutrophil protein landscape, how the mouse neutrophil proteome is impacted by systemic infection and perform a comparative analysis of human and mouse neutrophils. Using quantitative mass spectrometry we reveal tissue-specific, infection-induced and species-specific neutrophil protein signatures. We show a high degree of proteomic conservation between mouse bone marrow, blood and peritoneal neutrophils, but also identify key differences in the molecules that these cells express for sensing and responding to their environment. Systemic infection triggers a change in the bone marrow neutrophil population with considerable impact on the core machinery for protein synthesis and DNA replication along with environmental sensors. We also reveal profound differences in mouse and human blood neutrophils, particularly their granule contents. Our proteomics data provides a valuable resource for understanding neutrophil function and phenotypes across species and model systems.

HTT
Also flagged:phenylketonurianucleotideglucose-6-phosphate dehydrogenaseG6PDdeficiencythyroid-stimulating hormone
Journal Article 2023-09-05 ✓ 3 Snippets Chen T, Fan C, Huang Y, Feng J, Zhang Y, Miao J, Wang X, Li Y, Huang C, Jin W, Tang C, Feng L, Yin Y, Zhu B, Sun M, Liu X, Xiang J, Tan M, Jia L, Chen L, Huang H, Peng H, Sun X, Gu X, Peng Z, Zhu B, Zou H, Han L.
In-Text Gene Mentions

Specifically, 20 patients were affected by disorders screened by both biochemical and genetic NBS (10 G6PD deficiency; 8 congenital hypothyroidism or isolated HTT; 2 amino acid, organic acid, or fatty acid oxidation disorders), whereas 39 patients were affected by disorders screened solely by genetic NBS (Figure).

Patients With G6PD Deficiency, Congenital Hypothyroidism, Isolated HTT and Amino Acid, Organic Acid, and Fatty Acid Oxidation Disorders

A total of 445 newborns were diagnosed with 13 disorders screened by both genetic and biochemical NBS (Table 2), which included G6PD deficiency (328 newborns), congenital hypothyroidism and isolated HTT (94 newborns), and amino acid, organic acid, or fatty acid oxidation disorders (23 newborns).

Show Full Abstract

<h4>Importance</h4>Newborn screening via biochemical tests is in use worldwide. The availability of genetic sequencing has allowed rapid screening for a substantial number of monogenic disorders. However, the outcomes of this strategy have not been evaluated in a general newborn population.<h4>Objective</h4>To evaluate the outcomes of applying gene panel sequencing as a first-tier newborn screening test.<h4>Design, setting, and participants</h4>This cohort study included newborns who were prospectively recruited from 8 screening centers in China between February 21 and December 31, 2021. Neonates with positive results were followed up before July 5, 2022.<h4>Exposures</h4>All participants were concurrently screened using dried blood spots. The screen consisted of biochemical screening tests and a targeted gene panel sequencing test for 128 conditions. The biochemical and genomic tests could both detect 43 of the conditions, whereas the other 85 conditions were screened solely by the gene panel.<h4>Main outcomes and measures</h4>The primary outcomes were the number of patients detected by gene panel sequencing but undetected by the biochemical test.<h4>Results</h4>This study prospectively recruited 29 601 newborns (15 357 [51.2%] male). The mean (SD) gestational age was 39.0 (1.5) weeks, and the mean (SD) birth weight was 3273 (457) g. The gene panel sequencing screened 813 infants (2.7%; 95% CI, 2.6%-2.9%) as positive. By the date of follow-up, 402 infants (1.4%; 95% CI, 1.2%-1.5%) had been diagnosed, indicating the positive predictive value was 50.4% (95% CI, 50.0%-53.9%). The gene panel sequencing identified 59 patients undetected by biochemical tests, including 20 patients affected by biochemically and genetically screened disorders and 39 patients affected by solely genetically screened disorders, which translates into 1 out of every 500 newborns (95% CI, 1/385-1/625) benefiting from the implementation of gene panels as a first-tier screening test.<h4>Conclusions and relevance</h4>In this cohort study, the use of gene panel sequencing in a general newborn population as a first-tier screening test improved the detection capability of traditional screening, providing an evidence-based suggestion that it could be considered as a crucial method for first-tier screening.

HFE
Also flagged:Ironiron-regulatory hormonehemeiron storage proteinFerritiniron importer
Journal Article 2023-09-05 ✓ 1 Snippet Colucci S, Carvalho Oliveira T, Muckenthaler MU, Marques O.
In-Text Gene Mentions

…prevalent form ofhemochromatosis.…

Show Full Abstract

The liver plays a crucial role in maintaining systemic iron homeostasis through iron storage, sensing of systemic iron needs, and production of the iron-regulatory hormone hepcidin. While mice are commonly used as models for studying human iron homeostasis, their liver structure differs significantly from humans. Since the mouse liver is structured in six separated lobes, often, the analysis of a single defined lobe is preferred due to concerns over data reproducibility between experimental cohorts. In this study, we compared iron-related parameters in distinct liver lobes of C57BL/6 wild-type mice across different ages. We found that the non-heme iron levels, as well as the mRNA and protein expression of iron storage protein Ferritin and the iron importer Transferrin Receptor 1, were similar between liver lobes. Additionally, the mRNA expression of <i>Hepcidin</i>, as well as its regulators, <i>Bmp2</i> and <i>Bmp6</i>, and iron importers <i>Zip8</i> and <i>Zip14</i> were comparable. Minor differences were observed in <i>Ferroportin</i> mRNA levels of 24-wk-old mice; however, this did not correlate with altered iron content. The findings in wild-type mice were reproduced in <i>Hfe</i> knock-out mice - a well-established genetic model of the most prevalent form of hemochromatosis. Overall, our results indicate that C57BL/6 mouse liver lobes can be used interchangeably for assessing iron content and expression of iron-related genes. Understanding if these findings are applicable to other mouse developmental stages, strains, or models of (iron-related) disorders will be key to promote reduction of experimental animal numbers and facilitate resource sharing among research groups studying liver iron homeostasis.<b>NEW & NOTEWORTHY</b> This study reveals that, despite being structurally separated, liver lobes from C57BL/6 wild-type and iron-overloaded mice can be used interchangeably for the evaluation of iron content and expression of iron-related genes.

Also flagged:neurogenesisLipidmetabolismmembranesorganizationsugar
Journal Article 2023-09-05 No Snippets Fuchigami T, Itokazu Y, Yu RK.
Show Full Abstract

The postnatal neural stem cell (NSC) pool hosts quiescent and activated radial glia-like NSCs contributing to neurogenesis throughout adulthood. However, the underlying regulatory mechanism during the transition from quiescent NSCs to activated NSCs in the postnatal NSC niche is not fully understood. Lipid metabolism and lipid composition play important roles in regulating NSC fate determination. Biological lipid membranes define the individual cellular shape and help maintain cellular organization and are highly heterogeneous in structure and there exist diverse microdomains (also known as lipid rafts), which are enriched with sugar molecules, such as glycosphingolipids. An often overlooked but key aspect is that the functional activities of proteins and genes are highly dependent on their molecular environments. We previously reported that ganglioside GD3 is the predominant species in NSCs and that the reduced postnatal NSC pools are observed in global GD3-synthase knockout (GD3S-KO) mouse brains. The specific roles of GD3 in determining the stage and cell-lineage determination of NSCs remain unclear, since global GD3S-KO mice cannot distinguish if GD3 regulates postnatal neurogenesis or developmental impacts. Here, we show that inducible GD3 deletion in postnatal radial glia-like NSCs promotes NSC activation, resulting in the loss of the long-term maintenance of the adult NSC pools. The reduced neurogenesis in the subventricular zone (SVZ) and the dentate gyrus (DG) of GD3S-conditional-knockout mice led to the impaired olfactory and memory functions. Thus, our results provide convincing evidence that postnatal GD3 maintains the quiescent state of radial glia-like NSCs in the adult NSC niche.

HFE
Also flagged:ferroptosisextracellulardeathironlipidimmune responses
Journal Article 2023-09-05 ✓ 1 Snippet Qiu X, Bi Q, Wu J, Sun Z, Wang W.
In-Text Gene Mentions

HFE-knockout mice developed severe fatty liver disease phenotype similar to human non-alcoholic steatohepatitis (NASH) with early fibrosis via dysregulating lipid metabolism which favors lipogenesis, supported by upregulated messenger RNA (mRNA) expression of lipogenic genes.[26] However, this study lacks evidence of significant iron and LPO in Hfe-/- models, indicating that IRP can cause lipid accumulation but LPO-related fibrosis is not independent of iron overload.

Show Full Abstract

<h4>Abstract</h4>Fibrosis, which is a manifestation of the physiological response to injury characterized by excessive accumulation of extracellular matrix components, is a ubiquitous outcome of the repair process. However, in cases of repetitive or severe injury, fibrosis may become dysregulated, leading to a pathological state and organ failure. In recent years, a novel form of regulated cell death, referred to as ferroptosis, has been identified as a possible contributor to fibrosis; it is characterized by iron-mediated lipid peroxidation. It has garnered attention due to the growing body of evidence linking ferroptosis and fibrogenesis, which is believed to be driven by underlying inflammation and immune responses. Despite the increasing interest in the relationship between ferroptosis and fibrosis, a comprehensive understanding of the precise role that ferroptosis plays in the formation of fibrotic tissue remains limited. This review seeks to synthesize previous research related to the topic. We categorized the different direct and indirect mechanisms by which ferroptosis may contribute to fibrosis into three categories: (1) iron overload toxicity; (2) ferroptosis-evoked necroinflammation, with a focus on ferroptosis and macrophage interplay; and (3) ferroptosis-associated pro-fibrotic factors and pathways. Furthermore, the review considers the potential implications of these findings and highlights the utilization of ferroptosis-targeted therapies as a promising strategy for mitigating the progression of fibrosis. In conclusion, novel anti-fibrotic treatments targeting ferroptosis could be an effective treatment for fibrosis.

HFE
Also flagged:adenocarcinoma ofneoplasmKRASovarian tumorsadenocarcinomasadenocarcinoma
Journal Article 2023-09-05 ✓ 1 Snippet Brambs CE, Horn LC, Hiller R, Krücken I, Braun C, Christmann C, Monecke A, Höhn AK.
In-Text Gene Mentions

…affecting CTNNB1, TP53,HFE, Jak-2, EGFR, and…

Show Full Abstract

<h4>Purpose</h4>Mesonephric-like adenocarcinomas (MLA) of the female genital tract represent a rare and relatively recently described neoplasm exhibiting characteristic morphologic and immunohistochemical findings commonly associated with a KRAS-mutation. Most cases display an aggressive clinical behavior, but knowledge about treatment approaches is limited, especially for targeting KRAS.<h4>Methods</h4>We report a series of eight cases with a detailed molecular analysis for KRAS. These cases as well as the data of previously published cases with detailed information regarding KRAS-mutational events were reviewed for a potential targeted approach and its prognostic impact.<h4>Results</h4>Both the uterine and ovarian MLA harbor a somatic KRAS-mutation in about 85% of the reported cases, affecting the hotspot codons 12 and 13. 15.7% of the endometrial and 15.6% of ovarian MLA are wild type for KRAS. A p.G12A-alteration was seen in 5.6% (5/89) of the endometrial and in 6.2% (2/32) of the ovarian tumors, for p.G12C in 7.9% and 6.2%, for p.G12D in 32.6% and 34.5% and for p.G12V in 36% and 37.5%, respectively. Very limited data are available regarding the prognostic impact of different mutational sites within the KRAS-gene without significant prognostic impact.<h4>Conclusion</h4>Because of a specific p.G12C-KRAS somatic mutation, only the minority of MLA (7.9% with uterine and 6.2% with ovarian primary) are potentially targetable by sotarasib in that rare but aggressive subtype of adenocarcinoma of the female genital tract. Until now, the different location of a somatic KRAS-mutation is of no prognostic impact.

Also flagged:osteoporosismetabolic bone disordertype I collagenbiosynthesisWNTsphingomyelin synthase 2
Journal Article 2023-09-05 No Snippets Formosa MM, Christou MA, Mäkitie O.
Show Full Abstract

Osteoporosis is a metabolic bone disorder which increases fragility fracture risk. Elderly individuals, especially postmenopausal women, are particularly susceptible to osteoporosis. Although rare, osteoporosis in children and young adults is becoming increasingly evident, highlighting the need for timely diagnosis, management and follow-up. Early-onset osteoporosis is defined as the presence of a low BMD (Z-score of ≤ -2.0 in individuals aged < 20 years; T-score of ≤ -2.5 in those aged between 20 to 50 years) accompanied by a clinically significant fracture history, or the presence of low-energy vertebral compression fractures even in the absence of osteoporosis. Affected children and young adults should undergo a thorough diagnostic workup, including collection of clinical history, radiography, biochemical investigation and possibly bone biopsy. Once secondary factors and comorbidities are excluded, genetic testing should be considered to determine the possibility of an underlying monogenic cause. Defects in genes related to type I collagen biosynthesis are the commonest contributors of primary osteoporosis, followed by loss-of-function variants in genes encoding key regulatory proteins of canonical WNT signalling (specifically LRP5 and WNT1), the actin-binding plastin-3 protein (encoded by PLS3) resulting in X-linked osteoporosis, and the more recent sphingomyelin synthase 2 (encoded by SGMS2) which is critical for signal transduction affecting sphingomyelin metabolism. Despite these discoveries, genetic causes and underlying mechanisms in early-onset osteoporosis remain largely unknown, and if no causal gene is identified, early-onset osteoporosis is deemed idiopathic. This calls for further research to unravel the molecular mechanisms driving early-onset osteoporosis that consequently will aid in patient management and individualised targeted therapy.

CCPG1
Also flagged:α-synucleinendoplasmic reticulum-degradationFAM134BPD
Journal Article 2023-09-05 ✓ 4 Snippets Kim DY, Shin JY, Lee JE, Kim HN, Chung SJ, Yoo HS, Kim SJ, Cho HJ, Lee EJ, Nam SJ, Kim SH, Jang J, Lee SE, Lee PH.
In-Text Gene Mentions

…lnexin (1:1,000, Abcam), anti-CCPG1(1:1,000, Abcam), anti-SEC62 (…

…such as FAM134B,CCPG1, and SEC62, were…

…of FAM134B andCCPG1were decreased in…

…such as SEC62,CCPG1, TEX264, RTN3L, and…

Show Full Abstract

The endoplasmic reticulum (ER) is selectively degraded by ER-phagy to maintain cell homeostasis. α-synuclein accumulates in the ER, causing ER stress that contributes to neurodegeneration in Parkinson's disease (PD), but the role of ER-phagy in α-synuclein modulation is largely unknown. Here, we investigated the mechanisms by which ER-phagy selectively recognizes α-synuclein for degradation in the ER. We found that ER-phagy played an important role in the degradation of α-synuclein and recovery of ER function through interaction with FAM134B, where calnexin is required for the selective FAM134B-mediated α-synuclein clearance via ER-phagy. Overexpression of α-synuclein in the ER of the substantia nigra (SN) resulted in marked loss of dopaminergic neurons and motor deficits, mimicking PD characteristics. However, enhancement of ER-phagy using FAM134B overexpression in the SN exerted neuroprotective effects on dopaminergic neurons and recovered motor performance. These data suggest that ER-phagy represents a specific ER clearance mechanism for the degradation of α-synuclein.

OLFM4
Also flagged:TET3methylationTen-eleven translocationTETDNA dioxygenases5
Journal Article 2023-09-05 ✓ 2 Snippets Gonzalez EA, Liu Y, Wang D, Jeziorek M, Bandyopadhyay S, Rao A, Gao N, Etchegaray JP.
In-Text Gene Mentions

…the number ofOlfm4expressing intestinal stem…

…cellular stemness (e.g.,Olfm4, Lgr4, Lgr5, and…

Show Full Abstract

DNA methylation functions as a repressive epigenetic mark that can be reversed by the Ten-eleven translocation (TET) family of DNA dioxygenases that sequentially oxidize 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC). Both 5fC and 5caC can be excised by DNA base-excision repair factors leading to unmodified cytosines. TET enzymes were recently implicated as potential risk factors for inflammatory bowel disease (IBD), but the contribution of TET-mediated DNA oxidation to intestinal homeostasis and response to environmental stressors are unknown. Here, we show prominent roles of TET3 in regulating mouse intestinal epithelial differentiation and response to luminal stressors. Compared with wild-type littermates, mice with intestinal epithelial cell-specific ablation of <i>Tet3</i> (<i>Tet3</i><sup><i>ΔIEC</i></sup>) demonstrated a decreased transcriptome involved in innate immune response, Paneth cell differentiation, and epithelial regeneration. <i>Tet3</i><i><sup>IEC</sup></i> mice exhibited an elevated susceptibility to enteric pathogen infection that is correlated with a decreased epithelial 5hmC abundance. Infection of human enterocytes or mice with the pathogenic bacteria acutely increased 5hmC abundance. Genome-wide 5hmC profiling revealed a shift of genomic enrichment of 5hmC toward genes involved in activating Notch, Wnt, and autophagy pathways. Furthermore, chemical stressor dextran sulfate sodium (DSS) represses epithelial 5hmC abundance in a temporal fashion, and <i>Tet3</i><i><sup>IEC</sup></i> mice exhibited increased susceptibility to DSS experimental colitis with reduced regenerative capacity. TET3 is a critical regulator of gut epithelial DNA methylome and transcriptome, especially in response to luminal stressors, for the maintenance of tissue homeostasis.

OLFM4
Also flagged:Interleukin-33IL-33cytokinemembraneST2IL-1R3
Journal Article 2023-09-05 ✓ 5 Snippets Calafiore M, Fu YY, Vinci P, Arnhold V, Chang WY, Jansen SA, Egorova A, Takashima S, Kuttiyara J, Ito T, Serody J, Nakae S, Turnquist H, van Es J, Clevers H, Lindemans CA, Blazar BR, Hanash AM.
In-Text Gene Mentions

For Olfm4, tamoxifen-induced labeling shortly before purification restricted the HA tag to ISCs without labeling of stem cell progeny, whereas for lysozyme, tamoxifen could be administered several days in advance to maximize ribosome labeling in terminally differentiated Paneth cells.

Treating Olfm4-Ribo mice with tamoxifen to label ribosomes with HA 24 h post-TBI, when Olfm4 expression remained intact, resulted in persistent HA labeling of the crypt base by 48 h post-TBI (Supplementary Fig. 8b), despite the reduction in Olfm4 gene expression at this timepoint.

Olfm4-Ribo mice were treated with a single intraperitoneal injection of tamoxifen (80 mg/kg).

Olfm4-IRES-eGFPCreERT2 18 , Lyz-DsR…

…9902-2, 1:100 dilution), anti-Olfm4(Cell Signaling Technology…

Show Full Abstract

Intestinal stem cells (ISCs) maintain the epithelial lining of the intestines, but mechanisms regulating ISCs and their niche after damage remain poorly understood. Utilizing radiation injury to model intestinal pathology, we report here that the Interleukin-33 (IL-33)/ST2 axis, an immunomodulatory pathway monitored clinically as an intestinal injury biomarker, regulates intrinsic epithelial regeneration by inducing production of epidermal growth factor (EGF). Three-dimensional imaging and lineage-specific RiboTag induction within the stem cell compartment indicated that ISCs expressed IL-33 in response to radiation injury. Neighboring Paneth cells responded to IL-33 by augmenting production of EGF, which promoted ISC recovery and epithelial regeneration. These findings reveal an unknown pathway of niche regulation and crypt regeneration whereby the niche responds dynamically upon injury and the stem cells orchestrate regeneration by regulating their niche. This regenerative circuit also highlights the breadth of IL-33 activity beyond immunomodulation and the therapeutic potential of EGF administration for treatment of intestinal injury.

SLC9C2
Also flagged:male infertilitybicarbonatefertilizationsynthesisamilorideputative Na + /H + exchanger
Journal Article 2023-09-05 ✓ 5 Snippets Grahn E, Kaufmann SV, Askarova M, Ninov M, Welp LM, Berger TK, Urlaub H, Kaupp UB.
In-Text Gene Mentions

Considering that SLC9C2 is also present in human sperm, we speculate that SLC9C1 and SLC9C2 forms heterodimers that may adopt new properties and mediate amiloride-sensitive Na+/H+ exchange via a classical alternating-access mechanism81 rather than by Vm gating and modulation by cAMP.

…two isoforms—SLC9C1 andSLC9C2; SLC9C2 is an…

…isoforms—SLC9C1 and SLC9C2;SLC9C2is an orphan…

…Considering thatSLC9C2is also present…

…that SLC9C1 andSLC9C2forms heterodimers that…

Show Full Abstract

The reaction of CO<sub>2</sub> with H<sub>2</sub>O to form bicarbonate (HCO<sub>3</sub><sup>-</sup>) and H<sup>+</sup> controls sperm motility and fertilization via HCO<sub>3</sub><sup>-</sup>-stimulated cAMP synthesis. A complex network of signaling proteins participates in this reaction. Here, we identify key players that regulate intracellular pH (pH<sub>i</sub>) and HCO<sub>3</sub><sup>-</sup> in human sperm by quantitative mass spectrometry (MS) and kinetic patch-clamp fluorometry. The resting pH<sub>i</sub> is set by amiloride-sensitive Na<sup>+</sup>/H<sup>+</sup> exchange. The sperm-specific putative Na<sup>+</sup>/H<sup>+</sup> exchanger SLC9C1, unlike its sea urchin homologue, is not gated by voltage or cAMP. Transporters and channels implied in HCO<sub>3</sub><sup>-</sup> transport are not detected, and may be present at copy numbers < 10 molecules/sperm cell. Instead, HCO<sub>3</sub><sup>-</sup> is produced by diffusion of CO<sub>2</sub> into cells and readjustment of the CO<sub>2</sub>/HCO<sub>3</sub><sup>-</sup>/H<sup>+</sup> equilibrium. The proton channel H<sub>v</sub>1 may serve as a unidirectional valve that blunts the acidification ensuing from HCO<sub>3</sub><sup>-</sup> synthesis. This work provides a new framework for the study of male infertility.

Also flagged:NOTCHmultiple myeloma
Journal Article 2023-09-05 No Snippets Maichl DS, Kirner JA, Beck S, Cheng WH, Krug M, Kuric M, Ade CP, Bischler T, Jakob F, Hose D, Seckinger A, Ebert R, Jundt F.
Show Full Abstract

No abstract available.

Also flagged:sleeping sicknesstrypanosomiasisTrypanosoma brucei infectionMmp8metalloproteinasesextracellular
Journal Article 2023-09-05 No Snippets Pham HTT, Magez S, Choi B, Baatar B, Jung J, Radwanska M.
Show Full Abstract

Recent blood transcriptomic analysis of rhodesiense sleeping sickness patients has revealed that neutrophil signature genes and activation markers constitute the top indicators of trypanosomiasis-associated inflammation. Here, we show that Trypanosoma brucei infection results in expansion and differentiation of four splenic neutrophil subpopulations, including Mki67<sup>+</sup>Birc5<sup>+</sup>Gfi1<sup>+</sup>Cebpe<sup>+</sup> proliferation-competent precursors, two intermediate immature subpopulations and Cebpb<sup>+</sup>Spi1<sup>+</sup>Irf7<sup>+</sup>Mcl1<sup>+</sup>Csf3r<sup>+</sup> inflammation reprogrammed mature neutrophils. Transcriptomic scRNA-seq profiling identified the largest immature subpopulation by Mmp8/9 positive tertiary granule markers. We confirmed the presence of both metalloproteinases in extracellular spleen homogenates and plasma. During infection, these enzymes digest extracellular matrix components in the absence of sufficient TIMP inhibitory activity, driving remodeling of the spleen follicular architecture. Neutrophil depletion prevents the occurrence of organ damage, resulting in increased plasma cell numbers and prolonged host survival. We conclude that trypanosomiasis-associated neutrophil activation is a major contributor to the destruction of the secondary lymphoid architecture, required for maintaining an efficient adaptive immune response.

CACNA1E
Also flagged:lipidlipoproteincholesteroltriglyceridescardiometabolic diseasescardiometabolic disease
Journal Article 2023-09-05 ✓ 1 Snippet Kamiza AB, Touré SM, Zhou F, Soremekun O, Cissé C, Wélé M, Touré AM, Nashiru O, Corpas M, Nyirenda M, Crampin A, Shaffer J, Doumbia S, Zeggini E, Morris AP, Asimit JL, Chikowore T, Fatumo S.
In-Text Gene Mentions

…For instance,CACNA1Eencodes the alpha-1E…

Show Full Abstract

Most genome-wide association studies (GWAS) for lipid traits focus on the separate analysis of lipid traits. Moreover, there are limited GWASs evaluating the genetic variants associated with multiple lipid traits in African ancestry. To further identify and localize loci with pleiotropic effects on lipid traits, we conducted a genome-wide meta-analysis, multi-trait analysis of GWAS (MTAG), and multi-trait fine-mapping (flashfm) in 125,000 individuals of African ancestry. Our meta-analysis and MTAG identified four and 14 novel loci associated with lipid traits, respectively. flashfm yielded an 18% mean reduction in the 99% credible set size compared to single-trait fine-mapping with JAM. Moreover, we identified more genetic variants with a posterior probability of causality >0.9 with flashfm than with JAM. In conclusion, we identified additional novel loci associated with lipid traits, and flashfm reduced the 99% credible set size to identify causal genetic variants associated with multiple lipid traits in African ancestry.

ABT1
Also flagged:ethanolatopic dermatitisADinflammatory skin diseaseimmunoglobulin Einflammatory chemokines
Journal Article 2023-09-05 ✓ 1 Snippet Song HK, Park SH, Kim HJ, Jang S, Choo BK, Kim HK, Kim T.
In-Text Gene Mentions

…tivated protein kinase (MAPK)/activator of transcription 1of transcription 1…

Show Full Abstract

Atopic dermatitis (AD) is an allergic, inflammatory skin disease caused by immune dysregulation. In this study, we investigated anti-atopic and anti-inflammatory activities of Sanguisorba hakusanensis ethanol extract (SHE) both in vivo using NC/Nga mice and in vitro using human HaCaT keratinocytes. Oral administration of SHE suppressed several atopic symptoms associated with house dust mites (induced with Dermatophagoides farinae extract) in NC/Nga mice and decreased serum levels of inflammatory mediators such as immunoglobulin E, histamine, and inflammatory chemokines. Additionally, SHE treatment reduced the infiltration of immune cells such as mast cells and macrophages in AD skin lesions. In vitro, interferon-γ- and tumor necrosis factor-α-stimulated HaCaT cells exhibited increased expression of T helper 1 and 2 chemokines; their expression was inhibited by SHE treatment. The anti-inflammatory effects of SHE treatment involved blocking of the mitogen-activated protein kinase and signal transducer and activator of transcription 1 signaling pathways. In conclusion, SHE exerts potent anti-atopic and anti-inflammatory effects and should be considered for the clinical treatment of AD.

SOX6
Also flagged:LIForganizationleukemia-inhibitory factorreceptorsneurogenesisLIF) receptor
Journal Article 2023-09-05 ✓ 1 Snippet Andrews MG, Siebert C, Wang L, White ML, Ross J, Morales R, Donnay M, Bamfonga G, Mukhtar T, McKinney AA, Gemenes K, Wang S, Bi Q, Crouch EE, Parikshak N, Panagiotakos G, Huang E, Bhaduri A, Kriegstein AR.
In-Text Gene Mentions

…NFIX, PROX1, NR2F2,SOX6, CXCR4…

Show Full Abstract

Radial glial (RG) development is essential for cerebral cortex growth and organization. In humans, the outer radial glia (oRG) subtype is expanded and gives rise to diverse neurons and glia. However, the mechanisms regulating oRG differentiation are unclear. oRG cells express leukemia-inhibitory factor (LIF) receptors during neurogenesis, and consistent with a role in stem cell self-renewal, LIF perturbation impacts oRG proliferation in cortical tissue and organoids. Surprisingly, LIF treatment also increases the production of inhibitory interneurons (INs) in cortical cultures. Comparative transcriptomic analysis identifies that the enhanced IN population resembles INs produced in the caudal ganglionic eminence. To evaluate whether INs could arise from oRGs, we isolated primary oRG cells and cultured them with LIF. We observed the production of INs from oRG cells and an increase in IN abundance following LIF treatment. Our observations suggest that LIF signaling regulates the capacity of oRG cells to generate INs.

HFE
Also flagged:Pyruvatekinase deficiencymembraneanemiagallstonesiron
Journal Article 2023-09-05 ✓ 1 Snippet Elkin B, Allende DS, Sengupta S.
In-Text Gene Mentions

…from coinheritance ofhemochromatosisgenes.…

Show Full Abstract

Liver transplant is a rare phenomenon for pyruvate kinase deficiency (PKD)-related liver disease and can be mediated by multiple mechanisms. In this report, we present a 55-year-old man with PKD who had acute-on-chronic liver failure with kidney failure and marked hyperbilirubinemia. His liver disease was from recurrent cholangitis, cholestasis from hemolysis, and iron deposition (likely from both repeated transfusions in youth and chronic hemolysis), all consequences of his PKD. He received a liver transplant and had a good outcome. Our case highlights the mechanisms of liver injury in PKD and successful transplantation for this rare complication.

Also flagged:brain injuryfatty acidcoagulationhemorrhagic shockhypocalcemiatrauma
Journal Article 2023-09-05 No Snippets Schaid TR, LaCroix I, Cohen MJ, Hansen KC, Moore EE, Sauaia A, Cralley AL, Thielen O, Hallas W, Erickson C, Mitra S, Dzieciatkowska M, Silliman CC, D'Alessandro A.
Show Full Abstract

<h4>Abstract</h4>Background: Trauma-induced hypocalcemia is common and associated with adverse outcomes, but the mechanisms remain unclear. Thus, we aimed to characterize the metabolomic and proteomic differences between normocalcemic and hypocalcemic trauma patients to illuminate biochemical pathways that may underlie a distinct pathology linked with this clinical phenomenon. Methods: Plasma was obtained on arrival from injured patients at a Level 1 Trauma Center. Samples obtained after transfusion were excluded. Multiple regression was used to adjust the omics data for injury severity and arrival base excess before metabolome- and proteome-wide comparisons between normocalcemic (ionized Ca 2+ > 1.0 mmol/L) and hypocalcemic (ionized Ca 2+ ≤ 1.0 mmol/L) patients using partial least squares-discriminant analysis. OmicsNet and Gene Ontology were used for network and pathway analyses, respectively. Results: Excluding isolated traumatic brain injury and penetrating injury, the main analysis included 36 patients (n = 14 hypocalcemic, n = 22 normocalcemic). Adjusted analyses demonstrated distinct metabolomic and proteomic signatures for normocalcemic and hypocalcemic patients. Hypocalcemic patients had evidence of mitochondrial dysfunction (tricarboxylic acid cycle disruption, dysfunctional fatty acid oxidation), inflammatory dysregulation (elevated damage-associated molecular patterns, activated endothelial cells), aberrant coagulation pathways, and proteolytic imbalance with increased tissue destruction. Conclusions: Independent of injury severity, hemorrhagic shock, and transfusion, trauma-induced hypocalcemia is associated with early metabolomic and proteomic changes that may reflect unique pathology in hypocalcemic trauma patients. This study paves the way for future experiments to investigate mechanisms, identify intervenable pathways, and refine our management of hypocalcemia in severely injured patients.

Also flagged:CalpainNeurodegenerative disorderspathogenesisdeathcalcium-dependent cysteine proteasessignal transduction
Journal Article 2023-09-05 No Snippets Metwally E, Al-Abbadi HA, Hussain T, Murtaza G, Abdellatif AM, Ahmed MF.
Show Full Abstract

Neurodegenerative disorders represent a major and growing healthcare challenge globally. Among the numerous molecular pathways implicated in their pathogenesis, calpain signaling has emerged as a crucial player in neuronal dysfunction and cell death. Calpain is a family of calcium-dependent cysteine proteases that is involved in many biological processes, such as signal transduction, cytoskeleton remodeling, and protein turnover. Dysregulation of calpain activation and activity has been associated with several neurodegenerative diseases, including Alzheimer's, Parkinson's, and Huntington's diseases. Understanding the intricate structure of calpains is crucial for unraveling their roles in cellular physiology and their implications in pathology. In addition, the identification of diverse abnormalities in both humans and other animal models with deficiencies in calpain highlights the significant progress made in understanding calpain biology. In this comprehensive review, we delve into the recent roles attributed to calpains and provide an overview of the mechanisms that govern their activity during the progression of neurodegenerative diseases. The possibility of utilizing calpain inhibition as a potential therapeutic approach for treating neuronal dysfunctions in neurodegenerative disorders would be an area of interest in future calpain research.

DNAH10
Also flagged:platinumovarian cancertumorBRCA1homologous recombinationneoplasm
Journal Article 2023-09-05 ✓ 1 Snippet Yang F, Wei W, Li G, Lan Q, Liu X, Gao L, Zhang C, Fan J, Li J.
In-Text Gene Mentions

…, MAP2 ,DNAH10, DYNC1H1 ,…

Show Full Abstract

<b>Introduction:</b> Platinum-based chemotherapy is the first-line treatment strategy for ovarian cancer patients. The dismal prognosis of ovarian cancer was shown to be stringently associated with the heterogeneity of tumor cells in response to this therapy, therefore understanding platinum sensitivity in ovarian cancer would be helpful for improving patients' quality of life and clinical outcomes. HRDetect, utilized to characterize patients' homologous recombination repair deficiency, was used to predict patients' response to platinum-based chemotherapy. However, whether each of the single features contributing to HRD score is associated with platinum sensitivity remains elusive. <b>Methods:</b> We analyzed the whole-exome sequencing data of 196 patients who received platinum-based chemotherapy from the TCGA database. Genetic features were determined individually to see if they could indicate patients' response to platinum-based chemotherapy and prognosis, then integrated into a Pt-score employing LASSO regression model to assess its predictive performance. <b>Results and discussion:</b> Multiple genetic features, including bi-allelic inactivation of BRCA1/2 genes and genes involved in HR pathway, multiple somatic mutations in genes involved in DNA damage repair (DDR), and previously reported HRD-related features, were found to be stringently associated with platinum sensitivity and improved prognosis. Higher contributions of mutational signature SBS39 or ID6 predicted improved overall survival. Besides, arm-level loss of heterozygosity (LOH) of either chr4p or chr5q predicted significantly better disease-free survival. Notably, some of these features were found independent of HRD. And SBS3, an HRD-related feature, was found irrelevant to platinum sensitivity. Integrated all candidate markers using the LASSO model to yield a Pt-score, which showed better predictive ability compared to HRDetect in determining platinum sensitivity and predicting patients' prognosis, and this performance was validated in an independent cohort. The outcomes of our study will be instrumental in devising effective strategies for treating ovarian cancer with platinum-based chemotherapy.

Also flagged:Hydroxyapatitesilicate ionscalcium phosphatesiliconsecretionVEGF-A
Journal Article 2023-09-05 No Snippets Usseglio J, Dumur A, Pagès E, Renaudie É, Abélanet A, Brie J, Champion É, Magnaudeix A.
Show Full Abstract

Incorporation of silicate ions in calcium phosphate ceramics (CPC) and modification of their multiscale architecture are two strategies for improving the vascularization of scaffolds for bone regenerative medicine. The response of endothelial cells, actors for vascularization, to the chemical and physical cues of biomaterial surfaces is little documented, although essential. We aimed to characterize in vitro the response of an endothelial cell line, C166, cultivated on the surface CPCs varying either in terms of their chemistry (pure versus silicon-doped HA) or their microstructure (dense versus microporous). Adhesion, metabolic activity, and proliferation were significantly altered on microporous ceramics, but the secretion of the pro-angiogenic VEGF-A increased from 262 to 386 pg/mL on porous compared to dense silicon-doped HA ceramics after 168 h. A tubulogenesis assay was set up directly on the ceramics. Two configurations were designed for discriminating the influence of the chemistry from that of the surface physical properties. The formation of tubule-like structures was qualitatively more frequent on dense ceramics. Microporous ceramics induced calcium depletion in the culture medium (from 2 down to 0.5 mmol/L), which is deleterious for C166. Importantly, this effect might be associated with the in vitro static cell culture. No influence of silicon doping of HA on C166 behavior was detected.

Also flagged:calciummalnutritionalbumincarbohydratesamino acidlysine
Journal Article 2023-09-05 No Snippets Ramírez-Jiménez AK, Cota-López R, Morales-Sánchez E, Gaytán-Martínez M, Martinez-Flores HE, Reyes-Vega ML, Figueroa-Cárdenas JD.
Show Full Abstract

The nixtamalization process used for tortilla production entails extended processing time and generates pollutant effluents. Ohmic heating (OH) is an emerging technology that uses an alternating electric current for rapid and uniform food heating and mitigates effluent concerns. However, gaps exist in nutrient bioavailability studies. In this work, we assessed OH's impact on tortilla nutritional value, protein, and calcium using a rat model. Twenty-five male Wistar rats were fed one of four diets for 21 days: raw corn (RC) as an experimental control, OH-processed tortillas (OHTs), traditionally processed tortillas (TPTs), commercial tortillas (CTs), and a casein diet (CD) as a growth control. Despite similar protein and macronutrient profiles, OH significantly enhanced insoluble fiber content. The weight gain sequence was OHTs > TPTs > CTs > RC. OHTs exhibited superior protein digestibility (88.52%), which was 3% higher than other diets. The serum albumin (2.63-2.73 g/dL) indicated moderate malnutrition due to the tortilla's lower protein content. Nonetheless, the protein efficiency ratio (1.2-1.74) showed no significant difference from TPTs. Bone characteristics and fracture strength resembled the tortilla-fed groups, surpassing RC. X-ray diffraction and scanning electron microscopy confirmed that the OHT and TPT diets improved male rat bone thickness and crystallinity. The findings suggest the potential for OH as an eco-friendly tortilla production method, maintaining nutritional value comparable to traditional methods.

Also flagged:inflammatory bowel diseasepathogenesisulcerative colitischronic inflammatory bowel diseasesfistulasabscesses
Journal Article 2023-09-05 No Snippets Kamal S, Parkash N, Beattie W, Christensen B, Segal JP.
Show Full Abstract

Crohn's disease (CD) is a type of inflammatory bowel disease. The number of IBD cases worldwide was estimated to be 4.9 million in 2019. CD exhibits heterogeneity in clinical presentation, anatomical involvement, disease behaviour, clinical course and response to treatment. The classical description of CD involves transmural inflammation with skip lesions anywhere along the entire gastrointestinal tract. The complexity and heterogeneity of Crohn's disease is not currently reflected in the conventional classification system. Though the knowledge of Crohn's pathophysiology remains far from understood, the established complex interplay of the omics-genomics, transcriptomics, proteomics, epigenomics, metagenomics, metabolomics, lipidomics and immunophenomics-provides numerous targets for potential molecular markers of disease. Advancing technology has enabled identification of small molecules within these omics, which can be extrapolated to differentiate types of Crohn's disease. The multi-omic future of Crohn's disease is promising, with potential for advancements in understanding of its pathogenesis and implementation of personalised medicine.

Also flagged:Type 1 DiabetessugarTNF-alphacholesterolcarbohydratesdiabetes complications
Journal Article 2023-09-05 No Snippets Sylvetsky AC, Moore HR, Zhu X, Kaidbey JH, Kang L, Saeed A, Khattak S, Grilo MF, Vallone N, Kuttamperoor J, Cogen FR, Elmi A, Walter PJ, Cai H, DiPietro L, Goran MI, Streisand R.
Show Full Abstract

Low-calorie sweeteners (LCS) are commonly consumed by children with type 1 diabetes (T1D), yet their role in cardiometabolic health is unclear. This study examined the feasibility, acceptability, and preliminary effects of 12 weeks of LCS restriction among children with T1D. Children (<i>n</i> = 31) with T1D completed a two-week run-in (<i>n</i> = 28) and were randomly assigned to avoid LCS (LCS restriction, <i>n</i> = 15) or continue their usual LCS intake (<i>n</i> = 13). Feasibility was assessed using recruitment, retention, and adherence rates percentages. Acceptability was assessed through parents completing a qualitative interview (subset, <i>n</i> = 15) and a satisfaction survey at follow-up. Preliminary outcomes were between-group differences in change in average daily time-in-range (TIR) over 12 weeks (primary), and other measures of glycemic variability, lipids, inflammatory biomarkers, visceral adiposity, and dietary intake (secondary). Linear regression, unadjusted and adjusted for age, sex, race, and change in BMI, was used to compare mean changes in all outcomes between groups. LCS restriction was feasible and acceptable. No between-group differences in change in TIR or other measures of glycemic variability were observed. However, significant decreases in TNF-alpha (-0.23 ± 0.08 pg/mL) and improvements in cholesterol (-0.31 ± 0.18 mmol/L) and LDL (-0.60 ± 0.39 mmol/L) were observed with usual LCS intake, compared with LCS restriction. Those randomized to LCS restriction did not report increases in total or added sugar intake, and lower energy intake was reported in both groups (-190.8 ± 106.40 kcal LCS restriction, -245.3 ± 112.90 kcal usual LCS intake group). Decreases in percent energy from carbohydrates (-8.5 ± 2.61) and increases in percent energy from protein (3.2 ± 1.16) and fat (5.2 ± 2.02) were reported with usual LCS intake compared with LCS restriction. Twelve weeks of LCS restriction did not compromise glycemic variability or cardiometabolic outcomes in this small sample of youth with T1D. Further examination of LCS restriction among children with T1D is warranted.

Also flagged:PABPN1metabolismpolyA binding proteinnuclear specklesRNA-binding proteinsRBM26
Journal Article 2023-09-04 No Snippets Huang L, Li G, Du C, Jia Y, Yang J, Fan W, Xu YZ, Cheng H, Zhou Y.
Show Full Abstract

The polyA tail of mRNAs is important for many aspects of RNA metabolism. However, whether and how it regulates pre-mRNA splicing is still unknown. Here, we report that the polyA tail acts as a splicing enhancer for the last intron via the nuclear polyA binding protein PABPN1 in HeLa cells. PABPN1-depletion induces the retention of a group of introns with a weaker 3' splice site, and they show a strong 3'-end bias and mainly locate in nuclear speckles. The polyA tail is essential for PABPN1-enhanced last intron splicing and functions in a length-dependent manner. Tethering PABPN1 to nonpolyadenylated transcripts also promotes splicing, suggesting a direct role for PABPN1 in splicing regulation. Using TurboID-MS, we construct the PABPN1 interactome, including many spliceosomal and RNA-binding proteins. Specifically, PABPN1 can recruit RBM26&27 to promote splicing by interacting with the coiled-coil and RRM domain of RBM27. PABPN1-regulated terminal intron splicing is conserved in mice. Together, our study establishes a novel mode of post-transcriptional splicing regulation via the polyA tail and PABPN1.

NEGR1DNAH10UNC13CSHISA6
Also flagged:response to exercisegene expressionmetabolismoxygencardiometabolic diseasesaging
Journal Article 2023-09-04 ✓ 4 Snippets Hota M, Barber JL, Ruiz-Ramie JJ, Schwartz CS, Lam DTUH, Rao P, Mi MY, Katz DH, Robbins JM, Clish CB, Gerszten RE, Sarzynski MA, Ghosh S, Bouchard C.
In-Text Gene Mentions

DNAH10

SHISA6

UNC13C

NEGR1

Show Full Abstract

Submaximal exercise capacity is an indicator of cardiorespiratory fitness with clinical and public health implications. Submaximal exercise capacity and its response to exercise programs are characterized by heritability levels of about 40%. Using physical working capacity (power output) at a heart rate of 150 beats/min (PWC150) as an indicator of submaximal exercise capacity in subjects of the HERITAGE Family Study, we have undertaken multi-omics and in silico explorations of the underlying biology of PWC150 and its response to 20 wk of endurance training. Our goal was to illuminate the biological processes and identify panels of genes associated with human variability in intrinsic PWC150 (iPWC150) and its trainability (dPWC150). Our bioinformatics approach was based on a combination of genome-wide association, skeletal muscle gene expression, and plasma proteomics and metabolomics experiments. Genes, proteins, and metabolites showing significant associations with iPWC150 or dPWC150 were further queried for the enrichment of biological pathways. We compared genotype-phenotype associations of emerging candidate genes with reported functional consequences of gene knockouts in mouse models. We investigated the associations between DNA variants and multiple muscle and cardiovascular phenotypes measured in HERITAGE subjects. Two panels of prioritized genes of biological relevance to iPWC150 (13 genes) and dPWC150 (6 genes) were identified, supporting the hypothesis that genes and pathways associated with iPWC150 are different from those underlying dPWC150. Finally, the functions of these genes and pathways suggested that human variation in submaximal exercise capacity is mainly driven by skeletal muscle morphology and metabolism and red blood cell oxygen-carrying capacity.<b>NEW & NOTEWORTHY</b> Multi-omics and in silico explorations of the genes and underlying biology of submaximal exercise capacity and its response to 20 wk of endurance training were undertaken. Prioritized genes were identified: 13 genes for variation in submaximal exercise capacity in the sedentary state and 5 genes for the response level to endurance training, with no overlap between them. Genes and pathways associated with submaximal exercise capacity in the sedentary state are different from those underlying trainability.

DCC
Also flagged:Cdc42axonsdendritesCFIm25NUDT21CFIm68
Journal Article 2023-09-04 ✓ 1 Snippet Herron RS, Kunisky AK, Madden JR, Anyaeche VI, Maung MZ, Hwang HW.
In-Text Gene Mentions

…the Netrin-1 receptor,DCC( Winkle et…

Show Full Abstract

Alternative polyadenylation (APA) generates mRNA isoforms and diversifies gene expression. Here we report the discovery that the mTORC1 signaling pathway balances the expression of two <i>Trim9/TRIM9</i> isoforms through APA regulation in human and mouse. We showed that CFIm components, CPSF6 and NUDT21, promote the short <i>Trim9/TRIM9</i> isoform (<i>Trim9-S/TRIM9-S</i>) expression. In addition, we identified an evolutionarily conserved twin UGUA motif, UGUAYUGUA, in <i>TRIM9-S</i> polyadenylation site (PAS) that is critical for its regulation by CPSF6. We found additional CPSF6-regulated PASs with similar twin UGUA motifs in human and experimentally validated the twin UGUA motif functionality in <i>BMPR1B</i>, <i>MOB4</i>, and <i>BRD4-L</i>. Importantly, we showed that inserting a twin UGUA motif into a heterologous PAS was sufficient to confer regulation by CPSF6 and mTORC1. Our study reveals an evolutionarily conserved mechanism to regulate gene isoform expression by mTORC1 and implicates possible gene isoform imbalance in cancer and neurological disorders with mTORC1 pathway dysregulation.

TNFSF4
Also flagged:Toll-like receptorMelanomamalignant tumorcancerToll-like receptorsTLRs
Journal Article 2023-09-04 ✓ 1 Snippet Guan H, Chen X, Liu J, Sun J, Guo H, Jiang Y, Zhang H, Zhang B, Lin J, Yuan Q.
In-Text Gene Mentions

…checkpoint genes( CTLA4,TNFSF4, PDCD1LG2, CD86, CD40,…

Show Full Abstract

Melanoma is a malignant tumor of melanocytes and is often considered immunogenic cancer. Toll-like receptor-related genes are expressed differently in most types of cancer, depending on the immune microenvironment inside cancer, and the key function of Toll-like receptors (TLRs) for melanoma has not been fully elucidated. Based on multi-omics data from TCGA and GEO databases, we first performed pan-cancer analysis on TLR, including CNV, SNV, and mRNA changes in TLR-related genes in multiple human cancers, as well as patient prognosis characterization. Then, we divided melanoma patients into three subgroups (clusters 1, 2, and 3) according to the expression of the TLR pathway, and explored the correlation between TLR pathway and melanoma prognosis, immune infiltration, metabolic reprogramming, and oncogene expression characteristics. Finally, through univariate Cox regression analysis and LASSO algorithm, we selected six TLR-related genes to construct a survival prognostic model, divided melanoma patients into the training set, internal validation set 1, internal validation set 2, and external validation set for multiple validations, and discussed the correlation between model genes and clinical features of melanoma patients. In conclusion, we constructed a prognostic survival model based on TLR-related genes that precisely and independently demonstrated the potential to assess the prognosis and immune traits of melanoma patients, which is critical for patients' survival.

OLFM4
Also flagged:colorectal adenomaCAcolorectal canceradenomasadenomametformin
Journal Article 2023-09-04 ✓ 5 Snippets Luo Z, Wang B, Luo F, Guo Y, Jiang N, Wei J, Wang X, Tseng Y, Chen J, Zhao B, Liu J.
In-Text Gene Mentions

Especially, we identified the dysregulated stem genes including LGR5, c-Myc, and OLFM4 as the markers of adenoma, which are well preserved in HRCA-PDOs.

Gene expression heatmap revealed significant enrichment of LGR5, OLFM4, c-Myc, CD44, and CD166 in adenoma (Fig. 3D), which is consistent with the results of Fig. 3A and further validated by qRT-PCR results tested with the paired samples of seven patients (Fig. 3E).

HRCA showed remarkably higher expression levels of intestinal stem cell markers (LGR5, OLFM4) and cancer stem cell markers (c-Myc, CD166) (Fig. 3).

As stemness gene c-Myc was observed to be significantly downregulated in metformin-treated PDOs (Fig. 6A), we further confirmed the decreased expression of stemness genes LGR5, OLFM4, and c-Myc by qRT-PCR after metformin treatment (Fig. 6E, left), even before CA organoids decay in morphology (Figure S10).

The expression of c-Myc is significantly higher in adenocarcinoma organoids than in adenoma organoids while the expression of the LGR5 and OLFM4 in adenocarcinoma organoids is extremely low.

Show Full Abstract

<h4>Background</h4>Colorectal adenoma (CA), especially high-risk CA (HRCA), is a precancerous lesion with high prevalence and recurrence rate and accounts for about 90% incidence of sporadic colorectal cancer cases worldwide. Currently, recurrent CA can only be treated with repeated invasive polypectomies, while safe and promising pharmaceutical invention strategies are still missing due to the lack of reliable in vitro model for CA-related drug screening.<h4>Methods</h4>We have established a large-scale patient-derived high-risk colorectal adenoma organoid (HRCA-PDO) biobank containing 37 PDO lines derived from 33 patients and then conducted a series of high-throughput and high-content HRCA drug screening.<h4>Results</h4>We established the primary culture system with the non-WNT3a medium which highly improved the purity while maintained the viability of HRCA-PDOs. We also proved that the HRCA-PDOs replicated the histological features, cellular diversity, genetic mutations, and molecular characteristics of the primary adenomas. Especially, we identified the dysregulated stem genes including LGR5, c-Myc, and OLFM4 as the markers of adenoma, which are well preserved in HRCA-PDOs. Based on the HRCA-PDO biobank, a customized 139 compound library was applied for drug screening. Four drugs including metformin, BMS754807, panobinostat and AT9283 were screened out as potential hits with generally consistent inhibitory efficacy on HRCA-PDOs. As a representative, metformin was discovered to hinder HRCA-PDO growth in vitro and in vivo by restricting the stemness maintenance.<h4>Conclusions</h4>This study established a promising HRCA-PDO biobank and conducted the first high-throughput and high-content HRCA drug screening in order to shed light on the prevention of colorectal cancer.

DCC
Also flagged:Thyroid CancerpathogenesisThyroidcancerPTCtumor
Journal Article 2023-09-04 ✓ 1 Snippet Fagin JA, Nikiforov YE.
In-Text Gene Mentions

…TP53 , andDCCin colorectal cancers…

Show Full Abstract

<b><i>Background:</i></b> Very little was known about the molecular pathogenesis of thyroid cancer until the late 1980s. As part of the Centennial celebration of the American Thyroid Association, we review the historical discoveries that contributed to our current understanding of the genetic underpinnings of thyroid cancer. <b><i>Summary:</i></b> The pace of discovery was heavily dependent on scientific breakthroughs in nucleic acid sequencing technology, cancer biology, thyroid development, thyroid cell signaling, and growth regulation. Accordingly, we attempt to link the primary observations on thyroid cancer molecular genetics with the methodological and scientific advances that made them possible. <b><i>Conclusions:</i></b> The major genetic drivers of the common forms of thyroid cancer are now quite well established and contribute to a significant extent to how we diagnose and treat the disease. However, many challenges remain. Future work will need to unravel the complexity of thyroid cancer ecosystems, which is likely to be a major determinant of their biological behavior and on how they respond to therapy.

POU3F2
Also flagged:Farnesolimmune responsecytokineMAPKisoprenoidMS
Journal Article 2023-09-04 ✓ 1 Snippet Doyle WJ, Walters D, Shi X, Hoffman K, Magori K, Roullet JB, Ochoa-Repáraz J.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

<h4>Background</h4>Farnesol (FOL) prevents the onset of experimental autoimmune encephalomyelitis (EAE), a murine model of multiple sclerosis (MS).<h4>Objective</h4>We examined the transcriptomic profile of the brains of EAE mice treated with daily oral FOL using next-generation sequencing (RNA-seq).<h4>Methods</h4>Transcriptomics from whole brains of treated and untreated EAE mice at the peak of EAE was performed.<h4>Results</h4>EAE-induced mice, compared to naïve, healthy mice, overall showed increased expression in pathways for immune response, as well as an increased cytokine signaling pathway, with downregulation of cellular stress proteins. FOL downregulates pro-inflammatory pathways and attenuates the immune response in EAE. FOL downregulated the expression of genes involved in misfolded protein response, MAPK activation/signaling, and pro-inflammatory response.<h4>Conclusion</h4>This study provides insight into the molecular impact of FOL in the brain and identifies potential therapeutic targets of the isoprenoid pathway in MS patients.

CA10
Also flagged:membrane proteinscell wallslipidmembranepeptidesfibrils
Journal Article 2023-09-04 ✓ 1 Snippet Toke O.
In-Text Gene Mentions

Statherin, a 43-amino acid salivary protein, has a dual function of inhibiting both the nucleation and the crystal growth of hydroxyapatite (HAP), Ca10(PO4)6(OH)2, the main mineral component of bone and teeth, via a direct interaction with the HAP surface.

Show Full Abstract

Solid-state NMR (ss-NMR) is a powerful tool to investigate noncrystallizable, poorly soluble molecular systems, such as membrane proteins, amyloids, and cell walls, in environments that closely resemble their physical sites of action. Rotational-echo double resonance (REDOR) is an ss-NMR methodology, which by reintroducing heteronuclear dipolar coupling under magic angle spinning conditions provides intramolecular and intermolecular distance restraints at the atomic level. In addition, REDOR can be exploited as a selection tool to filter spectra based on dipolar couplings. Used extensively as a spectroscopic ruler between isolated spins in site-specifically labeled systems and more recently as a building block in multidimensional ss-NMR pulse sequences allowing the simultaneous measurement of multiple distances, REDOR yields atomic-scale information on the structure and interaction of proteins. By extending REDOR to the determination of <sup>1</sup>H-X dipolar couplings in recent years, the limit of measurable distances has reached ~15-20 Å, making it an attractive method of choice for the study of complex biomolecular assemblies. Following a methodological introduction including the most recent implementations, examples are discussed to illustrate the versatility of REDOR in the study of biological systems.

FBXL4
Also flagged:Gene ExpressionCervical CancercancerinfectionMHC class IImmunity
Journal Article 2023-09-04 ✓ 3 Snippets Cakir MO, Bilge U, Naughton D, Ashrafi GH.
In-Text Gene Mentions

…, KLHL22 ,FBXL4, and TRIP12…

…, FBXO4 ,FBXL4, and CALR…

…FBXO4 , andFBXL4.…

Show Full Abstract

Cervical carcinogenesis is the leading cause of cancer-related deaths in women, and the role of high-risk human papillomavirus (HR-HPV) as a possible risk factor in the development of this cancer is well recognized. Despite the availability of multi-therapeutic approaches, there is still major concern regarding the prevention of metastatic dissemination and excessive tissue injuries. Therefore, it is imperative to develop a safer and more efficient treatment modality. <i>Ficus carica</i>, a natural plant, has shown potential therapeutic properties through its fruit latex when applied to HPV-positive cervical cancer cell lines. However, the mechanisms of action of <i>Ficus carica</i> (fig) latex are not well understood. This study aims to provide a deeper insight into the biological activities of fig latex on human cervical cancer cell lines expressing high-risk HPV types 16 and 18. The data obtained from this study reveal that fig latex influences the expression of genes involved in "Class I MHC-mediated antigen presentation" as well as "Antigen processing: Ubiquitination and Proteasome degradation". These genes play a crucial role in host immune surveillance and the resolution of infection. Notably, Western blot analysis corroborated these findings, demonstrating an increase in the expression of MHC class I in HeLa cells after fig latex treatment. Findings from this study suggest that fig latex may enhance T cell responses against oncogenic HPV, which could be beneficial for the clearance of early-stage cancer.

CACNA1E
Also flagged:Estrogen ReceptorBreast Cancermitogen-activated protein kinaseMAPKmetastatic breast cancerER
Journal Article 2023-09-04 ✓ 1 Snippet Angus L, Smid M, Wilting SM, Bos MK, Steeghs N, Konings IRHM, Tjan-Heijnen VCG, van Riel JMGH, van de Wouw AJ, Cpct Consortium, Cuppen E, Lolkema MP, Jager A, Sleijfer S, Martens JWM.
In-Text Gene Mentions

…MAST4 , andCACNA1E.…

Show Full Abstract

Mutations in the estrogen receptor gene (<i>ESR1</i>), its transcriptional regulators, and the mitogen-activated protein kinase (MAPK) pathway are enriched in patients with endocrine-resistant metastatic breast cancer (MBC). Here, we integrated whole genome sequencing with RNA sequencing data from the same samples of 101 ER-positive/HER2-negative MBC patients who underwent a tumor biopsy prior to the start of a new line of treatment for MBC (CPCT-02 study, NCT01855477) to analyze the downstream effects of DNA alterations previously linked to endocrine resistance, thereby gaining a better understanding of the associated mechanisms. Hierarchical clustering was performed using expression of <i>ESR1</i> target genes. Genomic alterations at the DNA level, gene expression levels, and last administered therapy were compared between the identified clusters. Hierarchical clustering revealed two distinct clusters, one of which was characterized by increased expression of <i>ESR1</i> and its target genes. Samples in this cluster were significantly enriched for mutations in <i>ESR1</i> and amplifications in <i>FGFR1</i> and <i>TSPYL.</i> Patients in the other cluster showed relatively lower expression levels of <i>ESR1</i> and its target genes, comparable to ER-negative samples, and more often received endocrine therapy as their last treatment before biopsy. Genes in the MAPK-pathway, including <i>NF1</i>, and <i>ESR1</i> transcriptional regulators were evenly distributed. In conclusion, RNA sequencing identified a subgroup of patients with clear expression of <i>ESR1</i> and its downstream targets, probably still benefiting from ER-targeting agents. The lower ER expression in the other subgroup might be partially explained by ER activity still being blocked by recently administered endocrine treatment, indicating that biopsy timing relative to endocrine treatment needs to be considered when interpreting transcriptomic data.

HTT
Also flagged:BDNFPost-traumatic stressPTSD) disorderPTSDpsychiatric disordersDE
Journal Article 2023-09-04 ✓ 2 Snippets Castillo-Navarrete JL, Vicente B, Schmidt K, Moraga-Escobar E, Rojas-Ponce R, Lagos P, Macaya X, Guzman-Castillo A.
In-Text Gene Mentions

Traumatic events have been described to increase serotonin release in some brain regions (Li et al., 2021a; Madsen et al., 2016; Xie et al., 2009). The 5-HTT gene (SLC6A4) contains a polymorphic region that modifies the expression of the serotonin transporter (Caspi et al., 2003; Li et al., 2021a; Rojas et al., 2015; Zhang et al., 2017).

…The5-HTTgene (SLC6A4) contains…

Show Full Abstract

Post-traumatic stress (PTSD) disorder is a mental health condition that can occur after experiencing or witnessing a traumatic event. The 27-F earthquake that struck Chile in 2010 was one such event that had a significant impact on the mental health of the population. A study was conducted to investigate the prevalence of PTSD and its associated factors among survivors of this earthquake. The study was a longitudinal design, involving a sample of 913 patients aged 18 to 75 years who attended 10 Primary Care Centers in Concepción, Chile. The Composite International Diagnostic Interview (CIDI) was used to assess both depressive episodes (DE) and PTSD before and after the earthquake. The study also involved genotyping studies using saliva samples from the participants, specifically focusing on the Val66Met and 5-HTTLPR polymorphisms. Statistical analysis was performed to examine the association between different variables and the presence of PTSD. These variables included demographic factors, family history of psychiatric disorders, DE, childhood maltreatment experiences, and critical traumatic events related to the earthquake. The results showed that the incidence of post-earthquake PTSD was 11.06%. No significant differences were found between the groups of participants who developed post-earthquake PTSD regarding the Val66Met or 5-HTTLPR polymorphisms. However, a significant association was found between the concomitant diagnosis of DE and the development of post-earthquake PTSD. The presence of DE doubled the risk of developing post-earthquake PTSD. The number of traumatic events experienced also had a statistically significant association with an increased risk of developing post-earthquake PTSD. The study's limitations include the potential interference of different DE subtypes, the complexity of quantifying the degree of earthquake exposure experienced by each individual, and events entailing social disruption, such as looting, that can profoundly influence distress. In conclusion, the study found that PTSD following the 27-F earthquake in Chile was associated with a concomitant diagnosis of DE and the number of traumatic events experienced. The study did not find a significant association between PTSD and the Val66Met or 5-HTTLPR polymorphisms. The researchers recommend that mental health professionals should prioritize the detection and treatment of concomitant depressive episodes and exposure to critical traumatic events in survivors of disasters. They also suggest that further research is needed to better understand the relationship between genetic factors and post-disaster PTSD.

Also flagged:hCGdeathlactational infertilityLAM
Journal Article 2023-09-04 No Snippets Eticha TG, Girma S, Mamo G, Asefa F, Birhanu A, Taye B, Alemu A, Nigussie K, Gedefaw A, Genet T, Amenu D, Mekuria T, Tura AK.
Show Full Abstract

<h4>Background</h4>Although the lactational amenorrhea method (LAM) is one of the most commonly used contraception methods during the first six months of a woman's postpartum period, there has been little research on its effectiveness in general and particularly in Ethiopia. The purpose of this study was to evaluate the effectiveness of LAM and the experiences of Ethiopian women who used it.<h4>Methods</h4>This was a multi-center prospective cohort study of postpartum women from five Ethiopian regions and one city administration. All pregnant women who gave birth in these randomly selected hospitals and five health centers directly referring to the hospitals were invited to the study if they selected LAM and were followed monthly at home. Each month, trained researchers visited the woman at her home and collected information about breast feeding, the return of menses, the resumption of sex, the use of another contraceptive, and a pregnancy test using urine human chorionic gonadotropin (hCG). Women who reported starting new contraceptive methods, resumption of menses, starting complementary feeding, neonatal death, getting pregnant, or refusing were excluded from the cohort. The data were collected using ODK Collect and exported to Stata 14 for analysis.<h4>Results</h4>Among the 2162 women who selected LAM as a contraceptive, 2022 were enrolled in the cohort study, and 901 completed the follow-up. At the end of the sixth month, eight women got pregnant, corresponding to an effectiveness of 99.1%. More than half of the cohort were excluded from the follow-up for reasons of transitioning to other types of contraception, resumption of menses, or refusal to follow-up.<h4>Conclusion</h4>The effectiveness of LAM is high and should be recommended for postpartum women, with proper counseling provided. A study should be conducted to examine the effectiveness of breast feeding as a contraceptive beyond the Bellagio consensus.

Also flagged:transthyretinamyloid cardiomyopathytransthyretin amyloidosisatrial fibrillationventricular tachycardiaVT
Journal Article 2023-09-04 No Snippets Skov JK, Ladefoged B, Clemmensen TS, Poulsen SH.
Show Full Abstract

<h4>Background</h4>General interest and incidence are increasing in wild-type transthyretin amyloidosis (ATTRwt) in recent time. As patient population increases, further knowledge of the management of the frequently encountered interacting cardiac comorbidities is requested to improve treatment of ATTRwt patients.<h4>Case summary</h4>A 73-year-old male ATTRwt patient presented to the outpatient clinic (Day 0) with dyspnoea, leg swelling, and palpitations. At diagnosis, 3 years prior to presentation, he exhibited only minor signs of ATTRwt. At Day 0, clinical examination revealed atrial fibrillation and mild peripheral oedema. Anticoagulant and symptomatic treatment with beta-blocker and diuretics was initiated, and the patient was planned for sub-acute direct cardioversion, and the patient was discharged with a Holter monitor to outpatient care. At Day 7, analysis of the monitoring demonstrated spontaneous conversion to sinus rhythm and, unexpectedly, episodes of high-rate self-remittent sustained monomorphic ventricular tachycardia (VT) and frequent ventricular ectopic beats. At Day 8, a sub-acute coronary angiography was performed which revealed a significant proximal left anterior descending artery stenosis which was treated with percutaneous coronary intervention (PCI) and subsequently an internal defibrillator was implanted. Following visits at 1- and 3-month post-PCI at the outpatient clinic revealed no VT and suppression of ventricular ectopic beats.<h4>Discussion</h4>The case illustrates some of the frequently encountered cardiac comorbidities (e.g. atrial fibrillation, ventricular arrhythmia, and ischaemic heart disease) associated with ATTRwt. A high level of suspicion is warranted to identify treatable cardiac conditions [atrial fibrillation, atrioventricular (AV) block, and ischaemic heart disease] and to uncover potentially fatal cardiac conditions in patients with ATTRwt.

Also flagged:Gene expressionneurogenesisneurological disordersschizophreniaion channelsNF-Kβ
Journal Article 2023-09-04 No Snippets Rashidi SK, Kalirad A, Rafie S, Behzad E, Dezfouli MA.
Show Full Abstract

MicroRNAs (miRNAs) are short non-coding and well-conserved RNAs that are linked to many aspects of development and disorders. MicroRNAs control the expression of genes related to different biological processes and play a prominent role in the harmonious expression of many genes. During neural development of the central nervous system, miRNAs are regulated in time and space. In the mature brain, the dynamic expression of miRNAs continues, highlighting their functional importance in neurons. The hippocampus, as one of the crucial brain structures, is a key component of major functional connections in brain. Gene expression abnormalities in the hippocampus lead to disturbance in neurogenesis, neural maturation and synaptic formation. These disturbances are at the root of several neurological disorders and behavioral deficits, including Alzheimer's disease, epilepsy and schizophrenia. There is strong evidence that abnormalities in miRNAs are contributed in neurodegenerative mechanisms in the hippocampus through imbalanced activity of ion channels, neuronal excitability, synaptic plasticity and neuronal apoptosis. Some miRNAs affect oxidative stress, inflammation, neural differentiation, migration and neurogenesis in the hippocampus. Furthermore, major signaling cascades in neurodegeneration, such as NF-Kβ signaling, PI3/Akt signaling and Notch pathway, are closely modulated by miRNAs. These observations, suggest that microRNAs are significant regulators in the complicated network of gene regulation in the hippocampus. In the current review, we focus on the miRNA functional role in the progression of normal development and neurogenesis of the hippocampus. We also consider how miRNAs in the hippocampus are crucial for gene expression mechanisms in pathophysiological pathways.

HFE
Also flagged:deathEnd-Stage Liver DiseasetacrolimusMycophenolate mofetilcreatininealcohol-related liver disease
Journal Article 2023-09-04 ✓ 1 Snippet Meier RPH, Nunez M, Syed SM, Feng S, Tavakol M, Freise CE, Roberts JP, Ascher NL, Hirose R, Roll GR.
In-Text Gene Mentions

…HAV, HBV, HCV,hemochromatosis, PBC, tumor or…

Show Full Abstract

<h4>Introduction</h4>Donation after circulatory death (DCD) liver transplantation (LT) makes up well less than 1% of all LTs with a Model for End-Stage Liver Disease (MELD)≥35 in the United States. We hypothesized DCD-LT yields acceptable ischemia-reperfusion and reasonable outcomes for recipients with MELD≥35.<h4>Methods</h4>We analyzed recipients with lab-MELD≥35 at transplant within the UCSF (n=41) and the UNOS (n=375) cohorts using multivariate Cox regression and propensity score matching.<h4>Results</h4>In the UCSF cohort, five-year patient survival was 85% for DCD-LTs and 86% for matched-Donation after Brain Death donors-(DBD) LTs (p=0.843). Multivariate analyses showed that younger donor/recipient age and more recent transplants (2011-2021 versus 1999-2010) were associated with better survival. DCD vs. DBD graft use did not significantly impact survival (HR: 1.2, 95%CI 0.6-2.7). The transaminase peak was approximately doubled, indicating suggesting an increased ischemia-reperfusion hit. DCD-LTs had a median post-LT length of stay of 11 days, and 34% (14/41) were on dialysis at discharge versus 12 days and 22% (9/41) for DBD-LTs. 27% (11/41) DCD-LTs versus 12% (5/41) DBD-LTs developed a biliary complication (p=0.095). UNOS cohort analysis confirmed patient survival predictors, but DCD graft emerged as a risk factor (HR: 1.5, 95%CI 1.3-1.9) with five-year patient survival of 65% versus 75% for DBD-LTs (p=0.016). This difference became non-significant in a sub-analysis focusing on MELD 35-36 recipients. Analysis of MELD≥35 DCD recipients showed that donor age of <30yo independently reduced the risk of graft loss by 30% (HR, 95%CI: 0.7 (0.9-0.5), p=0.019). Retransplant status was associated with a doubled risk of adverse event (HR, 95%CI: 2.1 (1.4-3.3), p=0.001). The rejection rates at 1y were similar between DCD- and DBD-LTs, (9.3% (35/375) versus 1,541 (8.7% (1,541/17,677), respectively).<h4>Discussion</h4>In highly selected recipient/donor pair, DCD transplantation is feasible and can achieve comparable survival to DBD transplantation. Biliary complications occurred at the expected rates. In the absence of selection, DCD-LTs outcomes remain worse than those of DBD-LTs.

PTGIS
Also flagged:pulmonary fibrosispulmonary hypertensionPHGene Expressionlymphocyte activationCD4
Journal Article 2023-09-04 ✓ 2 Snippets Zhao H, Wang L, Yan Y, Zhao QH, He J, Jiang R, Luo CJ, Qiu HL, Miao YQ, Gong SG, Yuan P, Wu WH.
In-Text Gene Mentions

They inhibit the activity of other T cells, especially CD8+ cytotoxic T cells, limit the immune response (39), reduce endothelial injury, and then impede PH-mediated vascular remodeling (40, 41) by upregulating COX-2, PTGIS, HO-1, and PD-L1 in the media layer of the pulmonary arteriole (40).

…by upregulating COX-2,PTGIS, HO-1, and PD-L1…

Show Full Abstract

Pulmonary fibrosis (PF) and pulmonary hypertension (PH) have common pathophysiological features, such as the significant remodeling of pulmonary parenchyma and vascular wall. There is no effective specific drug in clinical treatment for these two diseases, resulting in a worse prognosis and higher mortality. This study aimed to screen the common key genes and immune characteristics of PF and PH by means of bioinformatics to find new common therapeutic targets. Expression profiles are downloaded from the Gene Expression Database. Weighted gene co-expression network analysis is used to identify the co-expression modules related to PF and PH. We used the ClueGO software to enrich and analyze the common genes in PF and PH and obtained the protein-protein interaction (PPI) network. Then, the differential genes were screened out in another cohort of PF and PH, and the shared genes were crossed. Finally, RT-PCR verification and immune infiltration analysis were performed on the intersection genes. In the result, the positive correlation module with the highest correlation between PF and PH was determined, and it was found that lymphocyte activation is a common feature of the pathophysiology of PF and PH. Eight common characteristic genes (<i>ACTR2, COL5A2, COL6A3, CYSLTR1, IGF1, RSPO3, SCARNA17</i> and <i>SEL1L</i>) were gained. Immune infiltration showed that compared with the control group, resting CD4 memory T cells were upregulated in PF and PH. Combining the results of crossing characteristic genes in ImmPort database and RT-PCR, the important gene <i>IGF1</i> was obtained. Knocking down <i>IGF1</i> could significantly reduce the proliferation and apoptosis resistance in pulmonary microvascular endothelial cells, pulmonary smooth muscle cells, and fibroblasts induced by hypoxia, platelet-derived growth factor-BB (PDGF-BB), and transforming growth factor-β1 (TGF-β1), respectively. Our work identified the common biomarkers of PF and PH and provided a new candidate gene for the potential therapeutic targets of PF and PH in the future.

HFE
Also flagged:organizationinfectious diseasesInfectionsmalignant diseasecommunicable diseasedeath
Journal Article 2023-09-04 ✓ 1 Snippet Böhler K, Rahmel A, Barreiros AP.
In-Text Gene Mentions

…heart recipient, onehemochromatosistransmitted to the…

Show Full Abstract

The reporting of serious adverse events (SAE) and serious adverse reactions (SAR) is an essential part of an effective vigilance and surveillance system (V&S) in organ donation and transplantation. All SAE and SAR reported to the German organ procurement organization (DSO) between 2016 and 2022 were analyzed. In case of a possible transmission of a disease to one or more recipients, an assessment of imputability was done according to the grading system of the US Disease Transmission Advisory Committee (DTAC). 543 SAE and SAR cases were reported to the DSO and analyzed in detail. 53 of the 543 reports (9.8%) were proven or probable (P/P) transmissions of infectious diseases, malignancies or other diseases to 75 recipients. Infections were the most frequently reported P/P disease transmission occurrences (30/53, 57%). In case of disease transmission, the mortality of the recipients was high (17/75, 23%), especially when a malignant disease was transmitted (11/22, 50 %). Donor-Derived disease transmission is a rare event (53/8,519; 0.6 %), but when it occurs can lead to significant morbidity and mortality.

Also flagged:antibodiesantibodyhemagglutinationglobinglobulinred cell adhesion
Journal Article 2023-09-04 No Snippets Chen DP, Wu PY, Lin YH.
Show Full Abstract

The screening procedure for antibodies is considered the most tedious among the three pretransfusion operations, i.e., ABO and Rhesus (Rh) typing, irregular antibody screening/identification, and crossmatching tests. The commonly used screening method for irregular antibodies in clinics at present is a manual polybrene test (MP). The MP test involves numerous reagent replacement and centrifuge procedures, and the sample volume is expected to be relatively less. Herein, screening red blood cells (RBCs) and serum irregular antibodies are encapsulated in microdroplets with a diameter of ~300 μm for a hemagglutination reaction. Owing to the advantage of spatial limitation in microdroplets, screening RBCs and irregular antibodies can be directly agglutinated, thereby eliminating the need for centrifugation and the addition of reagents to promote agglutination, as required by the MP method. Furthermore, the results for a large number of repeated tests can be concurrently obtained, further simplifying the steps of irregular antibody screening and increasing accuracy. Eight irregular antibodies are screened using the proposed platform, and the results are consistent with the MP method. Moreover, the volume of blood samples and antibodies can be reduced to 10 μL and 5 μL, respectively, which is ten times less than that using the MP method.

HFE
Also flagged:ironFerritiniron-binding proteinFTLFTH1ferroxidase
Journal Article 2023-09-03 ✓ 1 Snippet Shieh JT, Tintos-Hernandez JA, Murali CN, Penon-Portmann M, Flores-Mendez M, Santana A, Bulos JA, Du K, Dupuis L, Damseh N, Mendoza-Londoño R, Berera C, Lee JC, Phillips JJ, Alves CAPF, Dmochowski IJ, Ortiz-González XR.
In-Text Gene Mentions

…had signs ofhemochromatosis.…

Show Full Abstract

Ferritin, the iron-storage protein, is composed of light- and heavy-chain subunits, encoded by FTL and FTH1, respectively. Heterozygous variants in FTL cause hereditary neuroferritinopathy, a type of neurodegeneration with brain iron accumulation (NBIA). Variants in FTH1 have not been previously associated with neurologic disease. We describe the clinical, neuroimaging, and neuropathology findings of five unrelated pediatric patients with de novo heterozygous FTH1 variants. Children presented with developmental delay, epilepsy, and progressive neurologic decline. Nonsense FTH1 variants were identified using whole-exome sequencing, with a recurrent variant (p.Phe171∗) identified in four unrelated individuals. Neuroimaging revealed diffuse volume loss, features of pontocerebellar hypoplasia, and iron accumulation in the basal ganglia. Neuropathology demonstrated widespread ferritin inclusions in the brain. Patient-derived fibroblasts were assayed for ferritin expression, susceptibility to iron accumulation, and oxidative stress. Variant FTH1 mRNA transcripts escape nonsense-mediated decay (NMD), and fibroblasts show elevated ferritin protein levels, markers of oxidative stress, and increased susceptibility to iron accumulation. C-terminal variants in FTH1 truncate ferritin's E helix, altering the 4-fold symmetric pores of the heteropolymer, and likely diminish iron-storage capacity. FTH1 pathogenic variants appear to act by a dominant, toxic gain-of-function mechanism. The data support the conclusion that truncating variants in the last exon of FTH1 cause a disorder in the spectrum of NBIA. Targeted knockdown of mutant FTH1 transcript with antisense oligonucleotides rescues cellular phenotypes and suggests a potential therapeutic strategy for this pediatric neurodegenerative disorder.

Also flagged:sickle cell diseasehaemolytic disorderacute chest syndromeinfectionsstrokeacute anaemia
Journal Article 2023-09-03 No Snippets Oppong-Mensah YG, Odoom SF, Nyanor I, Amuzu EX, Yawnumah SA, Asafo-Adjei E, Nguah SB, Ansong D, Osei-Akoto A, Paintsil V.
Show Full Abstract

<h4>Background and aims</h4>Sickle cell disease (SCD) is the commonest monogenic haemolytic disorder in Africa. Despite strides made in its management, a significant proportion of patients are hospitalized from the various complications of the disease. This study set out to describe the main causes and outcomes of hospitalizations among pediatric patients with SCD.<h4>Methods</h4>A cross-sectional study was conducted at the Pediatric Emergency Unit of Komfo Anokye Teaching Hospital within a period of 12 months to recruit pediatric SCD patients. This study looked at causes of admission, length of hospital stay (LOS), and outcome of admission.<h4>Results</h4>Of the 201 SCD patients recruited, 57.2% were males and majority were of SCD-SS phenotype 83.1%. The median age was 6 years. The three leading causes of hospitalization were Vaso-occlusive pain events (VOPE) (39.8%), acute chest syndrome (ACS) (25.9%), and infections (12.4%). Ten (5.0%) of the patients presented with a stroke. High admissions were observed in June (12.4%) and November (16.9%). The median (interquartile range [IQR]) LOS was 6 days (IQR: 4-10). Six (3.0%) of the patients died from complications of the disease during hospitalization.<h4>Conclusion</h4>VOPE, ACS, infections, and acute anaemia from hyperhaemolysis were observed as the most common causes of admissions among SCD patients. A good outcome of discharge was seen in most of the patients that were hospitalized with a median length of stay of 6 days. This study also strengthens the importance of a good SCD database with patient follow-ups for better outcomes in SCD patients.

Also flagged:Hydroxyapatitetitaniumcobaltsilicongrowthcobalt-chromium
Journal Article 2023-09-03 No Snippets Murphy B, Baez J, Morris MA.
Show Full Abstract

Whilst titanium, stainless steel, and cobalt-chrome alloys are the most common materials for use in orthopaedic implant devices, there are significant advantages in moving to alternative non-metallic substrates. Substrates such as polymers may have advantageous mechanical biological properties whilst other substrates may bring unique capability. A key challenge in the use of non-metal products is producing substrates which can be modified to allow the formation of well-adhered hydroxyapatite films which promote osteointegration and have other beneficial properties. In this work, we aim to develop methodology for the growth of hydroxyapatite films on surfaces other than bulk metallic parts using a wet chemical coating process, and we provide a detailed characterisation of the coatings. In this study, hydroxyapatite is grown from saturated solutions onto thin titanium films and silicon substrates and compared to results from titanium alloy substrates. The coating process efficacy is shown to be dependent on substrate roughness, hydrophilicity, and activation. The mechanism of the hydroxyapatite growth is investigated in terms of initial attachment and morphological development using SEM and XPS analysis. XPS analysis reveals the exact chemical state of the hydroxyapatite compositional elements of Ca, P, and O. The characterisation of grown hydroxyapatite layers by XRD reveals that the hydroxyapatite forms from amorphous phases, displaying preferential crystal growth along the [002] direction, with TEM imagery confirming polycrystalline pockets amid an amorphous matrix. SEM-EDX and FTIR confirmed the presence of hydroxyapatite phases through elemental atomic weight percentages and bond assignment. All data are collated and reviewed for the different substrates. The results demonstrate that once hydroxyapatite seeds, it crystallises in the same manner as bulk titanium whether that be on a titanium or silicon substrate. These data suggest that a range of substrates may be coated using this facile hydroxyapatite deposition technique, just broadening the choice of substrate for a particular function.

Also flagged:GLP-1Abile acidstransporterglucagon-like peptide-1diabetesendocytosis
Journal Article 2023-09-02 No Snippets Kweon S, Lee JH, Yang SB, Park SJ, Subedi L, Shim JH, Cho SS, Choi JU, Byun Y, Park J, Park JW.
Show Full Abstract

<h4>Background</h4>Despite the effectiveness of glucagon-like peptide-1 agonist (GLP-1A) in the treatment of diabetes, its large molecular weight and high hydrophilicity result in poor cellular permeability, thus limiting its oral bioavailability. To address this, we developed a chimeric GLP-1A that targets transporter-mediated endocytosis to enhance cellular permeability to GLP-1A by utilizing the transporters available in the intestine, particularly the apical sodium-dependent bile acid transporter (ASBT).<h4>Methods</h4>In silico molecular docking and molecular dynamics simulations were used to investigate the binding interactions of mono-, bis-, and tetra-deoxycholic acid (DOCA) (monoDOCA, bisDOCA, and tetraDOCA) with ASBT. After synthesizing the chimeric GLP-1A-conjugated oligomeric DOCAs (mD-G1A, bD-G1A, and tD-G1A) using a maleimide reaction, in vitro cellular permeability and insulinotropic effects were assessed. Furthermore, in vivo oral absorption in rats and hypoglycemic effect on diabetic db/db mice model were evaluated.<h4>Results</h4>In silico results showed that tetraDOCA had the lowest interaction energy, indicating high binding affinity to ASBT. Insulinotropic effects of GLP-1A-conjugated oligomeric DOCAs were not different from those of GLP-1A-Cys or exenatide. Moreover, bD-G1A and tD-G1A exhibited improved in vitro Caco-2 cellular permeability and showed higher in vivo bioavailability (7.58% and 8.63%) after oral administration. Regarding hypoglycemic effects on db/db mice, tD-G1A (50 μg/kg) lowered the glucose level more than bD-G1A (50 μg/kg) compared with the control (35.5% vs. 26.4%).<h4>Conclusion</h4>GLP-1A was conjugated with oligomeric DOCAs, and the resulting chimeric compound showed the potential not only for glucagon-like peptide-1 receptor agonist activity but also for oral delivery. These findings suggest that oligomeric DOCAs can be used as effective carriers for oral delivery of GLP-1A, offering a promising solution for enhancing its oral bioavailability and improving diabetes treatment.

SOX6
Also flagged:pancreatic diseasestransposasechromatingene expressionNotchMAPK
Journal Article 2023-09-02 ✓ 3 Snippets Ma Z, Zhang X, Zhong W, Yi H, Chen X, Zhao Y, Ma Y, Song E, Xu T.
In-Text Gene Mentions

…TFs TBX3 andSOX6, while dorsal…

…as CEBPD andSOX6.…

…SOX4 ,SOX6, LRRFIP1 and…

Show Full Abstract

Understanding pancreas development can provide clues for better treatments of pancreatic diseases. However, the molecular heterogeneity and developmental trajectory of the early human pancreas are poorly explored. Here, we performed large-scale single-cell RNA sequencing and single-cell assay for transposase accessible chromatin sequencing of human embryonic pancreas tissue obtained from first-trimester embryos. We unraveled the molecular heterogeneity, developmental trajectories and regulatory networks of the major cell types. The results reveal that dorsal pancreatic multipotent cells in humans exhibit different gene expression patterns than ventral multipotent cells. Pancreato-biliary progenitors that generate ventral multipotent cells in humans were identified. Notch and MAPK signals from mesenchymal cells regulate the differentiation of multipotent cells into trunk and duct cells. Notably, we identified endocrine progenitor subclusters with different differentiation potentials. Although the developmental trajectories are largely conserved between humans and mice, some distinct gene expression patterns have also been identified. Overall, we provide a comprehensive landscape of early human pancreas development to understand its lineage transitions and molecular complexity.

PRDX6
Also flagged:capacitationovulationejaculationphosphatidylinositol 3-kinasePI3Kprotein kinase B
Journal Article 2023-09-02 ✓ 5 Snippets Liao HY, O'Flaherty C.
In-Text Gene Mentions

We previously demonstrated that peroxiredoxin 6 (PRDX6) calcium-independent phospholipase A2 (iPLA2) releases lysophospholipids such as LPA or arachidonic acid (AA) and that inhibiting PRDX6 iPLA2 activity impairs sperm cell viability.

Previously, we also found that PRDX6 iPLA2 activity maintains human sperm viability by activating the PI3K/AKT pathway through the release of fatty acids and lysophospholipids such as lysophosphatidic acid (LPA) and arachidonic acid (AA) [4].

…by peroxiredoxin 6 (PRDX6), an antioxidant enzyme…

PRDX6is unique to…

PRDX6is vital in…

Show Full Abstract

Lysophosphatidic acid (LPA) signalling is essential for maintaining germ cell viability during mouse spermatogenesis; however, its role in human spermatozoa is unknown. We previously demonstrated that peroxiredoxin 6 (PRDX6) calcium-independent phospholipase A<sub>2</sub> (iPLA<sub>2</sub>) releases lysophospholipids such as LPA or arachidonic acid (AA) and that inhibiting PRDX6 iPLA<sub>2</sub> activity impairs sperm cell viability. The exogenous addition of LPA bypassed the inhibition of PRDX6 iPLA<sub>2</sub> activity and maintained the active phosphoinositide 3-kinase (PI3K)/AKT pathway. Here, we aimed to study PI3K/AKT pathway regulation via LPA signalling and protein kinases in maintaining sperm viability. The localization of LPARs in human spermatozoa was determined using immunocytochemistry, and P-PI3K and P-AKT substrate phosphorylations via immunoblotting. Sperm viability was determined using the hypo-osmotic swelling test. LPAR1, 3, 5 and 6 were located on the sperm plasma membrane. The inhibition of LPAR1-3 with Ki16425 promoted the impairment of sperm viability and decreased the phosphorylation of PI3K AKT substrates. Inhibitors of PKC, receptor-type PTK and PLC impaired sperm viability and the PI3K/AKT pathway. Adding 1-oleoyl-2-acetyl-snglycerol (OAG), a cell-permeable analog of diacylglycerol (DAG), prevented the loss of sperm viability and maintained the phosphorylation of PI3K. In conclusion, human sperm viability is supported by LPAR signalling and regulated by PLC, PKC and RT-PTK by maintaining phosphorylation levels of PI3K and AKT substrates.

HFE
Also flagged:Alpha-1 AntitrypsinAAT1) deficiencyinheritedchronic obstructive pulmonary diseaseCOPD
Journal Article 2023-09-02 ✓ 2 Snippets Cuenca I, Botella C, Moya-Quiles MR, Jimenez-Coll V, Galian JA, Martinez-Banaclocha H, Muro-Pérez M, Minguela A, Legaz I, Muro M.
In-Text Gene Mentions

…genes, such asHFE, responsible for hemochromato…

…HFE, responsible forhemochromatosis[ 37 ,…

Show Full Abstract

Alpha-1 antitrypsin (AAT1) deficiency (AAT1D) is an inherited disease with an increased risk of chronic obstructive pulmonary disease (COPD), liver disease, and skin and blood vessel problems. AAT1D is caused by mutations in the SERPINE1 gene (Serine Protease Inhibitor, group A, member 1). Numerous variants of this gene, the Pi system, have been identified. The most frequent allelic variants are Pi*M, Pi*S, and Pi*Z. The development of COPD requires both a genetic predisposition and the contribution of an environmental factor, smoking being the most important. Studies on this deficiency worldwide are very scarce, and it is currently considered a rare disease because it is underdiagnosed. The aim of this study was to analyze the genotypic frequencies of mutations associated with AAT1 deficiency in unrelated bone marrow donors from the donor registry of the Region of Murcia in southeastern Spain due to the high risk of presenting with different pathologies and underdiagnosis in the population. A total of 112 DNA-healthy voluntary unrelated bone marrow donors from different parts of the Region of Murcia were analyzed retrospectively. AAT1 deficiency patient testing involved an automated biochemical screening routine. The three main variants, Pi*M, Pi*Z, and Pi*S, were analyzed in the SERPINE1 gene. Our results showed a frequency of 3.12% of the Pi*Z (K342) mutation in over 224 alleles tested in the healthy population. The frequency of Pi*S (V264) was 11.1%. The frequency of the haplotype with the most dangerous mutation, EK342 EE264, was 4.46%, and the frequency of EK342 EV264 was 1.78% in the healthy population. Frequencies of other EE342 EV264-mutated haplotypes accounted for 18.7%. As for the EE342 VV264 haplotype, 0.89% of the total healthy population presented heterozygous for the EV264 mutation and one individual presented homozygous for the VV264 mutation. In conclusion, the frequencies of Pi mutations in the healthy population of the Region of Murcia were not remarkably different from the few studies reported in Spain. The genotype and haplotype frequencies followed the usual pattern. Health authorities should be aware of this high prevalence of the Pi*S allelic variant and pathological genotypes such as Pi*MZ and Pi*SZ in the healthy population if they consider screening the smoking population.

ZNFX1
Also flagged:membranegestationinseminationmembraneslumeninterferon
Journal Article 2023-09-02 ✓ 1 Snippet Biase FH, Moorey SE, Schnuelle JG, Rodning S, Ortega MS, Spencer TE.
In-Text Gene Mentions

…ZBP1 , andZNFX1) associated with…

Show Full Abstract

Pregnancy loss is a significant problem when embryos produced in vitro are transferred to a synchronized uterus. Currently, mechanisms that underlie losses of in vitro-produced embryos during implantation are largely unknown. We investigated this problem using cattle as a model of conceptus attachment by analyzing transcriptome data of paired extraembryonic membrane and endometrial samples collected on gestation days 18 and 25, which spans the attachment window in cattle. We identified that the transfer of an in vitro-produced embryo caused a significant alteration in transcript abundance of hundreds of genes in extraembryonic and endometrial tissues on gestation days 18 and 25, when compared to pregnancies initiated by artificial insemination. Many of the genes with altered transcript abundance are associated with biological processes that are relevant to the establishment of pregnancy. An integrative analysis of transcriptome data from the conceptus and endometrium identified hundreds of putative ligand-receptor pairs. There was a limited variation of ligand-receptor pairs in pregnancies initiated by in vitro-produced embryos on gestation day 18, and no alteration was observed on gestation day 25. In parallel, we identified that in vitro production of embryos caused an extensive alteration in the coexpression of genes expressed in the extraembryonic membranes and the corresponding endometrium on both gestation days. Both the transcriptional dysregulation that exists in the conceptus or endometrium independently and the rewiring of gene transcription between the conceptus and endometrium are a potential component of the mechanisms that contribute to pregnancy losses caused by in vitro production of embryos.

HTT
Also flagged:BiosynthesismetabolismHDAminoacyl-tRNAMethylationAminoacyl
Journal Article 2023-09-02 ✓ 5 Snippets Vishweswaraiah S, Yilmaz A, Saiyed N, Khalid A, Koladiya PR, Pan X, Macias S, Robinson AC, Mann D, Green BD, Kerševičiūte I, Gordevičius J, Radhakrishna U, Graham SF.
In-Text Gene Mentions

Additionally, the mutant HTT gene appears to impact the epigenetic age of individuals with HD [18].

The root cause of HD is the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene, producing a toxic protein that adversely affects the brain’s cells [2].

…the huntingtin (HTT) gene, producing…

…levels of theHTTgene may contribute…

…Additionally, the mutantHTTgene appears to…

Show Full Abstract

The impact of environmental factors on epigenetic changes is well established, and cellular function is determined not only by the genome but also by interacting partners such as metabolites. Given the significant impact of metabolism on disease progression, exploring the interaction between the metabolome and epigenome may offer new insights into Huntington's disease (HD) diagnosis and treatment. Using fourteen post-mortem HD cases and fourteen control subjects, we performed metabolomic profiling of human postmortem brain tissue (striatum and frontal lobe), and we performed DNA methylome profiling using the same frontal lobe tissue. Along with finding several perturbed metabolites and differentially methylated loci, Aminoacyl-tRNA biosynthesis (adj <i>p</i>-value = 0.0098) was the most significantly perturbed metabolic pathway with which two CpGs of the <i>SEPSECS</i> gene were correlated. This study improves our understanding of molecular biomarker connections and, importantly, increases our knowledge of metabolic alterations driving HD progression.

bioRxiv 2023-09-02 Preprint (No Snippets API) Gierten J, Welz B, Fitzgerald T, Thumberger T, Hummel O, Leger A, Weber P, Hassel D, Hübner N, Birney E, Wittbrodt J.
Show Full Abstract

The polygenic contribution to heart development and function along the health-disease continuum remains unresolved. To gain insight into the genetic basis of quantitative cardiac phenotypes, we utilize highly inbred Japanese rice fish models, Oryzias latipes , and Oryzias sakaizumii . Employing automated quantification of embryonic heart rates as core metric, we profiled phenotype variability across five inbred strains. We observed maximal phenotypic contrast between individuals of the HO5 and the HdrR strain. HO5 showed elevated heart rates associated with embryonic ventricular hypoplasia and impaired adult cardiac function. This contrast served as the basis for genome-wide mapping. In a segregation population of 1192 HO5 x HdrR F2 embryos, we mapped 59 loci (173 genes) associated with heart rate. Experimental validation of the top 12 candidate genes in loss-of-function models revealed their causal and distinct impact on heart rate, development, ventricle size, and arrhythmia. Our study uncovers new diagnostic and therapeutic targets for developmental and electrophysiological cardiac diseases and provides a novel scalable approach to investigate the intricate genetic architecture of the vertebrate heart. <h4>One-Sentence Summary</h4> Key loci for vertebrate heart function mapped and validated, highlighting diagnostic and potential therapeutic targets for cardiac disorders.

medRxiv 2023-09-02 Preprint (No Snippets API) Nievergelt CM, Maihofer AX, Atkinson EG, Chen C, Choi KW, Coleman JR, Daskalakis NP, Duncan LE, Polimanti R, Aaronson C, Amstadter AB, Andersen SB, Andreassen OA, Arbisi PA, Ashley-Koch AE, Austin SB, Avdibegoviç E, Babic D, Bacanu S, Baker DG, Batzler A, Beckham JC, Belangero S, Benjet C, Bergner C, Bierer LM, Biernacka JM, Bierut LJ, Bisson JI, Boks MP, Bolger EA, Brandolino A, Breen G, Bressan RA, Bryant RA, Bustamante AC, Bybjerg-Grauholm J, Bækvad-Hansen M, Børglum AD, Børte S, Cahn L, Calabrese JR, Caldas-de-Almeida JM, Chatzinakos C, Cheema S, Clouston SAP, Colodro-Conde L, Coombes BJ, Cruz-Fuentes CS, Dale AM, Dalvie S, Davis LK, Deckert J, Delahanty DL, Dennis MF, deRoon-Cassini T, Desarnaud F, DiPietro CP, Disner SG, Docherty AR, Domschke K, Dyb G, Kulenovic AD, Edenberg HJ, Evans A, Fabbri C, Fani N, Farrer LA, Feder A, Feeny NC, Flory JD, Forbes D, Franz CE, Galea S, Garrett ME, Gelaye B, Gelernter J, Geuze E, Gillespie CF, Goci A, Goleva SB, Gordon SD, Grasser LR, Guindalini C, Haas M, Hagenaars S, Hauser MA, Heath AC, Hemmings SM, Hesselbrock V, Hickie IB, Hogan K, Hougaard DM, Huang H, Huckins LM, Hveem K, Jakovljevic M, Javanbakht A, Jenkins GD, Johnson J, Jones I, Jovanovic T, Karstoft K, Kaufman ML, Kennedy JL, Kessler RC, Khan A, Kimbrel NA, King AP, Koen N, Kotov R, Kranzler HR, Krebs K, Kremen WS, Kuan P, Lawford BR, Lebois LAM, Lehto K, Levey DF, Lewis C, Liberzon I, Linnstaedt SD, Logue MW, Lori A, Lu Y, Luft BJ, Lupton MK, Luykx JJ, Makotkine I, Maples-Keller JL, Marchese S, Marmar C, Martin NG, MartÍnez-Levy GA, McAloney K, McFarlane A, McLaughlin KA, McLean SA, Medland SE, Mehta D, Meyers J, Michopoulos V, Mikita EA, Milani L, Milberg W, Miller MW, Morey RA, Morris CP, Mors O, Mortensen PB, Mufford MS, Nelson EC, Nordentoft M, Norman SB, Nugent NR, O’Donnell M, Orcutt HK, Pan PM, Panizzon MS, Pathak GA, Peters ES, Peterson AL, Peverill M, Pietrzak RH, Polusny MA, Porjesz B, Powers A, Qin X, Ratanatharathorn A, Risbrough VB, Roberts AL, Rothbaum BO, Rothbaum AO, Roy-Byrne P, Ruggiero KJ, Rung A, Runz H, Rutten BPF, de Viteri SS, Salum GA, Sampson L, Sanchez SE, Santoro M, Seah C, Seedat S, Seng JS, Shabalin A, Sheerin CM, Silove D, Smith AK, Smoller JW, Sponheim SR, Stein DJ, Stensland S, Stevens JS, Sumner JA, Teicher MH, Thompson WK, Tiwari AK, Trapido E, Uddin M, Ursano RJ, Valdimarsdóttir U, van den Heuvel LL, Van Hooff M, van Rooij SJ, Vermetten E, Vinkers CH, Voisey J, Wang Z, Wang Y, Waszczuk M, Weber H, Wendt FR, Werge T, Williams MA, Williamson DE, Winsvold BS, Winternitz S, Wolf EJ, Wolf C, Xia Y, Xiong Y, Yehuda R, Young RM, Young KA, Zai CC, Zai GC, Zervas M, Zhao H, Zo LA.
Show Full Abstract

Posttraumatic stress disorder (PTSD) genetics are characterized by lower discoverability than most other psychiatric disorders. The contribution to biological understanding from previous genetic studies has thus been limited. We performed a multi-ancestry meta-analysis of genome-wide association studies across 1,222,882 individuals of European ancestry (137,136 cases) and 58,051 admixed individuals with African and Native American ancestry (13,624 cases). We identified 95 genome-wide significant loci (80 novel). Convergent multi-omic approaches identified 43 potential causal genes, broadly classified as neurotransmitter and ion channel synaptic modulators (e.g., GRIA1, GRM8, CACNA1E ), developmental, axon guidance, and transcription factors (e.g., FOXP2, EFNA5, DCC ), synaptic structure and function genes (e.g., PCLO, NCAM1, PDE4B ), and endocrine or immune regulators (e.g., ESR1, TRAF3, TANK ). Additional top genes influence stress, immune, fear, and threat-related processes, previously hypothesized to underlie PTSD neurobiology. These findings strengthen our understanding of neurobiological systems relevant to PTSD pathophysiology, while also opening new areas for investigation.

Also flagged:Sickle cell diseasehemolytic anemiarenal failureend-stage renal diseaseglomerular filtrationrenal dysfunction
Journal Article 2023-09-01 No Snippets Garrett ME, Soldano KL, Erwin KN, Zhang Y, Gordeuk VR, Gladwin MT, Telen MJ, Ashley-Koch AE.
Show Full Abstract

Sickle cell disease nephropathy (SCDN), a common SCD complication, is strongly associated with mortality. Polygenic risk scores calculated from recent transethnic meta-analyses of urinary albumin-to-creatinine ratio and estimated glomerular filtration rate (eGFR) trended toward association with proteinuria and eGFR in SCD but the model fit was poor (R2 < 0.01), suggesting that there are likely unique genetic risk factors for SCDN. Therefore, we performed genome-wide association studies (GWAS) for 2 critical manifestations of SCDN, proteinuria and decreased eGFR, in 2 well-characterized adult SCD cohorts, representing, to the best of our knowledge, the largest SCDN sample to date. Meta-analysis identified 6 genome-wide significant associations (false discovery rate, q ≤ 0.05): 3 for proteinuria (CRYL1, VWF, and ADAMTS7) and 3 for eGFR (LRP1B, linc02288, and FPGT-TNNI3K/TNNI3K). These associations are independent of APOL1 risk and represent novel SCDN loci, many with evidence for regulatory function. Moreover, GWAS SNPs in CRYL1, VWF, ADAMTS7, and linc02288 are associated with gene expression in kidney and pathways important to both renal function and SCD biology, supporting the hypothesis that SCDN pathophysiology is distinct from other forms of kidney disease. Together, these findings provide new targets for functional follow-up that could be tested prospectively and potentially used to identify patients with SCD who are at risk, before onset of kidney dysfunction.

MLLT10
Also flagged:endometriosiscancermigraineuterine fibroidsovarian cancermelanoma
Journal Article 2023-09-01 ✓ 4 Snippets McGrath IM, Montgomery GW, Mortlock S.
In-Text Gene Mentions

Similarly, SKAP1 and MLLT10, candidate genes for endometriosis, ovarian cancer and asthma, have also been linked to adhesion and immune regulation and hematopoietic differentiation.

Mix-lineage leukaemia translocated to 10 (MLLT10) is a transcription factor that is involved in several chromosomal rearrangements resulting in leukaemias.

Based on their known functions, all three genes at the 1p36.12 locus have the potential to contribute to the formation and progression of lesions characteristic of endometriosis, fibroids and cancer whilst WNT4, LINC0039, MLLT10, and SKAP1 have known roles in respiratory physiology and/or immune regulation, which are also important factors in asthma and cancer.

Individual candidate target genes identified between multiple endometriosis comorbidities include genes in the 1p36.12 locus, ESR1, GREB1, FSHB, SKAP1, CASC10, MLLT10, ARL14EP, SNX11, CBX1, CDKN2B-AS1, and SMAD3 (Fig. 5).

Show Full Abstract

<h4>Background</h4>Endometriosis remains a poorly understood disease, despite its high prevalence and debilitating symptoms. The overlap in symptoms and the increased risk of multiple other traits in women with endometriosis is becoming increasingly apparent through epidemiological data. Genetic studies offer a method of investigating these comorbid relationships through the assessment of causal relationships with Mendelian randomization (MR), as well as identification of shared genetic variants and genes involved across traits. This has the capacity to identify risk factors for endometriosis as well as provide insight into the aetiology of disease.<h4>Objective and rationale</h4>We aim to review the current literature assessing the relationship between endometriosis and other traits using genomic data, primarily through the methods of MR and genetic correlation. We critically examine the limitations of these studies in accordance with the assumptions of the utilized methods.<h4>Search methods</h4>The PubMed database was used to search for peer-reviewed original research articles using the terms 'Mendelian randomization endometriosis' and '"genetic correlation" endometriosis'. Additionally, a Google Scholar search using the terms '"endometriosis" "mendelian randomization" "genetic correlation"' was performed. All relevant publications (n = 21) published up until 7 October 2022 were included in this review. Upon compilation of all traits with published MR and/or genetic correlation with endometriosis, additional epidemiological and genetic information on their comorbidity with endometriosis was sourced by searching for the trait in conjunction with 'endometriosis' on Google Scholar.<h4>Outcomes</h4>The association between endometriosis and multiple pain, gynaecological, cancer, inflammatory, gastrointestinal, psychological, and anthropometric traits has been assessed using MR analysis and genetic correlation analysis. Genetic correlation analyses provide evidence that genetic factors contributing to endometriosis are shared with multiple traits: migraine, uterine fibroids, subtypes of ovarian cancer, melanoma, asthma, gastro-oesophageal reflux disease, gastritis/duodenitis, and depression, suggesting the involvement of multiple biological mechanisms in endometriosis. The assessment of causality with MR has revealed several potential causes (e.g. depression) and outcomes (e.g. ovarian cancer and uterine fibroids) of a genetic predisposition to endometriosis; however, interpretation of these results requires consideration of potential violations of the MR assumptions.<h4>Wider implications</h4>Genomic studies have demonstrated that there is a molecular basis for the co-occurrence of endometriosis with other traits. Dissection of this overlap has identified shared genes and pathways, which provide insight into the biology of endometriosis. Thoughtful MR studies are necessary to ascertain causality of the comorbidities of endometriosis. Given the significant diagnostic delay of endometriosis of 7-11 years, determining risk factors is necessary to aid diagnosis and reduce the disease burden. Identification of traits for which endometriosis is a risk factor is important for holistic treatment and counselling of the patient. The use of genomic data to disentangle the overlap of endometriosis with other traits has provided insights into the aetiology of endometriosis.

Also flagged:acute myeloid leukemiaAMLmyelodysplasiatumorsMyeloid NeoplasmsAcute Leukemias
Journal Article 2023-09-01 No Snippets Attardi E, Savi A, Borsellino B, Piciocchi A, Cipriani M, Ottone T, Fabiani E, Divona M, Travaglini S, Pascale MR, Awada H, Durmaz A, Visconte V, Della Porta MG, Venditti A, Maciejewski JP, Gurnari C, Voso MT.
Show Full Abstract

The increasing knowledge of molecular genetics of acute myeloid leukemia (AML) necessitated the update of previous diagnostic and prognostic schemes, which resulted in the development of the World Health Organization (WHO), the International Consensus Classification (ICC), and the new European LeukemiaNet (ELN) recommendations in 2022. We aimed to provide a real-world application of the new models, unravel differences and similarities, and test their implementation in clinical AML diagnosis. A total of 1001 patients diagnosed with AML were reclassified based on the new schemes. The overall diagnostic changes between the WHO 2016 and the WHO 2022 and ICC classifications were 22.8% and 23.7%, respectively, with a 13.1% difference in patients' distribution between ICC and WHO 2022. The 2022 ICC "not otherwise specified" and WHO "defined by differentiation" AML category sizes shrank when compared with that in WHO 2016 (24.1% and 26.8% respectively, vs 38.7%), particularly because of an expansion of the myelodysplasia (MDS)-related group. Of 397 patients with a MDS-related AML according to the ICC, 55.9% were defined by the presence of a MDS-related karyotype. The overall restratification between ELN 2017 and ELN 2022 was 12.9%. The 2022 AML classifications led to a significant improvement of diagnostic schemes. In the real-world setting, conventional cytogenetics, usually rapidly available and less expensive than molecular characterization, stratified 56% of secondary AML, still maintaining a powerful diagnostic role. Considering the similarities between WHO and ICC diagnostic schemes, a tentative scheme to generate a unified model is desirable.

Also flagged:tumortumorsCD8oncogenesoncoproteinsPD-L1
Journal Article 2023-09-01 No Snippets Pich-Bavastro C, Yerly L, Di Domizio J, Tissot-Renaud S, Gilliet M, Kuonen F.
Show Full Abstract

<h4>Purpose</h4>Cemiplimab is approved for the treatment of locally advanced basal cell carcinomas (BCC), although with mitigated results. We sought to interrogate the cellular and molecular transcriptional reprogramming underlying BCC resistance to immunotherapy.<h4>Experimental design</h4>Here, we combined spatial and single-cell transcriptomics to deconvolute the spatial heterogeneity of the tumor microenvironment in regard with response to immunotherapy, in a cohort of both naïve and resistant BCCs.<h4>Results</h4>We identified subsets of intermingled cancer-associated fibroblasts (CAF) and macrophages contributing the most to CD8 T-cell exclusion and immunosuppression. Within this spatially resolved peritumoral immunosuppressive niche, CAFs and adjacent macrophages were found to display Activin A-mediated transcriptional reprogramming towards extracellular matrix remodeling, suggesting active participation to CD8 T-cell exclusion. In independent datasets of human skin cancers, Activin A-conditioned CAFs and macrophages were associated with resistance to immune checkpoint inhibitors (ICI).<h4>Conclusions</h4>Altogether, our data identify the cellular and molecular plasticity of tumor microenvironment (TME) and the pivotal role of Activin A in polarizing the TME towards immune suppression and ICI resistance.

ARFGEF2
Also flagged:KRASBiogenesisCircularcancertumorsPDAC
Journal Article 2023-09-01 ✓ 5 Snippets Kong Y, Luo Y, Zheng S, Yang J, Zhang D, Zhao Y, Zheng H, An M, Lin Y, Ai L, Diao X, Lin Q, Chen C, Chen R.
In-Text Gene Mentions

Furthermore, circARFGEF2 exhibited stronger resistance to RNase R compared with ARFGEF2 mRNA, while actinomycin D assay demonstrated that circARFGEF2 had a longer half-life than ARFGEF2 mRNA (Fig. 1M and N; Supplementary Figs. S1M and S1N), indicating that circARFGEF2 was more stable than ARFGEF2 mRNA.

…and 6 ofARFGEF2pre-mRNA to facilitate…

…and 6 ofARFGEF2pre-mRNA to induce…

…between QKI-5 andARFGEF2pre-mRNA…

…between QKI andARFGEF2pre-mRNA.…

Show Full Abstract

Circular RNAs (circRNA) contribute to cancer stemness, proliferation, and metastasis. The biogenesis of circRNAs can be impacted by the genetic landscape of tumors. Herein, we identified a novel circRNA, circARFGEF2 (hsa_circ_0060665), which was upregulated in KRASG12D pancreatic ductal adenocarcinoma (PDAC) and positively associated with KRASG12D PDAC lymph node (LN) metastasis. CircARFGEF2 overexpression significantly facilitated KRASG12D PDAC LN metastasis in vitro and in vivo. Mechanistically, circARFGEF2 biogenesis in KRASG12D PDAC was significantly activated by the alternative splicing factor QKI-5, which recruited U2AF35 to facilitate spliceosome assembly. QKI-5 bound the QKI binding motifs and neighboring reverse complement sequence in intron 3 and 6 of ARFGEF2 pre-mRNA to facilitate circARFGEF2 biogenesis. CircARFGEF2 sponged miR-1205 and promoted the activation of JAK2, which phosphorylated STAT3 to trigger KRASG12D PDAC lymphangiogenesis and LN metastasis. Importantly, circARFGEF2 silencing significantly inhibited LN metastasis in the KrasG12D/+Trp53R172H/+Pdx-1-Cre (KPC) mouse PDAC model. These findings provide insight into the mechanism and metastasis-promoting function of mutant KRAS-mediated circRNA biogenesis.<h4>Significance</h4>Increased splicing-mediated biogenesis of circARFGEF2 in KRAS-mutant pancreatic ductal adenocarcinoma activates JAK2-STAT3 signaling and triggers lymph node metastasis, suggesting circARFGEF2 could be a therapeutic target to inhibit pancreatic cancer progression.

Also flagged:PD-1triple-negative breast cancerCD25IL2antibodiestumor
Journal Article 2023-09-01 No Snippets Fattori S, Le Roy A, Houacine J, Robert L, Abes R, Gorvel L, Granjeaud S, Rouvière MS, Ben Amara A, Boucherit N, Tarpin C, Pakradouni J, Charafe-Jauffret E, Houvenaeghel G, Lambaudie E, Bertucci F, Rochigneux P, Gonçalves A, Foussat A, Chrétien AS, Olive D.
Show Full Abstract

Regulatory T cells (Treg) impede effective antitumor immunity. However, the role of Tregs in the clinical outcomes of patients with triple-negative breast cancer (TNBC) remains controversial. Here, we found that an immunosuppressive TNBC microenvironment is marked by an imbalance between effector αβCD8+ T cells and Tregs harboring hallmarks of highly suppressive effector Tregs (eTreg). Intratumoral eTregs strongly expressed PD-1 and persisted in patients with TNBC resistant to PD-1 blockade. Importantly, CD25 was the most selective surface marker of eTregs in primary TNBC and metastases compared with other candidate targets for eTreg depletion currently being evaluated in trials for patients with advanced TNBC. In a syngeneic TNBC model, the use of Fc-optimized, IL2 sparing, anti-CD25 antibodies synergized with PD-1 blockade to promote systemic antitumor immunity and durable tumor growth control by increasing effector αβCD8+ T-cell/Treg ratios in tumors and in the periphery. Together, this study provides the rationale for the clinical translation of anti-CD25 therapy to improve PD-1 blockade responses in patients with TNBC.<h4>Significance</h4>An imbalance between effector CD8+ T cells and CD25high effector Tregs marks immunosuppressive microenvironments in αPD-1-resistant TNBC and can be reversed through effector Treg depletion to increase αPD-1 efficacy.

POU3F2
Also flagged:neuroendocrine tumorSCLCosimertinibEGFRlung adenocarcinomaNOTCH
Journal Article 2023-09-01 ✓ 1 Snippet Chakraborty S, Coleman C, Manoj P, Demircioglu D, Shah N, de Stanchina E, Rudin CM, Hasson D, Sen T.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Purpose</h4>Small-cell lung cancer (SCLC) is a high-grade neuroendocrine tumor with dismal prognosis and limited treatment options. Lurbinectedin, conditionally approved as a second-line treatment for metastatic SCLC, drives clinical responses in about 35% of patients, and the overall survival (OS) of those who benefit from it remains very low (∼9.3 months). This finding highlights the need to develop improved mechanistic insight and predictive biomarkers of response.<h4>Experimental design</h4>We used human and patient-derived xenograft (PDX)-derived SCLC cell lines to evaluate the effect of lurbinectedin in vitro. We also demonstrate the antitumor effect of lurbinectedin in multiple de novo and transformed SCLC PDX models. Changes in gene and protein expression pre- and post-lurbinectedin treatment was assessed by RNA sequencing and Western blot analysis.<h4>Results</h4>Lurbinectedin markedly reduced cell viability in the majority of SCLC models with the best response on POU2F3-driven SCLC cells. We further demonstrate that lurbinectedin, either as a single agent or in combination with osimertinib, causes an appreciable antitumor response in multiple models of EGFR-mutant lung adenocarcinoma with histologic transformation to SCLC. Transcriptomic analysis identified induction of apoptosis, repression of epithelial-mesenchymal transition, modulation of PI3K/AKT, NOTCH signaling associated with lurbinectedin response in de novo, and transformed SCLC models.<h4>Conclusions</h4>Our study provides a mechanistic insight into lurbinectedin response in SCLC and the first demonstration that lurbinectedin is a potential therapeutic target after SCLC transformation.

VRK2
Also flagged:sleepchronic diseasesPRR12COG5HACD2SH3RF1
Journal Article 2023-09-01 ✓ 1 Snippet Scammell BH, Tchio C, Song Y, Nishiyama T, Louie TL, Dashti HS, Nakatochi M, Zee PC, Daghlas I, Momozawa Y, Cai J, Ollila HM, Redline S, Wakai K, Sofer T, Suzuki S, Lane JM, Saxena R.
In-Text Gene Mentions

VRK2

Show Full Abstract

Both short (≤6 h per night) and long sleep duration (≥9 h per night) are associated with increased risk of chronic diseases. Despite evidence linking habitual sleep duration and risk of disease, the genetic determinants of sleep duration in the general population are poorly understood, especially outside of European (EUR) populations. Here, we report that a polygenic score of 78 European ancestry sleep duration single-nucleotide polymorphisms (SNPs) is associated with sleep duration in an African (n = 7288; P = 0.003), an East Asian (n = 13 618; P = 6 × 10-4) and a South Asian (n = 7485; P = 0.025) genetic ancestry cohort, but not in a Hispanic/Latino cohort (n = 8726; P = 0.71). Furthermore, in a pan-ancestry (N = 483 235) meta-analysis of genome-wide association studies (GWAS) for habitual sleep duration, 73 loci are associated with genome-wide statistical significance. Follow-up of five loci (near HACD2, COG5, PRR12, SH3RF1 and KCNQ5) identified expression-quantitative trait loci for PRR12 and COG5 in brain tissues and pleiotropic associations with cardiovascular and neuropsychiatric traits. Overall, our results suggest that the genetic basis of sleep duration is at least partially shared across diverse ancestry groups.

HFE
Also flagged:heart failure with preservedtransthyretincardiac amyloidosishypertensionobesitydiabetes mellitus
Journal Article 2023-09-01 ✓ 1 Snippet Baron T, Gerovasileiou S, Flachskampf FA.
In-Text Gene Mentions

…yloidosis, Anderson-Fabry, andhemochromatosis, as well as…

Show Full Abstract

Heart failure with preserved ejection fraction (HFpEF) traditionally has been characterized as a form of heart failure without therapeutic options, in particular with a lack of response to the established therapies of heart failure with reduced ejection fraction (HFrEF). However, this is no longer true. Besides physical exercise, risk factor modification, aldosterone blocking agents, and sodium-glucose cotransporter 2 inhibitors, specific therapies are emerging for specific HFpEF etiologies, such as hypertrophic cardiomyopathy or cardiac amyloidosis. This development justifies increased efforts to arrive at specific diagnoses within the umbrella of HFpEF. Cardiac imaging plays by far the largest role in this effort and is discussed in the following review.

Also flagged:Prostaglandin IPulmonary Arterial HypertensionCD16CD8CD14CD4
Journal Article 2023-09-01 No Snippets Norlander AE, Abney M, Cephus JY, Roe CE, Irish JM, Shelburne NJ, Newcomb DC, Hemnes AR, Peebles RS.
Show Full Abstract

No abstract available.

BTN3A3
Also flagged:Psychiatric Disordersschizophreniabipolar disorderdepressionattention deficit and hyperactivityADHD
Journal Article 2023-09-01 ✓ 3 Snippets Li X, Shen A, Zhao Y, Xia J.
In-Text Gene Mentions

Combining MR results using pQTL genetic instruments, we finally proposed 8 drug-targeting genes supported by the strongest MR evidence, including gene ACE, BTN3A3, HAPLN4, MAPK3 and NEK4 for schizophrenia, gene NEK4 and HAPLN4 for bipolar disorder, and gene TIE1 for ADHD.<h4>Conclusions</h4>Our findings with genetic support were more likely to be to succeed in clinical trials.

…including gene ACE,BTN3A3, HAPLN4, MAPK3 and…

BTN3A3

Show Full Abstract

<h4>Background and hypothesis</h4>Psychiatric disorders impose a huge health and economic burden on modern society. However, there is currently no proven completely effective treatment available, partly owing to the inefficiency of drug target identification and validation. We aim to identify therapeutic targets relevant to psychiatric disorders by conducting Mendelian randomization (MR) analysis.<h4>Study design</h4>We performed genome-wide MR analysis by integrating expression quantitative trait loci (eQTL) of 4479 actionable genes that encode druggable proteins and genetic summary statistics from genome-wide association studies of psychiatric disorders. After conducting colocalization analysis on the brain MR findings, we employed protein quantitative trait loci (pQTL) data as genetic proposed instruments for intersecting the colocalized genes to provide further genetic evidence.<h4>Study results</h4>By performing MR and colocalization analysis with eQTL genetic instruments, we obtained 31 promising drug targets for psychiatric disorders, including 21 significant genes for schizophrenia, 7 for bipolar disorder, 2 for depression, 1 for attention deficit and hyperactivity (ADHD) and none for autism spectrum disorder. Combining MR results using pQTL genetic instruments, we finally proposed 8 drug-targeting genes supported by the strongest MR evidence, including gene ACE, BTN3A3, HAPLN4, MAPK3 and NEK4 for schizophrenia, gene NEK4 and HAPLN4 for bipolar disorder, and gene TIE1 for ADHD.<h4>Conclusions</h4>Our findings with genetic support were more likely to be to succeed in clinical trials. In addition, our study prioritizes approved drug targets for the development of new therapies and provides critical drug reuse opportunities for psychiatric disorders.

Also flagged:EstrogenPARPCas9estradiolbreast cancerE2
Journal Article 2023-09-01 No Snippets Traphagen NA, Schwartz GN, Tau S, Roberts AM, Jiang A, Hosford SR, Marotti JD, Goen AE, Romo BA, Johnson AL, Duffy EK, Demidenko E, Heverly P, Mosesson Y, Soucy SM, Kolling F, Miller TW.
Show Full Abstract

<h4>Purpose</h4>Clinical evidence indicates that treatment with estrogens elicits anticancer effects in ∼30% of patients with advanced endocrine-resistant estrogen receptor α (ER)-positive breast cancer. Despite the proven efficacy of estrogen therapy, its mechanism of action is unclear and this treatment remains underused. Mechanistic understanding may offer strategies to enhance therapeutic efficacy.<h4>Experimental design</h4>We performed genome-wide CRISPR/Cas9 screening and transcriptomic profiling in long-term estrogen-deprived ER+ breast cancer cells to identify pathways required for therapeutic response to the estrogen 17β-estradiol (E2). We validated findings in cell lines, patient-derived xenografts (PDX), and patient samples, and developed a novel combination treatment through testing in cell lines and PDX models.<h4>Results</h4>Cells treated with E2 exhibited replication-dependent markers of DNA damage and the DNA damage response prior to apoptosis. Such DNA damage was partially driven by the formation of DNA:RNA hybrids (R-loops). Pharmacologic suppression of the DNA damage response via PARP inhibition with olaparib enhanced E2-induced DNA damage. PARP inhibition synergized with E2 to suppress growth and prevent tumor recurrence in BRCA1/2-mutant and BRCA1/2-wild-type cell line and PDX models.<h4>Conclusions</h4>E2-induced ER activity drives DNA damage and growth inhibition in endocrine-resistant breast cancer cells. Inhibition of the DNA damage response using drugs such as PARP inhibitors can enhance therapeutic response to E2. These findings warrant clinical exploration of the combination of E2 with DNA damage response inhibitors in advanced ER+ breast cancer, and suggest that PARP inhibitors may synergize with therapeutics that exacerbate transcriptional stress.

STAU1
Also flagged:Cancersplicing factorSF3B1hematologic malignanciesmyelodysplastic syndromechronic lymphocytic leukemia
Journal Article 2023-09-01 ✓ 5 Snippets Cusan M, Shen H, Zhang B, Liao A, Yang L, Jin M, Fernandez M, Iyer P, Wu Y, Hart K, Gutierrez C, Nik S, Pruett-Miller SM, Stark J, Obeng EA, Bowman TV, Wu CJ, Lin RJ, Wang L.
In-Text Gene Mentions

…of THOC1 ,STAU1, SERBP1 ,…

…including SERBP1 ,STAU1, SKIV2L ,…

…protein 1) andSTAU1(Staufen double-stranded RNA–b…

STAU1is involved in…

…of SERBP1 ,STAU1, and SKIV2L…

Show Full Abstract

RNA splicing factor SF3B1 is recurrently mutated in various cancers, particularly in hematologic malignancies. We previously reported that coexpression of Sf3b1 mutation and Atm deletion in B cells, but not either lesion alone, leads to the onset of chronic lymphocytic leukemia (CLL) with CLL cells harboring chromosome amplification. However, the exact role of Sf3b1 mutation and Atm deletion in chromosomal instability (CIN) remains unclear. Here, we demonstrated that SF3B1 mutation promotes centromeric R-loop (cen-R-loop) accumulation, leading to increased chromosome oscillation, impaired chromosome segregation, altered spindle architecture, and aneuploidy, which could be alleviated by removal of cen-R-loop and exaggerated by deletion of ATM. Aberrant splicing of key genes involved in R-loop processing underlay augmentation of cen-R-loop, as overexpression of the normal isoform, but not the altered form, mitigated mitotic stress in SF3B1-mutant cells. Our study identifies a critical role of splice variants in linking RNA splicing dysregulation and CIN and highlights cen-R-loop augmentation as a key mechanism for leukemogenesis.

Also flagged:RAS GTPasescancerRASmembraneacylglycophosphatidylinositol-anchored proteins
Journal Article 2023-09-01 No Snippets Liu J, Arora N, Zhou Y.
Show Full Abstract

<i>RAS</i> genes are frequently mutated in cancer. The primary signaling compartment of wild-type and constitutively active oncogenic mutant RAS proteins is the inner leaflet of the plasma membrane (PM). Thus, a better understanding of the unique environment of the PM inner leaflet is important to shed further light on RAS function. Over the past few decades, an integrated approach of superresolution imaging, molecular dynamic simulations, and biophysical assays has yielded new insights into the capacity of RAS proteins to sort lipids with specific headgroups and acyl chains, to assemble signaling nanoclusters on the inner PM. RAS proteins also sense and respond to changes in components of the outer PM leaflet, including glycophosphatidylinositol-anchored proteins, sphingophospholipids, glycosphingolipids, and galectins, as well as cholesterol that translocates between the two leaflets. Such communication between the inner and outer leaflets of the PM, called interleaflet coupling, allows RAS to potentially integrate extracellular mechanical and electrostatic information with intracellular biochemical signaling events, and reciprocally allows mutant RAS-transformed tumor cells to modify tumor microenvironments. Here, we review RAS-lipid interactions and speculate on potential mechanisms that allow communication between the opposing leaflets of the PM.

Also flagged:localizationdegradationlocalizationsmembraneenvelopeorganelles
Journal Article 2023-09-01 No Snippets Wang J, Horlacher M, Cheng L, Winther O.
Show Full Abstract

RNA localization is essential for regulating spatial translation, where RNAs are trafficked to their target locations via various biological mechanisms. In this review, we discuss RNA localization in the context of molecular mechanisms, experimental techniques and machine learning-based prediction tools. Three main types of molecular mechanisms that control the localization of RNA to distinct cellular compartments are reviewed, including directed transport, protection from mRNA degradation, as well as diffusion and local entrapment. Advances in experimental methods, both image and sequence based, provide substantial data resources, which allow for the design of powerful machine learning models to predict RNA localizations. We review the publicly available predictive tools to serve as a guide for users and inspire developers to build more effective prediction models. Finally, we provide an overview of multimodal learning, which may provide a new avenue for the prediction of RNA localization.

SOX6
Also flagged:transcription factorsgene expressionbindingTFchromatinCTCF
Journal Article 2023-09-01 ✓ 1 Snippet Pop RT, Pisante A, Nagy D, Martin PCN, Mikheeva LA, Hayat A, Ficz G, Zabet NR.
In-Text Gene Mentions

…TFs (NR2C2, YBX1,SOX6, SMAD2 and E2F8)…

Show Full Abstract

Transcription factors (TFs) are proteins that affect gene expression by binding to regulatory regions of DNA in a sequence specific manner. The binding of TFs to DNA is controlled by many factors, including the DNA sequence, concentration of TF, chromatin accessibility and co-factors. Here, we systematically investigated the binding mechanism of hundreds of TFs by analysing ChIP-seq data with our explainable statistical model, ChIPanalyser. This tool uses as inputs the DNA sequence binding motif; the capacity to distinguish between strong and weak binding sites; the concentration of TF; and chromatin accessibility. We found that approximately one third of TFs are predicted to bind the genome in a DNA accessibility independent fashion, which includes TFs that can open the chromatin, their co-factors and TFs with similar motifs. Our model predicted this to be the case when the TF binds to its strongest binding regions in the genome, and only a small number of TFs have the capacity to bind dense chromatin at their weakest binding regions, such as CTCF, USF2 and CEBPB. Our study demonstrated that the binding of hundreds of human and mouse TFs is predicted by ChIPanalyser with high accuracy and showed that many TFs can bind dense chromatin.

MLLT10
Also flagged:histone lysine methyltransferasesG9aGLPSetdb1Suv39h1histone methyltransferases
Journal Article 2023-09-01 ✓ 4 Snippets Zhao X, Li X, Sun H, Zhao X, Gao T, Shi P, Chen F, Liu L, Lu X.
In-Text Gene Mentions

…previously reported thatMllt10(AF10), Mllt6 (AF17)…

…specific downregulation ofMllt10, Mllt6 and Mllt3…

…complex consisting ofMllt10(AF10), Mllt6 (AF17),…

…E), but notMllt10( AF10 ),…

Show Full Abstract

Dot1l is a histone methyltransferase without a SET domain and is responsible for H3K79 methylation, which marks active transcription. In contradiction, Dot1l also participates in silencing gene expression. The target regions and mechanism of Dot1l in repressing transcription remain enigmatic. Here, we show that Dot1l represses endogenous retroviruses in embryonic stem cells (ESCs). Specifically, the absence of Dot1l led to the activation of MERVL, which is a marker of 2-cell-like cells. In addition, Dot1l deletion activated the 2-cell-like state and predisposed ESCs to differentiate into trophectoderm lineage. Transcriptome analysis revealed activation of 2-cell genes and meiotic genes by Dot1l deletion. Mechanistically, Dot1l interacted with and co-localized with Npm1 on MERVL, and depletion of Npm1 similarly augmented MERVL expression. The catalytic activity and AT-hook domain of Dot1l are important to suppress MERVL. Notably, Dot1l-Npm1 restricts MERVL by regulating protein level and deposition of histone H1. Furthermore, Dot1l is critical for Npm1 to efficiently interact with histone H1 and inhibit ubiquitination of H1 whereas Npm1 is essential for Dot1l to interact with MERVL. Altogether, we discover that Dot1l represses MERVL through chaperoning H1 by collaborating with Npm1. Importantly, our findings shed light on the non-canonical transcriptional repressive role of Dot1l in ESCs.

MMS22L
Also flagged:FANCD2DNA2 nucleasereplication forksRAD51degradationhydroxyurea
Journal Article 2023-09-01 ✓ 1 Snippet Liu W, Polaczek P, Roubal I, Meng Y, Choe WC, Caron MC, Sedgeman CA, Xi Y, Liu C, Wu Q, Zheng L, Masson JY, Shen B, Campbell JL.
In-Text Gene Mentions

…from BRCA2 orMMS22L/TONSL ( 117 ),…

Show Full Abstract

FANCD2 protein, a key coordinator and effector of the interstrand crosslink repair pathway, is also required to prevent excessive nascent strand degradation at hydroxyurea-induced stalled forks. The RAD51 recombinase has also been implicated in regulation of resection at stalled replication forks. The mechanistic contributions of these proteins to fork protection are not well understood. Here, we used purified FANCD2 and RAD51 to study how each protein regulates DNA resection at stalled forks. We characterized three mechanisms of FANCD2-mediated fork protection: (1) The N-terminal domain of FANCD2 inhibits the essential DNA2 nuclease activity by directly binding to DNA2 accounting for over-resection in FANCD2 defective cells. (2) Independent of dimerization with FANCI, FANCD2 itself stabilizes RAD51 filaments to inhibit multiple nucleases, including DNA2, MRE11 and EXO1. (3) Unexpectedly, we uncovered a new FANCD2 function: by stabilizing RAD51 filaments, FANCD2 acts to stimulate the strand exchange activity of RAD51. Our work biochemically explains non-canonical mechanisms by which FANCD2 and RAD51 protect stalled forks. We propose a model in which the strand exchange activity of FANCD2 provides a simple molecular explanation for genetic interactions between FANCD2 and BRCA2 in the FA/BRCA fork protection pathway.

SOX6
Also flagged:DOT1LCPinterneuronparvalbumincell cyclecell proliferation
Journal Article 2023-09-01 ✓ 5 Snippets Cheffer A, Garcia-Miralles M, Maier E, Akol I, Franz H, Srinivasan VSV, Vogel T.
In-Text Gene Mentions

…1:250; Abcam; ab15580), anti-SOX6(rabbit; 1:50; Santa…

…markers Lhx6 ,Sox6, Sst ,…

…Lmo1 , andSox6, decreased in both…

…of Lhx6 andSox6, which is…

…Sp8 , andSOX6( Fig. 2A–F…

Show Full Abstract

The cortical plate (CP) is composed of excitatory and inhibitory neurons, the latter of which originate in the ganglionic eminences. From their origin in the ventral telencephalon, maturing postmitotic interneurons migrate during embryonic development over some distance to reach their final destination in the CP. The histone methyltransferase Disruptor of Telomeric Silencing 1-like (DOT1L) is necessary for proper CP development and layer distribution of glutamatergic neurons. However, its specific role on cortical interneuron development has not yet been explored. Here, we demonstrate that DOT1L affects interneuron development in a cell autonomous manner. Deletion of Dot1l in Nkx2.1-expressing interneuron precursor cells results in an overall reduction and altered distribution of GABAergic interneurons in the CP from postnatal day 0 onwards. We observed an altered proportion of GABAergic interneurons in the cortex, with a significant decrease in parvalbumin-expressing interneurons. Moreover, a decreased number of mitotic cells at the embryonic day E14.5 was observed upon Dot1l deletion. Altogether, our results indicate that reduced numbers of cortical interneurons upon DOT1L deletion result from premature cell cycle exit, but effects on postmitotic differentiation, maturation, and migration are likely at play as well.

Also flagged:gene expressionoscillationchromatintranscription factorTFtranscription factors
Journal Article 2023-09-01 No Snippets Zhang Y, Chen G, Deng L, Gao B, Yang J, Ding C, Zhang Q, Ouyang W, Guo M, Wang W, Liu B, Zhang Q, Sung WK, Yan J, Li G, Li X.
Show Full Abstract

Photoperiods integrate with the circadian clock to coordinate gene expression rhythms and thus ensure plant fitness to the environment. Genome-wide characterization and comparison of rhythmic genes under different light conditions revealed delayed phase under constant darkness (DD) and reduced amplitude under constant light (LL) in rice. Interestingly, ChIP-seq and RNA-seq profiling of rhythmic genes exhibit synchronous circadian oscillation in H3K9ac modifications at their loci and long non-coding RNAs (lncRNAs) expression at proximal loci. To investigate how gene expression rhythm is regulated in rice, we profiled the open chromatin regions and transcription factor (TF) footprints by time-series ATAC-seq. Although open chromatin regions did not show circadian change, a significant number of TFs were identified to rhythmically associate with chromatin and drive gene expression in a time-dependent manner. Further transcriptional regulatory networks mapping uncovered significant correlation between core clock genes and transcription factors involved in light/temperature signaling. In situ Hi-C of ZT8-specific expressed genes displayed highly connected chromatin association at the same time, whereas this ZT8 chromatin connection network dissociates at ZT20, suggesting the circadian control of gene expression by dynamic spatial chromatin conformation. These findings together implicate the existence of a synchronization mechanism between circadian H3K9ac modifications, chromatin association of TF and gene expression, and provides insights into circadian dynamics of spatial chromatin conformation that associate with gene expression rhythms.

ZNFX1
Also flagged:HELZ2RNase IIcatalytic activityribonucleaseRNasecancer
Journal Article 2023-09-01 ✓ 3 Snippets Huntzinger E, Sinteff J, Morlet B, Séraphin B.
In-Text Gene Mentions

Some other members of the Upf1-like subgroup of helicases such as ZNFX1, MOV10 and MOV10L1 interfere with viral infections and/or dispersion of mobile elements (64–66).

…helicases such asZNFX1, MOV10 and MOV10L1…

…that, like HELZ2,ZNFX1and MOV10 are…

Show Full Abstract

Proteins containing a RNB domain, originally identified in Escherichia coli RNase II, are widely present throughout the tree of life. Many RNB proteins have 3'-5' exoribonucleolytic activity but some have lost catalytic activity during evolution. Database searches identified a new RNB domain-containing protein in human: HELZ2. Analysis of genomic and expression data combined with evolutionary information suggested that the human HELZ2 protein is produced from an unforeseen non-canonical initiation codon in Hominidae. This unusual property was confirmed experimentally, extending the human protein by 247 residues. Human HELZ2 was further shown to be an active ribonuclease despite the substitution of a key residue in its catalytic center. HELZ2 RNase activity is lost in cells from some cancer patients as a result of somatic mutations. HELZ2 harbors also two RNA helicase domains and several zinc fingers and its expression is induced by interferon treatment. We demonstrate that HELZ2 is able to degrade structured RNAs through the coordinated ATP-dependent displacement of duplex RNA mediated by its RNA helicase domains and its 3'-5' ribonucleolytic action. The expression characteristics and biochemical properties of HELZ2 support a role for this factor in response to viruses and/or mobile elements.

DCC
Also flagged:MSL2dosage compensationchromosomebindingchromatinnucleosome
Journal Article 2023-09-01 ✓ 5 Snippets Eggers N, Gkountromichos F, Krause S, Campos-Sparr A, Becker PB.
In-Text Gene Mentions

…dosage compensation complex (DCC) binds exclusively to…

…TheDCCsubunit MSL2, the…

…subunit of theDCC, bears intrinsic sequence…

…of a matureDCC, MSL2 and CLAMP…

…the peaks ofDCCbinding are several…

Show Full Abstract

MSL2, the DNA-binding subunit of the Drosophila dosage compensation complex, cooperates with the ubiquitous protein CLAMP to bind MSL recognition elements (MREs) on the X chromosome. We explore the nature of the cooperative binding to these GA-rich, composite sequence elements in reconstituted naïve embryonic chromatin. We found that the cooperativity requires physical interaction between both proteins. Remarkably, disruption of this interaction does not lead to indirect, nucleosome-mediated cooperativity as expected, but to competition. The protein interaction apparently not only increases the affinity for composite binding sites, but also locks both proteins in a defined dimeric state that prevents competition. High Affinity Sites of MSL2 on the X chromosome contain variable numbers of MREs. We find that the cooperation between MSL2/CLAMP is not influenced by MRE clustering or arrangement, but happens largely at the level of individual MREs. The sites where MSL2/CLAMP bind strongly in vitro locate to all chromosomes and show little overlap to an expanded set of X-chromosomal MSL2 in vivo binding sites generated by CUT&RUN. Apparently, the intrinsic MSL2/CLAMP cooperativity is limited to a small selection of potential sites in vivo. This restriction must be due to components missing in our reconstitution, such as roX2 lncRNA.

Also flagged:non-small-cell lung cancerNSCLCLung Cancerdeathlung-cancerCancer
Journal Article 2023-09-01 No Snippets Fares AF, Li Y, Jiang M, Brown MC, Lam ACL, Aggarwal R, Schmid S, Leighl NB, Shepherd FA, Wang Z, Diao N, Wenzlaff AS, Xie J, Kohno T, Caporaso NE, Harris C, Ma H, Barnett MJ, Leal LF, Fernandez-Tardon G, Pérez-Ríos M, Davies MPA, Taylor F, Schöttker B, Brennan P, Zaridze D, Holcatova I, Lissowska J, Świątkowska B, Mates D, Savic M, Brenner H, Andrew A, Cox A, Field JK, Ruano-Ravina A, Shete SS, Tardon A, Wang Y, Le Marchand L, Reis RM, Schabath MB, Chen C, Shen H, Ryan BM, Landi MT, Shiraishi K, Zhang J, Schwartz AG, Tsao MS, Christiani DC, Yang P, Hung RJ, Xu W, Liu G.
Show Full Abstract

<h4>Background</h4>The association between duration of smoking abstinence before non-small-cell lung cancer (NSCLC) diagnosis and subsequent survival can influence public health messaging delivered in lung-cancer screening. We aimed to assess whether the duration of smoking abstinence before diagnosis of NSCLC is associated with improved survival.<h4>Methods</h4>In this retrospective, pooled analysis of cohort studies, we used 26 cohorts participating in Clinical Outcomes Studies of the International Lung Cancer Consortium (COS-ILCCO) at 23 hospitals. 16 (62%) were from North America, six (23%) were from Europe, three (12%) were from Asia, and one (4%) was from South America. Patients enrolled were diagnosed between June 1, 1983, and Dec 31, 2019. Eligible patients had smoking data before NSCLC diagnosis, epidemiological data at diagnosis (obtained largely from patient questionnaires), and clinical information (retrieved from medical records). Kaplan-Meier curves and multivariable Cox models (ie, adjusted hazard ratios [aHRs]) were generated with individual, harmonised patient data from the consortium database. We estimated overall survival for all causes, measured in years from diagnosis date until the date of the last follow-up or death due to any cause and NSCLC-specific survival.<h4>Findings</h4>Of 42 087 patients with NSCLC in the COS-ILCCO database, 21 893 (52·0%) of whom were male and 20 194 (48·0%) of whom were female, we excluded 4474 (10·6%) with missing data. Compared with current smokers (15 036 [40·0%] of 37 613), patients with 1-3 years of smoking abstinence before NSCLC diagnosis (2890 [7·7%]) had an overall survival aHR of 0·92 (95% CI 0·87-0·97), patients with 3-5 years of smoking abstinence (1114 [3·0%]) had an overall survival aHR of 0·90 (0·83-0·97), and patients with more than 5 years of smoking abstinence (10 841 [28·8%]) had an overall survival aHR of 0·90 (0·87-0·93). Improved NSCLC-specific survival was observed in 4301 (44%) of 9727 patients who had quit cigarette smoking and was significant at abstinence durations of more than 5 years (aHR 0·87, 95% CI 0·81-0·93). Results were consistent across age, sex, histology, and disease-stage distributions.<h4>Interpretation</h4>In this large, pooled analysis of cohort studies across Asia, Europe, North America, and South America, overall survival was improved in patients with NSCLC whose duration of smoking abstinence before diagnosis was as short as 1 year. These findings suggest that quitting smoking can improve overall survival, even if NSCLC is diagnosed at a later lung-cancer screening visit. These findings also support the implementation of public health smoking cessation strategies at any time.<h4>Funding</h4>The Alan B Brown Chair, The Posluns Family Fund, The Lusi Wong Fund, and the Princess Margaret Cancer Foundation.

MLLT10
Also flagged:cancercancersKIAA1549BRAFTMPRSS2ERG
Journal Article 2023-09-01 ✓ 1 Snippet Kim P, Kumar H, Yang C, Luo R, Liu J, Zhou X.
In-Text Gene Mentions

…ion genes (KMT2A-AFF1, PICALM-MLLT10and PML-RARA) as…

Show Full Abstract

Microhomology-mediated end joining (MMEJ), an error-prone DNA damage repair mechanism, frequently leads to chromosomal rearrangements due to its ability to engage in promiscuous end joining of genomic instability and also leads to increasing mutational load at the sequences flanking the breakpoints (BPs). In this study, we systematically investigated the homology sequences around the genomic breakpoint area of human fusion genes, which were formed by the chromosomal rearrangements initiated by DNA double-strand breakage. Since the RNA-seq data is the typical data set to check the fusion genes, for the known exon junction fusion breakpoints identified from RNA-seq data, we have to infer the high chance of genomic breakpoint regions. For this, we utilized the high feature importance score area calculated from our recently developed fusion BP prediction model, FusionAI and identified 151 K microhomologies among ~24 K fusion BPs in 20 K fusion genes. From our multiple bioinformatics studies, we found a relationship between sequence homologies and the immune system. This in-silico study will provide novel knowledge on the sequence homologies around the coded structural variants.

DCC
Also flagged:chromatinorganizationpathogenesisgene expressionchromosomesnucleus
Journal Article 2023-09-01 ✓ 1 Snippet Lee L, Yu M, Li X, Zhu C, Zhang Y, Yu H, Chen Z, Mishra S, Ren B, Li Y, Hu M.
In-Text Gene Mentions

DCC

Show Full Abstract

Single-cell high-throughput chromatin conformation capture technologies (scHi-C) has been used to map chromatin spatial organization in complex tissues. However, computational tools to detect differential chromatin contacts (DCCs) from scHi-C datasets in development and through disease pathogenesis are still lacking. Here, we present SnapHiC-D, a computational pipeline to identify DCCs between two scHi-C datasets. Compared to methods designed for bulk Hi-C data, SnapHiC-D detects DCCs with high sensitivity and accuracy. We used SnapHiC-D to identify cell-type-specific chromatin contacts at 10 Kb resolution in mouse hippocampal and human prefrontal cortical tissues, demonstrating that DCCs detected in the hippocampal and cortical cell types are generally associated with cell-type-specific gene expression patterns and epigenomic features. SnapHiC-D is freely available at https://github.com/HuMingLab/SnapHiC-D.

SOX6
Also flagged:chromatincancertumoroligonucleotidepolymerasegene expression
Journal Article 2023-09-01 ✓ 1 Snippet Athaya T, Ripan RC, Li X, Hu H.
In-Text Gene Mentions

…of Adarb2 andSox6genes in scRNA-seq…

Show Full Abstract

Integrating single-cell multi-omics data is a challenging task that has led to new insights into complex cellular systems. Various computational methods have been proposed to effectively integrate these rapidly accumulating datasets, including deep learning. However, despite the proven success of deep learning in integrating multi-omics data and its better performance over classical computational methods, there has been no systematic study of its application to single-cell multi-omics data integration. To fill this gap, we conducted a literature review to explore the use of multimodal deep learning techniques in single-cell multi-omics data integration, taking into account recent studies from multiple perspectives. Specifically, we first summarized different modalities found in single-cell multi-omics data. We then reviewed current deep learning techniques for processing multimodal data and categorized deep learning-based integration methods for single-cell multi-omics data according to data modality, deep learning architecture, fusion strategy, key tasks and downstream analysis. Finally, we provided insights into using these deep learning models to integrate multi-omics data and better understand single-cell biological mechanisms.

VRK2
Also flagged:FBXL6transketolasemTORliver cancerhepatocellular carcinomaF-Box and Leucine Rich Repeat Protein 6
Journal Article 2023-09-01 ✓ 5 Snippets Zhang J, Lin XT, Yu HQ, Fang L, Wu D, Luo YD, Zhang YJ, Xie CM.
In-Text Gene Mentions

The activated TKT protein level correlates positively with the protein levels of FBXL6 and VRK2 and predicts unfavorable survival in HCC patients

Activated TKT further increased PD-L1 and VRK2 expression via the ROS-mTOR axis, leading to immune evasion and HCC metastasis.

Our results suggest that elevated FBXL6 expression promotes VRK2 phosphorylation-dependent TKT polyubiquitination and activation and thereby enhances ROS-mTOR-mediated upregulation of VRK2 and PD-L1 expression and immune evasion, ultimately promoting HCC metastasis (Fig. 7k).

Taken together, these findings demonstrate that VRK2 is a downstream target of the FBXL6-TKT-ROS-mTOR axis and facilitates FBXL6-mediated HCC tumorigenesis and metastasis.

Inhibition or knockdown of VRK2 significantly blocked the FBXL6-mediated cell proliferation and migration of HCC cells (Fig. 5i, j, Supplementary Fig. 11g, h).

Show Full Abstract

Metastatic hepatocellular carcinoma (HCC) is the most lethal malignancy and lacks effective treatment. FBXL6 is overexpressed in human hepatocellular carcinoma (HCC), but whether this change drives liver tumorigenesis and lung metastasis in vivo remains unknown. In this study, we aimed to identify FBXL6 (F-Box and Leucine Rich Repeat Protein 6) as a key driver of HCC metastasis and to provide a new paradigm for HCC therapy. We found that elevated FBXL6 expression in hepatocytes drove HCC lung metastasis and was a much stronger driver than Kras mutation (Kras<sup>G12D/+</sup>;Alb-Cre), p53 haploinsufficiency (p53<sup>+/-</sup>) or Tsc1 loss (Tsc1<sup>fl/fl</sup>;Alb-Cre). Mechanistically, VRK2 promoted Thr287 phosphorylation of TKT and then recruited FBXL6 to promote TKT ubiquitination and activation. Activated TKT further increased PD-L1 and VRK2 expression via the ROS-mTOR axis, leading to immune evasion and HCC metastasis. Targeting or knockdown of TKT significantly blocked FBXL6-driven immune evasion and HCC metastasis in vitro and in vivo. Notably, the level of active TKT (p-Thr287 TKT) was increased and was positively correlated with the FBXL6 and VRK2 expression levels in HCC patients. Our work provides novel mechanistic insights into FBXL6-driven HCC metastasis and suggests that targeting the TKT-ROS-mTOR-PD-L1/VRK2 axis is a new paradigm for treating patients with metastatic HCC with high FBXL6 expression.

SERPINC1
Also flagged:extracellularorganizationmetabolismureasynthesiscoagulation factor
Journal Article 2023-09-01 ✓ 2 Snippets Harrison SP, Siller R, Tanaka Y, Chollet ME, de la Morena-Barrio ME, Xiang Y, Patterson B, Andersen E, Bravo-Pérez C, Kempf H, Åsrud KS, Lunov O, Dejneka A, Mowinckel MC, Stavik B, Sandset PM, Melum E, Baumgarten S, Bonanini F, Kurek D, Mathapati S, Almaas R, Sharma K, Wilson SR, Skottvoll FS, Boger IC, Bogen IL, Nyman TA, Wu JJ, Bezrouk A, Cizkova D, Corral J, Mokry J, Zweigerdt R, Park IH, Sullivan GJ.
In-Text Gene Mentions

GO analysis indicated that these enriched proteins were involved in a variety of metabolic pathways and functions, including blood coagulation (F2, SERPINC1, SERPING1, FGG, FGA, etc.)and glutamine family amino acid metabolic processes (ARG1, ASS1, FAH, GLUL, GFPT1, GOT1, GOT2, etc.)(Fig. 3A and Supplementary Table 1).

…blood coagulation (F2,SERPINC1, SERPING1, FGG, FGA,…

Show Full Abstract

The lack of physiological parity between 2D cell culture and in vivo culture has led to the development of more organotypic models, such as organoids. Organoid models have been developed for a number of tissues, including the liver. Current organoid protocols are characterized by a reliance on extracellular matrices (ECMs), patterning in 2D culture, costly growth factors and a lack of cellular diversity, structure, and organization. Current hepatic organoid models are generally simplistic and composed of hepatocytes or cholangiocytes, rendering them less physiologically relevant compared to native tissue. We have developed an approach that does not require 2D patterning, is ECM independent, and employs small molecules to mimic embryonic liver development that produces large quantities of liver-like organoids. Using single-cell RNA sequencing and immunofluorescence, we demonstrate a liver-like cellular repertoire, a higher order cellular complexity, presenting with vascular luminal structures, and a population of resident macrophages: Kupffer cells. The organoids exhibit key liver functions, including drug metabolism, serum protein production, urea synthesis and coagulation factor production, with preserved post-translational modifications such as N-glycosylation and functionality. The organoids can be transplanted and maintained long term in mice producing human albumin. The organoids exhibit a complex cellular repertoire reflective of the organ and have de novo vascularization and liver-like function. These characteristics are a prerequisite for many applications from cellular therapy, tissue engineering, drug toxicity assessment, and disease modeling to basic developmental biology.

SUDS3
Also flagged:Breast cancermalignant diseasecancertranscription factorshistonebreast tumors
Journal Article 2023-09-01 ✓ 1 Snippet Bao L, Kumar A, Zhu M, Peng Y, Xing C, Wang JE, Wang Y, Luo W.
In-Text Gene Mentions

…, HDAC2 ,SUDS3, and RBBP4…

Show Full Abstract

SAP30 is a core subunit of the transcriptional corepressor SIN3 complex, but little is known about its role in gene regulation and human cancer. Here, we show that SAP30 was a nonmutational oncoprotein upregulated in more than 50% of human breast tumors and correlated with unfavorable outcomes in patients with breast cancer. In various breast cancer mouse models, we found that SAP30 promoted tumor growth and metastasis through its interaction with SIN3A/3B. Surprisingly, the canonical gene silencing role was not essential for SAP30's tumor-promoting actions. SAP30 enhanced chromatin accessibility and RNA polymerase II occupancy at promoters in breast cancer cells, acting as a coactivator for genes involved in cell motility, angiogenesis, and lymphangiogenesis, thereby driving tumor progression. Notably, SAP30 formed a homodimer with 1 subunit binding to SIN3A and another subunit recruiting MLL1 through specific Phe186/200 residues within its transactivation domain. MLL1 was required for SAP30-mediated transcriptional coactivation and breast tumor progression. Collectively, our findings reveal that SAP30 represents a transcriptional dependency in breast cancer.

PRDX6
Also flagged:head and neck squamous cell carcinomaHNSCCGene Expressiontumorcell cycleSquamous cell carcinoma of the head and neck
Journal Article 2023-09-01 ✓ 1 Snippet You P, Liu S, Li Q, Xie D, Yao L, Guo C, Guo Z, Wang T, Qiu H, Guo Y, Li J, Zhou H.
In-Text Gene Mentions

PRDX6

Show Full Abstract

<h4>Background</h4>The advantages of radiotherapy for head and neck squamous cell carcinoma (HNSCC) depend on the radiation sensitivity of the patient. Here, we established and verified radiological factor-related gene signature and built a prognostic risk model to predict whether radiotherapy would be beneficial.<h4>Methods</h4>Data from The Cancer Genome Atlas, Gene Expression Omnibus, and RadAtlas databases were subjected to LASSO regression, univariate COX regression, and multivariate COX regression analyses to integrate genomic and clinical information from patients with HNSCC. HNSCC radiation-related prognostic genes were identified, and patients classified into high- and low-risk groups, based on risk scores. Variations in radiation sensitivity according to immunological microenvironment, functional pathways, and immunotherapy response were investigated. Finally, the expression of HNSCC radiation-related genes was verified by qRT-PCR.<h4>Results</h4>We built a clinical risk prediction model comprising a 15-gene signature and used it to divide patients into two groups based on their susceptibility to radiation: radiation-sensitive and radiation-resistant. Overall survival was significantly greater in the radiation-sensitive than the radiation-resistant group. Further, our model was an independent predictor of radiotherapy response, outperforming other clinical parameters, and could be combined with tumor mutational burden, to identify the target population with good predictive value for prognosis at 1, 2, and 3 years. Additionally, the radiation-resistant group was more vulnerable to low levels of immune infiltration, which are significantly associated with DNA damage repair, hypoxia, and cell cycle regulation. Tumor Immune Dysfunction and Exclusion scores also suggested that the resistant group would respond less favorably to immunotherapy.<h4>Conclusions</h4>Our prognostic model based on a radiation-related gene signature has potential for application as a tool for risk stratification of radiation therapy for patients with HNSCC, helping to identify candidates for radiation therapy and overcome radiation resistance.

Also flagged:ANeating disordermalnutritionpsychopathologiesneuroticismanxious personality disorders
Journal Article 2023-09-01 No Snippets Bang L, Bahrami S, Hindley G, Smeland OB, Rødevand L, Jaholkowski PP, Shadrin A, Connell KSO, Frei O, Lin A, Rahman Z, Cheng W, Parker N, Fan CC, Dale AM, Djurovic S, Bulik CM, Andreassen OA.
Show Full Abstract

Anorexia nervosa (AN) is a heritable eating disorder (50-60%) with an array of commonly comorbid psychiatric disorders and related traits. Although significant genetic correlations between AN and psychiatric disorders and related traits have been reported, their shared genetic architecture is largely understudied. We investigated the shared genetic architecture of AN and schizophrenia (SCZ), bipolar disorder (BIP), major depression (MD), mood instability (Mood), neuroticism (NEUR), and intelligence (INT). We applied the conditional false discovery rate (FDR) method to identify novel risk loci for AN, and conjunctional FDR to identify loci shared between AN and related phenotypes, to summarize statistics from relevant genome-wide association studies (GWAS). Individual GWAS samples varied from 72,517 to 420,879 participants. Using conditional FDR we identified 58 novel AN loci. Furthermore, we identified 38 unique loci shared between AN and major psychiatric disorders (SCZ, BIP, and MD) and 45 between AN and psychological traits (Mood, NEUR, and INT). In line with genetic correlations, the majority of shared loci showed concordant effect directions. Functional analyses revealed that the shared loci are involved in 65 unique pathways, several of which overlapped across analyses, including the "signal by MST1" pathway involved in Hippo signaling. In conclusion, we demonstrated genetic overlap between AN and major psychiatric disorders and related traits, and identified novel risk loci for AN by leveraging this overlap. Our results indicate that some shared characteristics between AN and related disorders and traits may have genetic underpinnings.

CCDC92
Also flagged:obesitycentral obesitygene expressionSEC16BBDNFFTO
Journal Article 2023-09-01 ✓ 1 Snippet Anwar MY, Graff M, Highland HM, Smit R, Wang Z, Buchanan VL, Young KL, Kenny EE, Fernandez-Rhodes L, Liu S, Assimes T, Garcia DO, Daeeun K, Gignoux CR, Justice AE, Haiman CA, Buyske S, Peters U, Loos RJF, Kooperberg C, North KE.
In-Text Gene Mentions

CCDC92

Show Full Abstract

Inadequate representation of non-European ancestry populations in genome-wide association studies (GWAS) has limited opportunities to isolate functional variants. Fine-mapping in multi-ancestry populations should improve the efficiency of prioritizing variants for functional interrogation. To evaluate this hypothesis, we leveraged ancestry architecture to perform comparative GWAS and fine-mapping of obesity-related phenotypes in European ancestry populations from the UK Biobank (UKBB) and multi-ancestry samples from the Population Architecture for Genetic Epidemiology (PAGE) consortium with comparable sample sizes. In the investigated regions with genome-wide significant associations for obesity-related traits, fine-mapping in our ancestrally diverse sample led to 95% and 99% credible sets (CS) with fewer variants than in the European ancestry sample. Lead fine-mapped variants in PAGE regions had higher average coding scores, and higher average posterior probabilities for causality compared to UKBB. Importantly, 99% CS in PAGE loci contained strong expression quantitative trait loci (eQTLs) in adipose tissues or harbored more variants in tighter linkage disequilibrium (LD) with eQTLs. Leveraging ancestrally diverse populations with heterogeneous ancestry architectures, coupled with functional annotation, increased fine-mapping efficiency and performance, and reduced the set of candidate variants for consideration for future functional studies. Significant overlap in genetic causal variants across populations suggests generalizability of genetic mechanisms underpinning obesity-related traits across populations.

B4GALT5
Also flagged:UGCGheart hypertrophymitochondrialheart failureUDP-glucose ceramide glycosyltransferasemetabolism
Journal Article 2023-09-01 ✓ 5 Snippets Cui S, Zhang X, Li Y, Hu S, Wu B, Fang Z, Gao J, Li M, Wu H, Tao B, Xia H, Xu L.
In-Text Gene Mentions

Therefore, this study aims to elucidate the mechanisms underlying the role of UGCG in pathological myocardial hypertrophy and investigate the potential joint mediation of UGCG and B4GalT5 in the regulation of cardiac hypertrophy.

Consequently, our findings suggest that the UGCG and B4GalT5 molecular axes may control ERK signaling, ultimately influencing myocardial hypertrophy.

Notably, limiting the expression of B4GalT5 impaired the capacity of UGCG to promote myocardial hypertrophy, suggesting that B4GalT5 acts as an intermediary for UGCG.

As shown in Fig. 6, compared with the UGCG overexpressing group, the group that received a simultaneous administration of UGCG overexpression and B4GalT5 inhibition showed improved myocardial hypertrophy (Fig. 6A–D) and myocardial fibrosis (Fig. 6A, E), along with a decreased myocardial size (Fig. 6F, G) and inhibited expression of ANP and BNP (Fig. 6H–J).

Taken together, these findings strongly suggest that the involvement of UGCG and B4GalT5 in myocardial hypertrophy may be mediated through ERK signaling.

Show Full Abstract

Mechanical pressure overload and other stimuli often contribute to heart hypertrophy, a significant factor in the induction of heart failure. The UDP-glucose ceramide glycosyltransferase (UGCG) enzyme plays a crucial role in the metabolism of sphingolipids through the production of glucosylceramide. However, its role in heart hypertrophy remains unknown. In this study, UGCG was induced in response to pressure overload in vivo and phenylephrine stimulation in vitro. Additionally, UGCG downregulation ameliorated cardiomyocyte hypertrophy, improved cardiomyocyte mitochondrial oxidative stress, and reduced the ERK signaling pathway. Conversely, UGCG overexpression in cardiomyocytes promoted heart hypertrophy development, aggravated mitochondrial oxidative stress, and stimulated ERK signaling. Furthermore, the interaction between beta-1,4-galactosyltransferase 5 (B4GalT5), which catalyses the synthesis of lactosylceramide, and UGCG was identified, which also functions as a synergistic molecule of UGCG. Notably, limiting the expression of B4GalT5 impaired the capacity of UGCG to promote myocardial hypertrophy, suggesting that B4GalT5 acts as an intermediary for UGCG. Overall, this study highlights the potential of UGCG as a modulator of heart hypertrophy, rendering it a potential target for combating heart hypertrophy.

Also flagged:Attention deficit hyperactivity disorderADHDattention deficitdopamine transporterDATDopamine receptor D1
Journal Article 2023-09-01 No Snippets Zhao Y, Zhong Y, Chen W, Chang S, Cao Q, Wang Y, Yang L.
Show Full Abstract

<h4>Objective</h4>Working memory (WM) deficits have frequently been linked to attention deficit hyperactivity disorder (ADHD). Despite previous studies suggested its high heritability, its genetic basis, especially in ADHD, remains unclear. The current study aimed to comprehensively explore the genetic basis of visual-spatial working memory (VSWM) in ADHD using wide-ranging genetic analyses.<h4>Methods</h4>The current study recruited a cohort consisted of 802 ADHD individuals, all met DSM-IV ADHD diagnostic criteria. VSWM was assessed by Rey-Osterrieth complex figure test (RCFT), which is a widely used psychological test include four memory indexes: detail delayed (DD), structure delayed (SD), structure immediate (SI), detail immediate (DI). Genetic analyses were conducted at the single nucleotide polymorphism (SNP), gene, pathway, polygenic and protein network levels. Polygenic Risk Scores (PRS) were based on summary statistics of various psychiatric disorders, including ADHD, autism spectrum disorder (ASD), major depressive disorder (MDD), schizophrenia (SCZ), obsessive compulsive disorders (OCD), and substance use disorder (SUD).<h4>Results</h4>Analyses at the single-marker level did not yield significant results (5E-08). However, the potential signals with P values less than E-05 and their mapped genes suggested the regulation of VSWM involved both ocular and neural system related genes, moreover, ADHD-related genes were also involved. The gene-based analysis found RAB11FIP1, whose encoded protein modulates several neurodevelopment processes and visual system, as significantly associated with DD scores (P = 1.96E-06, P<sub>adj</sub> = 0.036). Candidate pathway enrichment analyses (N = 53) found that forebrain neuron fate commitment significantly enriched in DD (P = 4.78E-04, Padj = 0.025), and dopamine transport enriched in SD (P = 5.90E-04, Padj = 0.031). We also observed a significant negative relationship between DD scores and ADHD PRS scores (P = 0.0025, Empirical P = 0.048).<h4>Conclusions</h4>Our results emphasized the joint contribution of ocular and neural genes in regulating VSWM. The study reveals a shared genetic basis between ADHD and VSWM, with GWAS indicating the involvement of ADHD-related genes in VSWM. Additionally, the PRS analysis identifies a significant relationship between ADHD-PRS and DD scores. Overall, our findings shed light on the genetic basis of VSWM deficits in ADHD, and may have important implications for future research and clinical practice.

DCC
Also flagged:rectal cancerWNTAPCrectal adenocarcinomaMSH6PMS1
Journal Article 2023-09-01 ✓ 1 Snippet Rateria N, Ojha R, Shukla M, Pandey M.
In-Text Gene Mentions

…loss of 18q (DCC, SMAD2, SMAD4), and…

Show Full Abstract

<h4>Background</h4>Colorectal cancer with a global incidence of 10% has multiple pathways implicated in its carcinogenesis. WNT signaling is the principal underlying pathway via APC gene, while defective mismatch repair genes and epigenetic changes also are known to contribute.<h4>Case presentation</h4>Here, we present an unusual case of rectal adenocarcinoma in a woman, with germline MSH6 and PMS1 mutations, and simultaneous somatic APC and TP53 mutations treated with surgery and adjuvant capecitabine.<h4>Conclusions</h4>The case is unique suggesting a possible interaction between the two pathways and contributing to carcinogenesis in this patient. This also suggests need for a thorough germline and somatic mutation evaluation in select colorectal cancer patients to direct a tailored therapy.

HTT
Also flagged:Central Nervous SystemGenetic DisordersHuntington's diseaseHDneurodegenerative disorderCas9
Journal Article 2023-09-01 ✓ 1 Snippet Duarte F, Vachey G, Caron NS, Sipion M, Rey M, Perrier AL, Hayden MR, Déglon N.
In-Text Gene Mentions

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by a toxic gain-of-function CAG expansion in the first exon of the huntingtin (<i>HTT</i>) gene.

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by a toxic gain-of-function CAG expansion in the first exon of the huntingtin (<i>HTT</i>) gene. The monogenic nature of HD makes mutant <i>HTT</i> (<i>mHTT</i>) inactivation a promising therapeutic strategy. Single nucleotide polymorphisms frequently associated with CAG expansion have been explored to selectively inactivate <i>mHTT</i> allele using the CRISPR/Cas9 system. One of such allele-selective approaches consists of excising a region flanking the first exon of <i>mHTT</i> by inducing simultaneous double-strand breaks at upstream and downstream positions of the <i>mHTT</i> exon 1. The removal of the first exon of <i>mHTT</i> deletes the CAG expansion and important transcription regulatory sites, leading to <i>mHTT</i> inactivation. However, the frequency of deletion events is yet to be quantified either <i>in vitro</i> or <i>in vivo</i>. Here, we developed accurate quantitative digital polymerase chain reaction-based assays to assess <i>HTT</i> exon 1 deletion <i>in vitro</i> and in fully humanized HU97/18 mice. Our results demonstrate that dual-single guide RNA (sgRNA) strategies are efficient and that 67% of HTT editing events are leading to exon 1 deletion in HEK293T cells. In contrast, these sgRNA actively cleaved <i>HTT</i> in HU97/18 mice, but most editing events do not lead to exon 1 deletion (10% exon 1 deletion). We also showed that the <i>in vivo</i> editing pattern is not affected by CAG expansion but may potentially be due to the presence of multiple copies of wildtype <i>(wt)/mHTT</i> genes HU97/18 mice as well as the slow kinetics of AAV-mediated CRISPR/Cas9 delivery.

PRDX6
Also flagged:Endoplasmic reticulumAgingcardiovascular diseasemitochondrialperoxiredoxinsdegradation
Journal Article 2023-09-01 ✓ 1 Snippet Chen Q, Thompson J, Hu Y, Lesnefsky EJ.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Aging-related cardiovascular disease is influenced by multiple factors, with oxidative stress being a key contributor. Aging-induced endoplasmic reticulum (ER) stress exacerbates oxidative stress by impairing mitochondrial function. Furthermore, a decline in antioxidants, including peroxiredoxins (PRDXs), augments the oxidative stress during aging. To explore if ER stress leads to PRDX degradation during aging, young adult (3 mo.) and aged (24 mo.) male mice were studied. Treatment with 4-phenylbutyrate (4-PBA) was used to alleviate ER stress in young adult and aged mice. Aged hearts showed elevated oxidative stress levels compared to young hearts. However, treatment with 4-PBA to attenuate ER stress reduced oxidative stress in aged hearts, indicating that ER stress contributes to increased oxidative stress in aging. Moreover, aging resulted in reduced levels of peroxiredoxin 3 (PRDX3) in mitochondria and peroxiredoxin 4 (PRDX4) in myocardium. While 4-PBA treatment improved PRDX3 content in aged hearts, it did not restore PRDX4 content in aged mice. These findings suggest that ER stress not only leads to mitochondrial dysfunction and increased oxidant stress but also impairs a vital antioxidant defense through decreased PRDX3 content. Additionally, the results suggest that PRDX4 may contribute an upstream role in inducing ER stress during aging.

HFE
Also flagged:Ironcell proliferationoxygensynthesishydroxyliron deficiency anemia
Journal Article 2023-09-01 ✓ 1 Snippet Rieg T, Xue J, Stevens M, Thomas L, White JR, Dominguez Rieg JA.
In-Text Gene Mentions

Hemochromatosis, or excessive iron…

Show Full Abstract

Iron deficiency anemia (IDA) is a leading global health concern affecting approximately 30% of the population. Treatment for IDA consists of replenishment of iron stores, either by oral or intravenous (IV) supplementation. There is a complex bidirectional interplay between the gut microbiota, the host's iron status, and dietary iron availability. Dietary iron deficiency and supplementation can influence the gut microbiome; however, the effect of IV iron on the gut microbiome is unknown. We studied how commonly used IV iron preparations, ferric carboxymaltose (FCM) and ferric derisomaltose (FDI), affected the gut microbiome in female iron-deficient anemic mice. At the phylum level, vehicle-treated mice showed an expansion in Verrucomicrobia, mostly because of the increased abundance of Akkermansia muciniphila, along with contraction in Firmicutes, resulting in a lower Firmicutes/Bacteroidetes ratio (indicator of dysbiosis). Treatment with either FCM or FDI restored the microbiome such that Firmicutes and Bacteroidetes were the dominant phyla. Interestingly, the phyla Proteobacteria and several members of Bacteroidetes (e.g., Alistipes) were expanded in mice treated with FCM compared with those treated with FDI. In contrast, several Clostridia class members were expanded in mice treated with FDI compared with FCM (e.g., Dorea spp., Eubacterium). Our data demonstrate that IV iron increases gut microbiome diversity independently of the iron preparation used; however, differences exist between FCM and FDI treatments. In conclusion, replenishing iron stores with IV iron preparations in clinical conditions, such as inflammatory bowel disease or chronic kidney disease, could affect gut microbiome composition and consequently contribute to an altered disease outcome.

SERPINC1
Also flagged:AntithrombinThrombosisthrombophiliaAT deficiencyDeficiency(AT) deficiency
Journal Article 2023-09-01 ✓ 5 Snippets Marco-Rico A, Marco-Vera P.
In-Text Gene Mentions

…single allele ofSERPINC1is the most…

…Most of theSERPINC1genetic variants are…

…mutations in theSERPINC1gene, depending on…

…by the homozygousSERPINC1c.391C>T variant (p.Leu131Phe;…

…by immunoturbidimetry (LiatestATIII® ; Stago,…

Show Full Abstract

Congenital antithrombin (AT) deficiency represents the form of thrombophilia with the highest thrombotic risk. It is characterized by a heterogeneous clinical presentation, depending mostly on the family history of thrombosis and type of genetic mutation. Inherited AT deficiency promotes idiopathic thrombosis at an early age (even in the pediatric population) and at atypical sites. Therefore, a positive family background necessitates ruling out this high-risk thrombophilia at a young age. Studying first-degree relatives, even if they are asymptomatic, is essential to establish thromboprophylaxis and a proper therapeutic approach in case of thrombosis. Patients with congenital AT deficiency require indefinite anticoagulation owing to the high thrombotic recurrence rate. Here, we present four unrelated cases reported in our institution who were diagnosed with hereditary AT deficiency, with a contrasting clinical evolution.

HFE
Also flagged:coordination polymersmetal ionsphosphonatescarboxylatessulphonatesimidazolates
Journal Article 2023-09-01 ✓ 1 Snippet Peng X, Xu L, Zeng M, Dang H.
In-Text Gene Mentions

…is also termedhemochromatosis, which can result…

Show Full Abstract

Metal-organic frameworks (MOFs) are coordination polymers that comprise metal ions/clusters and organic ligands. MOFs have been extensively employed in different fields (eg, gas adsorption, energy storage, chemical separation, catalysis, and sensing) for their versatility, high porosity, and adjustable geometry. To be specific, Fe<sup>2+</sup>/Fe<sup>3+</sup> exhibits unique redox chemistry, photochemical and electrical properties, as well as catalytic activity. Fe-based MOFs have been widely investigated in numerous biomedical fields over the past few years. In this study, the key index requirements of Fe-MOF materials in the biomedical field are summarized, and a conclusion is drawn in terms of the latest application progress, development prospects, and future challenges of Fe-based MOFs as drug delivery systems, antibacterial therapeutics, biocatalysts, imaging agents, and biosensors in the biomedical field.

SOX6
Also flagged:Wntdegenerative joint diseasedegradationosteoarthritisLgr5aging
Journal Article 2023-09-01 ✓ 1 Snippet Ruscitto A, Chen P, Tosa I, Wang Z, Zhou G, Safina I, Wei R, Morel MM, Koch A, Forman M, Reeve G, Lecholop MK, Wilson M, Bonthius D, Chen M, Ono M, Wang TC, Yao H, Embree MC.
In-Text Gene Mentions

SOX6

Show Full Abstract

Osteoarthritis is a degenerative joint disease that causes pain, degradation, and dysfunction. Excessive canonical Wnt signaling in osteoarthritis contributes to chondrocyte phenotypic instability and loss of cartilage homeostasis; however, the regulatory niche is unknown. Using the temporomandibular joint as a model in multiple species, we identify Lgr5-expressing secretory cells as forming a Wnt inhibitory niche that instruct Wnt-inactive chondroprogenitors to form the nascent synovial joint and regulate chondrocyte lineage and identity. Lgr5 ablation or suppression during joint development, aging, or osteoarthritis results in depletion of Wnt-inactive chondroprogenitors and a surge of Wnt-activated, phenotypically unstable chondrocytes with osteoblast-like properties. We recapitulate the cartilage niche and create StemJEL, an injectable hydrogel therapy combining hyaluronic acid and sclerostin. Local delivery of StemJEL to post-traumatic osteoarthritic jaw and knee joints in rabbit, rat, and mini-pig models restores cartilage homeostasis, chondrocyte identity, and joint function. We provide proof of principal that StemJEL preserves the chondrocyte niche and alleviates osteoarthritis.

SERPINC1
Also flagged:Diabetic NephropathyDNdiabetesprimary renal diseasesnon-diabetic renal diseasemembrane
Journal Article 2023-09-01 ✓ 2 Snippets Ding X, Zhang D, Ren Q, Hu Y, Wang J, Hao J, Wang H, Zhao X, Wang X, Song C, Du J, Yang F, Zhu H.
In-Text Gene Mentions

Serum albumin correlated negatively with APOB, while blood glucose correlated positively with the level of C18orf63, COMP, F2, and SERPINC1.

…COMP, F2, andSERPINC1.…

Show Full Abstract

Diabetic nephropathy (DN), as the one of most common complications of diabetes, is generally diagnosed based on a longstanding duration, albuminuria, and decreased kidney function. Some patients with the comorbidities of diabetes and other primary renal diseases have similar clinical features to DN, which is defined as non-diabetic renal disease (NDRD). It is necessary to distinguish between DN and NDRD, considering they differ in their pathological characteristics, treatment regimes, and prognosis. Renal biopsy provides a gold standard; however, it is difficult for this to be conducted in all patients. Therefore, it is necessary to discover non-invasive biomarkers that can distinguish between DN and NDRD. In this research, the urinary exosomes were isolated from the midstream morning urine based on ultracentrifugation combined with 0.22 μm membrane filtration. Data-independent acquisition-based quantitative proteomics were used to define the proteome profile of urinary exosomes from DN (n = 12) and NDRD (n = 15) patients diagnosed with renal biopsy and Type 2 diabetes mellitus (T2DM) patients without renal damage (n = 9), as well as healthy people (n = 12). In each sample, 3372 ± 722.1 proteins were identified on average. We isolated 371 urinary exosome proteins that were significantly and differentially expressed between DN and NDRD patients, and bioinformatic analysis revealed them to be mainly enriched in the immune and metabolic pathways. The use of least absolute shrinkage and selection operator (LASSO) logistic regression further identified phytanoyl-CoA dioxygenase domain containing 1 (PHYHD1) as the differential diagnostic biomarker, the efficacy of which was verified with another cohort including eight DN patients, five NDRD patients, seven T2DM patients, and nine healthy people. Additionally, a concentration above 1.203 μg/L was established for DN based on the ELISA method. Furthermore, of the 19 significantly different expressed urinary exosome proteins selected by using the protein-protein interaction network and LASSO logistic regression, 13 of them were significantly related to clinical indicators that could reflect the level of renal function and hyperglycemic management.

Also flagged:β-tricalcium phosphatebone deficiencystrontiumsilverpore-formingdegradation
Journal Article 2023-09-01 No Snippets Che J, Sun T, Lv X, Ma Y, Liu G, Li L, Yuan S, Fan X.
Show Full Abstract

β-tricalcium phosphate has good biodegradability and biocompatibility; it is widely perceived as a good material for treating bone deficiency. In this research, different contents of strontium (Sr) and silver (Ag) ion-doped β-tricalcium phosphate powders were prepared using the sol-gel method. After obtaining the best ratio of pore-forming agent and binder, the as-synthesized powders were sintered in a muffle for 5 h at 1000 °C to obtain the samples. Then, these samples were degraded in vitro in simulated body fluids. The samples were tested using a series of characterization methods before and after degradation. Results showed that the amount of Sr and/or Ag doping had an effect on the crystallinity and structural parameters of the samples. After degradation, though the compressive strength of these samples decreased overall, the compressive strength of the undoped samples was higher than that of the doped samples. Notably, apatite-like materials were observed on the surface of the samples. All the results indicate that Sr and/or Ag β-TCP has good osteogenesis and proper mechanical properties; it will be applied as a prospective biomaterial in the area of bone repair.

CCPG1
Also flagged:hepatocellular carcinomacell-cycle progression gene 1cancerstumor
Journal Article 2023-09-01 ✓ 5 Snippets Wang G, Liu Z, Wang Q, Liu B, Li J.
In-Text Gene Mentions

We firstly analyzed CCPG1 expression in various cancers using The Cancer Genome Atlas and the Genotype-Tissue Expression project databases.

Relative low expression of CCPG1 in HCC is significantly correlated with the poor prognosis of HCC patients after surgical resection, suggesting its possible role as a potential prognostic marker for HCC.

The relative expression levels of CCPG1 were determined in 164 paired HCC and adjacent tissues using immunohistochemistry.

The expression of CCPG1 was lower in HCC tissues than in adjacent non-tumor liver tissues.

Lower expression of CCPG1 in HCC patients was associated with poor OS and DFS (p < 0.01).

Show Full Abstract

This study aimed to examine the clinical and prognostic significance of cell-cycle progression gene 1 (CCPG1) in hepatocellular carcinoma (HCC). We firstly analyzed CCPG1 expression in various cancers using The Cancer Genome Atlas and the Genotype-Tissue Expression project databases. The relative expression levels of CCPG1 were determined in 164 paired HCC and adjacent tissues using immunohistochemistry. The correlation between CCPG1 and clinicopathological characteristics of HCC was analyzed. Cox proportional models were used to identify the prognostic factors for overall survival (OS) and disease-free survival (DFS). The expression of CCPG1 was lower in HCC tissues than in adjacent non-tumor liver tissues. The expression of CCPG1 was significantly correlated with tumor number (p = 0.02) and tumor differentiation (p = 0.04) in HCC. Lower expression of CCPG1 in HCC patients was associated with poor OS and DFS (p < 0.01). Relative low expression of CCPG1 in HCC is significantly correlated with the poor prognosis of HCC patients after surgical resection, suggesting its possible role as a potential prognostic marker for HCC.

Also flagged:Perforinpore-formingexocytosisdeath
Journal Article 2023-09-01 No Snippets Jose J, Law RHP, Leung EWW, Wai DCC, Akhlaghi H, Chandrashekaran IR, Caradoc-Davies TT, Voskoboinik I, Feutrill J, Middlemiss D, Jeevarajah D, Bashtannyk-Puhalovich T, Giddens AC, Lee TW, Jamieson SMF, Trapani JA, Whisstock JC, Spicer JA, Norton RS.
Show Full Abstract

Perforin is a pore-forming protein whose normal function enables cytotoxic T and natural killer (NK) cells to kill virus-infected and transformed cells. Conversely, unwanted perforin activity can also result in auto-immune attack, graft rejection and aberrant responses to pathogens. Perforin is critical for the function of the granule exocytosis cell death pathway and is therefore a target for drug development. In this study, by screening a fragment library using NMR and surface plasmon resonance, we identified 4,4-diaminodiphenyl sulfone (dapsone) as a perforin ligand. We also found that dapsone has modest (mM) inhibitory activity of perforin lytic activity in a red blood cell lysis assay in vitro. Sequential modification of this lead fragment, guided by structural knowledge of the ligand binding site and binding pose, and supported by SPR and ligand-detected <sup>19</sup>F NMR, enabled the design of nanomolar inhibitors of the cytolytic activity of intact NK cells against various tumour cell targets. Interestingly, the ligands we developed were largely inert with respect to direct perforin-mediated red blood cell lysis but were very potent in the context of perforin's action on delivering granzymes in the immune synapse, the context in which it functions physiologically. Our work indicates that a fragment-based, structure-guided drug discovery strategy can be used to identify novel ligands that bind perforin. Moreover, these molecules have superior physicochemical properties and solubility compared to previous generations of perforin ligands.

Also flagged:RNA-binding proteinsmitochondrialVascular complicationsdiabetes mellitusdiabetic angiopathycardiomyopathy
Journal Article 2023-09-01 No Snippets Potel KN, Cornelius VA, Yacoub A, Chokr A, Donaghy CL, Kelaini S, Eleftheriadou M, Margariti A.
Show Full Abstract

Vascular complications are the main cause of diabetes mellitus-associated morbidity and mortality. Oxidative stress and metabolic dysfunction underly injury to the vascular endothelium and myocardium, resulting in diabetic angiopathy and cardiomyopathy. Mitochondrial dysfunction has been shown to play an important role in cardiomyopathic disruptions of key cellular functions, including energy metabolism and oxidative balance. Both non-coding RNAs and RNA-binding proteins are implicated in diabetic cardiomyopathy, however, their impact on mitochondrial dysfunction in the context of this disease is largely unknown. Elucidating the effects of non-coding RNAs and RNA-binding proteins on mitochondrial pathways in diabetic cardiomyopathy would allow further insights into the pathophysiological mechanisms underlying diabetic vascular complications and could facilitate the development of new therapeutic strategies. Stem cell-based models can facilitate the study of non-coding RNAs and RNA-binding proteins and their unique characteristics make them a promising tool to improve our understanding of mitochondrial dysfunction and vascular complications in diabetes.

Also flagged:RNPamyotrophic lateral sclerosisfrontotemporal dementiamembrane-lessorganellesRNA-binding proteins
Journal Article 2023-09-01 No Snippets Naskar A, Nayak A, Salaikumaran MR, Vishal SS, Gopal PP.
Show Full Abstract

Liquid-liquid phase separation results in the formation of dynamic biomolecular condensates, also known as membrane-less organelles, that allow for the assembly of functional compartments and higher order structures within cells. Multivalent, reversible interactions between RNA-binding proteins (RBPs), including FUS, TDP-43, and hnRNPA1, and/or RNA (e.g., RBP-RBP, RBP-RNA, RNA-RNA), result in the formation of ribonucleoprotein (RNP) condensates, which are critical for RNA processing, mRNA transport, stability, stress granule assembly, and translation. Stress granules, neuronal transport granules, and processing bodies are examples of cytoplasmic RNP condensates, while the nucleolus and Cajal bodies are representative nuclear RNP condensates. In neurons, RNP condensates promote long-range mRNA transport and local translation in the dendrites and axon, and are essential for spatiotemporal regulation of gene expression, axonal integrity and synaptic function. Mutations of RBPs and/or pathologic mislocalization and aggregation of RBPs are hallmarks of several neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease. ALS/FTD-linked mutations of RBPs alter the strength and reversibility of multivalent interactions with other RBPs and RNAs, resulting in aberrant phase transitions. These aberrant RNP condensates have detrimental functional consequences on mRNA stability, localization, and translation, and ultimately lead to compromised axonal integrity and synaptic function in disease. Pathogenic protein aggregation is dependent on various factors, and aberrant dynamically arrested RNP condensates may serve as an initial nucleation step for pathologic aggregate formation. Recent studies have focused on identifying mechanisms by which neurons resolve phase transitioned condensates to prevent the formation of pathogenic inclusions/aggregates. The present review focuses on the phase separation of neurodegenerative disease-linked RBPs, physiological functions of RNP condensates, and the pathologic role of aberrant phase transitions in neurodegenerative disease, particularly ALS/FTD. We also examine cellular mechanisms that contribute to the resolution of aberrant condensates in neurons, and potential therapeutic approaches to resolve aberrantly phase transitioned condensates at a molecular level.

Also flagged:cancerbreast cancerPI3KAktAkt1-hydroxycoumarin
Journal Article 2023-09-01 No Snippets Mir WR, Bhat BA, Kumar A, Dhiman R, Alkhanani M, Almilaibary A, Dar MY, Ganie SA, Mir MA.
Show Full Abstract

<i>Delphinium roylei</i> Munz is an indigenous medicinal plant to India where its activity against cancer has not been previously investigated, and its specific interactions of bioactive compounds with vulnerable breast cancer drug targets remain largely unknown. Therefore, in the current study, we aimed to evaluate the anti-breast cancer activity of different extracts of <i>D. roylei</i> against breast cancer and deciphering the molecular mechanism by Network Pharmacology combined with Molecular Docking and <i>in vitro</i> verification. The experimental plant was extracted with various organic solvents according to their polarity index. Phytocompounds were identified by High resolution-liquid chromatography-mass spectrometry (HR-LC/MS) technique, and SwissADME programme evaluated their physicochemical properties. Next, target(s) associated with the obtained bioactives or breast cancer-related targets were retrieved by public databases, and the Venn diagram selected the overlapping targets. The networks between overlapping targets and bioactive were visualized, constructed, and analyzed by STRING programme and Cytoscape software. Finally, we implemented a molecular docking test (MDT) using AutoDock Vina to explore key target(s) and compound(s). HR-LC/MS detected hundreds of phytocompounds, and few were accepted by Lipinski's rules after virtual screening and therefore classified as drug-like compounds (DLCs). A total of 464 potential target genes were attained for the nine quantitative phytocompounds and using Gene Cards, OMIM and DisGeNET platforms, 12063 disease targets linked to breast cancer were retrieved. With Kyoto Encyclopaedia of Genes and Genomes (KEGG) pathway enrichment, a total of 20 signalling pathways were manifested, and a hub signalling pathway (PI3K-Akt signalling pathway), a key target (Akt1), and a key compound (8-Hydroxycoumarin) were selected among the 20 signalling pathways via molecular docking studies. The molecular docking investigation revealed that among the nine phytoconstituents, 8-hydroxycoumarin showed the best binding energy (-9.2 kcal/mol) with the Akt1 breast cancer target. 8-hydroxycoumarin followed all the ADME property prediction using SwissADME, and 100 nanoseconds (ns) MD simulations of 8-hydroxycoumarin complexes with Akt1 were found to be stable. Furthermore, <i>D. roylei</i> extracts also showed significant antioxidant and anticancer activity through <i>in vitro</i> studies. Our findings indicated for the first time that <i>D. roylei</i> extracts could be used in the treatment of BC.

HTT
Also flagged:neurodegenerative diseaseHDHuntingtinpolyglutaminevesicleciliogenesis
Journal Article 2023-09-01 ✓ 5 Snippets Laundos TL, Li S, Cheang E, De Santis R, Piccolo FM, Brivanlou AH.
In-Text Gene Mentions

However, the extent of this phenotype was less severe than the phenotype observed in HD lines, which grossly failed to compact the central neuroectodermal area, a phenotype only worsened by complete lack of expression of HTT, as in the HTT-KO cell line (Figures 1F, G).

Together, these findings are consistent with our results in supporting the idea that although lack of HTT expression results in HD-like outcome, intrinsic mHTT loss of activity would not be sufficient to elicit the HD-associated phenotypes.

However, halving endogenous wild-type HTT levels did not strongly recapitulate the HD phenotypes, arguing against a classical loss of function mechanism.

Due to selective neuronal vulnerability, pathological CAG expansion on the HTT gene (hereafter also referred to as HD mutation) results in extensive loss of striatal medium spiny neurons and cortical neurons, a disease hallmark evident in postmortem HD patient brains (Aylward et al., 2011; Halliday et al., 1998; Ross and Tabrizi, 2011).

At the 3′ end of the HTT coding sequence, an in-frame sequence coding a Glycine-Serine flexible linker and the HaloTag coding sequence were introduced, resulting in a C-terminal tagging of the transgenic full-length HTT proteins (Figure 2A).

Show Full Abstract

<b>Introduction:</b> Huntington's disease (HD) remains an incurable and fatal neurodegenerative disease long after CAG-expansion mutation in the huntingtin gene (<i>HTT</i>) was identified as the cause. The underlying pathological mechanism, whether <i>HTT</i> loss of function or gain of toxicity results from mutation, remains a matter of debate. <b>Methods:</b> In this study, we genetically modulated wild-type or mutant <i>HTT</i> expression levels in isogenic human embryonic stem cells to systematically investigate their contribution to HD-specific phenotypes. <b>Results:</b> Using highly reproducible and quantifiable <i>in vitro</i> micropattern-based assays, we observed comparable phenotypes with HD mutation and <i>HTT</i> depletion. However, halving endogenous wild-type <i>HTT</i> levels did not strongly recapitulate the HD phenotypes, arguing against a classical loss of function mechanism. Remarkably, expression of CAG-expanded <i>HTT</i> in non-HD cells induced HD like phenotypes akin to <i>HTT</i> depletion. <b>Discussion:</b> By corollary, these results indicate a dominant negative effect of mutated <i>HTT</i> on its wild-type counterpart. Complementation with additional copies of wild-type <i>HTT</i> ameliorated the HD-associated phenotypes, strongly supporting a classical dominant negative mechanism. Understanding the molecular basis of this dominant negative effect will guide the development of efficient clinical strategies to counteract the deleterious impact of mutant <i>HTT</i> on the wild-type <i>HTT</i> function.

Also flagged:ironmetabolismcancertumorsferroptosisdeath
Journal Article 2023-09-01 No Snippets Wang H, Zhang Z, Ruan S, Yan Q, Chen Y, Cui J, Wang X, Huang S, Hou B.
Show Full Abstract

The ability of cancer stem cells (CSCs) to self-renew, differentiate, and generate new tumors is a significant contributor to drug resistance, relapse, and metastasis. Therefore, the targeting of CSCs for treatment is particularly important. Recent studies have demonstrated that CSCs are more susceptible to ferroptosis than non-CSCs, indicating that this could be an effective strategy for treating tumors. Ferroptosis is a type of programmed cell death that results from the accumulation of lipid peroxides caused by intracellular iron-mediated processes. CSCs exhibit different molecular characteristics related to iron and lipid metabolism. This study reviews the alterations in iron metabolism, lipid peroxidation, and lipid peroxide scavenging in CSCs, their impact on ferroptosis, and the regulatory mechanisms underlying iron metabolism and ferroptosis. Potential treatment strategies and novel compounds targeting CSC by inducing ferroptosis are also discussed.

HTT
Also flagged:breast cancercancerTP53MAP3K1
Journal Article 2023-09-01 ✓ 1 Snippet Li Y, Zhang SW, Xie MY, Zhang T.
In-Text Gene Mentions

…(e.g. TP53, MAP3K1,HTT, etc.)…

Show Full Abstract

Identifying personalized cancer driver genes and further revealing their oncogenic mechanisms is critical for understanding the mechanisms of cell transformation and aiding clinical diagnosis. Almost all existing methods primarily focus on identifying driver genes at the cohort or individual level but fail to further uncover their underlying oncogenic mechanisms. To fill this gap, we present an interpretable framework, PhenoDriver, to identify personalized cancer driver genes, elucidate their roles in cancer development and uncover the association between driver genes and clinical phenotypic alterations. By analyzing 988 breast cancer patients, we demonstrate the outstanding performance of PhenoDriver in identifying breast cancer driver genes at the cohort level compared to other state-of-the-art methods. Otherwise, our PhenoDriver can also effectively identify driver genes with both recurrent and rare mutations in individual patients. We further explore and reveal the oncogenic mechanisms of some known and unknown breast cancer driver genes (e.g. TP53, MAP3K1, HTT, etc.) identified by PhenoDriver, and construct their subnetworks for regulating clinical abnormal phenotypes. Notably, most of our findings are consistent with existing biological knowledge. Based on the personalized driver profiles, we discover two existing and one unreported breast cancer subtypes and uncover their molecular mechanisms. These results intensify our understanding for breast cancer mechanisms, guide therapeutic decisions and assist in the development of targeted anticancer therapies.

Also flagged:appendage developmentPelAPitx1locomotionosmoregulationvitamin C
Journal Article 2023-09-01 No Snippets Chen HI, Turakhia Y, Bejerano G, Kingsley DM.
Show Full Abstract

Fins are major functional appendages of fish that have been repeatedly modified in different lineages. To search for genomic changes underlying natural fin diversity, we compared the genomes of 36 percomorph fish species that span over 100 million years of evolution and either have complete or reduced pelvic and caudal fins. We identify 1,614 genomic regions that are well-conserved in fin-complete species but missing from multiple fin-reduced lineages. Recurrent deletions of conserved sequences in wild fin-reduced species are enriched for functions related to appendage development, suggesting that convergent fin reduction at the organismal level is associated with repeated genomic deletions near fin-appendage development genes. We used sequencing and functional enhancer assays to confirm that PelA, a Pitx1 enhancer previously linked to recurrent pelvic loss in sticklebacks, has also been independently deleted and may have contributed to the fin morphology in distantly related pelvic-reduced species. We also identify a novel enhancer that is conserved in the majority of percomorphs, drives caudal fin expression in transgenic stickleback, is missing in tetraodontiform, syngnathid, and synbranchid species with caudal fin reduction, and alters caudal fin development when targeted by genome editing. Our study illustrates a broadly applicable strategy for mapping phenotypes to genotypes across a tree of vertebrate species and highlights notable new examples of regulatory genomic hotspots that have been used to evolve recurrent phenotypes across 100 million years of fish evolution.

Also flagged:Actinomycosischronic granulomatous diseasesubepithelial tumorAmpicillinEsophagealanemia
Journal Article 2023-09-01 No Snippets Nguyen HTT, Cho JW, Kim SG, Hoang TT, Jung GM, Cho BJ, Ju MJ.
Show Full Abstract

Esophageal actinomycosis is a rare, chronic granulomatous disease caused by Actinomyces species. Endoscopy and biopsy are essential for making a diagnosis. This paper reports a case of esophageal actinomycosis that developed after an endoscopic mucosal resection (EMR) for a subepithelial tumor (SET). A 74-year-old male patient had a 3 cm flat, smooth elevation in the esophagus without symptoms. The SET was partially resected, and histology revealed "nonspecific degenerated mesenchymal tissue". Three months later, the patient exhibited a persistently large ulceration at the EMR site, and a biopsy revealed actinomycosis. CT of the chest and abdomen revealed no abnormal findings. Ampicillin treatment was administered for six months, and the ulceration on the esophageal SET improved.

HFE
Also flagged:Intrahepatic CholangiocarcinomaBiliary HamartomasAcute Cholangitistumorfibrocysticcholangitis
Journal Article 2023-09-01 ✓ 1 Snippet Lee SM, Kim KB, Han JH, Woo CG, Chae HB, Park SM.
In-Text Gene Mentions

…three cases withhemochromatosis.…

Show Full Abstract

Biliary hamartomas are tumor-like malformations of the liver. Biliary hamartomas are a type of fibrocystic disorder originating from ductal plate malformation and are typically considered benign, but with the risk of malignant transformation. In this case report, we present a rare occurrence of intrahepatic cholangiocarcinoma (ICC) that developed from biliary hamartomas, along with a literature review. A 76-year-old man with a diagnosis of biliary hamartomas had a history of recurrent cholangitis for 12 years, necessitating cholecystectomy, ERCP, and repeated antibiotic treatments. During his last episode, imaging studies revealed a hypervascular infiltrative mass in the right posterior liver segment. A liver biopsy confirmed adenocarcinoma and subsequent surgical pathology revealed ICC originating from biliary hamartomas. Chronic inflammation in the bile duct associated with biliary hamartomas may serve as a potential trigger for malignant transformation, as observed in this case. Therefore, close surveillance is essential for patients with biliary hamartomas presenting with infectious complications.

DDX27
Also flagged:colorectal cancerlipid dropletcancersdegradationtumortaste receptors
Journal Article 2023-09-01 ✓ 1 Snippet Zhang CY, Zhang R, Zhang L, Wang ZM, Sun HZ, Cui ZG, Zheng HC.
In-Text Gene Mentions

…, POFUT1 andDDX27were more expressed…

Show Full Abstract

<h4>Background</h4>Regenerating gene 4 <i>(REG4)</i> has been proved to be carcinogenic in some cancers, but its manifestation and possible carcinogenic mechanisms in colorectal cancer (CRC) have not yet been elucidated. Our previous study found that the drug resistance of CRC cells may be closely linked to their fat metabolism.<h4>Aim</h4>To explore the role of <i>REG4</i> in CRC and its association with lipid droplet formation and chemoresistance.<h4>Methods</h4>We conducted a meta-analysis and bioinformatics and pathological analyses of <i>REG4</i> expression in CRC. The effects of <i>REG4</i> on the phenotypes and related protein expression were also investigated in CRC cells. We detected the impacts of <i>REG4</i> on the chemoresistance and lipid droplet formation in CRC cells. Finally, we analyzed how <i>REG4</i> regulated the transcription and proteasomal degradation of lipogenic enzymes in CRC cells.<h4>Results</h4>Compared to normal mucosa, <i>REG4</i> mRNA expression was high in CRC (<i>P</i> < 0.05) but protein expression was low. An inverse correlation existed between lymph node and distant metastases, tumor-node-metastasis staging or short overall survival and <i>REG4</i> mRNA overexpression (<i>P</i> < 0.05), but vice versa for <i>REG4</i> protein expression. <i>REG4</i>-related genes included: Chemokine activity; taste receptors; protein-DNA and DNA packing complexes; nucleosomes and chromatin; generation of second messenger molecules; programmed cell death signals; epigenetic regulation and DNA methylation; transcription repression and activation by DNA binding; insulin signaling pathway; sugar metabolism and transfer; and neurotransmitter receptors (<i>P</i> < 0.05). <i>REG4</i> exposure or overexpression promoted proliferation, antiapoptosis, migration, and invasion of DLD-1 cells in an autocrine or paracrine manner by activating the epidermal growth factor receptor-phosphoinositide 3-kinase-Akt-nuclear factor-κB pathway. <i>REG4</i> was involved in chemoresistance not through de novo lipogenesis, but lipid droplet assembly. <i>REG4</i> inhibited the transcription of acetyl-CoA carboxylase 1 (ACC1) and ATP-citrate lyase (ACLY) by disassociating the complex formation of anti-acetyl (AC)-acetyl-histone 3-AC-histone 4-inhibitor of growth protein-5-si histone deacetylase;-sterol-regulatory element binding protein 1 in their promoters and induced proteasomal degradation of ACC1 or ACLY.<h4>Conclusion</h4><i>REG4</i> may be involved in chemoresistance through lipid droplet assembly. <i>REG4</i> reduces expression of de novo lipid synthesis key enzymes by inhibiting transcription and promoting ubiquitination-mediated proteasomal degradation.

OLFM4
Also flagged:tumorbreast cancerBRCAgene expressionCACNG4KLHDC7B
Journal Article 2023-09-01 ✓ 2 Snippets Feng J.
In-Text Gene Mentions

Adopting a regional delivery pathway, enhancing tumor persistence and infiltration, combining anti-MSLN CAR-T cells with standard therapies, and improving the safety of treatment could elevate efficacy in solid malignancy treatment.[23] Mayama et al found that OLFM4, LY6 D and S100 A7 immunoreactivity were associated with ER-positive BRCA, and in patients with ER-positive breast tumors, these are markers indicating distant metastasis.[24] In addition, RSK2-YB-1-KLF5-KRT16/Ly6 D axis could be a therapeutic target and candidate diagnostic marker for those with triple-negative BCRA.[25] CACNG4 is elevated in BCRA with a poor prognosis.

…al found thatOLFM4, LY6 D and…

Show Full Abstract

The long-term efficacy of treatment, heterogeneity, and complexity in the tumor microenvironment remained a clinical challenge in breast cancer (BRCA). There is a need to classify and refine appropriate therapeutic intervention decisions. A stable subtype classification based on gene expression associated with neoadjuvant chemotherapy (NAC) prognosis and assessment on the clinical features, immune infiltration, and mutational characteristics of the different subcategories was performed using ConsensusClusterPlus. We constructed a prognostic model by the least absolute shrinkage and selection operator regression (LASSO) and univariate Cox regression method and further investigated the association between the risk model and clinical features, mutation and immune characteristics of BRCA. We constructed 3 molecular clusters associated with NAC. We found that cluster 1 had the best prognosis, while cluster 3 showed a poor prognosis. Cluster 3 were associated with the advance stage, higher mutation score, activated oncogenic, and lower tumor immune dysfunction and exclusion (TIDE) score. Subsequently, we constructed a prognosis-related risk model comprising 9 genes (RLN2, MSLN, SAPCD2, LY6D, CACNG4, TUBA3E, LAMP3, GNMT, KLHDC7B). The higher-risk group exhibited lower immune infiltration and demonstrated improved overall survival (OS) in both the independent validation cohort. Finally, by combining clinicopathological features with the NAC-related prognostic risk model, we enhanced the accuracy of survival prediction and model performance. Here, we revealed 3 new molecular subtypes based on prognosis-related genes for BRCA NAC and developed a prognostic risk model. It has the potential to aid in the selection of appropriate individualized treatment and the prediction of patient prognosis.

Also flagged:organogenesischromatinImmunodeficiencyOtofaciocervical syndromesendocrine disorderssevere
Journal Article 2023-09-01 No Snippets Kearns NA, Lobo M, Genga RMJ, Abramowitz RG, Parsi KM, Min J, Kernfeld EM, Huey JD, Kady J, Hennessy E, Brehm MA, Ziller MJ, Maehr R.
Show Full Abstract

Approaches to study human pharyngeal foregut endoderm-a developmental intermediate that is linked to various human syndromes involving pharynx development and organogenesis of tissues such as thymus, parathyroid, and thyroid-have been hampered by scarcity of tissue access and cellular models. We present an efficient stepwise differentiation method to generate human pharyngeal foregut endoderm from pluripotent stem cells. We determine dose and temporal requirements of signaling pathway engagement for optimized differentiation and characterize the differentiation products on cellular and integrated molecular level. We present a computational classification tool, "CellMatch," and transcriptomic classification of differentiation products on an integrated mouse scRNA-seq developmental roadmap confirms cellular maturation. Integrated transcriptomic and chromatin analyses infer differentiation stage-specific gene regulatory networks. Our work provides the method and integrated multiomic resource for the investigation of disease-relevant loci and gene regulatory networks and their role in developmental defects affecting the pharyngeal endoderm and its derivatives.

CCPG1
Also flagged:reticulophagy receptordeathSuberoylanilide hydroxamic acidhistone deacetylaseFAM134Breticulophagy
Journal Article 2023-09-01 ✓ 2 Snippets Li JY, Tian T, Han B, Yang T, Guo YX, Wu JY, Chen YS, Yang Q, Xie RJ.
In-Text Gene Mentions

…Wuhan, China 1:1500),CCPG1(Proteintech; 1:1500), LC3…

…expression of FAM134B,CCPG1, and autophagy-related protei…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a common clinical condition with a poor prognosis and few effective treatment options. Potent anticancer agents for treating HCC must be identified. Epigenetics plays an essential role in HCC tumorigenesis. Suberoylanilide hydroxamic acid (SAHA), the most common histone deacetylase inhibitor agent, triggers many forms of cell death in HCC. However, the underlying mechanism of action remains unclear. Family with sequence similarity 134 member B (FAM134B)-induced reticulophagy, a selective autophagic pathway, participates in the decision of cell fate and exhibits anticancer activity. This study focused on the relationship between FAM134B-induced reticulophagy and SAHA-mediated cell death.<h4>Aim</h4>To elucidate potential roles and underlying molecular mechanisms of reticulophagy in SAHA-induced HCC cell death.<h4>Methods</h4>The viability, apoptosis, cell cycle, migration, and invasion of SAHA-treated Huh7 and MHCC97L cells were measured. Proteins related to the reticulophagy pathway, mitochondria-endoplasmic reticulum (ER) contact sites, intrinsic mitochondrial apoptosis, and histone acetylation were quantified using western blotting. ER and lysosome colocalization, and mitochondrial Ca<sup>2+</sup> levels were characterized <i>via</i> confocal microscopy. The level of cell death was evaluated through Hoechst 33342 staining and propidium iodide colocalization. Chromatin immunoprecipitation was used to verify histone H4 lysine-16 acetylation in the <i>FAM134B</i> promoter region.<h4>Results</h4>After SAHA treatment, the proliferation of Huh7 and MHCC97L cells was significantly inhibited, and the migration and invasion abilities were greatly blocked <i>in vitro</i>. This promoted apoptosis and caused G1 phase cells to increase in a concentration-dependent manner. Following treatment with SAHA, ER-phagy was activated, thereby triggering autophagy-mediated cell death of HCC cells <i>in vitro</i>. Western blotting and chromatin immunoprecipitation assays confirmed that SAHA regulated FAM134B expression by enhancing the histone H4 lysine-16 acetylation in the <i>FAM134B</i> promoter region. Further, SAHA disturbed the Ca<sup>2+</sup> homeostasis and upregulated the level of autocrine motility factor receptor and proteins related to mitochondria-endoplasmic reticulum contact sites in HCC cells. Additionally, SAHA decreased the mitochondrial membrane potential levels, thereby accelerating the activation of the reticulophagy-mediated mitochondrial apoptosis pathway and promoting HCC cell death <i>in vitro</i>.<h4>Conclusion</h4>SAHA stimulates FAM134B-mediated ER-phagy to synergistically enhance the mitochondrial apoptotic pathway, thereby enhancing HCC cell death.

HFE
Also flagged:genetic disorderironcirrhosishepatocellular carcinomaliver dysfunctioncarcinoma
Journal Article 2023-09-01 ✓ 5 Snippets Cobilinschi CO, Săulescu I, Caraiola S, Nițu AF, Dumitru RL, Husar-Sburlan I, Bălănescu AR, Opriș-Belinski D.
In-Text Gene Mentions

Hemochromatosisis a genetic…

…the diagnosis ofhemochromatosisposes a challenge…

…pitfalls in diagnosinghemochromatosis.…

…literature and discusshemochromatosissubtypes and liver…

…In summary,hemochromatosisremains difficult to…

Show Full Abstract

Hemochromatosis is a genetic disorder characterized by increased iron storage in various organs with progressive multisystemic damage. Despite the reports dating back to 1865, the diagnosis of hemochromatosis poses a challenge to clinicians due to its non-specific symptoms and indolent course causing significant delay in disease recognition. The key organ that is affected by iron overload is the liver, suffering from fibrosis, cirrhosis or hepatocellular carcinoma, complications that can be prevented via early diagnosis and treatment. This review aims to draw attention to the pitfalls in diagnosing hemochromatosis. We present a case with multiorgan complaints, abnormal iron markers and a consistent genetic result. We then examine the relevant literature and discuss hemochromatosis subtypes and liver involvement, including transplant outcome and treatment options. In summary, hemochromatosis remains difficult to diagnose due to its symptom heterogeneity and rarity; thus, further education for practitioners of all disciplines is useful in facilitating its early recognition and management.

Also flagged:Melatonin ReceptorsMelatoninMel1B receptorsosteogenesisluzindolecell cycle
Journal Article 2023-09-01 No Snippets Skubis-Sikora A, Sikora B, Małysiak W, Wieczorek P, Czekaj P.
Show Full Abstract

Melatonin is a hormone secreted mainly by the pineal gland and acts through the Mel1A and Mel1B receptors. Among other actions, melatonin significantly increases osteogenesis during bone regeneration. Human adipose-derived mesenchymal stem cells (ADSCs) are also known to have the potential to differentiate into osteoblast-like cells; however, inefficient culturing due to the loss of properties over time or low cell survival rates on scaffolds is a limitation. Improving the process of ADSC expansion in vitro is crucial for its further successful use in bone regeneration. This study aimed to assess the effect of melatonin on ADSC characteristics, including osteogenicity. We assessed ADSC viability at different melatonin concentrations as well as the effect on its receptor inhibitors (luzindole or 4-P-PDOT). Moreover, we analyzed the ADSC phenotype, apoptosis, cell cycle, and expression of <i>MTNR1A</i> and <i>MTNR1B</i> receptors, and its potential for osteogenic differentiation. We found that ADSCs treated with melatonin at a concentration of 100 µM had a higher viability compared to those treated at higher melatonin concentrations. Melatonin did not change the phenotype of ADSCs or induce apoptosis and it promoted the activity of some osteogenesis-related genes. We concluded that melatonin is safe, non-toxic to normal ADSCs in vitro, and can be used in regenerative medicine at low doses (100 μM) to improve cell viability without negatively affecting the osteogenic potential of these cells.

Also flagged:invasive diseaseinvasive bacterial diseaseinvasive meningococcal diseaseinfectioncarbon dioxideoxidase
Journal Article 2023-09-01 No Snippets Kristinsdottir I, Visser LJ, Miellet WR, Mariman R, Pluister G, Haraldsson G, Haraldsson A, Trzciński K, Thors V.
Show Full Abstract

Background<i>Neisseria meningitidis</i> is a commensal bacterium which can cause invasive disease. Colonisation studies are important to guide vaccination strategies.AimThe study's aim was to determine the prevalence of meningococcal colonisation, duration of carriage and distribution of genogroups in Iceland.MethodsWe collected samples from 1 to 6-year-old children, 15-16-year-old adolescents and 18-20-year-old young adults. Carriers were sampled at regular intervals until the first negative swab. Conventional culture methods and qPCR were applied to detect meningococci and determine the genogroup. Whole genome sequencing was done on groupable meningococci.ResultsNo meningococci were detected among 460 children, while one of 197 (0.5%) adolescents and 34 of 525 young adults (6.5 %) carried meningococci. Non-groupable meningococci were most common (62/77 isolates from 26/35 carriers), followed by genogroup B (MenB) (12/77 isolates from 6/35 carriers). Genogroup Y was detected in two individuals and genogroup W in one. None carried genogroup C (MenC). The longest duration of carriage was at least 21 months. Serial samples from persistent carriers were closely related in WGS.ConclusionsCarriage of pathogenic meningococci is rare in young Icelanders. Non-groupable meningococci were the most common colonising meningococci in Iceland, followed by MenB. No MenC were found. Whole genome sequencing suggests prolonged carriage of the same strains in persistent carriers.

Also flagged:pulmonary lymphangioleiomyomatosisbreast cancerestrogen receptorERGene Expressioncell proliferation
Journal Article 2023-09-01 No Snippets Yang L, Xiao Y, Ren S.
Show Full Abstract

Accumulating evidence suggests that patients with pulmonary lymphangioleiomyomatosis (PLAM) have a markedly higher prevalence of breast cancer (BC) than the general population. However, the underlying pathophysiological mechanisms remain unclear. Therefore, in this study, we employed a bioinformatics approach to understand the association between PLAM and estrogen receptor (ER)-positive BC. The PLAM (GSE12027) and ER-positive BC (GSE42568, GSE29044, and GSE29431) datasets were obtained from the Gene Expression Omnibus database, and GEO2R was used to identify common differentially expressed genes (DEGs) between them. Functional annotation was performed, and a protein-protein interaction (PPI) network was constructed. Hub genes were identified and verified using western blotting and immunohistochemistry. We conducted an immune infiltration analysis; based on the results, selected 102 common DEGs for follow-up analysis. Functional analyses revealed that the DEGs were mostly enriched in cell proliferation, gene expression regulation, and tumor-related pathways. Four hub genes-ESR1, IL6, PLA2G4A, and CAV1-were further analyzed, and CAV1 was revealed to be associated with clinical outcomes and immune infiltration in ER-positive BC. This study proposes a common, possible pathogenesis of PLAM and ER-positive BC. These common pathways and pivotal genes may provide new directions for further mechanistic studies.

HFE
Also flagged:Hepatic FailureAlcoholHereditary HemochromatosisHHironhepatic cirrhosis
Journal Article 2023-09-01 ✓ 5 Snippets Alvi AT, Santiago LE, Nadeem Z, Chaudhry A.
In-Text Gene Mentions

…C282Y of theHFEgene, causing increased…

…C282Y of theHFEgene (chromosome 6p21.3).…

…S65C in theHFEgene.…

…is responsible forhemochromatosis-related iron overloading in…

…levels are elevated,HFEmutation testing is…

Show Full Abstract

Hereditary hemochromatosis (HH) is an inherited disorder in which organ damage and other clinical manifestations are commonly seen in patients with a homozygous mutation involving <i>C282Y</i> of the <i>HFE</i> gene, causing increased iron absorption in the intestine. The liver is the primary site of iron deposition, and excessive iron overload can eventually lead to hepatic cirrhosis. Patients who drink significant amounts of alcohol are more likely to develop cirrhosis, and in females, it is commonly seen after menopause. We describe a young female with hereditary hemochromatosis who developed fulminant hepatic failure with minimal alcohol consumption at age 25.

HFE
Also flagged:Hereditary Hemochromatosisironlevodopacarbidopadeathoxygen
Journal Article 2023-09-01 ✓ 3 Snippets Banta CW, Zonna X, Lott R, Jaisawal P, Elsisi A.
In-Text Gene Mentions

…mutations in theHFEgene (most notably…

…places patients withHFEmutations at an…

…patients of varyingHFEgenotypes, including C282Y…

Show Full Abstract

A 55-year-old male, with a strong family history of hereditary hemochromatosis, presented with progressively worsening right-sided tremor and Parkinsonian symptoms. He was diagnosed with hereditary hemochromatosis based on genetic testing and started undergoing regular phlebotomies to reduce his blood iron levels. Despite extensive trials of different pharmaceutical therapies, including levodopa-carbidopa, his Parkinsonian symptoms were not relieved and continued to worsen. This report serves to highlight the importance of early disease identification and intervention in patients with hereditary hemochromatosis to prevent the development of neurological sequelae, as well as a need for further research into effective therapies in such patients.

Also flagged:gene expressionbindingcatalytic activityDNA polymerasepolymeraseroo
Journal Article 2023-09-01 No Snippets Coronado-Zamora M, González J.
Show Full Abstract

Transcriptomes are dynamic, with cells, tissues, and body parts expressing particular sets of transcripts. Transposable elements (TEs) are a known source of transcriptome diversity; however, studies often focus on a particular type of chimeric transcript, analyze single body parts or cell types, or are based on incomplete TE annotations from a single reference genome. In this work, we have implemented a method based on de novo transcriptome assembly that minimizes the potential sources of errors while identifying a comprehensive set of gene-TE chimeras. We applied this method to the head, gut, and ovary dissected from five <i>Drosophila melanogaster</i> natural strains, with individual reference genomes available. We found that ∼19% of body part-specific transcripts are gene-TE chimeras. Overall, chimeric transcripts contribute a mean of 43% to the total gene expression, and they provide protein domains for DNA binding, catalytic activity, and DNA polymerase activity. Our comprehensive data set is a rich resource for follow-up analysis. Moreover, because TEs are present in virtually all species sequenced to date, their role in spatially restricted transcript expression is likely not exclusive to the species analyzed in this work.

Also flagged:congenital anomalycongenital anomaliesdeathdevelopmental delayintellectual disabilityCA
Journal Article 2023-09-01 No Snippets Vaseghi H, Akrami SM, Rashidi-Nezhad A.
Show Full Abstract

<h4>Background</h4>Despite the efforts that have been made to standardize the interpretation of variants, in some cases, their pathogenicity remains vague and confusing, and sometimes their interpretation does not help clinicians to establish clinical correlation using genetic test results. This study aims to shed more lights on these challenging variants.<h4>Methods</h4>In a clinical setting, the variants found from 81 array CGH and 79 whole exome sequencing (WES) in patients with congenital anomalies were interpreted based on American College of Medical Genetics and Genomics guidelines.<h4>Results</h4>In this study, the interpretation of the disease-causing variants and the variants with uncertain clinical significance detected by WES was far more challenging than the variants detected by array CGH. The presence of unreported clinical symptoms, incomplete penetrance, variable expressivity, parents' reluctance to analyze segregation in the family, and the limitations of prenatal tests, were among the challenging factors in the interpretation of variants in this study.<h4>Conclusion</h4>A careful study of the pedigree and disease mode of inheritance, as well as a careful clinical examination of the carrier parents in diseases with autosomal dominant inheritance, are among the primary strategies for determining the clinical significance of the variants. Continued efforts to mitigate these challenges are needed to improve the interpretation of variants.

HFE
Also flagged:Irondeathmethanolferricbindinghexane
Journal Article 2023-09-01 ✓ 3 Snippets Mithila M, Islam MR, Khatun MR, Gazi MS, Hossain SJ.
In-Text Gene Mentions

Hemochromatosisor iron overload…

…Inhemochromatosis, the body absorbs…

…DNA, whereas secondaryhemochromatosisis produced by…

Show Full Abstract

Iron overload results in oxidative damage to various biomolecules including DNA, proteins and lipids which ultimately leads to cell death. The <i>Sonneratia apetala</i> fruit contains a high content of antioxidants and displays several bioactive properties. Therefore, the powder of the <i>S. apetala</i> fruit was successively fractionated into <i>n</i>-hexane (Hex), chloroform (Chl), and methanol (Met) fractions to evaluate their efficiency in ameliorating iron overload. <i>In vitro</i>, a colorimetric method was used to assess the Fe-chelating activity of the fractions using ferrozine. The fractions were also used <i>in vivo</i> to examine their efficacy in ameliorating iron overload and iron-induced oxidative stress in mice induced by intraperitoneal injection of ferric carboxymaltose at 100 mg/kg body weight (bw). Among the fractions, Met showed the highest Fe-chelation ability with an inhibitory concentration 50 of 165 μg/mL followed by Hex (270 μg/mL), and Chl (418 μg/mL). <i>In vivo</i>, the results showed a significantly (<i>P</i><0.05) lower iron profile (iron and ferritin concentrations in serum and liver tissue and total iron-binding capacity of serum) in the Met and the Hex treated mice groups than in the iron-overloaded group. Met at 1,000 μg/kg bw completely ameliorated iron overload in the blood and the liver tissue of mice. At this concentration, Met also prevented iron-induced oxidative stress in the liver tissue of iron-overloaded mice by restoring reducing power, total antioxidant capacity, and total protein. Thus, the <i>S. apetala</i> fruit, especially its Met fraction can be used in treating iron overload and associated toxicity.

SERPINC1
Also flagged:DementiaACEmild cognitive impairmentACE-RADcognition
Journal Article 2023-09-01 ✓ 2 Snippets Yu RC, Lai JC, Hui EK, Mukadam N, Kapur N, Stott J, Livingston G.
In-Text Gene Mentions

…the ACE-R andACE-IIIare the best…

…using the ACE-R,ACE-IIIto assess people…

Show Full Abstract

<h4>Background</h4>Chinese is the most commonly spoken world language; however, most cognitive tests were developed and validated in the West. It is essential to find out which tests are valid and practical in Chinese speaking people with suspected dementia.<h4>Objective</h4>We therefore conducted a systematic review and meta-analysis of brief cognitive tests adapted for Chinese-speaking populations in people presenting for assessment of suspected dementia.<h4>Methods</h4>We searched electronic databases for studies reporting brief (≤20 minutes) cognitive test's sensitivity and specificity as part of dementia diagnosis for Chinese-speaking populations in clinical settings. We assessed quality using Centre for Evidence Based Medicine (CEBM) criteria and translation and cultural adaptation using the Manchester Translation Reporting Questionnaire (MTRQ), and Manchester Cultural Adaptation Reporting Questionnaire (MCAR). We assessed heterogeneity and combined sensitivity in meta-analyses.<h4>Results</h4>38 studies met inclusion criteria and 22 were included in meta-analyses. None met the highest CEBM criteria. Five studies met the highest criteria of MTRQ and MCAR. In meta-analyses of studies with acceptable heterogeneity (I<sup>2</sup> <  75%), Addenbrooke's Cognitive Examination Revised &III (ACE-R & ACE-III) had the best sensitivity and specificity; specifically, for dementia (93.5% & 85.6%) and mild cognitive impairment (81.4% & 76.7%).<h4>Conclusions</h4>Current evidence is that the ACE-R and ACE-III are the best brief cognitive assessments for dementia and mild cognitive impairment in Chinese-speaking populations. They may improve time taken to diagnosis, allowing people to access interventions and future planning.

HTT
Also flagged:ADHDchildhood disordermethylationbehaviouralAttention deficit/hyperactivity disorderRUNX1
Journal Article 2023-09-01 ✓ 2 Snippets Chaumette B, Grizenko N, Fageera W, Fortier MÈ, Ter-Stepanian M, Labbe A, Joober R.
In-Text Gene Mentions

17 Several studies have investigated DNA methylation in relation to ADHD diagnosis or symptoms using candidate gene approaches or epigenome-wide association studies in peripheral blood and saliva tissue. Candidate-gene approaches have focused primarily on the monoaminergic system, given that blunted dopamine reward/motivation pathways in the striatum and prefrontal cortex have been implicated in the etiology of ADHD. Alterations in DNA methylation have been noted in studies examining the dopamine transporter gene (DAT1),18–24 genes encoding dopamine receptors,18,25–27 the serotonin transporter (5-HTT),25,28 the norepinephrine transporter,29 and catechol-O-methyltransferase (COMT).25,30 However, as with genetic studies, epigenome-wide association studies (EWAS) have been favoured since the genome can be probed in a hypothesis-free manner.

…the serotonin transporter (5-HTT), 25 , 28…

Show Full Abstract

<h4>Background</h4>Attention deficit/hyperactivity disorder (ADHD) is a highly prevalent childhood disorder. Maternal smoking during pregnancy is a replicated environmental risk factor for this disorder. It is also a robust modifier of gene methylation during the prenatal developmental period. In this study, we sought to identify loci differentially methylated by maternal smoking during pregnancy and relate their methylation levels to various behavioural and physical outcomes relevant to ADHD.<h4>Methods</h4>We extracted DNA from blood samples from children diagnosed with ADHD and deeply phenotyped. Genome-wide DNA methylation was assessed using Infinium MethylationEPIC BeadChip. Maternal smoking during pregnancy was self-declared and assessed retrospectively.<h4>Results</h4>Our sample included 231 children with ADHD. Statistically significant differences in DNA methylation between children exposed or not to maternal smoking during pregnancy were detected in 3457 CpGs. We kept 30 CpGs with at least 5% of methylation difference between the 2 groups for further analysis. Six genes were associated with varied phenotypes of clinical relevance to ADHD. The levels of DNA methylation in <i>RUNX1</i> were positively correlated with the CBCL scores, and DNA methylation in <i>MYO1G</i> correlated positively with the score at the Conners rating scale. Methylation level in a CpG located in <i>GFI1</i> correlated with birthweight, a risk factor for ADHD. Differentially methylated regions were also identified and confirmed the association of <i>RUNX1</i> methylation levels with the CBCL score.<h4>Limitations</h4>The study has several limitations, including the retrospective recall with self-report of maternal smoking during pregnancy as well as the grouping of individuals of varying age and developmental stage and of both males and females. In addition, the correlation design prevents the building of causation models.<h4>Conclusion</h4>This study provides evidence for the association between the level of methylation at specific loci and quantitative dimensions highly relevant for ADHD as well as birth weight, a measure that has already been associated with increased risk for ADHD. Our results provide further support to public health educational initiatives to stop maternal smoking during pregnancy.

Also flagged:Hederagenintriterpenoidleishmaniasistumorcarboxylhydroxyl
Journal Article 2023-09-01 No Snippets Huang X, Shen QK, Guo HY, Li X, Quan ZS.
Show Full Abstract

Hederagenin is a pentacyclic triterpenoid isolated from plants and widely distributed in a variety of medicinal plants. By integrating and analyzing external related literature reports, the latest research progress on the pharmacological effects and structural modification of hederagenin was reviewed. Hederagenin has a wide range of pharmacological activities, including antitumor, anti-inflammatory, antidepressant, anti-neurodegenerative, antihyperlipidemic, antidiabetic, anti-leishmaniasis, and antiviral activities. Among them, it shows high potential in the field of anti-tumor treatment. This paper also reviews the structural modifications of hederagenin, including carboxyl group modifications and two hydroxyl group modifications. Future research on hederagenin will focus on prolonging its half-life, improving its bioavailability and structural modification to enhance its pharmacological activity, accelerating the preclinical research stage of hederagenin for it to enter the clinical research stage as soon as possible.

HFE
Also flagged:ETV6
Journal Article 2023-09-01 ✓ 1 Snippet Zhang XL, Weng YH, Yang YF.
In-Text Gene Mentions

…report of secondaryhemochromatosiscaused by a…

Show Full Abstract

No abstract available.

Also flagged:chromosomal disordersgenetic diseasechromosomegenetic disordergenetic disordersreproduction
Journal Article 2023-09-01 No Snippets Blum K, Gold MS, Cadet JL, Gondre-Lewis MC, McLaughlin T, Braverman ER, Elman I, Paul Carney B, Cortese R, Abijo T, Bagchi D, Giordano J, Dennen CA, Baron D, Thanos PK, Soni D, Makale MT, Makale M, Murphy KT, Jafari N, Sunder K, Zeine F, Ceccanti M, Bowirrat A, Badgaiyan RD.
Show Full Abstract

No abstract available.

Also flagged:cancerpathogenesismethylationmethylsynthesiscancers
Journal Article 2023-09-01 No Snippets Lu Y, Peng R, Dong L, Xia K, Wu R, Xu S, Wang J.
Show Full Abstract

Artificial intelligence (AI) approaches in cancer analysis typically utilize a 'one-size-fits-all' methodology characterizing average patient responses. This manner neglects the diverse conditions in the pancancer and cancer subtypes of individual patients, resulting in suboptimal outcomes in diagnosis and treatment. To overcome this limitation, we shift from a blanket application of statistics to a focus on the explicit recognition of patient-specific abnormalities. Our objective is to use multiomics data to empower clinicians with personalized molecular descriptions that allow for customized diagnosis and interventions. Here, we propose a highly trustworthy multiomics learning (HTML) framework that employs multiomics self-adaptive dynamic learning to process each sample with data-dependent architectures and computational flows, ensuring personalized and trustworthy patient-centering of cancer diagnosis and prognosis. Extensive testing on a 33-type pancancer dataset and 12 cancer subtype datasets underscored the superior performance of HTML compared with static-architecture-based methods. Our findings also highlighting the potential of HTML in elucidating complex biological pathogenesis and paving the way for improved patient-specific care in cancer treatment.

SERPINC1
Also flagged:AntithrombinDeficiencyCerebral Venous ThrombosisHereditaryAT) deficiency
Journal Article 2023-09-01 ✓ 1 Snippet Ashraf VV, Salam KA, Kizhedath R, Puthussery K.
In-Text Gene Mentions

…positive for theSERPINC1gene mutation confirming…

Show Full Abstract

Hereditary antithrombin (AT) deficiency is a rare thrombophilia associated with cerebral vein thrombosis (CVT). We report a case study of hereditary AT deficiency causing CVT in three members of a family. A 29-year-old female presented with features of CVT. Her mother and a sister had CVT in the past and investigation for hereditary thrombophilia revealed low blood AT activity in all of them. The index patient (proband) was positive for the SERPINC1 gene mutation confirming the diagnosis of hereditary AT deficiency. She recovered well with anticoagulation and was advised to continue it lifelong. Diagnosing hereditary thrombophilia like AT deficiency is important in planning anticoagulation and proper counseling of asymptomatic family members regarding prophylaxis for venous thromboembolism (VTE) in high-risk situations.

HFE
Also flagged:Ironoxygenmetabolismtransportationiron deficiencytransferrin receptors
Journal Article 2023-09-01 ✓ 1 Snippet Winter WE, Harris NS.
In-Text Gene Mentions

…errone, transferrin, ferritin,HFE, and the transferrin…

Show Full Abstract

Iron serves a critical role in many metabolic processes, including oxygen delivery (e.g., hemoglobin) and oxygen utilization for the generation of ATP (e.g., cytochromes). Disorders of iron metabolism are best recognized and evaluated in the context of iron's absorption, transportation, monitoring, cellular uptake, and recycling. This review highlights these processes so that disorders of iron deficiency and iron excess can be better understood. Key players in iron metabolism will be highlighted, such as hepcidin, ferroportin, erythroferrone, transferrin, ferritin, HFE, and the transferrin receptors.

B for Beethoven

HFE
Also flagged:hearingtamedeathdisease of boneosteitisbreakdown
Journal Article 2023-09-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

… 2 variants of the HFE gene that most oft…

Show Full Abstract

No abstract available.

PEBP1
Also flagged:neuroepithelial tumorsmethylationgliomaIDHCancerPineal region tumors
Journal Article 2023-09-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

PEBP1

Show Full Abstract

No abstract available.

bioRxiv 2023-09-01 Preprint (No Snippets API) Fulford TS, Soliman C, Castle RG, Rigau M, Ruan Z, Dolezal O, Seneviratna R, Brown HG, Hanssen E, Hammet A, Li S, Redmond SJ, Chung A, Gorman MA, Parker MW, Patel O, Peat TS, Newman J, Behren A, Gherardin NA, Godfrey DI, Uldrich AP.
Show Full Abstract

Butyrophilin (BTN) molecules are emerging as key regulators of T cell immunity, however, how they trigger cell-mediated responses is poorly understood. Here, the crystal structure of a gamma-delta T cell receptor (γδTCR) in complex with BTN member 2A1 (BTN2A1) revealed that BTN2A1 engages the side of the γδTCR, leaving the apical TCR surface bioavailable. We reveal that BTN3A1 is a second γδTCR ligand, that co-engages γδTCR via binding to this accessible apical surface. BTN2A1 and BTN3A1 also directly interact with each other in cis, and structural analysis revealed formation of W-shaped heteromeric multimers. This BTN2A1–BTN3A1 interaction involved the same epitopes that BTN2A1 and BTN3A1 each use to engage γδTCR; indeed, either forced separation or locking together of BTN2A1 and BTN3A1 resulted in enhanced or abrogated γδTCR interaction, respectively. Our findings reveal a new paradigm in immune activation, whereby γδTCRs recognize dual epitopes on BTN2A1 and BTN3A1 complexes.

bioRxiv 2023-09-01 Preprint (No Snippets API) Dubin A, Parker J, Böhne A, Roth O.
Show Full Abstract

The allocation of energy towards gamete production, parental care, mate choice, sex roles, and sexual dimorphism generates divergence in selection pressures between the sexes, leading to opposing fitness strategies and sexual antagonism (SA). Due to the shared genetic makeup, a single genomic locus can contain a gene or allele with differing fitness impacts on each sex. This intralocus sexual conflict can be resolved via intersex bias in gene expression and/or formation of sex-linked genomic regions, that may also regulate sex determination. Sex determination (SD) encompasses environmental SD (ESD), monogenic SD, and polygenic SD. Occasionally, shifts from one SD locus to another can occur. While the precise mechanisms driving these shifts are unknown, SA is believed to be a major contributor. To investigate the link between SA and SD, we selected three syngnathid species along the gradient of male pregnancy that evolved with different sex roles and intensities of sexual dimorphism. By looking at intersex genetic divergence (Fst) and sex-biased expression patterns, we uncovered that sex role and mate competition, rather than male pregnancy, primarily drive SA. Furthermore, we identified processes related to non-coding RNAs and biased allele expression as mediators of SA. Most notably, we discovered intraspecies sex chromosome polymorphism in Hippocampus erectus . Overall, we report important details on the interplay between SA and SD, and suggest that understanding SA and its resolution mechanisms is crucial for unraveling the evolution of SD in diverse species.