Gene Literature Dashboard

Viewing January 2024 — 840 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← December 2023 February 2024 →
Also flagged:secretioninfectious diseasesnucleotidempb70oligopeptidepolyhistidine
Journal Article 2024-01-31 No Snippets Takeishi A, Shaban AK, Kakihana T, Takihara H, Okuda S, Osada H, Suameitria Dewi DNS, Ozeki Y, Yoshida Y, Nishiyama A, Tateishi Y, Aizu Y, Chuma Y, Onishi K, Hayashi D, Yamamoto S, Mukai T, Ato M, Thai DH, Nhi HTT, Shirai T, Shibata S, Obata F, Fujii J, Yamayoshi S, Kiso M, Matsumoto S.
Show Full Abstract

Vaccination is an important factor in public health. The recombinant bacillus Calmette Guérin (rBCG) vaccine, which expresses foreign antigens, is expected to be a superior vaccine against infectious diseases. Here, we report a new recombination platform in which the BCG Tokyo strain is transformed with nucleotide sequences encoding foreign protein fused with the MPB70 immunogenic protein precursor. By RNA-sequencing, mpb70 was found to be the most transcribed among all known genes of BCG Tokyo. Small oligopeptide, namely, polyhistidine tag, was able to be expressed in and secreted from rBCG through a process in which polyhistidine tag fused with intact MPB70 were transcribed by an mpb70 promoter. This methodology was applied to develop an rBCG expressing the receptor binding domain (RBD) of severe acute respiratory syndrome coronavirus 2. Immunoblotting images and mass spectrometry data showed that RBD was also secreted from rBCG. Sera from mice vaccinated with the rBCG showed a tendency of weak neutralizing capacity. The secretion was retained even after a freeze-drying process. The freeze-dried rBCG was administered to and recovered from mice. Recovered rBCG kept secreting RBD. Collectively, our recombination platform offers stable secretion of foreign antigens and can be applied to the development of practical rBCGs.

SOX6
Also flagged:DichlorodiphenyltrichloroethaneorganochlorineDichlorodiphenyldichloroethylenecancerorganochlorineschromatin
Journal Article 2024-01-31 ✓ 1 Snippet Lismer A, Shao X, Dumargne MC, Lafleur C, Lambrot R, Chan D, Toft G, Bonde JP, MacFarlane AJ, Bornman R, Aneck-Hahn N, Patrick S, Bailey JM, de Jager C, Dumeaux V, Trasler JM, Kimmins S.
In-Text Gene Mentions

…included NRP1 ,SOX6, and SEMA5A…

Show Full Abstract

<h4>Background</h4>The organochlorine dichlorodiphenyltrichloroethane (DDT) is banned worldwide owing to its negative health effects. It is exceptionally used as an insecticide for malaria control. Exposure occurs in regions where DDT is applied, as well as in the Arctic, where its endocrine disrupting metabolite, p,p'<i>-</i>dichlorodiphenyldichloroethylene (p,p'<i>-</i>DDE) accumulates in marine mammals and fish. DDT and p,p'<i>-</i>DDE exposures are linked to birth defects, infertility, cancer, and neurodevelopmental delays. Of particular concern is the potential of DDT use to impact the health of generations to come via the heritable sperm epigenome.<h4>Objectives</h4>The objective of this study was to assess the sperm epigenome in relation to p,p'<i>-</i>DDE serum levels between geographically diverse populations.<h4>Methods</h4>In the Limpopo Province of South Africa, we recruited 247 VhaVenda South African men and selected 50 paired blood serum and semen samples, and 47 Greenlandic Inuit blood and semen paired samples were selected from a total of 193 samples from the biobank of the INUENDO cohort, an EU Fifth Framework Programme Research and Development project. Sample selection was based on obtaining a range of p,p'-DDE serum levels (mean=870.734±134.030 ng/mL). We assessed the sperm epigenome in relation to serum p,p'-DDE levels using MethylC-Capture-sequencing (MCC-seq) and chromatin immunoprecipitation followed by sequencing (ChIP-seq). We identified genomic regions with altered DNA methylation (DNAme) and differential enrichment of histone H3 lysine 4 trimethylation (H3K4me3) in sperm.<h4>Results</h4>Differences in DNAme and H3K4me3 enrichment were identified at transposable elements and regulatory regions involved in fertility, disease, development, and neurofunction. A subset of regions with sperm DNAme and H3K4me3 that differed between exposure groups was predicted to persist in the preimplantation embryo and to be associated with embryonic gene expression.<h4>Discussion</h4>These findings suggest that DDT and p,p'<i>-</i>DDE exposure impacts the sperm epigenome in a dose-response-like manner and may negatively impact the health of future generations through epigenetic mechanisms. Confounding factors, such as other environmental exposures, genetic diversity, and selection bias, cannot be ruled out. https://doi.org/10.1289/EHP12013.

STAU1
Also flagged:Colorectal cancergastric cancercancercancersgene expressiontumor
Journal Article 2024-01-31 ✓ 2 Snippets Zabeti Touchaei A, Vahidi S, Samadani AA.
In-Text Gene Mentions

…of TINCR andSTAU1serves as a…

…pull-down assay that TINCR/STAU1complexes directly bind…

Show Full Abstract

Colorectal cancer (CRC) and gastric cancer (GC) are major contributors to cancer-related mortality worldwide. Despite advancements in understanding molecular mechanisms and improved drug treatments, the overall survival rate for patients remains unsatisfactory. Metastasis and drug resistance are major challenges contributing to the high mortality rate in both CRC and GC. Recent research has shed light on the role of long noncoding RNAs (lncRNAs) in the development and progression of these cancers. LncRNAs regulate gene expression through various mechanisms, including epigenetic modifications and interactions with microRNAs (miRNAs) and proteins. They can serve as miRNA precursors or pseudogenes, modulating gene expression at transcriptional and post-transcriptional levels. Additionally, circulating lncRNAs have emerged as non-invasive biomarkers for the diagnosis, prognosis, and prediction of drug therapy response in CRC and GC. This review explores the intricate relationship between lncRNAs and CRC/GC, encompassing their roles in cancer development, progression, and chemoresistance. Furthermore, it discusses the potential of lncRNAs as therapeutic targets in these malignancies. The interplay between lncRNAs, miRNAs, and tumor microenvironment is also highlighted, emphasizing their impact on the complexity of cancer biology. Understanding the regulatory landscape and molecular mechanisms governed by lncRNAs in CRC and GC is crucial for the development of effective diagnostic and prognostic biomarkers, as well as novel therapeutic strategies. This review provides a comprehensive overview of the current knowledge and paves the way for further exploration of lncRNAs as key players in the management of CRC and GC.

OLFM4
Also flagged:cancertumorstumornucleotidecancersdeath
Journal Article 2024-01-31 ✓ 1 Snippet Zhou Z, Lin T, Chen S, Zhang G, Xu Y, Zou H, Zhou A, Zhang Y, Weng S, Han X, Liu Z.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>In the past decades, cancer enigmatical heterogeneity at distinct expression levels could interpret disparities in therapeutic response and prognosis. It built hindrances to precision medicine, a tactic to tailor customized treatment informed by the tumors' molecular profile. Single-omics analysis dissected the biological features associated with carcinogenesis to some extent but still failed to revolutionize cancer treatment as expected. Integrated omics analysis incorporated tumor biological networks from diverse layers and deciphered a holistic overview of cancer behaviors, yielding precise molecular classification to facilitate the evolution and refinement of precision medicine.<h4>Conclusion</h4>This review outlined the biomarkers at multiple expression layers to tutor molecular classification and pinpoint tumor diagnosis, and explored the paradigm shift in precision therapy: from single- to multi-omics-based subtyping to optimize therapeutic regimens. Ultimately, we firmly believe that by parsing molecular characteristics, omics-based typing will be a powerful assistant for precision oncology.

Also flagged:Cancerobesityinsulin resistanceCRFtumorbehavioral
Journal Article 2024-01-31 No Snippets Zhang X, Perry RJ.
Show Full Abstract

Cancer-related fatigue (CRF) is one of the most prevalent and detrimental complications of cancer. Emerging evidence suggests that obesity and insulin resistance are associated with CRF occurrence and severity in cancer patients and survivors. In this narrative review, we analyzed recent studies including both preclinical and clinical research on the relationship between obesity and/or insulin resistance and CRF. We also describe potential mechanisms for these relationships, though with the caveat that because the mechanisms underlying CRF are incompletely understood, the mechanisms mediating the association between obesity/insulin resistance and CRF are similarly incompletely delineated. The data suggest that, in addition to their effects to worsen CRF by directly promoting tumor growth and metastasis, obesity and insulin resistance may also contribute to CRF by inducing chronic inflammation, neuroendocrinological disturbance, and metabolic alterations. Furthermore, studies suggest that patients with obesity and insulin resistance experience more cancer-induced pain and are at more risk of emotional and behavioral disruptions correlated with CRF. However, other studies implied a potentially paradoxical impact of obesity and insulin resistance to reduce CRF symptoms. Despite the need for further investigation utilizing interventions to directly elucidate the mechanisms of cancer-related fatigue, current evidence demonstrates a correlation between obesity and/or insulin resistance and CRF, and suggests potential therapeutics for CRF by targeting obesity and/or obesity-related mediators.

SOX6
Also flagged:Propranololbreast cancermammary adenocarcinomareverse transcriptionpolymerasewound healing
Journal Article 2024-01-31 ✓ 5 Snippets Zheng B, Du P, Zeng Z, Cao P, Ma X, Jiang Y.
In-Text Gene Mentions

However, propranolol was unable to reverse the EMT upregulation caused by either miR-499-5p overexpression or knockdown of Sox6.

Western blot analysis showed that propranolol also upregulated E-cadherin and Sox6 expression and downregulated vimentin expression in both cell lines (Fig. 4C, D).

These findings suggest that the inhibitory effect of propranolol on EMT in 4T1 cells is nullified when Sox6 mRNA is disrupted, further indicating the inhibitory effect of propranolol on EMT is primarily mediated by Sox6.

The results demonstrated that compared to the control group (NC mimic and physiological saline treatment), propranolol with NC mimic treatment upregulated the expression of Sox6 and GSK3β, while it downregulated the expression of p-Akt, Twist1, β-catenin, c-Myc, and p-GSK3β ser9 in 4T1 cells.

In summary, we have, for the first time, identified the role of miR-499-5p and its target Sox6 in the regulation of EMT and metastasis of 4T1 cells by propranolol.

Show Full Abstract

<h4>Purpose</h4>This study will focus on 4T1 cells, a murine mammary adenocarcinoma cell line, as the primary research subject. We aim to investigate the inhibitory effects and mechanisms of propranolol on epithelial-mesenchymal transition (EMT) in breast cancer cells, aiming to elucidate this phenomenon at the miRNA level.<h4>Methods</h4>In this study, the EMT inhibitory effect of propranolol was observed through in vitro and animal experiments. For the screening of potential target miRNAs and downstream target genes, second-generation sequencing (SGS) and bioinformatics analysis were conducted. Following the screening process, the identified target miRNAs and their respective target genes were confirmed using various experimental methods. To confirm the target miRNAs and target genes, Western Blot (WB), reverse transcription polymerase chain reaction (RT-PCR), and immunofluorescence experiments were performed.<h4>Results</h4>In this study, we found that propranolol significantly reduced lung metastasis in 4T1 murine breast cancer cells (p < 0.05). In vitro and in vivo experiments demonstrated that propranolol inhibited the epithelial-mesenchymal transition (EMT) as evidenced by Western Blot analysis (p < 0.05). Through next-generation sequencing (SGS), subsequent bioinformatics analysis, and PCR validation, we identified a marked downregulation of miR-499-5p (p < 0.05), suggesting its potential involvement in mediating the suppressive effects of propranolol on EMT. Overexpression of miR-499-5p promoted EMT, migration, and invasion of 4T1 cells, and these effects were not reversed or attenuated by propranolol (Validated via Western Blot, wound healing assay, transwell migration, and invasion assays, p < 0.05). Sox6 was identified as a functional target of miR-499-5p, with its downregulation correlating with the observed EMT changes (p < 0.05). Silencing Sox6 or overexpressing miR-499-5p inhibited Sox6 expression, further promoting the processes of EMT, invasion, and migration in 4T1 cells. Notably, these effects were not alleviated by propranolol (validated via Western Blot, wound healing assay, transwell migration, and invasion assays, p < 0.05). The direct interaction between miR-499-5p and Sox6 mRNA was confirmed by dual-luciferase reporter gene assay.<h4>Conclusion</h4>These results suggest that propranolol may have potential as a therapeutic agent for breast cancer treatment by targeting EMT and its regulatory mechanisms.

SUDS3
Also flagged:pathogenesisCongenital diaphragmatic herniapulmonary hypertensionSIN3Acell proliferationanacardic acid
Journal Article 2024-01-31 ✓ 3 Snippets Stokes G, Li Z, Talaba N, Genthe W, Brix MB, Pham B, Wienhold MD, Sandok G, Hernan R, Wynn J, Tang H, Tabima DM, Rodgers A, Hacker TA, Chesler NC, Zhang P, Murad R, Yuan JX, Shen Y, Chung WK, McCulley DJ.
In-Text Gene Mentions

Sin3 associated polypeptide

Suppressor of defective silencing 3 homolog

Suds3

Show Full Abstract

A major barrier to the impact of genomic diagnosis in patients with congenital malformations is the lack of understanding regarding how sequence variants contribute to disease pathogenesis and whether this information could be used to generate patient-specific therapies. Congenital diaphragmatic hernia (CDH) is among the most common and severe of all structural malformations; however, its underlying mechanisms are unclear. We identified loss-of-function sequence variants in the epigenomic regulator gene <i>SIN3A</i> in two patients with complex CDH. Tissue-specific deletion of <i>Sin3a</i> in mice resulted in defects in diaphragm development, lung hypoplasia, and pulmonary hypertension, the cardinal features of CDH and major causes of CDH-associated mortality. Loss of SIN3A in the lung mesenchyme resulted in reduced cellular differentiation, impaired cell proliferation, and increased DNA damage. Treatment of embryonic <i>Sin3a</i> mutant mice with anacardic acid, an inhibitor of histone acetyltransferase, reduced DNA damage, increased cell proliferation and differentiation, improved lung and pulmonary vascular development, and reduced pulmonary hypertension. These findings demonstrate that restoring the balance of histone acetylation can improve lung development in the <i>Sin3a</i> mouse model of CDH.

NEGR1
Also flagged:ageingAgingreproductionparturitioninfertilityhypertension
Journal Article 2024-01-31 ✓ 1 Snippet Punzon-Jimenez P, Machado-Lopez A, Perez-Moraga R, Llera-Oyola J, Grases D, Galvez-Viedma M, Sibai M, Satorres-Perez E, Lopez-Agullo S, Badenes R, Ferrer-Gomez C, Porta-Pardo E, Roson B, Simon C, Mas A.
In-Text Gene Mentions

…DCN, C7, APOD,NEGR1(Fig. 1B ),…

Show Full Abstract

Age-associated myometrial dysfunction can prompt complications during pregnancy and labor, which is one of the factors contributing to the 7.8-fold increase in maternal mortality in women over 40. Using single-cell/single-nucleus RNA sequencing and spatial transcriptomics, we have constructed a cellular atlas of the aging myometrium from 186,120 cells across twenty perimenopausal and postmenopausal women. We identify 23 myometrial cell subpopulations, including contractile and venous capillary cells as well as immune-modulated fibroblasts. Myometrial aging leads to fewer contractile capillary cells, a reduced level of ion channel expression in smooth muscle cells, and impaired gene expression in endothelial, smooth muscle, fibroblast, perivascular, and immune cells. We observe altered myometrial cell-to-cell communication as an aging hallmark, which associated with the loss of 25 signaling pathways, including those related to angiogenesis, tissue repair, contractility, immunity, and nervous system regulation. These insights may contribute to a better understanding of the complications faced by older individuals during pregnancy and labor.

TNFSF4
Also flagged:systemic sclerosisIRF8bindingpathogenesissystemic autoimmune diseasesAIDs
Journal Article 2024-01-31 ✓ 1 Snippet Ishikawa Y, Tanaka N, Asano Y, Kodera M, Shirai Y, Akahoshi M, Hasegawa M, Matsushita T, Saito K, Motegi SI, Yoshifuji H, Yoshizaki A, Kohmoto T, Takagi K, Oka A, Kanda M, Tanaka Y, Ito Y, Nakano K, Kasamatsu H, Utsunomiya A, Sekiguchi A, Niiro H, Jinnin M, Makino K, Makino T, Ihn H, Yamamoto M, Suzuki C, Takahashi H, Nishida E, Morita A, Yamamoto T, Fujimoto M, Kondo Y, Goto D, Sumida T, Ayuzawa N, Yanagida H, Horita T, Atsumi T, Endo H, Shima Y, Kumanogoh A, Hirata J, Otomo N, Suetsugu H, Koike Y, Tomizuka K, Yoshino S, Liu X, Ito S, Hikino K, Suzuki A, Momozawa Y, Ikegawa S, Tanaka Y, Ishikawa O, Takehara K, Torii T, Sato S, Okada Y, Mimori T, Matsuda F, Matsuda K, Amariuta T, Imoto I, Matsuo K, Kuwana M, Kawaguchi Y, Ohmura K, Terao C.
In-Text Gene Mentions

…PRDM1-ATG5 , IRF5,TNFSF4, and IRF8…

Show Full Abstract

Here we report the largest Asian genome-wide association study (GWAS) for systemic sclerosis performed to date, based on data from Japanese subjects and comprising of 1428 cases and 112,599 controls. The lead SNP is in the FCGR/FCRL region, which shows a penetrating association in the Asian population, while a complete linkage disequilibrium SNP, rs10917688, is found in a cis-regulatory element for IRF8. IRF8 is also a significant locus in European GWAS for systemic sclerosis, but rs10917688 only shows an association in the presence of the risk allele of IRF8 in the Japanese population. Further analysis shows that rs10917688 is marked with H3K4me1 in primary B cells. A meta-analysis with a European GWAS detects 30 additional significant loci. Polygenic risk scores constructed with the effect sizes of the meta-analysis suggest the potential portability of genetic associations beyond populations. Prioritizing the top 5% of SNPs of IRF8 binding sites in B cells improves the fitting of the polygenic risk scores, underscoring the roles of B cells and IRF8 in the development of systemic sclerosis. The results also suggest that systemic sclerosis shares a common genetic architecture across populations.

Also flagged:HNF4AMLL4Hepatocyte nuclear factor 4Abindinghistone 3lysine
Journal Article 2024-01-31 No Snippets Thakur A, Park K, Cullum R, Fuglerud BM, Khoshnoodi M, Drissler S, Stephan TL, Lotto J, Kim D, Gonzalez FJ, Hoodless PA.
Show Full Abstract

Hepatocyte nuclear factor 4A (HNF4A/NR2a1), a transcriptional regulator of hepatocyte identity, controls genes that are crucial for liver functions, primarily through binding to enhancers. In mammalian cells, active and primed enhancers are marked by monomethylation of histone 3 (H3) at lysine 4 (K4) (H3K4me1) in a cell type-specific manner. How this modification is established and maintained at enhancers in connection with transcription factors (TFs) remains unknown. Using analysis of genome-wide histone modifications, TF binding, chromatin accessibility and gene expression, we show that HNF4A is essential for an active chromatin state. Using HNF4A loss and gain of function experiments in vivo and in cell lines in vitro, we show that HNF4A affects H3K4me1, H3K27ac and chromatin accessibility, highlighting its contribution to the establishment and maintenance of a transcriptionally permissive epigenetic state. Mechanistically, HNF4A interacts with the mixed-lineage leukaemia 4 (MLL4) complex facilitating recruitment to HNF4A-bound regions. Our findings indicate that HNF4A enriches H3K4me1, H3K27ac and establishes chromatin opening at transcriptional regulatory regions.

Also flagged:CancerCas9vitronectinGPICHD5JADE2
Journal Article 2024-01-31 No Snippets Ciceri G, Baggiolini A, Cho HS, Kshirsagar M, Benito-Kwiecinski S, Walsh RM, Aromolaran KA, Gonzalez-Hernandez AJ, Munguba H, Koo SY, Xu N, Sevilla KJ, Goldstein PA, Levitz J, Leslie CS, Koche RP, Studer L.
Show Full Abstract

The pace of human brain development is highly protracted compared with most other species<sup>1-7</sup>. The maturation of cortical neurons is particularly slow, taking months to years to develop adult functions<sup>3-5</sup>. Remarkably, such protracted timing is retained in cortical neurons derived from human pluripotent stem cells (hPSCs) during in vitro differentiation or upon transplantation into the mouse brain<sup>4,8,9</sup>. Those findings suggest the presence of a cell-intrinsic clock setting the pace of neuronal maturation, although the molecular nature of this clock remains unknown. Here we identify an epigenetic developmental programme that sets the timing of human neuronal maturation. First, we developed a hPSC-based approach to synchronize the birth of cortical neurons in vitro which enabled us to define an atlas of morphological, functional and molecular maturation. We observed a slow unfolding of maturation programmes, limited by the retention of specific epigenetic factors. Loss of function of several of those factors in cortical neurons enables precocious maturation. Transient inhibition of EZH2, EHMT1 and EHMT2 or DOT1L, at progenitor stage primes newly born neurons to rapidly acquire mature properties upon differentiation. Thus our findings reveal that the rate at which human neurons mature is set well before neurogenesis through the establishment of an epigenetic barrier in progenitor cells. Mechanistically, this barrier holds transcriptional maturation programmes in a poised state that is gradually released to ensure the prolonged timeline of human cortical neuron maturation.

ZNF644
Also flagged:ROCK2lipopolysaccharidesepsisRho-associated coiled-coil containing protein kinase 2deoxyuridinelipid
Journal Article 2024-01-31 ✓ 4 Snippets Zhao J, Zhao Q, Duan Q.
In-Text Gene Mentions

Circ_0114428 is located in chr:91403041-91447927-, and consists of exons 2–4 of zinc finger protein 644 (ZNF644), and the published data have confirmed its upregulation in the serum samples of septic acute kidney injury [12].

…finger protein 644 (ZNF644), and the published…

…2–4 of theZNF644gene with a…

…treatment, although linearZNF644expression was greatly…

Show Full Abstract

<h4>Background</h4>Sepsis-induced acute lung injury (ALI) accounts for about 40% of ALI, accompanied by alveolar epithelial injury. The study aimed to reveal the role of circular RNA_0114428 (circ_0114428) in sepsis-induced ALI.<h4>Methods</h4>Human pulmonary alveolar epithelial cells (HPAEpiCs) were treated with lipopolysaccharide (LPS) to mimic a sepsis-induced ALI cell model. RNA expression of circ_0114428, miR-574-5p and Rho-associated coiled-coil containing protein kinase 2 (ROCK2) was detected by qRT-PCR. Protein expression was checked by Western blotting. Cell viability, proliferation and apoptosis were investigated by cell counting kit-8, 5-Ethynyl-29-deoxyuridine (EdU) and flow cytometry analysis, respectively. The levels of pro-inflammatory factors were detected by enzyme-linked immunosorbent assay (ELISA). Oxidative stress was analyzed by lipid peroxidation Malondialdehyde (MDA) and Superoxide Dismutase (SOD) activity detection assays. The interplay among circ_0114428, miR-574-5p and ROCK2 was identified by dual-luciferase reporter, RNA pull-down and RNA immunoprecipitation assays.<h4>Results</h4>Circ_0114428 and ROCK2 expression were significantly increased, but miR-574-5p was decreased in blood samples from sepsis patients and LPS-stimulated HPAEpiCs. LPS treatment led to decreased cell viability and proliferation and increased cell apoptosis, inflammation and oxidative stress; however, these effects were relieved after circ_0114428 knockdown. Besides, circ_0114428 acted as a miR-574-5p sponge and regulated LPS-treated HPAEpiC disorders through miR-574-5p. Meanwhile, ROCK2 was identified as a miR-574-5p target, and its silencing protected against LPS-induced cell injury. Importantly, circ_0114428 knockdown inhibited ROCK2 production by interacting with miR-574-5p.<h4>Conclusion</h4>Circ_0114428 knockdown protected against LPS-induced HPAEpiC injury through miR-574-5p/ROCK2 axis, providing a novel therapeutic target in sepsis-induced ALI.

Also flagged:TRRUNX2HOXD13ATXN7genetic disorderautism
Journal Article 2024-01-31 No Snippets Fazal S, Danzi MC, Xu I, Kobren SN, Sunyaev S, Reuter C, Marwaha S, Wheeler M, Dolzhenko E, Lucas F, Wuchty S, Tekin M, Züchner S, Aguiar-Pulido V.
Show Full Abstract

Expansions of tandem repeats (TRs) cause approximately 60 monogenic diseases. We expect that the discovery of additional pathogenic repeat expansions will narrow the diagnostic gap in many diseases. A growing number of TR expansions are being identified, and interpreting them is a challenge. We present RExPRT (Repeat EXpansion Pathogenicity pRediction Tool), a machine learning tool for distinguishing pathogenic from benign TR expansions. Our results demonstrate that an ensemble approach classifies TRs with an average precision of 93% and recall of 83%. RExPRT's high precision will be valuable in large-scale discovery studies, which require prioritization of candidate loci for follow-up studies.

HTT
Also flagged:SLEsystemic lupus erythematosus-hydroxynyptamineSerotonin transporter5-hydroxytryptamine transportergene expression
Journal Article 2024-01-31 ✓ 4 Snippets Ma L, Yang Y, Li S, Upreti B, Liu S, Wang X, Bai R, Cheng Y, Xu J.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT)gene expression.…

…ydroxytryptamine transporter (5-HTT) is located on…

…association with reduced5-HTTgene transcription and…

…association with increased5-HTTgene transcription.…

Show Full Abstract

<h4>Background</h4>Neuropsychiatric involvement in systemic lupus erythematosus (SLE) is a common clinical manifestation. In SLE patients, cerebral function is a more sensitive predictor of central nervous system damage, and abnormalities in cerebral function may be apparent before substantial neuropsychiatric symptoms occur. The 5-hydroxynyptamine(5-HT) system has the ability to interact with the majority of the neurochemical systems in the central nervous system (CNS), influencing brain function. Serotonin transporter gene-linked polymorphic region (5-HTTLPR) is an essential element of the 5-HT system gene polymorphism and is directly related to the control of 5-hydroxytryptamine transporter (5-HTT)gene expression. The relationship between 5-HTTLPR and functional brain measurements in SLE patients requires more investigation because it is one of the most attractive imaging genetics targets for shedding light on the pathophysiology of neuropsychiatric lupus.<h4>Methods</h4>Resting-state functional magnetic resonance imaging (rs-fMRI) images were collected from 51 SLE patients without obvious neuropsychiatric manifestations and 44 healthy volunteers. Regional homogeneity (ReHo), amplitude of low-frequency fluctuations (ALFF), and fractional amplitude of low-frequency fluctuations (fALFF) were selected as indicators for evaluating brain function. In accordance with the Anatomical Automatic Labeling template, the gray matter was divided into 116 regions. The mean ReHo value, mean ALFF value, and mean fALFF value of each brain region were extracted. 5-HTTLPR genotypes of all research objects were tested by polymerase chain reaction and agarose gel electrophoresis. Two-way analysis of covariance was used to investigate whether there is an interaction effect between SLE disease status and 5-HTTLPR genotype on resting-state brain function.<h4>Results</h4>In SLE patients with S/S homozygosity, there were notably lower mean ReHo, mean ALFF, and mean fALFF values observed in the right parietal, inferior angular gyrus, and the right paracentral lobule compared to healthy controls. However, this distinction was not evident among carriers of the L allele. Within the S/S genotype, SLE patients exhibited decreased mean ReHo in the left posterior cingulate gyrus, reduced mean fALFF in the left caudate nucleus, and diminished mean ALFF in the left temporal pole: superior temporal gyrus, in contrast to the HC group. Conversely, no such differences were discerned among carriers of the L allele. Notably, among L allele carriers, SLE patients displayed a higher mean ReHo value in the right hippocampus compared to the HC group, while demonstrating a lower mean ALFF value in the left medial and paracingulate gyrus in contrast to the HC group. Conversely, these differences were not apparent among S/S homozygotes.<h4>Conclusions</h4>Brain function in the right parietal and inferior angular gyrus and the right paracentral lobule is affected by the interaction effect of SLE disease status and 5-HTTLPR genotype.

CDK5RAP1
Also flagged:CuproptosisKeloiddeathcoppercell growthMAPK
Journal Article 2024-01-31 ✓ 1 Snippet Guo Z, Yu Q, Huang W, Huang F, Chen X, Wei C.
In-Text Gene Mentions

…uproptosis genes—DLD, SLC31A1,CDK5RAP1, ETFDH, HSPA1A, HSPA1B,…

Show Full Abstract

<h4>Background</h4>Keloid is a common condition characterized by abnormal scarring of the skin, affecting a significant number of individuals worldwide.<h4>Objective</h4>The occurrence of keloids may be related to the reduction of cell death. Recently, a new cell death mode that relies on copper ions has been discovered. This study aimed to identify novel cuproptosis-related genes that are associated with keloid diagnosis.<h4>Methods</h4>We utilized several gene expression datasets, including GSE44270 and GSE145725 as the training group, and GSE7890, GSE92566, and GSE121618 as the testing group. We integrated machine learning models (SVM, RF, GLM, and XGB) to identify 10 cuproptosis-related genes (CRGs) for keloid diagnosis in the training group. The diagnostic capability of the identified CRGs was validated using independent datasets, RT-qPCR, Western blotting, and IHC analysis.<h4>Results</h4>Our study successfully categorized keloid samples into two clusters based on the expression of cuproptosis-related genes. Utilizing WGCNA analysis, we identified 110 candidate genes associated with cuproptosis. Subsequent functional enrichment analysis results revealed that these genes may play a regulatory role in cell growth within keloid tissue through the MAPK pathway. By integrating machine learning models, we identified CRGs that can be used for diagnosing keloid. The diagnostic efficacy of CRGs was confirmed using independent datasets, RT-qPCR, Western blotting, and IHC analysis. GSVA analysis indicated that high expression of CRGs influenced the gene set related to ECM receptor interaction.<h4>Conclusion</h4>This study identified 10 cuproptosis-related genes that provide insights into the molecular mechanisms underlying keloid development and may have implications for the development of targeted therapies.

Also flagged:Depressionmental disordercognitive dysfunctionmental diseasesanxietymania
Journal Article 2024-01-31 No Snippets Sun B, Cao X, Xin M, Guan R.
Show Full Abstract

Depression is a prevalent mental disorder and has a profound impact on an individual's psychological and physical well-being. It is characterized by a persistently depressed mood, loss of interest, energy loss, and cognitive dysfunction. In recent years, more and more people have changed to mental diseases, such as depression, anxiety, mania and so on. In the incidence of depression, covering all ages, but still mainly young and middle-aged women. Traditional treatments for depression mainly rely on medication and psychotherapy, but these methods are not effective for all patients and are often accompanied by certain side effects. Therefore, finding safe and effective alternative or adjuvant treatments has become a priority. Here we highlight the research progress of acupuncture in the treatment of depression and to explore the mechanism of acupuncture in the treatment of depression. Acupuncture treatment of depression is an ancient and effective method, the mechanism involves multiple biological pathways, for example, by regulating neurotransmitter levels, regulating the neuroendocrine axis, improving neuroplasticity, anti-inflammatory and other effects, improving emotional state and play an antidepressant role. To provide evidence to support the widespread use of acupuncture in clinical practice. We hope to provide new treatment ideas and methods for patients with depression, and even reduce the incidence of depression.

HFE
Also flagged:XerostomiaSystemic DiseasesPsoriasisautoimmune diseasekeratinizationpsoriasis vulgaris
Journal Article 2024-01-31 ✓ 1 Snippet Novianti Y, Hidayat W, Rosa DE.
In-Text Gene Mentions

…erma, psoriasis), sarcoidosis,hemochromatosis, amyloidosis, kidney disease,…

Show Full Abstract

<h4>Introduction</h4>Psoriasis is a complex autoimmune disease associated with chronic systemic keratinization and inflammation, which can affect the skin, joints, and oral cavity. Xerostomia is a subjective feeling of oral dryness that impairs patient comfort and lowers the quality of life. The aim of this case report is to describe the clinical mechanism of xerostomia in a psoriasis patient with multiple systemic diseases.<h4>Case report</h4>A 51-year-old inpatient man with psoriasis vulgaris was referred to the Oral Medicine Department with complaints of difficulty swallowing due to a sore throat and dry tongue since last week. The patient had psoriasis vulgaris 15 years ago, chronic adrenal insufficiency, psoriatic arthritis, acute circulatory collapse, anemia of inflammation, acute kidney injury, dehydration, gastritis, urinary tract infections, and malnutrition. A complete anamnesis and oral examination were done. The patient was diagnosed with severe xerostomia, a fissured tongue, exfoliative cheilitis, angular cheilitis, and gingivitis by the Oral Medicine Department.<h4>Case management</h4>The patient was treated with petroleum jelly, chlorine dioxide mouthwash, miconazole cream, and benzydamine HCl lozenges.<h4>Conclusion</h4>Based on case reports and reviews, multiple systemic diseases may not only increase the risk of xerostomia but also aggravate its severity.

Also flagged:Extracellular VesiclesextracellularvesiclesCardiovascular diseasesischemic heart diseasecardiomyopathies
Journal Article 2024-01-31 No Snippets Caño-Carrillo S, Castillo-Casas JM, Franco D, Lozano-Velasco E.
Show Full Abstract

Effective intercellular communication is essential for cellular and tissue balance maintenance and response to challenges. Cellular communication methods involve direct cell contact or the release of biological molecules to cover short and long distances. However, a recent discovery in this communication network is the involvement of extracellular vesicles that host biological contents such as proteins, nucleic acids, and lipids, influencing neighboring cells. These extracellular vesicles are found in body fluids; thus, they are considered as potential disease biomarkers. Cardiovascular diseases are significant contributors to global morbidity and mortality, encompassing conditions such as ischemic heart disease, cardiomyopathies, electrical heart diseases, and heart failure. Recent studies reveal the release of extracellular vesicles by cardiovascular cells, influencing normal cardiac function and structure. However, under pathological conditions, extracellular vesicles composition changes, contributing to the development of cardiovascular diseases. Investigating the loading of molecular cargo in these extracellular vesicles is essential for understanding their role in disease development. This review consolidates the latest insights into the role of extracellular vesicles in diagnosis and prognosis of cardiovascular diseases, exploring the potential applications of extracellular vesicles in personalized therapies, shedding light on the evolving landscape of cardiovascular medicine.

Also flagged:Boroncell adhesionhydroxyapatitestrontiumnitrogenHydroxyapatites
Journal Article 2024-01-31 No Snippets Kolmas J, Samoilov P, Jaguszewska A, Skwarek E.
Show Full Abstract

Tissue engineering is an interdisciplinary field of science that has been developing very intensively over the last dozen or so years. New ways of treating damaged tissues and organs are constantly being sought. A variety of porous structures are currently being investigated to support cell adhesion, differentiation, and proliferation. The selection of an appropriate biomaterial on which a patient's new tissue will develop is one of the key issues when designing a modern tissue scaffold and the associated treatment process. Among the numerous groups of biomaterials used to produce three-dimensional structures, hydroxyapatite (HA) deserves special attention. The aim of this paper was to discuss changes in the double electrical layer in hydroxyapatite with an incorporated boron and strontium/electrolyte solution interface. The adsorbents were prepared via dry and wet precipitation and low-temperature nitrogen adsorption and desorption methods. The specific surface area was characterized, and the surface charge density and zeta potential were discussed.

TNFSF4
Also flagged:Breast CancerFTSJ1Tumormethyltransferasecell proliferationcancer
Journal Article 2024-01-31 ✓ 2 Snippets Sun Y, Liu Q, Zhong S, Wei R, Luo JL.
In-Text Gene Mentions

…TCAGAGTGTTTCAGAGGC-3′; CD252 (TNFSF4)-F: 5′-CCTACATCTGCCTGCACTTCTC…

…CATCTGCCTGCACTTCTC-3′; CD252 (TNFSF4)-R: 5′-TGATGACTGAGTTGTTCTGCAC…

Show Full Abstract

FtsJ RNA 2'-O-methyltransferase 1 (FTSJ1) is a member of the methyltransferase superfamily and is involved in the processing and modification of ribosomal RNA. We herein demonstrate that FTSJ1 favors TNBC progression. The knockdown of FTSJ1 inhibits TNBC cell proliferation and development, induces apoptosis of cancer cells, and increases the sensitivity of TNBC cells to T-cell-mediated cytotoxicity. Furthermore, the high expression of FTSJ1 in TNBC attenuates CD8+T cell infiltration in the tumor microenvironment (TME) correlated with poorer prognosis for clinical TNBC patients. In this study, we establish that FTSJ1 acts as a tumor promotor, is involved in cancer immune evasion, and may serve as a potential immunotherapy target in TNBC.

Also flagged:type 2 diabetes mellitusgallstone diseaseGSDdiabetescancerinsulin
Journal Article 2024-01-31 No Snippets Yan P, Zhang L, Yang C, Zhang W, Wang Y, Zhang M, Cui H, Tang M, Chen L, Wu X, Zhao X, Zou Y, Xiao J, Liu Y, Xiao C, Yang Y, Zhang L, Yao Y, Li J, Liu Z, Yang C, Jiang X, Zhang B.
Show Full Abstract

<h4>Background</h4>The relationship between type 2 diabetes mellitus (T2DM) and gallstone disease (GSD) have been incompletely understood. We aimed to investigate their phenotypic and genetic associations and evaluate the biological mechanisms underlying these associations.<h4>Methods</h4>We first evaluated the phenotypic association between T2DM and GSD using data from the UK Biobank (n>450,000) using a prospective observational design. We then conducted genetic analyses using summary statistics from a meta-analysis of genome-wide association studies of T2DM, with and without adjusting for body mass index (BMI) (N<sub>case</sub>=74,124, N<sub>control</sub>=824,006; T2DM<sub>adj</sub>BMI: N<sub>case</sub>=50,409, N<sub>control</sub>=523,897) and GSD (N<sub>case</sub>=43,639, N<sub>control</sub>=506,798).<h4>Results</h4>A unidirectional phenotypic association was observed, where individuals with T2DM exhibited a higher GSD risk (hazard ratio (HR)=1.39, <i>P</i><0.001), but not in the reverse direction (GSD→T2DM: HR=1.00, <i>P</i>=0.912). The positive T2DM-GSD genetic correlation (<i>r<sub>g</sub></i>=0.35, <i>P</i>=7.71×10<sup>-23</sup>) remained even after adjusting for BMI (T2DM<sub>adj</sub>BMI: <i>r<sub>g</sub></i>=0.22, <i>P</i>=4.48×10<sup>-10</sup>). Mendelian randomization analyses provided evidence of a unidirectional causal relationship (T2DM→GSD: odds ratio (OR)=1.08, <i>P</i>=4.6×10<sup>-8</sup>; GSD→T2DM: OR=1.02, <i>P</i>=0.48), even after adjusting for important metabolic confounders (OR=1.02, <i>P</i>=0.02). This association was further corroborated through a comprehensive functional analysis reflected by 23 pleiotropic single nucleotide polymorphisms, as well as multiple neural and motor-enriched tissues.<h4>Conclusion</h4>Through comprehensive observational and genetic analyses, our study clarified the causal relationship between T2DM and GSD, but not in the reverse direction. These findings might provide new insights into prevention and treatment strategies for T2DM and GSD.

SERPINC1
Also flagged:nadroparinheparinCreatininethromboembolic diseasearterial thrombosisheparins
Journal Article 2024-01-31 ✓ 2 Snippets Chen Y, Lan J, Zhu L, Dong M, Wang Y, Li Z.
In-Text Gene Mentions

…protein antithrombin III (ATIII).…

…nadroparin interacts withATIII, this complex leads…

Show Full Abstract

<b>Objectives:</b> Nadroparin, a low-molecular-weight-heparin is commonly used off-label in neonates and infants for thromboembolic events prevention. However, the recommended dosing regimen often fails to achieve therapeutic target ranges. This study aimed to develop a population pharmacokinetic (PK) model of nadroparin to determine an appropriate dosing regimen for neonates and infants less than 8 months. <b>Methods:</b> A retrospective chart review was conducted on patients treated with nadroparin at Children's Hospital of Fudan University between July 2021 and December 2023. A population PK model was developed using anti-Xa levels, and its predictive performance was evaluated internally. Monte Carlo simulations were performed to design an initial dosing schedule targeting anti-Xa levels between 0.5 and 1 IU/mL. <b>Results:</b> A total of 40 neonates and infants aged less than 8 months with gestational age ranging from 25 to 41 weeks treated with nadroparin were enrolled in the study for analysis. A one-compartment PK model with first order absorption and elimination was adequately fitted to the data. Creatinine clearance was identified as a significant factor contributing to inter-individual variability in clearance. The typical population parameter estimates of clearance, distribution volume and absorption rate in this population were 0.211 L/h, 1.55 L and 0.495 h<sup>-1</sup>, respectively. Our findings suggest that current therapeutic doses of nadroparin (150-200 IU/kg q12 h) may result in subtherapeutic exposure, thus higher doses might be required. <b>Conclusion:</b> The present study offers the first estimation of PK parameters for nadroparin in preterm or term neonates and infants less than 8 months utilizing the model. Our findings have potential implications for recommending initial personalized dosages, particularly among patient populations exhibiting similar characteristics.

Also flagged:intraventricular hemorrhagegestationsteroidspulmonary hypertensionpulmonary hemorrhagetension pneumothorax
Journal Article 2024-01-31 No Snippets Korček P, Širc J, Berka I, Kučera J, Straňák Z.
Show Full Abstract

<h4>Background</h4>Intraventricular hemorrhage (IVH) is an important cause of neurodevelopmental impairment in preterm infants. A number of risk factors for IVH have already been proposed; however, some controversies regarding optimal perinatal management persist. This study aimed to identify perinatal and neonatal attributes associated with IVH in a representative population of preterm infants.<h4>Methods</h4>Perinatal data on 1,279 very preterm infants (<32 weeks of gestation) admitted to a tertiary neonatal intensive care unit were analyzed. The records were assessed using univariate analysis and logistic regression model to evaluate the risk factors for any and high-grade IVH (grade III-IV according to the classification by Papile) within the first week after birth.<h4>Results</h4>The incidence of any IVH was 14.3% (183/1,279); the rate of low-grade (I-II) and high-grade (III-IV) IVH was 9.0% (115/1,279) and 5.3% (68/1,279), respectively. Univariate analysis revealed multiple factors significantly associated with intraventricular hemorrhage: lower gestational age and birth weight, absence of antenatal steroids, vaginal delivery, low Apgar score at 5 min, delivery room intubation, surfactant administration, high frequency oscillation, pulmonary hypertension, pulmonary hemorrhage, tension pneumothorax, persistent ductus arteriosus, hypotension and early onset sepsis. Logistic regression confirmed lower gestational age, vaginal delivery, ductus arteriosus and early onset sepsis to be independent predictors for any IVH. Pulmonary hemorrhage, tension pneumothorax and early onset sepsis were independent risk factors for high-grade IVH. Complete course of antenatal steroids was associated with a lower risk for any (odds ratio 0.58, 95% confidence interval 0.39-0.85; <i>P</i> = .006) and for high-grade intraventricular hemorrhage (odds ratio 0.36, 95% confidence interval 0.20-0.65; <i>P</i> < .001).<h4>Conclusion</h4>The use of antenatal steroids and mode of delivery are crucial in the prevention of IVH; however, our study did not confirm the protective effect of placental transfusion. Severe respiratory insufficiency and circulatory instability remain to be powerful contributors to the development of IVH. Early detection and management of perinatal infection may also help to reduce the rate of brain injury and improve neurodevelopment in high-risk newborns.

SOX6
Also flagged:Spitz Melanocytic TumorsmelanomaSpitz neviSpitz melanocytomasSpitz melanomasbenign neoplasms
Journal Article 2024-01-31 ✓ 1 Snippet Chatzopoulos K, Syrnioti A, Linos K.
In-Text Gene Mentions

…62 ], NRF1,SOX6, EMLR4, and…

Show Full Abstract

Over the last 75 years, our understanding of Spitz lesions has undergone substantial evolution. Initially considered a specific type of melanoma, the perception has shifted towards recognizing Spitz lesions as a spectrum comprising Spitz nevi, Spitz melanocytomas, and Spitz melanomas. Spitz lesions are known for posing a significant diagnostic challenge regarding the distinction between benign neoplasms displaying atypical traits and melanomas. A comprehensive understanding of their molecular basis and genomic aberrations has significantly improved precision in classifying and diagnosing these challenging lesions. The primary aim of this review is to encapsulate the current understanding of the molecular pathogenesis and distinct clinicopathologic characteristics defining this intriguing set of tumors.

HTT
Also flagged:Calmodulin-Binding ProteinsIon ChannelsReceptorsCalciumcalcium-binding proteinendoplasmic reticulum
Journal Article 2024-01-31 ✓ 5 Snippets O'Day DH.
In-Text Gene Mentions

The mutations in the Htt gene that cause HD affect a number of targets involved in calcium homeostasis, of which upregulating the CaMBP PSEN1 while downregulating CaM could significantly impact downstream calcium signaling [95].

…biomarkers (Aβ; Tau;Htt; aSyn) linked to…

…Tau), VGCC (Aβ;Htt), TRPC (Aβ), Orai…

…VDAC (Aβ; Tau;Htt; αSyn), IP3R (Aβ;…

…αSyn), IP3R (Aβ;Htt), RyR (Htt) […

Show Full Abstract

Calcium dyshomeostasis is an early critical event in neurodegeneration as exemplified by Alzheimer's (AD), Huntington's (HD) and Parkinson's (PD) diseases. Neuronal calcium homeostasis is maintained by a diversity of ion channels, buffers, calcium-binding protein effectors, and intracellular storage in the endoplasmic reticulum, mitochondria, and lysosomes. The function of these components and compartments is impacted by the toxic hallmark proteins of AD (amyloid beta and Tau), HD (huntingtin) and PD (alpha-synuclein) as well as by interactions with downstream calcium-binding proteins, especially calmodulin. Each of the toxic hallmark proteins (amyloid beta, Tau, huntingtin, and alpha-synuclein) binds to calmodulin. Multiple channels and receptors involved in calcium homeostasis and dysregulation also bind to and are regulated by calmodulin. The primary goal of this review is to show the complexity of these interactions and how they can impact research and the search for therapies. A secondary goal is to suggest that therapeutic targets downstream from calcium dyshomeostasis may offer greater opportunities for success.

CCPG1
Also flagged:endoplasmic reticulumorganelleautophagypathogenesisneurodegenerative diseasesdegenerative nerve disorders
Journal Article 2024-01-31 ✓ 2 Snippets Zhao XY, Xu DE, Wu ML, Liu JC, Shi ZL, Ma QH.
In-Text Gene Mentions

In contrast to other selective autophagy pathways in which autophagy receptors such as P62, NBR1, and OPN recognize and select cargoes via their UBDs (Shaid et al., 2013), most ER-phagy receptors lack sizable luminal domains, the exceptions being CCPG1 and Atg39, which contain luminal domains of 518 and 234 amino acids, respectively.

…domain-containing protein 1;CCPG1: cell cycle progression…

Show Full Abstract

The endoplasmic reticulum, a key cellular organelle, regulates a wide variety of cellular activities. Endoplasmic reticulum autophagy, one of the quality control systems of the endoplasmic reticulum, plays a pivotal role in maintaining endoplasmic reticulum homeostasis by controlling endoplasmic reticulum turnover, remodeling, and proteostasis. In this review, we briefly describe the endoplasmic reticulum quality control system, and subsequently focus on the role of endoplasmic reticulum autophagy, emphasizing the spatial and temporal mechanisms underlying the regulation of endoplasmic reticulum autophagy according to cellular requirements. We also summarize the evidence relating to how defective or abnormal endoplasmic reticulum autophagy contributes to the pathogenesis of neurodegenerative diseases. In summary, this review highlights the mechanisms associated with the regulation of endoplasmic reticulum autophagy and how they influence the pathophysiology of degenerative nerve disorders. This review would help researchers to understand the roles and regulatory mechanisms of endoplasmic reticulum-phagy in neurodegenerative disorders.

HFE
Also flagged:Liver FibrosisCirrhosisNAFLDchronic liver diseasesNon-alcoholic fatty liver diseasehepatic steatosis
Journal Article 2024-01-31 ✓ 1 Snippet Parsi A, Hajiani E, Sadani S, Hashemi SJ, Seyedian SS, Alimadadi M, Ghanbari R.
In-Text Gene Mentions

…as Wilson’s disease,hemochromatosis, and heart failure.…

Show Full Abstract

<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is one of the most common chronic liver diseases in the world. Previous studies revealed that cholecystectomy may be considered a risk factor for the development of NAFLD. The aim of this study was to compare the amount of liver fibrosis, determined by elastography, between patients with NAFLD with and without a history of cholecystectomy.<h4>Methods</h4>In this descriptive-analytical cross-sectional study, 50 patients with NAFLD were divided into two groups: one with a history of cholecystectomy and the other without. No significant differences were found between these two groups in terms of age or sex distribution. Liver fibrosis was measured for all patients using an elastography imaging system. Subsequently, the data related to liver fibrosis, along with the demographic information of the patients, were statistically analyzed using SPSS software version 22.<h4>Results</h4>The mean elastography score in all patients was 10.66±12.18 kPa (the elasticity scale ranging from 3.80 to 66.40 kPa). The group with a history of cholecystectomy had a significantly higher mean elastography score (13.39±16.20 kPa) compared with the group without cholecystectomy (7.93±4.99 kPa) (<i>P</i>=0.02). Additionally, there was a significant positive correlation between body mass index (BMI) and the mean elastography score in the group of patients with a history of cholecystectomy.<h4>Conclusion</h4>The mean elastography score of patients with NAFLD with a history of cholecystectomy was approximately twice as high as that of non-cholecystectomy patients.

HFE
Also flagged:Hereditary Hemochromatosisironchronic liver diseasesliver diseasesnon-alcoholic steatohepatitishepatitis C
Journal Article 2024-01-31 ✓ 5 Snippets Fatemi R, Movassagh-Koolankuh S, Mosadeghi N.
In-Text Gene Mentions

However, this kind of iron overload is not originating from HFE or other related mutations.3 WD is a genetic disorder characterized by mutations in ATP7B gene leading to the secretion of copper into the biliary system and its accumulation in the liver, brain, and other organs, as well as the reduction of circulating ceruloplasmin.4,5 Copper deposition in organs contributes to an increased risk of neurological and psychological disorders as well as life-threatening liver failure if left undiagnosed and untreated.6,7 Absence of serum copper as a key element for the ceruloplasmin ferroxidation activity leads to the accumulation of ferrous ions instead of ferric ions in the bloodstream.

Although many chronic liver diseases such as non-alcoholic steatohepatitis (NASH), chronic hepatitis B and C, primary biliary cholestasis, and alpha-1 antitrypsin deficiency are associated with mild iron overload and near-normal transferrin saturation rarely exceeding 45%, the association between primary & secondary hemochromatosis and other liver diseases like AIH is exceedingly rare.1 The natural history of chronic liver diseases with a genetic mutation in HFE gene family, even in the absence of iron overload, is reported to be more progressive into liver fibrosis and cirrhosis.1 Consequently, it would be a trigger factor for the earlier presentation of underlying chronic liver diseases, including AIH and WD, in a patient with a positive balance of iron absorption from the gastrointestinal tract.

…iron regulator protein (HFE: High Fe 2+…

…simultaneous occurrence ofhemochromatosiswith chronic liver…

…rarely related toHFE(hereditary hemochromatosis ge…

Show Full Abstract

This is not surprising to detect iron overload in chronic liver diseases and end-stage liver diseases since Kupffer cells scavenge necrotic hepatocytes during the course of liver damage, leading to an increased serum iron level and transferrin saturation compatible with iron overload even in the absence of a genetic mutation suggestive of hereditary hemochromatosis. Therewith, a relative association has been found between some sorts of chronic liver diseases like non-alcoholic steatohepatitis and hepatitis C with human homeostatic iron regulator protein (HFE: High Fe<sup>2+</sup>) gene mutations. Moreover, impairment of ceruloplasmin ferroxidase activity in the course of Wilson's disease (WD), leading to the accumulation of ferrous ions just like what is expected in aceruloplasminemia, is another known reason for iron overload accompanied by chronic liver disease. Of chronic liver diseases, autoimmune hepatitis (AIH), and cholestatic liver diseases are less related to iron overload. Accordingly, the coexistence of WD, AIH, and hereditary hemochromatosis when there exist clinical features, laboratory tests, genetic confirmation, and histological evaluations indicative of the three mentioned diseases is exceedingly rare. Here, we present a 55-year-old man referred with progressive generalized icterus accompanied by loss of appetite and significant weight loss. The presented case was not an appropriate candidate for liver biopsy due to recent coronary angioplasty and the urgent need for dual antiplatelet therapy. However, medical follow-ups were highly suggestive of concomitant WD, hereditary hemochromatosis, and AIH. The attempts failed for the treatment of hereditary hemochromatosis and WD with chelating agents until the completion of the course of treatment with immunosuppressants targeting components of the AIH-related immune system.

Research Square 2024-01-31 Preprint (No Snippets API) Lin S, Wang HL, Huang J, Kuo M, Tsai Y, Lu C, Chen Y, Phoa FKH, Kung P, Lin Y, Chu Y, Ju Y, Shen T, Hong C, Ochiya T, Ueda K, Wu R.
Show Full Abstract

<title>Abstract</title> <p>Multiple system atrophy (MSA) is an atypical parkinsonism that mimics the clinical manifestation of Parkinson’s disease (PD) but is characterized by distinct pathological hallmarks and poor medication response. Identifying reliable biomarkers for MSA facilitates differential diagnosis and promotes targeted treatments. Here, we profiled plasma-derived extracellular vesicle (EV) proteomics in patients with MSA or PD and healthy controls (HC), based on liquid chromatography‒mass spectrometry (LC‒MS/MS). A modified linear programming system termed Biomedical Oriented Logistic Dantzig (BOLD) Selector was implemented for the identification of the EV proteins that were significantly associated with MSA through an oversaturated proteomic dataset comprising 1272 entries. As a result, the top-ranked EV protein candidates incorporated into our constructed logistic regression formula for differentiating MSA patients with HC were LCAT, CRKL, Kallistatin and CSE1L, and APOE, ALDH4A1, ABCC4, and kallistatin for separating MSA from typical PD patients. These EV proteins are most strongly attributed to “cholesterol transport” by gene ontology analysis. The other major biological processes highlighted for these candidates include modulators for oxidative stress, inflammation, and demyelination processes. Innovative therapeutic approaches targeting these candidates aiming at regulating cholesterol balance, reducing oxidative stress, and alleviating glial inflammation hold promise for neuroprotection against the lethal neurodegenerative disorders.</p>

Authorea Preprints 2024-01-31 Preprint (No Snippets API) Sawetaji, Jindal S, Kant R, Saluja D, Aggarwal KK.
Show Full Abstract

Sequences similar to antithrombin-III in plants were retrieved from NCBI BLAST. Sequences showing homology more than 32% were shortlisted. Due to the non-availability of the crystal structures of the shortlisted sequences in the PDB database, models were generated using SWISS MODEL web server. The generated models were authenticated using SAVES web server. Best models for each sequence were selected and docked with thrombin using HawkDock web server. Out of 15 docked complexes, ALPP was shortlisted depending upon the highest binding affinity of -41.28 kcal/mol. Thrombin structure complexed with antithrombin-III like protein from Punica granatum (ALPP) was docked with TAME using AutoDock Vina to see if structure from ALPP affects the TAME binding. No interaction or binding is observed for TAME at 195Ser residue of thrombin. So after binding with ALPP, thrombin loses its affinity to bind with TAME at active site residue. MD simulation was performed for 20 ns to evaluate the flexibility and the stability of the docked complexes. The RMSD for the Thrombin-TAME complex was found to be 0.35nm whereas the RMSD of ALPP-Thrombin complex was found to be 0.4nm. Thus, it is very likely that the protein identified from Punica granatum may act as an inhibitor for thrombin.

Authorea Preprints 2024-01-31 Preprint (No Snippets API) Al-Sweedan s, Almasri M, Abushukair H, Alhusan A, Za'nouneh FA, Alsweedan D, ayasreh h.
Show Full Abstract

<h4>Objective: </h4> We report this case of a 2.5 months old infant diagnosed with HLH with an autosomal recessive ZNFX1 related immune-hematological abnormalities in order to provide more information regarding the genetic and clinical manifestations concerning this disorder. <h4>Method:</h4> Medical file of the patient was reviewed including; patient profile, lab results, and management. <h4>Results:</h4> we present a unique case of a 2.5 months HLH patient that presented with a unique genetic variant with a mutated ZNFX1 gene. <h4>Conclusion:</h4> we report a homozygous ZNFX1 variant as the base of HLH in this patient. HLH proposes a diagnostic challenge as its signs and symptoms are concurrent with other differentials.

Also flagged:Lmx1blocomotiontranscription factorNail‐Patella syndromelimb developmentorganization
Journal Article 2024-01-30 No Snippets Castilla-Ibeas A, Zdral S, Oberg KC, Ros MA.
Show Full Abstract

The limb anatomy displays well-defined dorsal and ventral compartments, housing extensor, and flexor muscles, which play a crucial role in facilitating limb locomotion and manipulation. Despite its importance, the study of limb dorsoventral patterning has been relatively neglected compared to the other two axes leaving many crucial questions about the genes and developmental processes implicated unanswered. This review offers a thorough overview of the current understanding of limb dorsoventral patterning, synthesizing classical literature with recent research. It covers the specification of dorsal fate in the limb mesoderm and its subsequent translation into dorsal morphologies-a process directed by the transcription factor Lmx1b. We also discuss the potential role of dorsoventral patterning in the evolution of paired appendages and delve into the involvement of LMX1B in Nail-Patella syndrome, discussing the molecular and genetic aspects underlying this condition. Finally, the potential role of dorsoventral polarity in digit tip regeneration, a prominent instance of multi-tissue regeneration in mammals is also considered. We anticipate that this review will renew interest in a process that is critical to limb function and evolutionary adaptations but has nonetheless been overlooked.

CA10
Also flagged:carbazoleanthranilatecatecholchromosomesGFPchromosome
Journal Article 2024-01-30 ✓ 5 Snippets Suzuki-Minakuchi C, Yamamoto N, Takahira S, Yamaguchi M, Takeda Y, Okada K, Shigeto S, Nojiri H.
In-Text Gene Mentions

…(hereafter, KTPC) andPseudomonas resinovorans CA10resinovorans CA10.…

CA10has a gene,…

…harboring Pseudomonas strains,P. resinovorans CA10resinovorans CA10 exhibits…

Pseudomonas resinovorans CA10

P. resinovorans CA10

Show Full Abstract

To elucidate why plasmid-borne catabolic ability differs among host bacteria, we assessed the expression dynamics of the P<i><sub>ant</sub></i> promoter on the carbazole-degradative conjugative plasmid pCAR1 in <i>Pseudomonas putida</i> KT2440(pCAR1) (hereafter, KTPC) and <i>Pseudomonas resinovorans</i> CA10. The P<i><sub>ant</sub></i> promoter regulates the transcription of both the <i>car</i> and <i>ant</i> operons, which are responsible for converting carbazole into anthranilate and anthranilate into catechol, respectively. In the presence of anthranilate, transcription of the P<i><sub>ant</sub></i> promoter is induced by the AraC/XylS family regulator AntR, encoded on pCAR1. A reporter cassette containing the P<i><sub>ant</sub></i> promoter followed by <i>gfp</i> was inserted into the chromosomes of KTPC and CA10. After adding anthranilate, GFP expression in the population of CA10 showed an unimodal distribution, whereas a small population with low GFP fluorescence intensity appeared for KTPC. CA10 has a gene, <i>antR</i><sub>CA</sub>, that encodes an iso-functional homolog of AntR on its chromosome. When <i>antR</i><sub>CA</sub> was disrupted, a small population with low GFP fluorescence intensity appeared. In contrast, overexpression of pCAR1-encoded AntR in KTPC resulted in unimodal expression under the P<i><sub>ant</sub></i> promoter. These results suggest that the expression of pCAR1-encoded AntR is insufficient to ameliorate the stochastic expression of the P<i><sub>ant</sub></i> promoter. Raman spectra of single cells collected using deuterium-labeled carbazole showed that the C-D Raman signal exhibited greater variability for KTPC than CA10. These results indicate that heterogeneity at the transcriptional level of the P<i><sub>ant</sub></i> promoter due to insufficient AntR availability causes fluctuations in the pCAR1-borne carbazole-degrading capacity of host bacterial cells.IMPORTANCEHorizontally acquired genes increase the competitiveness of host bacteria under selective conditions, although unregulated expression of foreign genes may impose fitness costs. The "appropriate" host for a plasmid is empirically known to maximize the expression of plasmid-borne traits. In the case of pCAR1-harboring <i>Pseudomonas</i> strains, <i>P. resinovorans</i> CA10 exhibits strong carbazole-degrading capacity, whereas <i>P. putida</i> KT2440 harboring pCAR1 exhibits low degradation capacity. Our results suggest that a chromosomally encoded transcription factor affects transcriptional and metabolic fluctuations in host cells, resulting in different carbazole-degrading capacities as a population. This study may provide a clue for determining appropriate hosts for a plasmid and for regulating the expression of plasmid-borne traits, such as the degradation of xenobiotics and antibiotic resistance.

STAU1
Also flagged:XRN1RHAPACTRNA-induced silencingRISCbinding
Journal Article 2024-01-30 ✓ 1 Snippet Chen X, Li R-T, Chen R-Y, Shi P-D, Liu Z-X, Lou Y-N, Wu M, Zhang R-R, Tang W, Li X-F, Qin C-F.
In-Text Gene Mentions

STAU1

Show Full Abstract

During the life cycle of mosquito-borne flaviviruses, substantial subgenomic flaviviral RNA (sfRNA) is produced <i>via</i> incomplete degradation of viral genomic RNA by host XRN1. Zika virus (ZIKV) sfRNA has been detected in mosquito and mammalian somatic cells. Human neural progenitor cells (hNPCs) in the developing brain are the major target cells of ZIKV, and antiviral RNA interference (RNAi) plays a critical role in hNPCs. However, whether ZIKV sfRNA was produced in ZIKV-infected hNPCs as well as its function remains not known. In this study, we demonstrate that abundant sfRNA was produced in ZIKV-infected hNPCs. RNA pulldown and mass spectrum assays showed ZIKV sfRNA interacted with host proteins RHA and PACT, both of which are RNA-induced silencing complex (RISC) components. Functionally, ZIKV sfRNA can antagonize RNAi by outcompeting small interfering RNAs (siRNAs) in binding to RHA and PACT. Furthermore, the 3' stem loop (3'SL) of sfRNA was responsible for RISC components binding and RNAi inhibition, and 3'SL can enhance the replication of a viral suppressor of RNAi (VSR)-deficient virus in a RHA- and PACT-dependent manner. More importantly, the ability of binding to RISC components is conversed among multiple flaviviral 3'SLs. Together, our results identified flavivirus 3'SL as a potent VSR in RNA format, highlighting the complexity in virus-host interaction during flavivirus infection.IMPORTANCEZika virus (ZIKV) infection mainly targets human neural progenitor cells (hNPCs) and induces cell death and dysregulated cell-cycle progression, leading to microcephaly and other central nervous system abnormalities. RNA interference (RNAi) plays critical roles during ZIKV infections in hNPCs, and ZIKV has evolved to encode specific viral proteins to antagonize RNAi. Herein, we first show that abundant sfRNA was produced in ZIKV-infected hNPCs in a similar pattern to that in other cells. Importantly, ZIKV sfRNA acts as a potent viral suppressor of RNAi (VSR) by competing with siRNAs for binding RISC components, RHA and PACT. The 3'SL of sfRNA is responsible for binding RISC components, which is a conserved feature among mosquito-borne flaviviruses. As most known VSRs are viral proteins, our findings highlight the importance of viral non-coding RNAs during the antagonism of host RNAi-based antiviral innate immunity.

HTT
Also flagged:Depressionmental illnessserotoninhistamineglutamatetransporters
Journal Article 2024-01-30 ✓ 1 Snippet Dunham KE, Venton BJ.
In-Text Gene Mentions

Initially, they explored serotonin changes with male 5-HTT (SERT) KO mice (+/+, +/-, and -/-) [31], and found that serotonin clearance decreased in the heterozygous (+/-) group, and even more in the homozygous (-/-) mice.

Show Full Abstract

Depression is a common mental illness. However, its current treatments, like selective serotonin reuptake inhibitors (SSRIs) and micro-dosing ketamine, are extremely variable between patients and not well understood. Three neurotransmitters: serotonin, histamine, and glutamate, have been proposed to be key mediators of depression. This review focuses on analytical methods to quantify these neurotransmitters to better understand neurological mechanisms of depression and how they are altered during treatment. To quantitatively measure serotonin and histamine, electrochemical techniques such as chronoamperometry and fast-scan cyclic voltammetry (FSCV) have been improved to study how specific molecular targets, like transporters and receptors, change with antidepressants and inflammation. Specifically, these studies show that different SSRIs have unique effects on serotonin reuptake and release. Histamine is normally elevated during stress, and a new inflammation hypothesis of depression links histamine and cytokine release. Electrochemical measurements revealed that stress increases histamine, decreases serotonin, and leads to changes in cytokines, like interleukin-6. Biosensors can also measure non-electroactive neurotransmitters, including glutamate and cytokines. In particular, new genetic sensors have shown how glutamate changes with chronic stress, as well as with ketamine treatment. These techniques have been used to characterize how ketamine changes glutamate and serotonin, and to understand how it is different from SSRIs. This review briefly outlines how these electrochemical techniques work, but primarily highlights how they have been used to understand the mechanisms of depression. Future studies should explore multiplexing techniques and personalized medicine using biomarkers in order to investigate multi-analyte changes to antidepressants.

Also flagged:Quinalizarinanthraquinonehyphal growthbiofilm formationoxygenmitochondrial
Journal Article 2024-01-30 No Snippets Janeczko M, Kochanowicz E, Górka K, Skrzypek T.
Show Full Abstract

This study aims to analyze the antifungal properties of quinalizarin, a plant-derived compound with proven anticancer effects. Quinalizarin exhibited antifungal activity against opportunistic pathogenic <i>Candida</i> species and <i>Geotrichum capitatum</i>. The treatment with this anthraquinone reduced hyphal growth, inhibited biofilm formation, and damaged mature <i>Candida albicans</i> biofilms. Real-time RT-PCR revealed that quinalizarin downregulated the expression of hyphae-related and biofilm-specific genes. The flow cytometry method used in the study showed that both apoptosis and necrosis were the physiological mechanisms of quinalizarin-induced <i>C. albicans</i> cell death, depending on the dose of the antifungal agent. A further study revealed an increase in the levels of intracellular reactive oxygen species and alterations in mitochondrial membrane potential after treatment with quinalizarin. Finally, quinalizarin was found to have low toxicity in a hemolytic test using human erythrocytes. In conclusion, we have identified quinalizarin as a potential antifungal compound.<h4>Importance</h4>This article is a study to determine the antifungal activity of quinalizarin (1,2,5,8-tetrahydroxyanthraquinone). Quinalizarin has potential antitumor properties and is effective in different types of tumor cells. The aim of the present study was to prove that quinalizarin can be used simultaneously in the treatment of cancer and in the treatment of intercurrent fungal infections. Quinalizarin was identified as a novel antifungal compound with low toxicity. These results may contribute to the development of a new drug with dual activity in the treatment of cancer-associated candidiasis.

Also flagged:coagulation factor II receptorCoagulation factor 2 thrombin receptorG protein-coupled receptorblood clottinggastric adenocarcinomaF2R
Journal Article 2024-01-30 No Snippets Wu X, Wang S, Wang C, Wu C, Zhao Z.
Show Full Abstract

Coagulation factor 2 thrombin receptor (F2R), a member of the G protein-coupled receptor family, plays an important role in regulating blood clotting through protein hydrolytic cleavage mediated receptor activation. However, the underlying biological mechanisms by which F2R affects the development of gastric adenocarcinoma are not fully understood. This study aimed to systematically analyze the role of F2R in gastric adenocarcinoma. Stomach adenocarcinoma (STAD)-related gene microarray data and corresponding clinicopathological information were downloaded from the Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. Differential expression genes (DEGs) associated with F2R were analyzed using Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), gene set enrichment analysis (GSEA), and protein-protein interaction (PPI) networks. F2R mRNA expression data were utilized to estimate stromal cell and immune cell scores in gastric cancer tissue samples, including stromal score, immune score, and ESTIMATE score, derived from single-sample enrichment studies. Analysis of TCGA and GEO databases revealed significantly higher F2R expression in STAD tissues compared to normal tissues. Patients with high F2R expression had shorter survival times than those with low F2R expression. F2R expression was significantly correlated with tumor (T) stage, node (N) stage, histological grade and pathological stage. Enrichment analysis of F2R-related genes showed that GO terms were mainly related to circulation-mediated human immune response, immunoglobulin, cell recognition and phagocytosis. KEGG analysis indicated associations to extracellular matrix (ECM) receptor interactions, neuroactive ligand-receptor interactions, the phosphoinositide-3-kinase-protein kinase B/Akt (PI3K-AKT) signaling pathway, the Wnt signaling pathway and the transforming growth factor-beta (TGF-β) signaling pathway. GSEA revealed connections to DNA replication, the Janus kinase/signal transducers and activators of transcription (JAK-STAT) signaling pathway, the mitogen-activated protein kinase (MAPK) signaling pathway and oxidative phosphorylation. Drug sensitivity analysis demonstrated positive correlations between F2R and several drugs, including BEZ235, CGP-60474, Dasatinib, HG-6-64-1, Aazopanib, Rapamycin, Sunitinib and TGX221, while negative correlation with CP724714, FH535, GSK1904529A, JNK-9L, LY317615, pyrimidine, rTRAIL and Vinorelbine. Knocking down F2R in GC cell lines resulted in slowed proliferation, migration, and invasion. All statistical analyses were performed using R software (version 4.2.1) and GraphPad Prism 9.0. p < 0.05 was considered statistically significant. In conclusion, this study underscores the significance of F2R as a potential biomarker in gastric adenocarcinoma, shedding light on its molecular mechanisms in tumorigenesis. F2R holds promise for aiding in the diagnosis, prognosis, and targeted therapy of STAD.

SERPINC1
Also flagged:albuminimmunoglobulinprimary immunodeficienciesautoimmune disorderscoagulationdefects
Journal Article 2024-01-30 ✓ 2 Snippets Zanardi A, Nardini I, Raia S, Conti A, Ferrini B, D'Adamo P, Gilberti E, DePalma G, Belloli S, Belloli S, Monterisi C, Coliva A, Rainone P, Moresco RM, Mori F, Zurlo G, Scali C, Natali L, Pancanti A, Giovacchini P, Magherini G, Tovani G, Salvini L, Cicaloni V, Tinti C, Tinti L, Lana D, Magni G, Giovannini MG, Gringeri A, Caricasole A, Alessio M.
In-Text Gene Mentions

Examples are F11 and Hereditary Factor XI Deficiency (score= 1.00), F13A1 and Hereditary Factor XIII Deficiency (score= 0.98), F9 and Hemophilia B (score= 1.00), SERPINC1 and Antithrombin III Deficiency (score= 1.00), VWF and von Willebrand Disease, Type 2 (score= 1.00), CP and Ceruloplasmin Deficiency (score= 0.90), HP and Congenital haptoglobin deficiency (score = 1,00), TF and Congenital atransferrinemia (score= 0.91).

…B (score= 1.00),SERPINC1and Antithrombin III…

Show Full Abstract

Plasma-derived therapeutic proteins are produced through an industrial fractionation process where proteins are purified from individual intermediates, some of which remain unused and are discarded. Relatively few plasma-derived proteins are exploited clinically, with most of available plasma being directed towards the manufacture of immunoglobulin and albumin. Although the plasma proteome provides opportunities to develop novel protein replacement therapies, particularly for rare diseases, the high cost of plasma together with small patient populations impact negatively on the development of plasma-derived orphan drugs. Enabling therapeutics development from unused plasma fractionation intermediates would therefore constitute a substantial innovation. To this objective, we characterized the proteome of unused plasma fractionation intermediates and prioritized proteins for their potential as new candidate therapies for human disease. We selected ceruloplasmin, a plasma ferroxidase, as a potential therapy for aceruloplasminemia, an adult-onset ultra-rare neurological disease caused by iron accumulation as a result of ceruloplasmin mutations. Intraperitoneally administered ceruloplasmin, purified from an unused plasma fractionation intermediate, was able to prevent neurological, hepatic and hematological phenotypes in ceruloplasmin-deficient mice. These data demonstrate the feasibility of transforming industrial waste plasma fraction into a raw material for manufacturing of new candidate proteins for replacement therapies, optimizing plasma use and reducing waste generation.

HTT
Also flagged:HuntingtindeathHDATXN3SCA3MSH2
Journal Article 2024-01-30 ✓ 4 Snippets Mätlik K, Baffuto M, Kus L, Deshmukh AL, Davis DA, Paul MR, Carroll TS, Caron MC, Masson JY, Pearson CE, Heintz N.
In-Text Gene Mentions

HTTand ATXN3 CAG…

…a set ofHTTexon 1 or…

…the gene encodingHTT-interacting protein ULK1 invo…

…the gene encodingHTT-interacting autophagy cargo r…

Show Full Abstract

Brain region-specific degeneration and somatic expansions of the mutant Huntingtin (mHTT) CAG tract are key features of Huntington's disease (HD). However, the relationships among CAG expansions, death of specific cell types and molecular events associated with these processes are not established. Here, we used fluorescence-activated nuclear sorting (FANS) and deep molecular profiling to gain insight into the properties of cell types of the human striatum and cerebellum in HD and control donors. CAG expansions arise at mHTT in striatal medium spiny neurons (MSNs), cholinergic interneurons and cerebellar Purkinje neurons, and at mutant ATXN3 in MSNs from SCA3 donors. CAG expansions in MSNs are associated with higher levels of MSH2 and MSH3 (forming MutSβ), which can inhibit nucleolytic excision of CAG slip-outs by FAN1. Our data support a model in which CAG expansions are necessary but may not be sufficient for cell death and identify transcriptional changes associated with somatic CAG expansions and striatal toxicity.

Also flagged:nucleusossificationWntfibroblast growth factorFGFNotch
Journal Article 2024-01-30 No Snippets Szoszkiewicz A, Bukowska-Olech E, Jamsheer A.
Show Full Abstract

Vertebral malformations (VMs) pose a significant global health problem, causing chronic pain and disability. Vertebral defects occur as isolated conditions or within the spectrum of various congenital disorders, such as Klippel-Feil syndrome, congenital scoliosis, spondylocostal dysostosis, sacral agenesis, and neural tube defects. Although both genetic abnormalities and environmental factors can contribute to abnormal vertebral development, our knowledge on molecular mechanisms of numerous VMs is still limited. Furthermore, there is a lack of resource that consolidates the current knowledge in this field. In this pioneering review, we provide a comprehensive analysis of the latest research on the molecular basis of VMs and the association of the VMs-related causative genes with bone developmental signaling pathways. Our study identifies 118 genes linked to VMs, with 98 genes involved in biological pathways crucial for the formation of the vertebral column. Overall, the review summarizes the current knowledge on VM genetics, and provides new insights into potential involvement of biological pathways in VM pathogenesis. We also present an overview of available data regarding the role of epigenetic and environmental factors in VMs. We identify areas where knowledge is lacking, such as precise molecular mechanisms in which specific genes contribute to the development of VMs. Finally, we propose future research avenues that could address knowledge gaps.

HFE
Also flagged:taubehavioralcognitive declineironADcognitive impairment
Journal Article 2024-01-30 ✓ 3 Snippets Zhang Y, Qian W, Zhang Y, Ma Y, Qian J, Li J, Wei X, Long Y, Wan X.
In-Text Gene Mentions

…impairment in theHFemouse model.…

…cognitive performance inHFe-fed mice…

…acid levels inHFemice.…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD), affecting many elders worldwide, is characterized by A-beta and tau-related cognitive decline. Accumulating evidence suggests that brain iron accumulation is an important characteristic of AD. However, the function and mechanism of the iron-mediated gut-brain axis on AD is still unclear.<h4>Methods</h4>A Caenorhabditis elegans model with tau-overexpression and a high-Fe diet mouse model of cognitive impairment was used for probiotic function evaluation. With the use of qPCR, and immunoblotting, the probiotic regulated differential expression of AD markers and iron related transporting genes was determined. Colorimetric kits, IHC staining, and immunofluorescence have been performed to explore the probiotic mechanism on the development of gut-brain links and brain iron accumulation.<h4>Results</h4>In the present study, a high-Fe diet mouse model was used for evaluation in which cognitive impairment, higher A-beta, tau and phosphorylated (p)-tau expression, and dysfunctional phosphate distribution were observed. Considering the close crosstalk between intestine and brain, probiotics were then employed to delay the process of cognitive impairment in the HFe mouse model. Pediococcus acidilactici (PA), but not Bacillus subtilis (BN) administration in HFe-fed mice reduced brain iron accumulation, enhanced global alkaline phosphatase (AP) activity, accelerated dephosphorylation, lowered phosphate levels and increased brain urate production. In addition, because PA regulated cognitive behavior in HFe fed mice, we used the transgenic Caenorhabditis elegans with over-expressed human p-tau for model, and then PA fed worms became more active and longer lived than E.coli fed worms, as well as p-tau was down-regulated. These results suggest that brain iron accumulation influences AD risk proteins and various metabolites. Furthermore, PA was shown to reverse tau-induced pathogenesis via iron transporters and AP-urate interaction.<h4>Conclusions</h4>PA administration studies demonstrate that PA is an important mediator of tau protein reduction, p-tau expression and neurodegenerative behavior both in Caenorhabditis elegans and iron-overload mice. Finally, our results provide candidates for AP modulation strategies as preventive tools for promoting brain health. Video Abstract.

HTT
Also flagged:neurodegenerative diseasesRANtranslationdegenerative disordersHDdentatorubral-pallidoluysian atrophy
Journal Article 2024-01-30 ✓ 1 Snippet Anderson R, Das MR, Chang Y, Farenhem K, Schmitz CO, Jain A.
In-Text Gene Mentions

HTT

Show Full Abstract

Expansions of CAG trinucleotide repeats cause several rare neurodegenerative diseases. The disease-causing repeats are translated in multiple reading frames and without an identifiable initiation codon. The molecular mechanism of this repeat-associated non-AUG (RAN) translation is not known. We find that expanded CAG repeats create new splice acceptor sites. Splicing of proximal donors to the repeats produces unexpected repeat-containing transcripts. Upon splicing, depending on the sequences surrounding the donor, CAG repeats may become embedded in AUG-initiated open reading frames. Canonical AUG-initiated translation of these aberrant RNAs may account for proteins that have been attributed to RAN translation. Disruption of the relevant splice donors or the in-frame AUG initiation codons is sufficient to abrogate RAN translation. Our findings provide a molecular explanation for the abnormal translation products observed in CAG trinucleotide repeat expansion disorders and add to the repertoire of mechanisms by which repeat expansion mutations disrupt cellular functions.

CSE1LDDX27
Also flagged:oral squamous cell carcinomaDEAD-box helicase 27DEAD-Box nucleic acid helicaseOSCCgene silencingtumor
Journal Article 2024-01-30 ✓ 5 Snippets Li G, Li R, Wang W, Sun M, Wang X.
In-Text Gene Mentions

<h4>The headings aims</h4>DEAD-box helicase 27 (DDX27), a member of the DEAD-Box nucleic acid helicase family, holds an elusive role in oral squamous cell carcinoma (OSCC).

⭐ same-sentence co-mention

Cell rescue experiments demonstrated that increased DDX27 levels ameliorated cell proliferation, attenuated apoptosis, and CSE1L depletion blocked cell development induced by DDX27 overexpression.<h4>Significances</h4>This study highlighted DDX27 as a potential therapeutic target for OSCC treatment, shedding light on its crucial role in OSCC development.

Xenograft tumor models were employed to evaluate DDX27's role in OSCC tumor formation.<h4>Key findings</h4>Elevated DDX27 expression in OSCC correlated with a higher pathological grade.

This study aims to unravel the regulatory functions of DDX27 in OSCC and explore its downstream targets.<h4>Materials and methods</h4>A commercial oral squamous cell carcinoma (OSCC) tissue microarray (TMA) was utilized.

⭐ same-sentence co-mention

DDX27 regulates oral squamous cell carcinoma development through targeting CSE1L.

Show Full Abstract

<h4>The headings aims</h4>DEAD-box helicase 27 (DDX27), a member of the DEAD-Box nucleic acid helicase family, holds an elusive role in oral squamous cell carcinoma (OSCC). This study aims to unravel the regulatory functions of DDX27 in OSCC and explore its downstream targets.<h4>Materials and methods</h4>A commercial oral squamous cell carcinoma (OSCC) tissue microarray (TMA) was utilized. We analyzed differentially expressed genes in OSCC through the GEO database. Target gene silencing was achieved using the shRNA-mediated lentivirus method. Coexpedia analysis identified co-expressed genes associated with DDX27. Additionally, a Co-Immunoprecipitation (Co-IP) experiment confirmed the protein interaction between DDX27 and CSE1L. Xenograft tumor models were employed to evaluate DDX27's role in OSCC tumor formation.<h4>Key findings</h4>Elevated DDX27 expression in OSCC correlated with a higher pathological grade. DDX27 knockdown resulted in decreased cell proliferation, increased apoptosis, inhibited cell migration, and induced G2/M phase cell cycle arrest, as well as impaired tumor outgrowth. Coexpedia analysis identified STAU1, NELFCD, and CSE1L as top co-expressed genes. Lentiviral vectors targeting STAU1, NELFCD, and CSE1L revealed that silencing CSE1L significantly impaired cell growth, indicating it as a downstream target of DDX27. Cell rescue experiments demonstrated that increased DDX27 levels ameliorated cell proliferation, attenuated apoptosis, and CSE1L depletion blocked cell development induced by DDX27 overexpression.<h4>Significances</h4>This study highlighted DDX27 as a potential therapeutic target for OSCC treatment, shedding light on its crucial role in OSCC development. Targeting DDX27 or its downstream effector, CSE1L, holds promise for innovative OSCC therapies.

Also flagged:chronic pancreatitisductal hypertensionHolmiumPancreaticolithiasispancreatitisPD
Journal Article 2024-01-30 No Snippets Emmanuel J, Hsin DCC, Bt Wan Abdullah WZA, See LT.
Show Full Abstract

The central dogma of pain in patients with chronic pancreatitis revolves around the pathophysiology of ductal hypertension owing to stones that obstruct the pancreatic duct. Conventional modalities available to decompress the pancreatic duct are occasionally limited by failed selective pancreatic duct cannulation during endoscopic retrograde cholangiopancreatography. We describe a novel endoscopic approach of EUS-guided laser lithotripsy to assist in pancreatic duct (PD) stone fragmentation in two symptomatic patients with underlying chronic pancreatitis who had failed PD cannulation and extracorporeal shock wave lithotripsy (ESWL). In both cases, a 365-micrometer LightTrail TracTip Holmium laser fiber was advanced within a 19G endoscopic ultrasound aspiration needle (Expect Slimline (SL), Boston Scientific, Marlborough, Massachusetts, United States) under endoscopic ultrasound (EUS) guidance to fragment the PD stones. There were no procedure-related complications encountered and follow-up after 1 month of the procedure revealed significant reduction in abdominal pain scores. To the best of our knowledge, these are the first reported cases of EUS-guided laser lithotripsy performed for PD stones. Our approach of performing laser lithotripsy under EUS guidance obviates the need for an ESWL procedure; however, it is technically more challenging and requires precision to avoid injury to the pancreas. Further prospective studies are required to evaluate the safety and efficacy of this novel approach and its applicability as either a rescue procedure or in tandem with conventional pancreatic endotherapy modalities.

HFE
Also flagged:Steatotic Liver Diseaseimmune responsesepsismetabolic syndromeacute kidney injuryacute kidney
Journal Article 2024-01-30 ✓ 1 Snippet Krznaric J, Papic N, Vrsaljko N, Gjurasin B, Kutlesa M, Vince A.
In-Text Gene Mentions

…conditions such ashemochromatosis, Wilson’s disease, toxic…

Show Full Abstract

<b>Background</b>: While it has been shown that steatotic liver disease (SLD) is associated with systemic changes in immune response, the impact of SLD on sepsis outcomes has not yet been established. The aim of this study was to investigate the association between SLD and sepsis severity and outcomes. <b>Methods</b>: A prospective observational study included consecutively hospitalized adult patients with community-acquired sepsis during a 16-month period. <b>Results</b>: Of the 378 included patients (49.5% male, median age of 69, IQR 57-78 years), 174 (46%) were diagnosed with SLD. Patients with SLD were older and more frequently fulfilled the criteria for metabolic syndrome. There were no differences in the source and etiology of sepsis between the groups. Patients with SLD exhibited a higher incidence of acute kidney injury (29.3% vs. 17.6%), the need for renal replacement therapy (16.1% vs. 8.8%), and more frequent use of invasive mechanical ventilation (29.3% vs. 18.1%). In-hospital mortality was significantly higher in the SLD group (18.39% vs. 9.8%). The multivariable analysis indicated that SLD was associated with mortality (HR 2.82, 95% CI 1.40-5.71) irrespective of the other elements within metabolic syndrome. <b>Conclusions</b>: SLD might be associated with higher sepsis in-hospital mortality, and more frequent development of acute kidney and respiratory insufficiency requiring more critical care support.

HFE
Also flagged:HepcidinCarotid Atheromaironcarotid plaquestransferrin receptorCD68
Journal Article 2024-01-30 ✓ 1 Snippet Yuan XM, Sultana N, Ghosh-Laskar M, Li W.
In-Text Gene Mentions

…in patients withhemochromatosis, a condition characterized…

Show Full Abstract

Hepcidin is upregulated by increased body iron stores and inflammatory cytokines. It is associated with cardiovascular events, arterial stiffness, and increased iron accumulation in human atheroma with hemorrhage. However, it is unknown whether the expression of hepcidin in human carotid plaques is related to plaque severity and whether hepcidin expression differs between men and women. Carotid samples from 58 patients (38 males and 20 females) were immunostained with hepcidin, macrophages, ferritin, and transferrin receptor. Immunocytochemistry of hepcidin was performed on THP-1 macrophages exposed to iron or 7betahydroxycholesterol. Hepcidin expression significantly increases with the progression of human atherosclerotic plaques. Plaques of male patients have significantly higher levels of hepcidin. Expressions of hepcidin are significantly correlated with the accumulation of CD68-positive macrophages and transferrin receptor 1 (TfR1) and apoptosis. In vitro, hepcidin is significantly increased in macrophages exposed to iron and moderately increased following 7-oxysterol treatment. In the cultured cells, suppression of hepcidin protected against macrophage cell death, lysosomal membrane permeabilization, and oxidative stress. Hepcidin may play a crucial role in the development and progression of atherosclerosis. The differential expression of hepcidin in male and female patients and its significant correlations with plaque severity, highlight the potential of hepcidin as a biomarker for risk stratification and therapeutic targeting in atherosclerosis.

Also flagged:Siglec-15LSCChead and neck cancerSialic acid-binding immunoglobulin-like lectin 15gene expressionlaryngeal cancer
Journal Article 2024-01-30 No Snippets Chen X, Cai Q, Wong K, Shen X, Guan Z.
Show Full Abstract

<h4>Background</h4>Laryngeal squamous cell carcinoma (LSCC) is the ultimate common malignant head and neck cancer with dismal prognosis. The expression pattern and clinical significance of Siglec-15 (Sialic acid-binding immunoglobulin-like lectin 15) in LSCC are poorly understood. In order to lay the groundwork for future immune-related research on Siglec-15 in LSCC, we set out to study its expression and prognostic importance in the disease, as well as to use bioinformatics to investigate the immune features modulated by Siglec-15 in LSCC.<h4>Methods</h4>① In order to get the gene expression profile and clinical data for TCGA head and neck cancer (TCGA-HNSC), you may access the relevant data from UCSC xena and use 110 cases of laryngeal cancer as a training set. Two datasets, GSE27020 and GSE25727, were obtained from the GEO databank and utilized as validation sets. These datasets include expression profiles and clinical information. The Siglec-15 gene and immune characteristics were analyzed by bioinformatics methods. ② Retrospectively collected routine paraffin specimens from patients with pathological diagnosis of squamous cell carcinoma from December 2012 to November 2015 in Sun Yat-sen Memorial Hospital and fresh frozen tissue of patients from June 2021 to March 2022. Immunohistochemistry method, immunofluorescence technique and real-time quantitative PCR was used to examine the difference of Siglec-15 appearance in LSCC tissue and adjacent tissue, and its correlation of prognosis, clinic pathological characteristics and CD8+T lymphocyte infiltration. Using human laryngeal cancer cell line (LCC), we studied the influence of Siglec-15 in cell proliferation and invasion.<h4>Results</h4>We identified Siglec-15 was upregulated in LSCC. The patients in Siglec-15 high expression group had a poor overall survival (OS) based on the clinical information from TGCA and 111 LSCC patients that hospitalized in Sun Yat-sen Memorial Hospital. The COX regression analysis indicated Siglec-15 as an independent predictor for poor prognosis of LSCC. Bioinformatic analysis suggested that the high expression of Siglec-15 shape an immune suppressive tumor microenvironment (TEM), leading to poor response to immunotherapy in LSCC. Siglec-15 enhanced cell invasion and proliferation, as we showed in vitro.<h4>Conclusion</h4>Our study support Siglec-15 as a potential predictor for LSCC prognosis and an attractive target for LSCC immunotherapy.

CSE1L
Also flagged:HSCRneurocristopathyaganglionosisdiseasegenetic disorderRET
Journal Article 2024-01-30 ✓ 2 Snippets Lucena-Padros H, Bravo-Gil N, Tous C, Rojano E, Seoane-Zonjic P, Fernández RM, Ranea JAG, Antiñolo G, Borrego S.
In-Text Gene Mentions

Of note, several experimental validated target mRNAs of these two miRNAs were also dysregulated in intestine samples of HSCR patients and were related to the pathophysiology of this disease, such as ATP2A2, CSE1L, LRP8 and THBS4 (target of hsa-miR-142-3p) and CDH2 and PKM (target of hsa-miR-338-3p).

…as ATP2A2 ,CSE1L, LRP8 and…

Show Full Abstract

Hirschsprung's disease (HSCR) is a rare developmental disorder in which enteric ganglia are missing along a portion of the intestine. HSCR has a complex inheritance, with <i>RET</i> as the major disease-causing gene. However, the pathogenesis of HSCR is still not completely understood. Therefore, we applied a computational approach based on multi-omics network characterization and clustering analysis for HSCR-related gene/miRNA identification and biomarker discovery. Protein-protein interaction (PPI) and miRNA-target interaction (MTI) networks were analyzed by DPClusO and BiClusO, respectively, and finally, the biomarker potential of miRNAs was computationally screened by miRNA-BD. In this study, a total of 55 significant gene-disease modules were identified, allowing us to propose 178 new HSCR candidate genes and two biological pathways. Moreover, we identified 12 key miRNAs with biomarker potential among 137 predicted HSCR-associated miRNAs. Functional analysis of new candidates showed that enrichment terms related to gene ontology (GO) and pathways were associated with HSCR. In conclusion, this approach has allowed us to decipher new clues of the etiopathogenesis of HSCR, although molecular experiments are further needed for clinical validations.

MRPL39
Also flagged:Spike ProteinMacropinocytosisCoronavirus disease 2019COVID-19infectious diseaselung pneumonia
Journal Article 2024-01-30 ✓ 1 Snippet Ahn W, Burnett FN, Pandey A, Ghoshal P, Singla B, Simon AB, Derella CC, A Addo S, Harris RA, Lucas R, Csányi G.
In-Text Gene Mentions

…demonstrated that SARS-CoV-2spike protein subunitsprotein subunits S1,…

Show Full Abstract

Coronavirus disease 2019 (COVID-19) is an infectious disease caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). While recent studies have demonstrated that SARS-CoV-2 may enter kidney and colon epithelial cells by inducing receptor-independent macropinocytosis, it remains unknown whether this process also occurs in cell types directly relevant to SARS-CoV-2-associated lung pneumonia, such as alveolar epithelial cells and macrophages. The goal of our study was to investigate the ability of SARS-CoV-2 spike protein subunits to stimulate macropinocytosis in human alveolar epithelial cells and primary human and murine macrophages. Flow cytometry analysis of fluid-phase marker internalization demonstrated that SARS-CoV-2 spike protein subunits S1, the receptor-binding domain (RBD) of S1, and S2 stimulate macropinocytosis in both human and murine macrophages in an angiotensin-converting enzyme 2 (ACE2)-independent manner. Pharmacological and genetic inhibition of macropinocytosis substantially decreased spike-protein-induced fluid-phase marker internalization in macrophages both in vitro and in vivo. High-resolution scanning electron microscopy (SEM) imaging confirmed that spike protein subunits promote the formation of membrane ruffles on the dorsal surface of macrophages. Mechanistic studies demonstrated that SARS-CoV-2 spike protein stimulated macropinocytosis via NADPH oxidase 2 (Nox2)-derived reactive oxygen species (ROS) generation. In addition, inhibition of protein kinase C (PKC) and phosphoinositide 3-kinase (PI3K) in macrophages blocked SARS-CoV-2 spike-protein-induced macropinocytosis. To our knowledge, these results demonstrate for the first time that SARS-CoV-2 spike protein subunits stimulate macropinocytosis in macrophages. These results may contribute to a better understanding of SARS-CoV-2 infection and COVID-19 pathogenesis.

HFE
Also flagged:Chronic Liver DiseaseSteatosisType 2 Diabetesmetabolic dysfunction-associatedsteatotic liver diseaseliver steatosis
Journal Article 2024-01-30 ✓ 1 Snippet Barisic-Jaman M, Milosevic M, Skurla V, Dohoczky D, Stojic J, Dinjar Kujundzic P, Cigrovski Berkovic M, Majic-Tengg A, Matijaca A, Lucijanic T, Kardum-Pejic M, Pandzic Jaksic V, Marusic S, Grgurevic I.
In-Text Gene Mentions

…g/day for women),hemochromatosis(elevated ferritin levels,…

Show Full Abstract

Patients with type 2 diabetes (T2D) are at risk of developing metabolic dysfunction-associated steatotic liver disease (MASLD). We investigated the prevalence of compensated advanced chronic liver disease (cACLD) and steatosis in patients with T2D using the new non-invasive diagnostic methods of shear wave measurements (SWMs) and attenuation (ATT) measurements in comparison with those of vibration-controlled transient elastography (VCTE) and the controlled attenuation parameter (CAP), which served as the reference methods. Among 214 T2D patients, steatosis at any grade and cACLD were revealed in 134 (62.6%) and 19 (8.9%) patients, respectively. SWMs showed a high correlation with VCTE (Spearman's <i>ρ</i> = 0.641), whereas SWMs produced lower (mean of -0.7 kPa) liver stiffness measurements (LSMs) overall. At a LSM of >11.0 kPa (Youden), SWMs had an AUROC of 0.951 that was used to diagnose cACLD (defined as a LSM of >15 kPa through VCTE) with 84.2% sensitivity and 96.4% specificity. The performance of ATT measurements in diagnosing liver steatosis at any grade (defined as the CAP of ≥274 dB/m) was suboptimal (AUROC of 0.744 at the ATT measurement cut-off of >0.63 dB/cm/MHz (Youden) with 59% sensitivity and 81.2% specificity). In conclusion, the prevalence of liver steatosis and previously unrecognized cACLD in patients with T2D is high and SWMs appear to be a reliable diagnostic method for this purpose, whereas further investigation is needed to optimize the diagnostic performance of ATT measurements.

SERPINC1
Also flagged:hereditary thrombophiliaPCthrombinAT) IIIphospholipidantibody
Journal Article 2024-01-30 ✓ 5 Snippets Dogar AW, Hussain A, Ullah K, Shams-Ud-Din, Ghaffar A, Abbasher Hussien Mohamed Ahmed K, Junaid Tahir M.
In-Text Gene Mentions

…were deficient in anti-thrombin-III.…

…were deficient in anti-thrombin-IIIon repeat testing.…

…PC (%) and Anti-thrombin-III(%) activity were…

…PC (%) and anti-thrombin-III(%) activity of…

…PC (%) and anti-thrombin-III(%) activity were…

Show Full Abstract

<h4>Background and aims</h4>The study aimed to determine the prevalence of hereditary thrombophilia, and stratify its severity among live liver donors in Pakistan. Also, the authors evaluated the safety and efficacy of thrombophilia profile testing directed venous thromboembolic events (VTE) prophylaxis while balancing bleeding risk and the need for routine thrombophilia testing before live liver donation among living donor candidates.<h4>Materials and methods</h4>Protein S (PS), protein C (PC), anti-thrombin (AT) III, and anti-phospholipid antibody panel (APLA) levels were measured in 567 potential donor candidates. Donors were divided into normal, borderline and high-risk groups based on Caprini score. The safety endpoints were VTE occurrence, bleeding complications or mortality.<h4>Results</h4>Among 567 donors, 21 (3.7%) were deficient in protein C, and 14 (2.5%) were deficient in anti-thrombin-III. IgM and IgG. Anti-phospholipids antibodies were positive in 2/567 (0.4%) and 2/567 (0.4%), respectively. IgM and IgG lupus anticoagulant antibodies were positive in 3/567 (0.5%) and 3/567 (0.5%), respectively. VTE events, bleeding complications and postoperative living donors liver transplantation-related complications were comparable among the three donor groups (<i>P</i>>0.05). One donor in the normal donor group developed pulmonary embolism, but none of the donors in either borderline or high-risk group developed VTE. The mean length of ICU and total hospital stay were comparable. No donor mortality was observed in all donor groups.<h4>Conclusions</h4>Due to thrombophilia testing directed VTE prophylaxis, VTE events were comparable in normal, borderline and high-risk thrombophilia donor groups, but more evaluations are required to determine the lower safe levels for various thrombophilia parameters including PC, PS and AT-III before surgery among living donor candidates.

HFE
Also flagged:liver fibrosiswaterhydroxyprolineglutathionealanine aminotransferaseALT
Journal Article 2024-01-30 ✓ 1 Snippet Yılmaz HK, Türker M, Kutlu EY, Mercantepe T, Pınarbaş E, Tümkaya L, Atak M.
In-Text Gene Mentions

…alcoholic liver disease,hemochromatosis, and Wilson's disease.…

Show Full Abstract

Liver fibrosis is a common, progressive disease that affects millions of patients worldwide. In this study, it was aimed at investigating the effect of white tea on liver fibrosis in an in-vivo environment by creating an experimental liver fibrosis model on rats. In this study, an experimental liver fibrosis model was created with carbon tetrachloride (CCl<sub>4</sub>) in Sprague-Dawley rats to investigate the effect of white tea on liver fibrosis. Rats are treated with CCl<sub>4</sub> (1 mL/kg) to constitute the liver fibrosis model. White tea was given ad libitum with drinking water. As a result of the study, liver tissue hydroxyproline levels were found to be significantly lower (<i>p</i> = .001) in the white tea group. Histopathologically, it was found that the liver tissue histopathological damage score (LHDS) and fibrosis scoring were significantly lower (<i>p <</i> .001) in the white tea group. However, although it was not statistically significant in the group given white tea, compared with the fibrosis group, it was found that the malondialdehyde (MDA) level in the liver tissues was lower, the glutathione (GSH) level was higher, and the serum alanine aminotransferase (ALT) levels were lower. The study explained the effect of white tea on liver fibrosis and suggested that white tea might be beneficial in reducing the progression of liver fibrosis.

Also flagged:Nicotinamide adenine dinucleotideelectronstricarboxylic acidphosphorylationphotoncytoplasmic
Journal Article 2024-01-30 No Snippets Priest KM, Schluns JV, Nischal N, Gattis CL, Wolchok JC, Muldoon TJ.
Show Full Abstract

Nicotinamide adenine dinucleotide (NADH) is a cofactor that serves to shuttle electrons during metabolic processes such as glycolysis, the tricarboxylic acid cycle, and oxidative phosphorylation (OXPHOS). NADH is autofluorescent, and its fluorescence lifetime can be used to infer metabolic dynamics in living cells. Fiber-coupled time-correlated single photon counting (TCSPC) equipped with an implantable needle probe can be used to measure NADH lifetime <i>in vivo</i>, enabling investigation of changing metabolic demand during muscle contraction or tissue regeneration. This study illustrates a proof of concept for point-based, minimally-invasive NADH fluorescence lifetime measurement <i>in vivo</i>. Volumetric muscle loss (VML) injuries were created in the left tibialis anterior (TA) muscle of male Sprague Dawley rats. NADH lifetime measurements were collected before, during, and after a 30 s tetanic contraction in the injured and uninjured TA muscles, which was subsequently fit to a biexponential decay model to yield a metric of NADH utilization (cytoplasmic vs protein-bound NADH, the A<sub>1</sub>τ<sub>1</sub>/A<sub>2</sub>τ<sub>2</sub> ratio). On average, this ratio was higher during and after contraction in uninjured muscle compared to muscle at rest, suggesting higher levels of free NADH in contracting and recovering muscle, indicating increased rates of glycolysis. In injured muscle, this ratio was higher than uninjured muscle overall but decreased over time, which is consistent with current knowledge of inflammatory response to injury, suggesting tissue regeneration has occurred. These data suggest that fiber-coupled TCSPC has the potential to measure changes in NADH binding <i>in vivo</i> in a minimally invasive manner that requires further investigation.

Also flagged:ProteolysisE3 ubiquitin ligasesbindingE3 ligaseprotein degradationamino acid
Journal Article 2024-01-29 No Snippets Nguyen KQT, Nguyen HH, Phung HTT, Chung KL, Vu TY.
Show Full Abstract

PROTACs (Proteolysis Targeting Chimeras), heterobifunctional molecules, exhibit selectivity in degrading target proteins through E3 ubiquitin ligases. Designing effective PROTACs requires a deep understanding of the intricate binding interactions in the ternary complex (POI/PROTAC/E3 ligase), crucial for efficient target protein degradation. To address this challenge, we introduce a novel computational virtual screening method that considers essential amino acid interactions between the protein of interest and the chosen E3 ligase. This approach enhances accuracy and reliability, facilitating the strategic development of potent PROTACs. Utilizing a crystallized model of the VHL:PROTAC:SMARCA2<sup>BD</sup> ternary complex (PDB: 7Z6L), we assessed the effectiveness of our method. Our study reveals that increasing the number of essential restraints between the two proteins reduces the generated docking poses, leading to closer alignment with the experimental ternary complex. Specifically, utilizing three restraints showed the closest resemblance to the published complex, highlighting crucial interactions such as an H-bond between A:Gln 89 and B:Asn 67, along with two hydrophobic interactions: A:Gly 22 with B:Arg 69 and A:Glu 37 with B:Pro 99. This resulted in a significant decrease in the mean RMSD value from 31.8 and 31.0 Å to 24.4 Å, respectively. This underscores the importance of incorporating multiple essential restraints to enhance docking accuracy. Building on this progress, we introduce a systematic approach to design potential PROTACs between the Estrogen receptor and the E3 ligase, utilizing bridging intermediates with 4, 6, or 7 carbon atoms. By providing a more accurate and efficient means of identifying optimal PROTAC candidates, this approach has the potential to accelerate the development of targeted therapies and reduce the time and costs associated with drug discovery.

Also flagged:hydroxyapatitepolycaprolactonegelatindoxorubicinbone cancermineralization
Journal Article 2024-01-29 No Snippets Kadi F, Dini G, Poursamar SA, Ejeian F.
Show Full Abstract

In this study, nanocomposite scaffolds of hydroxyapatite (HA)/polycaprolactone (PCL)/gelatin (Gel) with varying amounts of HA (42-52 wt. %), PCL (42-52 wt. %), and Gel (6 wt. %) were 3D printed. Subsequently, a scaffold with optimal mechanical properties was utilized as a carrier for doxorubicin (DOX) in the treatment of bone cancer. For this purpose, HA nanoparticles were first synthesized by the hydrothermal conversion of Acropora coral and characterized by using different techniques. Also, a compression test was performed to investigate the mechanical properties of the fabricated scaffolds. The mineralization of the optimal scaffold was determined by immersing it in simulated body fluid (SBF) solution for 28 days, and the biocompatibility was investigated by seeding MG-63 osteoblast-like cells on it after 1-7 days. The obtained results showed that the average size of the synthesized HA particles was about 80 nm. The compressive modulus and strength of the scaffold with 47 wt. % HA was reported to be 0.29 GPa and 9.9 MPa, respectively, which was in the range of trabecular bones. In addition, the scaffold surface was entirely coated with an apatite layer after 28 days of soaking in SBF. Also, the efficiency and loading percentage of DOX were obtained as 30.8 and 1.6%, respectively. The drug release behavior was stable for 14 days. Cytotoxicity and adhesion evaluations showed that the fabricated scaffold had no negative effects on the viability of MG-63 cells and led to their proliferation during the investigated period. From these results, it can be concluded that the HA/PCL/Gel scaffold prepared in this study, in addition to its drug release capability, has good bioactivity, mechanical properties, and biocompatibility, and can be considered a suitable option for bone tumor treatment.

PEBP1
Also flagged:RRM2sepsisferroptosisRPL7AHNRNPA1TXNIP
Journal Article 2024-01-29 ✓ 2 Snippets He S, He Y, Deng L, Guo Y, Wang X, Wang Q, Luo L, Liu Q.
In-Text Gene Mentions

Additionally, a cecum ligation and puncture (CLP)-induced mouse sepsis model was constructed to validate the expression of key gene in the sepsis.<h4>Results</h4>Six sepsis-associated differentially expressed FRGs (RRM2, RPL7A, HNRNPA1, PEBP1, MYL8B and TXNIP) were screened by WGCNA and three machine learning methods analysis.

…(RRM2, RPL7A, HNRNPA1,PEBP1, MYL8B and TXNIP)…

Show Full Abstract

<h4>Objective</h4>Sepsis and sepsis-associated organ failure are devastating conditions for which there are no effective therapeutic agent. Several studies have demonstrated the significance of ferroptosis in sepsis. The study aimed to identify ferroptosis-related genes (FRGs) in sepsis, providing potential therapeutic targets.<h4>Methods</h4>The weighted gene co-expression network analysis (WGCNA) was utilized to screen sepsis-associated genes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were used to explore gene functions. Three machine learning methods were employed to identify sepsis-related hub genes. Survival and multivariate Cox regression analysis allowed further screening for the key gene RRM2 associated with prognosis. The immune infiltration analysis of the screened sepsis key genes was performed. Additionally, a cecum ligation and puncture (CLP)-induced mouse sepsis model was constructed to validate the expression of key gene in the sepsis.<h4>Results</h4>Six sepsis-associated differentially expressed FRGs (RRM2, RPL7A, HNRNPA1, PEBP1, MYL8B and TXNIP) were screened by WGCNA and three machine learning methods analysis. Survival analysis and multivariate Cox regression analysis showed that RRM2 was a key gene in sepsis and an independent prognostic factor associated with clinicopathological and molecular features of sepsis. Immune cell infiltration analysis demonstrated that RRM2 had a connection to various immune cells, such as CD4 T cells and neutrophils. Furthermore, animal experiment demonstrated that RRM2 was highly expressed in CLP-induced septic mice, and the use of Fer-1 significantly inhibited RRM2 expression, inhibited serum inflammatory factor TNF-α, IL-6 and IL-1β expression, ameliorated intestinal injury and improved survival in septic mice.<h4>Conclusion</h4>RRM2 plays an important role in sepsis and may contribute to sepsis through the ferroptosis pathway. This study provides potential therapeutic targets for sepsis.

HFE
Also flagged:immune responseimmune responsesautoimmune diseasesimmune-mediated inflammatory diseasePrimary biliary cholangitisliver disease
Journal Article 2024-01-29 ✓ 4 Snippets Davies SP, Ronca V, Wootton GE, Krajewska NM, Bozward AG, Fiancette R, Patten DA, Yankouskaya K, Reynolds GM, Pat S, Osei-Bordom DC, Richardson N, Grover LM, Weston CJ, Oo YH.
In-Text Gene Mentions

Flow cytometry phenotyping of peripheral blood mononuclear cells (PBMCs) originating from PBC patients demonstrated that CD8+ T cells exhibited higher expression of E-cadherin 48 h post-activation compared to non-PBC controls (HFE; Fig. 10d; Supplementary Table 1).

Peripheral blood-derived CD8+ T cells, obtained from patients who have chronic iron overload (haemochromatosis; HFE) undergoing venesection, were co-cultured for 4 h with primary human BEC, isolated from non-cirrhotic donor livers or explanted livers from patients with chronic liver disease.

…lunteers or haemochromatosis (HFE) was collected with…

…on overload (haemochromatosis;HFE) undergoing venesection, were…

Show Full Abstract

The presence of CD8<sup>+</sup> T cells in the cytoplasm of biliary epithelial cells (BEC) has been correlated with biliary damage associated with primary biliary cholangitis (PBC). Here, we characterise the mechanism of CD8<sup>+</sup> T cell invasion into BEC. CD8<sup>+</sup> T cells observed within BEC were large, eccentric, and expressed E-cadherin, CD103 and CD69. They were also not contained within secondary vesicles. Internalisation required cytoskeletal rearrangements which facilitated contact with BEC. Internalised CD8<sup>+</sup> T cells were observed in both non-cirrhotic and cirrhotic diseased liver tissues but enriched in PBC patients, both during active disease and at the time of transplantation. E-cadherin expression by CD8<sup>+</sup> T cells correlated with frequency of internalisation of these cells into BEC. E-cadherin<sup>+</sup> CD8<sup>+</sup> T cells formed β-catenin-associated interactions with BEC, were larger than E-cadherin<sup>-</sup> CD8<sup>+</sup> T cells and invaded into BEC more frequently. Overall, we unveil a distinct cell-in-cell structure process in the liver detailing the invasion of E-cadherin<sup>+</sup> CD103<sup>+</sup> CD69<sup>+</sup> CD8<sup>+</sup> T cells into BEC.

DCC
Also flagged:autism spectrum disorderneurodevelopmental disordersNucleotideautismSLCO1B1ACADSB
Journal Article 2024-01-29 ✓ 3 Snippets Bui DT, Ton ANV, Nguyen CTD, Nguyen SH, Tran HK, Nguyen XT, Nguyen HT, Pham GLT, Tran DS, Harrington J, Pham HN, Pham TNV, Cao TA.
In-Text Gene Mentions

Among the confirmed SNPs, mutations were identified in genes previously known to be strongly associated with ASD such as SLCO1B1, ACADSB, TCF4, HCP5, MOCOS, SRD5A2, MCCC2, DCC, and PRKN while several other mutations are known to associate with autistic traits or other neurodevelopmental disorders.

…MOCOS, SRD5A2, MCCC2,DCC, and PRKN…

…MCCC2 32 ,DCC33 and PRKN…

Show Full Abstract

Among the most prevalent neurodevelopmental disorders, Autism Spectrum Disorder (ASD) is highly diverse showing a broad phenotypic spectrum. ASD also couples with a broad range of mutations, both de novo and inherited. In this study, we used a proprietary SNP genotyping chip to analyze the genomic DNA of 250 Vietnamese children diagnosed with ASD. Our Single Nucleotide Polymorphism (SNP) genotyping chip directly targets more than 800 thousand SNPs in the genome. Our primary focus was to identify pathogenic/likely pathogenic mutations that are potentially linked to more severe symptoms of autism. We identified and validated 23 pathogenic/likely pathogenic mutations in this initial study. The data shows that these mutations were detected in several cases spanning multiple biological pathways. Among the confirmed SNPs, mutations were identified in genes previously known to be strongly associated with ASD such as SLCO1B1, ACADSB, TCF4, HCP5, MOCOS, SRD5A2, MCCC2, DCC, and PRKN while several other mutations are known to associate with autistic traits or other neurodevelopmental disorders. Some mutations were found in multiple patients and some patients carried multiple pathogenic/likely pathogenic mutations. These findings contribute to the identification of potential targets for therapeutic solutions in what is considered a genetically heterogeneous neurodevelopmental disorder.

Also flagged:zincmagnesiumbiodegradationdegradationhydroxyapatitecalcium silicate
Journal Article 2024-01-29 No Snippets Youness RA, Taha MA.
Show Full Abstract

This work aimed to improve the rapid biodegradation, poor wear resistance properties, and lack of bioactivity of metallic biomaterials to be used in orthopedic applications. In this context, zinc-magnesium (Zn-Mg) alloy with successive contents of calcium silicate (CaSiO<sub>3</sub>) and silicon nitride (Si<sub>3</sub>N<sub>4</sub>) was prepared using powder metallurgy technique. After sintering, their phase composition and microstructure were investigated using the X-ray diffraction technique and scanning electron microscopy (SEM), respectively. Furthermore, their degradation behavior and ability to form hydroxyapatite (HA) layer on the sample surface after immersion in simulated body fluid (SBF) were monitored using weight loss measurements, inductively coupled plasma-atomic emission spectroscopy, and SEM. Moreover, their tribo-mechanical properties were measured. The results obtained showed that the successive contents of CaSiO<sub>3</sub> were responsible for improving the bioactivity behavior as indicated by a good formation of the HA layer on the samples' surface. Additionally, ceramic materials were responsible for a continuous decrease in the released ions in the SBF solution as indicated by the ICP results. The tribology properties were significantly improved even after exposure to different loads. Based on the above results, the prepared nanocomposites are promising for use in orthopedic applications.

GPR52
Also flagged:oleic acidGPR3extracellularmembranefatty acidssecretion
Journal Article 2024-01-29 ✓ 1 Snippet Xiong Y, Xu Z, Li X, Wang Y, Zhao J, Wang N, Duan Y, Xia R, Han Z, Qian Y, Liang J, Zhang A, Guo C, Inoue A, Xia Y, Chen Z, He Y.
In-Text Gene Mentions

…For example,GPR52utilizes its extracellular…

Show Full Abstract

Although GPR3 plays pivotal roles in both the nervous system and metabolic processes, such as cold-induced thermogenesis, its endogenous ligand remains elusive. Here, by combining structural approach (including cryo-electron microscopy), mass spectrometry analysis, and functional studies, we identify oleic acid (OA) as an endogenous ligand of GPR3. Our study reveals a hydrophobic tunnel within GPR3 that connects the extracellular side of the receptor to the middle of plasma membrane, enabling fatty acids to readily engage the receptor. Functional studies demonstrate that OA triggers downstream G<sub>s</sub> signaling, whereas lysophospholipids fail to activate the receptor. Moreover, our research reveals that cold stimulation induces the secretion of OA in mice, subsequently activating G<sub>s</sub>/cAMP/PKA signaling in brown adipose tissue. Notably, brown adipose tissues from Gpr3 knockout mice do not respond to OA during cold stimulation, reinforcing the significance of GPR3 in this process. Finally, we propose a "born to be activated and cold to enhance" model for GPR3 activation. Our study provides a starting framework for the understanding of GPR3 signaling in cold-stimulated thermogenesis.

SERPINC1
Also flagged:Stanford type A aortic dissectionrenal failuredisseminated intravascular coagulationaortic disordershematomahemostasis
Journal Article 2024-01-29 ✓ 1 Snippet Okamoto H, Ozawa T, Suzuki T, Nakagawa Y.
In-Text Gene Mentions

…µg/ml; antithrombin III (ATIII), 101%; thrombin-antithrombin…

Show Full Abstract

<h4>Background</h4>Management of the enhanced-fibrinolytic type of disseminated intravascular coagulation (DIC) caused by aortic disorders is the two strategies of surgical intervention and medical treatment based on the patient's age and comorbidities.<h4>Case presentation</h4>An 81-year-old woman with a history of two previous aortic surgeries and chronic heart and renal failure was admitted for uncontrollable subcutaneous hemorrhage. The hemorrhage was caused by the enhanced-fibrinolytic type of disseminated intravascular coagulation (DIC) caused by periprosthetic graft hematoma after aortic replacement for Stanford type A aortic dissection. Open thoracic hemostasis temporarily controlled the subcutaneous hemorrhage, but she was readmitted for the recurrence seven months after discharge. On the second admission, the combination of anticoagulant and antifibrinolytic agents was successful.<h4>Conclusion</h4>Management of the enhanced-fibrinolytic type of DIC caused by aortic disorders is important of a successful combination of surgical and medical therapy tailored the patient's condition.

HTT
Also flagged:GABRB3prostate cancerphosphoinositide 3-kinasePI3KAKTcell growth
Journal Article 2024-01-29 ✓ 1 Snippet Chen JY, Chang CF, Huang SP, Huang CY, Yu CC, Lin VC, Geng JH, Li CY, Lu TL, Bao BY.
In-Text Gene Mentions

…, huntingtin (HTT), MTOR associated…

Show Full Abstract

<h4>Background</h4>Treatment failure following androgen deprivation therapy (ADT) presents a significant challenge in the management of advanced prostate cancer. Thus, understanding the genetic factors influencing this process could facilitate the development of personalized treatments and innovative therapeutic strategies. The phosphoinositide 3-kinase (PI3K)/AKT signaling pathway plays a pivotal role in controlling cell growth and tumorigenesis. We hypothesized that genetic variants within this pathway may affect the clinical outcomes of patients undergoing ADT for prostate cancer.<h4>Methods</h4>We genotyped 399 single-nucleotide polymorphisms (SNPs) across 28 core PI3K/AKT pathway genes in a cohort of 630 patients with prostate cancer undergoing ADT. We assessed the potential association of the SNPs with patient survival. Functional analyses of the implicated genes were also performed to evaluate their effects on prostate cancer.<h4>Results</h4>After multivariate Cox regression analysis and multiple testing correction, GABRB3 rs12591845 exhibited the most significant association with both overall and cancer-specific survivals (P < 0.003). A comprehensive pooled analysis of 16 independent gene expression datasets revealed elevated expression of GABRB3 in prostate cancer tissues compared to that in normal tissues (P < 0.001). Furthermore, gene set enrichment analysis unveiled differential enrichment of pathways such as myogenesis, interferon γ and α responses, and the MYC proto-oncogene pathway in tumors with elevated GABRB3 expression, implying a role for GABRB3 in prostate cancer.<h4>Conclusion</h4>Our results suggest that rs12591845 could potentially serve as a valuable prognostic indicator for patients undergoing ADT. The potential role of GABRB3 in promoting prostate tumorigenesis is also highlighted.

PRDX6
Also flagged:iPLA2ischemic strokePeroxiredoxin(PRDX) 6 phospholipase A2oxygen
Journal Article 2024-01-29 ✓ 5 Snippets Peng L, Ji Y, Li Y, You Y, Zhou Y.
In-Text Gene Mentions

To explore the potential role of PRDX6-iPLA2 in stroke, MJ33, an inhibitor of the iPLA2 activity of PRDX6, was used to inhibit PRDX6-iPLA2 after 60 min of MCAO, a rat model for stroke, then followed by 24 h of reperfusion.

Thus, PRDX6 iPLA2 activity in astrocytes plays a vital role in ROS-induced mitochondrial fission induced by ROS after cerebral ischemia.

PRDX6-iPLA2 aggravates neuroinflamm…

…used to blockPRDX6-iPLA2 activity in vitro…

…the phosphorylation ofPRDX6in CTX-TNA2 cell…

Show Full Abstract

The crosstalk between astrocytes and microglia plays a pivotal role in neuroinflammation following ischemic stroke, and phenotypic distribution of these cells can change with the progression of ischemic stroke. Peroxiredoxin (PRDX) 6 phospholipase A2 (iPLA2) activity is involved in the generation of reactive oxygen species(ROS), with ROS driving the activation of microglia and astrocytes; however, its exact function remains unexplored. MJ33, PRDX6<sup>D140A</sup> mutation was used to block PRDX6-iPLA2 activity in vitro and vivo after ischemic stroke. PRDX6<sup>T177A</sup> mutation was used to block the phosphorylation of PRDX6 in CTX-TNA2 cell lines. NAC, GSK2795039, Mdivi-1, U0126, and SB202190 were used to block the activity of ROS, NOX2, mitochondrial fission, ERK, and P38, respectively, in CTX-TNA2 cells. In ischemic stroke, PRDX6 is mainly expressed in astrocytes and PRDX6-iPLA2 is involved in the activation of astrocytes and microglia. In co-culture system, Asp140 mutation in PRDX6 of CTX-TNA2 inhibited the polarization of microglia, reduced the production of ROS, suppressed NOX2 activation, and inhibited the Drp1-dependent mitochondrial fission following OGD/R. These effects were further strengthened by the inhibition of ROS production. In subsequent experiments, U0126 and SB202190 inhibited the phosphorylation of PRDX6 at Thr177 and reduced PRDX6-iPLA2 activity. These results suggest that PRDX6-iPLA2 plays an important role in the astrocyte-induced generation of ROS and activation of microglia, which are regulated by the activation of Nox2 and Drp1-dependent mitochondrial fission pathways. Additionally, PRDX6-iPLA2 activity is regulated by MAPKs via the phosphorylation of PRDX6 at Thr177 in astrocytes.

DCC
Also flagged:OsteoarthritisOAdegenerative diseaseobesityagingpathogenesis
Journal Article 2024-01-29 ✓ 3 Snippets Wang H, Yuan T, Wang Y, Liu C, Li D, Li Z, Sun S.
In-Text Gene Mentions

Alleviation of innervation and pain symptoms were observed in the Netrin‐1 or Dcc knockdown models or when osteoclast activity was inhibited by alendronate (Zhu et al., 2019).

…in colorectal cancer (DCC) receptor and significantly…

…the Netrin‐1 orDccknockdown models or…

Show Full Abstract

Osteoarthritis (OA), a chronic degenerative joint disease, is highly prevalent among the aging population, and often leads to joint pain, disability, and a diminished quality of life. Although considerable research has been conducted, the precise molecular mechanisms propelling OA pathogenesis continue to be elusive, thereby impeding the development of effective therapeutics. Notably, recent studies have revealed subchondral bone lesions precede cartilage degeneration in the early stage of OA. This development is marked by escalated osteoclast-mediated bone resorption, subsequent imbalances in bone metabolism, accelerated bone turnover, and a decrease in bone volume, thereby contributing significantly to the pathological changes. While the role of aging hallmarks in OA has been extensively elucidated from the perspective of chondrocytes, their connection with osteoclasts is not yet fully understood. There is compelling evidence to suggest that age-related abnormalities such as epigenetic alterations, proteostasis network disruption, cellular senescence, and mitochondrial dysfunction, can stimulate osteoclast activity. This review intends to systematically discuss how aging hallmarks contribute to OA pathogenesis, placing particular emphasis on the age-induced shifts in osteoclast activity. It also aims to stimulate future studies probing into the pathological mechanisms and therapeutic approaches targeting osteoclasts in OA during aging.

DCC
Also flagged:Netrin-1Colorectal CancerVascular Endothelial Growth FactorPathogenesisepithelial-secreted proteindeleted in colorectal cancer
Journal Article 2024-01-29 ✓ 5 Snippets Badary DM, Elsaied H, Abdel-Fadeil MR, Ali MK, Abou-Taleb H, Iraqy HM.
In-Text Gene Mentions

Our study aimed to investigate the suggested role of macrophage-induced netrin-1/DCC/vascular endothelial growth factor (VEGF) signaling in PAS pathogenesis.

…in colorectal cancer (DCC) receptor.…

…f macrophage-induced netrin-1/DCC/vascular endothelial growth f…

…analysis of tissueDCC receptorreceptor.…

…Significant overexpression ofDCC receptorsreceptors, VEGF, and…

Show Full Abstract

<h4>Summary</h4>Netrin-1, an epithelial-secreted protein, plays a key role in placental formation through the promotion of cytotrophoblast proliferation and placental vascular development. These effects are mediated through several receptors, including the deleted in colorectal cancer (DCC) receptor. Placenta accreta spectrum (PAS) is an exaggerated trophoblastic invasion into the uterine myometrium. The exact etiology is unknown, but it is believed that increased trophoblastic invasion, defect decidualization, and/or abnormal angiogenesis might play a role. Our study aimed to investigate the suggested role of macrophage-induced netrin-1/DCC/vascular endothelial growth factor (VEGF) signaling in PAS pathogenesis. A total of 29 women with PAS (as cases) and 29 women with normal pregnancies (as controls) were enrolled in the study. At delivery, placental tissues of both groups were collected and processed for the evaluation of placental netrin-1 level by enzyme-linked immunoassay technique and immunohistochemical analysis of tissue DCC receptor. Placental tissue netrin-1 level of PAS cases showed a statistically significantly higher value than those in the normal group. Significant overexpression of DCC receptors, VEGF, and enhanced macrophage recruitment was noted in PAS cases in comparison to the normal placenta. Macrophage-induced netrin-1/DCC/VEGF signaling might be involved in PAS pathogenesis through the enhancement of trophoblastic angiogenesis.

Also flagged:cavernous haemangiomaspulmonary adenocarcinomaPulmonarylung cancerhaemangiomaglucose
Journal Article 2024-01-29 No Snippets Wang X, Ren T, You H, Han W, Guo J, Wang M.
Show Full Abstract

<h4>Background</h4>Cavernous haemangiomas (CHs) commonly occurred in the skin, subcutaneous tissue, muscles, and liver. Pulmonary cavernous haemangiomas (PCHs) are quite rare and usually present with nonspecific clinical symptoms. When lung cancer patients are complicated with pulmonary cavernous haemangiomas, radiologically, these haemangioma lesions can be easily misinterpreted as intrapulmonary metastases, potentially resulting in misdiagnosis, or missed diagnosis.<h4>Case presentation</h4>The present study reported the case of a 53-year-old female patient with pulmonary adenocarcinoma coexisting with multiple PCHs. <sup>18</sup>F-FDG-Positron emission tomography-computed tomography (PET-CT) showed an elevated glucose metabolism in the apicoposterior segment of the left upper lobe; however, the other nodules were not hypermetabolic. Percutaneous lung biopsy was performed on the nodule in the apicoposterior segment of the left upper lobe, which were diagnosed as primary adenocarcinoma. Some nodules in the upper left lobe underwent wedge resection by video-assisted thoracic surgery (VATS) and intraoperative frozen section identified as PCHs. Finally, the patient underwent lobectomy of the left upper lobe via VATS, cancerous nodule in the apicoposterior segment of the left upper lobe underwent genetic molecular testing of PCR-Sanger sequencing, suggested <i>EGFR</i> mutation, and patient received treatment with Osimertinib. During the 4-months follow-up, contrast-enhanced CT showed no recurrence of either disease. PCHs are rare benign tumours of the lung, which can lead to misdiagnosis due to their non-specific clinical symptoms and radiological features, especially when they coexist with lung cancer. PCHs is easily misunderstood as metastatic lung cancer, in this case, PET-CT can assist in differentiating benign from malignant. For the cases of early lung cancer complicated with PCHs, lung cancer can be surgically resected, and whether PCHs should be removed or not should be determined according to the size and distribution of the lesions.

Also flagged:asthmaBronchial asthmachronic respiratory diseaseageingpro-inflammatory cytokinesdeoxyribonucleic acid
Journal Article 2024-01-29 No Snippets Zhang Y, Yang X, Jiang W, Gao X, Yang B, Feng XL, Yang L.
Show Full Abstract

<h4>Background</h4>This study aimed to explore the relationship between air pollution and hospital admissions for asthma in older adults, and to further assess the health and economic burden of asthma admissions attributable to air pollution.<h4>Methods</h4>We collected information on asthma cases in people over 65 years of age from nine cities in Sichuan province, as well as air pollution and meteorological data. The relationship between short-term air pollutant exposure and daily asthma hospitalizations was analyzed using the generalized additive model (GAM), and stratified by gender, age, and season. In addition, we assessed the economic burden of hospitalization for air pollution-related asthma in older adults using the cost of disease approach.<h4>Results</h4>The single pollutant model showed that every 1 mg/m<sup>3</sup> increase in CO was linked with an increase in daily hospitalizations for older adults with asthma, with relative risk values of 1.327 (95% CI: 1.116-1.577) at lag7. Each 10 μg/m<sup>3</sup> increase in NO<sub>2</sub>, O<sub>3</sub>, PM<sub>10</sub>, PM<sub>2.5</sub> and SO<sub>2</sub>, on asthma hospitalization, with relative risk values of 1.044 (95% CI: 1.011-1.078), 1.018 (95% CI: 1.002-1.034), 1.013 (95% CI: 1.004-1.022), 1.015 (95% CI: 1.003-1.028) and 1.13 (95% CI: 1.041-1.227), respectively. Stratified analysis shows that stronger associations between air pollution and asthma HAs among older adult in females, those aged 65-69 years, and in the warm season, although all of the differences between subgroups did not reach statistical significance. During the study period, the number of asthma hospitalizations attributable to PM<sub>2.5</sub>, PM<sub>10</sub>, and NO<sub>2</sub> pollution was 764, 581 and 95, respectively, which resulted in a total economic cost of 6.222 million CNY, 4.73 million CNY and 0.776 million CNY, respectively.<h4>Conclusion</h4>This study suggests that short-term exposure to air pollutants is positively associated with an increase in numbers of asthma of people over 65 years of age in Sichuan province, and short-term exposure to excessive PM and NO<sub>2</sub> brings health and economic burden to individuals and society.

Also flagged:breast cancergene expressioncancertumorchromosomeHER2
Journal Article 2024-01-29 No Snippets Tomasoni D, Lombardo R, Lauria M.
Show Full Abstract

Preserving data privacy is an important concern in the research use of patient data. The DataSHIELD suite enables privacy-aware advanced statistical analysis in a federated setting. Despite its many applications, it has a few open practical issues: the complexity of hosting a federated infrastructure, the performance penalty imposed by the privacy-preserving constraints, and the ease of use by non-technical users. In this work, we describe a case study in which we review different breast cancer classifiers and report our findings about the limits and advantages of such non-disclosive suite of tools in a realistic setting. Five independent gene expression datasets of breast cancer survival were downloaded from Gene Expression Omnibus (GEO) and pooled together through the federated infrastructure. Three previously published and two newly proposed 5-year cancer-free survival risk score classifiers were trained in a federated environment, and an additional reference classifier was trained with unconstrained data access. The performance of these six classifiers was systematically evaluated, and the results show that i) the published classifiers do not generalize well when applied to patient cohorts that differ from those used to develop them; ii) among the methods we tried, the classification using logistic regression worked better on average, closely followed by random forest; iii) the unconstrained version of the logistic regression classifier outperformed the federated version by 4<b>%</b> on average. Reproducibility of our experiments is ensured through the use of VisualSHIELD, an open-source tool that augments DataSHIELD with new functions, a standardized deployment procedure, and a simple graphical user interface.

RABGAP1LBTN3A3
Also flagged:pathogenesisinterferonMxIFITMsTRIMsinfluenza virus infection
Journal Article 2024-01-29 ✓ 2 Snippets Husain M.
In-Text Gene Mentions

RABGAP1L (RAB GTPase-activating protein 1-like) or TBC1D18 (Tre2/Bub2/Cdc16 (TBC)-domain-containing 18) protein restricts influenza virus infection by disrupting the endosome function hence virus entry [213].

BTN3A3 (butyrophilin subfamily 3 member A3) inhibits the infection of, specifically, avian influenza viruses by interfering with the replication of viral RNA [279].

Show Full Abstract

Influenza virus has been one of the most prevalent and researched viruses globally. Consequently, there is ample information available about influenza virus lifecycle and pathogenesis. However, there is plenty yet to be known about the determinants of influenza virus pathogenesis and disease severity. Influenza virus exploits host factors to promote each step of its lifecycle. In turn, the host deploys antiviral or restriction factors that inhibit or restrict the influenza virus lifecycle at each of those steps. Two broad categories of host restriction factors can exist in virus-infected cells: (1) encoded by the interferon-stimulated genes (ISGs) and (2) encoded by the constitutively expressed genes that are not stimulated by interferons (non-ISGs). There are hundreds of ISGs known, and many, e.g., Mx, IFITMs, and TRIMs, have been characterized to restrict influenza virus infection at different stages of its lifecycle by (1) blocking viral entry or progeny release, (2) sequestering or degrading viral components and interfering with viral synthesis and assembly, or (3) bolstering host innate defenses. Also, many non-ISGs, e.g., cyclophilins, ncRNAs, and HDACs, have been identified and characterized to restrict influenza virus infection at different lifecycle stages by similar mechanisms. This review provides an overview of those ISGs and non-ISGs and how the influenza virus escapes the restriction imposed by them and aims to improve our understanding of the host restriction mechanisms of the influenza virus.

Also flagged:Bone tuberculosistuberculosisgranulomasTBinfectioninfectious diseases
Journal Article 2024-01-29 No Snippets Luo Y, Chen H, Chen H, Xiu P, Zeng J, Song Y, Li T.
Show Full Abstract

Bone tuberculosis, an extrapulmonary manifestation of tuberculosis, presents unique treatment challenges, including its insidious onset and complex pathology. While advancements in anti-tubercular therapy have been made, the efficacy is often limited by difficulties in achieving targeted drug concentrations and avoiding systemic toxicity. The intricate bone structure and presence of granulomas further impede effective drug delivery. Nano-drug delivery systems have emerged as a promising alternative, offering the enhanced targeting of anti-tubercular drugs. These systems, characterized by their minute size and adaptable surface properties, can be tailored to improve drug solubility, stability, and bioavailability, while also responding to specific stimuli within the bone TB microenvironment for controlled drug release. Nano-drug delivery systems can encapsulate drugs for precise delivery to the infection site. A significant innovation is their integration with prosthetics or biomaterials, which aids in both drug delivery and bone reconstruction, addressing the infection and its osteological consequences. This review provides a comprehensive overview of the pathophysiology of bone tuberculosis and its current treatments, emphasizing their limitations. It then delves into the advancements in nano-drug delivery systems, discussing their design, functionality, and role in bone TB therapy. The review assesses their potential in preclinical research, particularly in targeted drug delivery, treatment efficacy, and a reduction of side effects. Finally, it highlights the transformative promise of nanotechnology in bone TB treatments and suggests future research directions in this evolving field.

SERPINC1
Also flagged:urothelial carcinomastumourRASMAPKBRAFangiogenesis
Journal Article 2024-01-29 ✓ 1 Snippet Gentilini F, Salaroli R, Tornago R, Turba M, Ogundipe T, Zannoni A, Forni M, Campigli M, Furlanello T.
In-Text Gene Mentions

…haemostatic profile includingATIIIand d‐dimers/FDP measurements.…

Show Full Abstract

No abstract available.

Also flagged:ExtracellularVesiclesCell-to-cell communicationmembraneExtracellular vesiclescarbohydrates
Journal Article 2024-01-28 No Snippets Filannino FM, Panaro MA, Benameur T, Pizzolorusso I, Porro C.
Show Full Abstract

Cell-to-cell communication is essential for the appropriate development and maintenance of homeostatic conditions in the central nervous system. Extracellular vesicles have recently come to the forefront of neuroscience as novel vehicles for the transfer of complex signals between neuronal cells. Extracellular vesicles are membrane-bound carriers packed with proteins, metabolites, and nucleic acids (including DNA, mRNA, and microRNAs) that contain the elements present in the cell they originate from. Since their discovery, extracellular vesicles have been studied extensively and have opened up new understanding of cell-cell communication; they may cross the blood-brain barrier in a bidirectional way from the bloodstream to the brain parenchyma and vice versa, and play a key role in brain-periphery communication in physiology as well as pathology. Neurons and glial cells in the central nervous system release extracellular vesicles to the interstitial fluid of the brain and spinal cord parenchyma. Extracellular vesicles contain proteins, nucleic acids, lipids, carbohydrates, and primary and secondary metabolites. that can be taken up by and modulate the behaviour of neighbouring recipient cells. The functions of extracellular vesicles have been extensively studied in the context of neurodegenerative diseases. The purpose of this review is to analyse the role extracellular vesicles extracellular vesicles in central nervous system cell communication, with particular emphasis on the contribution of extracellular vesicles from different central nervous system cell types in maintaining or altering central nervous system homeostasis.

Also flagged:RAFMEKERKPancreatic Cancerpancreatic ductal adenocarcinomaPDAC
Journal Article 2024-01-28 No Snippets Adamopoulos C, Cave DD, Papavassiliou AG, Papavassiliou AG.
Show Full Abstract

Pancreatic cancer represents a formidable challenge in oncology, primarily due to its aggressive nature and limited therapeutic options. The prognosis of patients with pancreatic ductal adenocarcinoma (PDAC), the main form of pancreatic cancer, remains disappointingly poor with a 5-year overall survival of only 5%. Almost 95% of PDAC patients harbor Kirsten rat sarcoma virus (KRAS) oncogenic mutations. KRAS activates downstream intracellular pathways, most notably the rapidly accelerated fibrosarcoma (RAF)/mitogen-activated protein kinase kinase (MEK)/extracellular signal-regulated kinase (ERK) signaling axis. Dysregulation of the RAF/MEK/ERK pathway is a crucial feature of pancreatic cancer and therefore its main components, RAF, MEK and ERK kinases, have been targeted pharmacologically, largely by small-molecule inhibitors. The recent advances in the development of inhibitors not only directly targeting the RAF/MEK/ERK pathway but also indirectly through inhibition of its regulators, such as Src homology-containing protein tyrosine phosphatase 2 (SHP2) and Son of sevenless homolog 1 (SOS1), provide new therapeutic opportunities. Moreover, the discovery of allele-specific small-molecule inhibitors against mutant KRAS variants has brought excitement for successful innovations in the battle against pancreatic cancer. Herein, we review the recent advances in targeted therapy and combinatorial strategies with focus on the current preclinical and clinical approaches, providing critical insight, underscoring the potential of these efforts and supporting their promise to improve the lives of patients with PDAC.

HFE
Also flagged:HaemophiliaIronhaemophilic arthropathyhemearthropathyHMOX1
Journal Article 2024-01-28 ✓ 5 Snippets van Vulpen LFD, Mastbergen SC, Foppen W, Fischer K, Lafeber FPJG, Schutgens REG.
In-Text Gene Mentions

Considering the importance of heme-derived iron in the pathogenesis of HA [22], and the suggested role of HFE and HMOX1 on HA [26] and RA [28,29] development and progression, we hypothesized that a genetic predisposition for impaired iron or heme handling might impact the severity of blood-induced joint damage.

Although iron levels and transferrin saturation were significantly increased in the 95 patients with an HFE mutation, neither carrying this mutation nor the HMOX1 polymorphism was associated with radiographic joint damage, and the same was true after adjustment for well-known factors associated with arthropathy.

…the association ofHFEmutations or HMOX1…

…patients with anHFEmutation, neither carrying…

…the hypothesis thatHFEmutations or HMOX1…

Show Full Abstract

The treatment landscape for haemophilia is changing rapidly, creating opportunities for personalized treatment. As major morbidity is still caused by haemophilic arthropathy, understanding the factors affecting joint damage and joint damage progression might lead to more individualized treatment regimens. We investigated the association of <i>HFE</i> mutations or <i>HMOX1</i> polymorphisms affecting iron/heme handling with radiographic joint damage in 252 haemophilia patients (severe and moderate). Although iron levels and transferrin saturation were significantly increased in the 95 patients with an <i>HFE</i> mutation, neither carrying this mutation nor the <i>HMOX1</i> polymorphism was associated with radiographic joint damage, and the same was true after adjustment for well-known factors associated with arthropathy. In conclusion, this study does not support the hypothesis that <i>HFE</i> mutations or <i>HMOX1</i> polymorphisms can be used to predict the development of haemophilic arthropathy.

Also flagged:Cancerdeathtumortumorscolorectal canceracute myeloid leukemia
Journal Article 2024-01-28 No Snippets Chen HL, Jin WL.
Show Full Abstract

Cancer is one of the leading causes of death in the world. Various drugs have been developed to eliminate it but to no avail because a tumor can go into dormancy to avoid therapy. In the past few decades, tumor dormancy has become a popular topic in cancer therapy. Recently, there has been an important breakthrough in the study of tumor dormancy. That is, cancer cells can enter a reversible drug-tolerant persister (DTP) state to avoid therapy, but no exact mechanism has been found. The study of the link between the DTP state and diapause seems to provide an opportunity for a correct understanding of the mechanism of the DTP state. Completely treating cancer and avoiding dormancy by targeting the expression of key genes in diapause are possible. This review delves into the characteristics of the DTP state and its connection with embryonic diapause, and possible treatment strategies are summarized. The authors believe that this review will promote the development of cancer therapy.

HFE
Also flagged:metalsaluminumcadmiumarsenicnickelidiopathic hypogonadotropic hypogonadism
Journal Article 2024-01-28 ✓ 1 Snippet Ciftel S, Ozkaya AL.
In-Text Gene Mentions

…lesions, radiation andhemochromatosis, sarcoidosis and histiocytosi…

Show Full Abstract

<h4>Introduction</h4>The toxic effects of heavy metals on biological systems are being investigated with increasing interest day by day. Our purpose was to investigate heavy metals such as aluminum (Al), cadmium (Cd), arsenic (As), lead (Pb), and nickel (Ni) in males with idiopathic hypogonadotropic hypogonadism (IHH) and to determine whether there is a relationship between heavy metals and testosterone levels.<h4>Methods</h4>Twenty-six male patients with IHH aged 18-50 and 22 healthy males aged 21-50 admitted to the Outpatient Department of Endocrinology for follow-up were enrolled. BMIs were calculated by measuring the height and weight of all participants. Al, Cd, As, Pb, and Ni levels were measured and compared between groups. Testosterone levels were measured to investigate whether there was a correlation with heavy metal levels.<h4>Results</h4>Al, Cd, As, Pb, and Ni levels were statistically higher in the patient group compared to the control group (p<0.001). A moderately strong significant negative correlation was detected between the patients' testosterone and As levels (p=0.001, r=-0.609, R<sup>2</sup>=0.371). Decreased As and Cd levels were observed as the patients' ages increased (p=0.013, r=-0.471).<h4>Conclusion</h4>Heavy metals might play potential roles in IHH. We hope that investigating heavy metal levels in IHH and adding toxicity-preventive treatments to hormonal therapies will be beneficial in the multifaceted management of the disease in clinical practice.

HFE
Also flagged:FerritinType 2 Diabetes MellitusironGlucose intoleranceinsulininsulin resistance
Journal Article 2024-01-28 ✓ 2 Snippets Arumugam S, Suyambulingam A.
In-Text Gene Mentions

…illnesses, such ashemochromatosis, or those who…

…type 1 diabetes,hemochromatosis, constant liquor addiction,…

Show Full Abstract

<h4>Background</h4>Hyperinsulinemia has been linked to increased ferritin production and iron absorption in type 2 diabetes mellitus, ultimately leading to increased iron storage. Glucose intolerance is intimately linked to this issue. Increased oxidative stress from iron decreases insulin's ability to be taken into cells and used for energy. Researchers suggest that increased iron levels in the body play a role in the emergence of insulin resistance, glucose intolerance, and vascular repercussions associated with diabetes.<h4>Objective</h4>The aim of this study is to assess the levels of serum ferritin and fasting plasma glucose in both diabetic and nondiabetic individuals while establishing a relationship between the two. Exploring the connection between serum ferritin levels and the duration of diabetes mellitus in individuals diagnosed with diabetes is our objective.<h4>Methodology</h4>In this study, 80 men diagnosed with type 2 diabetes mellitus were included, and they were compared with 70 male volunteers who were in good health. We took blood samples while the subjects fasted, and we analyzed the plasma glucose and serum ferritin levels.<h4>Results</h4>In the diabetic group, there were notably higher levels of serum ferritin and fasting plasma glucose compared to the nondiabetic subjects. Furthermore, a correlation was observed between the duration of diabetes among participants with diabetes and elevated serum ferritin levels.<h4>Conclusion</h4>The findings suggest that low-grade inflammation and increased body iron stores are positively related to hyperglycemia in type 2 diabetes mellitus.

Also flagged:methylationcolorectal cancercancerpathogenesismalignant tumorcancers
Journal Article 2024-01-28 No Snippets Ye J, Zhang J, Ding W.
Show Full Abstract

Colorectal cancer (CRC) is a multifaceted disease influenced by the interplay of genetic and environmental factors. The clinical heterogeneity of CRC cannot be attributed exclusively to genetic diversity and environmental exposures, and epigenetic markers, especially DNA methylation, play a critical role as key molecular markers of cancer. This review compiles a comprehensive body of evidence underscoring the significant involvement of DNA methylation modifications in the pathogenesis of CRC. Moreover, this review explores the potential utility of DNA methylation in cancer diagnosis, prognostics, assessment of disease activity, and prediction of drug responses. Recognizing the impact of DNA methylation will enhance the ability to identify distinct CRC subtypes, paving the way for personalized treatment strategies and advancing precision medicine in the management of CRC.

bioRxiv 2024-01-28 Preprint (No Snippets API) Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S.
Show Full Abstract

Post-transcriptional regulation of immune-related transcripts by RNA-binding proteins (RBPs) impacts immune cell responses, including mast cell functionality. Despite their importance in immune regulation, the functional role of most RBPs remains to be understood. By manipulating the expression of specific RBPs in mast cells, coupled with mass spectrometry and transcriptomic analyses, we found that the Regnase family of proteins acts as a potent regulator of mast cell physiology. Specifically, Regnase-1 is required to maintain basic cell proliferation and survival, while both Regnase-1 and −3 cooperatively regulate the expression of inflammatory transcripts upon mast cell activation, with Tnf being a primary target of both proteins. In mast cells, Regnase-3 directly interacts with Regnase-1 and is necessary to restrain Regnase-1 expression through the destabilization of its transcript. Overall, our study identifies protein interactors of endogenously expressed Regnase factors, characterizes the regulatory interplay between Regnase family members in mast cells, and establishes their role in the control of mast cell homeostasis and inflammatory responses.

POU3F2
Also flagged:leptin receptornucleusleptinleptin receptor longSim1Mc4r
Journal Article 2024-01-27 ✓ 1 Snippet Higgins MBA, Glendining KA, Jasoni CL.
In-Text Gene Mentions

…co-expressed with Sim1,Pou3f2, Mc4r and Bdnf…

Show Full Abstract

The arcuate nucleus is a crucial hypothalamic brain region involved in regulating body weight homeostasis. Neurons within the arcuate nucleus respond to peripheral metabolic signals, such as leptin, and relay these signals via neuronal projections to brain regions both within and outside the hypothalamus, ultimately causing changes in an animal's behaviour and physiology. There is a substantial amount of evidence to indicate that leptin is intimately involved with the postnatal development of arcuate nucleus melanocortin circuitry. Further, it is clear that leptin signalling directly in the arcuate nucleus is required for circuitry development. However, as leptin receptor long isoform (Leprb) mRNA is expressed in multiple nuclei within the developing hypothalamus, including the postsynaptic target regions of arcuate melanocortin projections, this raises the possibility that leptin also signals in these nuclei to promote circuitry development. Here, we used RT-qPCR and RNAscope® to reveal the spatio-temporal pattern of Leprb mRNA in the early postnatal mouse hypothalamus. We found that Leprb mRNA expression increased significantly in the arcuate nucleus, ventromedial nucleus and paraventricular nucleus of the hypothalamus from P8, in concert with the leptin surge. In the dorsomedial nucleus of the hypothalamus, increases in Leprb mRNA were slightly later, increasing significantly from P12. Using duplex RNAscope®, we found Leprb co-expressed with Sim1, Pou3f2, Mc4r and Bdnf in the paraventricular nucleus at P8. Together, these data suggest that leptin may signal in a subset of neurons postsynaptic to arcuate melanocortin neurons, as well as within the arcuate nucleus itself, to promote the formation of arcuate melanocortin circuitry during the early postnatal period.

HFE
Also flagged:ironHHsynthesisdeferasiroxHereditary hemochromatosisgenetic disease
Journal Article 2024-01-27 ✓ 5 Snippets Hoxha M, Malaj V, Zappacosta B.
In-Text Gene Mentions

…Economic Evaluations ofHemochromatosisScreening and Treatment:…

…Mutation of thehemochromatosisgene (HFE: C282Y…

…the hemochromatosis gene (HFE: C282Y [main mutation],…

…the discovery ofHFEgene in 1996,…

…further confirmed withHFEgenotyping.…

Show Full Abstract

<h4>Background</h4>Hereditary hemochromatosis (HH) is an autosomal recessive disorder that leads to iron overload and multiorgan failure.<h4>Objectives</h4>The aim of this systematic review was to provide up-to-date evidence of all the current data on the costs and cost effectiveness of screening and treatment for HH.<h4>Methods</h4>We searched PubMed, Cochrane Library, National Health Service Economic Evaluation Database (NHSEED), Cost-Effectiveness Analysis Registry (CEA Registry), Health Technology Assessment Database (HTAD), Centre for Reviews and Dissemination (CRD), and Econlit until April 2023 with no date restrictions. Articles that reported cost-utility, cost-description, cost-minimization, cost-effectiveness, or cost-benefit analyses for any kind of management (drugs, screening, etc.) were included in the study. Patients with HH, their siblings, or individuals suspected of having HH were included in the study. All screening and treatment strategies were included. Two authors assessed the quality of evidence related to screening (either phenotype or genotype screening) and treatment (phlebotomy and electrophoresis). Narrative synthesis was used to analyse the similarities and differences between the respective studies.<h4>Results</h4>Thirty-nine papers were included in this study. The majority of the studies reported both the cost of phenotype screening, including transferrin saturation (TS), serum ferritin, and liver biopsy, and the cost of genotype screening (HFE screening, C282Y mutation). Few studies reported the cost for phlebotomy and erythrocytapheresis treatment. Data revealed that either phenotype or genotype screening were cost effective compared with no screening. Treatment studies concluded that erythrocytapheresis might be a cost-effective therapy compared with phlebotomy.<h4>Conclusions</h4>Economic studies on either the screening, or treatment strategy for HH patients should be performed in more countries. We suggest that cost-effectiveness studies on the role of deferasirox in HH should be carried out as an alternative therapy to phlebotomy.

Also flagged:Palatogenesisgene expressiontranscription factorscleft palateCPdefects
Journal Article 2024-01-27 No Snippets Yan F, Suzuki A, Iwaya C, Pei G, Chen X, Yoshioka H, Yu M, Simon LM, Iwata J, Zhao Z.
Show Full Abstract

Perturbations in gene regulation during palatogenesis can lead to cleft palate, which is among the most common congenital birth defects. Here, we perform single-cell multiome sequencing and profile chromatin accessibility and gene expression simultaneously within the same cells (n = 36,154) isolated from mouse secondary palate across embryonic days (E) 12.5, E13.5, E14.0, and E14.5. We construct five trajectories representing continuous differentiation of cranial neural crest-derived multipotent cells into distinct lineages. By linking open chromatin signals to gene expression changes, we characterize the underlying lineage-determining transcription factors. In silico perturbation analysis identifies transcription factors SHOX2 and MEOX2 as important regulators of the development of the anterior and posterior palate, respectively. In conclusion, our study charts epigenetic and transcriptional dynamics in palatogenesis, serving as a valuable resource for further cleft palate research.

OLFM4
Also flagged:R-spondin 1RSPO1epidermal growth factorEGFprostaglandin E2Gene expression
Journal Article 2024-01-27 ✓ 1 Snippet Kwon O, Lee H, Jung J, Son YS, Jeon S, Yu WD, Son N, Jung KB, Choi E, Lee IC, Kwon HJ, Kim C, Lee MO, Cho HS, Kim DS, Son MY.
In-Text Gene Mentions

…, DEFA5 ,OLFM4, and MUC2…

Show Full Abstract

Three-dimensional human intestinal organoids (hIO) are widely used as a platform for biological and biomedical research. However, reproducibility and challenges for large-scale expansion limit their applicability. Here, we establish a human intestinal stem cell (ISC) culture method expanded under feeder-free and fully defined conditions through selective enrichment of ISC populations (ISC<sup>3D-hIO</sup>) within hIO derived from human pluripotent stem cells. The intrinsic self-organisation property of ISC<sup>3D-hIO</sup>, combined with air-liquid interface culture in a minimally defined medium, forces ISC<sup>3D-hIO</sup> to differentiate into the intestinal epithelium with cellular diversity, villus-like structure, and barrier integrity. Notably, ISC<sup>3D-hIO</sup> is an ideal cell source for gene editing to study ISC biology and transplantation for intestinal diseases. We demonstrate the intestinal epithelium differentiated from ISC<sup>3D-hIO</sup> as a model system to study severe acute respiratory syndrome coronavirus 2 viral infection. ISC<sup>3D-hIO</sup> culture technology provides a biological tool for use in regenerative medicine and disease modelling.

Also flagged:nuclear hormone receptorClustering Epilepsyepileptic disorderchromosomeNHRpathogenesis
Journal Article 2024-01-27 No Snippets de Nys R, van Eyk CL, Ritchie T, Møller RS, Scheffer IE, Marini C, Bhattacharjee R, Kumar R, Gecz J.
Show Full Abstract

Clustering Epilepsy (CE) is an epileptic disorder with neurological comorbidities caused by heterozygous variants of the X chromosome gene Protocadherin 19 (PCDH19). Recent studies have implicated dysregulation of the Nuclear Hormone Receptor (NHR) pathway in CE pathogenesis. To obtain a comprehensive overview of the impact and mechanisms of loss of PCDH19 function in CE pathogenesis, we have performed epigenomic, transcriptomic and proteomic analysis of CE relevant models. Our studies identified differential regulation and expression of Androgen Receptor (AR) and its targets in CE patient skin fibroblasts. Furthermore, our cell culture assays revealed the repression of PCDH19 expression mediated through ERα and the co-regulator FOXA1. We also identified a protein-protein interaction between PCDH19 and AR, expanding upon the intrinsic link between PCDH19 and the NHR pathway. Together, these results point to a novel mechanism of NHR signaling in the pathogenesis of CE that can be explored for potential therapeutic options.

Also flagged:Major depressive disorderneuropsychiatric disordersmental illnesspathogenesisdepressiontumour
Journal Article 2024-01-27 No Snippets Xie Y, Chen L, Wang L, Liu T, Zheng Y, Si L, Ge H, Xu H, Xiao L, Wang G.
Show Full Abstract

<h4>Background</h4>Major depressive disorder (MDD) is a common mental illness that affects millions of people worldwide and imposes a heavy burden on individuals, families and society. Previous studies on MDD predominantly focused on neurons and employed bulk homogenates of brain tissues. This paper aims to decipher the relationship between oligodendrocyte lineage (OL) development and MDD at the single-cell resolution level.<h4>Methods</h4>Here, we present the use of a guided regularized random forest (GRRF) algorithm to explore single-nucleus RNA sequencing profiles (GSE144136) of the OL at four developmental stages, which contains dorsolateral prefrontal cortex of 17 healthy controls (HC) and 17 MDD cases, generated by Nagy C et al. We prioritized and ordered differentially expressed genes (DEGs) based on Nagy et al., which could predominantly discriminate cells in the four developmental stages and two adjacent developmental stages of the OL. We further screened top-ranked genes that distinguished between HC and MDD in four developmental stages. Moreover, we estimated the performance of the GRRF model via the area under the curve value. Additionally, we validated the pivotal candidate gene Malat1 in animal models.<h4>Results</h4>We found that, among the four developmental stages, the onset development of OL (OPC2) possesses the best predictive power for distinguishing HC and MDD, and long noncoding RNA MALAT1 has top-ranked importance value in candidate genes of four developmental stages. In addition, results of fluorescence in situ hybridization assay showed that Malat1 plays a critical role in the occurrence of depression.<h4>Conclusions</h4>Our work elucidates the mechanism of MDD from the perspective of OL development at the single-cell resolution level and provides novel insight into the occurrence of depression.

PTGIS
Also flagged:coagulationplatelet activationhemostasisPlatelet aggregationlight transmissionadenosine diphosphate
Journal Article 2024-01-27 ✓ 5 Snippets Miglio A, Falcinelli E, Cappelli K, Mecocci S, Mezzasoma AM, Antognoni MT, Gresele P.
In-Text Gene Mentions

Interestingly the gene encoding for prostacyclin synthase, PTGIS, was down-regulated at all time points compared to T-30, suggesting a possible reduced prostaglandin I2-mediated inhibition of platelet aggregation.

…D1, prostaglandin I2 synthase-PTGIS, endothelial nitric oxide…

…prostaglandin I2 synthase-PTGIS, endothelial nitric…

…D1, prostaglandin I2 synthase-PTGIS, and nitric oxide…

…, ENTPD1 ,PTGIS, and NOS3…

Show Full Abstract

Training has a significant effect on the physiology of blood coagulation in humans and in horses. Several hemostatic changes have been reported after exercise in the horse but data available are inconclusive. The aim of this study was to investigate platelet activation and primary platelet-related hemostasis modifications in young never-trained Thoroughbreds in the first incremental training period in order to improve knowledge on this topic. Twenty-nine clinically healthy, untrained, 2-year-old Thoroughbred racehorses were followed during their incremental 4-month sprint exercise training. Blood collection was performed once a month, five times in total (T-30, T0, T30, T60, and T90). Platelet aggregation was measured by light transmission aggregometry in response to various agonists: adenosine diphosphate (ADP), collagen, and calcium ionophore A23187. Platelet function was evaluated using a platelet function analyzer (PFA-100<sup>®</sup>) using collagen/ADP and collagen/adrenaline cartridges. Nitrite-nitrate (NOx) plasma concentrations were measured via a colorimetric assay to assess in vivo nitric oxide bioavailability. Platelet activation was also investigated through gene expression analyses (selectin P-<i>SELP</i>, ectonucleotidase CD39-<i>ENTPD1</i>, prostaglandin I2 synthase-<i>PTGIS</i>, endothelial nitric oxide synthase 3-<i>NOS3</i>). Differences among the time points were analyzed and mean ± SEM were calculated. Significant modifications were identified compared with T-30, with an increase in platelet aggregation (collagen:32.6 ± 4.8 vs. 21.6 ± 4.9%; ADP: 35.5 ± 2.0 vs. 24.5 ± 3.1%; A23187: 30 ± 4.7 vs. 23.8 ± 4%) and a shorter closure time of C-ADP cartridges (75.6 ± 4.4 vs. 87.7 ± 3.4 s) that tended to return to the baseline value at T90. NOx concentrations in plasma significantly increased after 30 days of the training program compared with the baseline. The first long-term training period seems to induce platelet hyperactivity after 30 days in never-trained Thoroughbreds. Regular physical training reduces the negative effects of acute efforts on platelet activation.

SERPINC1
Also flagged:CD99Ewing sarcomabone tumorEWSdeathextracellular
Journal Article 2024-01-27 ✓ 2 Snippets De Feo A, Manfredi M, Mancarella C, Maqueda JJ, De Giorgis V, Pignochino Y, Sciandra M, Cristalli C, Donadelli M, Scotlandi K.
In-Text Gene Mentions

…it (IGFALS), antithrombin-II (SERPINC1), and inter-alpha-trypsin inh…

…including RBP4, SERPIND1,SERPINC1, and GC.…

Show Full Abstract

Ewing sarcoma (EWS) is an aggressive pediatric bone tumor characterized by unmet clinical needs and an incompletely understood epigenetic heterogeneity. Here, we considered CD99, a major surface molecule hallmark of EWS malignancy. Fluctuations in CD99 expression strongly impair cell dissemination, differentiation, and death. CD99 is also loaded within extracellular vesicles (EVs), and the delivery of CD99-positive or CD99-negative EVs dynamically exerts oncogenic or oncosuppressive functions to recipient cells, respectively. We undertook mass spectrometry and functional annotation analysis to investigate the consequences of CD99 silencing on the proteomic landscape of EWS cells and related EVs. Our data demonstrate that (i) the decrease in CD99 leads to major changes in the proteomic profile of EWS cells and EVs; (ii) intracellular and extracellular compartments display two distinct signatures of differentially expressed proteins; (iii) proteomic changes converge to the modulation of cell migration and immune-modulation biological processes; and (iv) CD99-silenced cells and related EVs are characterized by a migration-suppressive, pro-immunostimulatory proteomic profile. Overall, our data provide a novel source of CD99-associated protein biomarkers to be considered for further validation as mediators of EWS malignancy and as EWS disease liquid biopsy markers.

Also flagged:neurological disorderagingmultiple sclerosisAlzheimer's diseaseADParkinson's disease
Journal Article 2024-01-27 No Snippets Mamun AA, Shao C, Geng P, Wang S, Xiao J.
Show Full Abstract

Polyphenolic compounds have shown promising neuroprotective properties, making them a valuable resource for identifying prospective drug candidates to treat several neurological disorders (NDs). Numerous studies have reported that polyphenols can disrupt the nuclear factor kappa B(NF-κB) pathway by inhibiting the phosphorylation or ubiquitination of signaling molecules, which further prevents the degradation of IκB. Additionally, they prevent NF-κB translocation to the nucleus and pro-inflammatory cytokine production. Polyphenols such as curcumin, resveratrol, and pterostilbene had significant inhibitory effects on NF-κB, making them promising candidates for treating NDs. Recent experimental findings suggest that polyphenols possess a wide range of pharmacological properties. Notably, much attention has been directed towards their potential therapeutic effects in NDs such as Alzheimer's disease (AD), Parkinson's disease (PD), cerebral ischemia, anxiety, depression, autism, and spinal cord injury (SCI). Much preclinical data supporting the neurotherapeutic benefits of polyphenols has been developed. Nevertheless, this study has described the significance of polyphenols as potential neurotherapeutic agents, specifically emphasizing their impact on the NF-κB pathway. This article offers a comprehensive analysis of the involvement of polyphenols in NDs, including both preclinical and clinical perspectives.

Also flagged:Chronic progressive external ophthalmoplegiaCPEOmitochondrial diseasesptosismitochondrialdysfunction
Journal Article 2024-01-27 No Snippets Ali A, Esmaeil A, Behbehani R.
Show Full Abstract

<h4>Background</h4>Chronic progressive external ophthalmoplegia (CPEO) is a rare disorder that can be at the forefront of several mitochondrial diseases. This review overviews mitochondrial CPEO encephalomyopathies to enhance accurate recognition and diagnosis for proper management.<h4>Methods</h4>This study is conducted based on publications and guidelines obtained by selective review in PubMed. Randomized, double-blind, placebo-controlled trials, Cochrane reviews, and literature meta-analyses were particularly sought.<h4>Discussion</h4>CPEO is a common presentation of mitochondrial encephalomyopathies, which can result from alterations in mitochondrial or nuclear DNA. Genetic sequencing is the gold standard for diagnosing mitochondrial encephalomyopathies, preceded by non-invasive tests such as fibroblast growth factor-21 and growth differentiation factor-15. More invasive options include a muscle biopsy, which can be carried out after uncertain diagnostic testing. No definitive treatment option is available for mitochondrial diseases, and management is mainly focused on lifestyle risk modification and supplementation to reduce mitochondrial load and symptomatic relief, such as ptosis repair in the case of CPEO. Nevertheless, various clinical trials and endeavors are still at large for achieving beneficial therapeutic outcomes for mitochondrial encephalomyopathies.<h4>Key messages</h4>Understanding the varying presentations and genetic aspects of mitochondrial CPEO is crucial for accurate diagnosis and management.

NEGR1
Also flagged:ALKNon-Small Cell Lung Canceranaplastic lymphoma kinaseNSCLCnucleolar phosphoprotein(
Journal Article 2024-01-27 ✓ 1 Snippet Parvaresh H, Roozitalab G, Golandam F, Behzadi P, Jabbarzadeh Kaboli P.
In-Text Gene Mentions

The Negr1-derived peptide demonstrated the ability to degrade ALK and slow tumor growth both in vitro and in vivo, presenting a promising avenue for treating aggressive neuroblastoma resistant to current ALK inhibitors [48].

Show Full Abstract

<b>Background and Objective:</b> This review comprehensively explores the intricate landscape of anaplastic lymphoma kinase (ALK), focusing specifically on its pivotal role in non-small cell lung cancer (NSCLC). Tracing ALK's discovery, from its fusion with nucleolar phosphoprotein (NPM)-1 in anaplastic large cell non-Hodgkin's lymphoma (ALCL) in 1994, the review elucidates the subsequent impact of ALK gene alterations in various malignancies, including inflammatory myofibroblastoma and NSCLC. Approximately 3-5% of NSCLC patients exhibit complex ALK rearrangements, leading to the approval of six ALK-tyrosine kinase inhibitors (TKIs) by 2022, revolutionizing the treatment landscape for advanced metastatic ALK + NSCLC. Notably, second-generation TKIs such as alectinib, ceritinib, and brigatinib have emerged to address resistance issues initially associated with the pioneer ALK-TKI, crizotinib. <b>Methods:</b> To ensure comprehensiveness, we extensively reviewed clinical trials on ALK inhibitors for NSCLC by 2023. Additionally, we systematically searched PubMed, prioritizing studies where the terms "ALK" AND "non-small cell lung cancer" AND/OR "NSCLC" featured prominently in the titles. This approach aimed to encompass a spectrum of relevant research studies, ensuring our review incorporates the latest and most pertinent information on innovative and alternative therapeutics for ALK + NSCLC. <b>Key Content and Findings:</b> Beyond exploring the intricate details of ALK structure and signaling, the review explores the convergence of ALK-targeted therapy and immunotherapy, investigating the potential of immune checkpoint inhibitors in ALK-altered NSCLC tumors. Despite encouraging preclinical data, challenges observed in trials assessing combinations such as nivolumab-crizotinib, mainly due to severe hepatic toxicity, emphasize the necessity for cautious exploration of these novel approaches. Additionally, the review explores innovative directions such as ALK molecular diagnostics, ALK vaccines, and biosensors, shedding light on their promising potential within ALK-driven cancers. <b>Conclusions:</b> This comprehensive analysis covers molecular mechanisms, therapeutic strategies, and immune interactions associated with ALK-rearranged NSCLC. As a pivotal resource, the review guides future research and therapeutic interventions in ALK-targeted therapy for NSCLC.

Also flagged:Autophagyorganellesautophagosomesdegradationmetabolismcytoplasmic
Journal Article 2024-01-27 No Snippets Zhang Y, Wang Q, Xue H, Guo Y, Wei S, Li F, Gong L, Pan W, Jiang P.
Show Full Abstract

The skeletal system is crucial for supporting bodily functions, protecting vital organs, facilitating hematopoiesis, and storing essential minerals. Skeletal homeostasis, which includes aspects such as bone density, structural integrity, and regenerative processes, is essential for normal skeletal function. Autophagy, an intricate intracellular mechanism for degrading and recycling cellular components, plays a multifaceted role in bone metabolism. It involves sequestering cellular waste, damaged proteins, and organelles within autophagosomes, which are then degraded and recycled. Autophagy's impact on bone health varies depending on factors such as regulation, cell type, environmental cues, and physiological context. Despite being traditionally considered a cytoplasmic process, autophagy is subject to transcriptional and epigenetic regulation within the nucleus. However, the precise influence of epigenetic regulation, including DNA methylation, histone modifications, and non-coding RNA expression, on cellular fate remains incompletely understood. The interplay between autophagy and epigenetic modifications adds complexity to bone cell regulation. This article provides an in-depth exploration of the intricate interplay between these two regulatory paradigms, with a focus on the epigenetic control of autophagy in bone metabolism. Such an understanding enhances our knowledge of bone metabolism-related disorders and offers insights for the development of targeted therapeutic strategies.

DCC
Also flagged:actin polymeraseVASPcell spreadingcytoskeletonbiologycell division
Journal Article 2024-01-26 ✓ 4 Snippets McCormick LE, Suarez C, Herring LE, Cannon KS, Kovar DR, Brown NG, Gupton SL.
In-Text Gene Mentions

…the netrin-1 receptorDCCis ubiquitylated in…

…AsDCCalso localizes to…

…IM9-mediated ubiquitylation ofDCCreduces phosphorylation at…

…the netrin receptorDCCalso localizes to…

Show Full Abstract

The actin cytoskeleton performs multiple cellular functions, and as such, actin polymerization must be tightly regulated. We previously demonstrated that reversible, non-degradative ubiquitylation regulates the function of the actin polymerase VASP in developing neurons. However, the underlying mechanism of how ubiquitylation impacts VASP activity was unknown. Here, we show that mimicking multi-monoubiquitylation of VASP at K240 and K286 negatively regulates VASP interactions with actin. Using in vitro biochemical assays, we demonstrate the reduced ability of multi-monoubiquitylated VASP to bind, bundle, and elongate actin filaments. However, multi-monoubiquitylated VASP maintained the ability to bind and protect barbed ends from capping protein. Finally, we demonstrate the electroporation of recombinant multi-monoubiquitylated VASP protein altered cell spreading morphology. Collectively, these results suggest a mechanism in which ubiquitylation controls VASP-mediated actin dynamics.

SOX6
Also flagged:Adolescent idiopathic scoliosisPAX1collagen (α1) XIpathogenesisestrogenMMP3
Journal Article 2024-01-26 ✓ 5 Snippets Yu H, Khanshour AM, Ushiki A, Otomo N, Koike Y, Einarsdottir E, Fan Y, Antunes L, Kidane YH, Cornelia R, Sheng RR, Zhang Y, Pei J, Grishin NV, Evers BM, Cheung JPY, Herring JA, Terao C, Song YQ, Gurnett CA, Gerdhem P, Ikegawa S, Rios JJ, Ahituv N, Wise CA.
In-Text Gene Mentions

It is likely, however, that Col11a1 expression in developing tail is directly activated by binding SOX transcription factors, as a prior genomic study using chromatin immunoprecipitation and sequencing in rat chondrosarcoma cells identified super enhancers near the Col11a1 gene that were bound multiple times by SOX9 and SOX6 (Liu and Lefebvre, 2015).

…an intron ofSOX6, a transcription…

…Col11a1, Adgrg6, andSox6was significantly reduced…

…genes Adgrg6 andSox6in affected tissue…

…of Col11a1 ,Sox6, and Adgrg6 in…

Show Full Abstract

Adolescent idiopathic scoliosis (AIS) is a common and progressive spinal deformity in children that exhibits striking sexual dimorphism, with girls at more than fivefold greater risk of severe disease compared to boys. Despite its medical impact, the molecular mechanisms that drive AIS are largely unknown. We previously defined a female-specific AIS genetic risk locus in an enhancer near the <i>PAX1</i> gene. Here, we sought to define the roles of <i>PAX1</i> and newly identified AIS-associated genes in the developmental mechanism of AIS. In a genetic study of 10,519 individuals with AIS and 93,238 unaffected controls, significant association was identified with a variant in <i>COL11A1</i> encoding collagen (α1) XI (rs3753841; NM_080629.2_c.4004C>T; p.(Pro1335Leu); p=7.07E<sup>-11</sup>, OR = 1.118). Using CRISPR mutagenesis we generated <i>Pax1</i> knockout mice (<i>Pax1<sup>-/</sup></i><sup>-</sup>). In postnatal spines we found that PAX1 and collagen (α1) XI protein both localize within the intervertebral disc-vertebral junction region encompassing the growth plate, with less collagen (α1) XI detected in <i>Pax1<sup>-/-</sup></i> spines compared to wild-type. By genetic targeting we found that wild-type <i>Col11a1</i> expression in costal chondrocytes suppresses expression of <i>Pax1</i> and of <i>Mmp3</i>, encoding the matrix metalloproteinase 3 enzyme implicated in matrix remodeling. However, the latter suppression was abrogated in the presence of the AIS-associated <i>COL11A1</i><sup>P1335L</sup> mutant. Further, we found that either knockdown of the estrogen receptor gene <i>Esr2</i> or tamoxifen treatment significantly altered <i>Col11a1</i> and <i>Mmp3</i> expression in chondrocytes. We propose a new molecular model of AIS pathogenesis wherein genetic variation and estrogen signaling increase disease susceptibility by altering a PAX1-COL11a1-MMP3 signaling axis in spinal chondrocytes.

Also flagged:Curcuminsodiumsynthesiswaterviral infectionshost cells
Journal Article 2024-01-26 No Snippets Obłoza M, Milewska A, Botwina P, Szczepański A, Medaj A, Bonarek P, Szczubiałka K, Pyrć K, Nowakowska M.
Show Full Abstract

Curcumin, a natural product with recognized antiviral properties, is limited in its application largely due to its poor solubility. This study presents the synthesis of water-soluble curcumin-poly(sodium 4-styrenesulfonate) (Cur-PSSNa<sub><i>n</i></sub>) covalent conjugates. The antiflaviviral activity of conjugates was validated in vitro by using the Zika virus as a model. In the development of these water-soluble curcumin-containing derivatives, we used the macromolecules reported by us to also hamper viral infections. Mechanistic investigations indicated that the conjugates exhibited excellent stability and bioavailability. The curcumin and macromolecules in concerted action interact directly with virus particles and block their attachment to host cells, hampering the infection process.

NEGR1
Also flagged:copperarsenicgene expressiongene expressionsalbuminglobulin
Journal Article 2024-01-26 ✓ 2 Snippets Kumar N, Thorat ST, Chavhan SR.
In-Text Gene Mentions

…GH ) ,growth hormone regulator 1hormone regulator 1…

…( GH ),growth hormone regulator 1hormone regulator 1…

Show Full Abstract

It is an urgent needs to address climate change and pollution in aquatic systems using suitable mitigation measures to avoid the aquatic animals' extinction. The vulnerability and extinction of the aquatic animals in the current scenario must be addressed to enhance safe fish food production. Taking into consideration of such issues in fisheries and aquaculture, an experiment was designed to mitigate high temperature (T) and low pH stress, as well as arsenic (As) pollution in fish using copper (Cu) containing diets. In the present investigation, the Cu-containing diets graded with 0, 4, 8, and 12 mg kg<sup>-1</sup> were prepared and fed to Pangasianodon hypophthalmus reared under As, low pH, and high-temperature stress. The gene expression was highly affected in terms of the primary, secondary, and tertiary stress response, whereas supplementation of Cu-containing diet mitigates the stress response. Oxidative stress genes such as catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPx) were significantly upregulated by stressors (As, As + T, and As + pH + T). Whereas, heat shock protein (HSP 70), inducible nitric oxide synthase (iNOS), metallothionine (MT), caspase 3a (Cas 3a), and cytochrome P450 (CYP 450) were highly upregulated by stressors, while dietary Cu at 8 mg kg<sup>-1</sup> diet significantly downregulated these gene expressions. Indeed, the immunity-related genes viz. TNFα, Ig, TLR, and immune-related attributes viz. albumin, globulin, total protein, A:G ratio, blood glucose, NBT, and myeloperoxidase (MPO) were also improved with Cu-containing diets. Cu containing diets substantially improved neurotransmitter enzyme (AChE) and vitamin C (Vit C). DNA damage was also reduced with supplementation of Cu at 8 mg kg<sup>-1</sup> diet. The growth index viz. final body weight gain (%), specific growth rate, protein efficiency ratio, food conversion ratio, relative feed intake, and daily growth index were noticeably enhanced by Cu diets (4 and 8 mg kg<sup>-1</sup> diet). The growth-related genes expressions viz. growth hormone (GH), growth hormone regulator 1 (Ghr1), growth hormone regulator β (Ghrβ,) myostatin (MYST), and somatostatin (SMT) supported the growth enhancement with Cu at 8 mg kg<sup>-1</sup> diet. The bioaccumulation of As was reduced with Cu-containing diets. The fish were infected with Aeromonas hydrophila at the end of the 105 days experimental trial. Cu at 8 mg kg<sup>-1</sup> diet improved immunity, reduced the cumulative mortality, and enhanced the relative percentage survival of the fish. The results revealed that the innovative Cu diets could reduce the extinction of the fish against climate change and pollution era and produce the safest production that is safe to humans for consumption.

HTT
Also flagged:STRnucleotidegene expressionneurological disordersHuntington diseaseamyotrophic lateral sclerosis
Journal Article 2024-01-26 ✓ 3 Snippets Lu J, Toro C, Adams DR, Undiagnosed Diseases Network, Moreno CAM, Lee WP, Leung YY, Harms MB, Vardarajan B, Heinzen EL.
In-Text Gene Mentions

…to ATN1 andHTTSTR loci from…

…the ATN1 andHTTloci for the…

…DMPK , andHTT) (46.2%, Table…

Show Full Abstract

<h4>Background</h4>Short tandem repeats (STRs) are widely distributed across the human genome and are associated with numerous neurological disorders. However, the extent that STRs contribute to disease is likely under-estimated because of the challenges calling these variants in short read next generation sequencing data. Several computational tools have been developed for STR variant calling, but none fully address all of the complexities associated with this variant class.<h4>Results</h4>Here we introduce LUSTR which is designed to address some of the challenges associated with STR variant calling by enabling more flexibility in defining STR loci, allowing for customizable modules to tailor analyses, and expanding the capability to call somatic and multiallelic STR variants. LUSTR is a user-friendly and easily customizable tool for targeted or unbiased genome-wide STR variant screening that can use either predefined or novel genome builds. Using both simulated and real data sets, we demonstrated that LUSTR accurately infers germline and somatic STR expansions in individuals with and without diseases.<h4>Conclusions</h4>LUSTR offers a powerful and user-friendly approach that allows for the identification of STR variants and can facilitate more comprehensive studies evaluating the role of pathogenic STR variants across human diseases.

HFE
Also flagged:Epithelioid Angiosarcomasoft tissue sarcomasoft tissue sarcomastumorHematoxylinneoplasia
Journal Article 2024-01-26 ✓ 1 Snippet Al Laham O, Sharaf Aldeen R, Ibrahim Basha Z, Ali A, Alhanwt A.
In-Text Gene Mentions

…Type 1 andHemochromatosis[ 2 ,…

Show Full Abstract

<h4>Introduction and importance</h4>Angiosarcomas are an exceedingly rare and malignant form of soft tissue sarcoma that are derived from endothelial cells. Overall, they comprise <1 % of the total number of soft tissue sarcomas. Due to nonspecific and misleading symptoms, the subsequent clinical presentations can easily result in misdiagnosis. This leads to life-threatening complications for patients. Contemplating this tumor as a differential diagnosis during the preoperative phase allows for essential time-sensitive therapeutic interventions to be accomplished.<h4>Case presentation</h4>Herein, we present the seldom precedented case of a 66-year-old Middle Eastern male who came to our surgical clinic chiefly complaining of an exacerbation of chronic left hypochondriac pain accompanied by gradual inexplicable abdominal distention. Our diagnostic radiological evaluation demonstrated two isolated abdominal mass formations.<h4>Clinical discussion</h4>Sheer excision of the neoplastic masses with safety margins was successfully executed via open surgery. The stemming histopathological examination through Hematoxylin and Eosin and immunohistochemical staining established the definitive diagnosis of an Epithelioid Angiosarcoma.<h4>Conclusion</h4>Epithelioid Angiosarcomas belong to the category of profoundly rare tumors. The available published literature conveys this rarity through the scarcity of epidemiological parameters and studies. It necessitates being borne in mind when facing similar clinical scenarios so that apt therapeutic interventions can be achieved. Structured diagnostic methods, timely surgical interventions and proper techniques, and comprehensive follow-up patient surveillance protocols are, therefore, merited. After thorough review of the published literature, we reckon herewith that ours is the first documented case from our country of an Epithelioid Angiosarcoma.

Also flagged:Benzyl Isothiocyanateinfectionsexcretionbeta defensin 1bacterial infectionsurinary tract infections
Journal Article 2024-01-26 No Snippets Pfäffle SP, Herz C, Brombacher E, Proietti M, Gigl M, Hofstetter CK, Mittermeier-Kleßinger VK, Claßen S, Tran HTT, Rajguru D, Dawid C, Kreutz C, Günther S, Lamy E.
Show Full Abstract

Despite substantial heterogeneity of studies, there is evidence that antibiotics commonly used in primary care influence the composition of the gastrointestinal microbiota in terms of changing their composition and/or diversity. Benzyl isothiocyanate (BITC) from the food and medicinal plant nasturtium (<i>Tropaeolum majus</i>) is known for its antimicrobial activity and is used for the treatment of infections of the draining urinary tract and upper respiratory tract. Against this background, we raised the question of whether a 14 d nasturtium intervention (3 g daily, N = 30 healthy females) could also impact the normal gut microbiota composition. Spot urinary BITC excretion highly correlated with a weak but significant antibacterial effect against <i>Escherichia coli</i>. A significant increase in human beta defensin 1 as a parameter for host defense was seen in urine and exhaled breath condensate (EBC) upon verum intervention. Pre-to-post analysis revealed that mean gut microbiome composition did not significantly differ between groups, nor did the circulating serum metabolome. On an individual level, some large changes were observed between sampling points, however. Explorative Spearman rank correlation analysis in subgroups revealed associations between gut microbiota and the circulating metabolome, as well as between changes in blood markers and bacterial gut species.

ZNF322
Also flagged:Thymic Epithelial Tumorstumorthymic carcinomasGTF2IHRASTP53
Journal Article 2024-01-26 ✓ 1 Snippet Elm L, Levidou G.
In-Text Gene Mentions

…, COL5A2 ,ZNF322, PXDN ,…

Show Full Abstract

Thymic epithelial tumors (TETs) are characterized by their extreme rarity and variable clinical presentation, with the inadequacy of the use of histological classification alone to distinguish biologically indolent from aggressive cases. The utilization of Next Generation Sequencing (NGS) to unravel the intricate genetic landscape of TETs could offer us a comprehensive understanding that is crucial for precise diagnoses, prognoses, and potential therapeutic strategies. Despite the low tumor mutational burden of TETS, NGS allows for exploration of specific genetic signatures contributing to TET onset and progression. Thymomas exhibit a limited mutational load, with prevalent <i>GTF2I</i> and <i>HRAS</i> mutations. On the other hand, thymic carcinomas (TCs) exhibit an elevated mutational burden, marked by frequent mutations in <i>TP53</i> and genes associated with epigenetic regulation. Moreover, signaling pathway analyses highlight dysregulation in crucial cellular functions and pathways. Targeted therapies, and ongoing clinical trials show promising results, addressing challenges rooted in the scarcity of actionable mutations and limited genomic understanding. International collaborations and data-sharing initiatives are crucial for breakthroughs in TETs research.

HFE
Also flagged:VinorelbineSorafenibHepatocellular Carcinomacancertumorstumor
Journal Article 2024-01-26 ✓ 1 Snippet Ng WH, Soo KC, Huynh H.
In-Text Gene Mentions

…liver disease (NAFLD),hemochromatosis, obesity, metabolic syndrome,…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a leading global cause of cancer-related mortality. Despite the widespread adoption of sorafenib as the standard HCC treatment, its efficacy is constrained, frequently encountering resistance. To augment the effectiveness of sorafenib, this study investigated the synergy of sorafenib and vinorelbine using 22 HCC patient-derived xenograft (PDX) models. In this study, mice bearing HCC tumors were treated with the vehicle, sorafenib (15 mg/kg), vinorelbine (3 mg/kg), and sorafenib-vinorelbine combination (Sora/Vino). Rigorous monitoring of the tumor growth and side effects coupled with comprehensive histological and molecular analyses was conducted. The overall survival (OS) of mice bearing HCC orthotopic tumors was also assessed. Our data showed a notable 86.4% response rate to Sora/Vino, surpassing rates of 31.8% for sorafenib and 9.1% for vinorelbine monotherapies. Sora/Vino significantly inhibited tumor growth, prolonged OS of mice bearing HCC orthotopic tumors (<i>p</i> < 0.01), attenuated tumor cell proliferation and angiogenesis, and enhanced necrosis and apoptosis. The combination therapy effectively suppressed the focal adhesion kinase (FAK) pathway, which is a pivotal player in cell proliferation, tumor angiogenesis, survival, and metastasis. The noteworthy antitumor activity in 22 HCC PDX models positions Sora/Vino as a promising candidate for early-phase clinical trials, leveraging the established use of sorafenib and vinorelbine in HCC and other cancers.

Also flagged:lectinMannose-binding lectinMBLMBL-associated serine proteasesMBL-associated proteinsserine protease
Journal Article 2024-01-26 No Snippets Dobó J, Kocsis A, Farkas B, Demeter F, Cervenak L, Gál P.
Show Full Abstract

The complement system is the other major proteolytic cascade in the blood of vertebrates besides the coagulation-fibrinolytic system. Among the three main activation routes of complement, the lectin pathway (LP) has been discovered the latest, and it is still the subject of intense research. Mannose-binding lectin (MBL), other collectins, and ficolins are collectively termed as the pattern recognition molecules (PRMs) of the LP, and they are responsible for targeting LP activation to molecular patterns, e.g., on bacteria. MBL-associated serine proteases (MASPs) are the effectors, while MBL-associated proteins (MAps) have regulatory functions. Two serine protease components, MASP-1 and MASP-2, trigger the LP activation, while the third component, MASP-3, is involved in the function of the alternative pathway (AP) of complement. Besides their functions within the complement system, certain LP components have secondary ("moonlighting") functions, e.g., in embryonic development. They also contribute to blood coagulation, and some might have tumor suppressing roles. Uncontrolled complement activation can contribute to the progression of many diseases (e.g., stroke, kidney diseases, thrombotic complications, and COVID-19). In most cases, the lectin pathway has also been implicated. In this review, we summarize the history of the lectin pathway, introduce their components, describe its activation and regulation, its roles within the complement cascade, its connections to blood coagulation, and its direct cellular effects. Special emphasis is placed on disease connections and the non-canonical functions of LP components.

POU3F2
Also flagged:TGF-βcell-surfacegastrulationCD34Sox2Klf4
Journal Article 2024-01-26 ✓ 1 Snippet Warin J, Vedrenne N, Tam V, Zhu M, Yin D, Lin X, Guidoux-D'halluin B, Humeau A, Roseiro L, Paillat L, Chédeville C, Chariau C, Riemers F, Templin M, Guicheux J, Tryfonidou MA, Ho JWK, David L, Chan D, Camus A.
In-Text Gene Mentions

…DEG: NEUROD4, NEUROG2,POU3F2, TUBB3 ).…

Show Full Abstract

Understanding the emergence of human notochordal cells (NC) is essential for the development of regenerative approaches. We present a comprehensive investigation into the specification and generation of <i>bona fide</i> NC using a straightforward pluripotent stem cell (PSC)-based system benchmarked with human fetal notochord. By integrating <i>in vitro</i> and <i>in vivo</i> transcriptomic data at single-cell resolution, we establish an extended molecular signature and overcome the limitations associated with studying human notochordal lineage at early developmental stages. We show that TGF-β inhibition enhances the yield and homogeneity of notochordal lineage commitment <i>in vitro</i>. Furthermore, this study characterizes regulators of cell-fate decision and matrisome enriched in the notochordal niche. Importantly, we identify specific cell-surface markers opening avenues for differentiation refinement, NC purification, and functional studies. Altogether, this study provides a human notochord transcriptomic reference that will serve as a resource for notochord identification in human systems, diseased-tissues modeling, and facilitating future biomedical research.

HFE
Also flagged:Chronic Liver DiseaseAcute on Chronic Liver Failurehepatocellular carcinomaacute liver failureacute-on-chronic liver failureviral hepatitis
Journal Article 2024-01-26 ✓ 1 Snippet Choudhury A, Adali G, Kaewdech A, Giri S, Kumar R.
In-Text Gene Mentions

Hemochromatosis

Show Full Abstract

Liver transplantation (LT) is the second most common solid organ transplantation worldwide. LT is considered the best and most definitive therapeutic option for patients with decompensated chronic liver disease (CLD), hepatocellular carcinoma (HCC), acute liver failure (ALF), and acute-on-chronic liver failure (ACLF). The etiology of CLD shows wide geographical variation, with viral hepatitis being the major etiology in the east and alcohol-related liver disease (ALD) in the west. Non-alcoholic fatty liver disease (NAFLD) is on an increasing trend and is expected to be the most common etiology on a global scale. Since the first successful LT, there have been radical changes in the indications for LT. In many circumstances, not just the liver disease itself but factors such as extra-hepatic organ dysfunction or failures necessitate LT. ACLF is a dynamic syndrome that has extremely high short-term mortality. Currently, there is no single approved therapy for ACLF, and LT seems to be the only feasible therapeutic option for selected patients at high risk of mortality. Early identification of ACLF, stratification of patients according to disease severity, aggressive organ support, and etiology-specific treatment approaches have a significant impact on post-transplant outcomes. This review briefly describes the indications, timing, and referral practices for LT in patients with CLD and ACLF.

Also flagged:ABC transporterABCC6ectonucleotidasesENPP1CD73pyrophosphate
Journal Article 2024-01-26 No Snippets Kauffenstein G, Martin L, Le Saux O.
Show Full Abstract

Pseudoxanthoma Elasticum (PXE) is an inherited disease characterized by elastic fiber calcification in the eyes, the skin and the cardiovascular system. PXE results from mutations in <i>ABCC6</i> that encodes an ABC transporter primarily expressed in the liver and kidneys. It took nearly 15 years after identifying the gene to better understand the etiology of PXE. ABCC6 function facilitates the efflux of ATP, which is sequentially hydrolyzed by the ectonucleotidases ENPP1 and CD73 into pyrophosphate (PPi) and adenosine, both inhibitors of calcification. PXE, together with General Arterial Calcification of Infancy (GACI caused by <i>ENPP1</i> mutations) as well as Calcification of Joints and Arteries (CALJA caused by <i>NT5E</i>/CD73 mutations), forms a disease continuum with overlapping phenotypes and shares steps of the same molecular pathway. The explanation of these phenotypes place ABCC6 as an upstream regulator of a purinergic pathway (ABCC6 → ENPP1 → CD73 → TNAP) that notably inhibits mineralization by maintaining a physiological Pi/PPi ratio in connective tissues. Based on a review of the literature and our recent experimental data, we suggest that PXE (and GACI/CALJA) be considered as an authentic "purinergic disease". In this article, we recapitulate the pathobiology of PXE and review molecular and physiological data showing that, beyond PPi deficiency and ectopic calcification, PXE is associated with wide and complex alterations of purinergic systems. Finally, we speculate on the future prospects regarding purinergic signaling and other aspects of this disease.

MLLT10
Also flagged:PolymeraseAcute LeukemiaMalignant diseasesacute myeloid leukemiatumorMalignancies
Journal Article 2024-01-26 ✓ 5 Snippets Erdoğdu İH, Örenay-Boyacıoğlu S, Boyacıoğlu O, Kahraman-Çetin N, Kacar-Döger F, Yavaşoğlu İ, Bolaman AZ.
In-Text Gene Mentions

Gene fusions observed in AML cases in the elderly group are RUNX1::RUNX1T1 (10.52%), CBFB::MYH11 (9.47%), PML::RARA (7.36%), SET::NUP214 (3.2%), STIL::TAL1 (3.2%), MLL::AFF1 (3.2%), MLL::MLLT10 (3.2%), and BCR::ABL1 (1.25%).

The MLL::AFF1, SET::NUP214, STIL::TAL1, and MLL::MLLT10 fusions were each detected in 25% of ALL patients.

Again in the current study, the most common fusions in AML cases in the elderly group were RUNX1::RUNX1T1, CBFB::MYH11, PML::RARA, BCR::ABL1, SET::NUP214, STIL::TAL1, MLL::AFF1, and MLL::MLLT10.

…5%), MLL::MLLT3 (1.25%), MLL::MLLT10(1.25%), and BCR::ABL1…

…, STIL::TAL1 , MLL::MLLT10, and MLL::ELL…

Show Full Abstract

Malignant diseases occurring in elderly patients follow a different course from younger patients and show different genetic structures. Therefore, in this retrospective study, the somatic gene variant profile and fusion gene profiles of elderly and young acute leukemia patients were determined to draw attention to the existing genetic difference, and the results were compared. In this study, the records of 204 acute leukemia patients aged 18+ who were referred to the Molecular Pathology Laboratory from the Hematology Clinic between 2018 and 2022 were reviewed retrospectively. Fusion gene detection in patients was performed with the HemaVision<sup>®</sup>-28Q Panel. The NGS Myeloid Neoplasms Panel was conducted using the MiniSEQ NGS platform according to the manufacturer's protocol. When all cases are evaluated together, the most frequently diagnosed acute leukemia is acute myeloid leukemia (85.8%). Both groups had a similar fusion gene profile; however, the fusion burden was higher in the elderly group. When the groups were evaluated in terms of somatic gene variations, there were differences between the groups, and the variation load was higher in the elderly group. Considering the different somatic gene variation profiles, it is understood that the genetic structure of tumor cells is different in elderly patients compared to young cases.

Also flagged:autophagydegradationSQSTM1p62membranousorganelle
Journal Article 2024-01-25 No Snippets Kurusu R, Morishita H, Komatsu M.
Show Full Abstract

SQSTM1/p62 bodies are phase-separated condensates that play a fundamental role in intracellular quality control and stress responses. Despite extensive studies investigating the mechanism of formation and degradation of SQSTM1/p62 bodies, the constituents of SQSTM1/p62 bodies remain elusive. We recently developed a purification method for intracellular SQSTM1/p62 bodies using a cell sorter and identified their constituents by mass spectrometry. Combined with mass spectrometry of tissues from selective autophagy-deficient mice, we identified vault, a ubiquitous non-membranous organelle composed of proteins and non-coding RNA, as a novel substrate for selective autophagy. Vault directly binds to NBR1, an SQSTM1/p62 binding partner recruited to SQSTM1/p62 bodies, and is subsequently degraded by selective autophagy dependent on the phase separation of SQSTM1/p62. We named this process "vault-phagy" and found that defects in vault-phagy are related to nonalcoholic steatohepatitis (NASH)-derived hepatocellular carcinoma. Our method for purifying SQSTM1/p62 bodies will contribute to elucidating the mechanisms of several stress responses and diseases mediated by SQSTM1/p62 bodies.

HTT
Also flagged:chaperoneautophagylysosomesTARDBPTDP-43TAR DNA binding protein
Journal Article 2024-01-25 ✓ 4 Snippets Grochowska KM, Kreutz MR.
In-Text Gene Mentions

Finally, we could show that LAMP2B-DLG3/SAP102 binding of dendritic lysosomes mediates activity-dependent lysosomal exocytosis of two disease-relevant CMA clients: TARDBP and HTT, whose mutation results in Huntington disease (Figure 1).

…binding protein) andHTT(huntingtin).…

…like TARDBP andHTT.…

…clients: TARDBP andHTT, whose mutation results…

Show Full Abstract

The neuronal metastable proteome includes several aggregation-prone proteins related to neurodegeneration. The complex morphology of neurons with very thin processes and enhanced protein turnover therefore necessitates efficient local machinery to remove excessive protein. In recent work we revealed that chaperone-mediated autophagy (CMA) provides cargo for dendritic exocytic lysosomes, a mechanism that serves in the rapid removal of disease-relevant, supersaturated proteins such as TARDBP/TDP-43 (TAR DNA binding protein) and HTT (huntingtin). We found that lysosomal exocytosis requires docking of the lysosomal protein LAMP2B to the glutamatergic receptor scaffold DLG3/SAP102 and that it is regulated by GRIN/NMDA (N-methyl-D-aspartate)-receptor activity. Thus, the small caliber of dendritic processes might impose a need for local disposal of aggregation-prone proteins like TARDBP and HTT. Moreover, we observed that lysosomal exocytosis might serve in both protein removal and modulation of synaptic processes, and the latter might be an inevitable consequence of the necessity for local disposal of CMA clients in dendrites.

FBXL4
Also flagged:BNIP3BNIP3Lmitophagypathogenesismitochondriamitochondrial
Journal Article 2024-01-25 ✓ 5 Snippets Gao K, Chen Y, Mo R, Wang C.
In-Text Gene Mentions

FBXL4 mutations, which affect the substrate-binding adaptor of the CUL1 (cullin 1)-RING ubiquitin ligase complex (CRL1), have been linked to mitochondrial DNA depletion syndrome type 13 (MTDPS13) characterized by reduced mtDNA content and impaired energy production in affected organs.

Excessive BNIP3- and BNIP3L-dependent mitophagy underlies the pathogenesis of FBXL4-mutated mitochondrial DNA depletion syndrome.

These findings support the model that the CRL1-FBXL4 complex tightly restricts basal mitophagy, and its dysregulation leads to severe symptoms of MTDPS13.

…the pathogenesis ofFBXL4-mutated mitochondrial DNA dep…

FBXL4mutations, which affect…

Show Full Abstract

Mitophagy, the process of removing damaged mitochondria to promote cell survival, plays a crucial role in cellular functionality. However, excessive, or uncontrolled mitophagy can lead to reduced mitochondrial content that burdens the remaining organelles, triggering mitophagy-mediated cell death. FBXL4 mutations, which affect the substrate-binding adaptor of the CUL1 (cullin 1)-RING ubiquitin ligase complex (CRL1), have been linked to mitochondrial DNA depletion syndrome type 13 (MTDPS13) characterized by reduced mtDNA content and impaired energy production in affected organs. However, the mechanism behind FBXL4 mutation-driven MTDPS13 remain poorly understood. In a recent study, we demonstrate that the CRL1-FBXL4 complex promotes the degradation of BNIP3 and BNIP3L, two key mitophagy cargo receptors. Deficiency of FBXL4 results in a strong accumulation of BNIP3 and BNIP3L proteins and triggers high levels of BNIP3- and BNIP3L-dependent mitophagy. Patient-derived FBXL4 mutations do not affect its interaction with BNIP3 and BNIP3L but impair the assembly of an active CRL1-FBXL4 complex. Furthermore, excessive mitophagy is observed in knockin mice carrying a patient-derived FBXL4 mutation, and in cortical neurons generated from human patient induced pluripotent stem cells (hiPSCs). These findings support the model that the CRL1-FBXL4 complex tightly restricts basal mitophagy, and its dysregulation leads to severe symptoms of MTDPS13.

NEGR1SOX6
Also flagged:wound-healingasbestospleural mesotheliomacancerEpithelioid mesotheliomapleural cancer
Journal Article 2024-01-25 ✓ 5 Snippets Obacz J, Valer JA, Nibhani R, Adams TS, Schupp JC, Veale N, Lewis-Wade A, Flint J, Hogan J, Aresu G, Coonar AS, Peryt A, Biffi G, Kaminski N, Francies H, Rassl DM, Garnett MJ, Rintoul RC, Marciniak SJ.
In-Text Gene Mentions

This is consistent with the previous detection of SOX6 in mesothelioma cells in the pleura, peritoneum and tunica vaginalis [25–27].

…( LAMA2 ),neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1), complement C7…

…transcription factor 6 (SOX6) regulon activity than…

…scRNA-seq atlas confirmedSOX6was expressed more…

Show Full Abstract

The pleural lining of the thorax regulates local immunity, inflammation and repair. A variety of conditions, both benign and malignant, including pleural mesothelioma, can affect this tissue. A lack of knowledge concerning the mesothelial and stromal cells comprising the pleura has hampered the development of targeted therapies. Here, we present the first comprehensive single-cell transcriptomic atlas of the human parietal pleura and demonstrate its utility in elucidating pleural biology. We confirm the presence of known universal fibroblasts and describe novel, potentially pleural-specific, fibroblast subtypes. We also present transcriptomic characterisation of multiple <i>in vitro</i> models of benign and malignant mesothelial cells, and characterise these through comparison with <i>in vivo</i> transcriptomic data. While bulk pleural transcriptomes have been reported previously, this is the first study to provide resolution at the single-cell level. We expect our pleural cell atlas will prove invaluable to those studying pleural biology and disease. It has already enabled us to shed light on the transdifferentiation of mesothelial cells, allowing us to develop a simple method for prolonging mesothelial cell differentiation <i>in vitro</i>.

OLFM4
Also flagged:tissue homeostasisleucine-rich repeat-containing G protein-coupled receptor 5LGR5lumendeathWnt
Journal Article 2024-01-25 ✓ 1 Snippet Oh SJ, Seo Y, Kim HS.
In-Text Gene Mentions

…11 ) andOlfm4, one of the…

Show Full Abstract

Tissue-specific adult stem cells are pivotal in maintaining tissue homeostasis, especially in the rapidly renewing intestinal epithelium. At the heart of this process are leucine-rich repeat-containing G protein-coupled receptor 5-expressing crypt base columnar cells (CBCs) that differentiate into various intestinal epithelial cells. However, while these CBCs are vital for tissue turnover, they are vulnerable to cytotoxic agents. Recent advances indicate that alternative stem cell sources drive the epithelial regeneration post-injury. Techniques like lineage tracing and single-cell RNA sequencing, combined with <i>in vitro</i> organoid systems, highlight the remarkable cellular adaptability of the intestinal epithelium during repair. These regenerative responses are mediated by the reactivation of conserved stem cells, predominantly quiescent stem cells and revival stem cells. With focus on these cells, this review unpacks underlying mechanisms governing intestinal regeneration and explores their potential clinical applications.

PTGIS
Also flagged:Prostanoidsarachidonic acidbiosynthesisCOXmyocardial infarctionstroke
Journal Article 2024-01-25 ✓ 1 Snippet Ricciotti E, Haines PG, Chai W, FitzGerald GA.
In-Text Gene Mentions

PTGIS

Show Full Abstract

Prostanoids are biologically active lipids generated from arachidonic acid by the action of the COX (cyclooxygenase) isozymes. NSAIDs, which reduce the biosynthesis of prostanoids by inhibiting COX activity, are effective anti-inflammatory, antipyretic, and analgesic drugs. However, their use is limited by cardiovascular adverse effects, including myocardial infarction, stroke, hypertension, and heart failure. While it is well established that NSAIDs increase the risk of atherothrombotic events and hypertension by suppressing vasoprotective prostanoids, less is known about the link between NSAIDs and heart failure risk. Current evidence indicates that NSAIDs may increase the risk for heart failure by promoting adverse myocardial and vascular remodeling. Indeed, prostanoids play an important role in modulating structural and functional changes occurring in the myocardium and in the vasculature in response to physiological and pathological stimuli. This review will summarize current knowledge of the role of the different prostanoids in myocardial and vascular remodeling and explore how maladaptive remodeling can be counteracted by targeting specific prostanoids.

SOX6
Also flagged:TP53tumorcancersuppressorp53cell homeostasis
Journal Article 2024-01-25 ✓ 1 Snippet Zhu KL, Su F, Yang JR, Xiao RW, Wu RY, Cao MY, Ling XL, Zhang T.
In-Text Gene Mentions

…miR-18a by targetingSOX6to activate the…

Show Full Abstract

Increasing evidence suggests that key cancer-causing driver genes continue to exert a sustained influence on the tumor microenvironment (TME), highlighting the importance of immunotherapeutic targeting of gene mutations in governing tumor progression. TP53 is a prominent tumor suppressor that encodes the p53 protein, which controls the initiation and progression of different tumor types. Wild-type p53 maintains cell homeostasis and genomic instability through complex pathways, and mutant p53 (Mut p53) promotes tumor occurrence and development by regulating the TME. To date, it has been wildly considered that TP53 is able to mediate tumor immune escape. Herein, we summarized the relationship between TP53 gene and tumors, discussed the mechanism of Mut p53 mediated tumor immune escape, and summarized the progress of applying p53 protein in immunotherapy. This study will provide a basic basis for further exploration of therapeutic strategies targeting p53 protein.

Also flagged:CancerdeathGlioblastoma multiformeGBMtumour of the brainflavonoid
Journal Article 2024-01-25 No Snippets Ahmed SHH, Tayeb BA, Gonda T, Girst G, Szőri K, Berkecz R, Zupkó I, Minorics R, Hunyadi A.
Show Full Abstract

We describe herein the synthesis of eight new ester-coupled hybrid compounds from thymoquinone and protoflavone building blocks, and their bioactivity testing against multiple cancer cell lines. Among the hybrids, compound 14 showed promising activities in all cell lines studied. The highest activities were recorded against breast cancer cell lines with higher selectivity to MDA-MB-231 as compared to MCF-7. Even though the hybrids were found to be completely hydrolysed in 24 h under cell culture conditions, compound 14 demonstrated a ca. three times stronger activity against U-87 glioblastoma cells than a 1:1 mixture of its fragments. Further, compound 14 showed good tumour selectivity: it acted 4.4-times stronger on U-87 cells than on MRC-5 fibroblasts. This selectivity was much lower, only ca. 1.3-times, when the cells were co-treated with a 1:1 mixture of its non-coupled fragments. Protoflavone-thymoquinone hybrids may therefore serve as potential new antitumor leads particularly against glioblastoma.

STAU1
Also flagged:hemagglutininHAFKBP12bindingbiotinylationDBP
Journal Article 2024-01-25 ✓ 3 Snippets Islam S, Gour J, Beer T, Tang HY, Cassel J, Salvino JM, Busino L.
In-Text Gene Mentions

… Sciences, A300-710A-T), anti-STAU1(Fortis Life Sciences,…

…interacted with NCL,STAU1, and RPL7A, even…

…to PARP2, NCL,STAU1, and RPL7A (…

Show Full Abstract

In the field of drug discovery, understanding how small molecule drugs interact with cellular components is crucial. Our study introduces a novel methodology to uncover primary drug targets using <u>T</u>andem <u>A</u>ffinity <u>P</u>urification for identification of <u>D</u>rug-<u>B</u>inding <u>P</u>roteins (TAP-DBP). Central to our approach is the generation of a FLAG-hemagglutinin (HA)-tagged chimeric protein featuring the FKBP12(F36V) adaptor protein and the TurboID enzyme. Conjugation of drug molecules with the FKBP12(F36V) ligand allows for the coordinated recruitment of drug-binding partners effectively enabling in-cell TurboID-mediated biotinylation. By employing a tandem affinity purification protocol based on FLAG-immunoprecipitation and streptavidin pulldown, alongside mass spectrometry analysis, TAP-DBP allows for the precise identification of drug-primary binding partners. Overall, this study introduces a systematic, unbiased method for identification of drug-protein interactions, contributing a clear understanding of target engagement and drug selectivity to advance the mode of action of a drug in cells.

HFE
Also flagged:IronSBSinsulindiabetes mellitusshort bowel syndromeinflammatory disease
Journal Article 2024-01-25 ✓ 1 Snippet Shimodaira Y, Fukuda S, Takahashi S, Iijima K.
In-Text Gene Mentions

…mellitus due tohemochromatosis, and intravenous iron…

Show Full Abstract

Crohn's disease patients often need regular home parenteral nutrition (HPN) for intestinal failure due to multiple intestinal resections. Trace elements are necessary for long-term HPN but the requirement volume of iron is undetermined. We describe three patients with Crohn's disease with short bowel syndrome (SBS) who had iron overload as a result of long-term HPN including iron. Serum ferritin level was significantly decreased through depleting intravenous iron administration in all cases. One patient needed regular insulin injection and phlebotomy for diabetes mellitus due to hemochromatosis, and intravenous iron administration had a significant impact on the patient's health. Long-term routine intravenous iron administration should be cautious in SBS patients to avoid the overload.

SOX6
Also flagged:methylationbrain disorderspathogenesisgene expressionglial cell activationNuclei
Journal Article 2024-01-25 ✓ 2 Snippets Hannon E, Dempster EL, Davies JP, Chioza B, Blake GET, Burrage J, Policicchio S, Franklin A, Walker EM, Bamford RA, Schalkwyk LC, Mill J.
In-Text Gene Mentions

…an antibody againstSOX6[ 39 ]…

…use of theSOX6antibody, which is…

Show Full Abstract

<h4>Background</h4>Due to interindividual variation in the cellular composition of the human cortex, it is essential that covariates that capture these differences are included in epigenome-wide association studies using bulk tissue. As experimentally derived cell counts are often unavailable, computational solutions have been adopted to estimate the proportion of different cell types using DNA methylation data. Here, we validate and profile the use of an expanded reference DNA methylation dataset incorporating two neuronal and three glial cell subtypes for quantifying the cellular composition of the human cortex.<h4>Results</h4>We tested eight reference panels containing different combinations of neuronal- and glial cell types and characterised their performance in deconvoluting cell proportions from computationally reconstructed or empirically derived human cortex DNA methylation data. Our analyses demonstrate that while these novel brain deconvolution models produce accurate estimates of cellular proportions from profiles generated on postnatal human cortex samples, they are not appropriate for the use in prenatal cortex or cerebellum tissue samples. Applying our models to an extensive collection of empirical datasets, we show that glial cells are twice as abundant as neuronal cells in the human cortex and identify significant associations between increased Alzheimer's disease neuropathology and the proportion of specific cell types including a decrease in NeuNNeg/SOX10Neg nuclei and an increase of NeuNNeg/SOX10Pos nuclei.<h4>Conclusions</h4>Our novel deconvolution models produce accurate estimates for cell proportions in the human cortex. These models are available as a resource to the community enabling the control of cellular heterogeneity in epigenetic studies of brain disorders performed on bulk cortex tissue.

TNFSF4
Also flagged:FUT8kidney renal clear cell cancerurological cancercancerCFimmune responses
Journal Article 2024-01-25 ✓ 1 Snippet Xin Z, Wen X, Zhou M, Lin H, Liu J.
In-Text Gene Mentions

…ICGs (i.e., TNFRSF9,TNFSF4, TNFSF14, BTLA, CD44,…

Show Full Abstract

<h4>Background</h4>Kidney renal clear cell cancer (KIRC) is a type of urological cancer that occurs worldwide. Core fucosylation (CF), as the most common post-translational modification, is involved in the tumorigenesis.<h4>Methods</h4>The alterations of CF-related genes were summarized in pan-cancer. The "ConsensusClusterPlus" package was utilized to identify two CF-related KIRC subtypes. The "ssgsea" function was chosen to estimate the CF score, signaling pathways and cell deaths. Multiple algorithms were applied to assess immune responses. The "oncoPredict" was utilized to estimate the drug sensitivity. The IHC and subgroup analysis was performed to reveal the molecular features of FUT8. Single-cell RNA sequencing (scRNA-seq) data were scrutinized to evaluate the CF state.<h4>Results</h4>In pan-cancer, there was a noticeable alteration in the expression of CF-related genes. In KIRC, two CF-related subtypes (i.e., C1, C2) were obtained. In comparison to C2, C1 exhibited a higher CF score and correlated with poorer overall survival. Additionally, the TME of C2 demonstrated increased activity in neutrophils, macrophages, myeloid dendritic cells, and B cells, alongside a higher presence of silent mast cells, NK cells, and endothelial cells. Compared to normal samples, higher expression of FUT8 is observed in KIRC. The mutation of SETD2 was more frequent in low-FUT8 samples while the mutation of DNAH9 was more frequent in high-FUT8 samples. scRNA-seq analyses revealed that the CF score was predominantly higher in endothelial cells and fibroblast cells.<h4>Conclusions</h4>Two CF-related subtypes with distinct prognosis and TME were identified in KIRC. FUT8 exhibited elevated expression in KIRC samples.

FBXL4
Also flagged:FBXO38lysosomeSTINGF-box only protein 38proteasomedegradation
Journal Article 2024-01-25 ✓ 1 Snippet Wu Y, Lin Y, Shen F, Huang R, Zhang Z, Zhou M, Fang Y, Shen J, Fan X.
In-Text Gene Mentions

…Deficiency inFBXL4reduced steady-state levels…

Show Full Abstract

F-box only protein 38 (FBXO38) is a member of the F-box family that mediates the ubiquitination and proteasome degradation of programmed death 1 (PD-1), and thus has important effects on T cell-related immunity. While its powerful role in adaptive immunity has attracted much attention, its regulatory roles in innate immune pathways remain unknown. The cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway is an important innate immune pathway that regulates type I interferons. STING protein is the core component of this pathway. In this study, we identified that FBXO38 deficiency enhanced tumor proliferation and reduced tumor CD8<sup>+</sup> T cells infiltration. Loss of FBXO38 resulted in reduced STING protein levels in vitro and in vivo, further leading to preventing cGAS-STING pathway activation, and decreased downstream product IFNA1 and CCL5. The mechanism of reduced STING protein was associated with lysosome-mediated degradation rather than proteasomal function. Our results demonstrate a critical role for FBXO38 in the cGAS-STING pathway.

TNFSF4
Also flagged:InosinetumorCD39CD73Ado deaminaseADA
Journal Article 2024-01-25 ✓ 1 Snippet Klysz DD, Fowler C, Malipatlolla M, Stuani L, Freitas KA, Chen Y, Meier S, Daniel B, Sandor K, Xu P, Huang J, Labanieh L, Keerthi V, Leruste A, Bashti M, Mata-Alcazar J, Gkitsas N, Guerrero JA, Fisher C, Patel S, Asano K, Patel S, Davis KL, Satpathy AT, Feldman SA, Sotillo E, Mackall CL.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Adenosine (Ado) mediates immune suppression in the tumor microenvironment and exhausted CD8<sup>+</sup> CAR-T cells express CD39 and CD73, which mediate proximal steps in Ado generation. Here, we sought to enhance CAR-T cell potency by knocking out CD39, CD73, or adenosine receptor 2a (A2aR) but observed only modest effects. In contrast, overexpression of Ado deaminase (ADA-OE), which metabolizes Ado to inosine (INO), induced stemness and enhanced CAR-T functionality. Similarly, CAR-T cell exposure to INO augmented function and induced features of stemness. INO induced profound metabolic reprogramming, diminishing glycolysis, increasing mitochondrial and glycolytic capacity, glutaminolysis and polyamine synthesis, and reprogrammed the epigenome toward greater stemness. Clinical scale manufacturing using INO generated enhanced potency CAR-T cell products meeting criteria for clinical dosing. These results identify INO as a potent modulator of CAR-T cell metabolism and epigenetic stemness programming and deliver an enhanced potency platform for cell manufacturing.

VRK2
Also flagged:kinasekinasesglioblastomareceptor tyrosine kinaseMEKMAPK
Journal Article 2024-01-25 ✓ 1 Snippet McFaline-Figueroa JL, Srivatsan S, Hill AJ, Gasperini M, Jackson DL, Saunders L, Domcke S, Regalado SG, Lazarchuck P, Alvarez S, Monnat RJ, Shendure J, Trapnell C.
In-Text Gene Mentions

…, VRK1 ,VRK2), ribosome maturation…

Show Full Abstract

Chemical genetic screens are a powerful tool for exploring how cancer cells' response to drugs is shaped by their mutations, yet they lack a molecular view of the contribution of individual genes to the response to exposure. Here, we present sci-Plex-Gene-by-Environment (sci-Plex-GxE), a platform for combined single-cell genetic and chemical screening at scale. We highlight the advantages of large-scale, unbiased screening by defining the contribution of each of 522 human kinases to the response of glioblastoma to different drugs designed to abrogate signaling from the receptor tyrosine kinase pathway. In total, we probed 14,121 gene-by-environment combinations across 1,052,205 single-cell transcriptomes. We identify an expression signature characteristic of compensatory adaptive signaling regulated in a MEK/MAPK-dependent manner. Further analyses aimed at preventing adaptation revealed promising combination therapies, including dual MEK and CDC7/CDK9 or nuclear factor κB (NF-κB) inhibitors, as potent means of preventing transcriptional adaptation of glioblastoma to targeted therapy.

HFE
Also flagged:Liver SteatosisNonalcoholic Fatty Liver DiseaseNAFLDsteatosisliver disordersteatohepatitis
Journal Article 2024-01-25 ✓ 1 Snippet Zanini B, Benini F, Marullo M, Simonetto A, Rossi A, Cavagnoli P, Bonalumi A, Marconi S, Pigozzi MG, Gilioli G, Valerio A, Donato F, Castellano M, Ricci C.
In-Text Gene Mentions

…hepatitis virus infection,hemochromatosis, and others).…

Show Full Abstract

<h4>Results</h4>One hundred and fifty five subjects aged 20-59 years underwent (i) liver ultrasound (US), (ii) clinical and anthropometric evaluations, (iii) blood tests, and (iv) assessment of dietary habits. According to US evaluation, 73 of them had severe, moderate, or mild liver steatosis (NAFLD patients) and 82 had no liver steatosis (healthy controls). Fifty-eight NAFLD patients and 73 controls completed the study. Among NAFLD patients, 26 (45%) downgraded steatosis severity, 12 of which achieved complete steatosis regression (21%). Three of the healthy controls developed NAFLD. The NAFLD patients improved their dietary habits and reduced BMI and waist circumference, during the study period, more than healthy controls. Liver steatosis remission/regression was independent of changes in BMI or liver enzymes and was more frequent among patients with mild steatosis at baseline.<h4>Conclusions</h4>Mediterranean dietary advices, without a personalised meal planning, were efficient in reducing/remitting NAFLD, especially among patients with mild disease, which argues in favour of early identification and lifestyle intervention. This trial is registered with NCT03300661.

HFE
Also flagged:AtorvastatinNonalcoholic Fatty Liver DiseaseNon-alcoholic fatty liver diseaseNAFLDobesityinsulin resistance
Journal Article 2024-01-25 ✓ 1 Snippet Eslami Z, Aghili SS, Ghafi AG.
In-Text Gene Mentions

…indication of alcoholism,hemochromatosis, Wilson disease, viral…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) is a condition in which excess fat builds up in the liver, often related to obesity and insulin resistance, which can lead to inflammation and scarring of the liver tissue. While efforts have been made to develop effective treatments for NAFLD, the need for pharmaceutical interventions remains unmet. Large clinical trials investigating the association between statin use and NAFLD are scarce, leading to contradictory results. Statins play a crucial role in cholesterol synthesis in the liver. Several studies have demonstrated that statins possess anti-inflammatory, anti-thrombotic, and anti-fibrotic properties. These properties make statins potentially useful in preventing the progression of NAFLD from simple steatosis to more severe forms like non-alcoholic steatohepatitis (NASH) and fibrosis. The results indicate that statin use is associated with a lower prevalence of NASH and fibrosis and may have a preventive effect on NAFLD.

STAU1
Also flagged:DExH-box helicase 9synapsesDHX9nucleuscytoplasmperipheral nerve injury
Journal Article 2024-01-25 ✓ 4 Snippets Yang L, Liu Q, Zhao Y, Lin N, Huang Y, Wang Q, Yang K, Wei R, Li X, Zhang M, Hao L, Wang H, Pan Z.
In-Text Gene Mentions

…sc-101048, Santa Cruz),STAU1(1:100, sc-390820, Santa…

…The antibody DHX9,STAU1and FRMP were…

…binding protein 1 (STAU1), which represses dendritic…

…or DHX9 andSTAU1( Figure 1…

Show Full Abstract

Experimental studies have shown that neuropathic pain impairs hippocampal synaptic plasticity. Here, we sought to determine the underlying mechanisms responsible for synaptic changes in neuropathic painful mouse hippocampal neurons. Beyond demonstrating proof-of-concept for the location of DExH-box helicase 9 (DHX9) in the nucleus, we found that it did exist in the cytoplasm and DHX9 depletion resulted in structural and functional changes at synapses in the hippocampus. A decrease of DHX9 was observed in the hippocampus after peripheral nerve injury; overexpression of DHX9 in the hippocampus significantly alleviated the nociceptive responses and improved anxiety behaviors. Mimicking DHX9 decrease evoked spontaneous pain behavioral symptoms and anxiety emotion in naïve mice. Mechanistically, we found that DHX9 bound to <i>dendrin</i> (<i>Ddn</i>) mRNA, which may have altered the level of synaptic- and dendritic-associated proteins. The data suggest that DHX9 contributes to synapses in hippocampal neurons and may modulate neuropathic pain and its comorbidity aversive emotion.

Also flagged:GADD45neuropsychiatric disordersgrowth arrest and DNA damage inducible protein 45nuclearDNA demethylasesdemethylation
Journal Article 2024-01-25 No Snippets Huang M, Wang J, Liu W, Zhou H.
Show Full Abstract

The growth arrest and DNA damage inducible protein 45 (GADD45) family comprises stress-induced nuclear proteins that interact with DNA demethylases to facilitate DNA demethylation, thereby regulating diverse cellular processes including oxidative stress, DNA damage repair, apoptosis, proliferation, differentiation, inflammation, and neuroplasticity by modulating the expression patterns of specific genes. Widely expressed in the central nervous system, the GADD45 family plays a pivotal role in various neurological disorders, rendering it a potential therapeutic target for central nervous system diseases. This review presented a comprehensive overview of the expression patterns and potential mechanisms of action associated with each member of GADD45 family (GADD45α, GADD45β, and GADD45γ) in neurodevelopmental, neurodegenerative, and neuropsychiatric disorders, while also explored strategies to harness these mechanisms for intervention and treatment. Future research should prioritize the development of effective modulators targeting the GADD45 family for clinical trials aimed at treating central nervous system diseases.

OLFM4
Also flagged:SIRSSepsisabdominal sepsispulmonary sepsisgene expressionFAM20A
Journal Article 2024-01-25 ✓ 2 Snippets Szakmany T, Fitzgerald E, Garlant HN, Whitehouse T, Molnar T, Shah S, Tong DL, Hall JE, Ball GR, Kempsell KE.
In-Text Gene Mentions

Gene entities exhibiting stronger expression in the SIRS-ranked dataset included CFC1, CT62, lnc-DAAM2-1 and lnc-LTBP3-2 and in the sepsis-ranked dataset included TDRD9, DAAM2, OLFM4 and OLAH.

…included TDRD9, DAAM2,OLFM4and OLAH.…

Show Full Abstract

<h4>Introduction</h4>Early diagnosis of sepsis and discrimination from SIRS is crucial for clinicians to provide appropriate care, management and treatment to critically ill patients. We describe identification of mRNA biomarkers from peripheral blood leukocytes, able to identify severe, systemic inflammation (irrespective of origin) and differentiate Sepsis from SIRS, in adult patients within a multi-center clinical study.<h4>Methods</h4>Participants were recruited in Intensive Care Units (ICUs) from multiple UK hospitals, including fifty-nine patients with abdominal sepsis, eighty-four patients with pulmonary sepsis, forty-two SIRS patients with Out-of-Hospital Cardiac Arrest (OOHCA), sampled at four time points, in addition to thirty healthy control donors. Multiple clinical parameters were measured, including SOFA score, with many differences observed between SIRS and sepsis groups. Differential gene expression analyses were performed using microarray hybridization and data analyzed using a combination of parametric and non-parametric statistical tools.<h4>Results</h4>Nineteen high-performance, differentially expressed mRNA biomarkers were identified between control and combined SIRS/Sepsis groups (FC>20.0, p<0.05), termed 'indicators of inflammation' (I°I), including CD177, FAM20A and OLAH. Best-performing minimal signatures e.g. FAM20A/OLAH showed good accuracy for determination of severe, systemic inflammation (AUC>0.99). Twenty entities, termed 'SIRS or Sepsis' (S°S) biomarkers, were differentially expressed between sepsis and SIRS (FC>2·0, p-value<0.05).<h4>Discussion</h4>The best performing signature for discriminating sepsis from SIRS was CMTM5/CETP/PLA2G7/MIA/MPP3 (AUC=0.9758). The I°I and S°S signatures performed variably in other independent gene expression datasets, this may be due to technical variation in the study/assay platform.

TAOK3
Also flagged:Childhoodacute lymphoblastic leukemiaALLpediatric cancerETV6RUNX1
Journal Article 2024-01-25 ✓ 1 Snippet Gutierrez-Camino A, Caron M, Richer C, Fuchs C, Illarregi U, Poncelet L, St-Onge P, Bataille AR, Tremblay-Dauphinais P, Lopez-Lopez E, Camos M, Ramirez-Orellana M, Astigarraga I, Lécuyer É, Bourque G, Martin-Guerrero I, Sinnett D.
In-Text Gene Mentions

…genes: MAKP14 (p38),TAOK3, MAP3K1 ,…

Show Full Abstract

Childhood B-cell acute lymphoblastic leukemia (B-ALL) is a heterogeneous disease comprising multiple molecular subgroups with subtype-specific expression profiles. Recently, a new type of ncRNA, termed circular RNA (circRNA), has emerged as a promising biomarker in cancer, but little is known about their role in childhood B-ALL. Here, through RNA-seq analysis in 105 childhood B-ALL patients comprising six genetic subtypes and seven B-cell controls from two independent cohorts we demonstrated that circRNAs properly stratified B-ALL subtypes. By differential expression analysis of each subtype vs. controls, 156 overexpressed and 134 underexpressed circRNAs were identified consistently in at least one subtype, most of them with subtype-specific expression. <i>TCF3::PBX1</i> subtype was the one with the highest number of unique and overexpressed circRNAs, and the circRNA signature could effectively discriminate new patients with <i>TCF3::PBX1</i> subtype from others. Our results indicated that <i>NUDT21</i>, an RNA-binding protein (RBP) involved in circRNA biogenesis, may contribute to this circRNA enrichment in <i>TCF3::PBX1</i> ALL. Further functional characterization using the CRISPR-Cas13d system demonstrated that <i>circBARD1</i>, overexpressed in <i>TCF3::PBX1</i> patients and regulated by <i>NUDT21</i>, might be involved in leukemogenesis through the activation of p38 via <i>hsa-miR-153-5p</i>. Our results suggest that circRNAs could play a role in the pathogenesis of childhood B-ALL.

Also flagged:FluorideApatiteCollagenbasic fibroblast growth factorbFGFfluoride ions
Journal Article 2024-01-25 No Snippets Pal A, Oyane A, Nakamura M, Koga K, Nishida E, Miyaji H.
Show Full Abstract

Coating layers consisting of a crystalline apatite matrix with immobilized basic fibroblast growth factor (bFGF) can release bFGF, thereby enhancing bone regeneration depending on their bFGF content. We hypothesized that the incorporation of fluoride ions into apatite crystals would enable the tailored release of bFGF from the coating layer depending on the layer's fluoride content. In the present study, coating layers consisting of fluoride-incorporated apatite (FAp) crystals with immobilized bFGF were coated on a porous collagen sponge by a precursor-assisted biomimetic process using supersaturated calcium phosphate solutions with various fluoride concentrations. The fluoride content in the coating layer increased with the increasing fluoride concentration of the supersaturated solution. The increased fluoride content in the coating layer reduced its solubility and suppressed the burst release of bFGF from the coated sponge into a physiological salt solution. The bFGF release was caused by the partial dissolution of the coating layer and, thus, accompanied by the fluoride release. The concentrations of released bFGF and fluoride were controlled within the estimated effective ranges in enhancing bone regeneration. These findings provide useful design guidelines for the construction of a mineralized, bFGF-releasing collagen scaffold that would be beneficial for bone tissue engineering, although further in vitro and in vivo studies are warranted.

STAU1
Also flagged:nobiletinneurodegenerative disordersflavonoidsodium arsenateresponse to oxidative stressP53
Journal Article 2024-01-25 ✓ 1 Snippet Jahan S, Ansari UA, Srivastava AK, Aldosari S, Alabdallat NG, Siddiqui AJ, Khan A, Albadrani HM, Sarkar S, Khan B, Adnan M, Pant AB.
In-Text Gene Mentions

…oxidative stress (PRDX3,STAU1, GSR, PYCR1, ATP2A2,…

Show Full Abstract

Chemical-induced neurotoxicity is increasingly recognized to accelerate the development of neurodegenerative disorders (NDs), which pose an increasing health burden to society. Attempts are being made to develop drugs that can cross the blood-brain barrier and have minimal or no side effects. Nobiletin (NOB), a polymethoxylated flavonoid with anti-oxidative and anti-inflammatory effects, has been demonstrated to be a promising compound to treat a variety of NDs. Here, we investigated the potential role of NOB in sodium arsenate (NA)-induced deregulated miRNAs and target proteins in human neural progenitor cells (hNPCs). The proteomics and microRNA (miRNA) profiling was done for different groups, namely, unexposed control, NA-exposed, NA + NOB, and NOB groups. Following the correlation analysis between deregulated miRNAs and target proteins, RT-PCR analysis was used to validate the selected genes. The proteomic analysis showed that significantly deregulated proteins were associated with neurodegeneration pathways, response to oxidative stress, RNA processing, DNA repair, and apoptotic process following exposure to NA. The OpenArray analysis confirmed that NA exposure significantly altered miRNAs that regulate P53 signaling, Wnt signaling, cell death, and cell cycle pathways. The RT-PCR validation studies concur with proteomic data as marker genes associated with autophagy and apoptosis (HO-1, SQSTM1, LC-3, Cas3, Apaf1, HSP70, and SNCA1) were altered following NA exposure. It was observed that the treatment of NOB significantly restored the deregulated miRNAs and proteins to their basal levels. Hence, it may be considered one of its neuroprotective mechanisms. Together, the findings are promising to demonstrate the potential applicability of NOB as a neuroprotectant against chemical-induced neurotoxicity.

Also flagged:Alpers' syndromeneurodegenerative disordermitochondriapolymerase gammaPOLGataxia
Journal Article 2024-01-25 No Snippets Hong Y, Zhang Z, Yangzom T, Chen A, Lundberg BC, Fang EF, Siller R, Sullivan GJ, Zeman J, Tzoulis C, Bindoff LA, Liang KX.
Show Full Abstract

Alpers' syndrome is an early-onset neurodegenerative disorder usually caused by biallelic pathogenic variants in the gene encoding the catalytic subunit of polymerase-gamma (POLG), which is essential for mitochondrial DNA (mtDNA) replication. The disease is progressive, incurable, and inevitably it leads to death from drug-resistant status epilepticus. The neurological features of Alpers' syndrome are intractable epilepsy and developmental regression, with no effective treatment; the underlying mechanisms are still elusive, partially due to lack of good experimental models. Here, we generated the patient derived induced pluripotent stem cells (iPSCs) from one Alpers' patient carrying the compound heterozygous mutations of A467T (c.1399G>A) and P589L (c.1766C>T), and further differentiated them into cortical organoids and neural stem cells (NSCs) for mechanistic studies of neural dysfunction in Alpers' syndrome. Patient cortical organoids exhibited a phenotype that faithfully replicated the molecular changes found in patient postmortem brain tissue, as evidenced by cortical neuronal loss and depletion of mtDNA and complex I (CI). Patient NSCs showed mitochondrial dysfunction leading to ROS overproduction and downregulation of the NADH pathway. More importantly, the NAD<sup>+</sup> precursor nicotinamide riboside (NR) significantly ameliorated mitochondrial defects in patient brain organoids. Our findings demonstrate that the iPSC model and brain organoids are good <i>in vitro</i> models of Alpers' disease; this first-in-its-kind stem cell platform for Alpers' syndrome enables therapeutic exploration and has identified NR as a viable drug candidate for Alpers' disease and, potentially, other mitochondrial diseases with similar causes.

NEGR1
Also flagged:Obesitygenetic obesityleptinmetabolic disorderorganizationtype 2 diabetes
Journal Article 2024-01-25 ✓ 2 Snippets Kalinderi K, Goula V, Sapountzi E, Tsinopoulou VR, Tsinopoulou VR, Fidani L.
In-Text Gene Mentions

With the advent of genome-wide association studies, multiple genes and loci such as FTO, TMEM18, CADM1, CADM2, and NEGR1 have been associated with increased susceptibility to common, polygenic obesity; (ii) “syndromic obesity”, which except for obesity is characterized by neurodevelopmental delay or dysmorphic features such as Prader–Willi and Bardet–Biedl syndrome and “monogenic obesity”, which is typically rare, early-onset, severe, inherited in a Mendelian pattern, and results from single gene mutations with large effects.

…CADM2 , andNEGR1have been associated…

Show Full Abstract

Obesity is a significant health problem with a continuously increasing prevalence among children and adolescents that has become a modern pandemic during the last decades. Nowadays, the genetic contribution to obesity is well-established. For this narrative review article, we searched PubMed and Scopus databases for peer-reviewed research, review articles, and meta-analyses regarding the genetics of obesity and current pharmacological treatment, published in the English language with no time restrictions. We also screened the references of the selected articles for possible additional articles in order to include most of the key recent evidence. Our research was conducted between December 2022 and December 2023. We used the terms "obesity", "genetics", "monogenic", "syndromic", "drugs", "autosomal dominant", "autosomal recessive", "leptin-melanocortin pathway", and "children" in different combinations. Recognizing the genetic background in obesity can enhance the effectiveness of treatment. During the last years, intense research in the field of obesity treatment has increased the number of available drugs. This review analyzes the main categories of syndromic and monogenic obesity discussing current data on genetic-based pharmacological treatment of genetic obesity and highlighting the necessity that cases of genetic obesity should follow specific, pharmacological treatment based on their genetic background.

Also flagged:nanostructuresbindingantibodiescancerinfectionsautoimmune diseases
Journal Article 2024-01-25 No Snippets Sitkov N, Ryabko A, Moshnikov V, Aleshin A, Kaplun D, Zimina T.
Show Full Abstract

Impedimetric biosensors represent a powerful and promising tool for studying and monitoring biological processes associated with proteins and can contribute to the development of new approaches in the diagnosis and treatment of diseases. The basic principles, analytical methods, and applications of hybrid impedimetric biosensors for express protein detection in biological fluids are described. The advantages of this type of biosensors, such as simplicity and speed of operation, sensitivity and selectivity of analysis, cost-effectiveness, and an ability to be integrated into hybrid microfluidic systems, are demonstrated. Current challenges and development prospects in this area are analyzed. They include (a) the selection of materials for electrodes and formation of nanostructures on their surface; (b) the development of efficient methods for biorecognition elements' deposition on the electrodes' surface, providing the specificity and sensitivity of biosensing; (c) the reducing of nonspecific binding and interference, which could affect specificity; (d) adapting biosensors to real samples and conditions of operation; (e) expanding the range of detected proteins; and, finally, (f) the development of biosensor integration into large microanalytical system technologies. This review could be useful for researchers working in the field of impedimetric biosensors for protein detection, as well as for those interested in the application of this type of biosensor in biomedical diagnostics.

SERPINC1
Also flagged:GlycosaminoglycanspeptideGAGpeptidesdegradationbinding
Journal Article 2024-01-25 ✓ 1 Snippet Sodhi H, Panitch A.
In-Text Gene Mentions

…heparin-binding domain ofAnti-Thrombin IIIIII (KAFAK) and…

Show Full Abstract

The popularity of Glycosaminoglycans (GAGs) in drug delivery systems has grown as their innate ability to sequester and release charged molecules makes them adept in the controlled release of therapeutics. However, peptide therapeutics have been relegated to synthetic, polymeric systems, despite their high specificity and efficacy as therapeutics because they are rapidly degraded in vivo when not encapsulated. We present a GAG-based nanoparticle system for the easy encapsulation of cationic peptides, which offers control over particle diameter, peptide release behavior, and swelling behavior, as well as protection from proteolytic degradation, using a singular, organic polymer and no covalent linkages. These nanoparticles can encapsulate cargo with a particle diameter range spanning 130-220 nm and can be tuned to release cargo over a pH range of 4.5 to neutral through the modulation of the degree of sulfation and the molecular weight of the GAG. This particle system also confers better in vitro performance than the unencapsulated peptide via protection from enzymatic degradation. This method provides a facile way to protect therapeutic peptides via the inclusion of the presented binding sequence and can likely be expanded to larger, more diverse cargo as well, abrogating the complexity of previously demonstrated systems while offering broader tunability.

Also flagged:hydroxyapatiteGlass ionomercariescarbohydrateszinc phosphatemetals
Journal Article 2024-01-25 No Snippets Shirazi M, Pirzeh A, Atashgaran M.
Show Full Abstract

<h4>Background</h4>Fixed orthodontic appliances enhance dental plaque accumulation. Glass ionomer (GI) is among the most popular orthodontic cement. It possesses antibacterial properties; however, its antibacterial activity may not be sufficient for caries prevention. Although evidence shows that the addition of 8wt% nano-hydroxyapatite (nHA) may enhance the antibacterial properties of GI, no clinical study has been conducted in this respect. Thus, this study aimed to assess the subgingival accumulation of <i>Streptococcus mutans</i> (S. mutans) and <i>Lactobacillus acidophilus</i> (<i>L. acidophilus</i>) around orthodontic bands cemented with conventional GI and GI reinforced with 8wt% nHA.<h4>Materials and methods</h4>This split-mouth clinical trial was conducted on 20 patients requiring a lingual arch. The patients were randomly assigned to two groups. In group 1, the right molar band was cemented with pure Fuji I (GC), and the left was cemented with Fuji I containing 8wt% nHA. In group 2, the right molar band was cemented with Fuji I containing 8wt% nHA, and the left was cemented with Fuji I. After 3 months, subgingival sampling was performed by sterile paper points. <i>S. mutans</i> and <i>L. acidophilus</i> were cultured on MSB and MRS agar, and colonies were counted by a colony counter. Data were analyzed by independent samples <i>t</i>-test using SPSS 25 at a 0.05 level of significance.<h4>Results</h4>The mean counts of <i>S. mutans</i>, aerobic and anaerobic lactobacilli, and total bacterial around orthodontic bands cemented with Fuji I containing 8wt% nHA were significantly lower than those around orthodontic bands cemented with pure Fuji I (<i>P</i> < 0.05).<h4>Conclusion</h4>The addition of 8wt% nHA to GI cement can enhance its antibacterial properties for the cementation of orthodontic bands, decrease the accumulation of cariogenic bacteria, and probably decrease the incidence of caries in orthodontic patients.

Also flagged:Hydroxyapatiteβ-tricalciumbone-formationagingtumors-tricalcium phosphate
Journal Article 2024-01-25 No Snippets Horikawa S, Suzuki K, Motojima K, Nakano K, Nagaya M, Nagashima H, Kaneko H, Aizawa M.
Show Full Abstract

Hydroxyapatite and β-tricalcium phosphate have been clinically applied as artificial bone materials due to their high biocompatibility. The development of artificial bones requires the verification of safety and efficacy through animal experiments; however, from the viewpoint of animal welfare, it is necessary to reduce the number of animal experiments. In this study, we utilized machine learning to construct a model that estimates the bone-forming ability of bioceramics from material fabrication conditions, material properties, and in vivo experimental conditions. We succeeded in constructing two models: 'Model 1', which predicts material properties from their fabrication conditions, and 'Model 2', which predicts the bone-formation rate from material properties and in vivo experimental conditions. The inclusion of full width at half maximum (FWHM) in the feature of Model 2 showed an improvement in accuracy. Furthermore, the results of the feature importance showed that the FWHMs were the most important. By an inverse analysis of the two models, we proposed candidates for material fabrication conditions to achieve target values of the bone-formation rate. Under the proposed conditions, the material properties of the fabricated material were consistent with the estimated material properties. Furthermore, a comparison between bone-formation rates after 12 weeks of implantation in the porcine tibia and the estimated bone-formation rate. This result showed that the actual bone-formation rates existed within the error range of the estimated bone-formation rates, indicating that machine learning consistently predicts the results of animal experiments using material fabrication conditions. We believe that these findings will lead to the establishment of alternative animal experiments to replace animal experiments in the development of artificial bones.

PLCL1
Also flagged:Gliomasgliomatemozolomidesupratentorialbrain tumorsgadolinium
Journal Article 2024-01-25 ✓ 1 Snippet Patel KS, Tessema KK, Kawaguchi R, Dudley L, Alvarado AG, Muthukrishnan SD, Perryman T, Hagiwara A, Swarup V, Liau LM, Wang AC, Yong W, Geschwind DH, Nakano I, Goldman SA, Everson RG, Ellingson BM, Kornblum HI.
In-Text Gene Mentions

…CADM2, IL1RAPL, PAK3,PLCL1, ERC2, SCN3A, KCN3…

Show Full Abstract

<h4>Background</h4>Non-enhancing (NE) infiltrating tumor cells beyond the contrast-enhancing (CE) bulk of tumor are potential propagators of recurrence after gross total resection of high-grade glioma.<h4>Methods</h4>We leveraged single-nucleus RNA sequencing on 15 specimens from recurrent high-grade gliomas (<i>n</i> = 5) to compare prospectively identified biopsy specimens acquired from CE and NE regions. Additionally, 24 CE and 22 NE biopsies had immunohistochemical staining to validate RNA findings.<h4>Results</h4>Tumor cells in NE regions are enriched in neural progenitor cell-like cellular states, while CE regions are enriched in mesenchymal-like states. NE glioma cells have similar proportions of proliferative and putative glioma stem cells relative to CE regions, without significant differences in % Ki-67 staining. Tumor cells in NE regions exhibit upregulation of genes previously associated with lower grade gliomas. Our findings in recurrent GBM paralleled some of the findings in a re-analysis of a dataset from primary GBM. Cell-, gene-, and pathway-level analyses of the tumor microenvironment in the NE region reveal relative downregulation of tumor-mediated neovascularization and cell-mediated immune response, but increased glioma-to-nonpathological cell interactions.<h4>Conclusions</h4>This comprehensive analysis illustrates differing tumor and nontumor landscapes of CE and NE regions in high-grade gliomas, highlighting the NE region as an area harboring likely initiators of recurrence in a pro-tumor microenvironment and identifying possible targets for future design of NE-specific adjuvant therapy. These findings also support the aggressive approach to resection of tumor-bearing NE regions.

Also flagged:PhosphorylationRPT6Gene Expressionprotein degradationproteasomeserine
Journal Article 2024-01-24 No Snippets Farrell K, Auerbach A, Musaus M, Navabpour S, Liu C, Lin Y, Xie H, Jarome TJ.
Show Full Abstract

Memory formation requires coordinated control of gene expression, protein synthesis, and ubiquitin-proteasome system (UPS)-mediated protein degradation. The catalytic component of the UPS, the 26S proteasome, contains a 20S catalytic core surrounded by two 19S regulatory caps, and phosphorylation of the 19S cap regulatory subunit RPT6 at serine 120 (pRPT6-S120) has been widely implicated in controlling activity-dependent increases in proteasome activity. Recently, RPT6 was also shown to act outside the proteasome where it has a transcription factor-like role in the hippocampus during memory formation. However, little is known about the proteasome-independent function of "free" RPT6 in the brain or during memory formation and whether phosphorylation of S120 is required for this transcriptional control function. Here, we used RNA-sequencing along with novel genetic approaches and biochemical, molecular, and behavioral assays to test the hypothesis that pRPT6-S120 functions independently of the proteasome to bind DNA and regulate gene expression during memory formation. RNA-sequencing following siRNA-mediated knockdown of free RPT6 revealed 46 gene targets in the dorsal hippocampus of male rats following fear conditioning, where RPT6 was involved in transcriptional activation and repression. Through CRISPR-dCas9-mediated artificial placement of RPT6 at a target gene, we found that RPT6 DNA binding alone may be important for altering gene expression following learning. Further, CRISPR-dCas13-mediated conversion of S120 to glycine on RPT6 revealed that phosphorylation at S120 is necessary for RPT6 to bind DNA and properly regulate transcription during memory formation. Together, we reveal a novel function for phosphorylation of RPT6 in controlling gene transcription during memory formation.

HTT
Also flagged:oligonucleotidesapolipoprotein A-IHuntington diseaseneurological diseasesHDneurodegenerative disorder
Journal Article 2024-01-24 ✓ 5 Snippets Caron NS, Aly AE, Findlay Black H, Martin DDO, Schmidt ME, Ko S, Anderson C, Harvey EM, Casal LL, Anderson LM, Rahavi SMR, Reid GSD, Oda MN, Stanimirovic D, Abulrob A, McBride JL, Leavitt BR, Hayden MR.
In-Text Gene Mentions

In this study, we report the optimization of apolipoprotein A-I nanodisks (apoA-I NDs) as vehicles for delivery of a HTT-targeted ASO (HTT ASO) to the brain and peripheral organs for HD.

These findings demonstrate the potential utility of apoA-I NDs as biocompatible vehicles for enhancing delivery of mutant HTT lowering ASOs to the CNS and peripheral organs for HD.

Huntington disease (HD) is a dominantly inherited neurodegenerative disorder caused by a CAG trinucleotide expansion mutation in the HTT gene which codes for a toxic mutant huntingtin (mHTT) protein.

ApoA-I K133C conjugated with HTT ASO forms NDs (HTT ASO NDs) that induce significant mHTT lowering in the liver, skeletal muscle and heart as well as in the brain when delivered intravenously in the BACHD mouse model of HD.

…mutation in theHTTgene which codes…

Show Full Abstract

Efficient delivery of therapeutics to the central nervous system (CNS) remains a major challenge for the treatment of neurological diseases. Huntington disease (HD) is a dominantly inherited neurodegenerative disorder caused by a CAG trinucleotide expansion mutation in the HTT gene which codes for a toxic mutant huntingtin (mHTT) protein. Pharmacological reduction of mHTT in the CNS using antisense oligonucleotides (ASO) ameliorates HD-like phenotypes in rodent models of HD, with such therapies being investigated in clinical trials for HD. In this study, we report the optimization of apolipoprotein A-I nanodisks (apoA-I NDs) as vehicles for delivery of a HTT-targeted ASO (HTT ASO) to the brain and peripheral organs for HD. We demonstrate that apoA-I wild type (WT) and the apoA-I K133C mutant incubated with a synthetic lipid, 1,2-dimyristoyl-sn-glycero-3-phosphocholine, can self-assemble into monodisperse discoidal particles with diameters <20 nm that transmigrate across an in vitro blood-brain barrier model of HD. We demonstrate that apoA-I NDs are well tolerated in vivo, and that apoA-I K133C NDs show enhanced distribution to the CNS and peripheral organs compared to apoA-I WT NDs following systemic administration. ApoA-I K133C conjugated with HTT ASO forms NDs (HTT ASO NDs) that induce significant mHTT lowering in the liver, skeletal muscle and heart as well as in the brain when delivered intravenously in the BACHD mouse model of HD. Furthermore, HTT ASO NDs increase the magnitude of mHTT lowering in the striatum and cortex compared to HTT ASO alone following intracerebroventricular administration. These findings demonstrate the potential utility of apoA-I NDs as biocompatible vehicles for enhancing delivery of mutant HTT lowering ASOs to the CNS and peripheral organs for HD.

SOX6
Also flagged:capsulecell differentiationmineralizationsecretionalkaline phosphataseALP
Journal Article 2024-01-24 ✓ 2 Snippets Camarero-Espinosa S, Beeren I, Liu H, Gomes DB, Zonderland J, Lourenço AFH, van Beurden D, Peters M, Koper D, Emans P, Kessler P, Rademakers T, Baker MB, Bouvy N, Moroni L.
In-Text Gene Mentions

…with Sox5 andSox6to regulate the…

…of Sox5 andSox6for all scaffolds…

Show Full Abstract

The regeneration of the osteochondral unit represents a challenge due to the distinct cartilage and bone phases. Current strategies focus on the development of multiphasic scaffolds that recapitulate features of this complex unit and promote the differentiation of implanted bone-marrow derived stem cells (BMSCs). In doing so, challenges remain from the loss of stemness during in vitro expansion of the cells and the low control over stem cell activity at the interface with scaffolds in vitro and in vivo. Here, this work scaffolds inspired by the bone marrow niche that can recapitulate the natural healing process after injury. The construct comprises an internal depot of quiescent BMSCs, mimicking the bone marrow cavity, and an electrospun (ESP) capsule that "activates" the cells to migrate into an outer "differentiation-inducing" 3D printed unit functionalized with TGF-β and BMP-2 peptides. In vitro, niche-inspired scaffolds retained a depot of nonproliferative cells capable of migrating and proliferating through the ESP capsule. Invasion of the 3D printed cavity results in location-specific cell differentiation, mineralization, secretion of alkaline phosphatase (ALP) and glycosaminoglycans (GAGs), and genetic upregulation of collagen II and collagen I. In vivo, niche-inspired scaffolds are biocompatible, promoted tissue formation in rat subcutaneous models, and regeneration of the osteochondral unit in rabbit models.

CCPG1
Also flagged:autophagycancerdegradationlysosomesorganellesmitochondria
Journal Article 2024-01-24 ✓ 1 Snippet Liu J, Wu Y, Meng S, Xu P, Li S, Li Y, Hu X, Ouyang L, Wang G.
In-Text Gene Mentions

…progression gene 1 (CCPG1) and Atlastin GTPase…

Show Full Abstract

Eukaryotic cells engage in autophagy, an internal process of self-degradation through lysosomes. Autophagy can be classified as selective or non-selective depending on the way it chooses to degrade substrates. During the process of selective autophagy, damaged and/or redundant organelles like mitochondria, peroxisomes, ribosomes, endoplasmic reticulum (ER), lysosomes, nuclei, proteasomes, and lipid droplets are selectively recycled. Specific cargo is delivered to autophagosomes by specific receptors, isolated and engulfed. Selective autophagy dysfunction is closely linked with cancers, neurodegenerative diseases, metabolic disorders, heart failure, etc. Through reviewing latest research, this review summarized molecular markers and important signaling pathways for selective autophagy, and its significant role in cancers. Moreover, we conducted a comprehensive analysis of small-molecule compounds targeting selective autophagy for their potential application in anti-tumor therapy, elucidating the underlying mechanisms involved. This review aims to supply important scientific references and development directions for the biological mechanisms and drug discovery of anti-tumor targeting selective autophagy in the future.

Also flagged:Huntington's DiseaseHDbehavioralCognitionalcoholdrug abuse
Journal Article 2024-01-24 No Snippets Migliore S, Bianco SD, Scocchia M, Maffi S, Busi LC, Ceccarelli C, Curcio G, Mazza T, Squitieri F.
Show Full Abstract

<h4>Background</h4>Cognitive changes in Huntington's disease (HD) precede motor manifestations. ENROLL-HD platform includes four cognitive measures of information processing speed (IPS). Our group is eager to seek clinical markers in the life stage that is as close as possible to the age of onset (ie, the so called prodromal HD phase) because this is the best time for therapeutic interventions.<h4>Objectives</h4>Our study aimed to test whether cognitive scores in prodromal ENROLL-HD mutation carriers show the potential to predict the severity of motor and behavioral changes once HD became fully manifested.<h4>Methods</h4>From the global ENROLL-HD cohort of 21,343 participants, we first selected a premanifest Cohort#1 (ie, subjects with Total Motor Score (TMS) <10 and Diagnostic Confidence Level (DCL) <4, N = 1.222). From this cohort, we then focused on a prodromal Cohort#2 of subjects who were ascertained to phenoconvert into manifest HD at follow-up visits (ie, subjects from 6 ≤ TMS≤9 and DCL <4 to TMS≥10 and DCL = 4, n = 206).<h4>Results</h4>The main results of our study showed that low IPS before phenoconversion in Cohort#2 predicted the severity of motor and behavioral manifestations. By combining the four IPS cognitive measures (eg, the Categorical Verbal Fluency Test; Stroop Color Naming Test; Stroop Word Reading; Symbol Digit Modalities Test), we generated a Composite Cognition Score (CCS). The lower the CCS score the higher the TMS and the apathy scores in the same longitudinally followed-up patients after phenoconversion.<h4>Conclusions</h4>CCS might represent a clinical instrument to predict the prognosis of mutation carriers who are close to manifesting HD.

SERPINC1
Also flagged:Amygdala atrophyfrontotemporal dementiaADsemantic dementiaSDprimary nonfluent aphasia
Journal Article 2024-01-24 ✓ 2 Snippets Huang M, Landin-Romero R, Matis S, Dalton MA, Piguet O.
In-Text Gene Mentions

…On theACE-III, all clinical groups…

…found on theACE-III(Table 1 ).…

Show Full Abstract

Amygdala atrophy has been found in frontotemporal dementia (FTD), yet the specific changes of its subregions across different FTD phenotypes remain unclear. The aim of this study was to investigate the volumetric alterations of the amygdala subregions in FTD phenotypes and how they evolve with disease progression. Patients clinically diagnosed with behavioral variant FTD (bvFTD) (n = 20), semantic dementia (SD) (n = 20), primary nonfluent aphasia (PNFA) (n = 20), Alzheimer's disease (AD) (n = 20), and 20 matched healthy controls underwent whole brain structural MRI. The patient groups were followed up annually for up to 3.5 years. Amygdala nuclei were segmented using FreeSurfer, corrected by total intracranial volumes, and grouped into the basolateral, superficial, and centromedial subregions. Linear mixed effects models were applied to identify changes in amygdala subregional volumes over time. At baseline, bvFTD, SD, and AD displayed global amygdala volume reduction, whereas amygdala volume appeared to be preserved in PNFA. Asymmetrical amygdala atrophy (left > right) was most pronounced in SD. Longitudinally, SD and PNFA showed greater rates of annual decline in the right basolateral and superficial subregions compared to bvFTD and AD. The findings provide comprehensive insights into the differential impact of FTD pathology on amygdala subregions, revealing distinct atrophy patterns that evolve over disease progression. The characterization of amygdala subregional involvement in FTD and their potential role as biomarkers carry substantial clinical implications.

HTT
Also flagged:FerroptosisNrf2nuclear factor E2-related factor 2Alzheimer's diseaseADParkinson's disease
Journal Article 2024-01-24 ✓ 2 Snippets Xiang Y, Song X, Long D.
In-Text Gene Mentions

This leads to the dysfunction of the scaffolding protein Htt involved in various physiological processes such as vesicle trafficking, autophagy (Benn et al. 2008; Saudou and Humbert 2016), and eventually leads to degenerative diseases in the striatum and cortex areas of the brain (McColgan and Tabrizi 2018).

Mutant huntingtin (mtHtt), an important trigger and pathological feature of HD, is caused by abnormal CAG trinucleotide repeat in the huntingtin (HTT) gene, resulting in amplification of polyglutamine repeats in mtHtt (Tabrizi et al. 2019; Zgorzynska et al. 2021).

Show Full Abstract

This article provides an overview of the background knowledge of ferroptosis in the nervous system, as well as the key role of nuclear factor E2-related factor 2 (Nrf2) in regulating ferroptosis. The article takes Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS) as the starting point to explore the close association between Nrf2 and ferroptosis, which is of clear and significant importance for understanding the mechanism of neurodegenerative diseases (NDs) based on oxidative stress (OS). Accumulating evidence links ferroptosis to the pathogenesis of NDs. As the disease progresses, damage to the antioxidant system, excessive OS, and altered Nrf2 expression levels, especially the inhibition of ferroptosis by lipid peroxidation inhibitors and adaptive enhancement of Nrf2 signaling, demonstrate the potential clinical significance of Nrf2 in detecting and identifying ferroptosis, as well as targeted therapy for neuronal loss and mitochondrial dysfunction. These findings provide new insights and possibilities for the treatment and prevention of NDs.

POU3F2
Also flagged:hearinghairtranscription factorAtoh1Gfi1Pou4f3
Journal Article 2024-01-24 ✓ 1 Snippet McGovern MM, Hosamani IV, Niu Y, Nguyen KY, Zong C, Groves AK.
In-Text Gene Mentions

…, Klf5 extended,Pou3f2extended, Rorb ,…

Show Full Abstract

Mechanosensory hair cells of the mature mammalian organ of Corti do not regenerate; consequently, loss of hair cells leads to permanent hearing loss. Although nonmammalian vertebrates can regenerate hair cells from neighboring supporting cells, many humans with severe hearing loss lack both hair cells and supporting cells, with the organ of Corti being replaced by a flat epithelium of nonsensory cells. To determine whether the mature cochlea can produce hair cells in vivo, we reprogrammed nonsensory cells adjacent to the organ of Corti with three hair cell transcription factors: <i>Gfi1</i>, <i>Atoh1</i>, and <i>Pou4f3.</i> We generated numerous hair cell-like cells in nonsensory regions of the cochlea and new hair cells continued to be added over a period of 9 wk. Significantly, cells adjacent to reprogrammed hair cells expressed markers of supporting cells, suggesting that transcription factor reprogramming of nonsensory cochlear cells in adult animals can generate mosaics of sensory cells like those seen in the organ of Corti. Generating such sensory mosaics by reprogramming may represent a potential strategy for hearing restoration in humans.

TNFSF4
Also flagged:tumourchemokine receptorCCR7tumoursCD8CD4
Journal Article 2024-01-24 ✓ 5 Snippets Lee CYC, Kennedy BC, Richoz N, Dean I, Tuong ZK, Gaspal F, Li Z, Willis C, Hasegawa T, Whiteside SK, Posner DA, Carlesso G, Hammond SA, Dovedi SJ, Roychoudhuri R, Withers DR, Clatworthy MR.
In-Text Gene Mentions

Using OX40LHu-CD4 (Tnfsf4)-reporter mice, we confirmed that some tumour CCR7+ DCs express OX40L, but it was not expressed by tumour cDCs or CCR7+ DCs in the dLN (Fig. 3h, Supplementary Fig. 6f, g).

Consistent with our findings, there was no difference in CCR7 expression, but CD80, CD86, TNFSF4, TNFSF9, CD70 and PVR were higher in tumour-residing CCR7_DCs versus dLN and normal tissue, while ICOSLG was enriched in the dLN (Fig. 6b, Supplementary Fig. 11d, e).

Importantly, we identified several lymphocyte activation ligands32,35,36 that were significantly upregulated on Ccr7_DC.2 versus other tumour CCR7+ DC states and Kaede-red dLN CCR7+ DCs, such as Il12b, Tnfsf4, Tnfsf9, Cd70 and Pvr (Supplementary Fig. 6e).

…CD4 to theTnfsf4locus (MRC Harwell…

…as Il12b ,Tnfsf4, Tnfsf9 ,…

Show Full Abstract

Tumour dendritic cells (DCs) internalise antigen and upregulate CCR7, which directs their migration to tumour-draining lymph nodes (dLN). CCR7 expression is coupled to an activation programme enriched in regulatory molecule expression, including PD-L1. However, the spatio-temporal dynamics of CCR7<sup>+</sup> DCs in anti-tumour immune responses remain unclear. Here, we use photoconvertible mice to precisely track DC migration. We report that CCR7<sup>+</sup> DCs are the dominant DC population that migrate to the dLN, but a subset remains tumour-resident despite CCR7 expression. These tumour-retained CCR7<sup>+</sup> DCs are phenotypically and transcriptionally distinct from their dLN counterparts and heterogeneous. Moreover, they progressively downregulate the expression of antigen presentation and pro-inflammatory transcripts with more prolonged tumour dwell-time. Tumour-residing CCR7<sup>+</sup> DCs co-localise with PD-1<sup>+</sup>CD8<sup>+</sup> T cells in human and murine solid tumours, and following anti-PD-L1 treatment, upregulate stimulatory molecules including OX40L, thereby augmenting anti-tumour cytolytic activity. Altogether, these data uncover previously unappreciated heterogeneity in CCR7<sup>+</sup> DCs that may underpin a variable capacity to support intratumoural cytotoxic T cells.

HTT
Also flagged:Huntington diseaseHDautosomal dominant movement disorderbehavioralglutaminemismatch repair
Journal Article 2024-01-24 ✓ 5 Snippets Driscoll R, Hampton L, Abraham NA, Larigan JD, Joseph NF, Hernandez-Vega JC, Geisler S, Yang FC, Deninger M, Tran DT, Khatri N, Godinho BMDC, Kinberger GA, Montagna DR, Hirst WD, Guardado CL, Glajch KE, Arnold HM, Gallant-Behm CL, Weihofen A.
In-Text Gene Mentions

The underlying cause of HD is an elongated CAG trinucleotide repeat expansion in exon 1 of the HTT gene, resulting in the formation of mutant HTT protein with an abnormally long poly-glutamine tail that exhibits a propensity to aggregate 3,4.

Our study presents strong evidence for a direct correlation between somatic instability of the CAG repeat within Htt Exon 1 and the levels of pharmacologically manipulated MSH3 in an HD mouse model.

…1 of theHTTgene, resulting in…

…formation of mutantHTTprotein with an…

…Q111/+ and humanHttBAC CAG transgenic…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by CAG trinucleotide repeat expansions in exon 1 of the HTT gene. In addition to germline CAG expansions, somatic repeat expansions in neurons also contribute to HD pathogenesis. The DNA mismatch repair gene, MSH3, identified as a genetic modifier of HD onset and progression, promotes somatic CAG expansions, and thus presents a potential therapeutic target. However, what extent of MSH3 protein reduction is needed to attenuate somatic CAG expansions and elicit therapeutic benefits in HD disease models is less clear. In our study, we employed potent di-siRNAs to silence mouse Msh3 mRNA expression in a dose-dependent manner in Hdh<sup>Q111/+</sup> mice and correlated somatic Htt CAG instability with MSH3 protein levels from simultaneously isolated DNA and protein after siRNA treatment. Our results reveal a linear correlation with a proportionality constant of ~ 1 between the prevention of somatic Htt CAG expansions and MSH3 protein expression in vivo, supporting MSH3 as a rate-limiting step in somatic expansions. Intriguingly, despite a 75% reduction in MSH3 protein levels, striatal nuclear HTT aggregates remained unchanged. We also note that evidence for nuclear Msh3 mRNA that is inaccessible to RNA interference was found, and that MSH6 protein in the striatum was upregulated following MSH3 knockdown in Hdh<sup>Q111/+</sup> mice. These results provide important clues to address critical questions for the development of therapeutic molecules targeting MSH3 as a potential therapeutic target for HD.

DCC
Also flagged:infectionextended-spectrum beta-lactamasecarbapenemasevancomycinciprofloxacinESBL-E
Journal Article 2024-01-24 ✓ 5 Snippets Dequeker S, van Hensbergen M, den Heijer CDJ, Dhaeze W, Raven SFH, Ewalts-Hakkoer H, Tolsma P, Willemsen I, van Drunen-Kamp KJ, van der Slikke-Verstraten K, Goossens H, Kluytmans-van den Bergh MFQ, Hoebe CJPA, i-4-1-Health Study Group.
In-Text Gene Mentions

…If aDCCrefused to participate, the DCC following the non-participating DCC in the list, was invited to participate.…

…If a DCC refused to participate, theDCCfollowing the non-participating DCC in the list, was invited to participate.…

…If a DCC refused to participate, the DCC following the non-participatingDCCin the list, was invited to participate.…

…Variables at child level were age, days per week attending theDCC, gender, antimicrobial use, hospital admission, parental occupation, animal contact and travel abroad.…

…Included risk factors, selected based on expert consensus within our study group, were: age, days per week attending theDCC, gender, antimicrobial use, hospital admission, parental occupation, animal contact and travel abroad (Table 1 ).…

Show Full Abstract

<h4>Background</h4>Day care centres (DCCs) are ideal settings for drug-resistant bacteria to emerge. Prevalence numbers of faecal carriage of antimicrobial resistant bacteria in these settings are rare. We aimed to determine the prevalence of faecal antimicrobial resistant bacteria carriage in children attending DCCs and to assess and identify infection risk factors within DCCs in The Netherlands and Belgium.<h4>Methods</h4>A point-prevalence study was conducted in 28 Dutch (499 children) and 18 Belgian (448 children) DCCs. Stool samples were taken from the children's diapers and a questionnaire was filled in by their parents. Hygiene related to stool and toilet use, hygiene related to food, environmental contamination, hand hygiene and hygiene guidelines were assessed conform a standardized questionnaire by the infection prevention and control expert visiting the DCC. Multilevel logistical regression analyses were used to define which characteristics predicted the presence of extended-spectrum beta-lactamase-producing Enterobacterales (ESBL-E), carbapenemase-producing Enterobacterales (CPE), vancomycin-resistant enterococci (VRE), and ciprofloxacin-resistant Enterobacterales (CipR-E).<h4>Results</h4>The ESBL-E prevalence was 16% (n = 71) in Belgium and 6% (n = 30) in the Netherlands. The CipR-E prevalence was 17% (n = 78) in Belgium and 8% (n = 38) in the Netherlands. Antimicrobial use (RR: 0.30; 95% CI: 0.33-0.48) and hospital admissions (RR: 0.37; 95% CI: 0.25-0.54) were lower in the Netherlands. Children travelling to Asia were at higher risk of being an ESBL-E carrier. Children using antimicrobials were at higher risk of being a CipR-E carrier. Cleaning the changing mat after each use was found as a protective factor for CipR-E carriage.<h4>Conclusions</h4>We established a significant difference in ESBL-E and CipR-E carriage and antimicrobial use and hospital admissions between the Netherlands and Belgium among children attending DCCs. The differences between both countries should be further studied to improve the policy on anti-microbial use and hospital admissions in children.

HFE
Also flagged:pediatric cancerschildhood cancerhypogonadismdyslipidemiadiabetes mellitusosteoporosis
Journal Article 2024-01-24 ✓ 2 Snippets Hwang S, Lee Y, Yoon JH, Kim JH, Kim H, Koh KN, Im HJ, Yoo HW, Choi JH.
In-Text Gene Mentions

…DM caused byhemochromatosisafter multiple transfusions…

…clinical signs ofhemochromatosis.…

Show Full Abstract

<h4>Purpose</h4>As the survival rate from pediatric cancers has increased significantly with advances in treatment modalities, long-term endocrine complications have also risen. This study investigated the frequencies and risks of endocrine sequelae in childhood cancer survivors who received hematopoietic stem cell transplantation (HSCT).<h4>Methods</h4>This study included 200 pediatric patients who underwent HSCT. Clinical and endocrinological findings were collected retrospectively. The median follow-up duration after HSCT was 14 years.<h4>Results</h4>Endocrine complications occurred in 135 patients (67.5%). Children who underwent HSCT at pubertal age (n=100) were at higher risk of endocrine complications than those who received it at prepubertal age (79% vs. 56%, P=0.001). The most common complication was hypogonadism (40%), followed by dyslipidemia (22%). Short stature and diabetes mellitus were more prevalent in the prepubertal group, whereas hypogonadism and osteoporosis were more common in the pubertal group. Being female, pubertal age at HSCT, and glucocorticoid use were predictors of an increased risk for any complication. Radiation exposure increased the risk of short stature and hypothyroidism. Hypogonadism was significantly associated with being female, pubertal age at HSCT, and high-dose radiation. Pubertal age at HSCT also increased the risks of osteoporosis and dyslipidemia.<h4>Conclusion</h4>This study demonstrates that long-term endocrine complications are common after HSCT in children and adolescents. Age at HSCT is a critical factor for endocrine complications after HSCT. These findings suggest that surveillance strategies for endocrine complications in childhood cancer survivors should be specified according to age at HSCT.

PRDX6
Also flagged:limoninfertilizationspindle assemblyoxygenglutathionemitochondrial
Journal Article 2024-01-24 ✓ 1 Snippet Jiao A, Sun J, Sun Z, Zhao Y, Han T, Zhang H, Gao Q.
In-Text Gene Mentions

…antioxidant genes (Prdx3,Prdx6, Sirt1) and antiapoptotic…

Show Full Abstract

To investigate the effects of limonin (Lim) on oxidative stress and early apoptosis in bovine oocytes during in vitro maturation (IVM), different concentrations of Lim (0, 10, 20, 50 μmol/L) were added to bovine IVM medium. Oocyte maturation rates and development 24 h after in vitro fertilization (IVF) were examined to determine the optimal Lim concentration. The optimal Lim concentration was added to the IVM medium, and 0 μmol/L Lim was used as the control. Immunofluorescence staining was used to detect the abnormal rate of spindle assembly, reactive oxygen species (ROS), glutathione (GSH), mitochondrial membrane potential (MMP) levels, mitochondrial distribution, and the fluorescence intensity of cathepsin B (CB)-active LC3 protein. RT‒qPCR was used to detect the mRNA expression levels of antioxidant-, apoptosis- and autophagy-related genes in oocytes. The total number of blastocysts and the proportion of apoptotic cells among blastocysts were detected. The results showed that the PBI ejection rate, cleavage rate and blastocyst rate of bovine oocytes in the 20 μmol/L Lim group were significantly higher than those in the control group (P < 0.05). Compared with those in the control group, ROS levels, abnormal mitochondrial distribution, the proportion of abnormal spindle assembly, CB activity and LC3 protein fluorescence intensity of oocytes in the 20 μmol/L Lim group were significantly decreased (P < 0.05), and GSH and MMP levels were significantly increased (P < 0.05). The expression of antioxidant genes (Prdx3, Prdx6, Sirt1) and antiapoptotic genes (Bcl-xl, Survivin) were significantly upregulated (P < 0.05), and the expression levels of proapoptotic genes (Caspase-4, BAX) and autophagy-related genes (LC3) were significantly downregulated (P < 0.05). The total number of cells among in vitro fertilized embryos was significantly increased (P < 0.05), and the apoptosis rate of blastocysts was significantly decreased (P < 0.05). Here, we show that Lim exerts positive effects on bovine oocyte IVM by regulating REDOX homeostasis, reducing spindle damage and enhancing mitochondrial function during IVM, thereby inhibiting oocyte apoptosis and autophagy.

Also flagged:multiple endocrine neoplasia type 1 syndromeautosomal dominant diseaseMEN1parathyroid tumorsgastroenteropancreaticneuroendocrine tumors
Journal Article 2024-01-24 No Snippets Trukhina DA, Mamedova EO, Nikitin AG, Koshkin PA, Belaya ZE, Melnichenko GA.
Show Full Abstract

<h4>Background</h4>MEN-1 is a rare autosomal dominant disease caused by mutations in MEN1 gene encoding the menin protein. This syndrome is characterized by the occurrence of parathyroid tumors, gastroenteropancreatic neuroendocrine tumors, pituitary adenomas, as well as other endocrine and non-endocrine tumors. If a patient with the MEN-1 phenotype carry no mutations in the MEN1 gene, the condition considers a phenocopy of syndrome (phMEN1). The possible cause of this changes could be changes in epigenetic regulation, particularly in microRNA expression that might affect menin signaling pathways.<h4>Aim</h4>to identify differently expressed circulating miRNAs in plasma in patients with genetically confirmed MEN-1 syndrome, its phenocopies and healthy controls.<h4>Materials and methods</h4>single-center, case-control study was conducted. We assessed plasma microRNA expression in patients with genetically confirmed MEN-1 (gMEN1), phMEN1 and healthy controls. Morning plasma samples were collected from fasting patients and stored at -80°C. Total RNA isolation was performed using miRNeasy Mini Kit with QIAcube. The libraries were prepared by the QIAseq miRNA Library Kit following the manufacturer. Circulating miRNA sequencing was done on Illumina NextSeq 500 (Illumina). Subsequent data processing was performed using the DESeq2 bioinformatics algorithm.<h4>Results</h4>we enrolled 21 consecutive patients with gMEN1 and 11 patients with phMEN1, along with 12 gender matched controls. Median age of gMEN1 was 38,0 [34,0; 41,0]; in phMEN1 - 59,0 [51,0; 60,0]; control - 59,5 [51,5; 62,5]. The gMEN1 group differed in age (p&lt;0.01) but not gender (р=0.739) or BMI (р=0.116) compared to phMEN1 and controls group, the last two groups did not differ by these parameters (p&gt;0.05). 25 microRNA were differently expressed in groups gMEN1 and phMEN1 (21 upregulated microRNAs, 4 - downregulated). Comparison of samples from the phMEN-1 group and relatively healthy controls revealed 10 differently expressed microRNAs: 5 - upregulated; 5 - downregulated. In the gMEN-1 and control groups, 26 differently expressed microRNAs were found: 24 - upregulated; 2 - downregulated. The miRNAs most differing in expression among the groups were selected for further validation by RT-qPCR (in the groups of gMEN1 vs phMEN1 - miR-3613-5p, miR-335-5p, miR-32-5p, miR-425-3p, miR-25-5p, miR-576-5p, miR-215-5p, miR-30a-3p, miR-141-3p, miR-760, miR-501-3p; gMEN1 vs control - miR-1976, miR-144-5p miR-532-3p, miR-375; as well as in phMEN1 vs control - miR-944, miR-191-5p, miR-98-5p).<h4>Conclusion</h4>In a pilot study, we detected microRNAs that may be expressed differently between patients with gMEN-1 and phMEN-1. The results need to be validated using different measurement method with larger sample size.

Also flagged:myocardial infarctionMINanomaterialsextracellularvesiclesmembranes
Journal Article 2024-01-24 No Snippets Yu T, Xu Q, Chen X, Deng X, Chen N, Kou MT, Huang Y, Guo J, Xiao Z, Wang J.
Show Full Abstract

Myocardial infarction (MI) and its associated poor prognosis pose significant risks to human health. Nanomaterials hold great potential for the treatment of MI due to their targeted and controlled release properties, particularly biomimetic nanomaterials. The utilization of biomimetic strategies based on extracellular vesicles (EVs) and cell membranes will serve as the guiding principle for the development of nanomaterial therapy in the future. In this review, we present an overview of research progress on various exosomes derived from mesenchymal stem cells, cardiomyocytes, or induced pluripotent stem cells in the context of myocardial infarction (MI) therapy. These exosomes, utilized as cell-free therapies, have demonstrated the ability to enhance the efficacy of reducing the size of the infarcted area and preventing ischaemic reperfusion through mechanisms such as oxidative stress reduction, polarization modulation, fibrosis inhibition, and angiogenesis promotion. Moreover, EVs can exert cardioprotective effects by encapsulating therapeutic agents and can be engineered to specifically target the infarcted myocardium. Furthermore, we discuss the use of cell membranes derived from erythrocytes, stem cells, immune cells and platelets to encapsulate nanomaterials. This approach allows the nanomaterials to camouflage themselves as endogenous substances targeting the region affected by MI, thereby minimizing toxicity and improving biocompatibility. In conclusion, biomimetic nano-delivery systems hold promise as a potentially beneficial technology for MI treatment. This review serves as a valuable reference for the application of biomimetic nanomaterials in MI therapy and aims to expedite the translation of NPs-based MI therapeutic strategies into practical clinical applications.

PTGIS
Also flagged:methylationmethionineinseminationsignal transductionGPCRaldosterone
Journal Article 2024-01-24 ✓ 1 Snippet Salilew-Wondim D, Tholen E, Held-Hoelker E, Shellander K, Blaschka C, Drillich M, Iwersen M, Suess D, Gebremedhn S, Tesfaye D, Parys C, Helmbrecht A, Guyader J, Miskel D, Trakooljul N, Wimmers K, Hoelker M.
In-Text Gene Mentions

…, PXDN ,PTGIS, ATP8B1, and AGO2…

Show Full Abstract

Post calving metabolic stress reduces the fertility of high producing dairy cows possibly by altering the expression of genes in the maternal environment via epigenetic modifications. Therefore, this study was conducted to identify endometrial DNA methylation marks that can be associated with pregnancy outcomes in postpartum cows at the time of breeding. For this, twelve days post-calving, cows were either offered a control diet or supplemented daily with rumen-protected methionine. Cows showing heat 50-64 days postpartum were artificially inseminated. Endometrial cytobrush samples were collected 4-8 h after artificial insemination and classified based on the pregnancy out comes as those derived from cows that resulted in pregnancy or resulted in no pregnancy. The DNAs isolated from endometrial samples were then subject to reduced representative bisulfite sequencing for DNA methylation analysis. Results showed that in the control diet group, 1,958 differentially methylated CpG sites (DMCGs) were identified between cows that resulted in pregnancy and those that resulted in no pregnancy of which 890 DMCGs were located on chr 27: 6217254-6225600 bp. A total of 537 DMCGs were overlapped with 313 annotated genes that were involved in various pathways including signal transduction, signalling by GPCR, aldosterone synthesis and secretion. Likewise, in methionine supplemented group, 3,430 CpG sites were differentially methylated between the two cow groups of which 18.7% were located on Chr27: 6217254-6225600 bp. A total of 1,781 DMCGS were overlapped with 890 genes which involved in developmental and signalling related pathways including WNT-signalling, focal adhesion and ECM receptor interaction. Interestingly, 149 genes involved in signal transduction, axon guidance and non-integrin membrane-ECM interactions were differentially methylated between the two cow groups irrespective of their feeding regime, while 453 genes involved in axon guidance, notch signalling and collagen formation were differentially methylated between cows that received rumen protected methionine and control diet irrespective of their fertility status. Overall, this study indicated that postpartum cows that could potentially become pregnant could be distinguishable based on their endometrial DNA methylation patterns at the time of breeding.

CCPG1
Also flagged:cervical cancerCCcancercancerspapillomavirusHPV) infection
Journal Article 2024-01-24 ✓ 1 Snippet Jafari A, Farahani M, Abdollahpour-Alitappeh M, Manzari-Tavakoli A, Yazdani M, Rezaei-Tavirani M.
In-Text Gene Mentions

Proteomic analysis, combined with tumor xenograft modelling, revealed that metformin reduced the expression of five proteins, namely TGFβ-1, TRIM26, CCPG1, MTR, LGMN, SLC38A2, ATP6AP1, CIRBP, and PTP4A1, while increasing the expression of IGFBP7 and CYR61.

Show Full Abstract

Cervical cancer (CC) is a major global health problem and leading cause of cancer deaths among women worldwide. Early detection through screening programs has reduced mortality; however, screening compliance remains low. Identifying non-invasive biomarkers through proteomics for diagnosis and monitoring response to treatment could improve patient outcomes. Here we review recent proteomics studies which have uncovered biomarkers and potential drug targets for CC. Additionally, we explore into the role of cervical cancer stem cells and their potential implications in driving CC progression and therapy resistance. Although challenges remain, proteomics has the potential to revolutionize the field of cervical cancer research and improve patient outcomes.

HFE
Also flagged:hepatocellular carcinomaLiver cancercancerhepatocellular liver cancercholangiocarcinomamixed cell carcinoma
Journal Article 2024-01-24 ✓ 1 Snippet Fan M, Niu T, Lin B, Gao F, Tan B, Du X.
In-Text Gene Mentions

…non-tumor diseases, includinghemochromatosis, chronic kidney disease,…

Show Full Abstract

The present study investigated the prognostic impact of preoperative serum ferritin (SF) levels on the survival of patients with hepatocellular carcinoma (HCC) undergoing transarterial chemoembolization (TACE). Clinicopathological characteristics and laboratory biomarkers of 223 patients with HCC who underwent TACE were retrospectively reviewed. The Kaplan-Meier method was used to calculate the overall survival (OS), and the log-rank test was used to evaluate statistical significance. Univariate and multivariate analyses were performed using Cox proportional hazards regression to evaluate the prognostic impact of SF in these patients. The present findings identified extrahepatic metastases [hazard ratio (HR)=0.490,95%; confidence interval (CI)=0.282-0.843; P=0.010)] and vascular invasion (HR=0.373; 95% CI=0.225-0.619; P<0.0001) as independent prognostic factors for OS. However, preoperative SF levels could not independently predict OS when compared with other prognostic factors (HR=0.810; 95% CI=0.539-1.216; P=0.309). In conclusion, preoperative SF level is an unreliable biochemical predictor of survival in patients with HCC undergoing TACE.

SOX6
Also flagged:homeobox geneHoxc8innervationchondrocyte differentiationcell maturationoligonucleotide
Journal Article 2024-01-24 ✓ 1 Snippet Cormier SA, Kappen C.
In-Text Gene Mentions

…Sox9, Sox5, andSox6are well-known transcriptional…

Show Full Abstract

<i>Hox</i> genes encode transcription factors whose roles in patterning animal body plans during embryonic development are well-documented. Multiple studies demonstrate that <i>Hox</i> genes continue to act in adult cells, in normal differentiation, in regenerative processes, and, with abnormal expression, in diverse types of cancers. However, surprisingly little is known about the regulatory mechanisms that govern <i>Hox</i> gene expression in specific cell types, as they differentiate during late embryonic development, and in the adult organism. The murine <i>Hoxc8</i> gene determines the identity of multiple skeletal elements in the lower thoracic and lumbar region and continues to play a role in the proliferation and differentiation of cells in cartilage as the skeleton matures. This study was undertaken to identify regulatory elements in the <i>Hoxc8</i> gene that control transcriptional activity, specifically in cartilage-producing chondrocytes. We report that an enhancer comprising two 416 and 224 bps long interacting DNA elements produces reporter gene activity when assayed on a heterologous transcriptional promoter in transgenic mice. This enhancer is distinct in spatial, temporal, and molecular regulation from previously identified regulatory sequences in the <i>Hoxc8</i> gene that control its expression in early development. The identification of a tissue-specific <i>Hox</i> gene regulatory element now allows mechanistic investigations into Hox transcription factor expression and function in differentiating cell types and adult tissues and to specifically target these cells during repair processes and regeneration.

SUDS3
Also flagged:Histone H1.2linker histonechromatincell cycleviral diseasesinnate immunity
Journal Article 2024-01-24 ✓ 2 Snippets Song Y, Li H, Lian R, Dou X, Li S, Xie J, Li X, Feng R, Li Z.
In-Text Gene Mentions

…al. found thatlinker histoneshistones, especially H1.2,…

…the gap oflinker histoneshistones relating to…

Show Full Abstract

Histone H1.2 is a member of the linker histone family, which plays extensive and crucial roles not only in the regulation of chromatin dynamics, cell cycle, and cell apoptosis, but also in viral diseases and innate immunity response. Recently, it was discovered that H1.2 regulates interferon-β and inhibits influenza virus replication, whereas its role in other viral infections is poorly reported. Here, we first found the up-regulation of H1.2 during Encephalomyocarditis virus (EMCV) infection, implying that H1.2 was involved in EMCV infection. Overexpression of H1.2 inhibited EMCV proliferation, whereas knockdown of H1.2 showed a significant promotion of virus infection in HEK293T cells. Moreover, we demonstrated that overexpression of H1.2 remarkably enhanced the production of EMCV-induced type I interferon, which may be the crucial factor for H1.2 proliferation-inhibitory effects. We further found that H1.2 up-regulated the expression of the proteins of the MDA5 signaling pathway and interacted with MDA5 and IRF3 in EMCV infection. Further, we demonstrated that H1.2 facilitated EMCV-induced phosphorylation and nuclear translocation of IRF3. Briefly, our research uncovers the mechanism of H1.2 negatively regulating EMCV replication and provides new insight into antiviral targets for EMCV.

HFE
Also flagged:Ironhepatic fibrosisarthritisdiabetes mellitusalcoholchronic hepatic disease
Journal Article 2024-01-24 ✓ 5 Snippets Olynyk JK, St Pierre TG, Chen J, Frazer DM, Ramm LE, Ramm GA.
In-Text Gene Mentions

…66 women withhemochromatosiswho underwent liver…

…in hemostatic iron regulator-hemochromatosisindividuals who also…

…Hepatic Fibrosis inHemochromatosis

…ims Hemostatic iron regulator-hemochromatosiscan result in…

…diagnosed individuals withhemochromatosis.…

Show Full Abstract

<h4>Background and aims</h4>Hemostatic iron regulator-hemochromatosis can result in progressive iron-loading and advanced hepatic fibrosis in some individuals. We studied total body and hepatic iron loading to determine whether the distribution of iron-loading influences the risk of advanced fibrosis.<h4>Methods</h4>One hundred thirty-eight men and 66 women with hemochromatosis who underwent liver biopsy for staging of hepatic fibrosis had evaluation of hepatic iron concentration (HIC), hepatic iron index (HIC/age), total body iron stores (mobilizable iron), and mobilizable iron/HIC ratio (a marker of total body iron relative to hepatic iron). The potential impact of liver volume on mobilizable iron stores was assessed using magnetic resonance imaging in a separate cohort of 19 newly diagnosed individuals with hemochromatosis.<h4>Results</h4>Of 204 biopsied subjects, 41 had advanced fibrosis and exhibited 60% greater accumulation of mobilizable iron relative to HIC (mean 0.070 ± 0.008 g Fe/[μmol Fe/g]) compared with 163 subjects with low-grade fibrosis (mean 0.044 ± 0.002 g Fe/[μmol Fe/g], <i>P</i> < .0001). Linear regression modeling confirmed a discrete advanced hepatic fibrosis phenotype associated with greater mobilizable iron stores relative to HIC. The ratios of the upper to lower 95% limits of the distributions of liver volumes and the mobilizable iron/HIC ratios were 2.7 (95% confidence interval 2.3-3.0) and 9.7 (95% confidence interval 8.0-11.7), respectively, indicating that the distribution of liver volumes is not sufficiently wide to explain the variability in mobilizable iron/HIC ratios, suggesting that significant extrahepatic iron loading is present in those with advanced hepatic fibrosis.<h4>Conclusion</h4>Advanced hepatic fibrosis develops in hemostatic iron regulator-hemochromatosis individuals who also have excessive extrahepatic mobilizable iron stores.

Also flagged:mineralOsteoporosisage-related diseaseOPGbindingmetabolism
Journal Article 2024-01-24 No Snippets Yalaev BI, Novikov AV, Minniakhmetov IR, Khusainova RI.
Show Full Abstract

<h4>Background</h4>Osteoporosis is a common age-related disease with disabling consequences, the early diagnosis of which is difficult due to its long and hidden course, which often leads to diagnosis only after a fracture. In this regard, great expectations are placed on advanced developments in machine learning technologies aimed at predicting osteoporosis at an early stage of development, including the use of large data sets containing information on genetic and clinical predictors of the disease. Nevertheless, the inclusion of DNA markers in prediction models is fraught with a number of difficulties due to the complex polygenic and heterogeneous nature of the disease. Currently, the predictive power of neural network models is insufficient for their incorporation into modern osteoporosis diagnostic protocols. Studies in this area are sporadic, but are widely demanded, as their results are of great importance for preventive medicine. This leads to the need to search for the most effective machine learning approaches and optimise the selection of genetic markers as input parameters to neural network models.<h4>Aim</h4>to evaluate the effectiveness of machine learning and neural network analysis to develop predictive risk models for osteoporosis based on clinical predictors and genetic markers of osteoporetic fractures.<h4>Materials and methods</h4>The predictive models were trained using a database of genotyping and clinical characteristics of 701 women and 501 men living in the Volga-Ural region of Russia. Anthropometric parameters, data on gender, bone mineral density level, and the results of genotyping of 152 polymorphic loci of candidate genes and replication loci of the GEFOS consortium's full genome-wide association search were included as input parameters.<h4>Results</h4>It was found that the model for predicting low bone mineral density, including 6 polymorphic variants of the OPG gene (rs2073618, rs2073617, rs7844539, rs3102735, rs3134069) and 5 polymorphic variants of microRNA binding sites in the mRNA of genes involved in bone metabolism (COL11A1 - rs1031820, FGF2 - rs6854081, miR-146 - rs2910164, ZNF239 - rs10793442, SPARC - rs1054204 and VDR - rs11540149) (AUC=0.81 for men and AUC=0.82 for women).<h4>Conclusion</h4>The results confirm the promising application of machine learning to predict the risk of osteoporosis at the preclinical stage of the disease based on the analysis of clinical and genetic factors.

Also flagged:Tinctoric acidhopan-type triterpenoidsα-glucosidasetinctoric acid A-Bglucosidaseacarbose
Journal Article 2024-01-23 No Snippets Hoang LT, Phan HV, Nguyen-Si HV, Tran TN, Vo TP, Le HTT, Dao NV, Huynh TM, Mai DT, Dong PS, Nguyen VK.
Show Full Abstract

Two new hopan-type triterpenoids, namely tinctoric acid A-B (<b>1-2</b>), were isolated from the lichen <i>Parmotrema tinctorum</i> (Despr. ex Nyl.) Hale. Their structures were elucidated by extensive spectroscopic analyses (1D and 2D NMR). The absolute configuration at C-22 of <b>1</b> was established through DP4 probability. Compounds <b>1-2</b> were evaluated for their inhibitory activity against <i>α-</i>glucosidase and found to be more potent than those of positive control (acarbose, IC<sub>50</sub> 168 µM) with values IC<sub>50</sub> 74.7 and 98.2 µM, respectively. Both of these compounds interacted well with enzyme α-glucosidase MAL32 through H-bonds and hydrophobic interaction.

Also flagged:Phenolic amidesalkaloidsbiosynthesismetabolismtosignal transduction
Journal Article 2024-01-23 No Snippets Xie X, Lin M, Xiao G, Liu H, Wang F, Liu D, Ma L, Wang Q, Li Z.
Show Full Abstract

Oats (<i>Avena sativa</i> L.) are one of the worldwide cereal crops. Avenanthramides (AVNs), the unique plant alkaloids of secondary metabolites found in oats, are nutritionally important for humans and animals. Numerous bioactivities of AVNs have been investigated and demonstrated <i>in vivo</i> and <i>in vitro</i>. Despite all these, researchers from all over the world are taking efforts to learn more knowledge about AVNs. In this work, we highlighted the recent updated findings that have increased our understanding of AVNs bioactivity, distribution, and especially the AVNs biosynthesis. Since the limits content of AVNs in oats strictly hinders the demand, understanding the mechanisms underlying AVN biosynthesis is important not only for developing a renewable, sustainable, and environmentally friendly source in both plants and microorganisms but also for designing effective strategies for enhancing their production via induction and metabolic engineering. Future directions for improving AVN production in native producers and heterologous systems for food and feed use are also discussed. This summary will provide a broad view of these specific natural products from oats.

OLFM4
Also flagged:colorectal cancerColitis-associated cancerinflammatory bowel diseasechronic intestinal disordertumorimmune responses
Journal Article 2024-01-23 ✓ 5 Snippets Dong X, Qi M, Cai C, Zhu Y, Li Y, Coulter S, Sun F, Liddle C, Uboha NV, Halberg R, Xu W, Marker P, Fu T.
In-Text Gene Mentions

…[CST], catalog 9449s; anti-Olfm4, 1:100, CST, catalog…

…CST, catalog 9449s; anti-Olfm4, 1:100, CST, catalog…

…( Lgr5 ,Olfm4, etc.)…

…proliferation illustrated byOlfm4and Ki67 (a…

…Notably, expression ofOlfm4and Ki67 decreased…

Show Full Abstract

Bile acids (BAs) affect the intestinal environment by ensuring barrier integrity, maintaining microbiota balance, regulating epithelium turnover, and modulating the immune system. As a master regulator of BA homeostasis, farnesoid X receptor (FXR) is severely compromised in patients with inflammatory bowel disease (IBD) and colitis-associated colorectal cancer (CAC). At the front line, gut macrophages react to the microbiota and metabolites that breach the epithelium. We aim to study the role of the BA/FXR axis in macrophages. This study demonstrates that inflammation-induced epithelial abnormalities compromised FXR signaling and altered BAs' profile in a mouse CAC model. Further, gut macrophage-intrinsic FXR sensed aberrant BAs, leading to pro-inflammatory cytokines' secretion, which promoted intestinal stem cell proliferation. Mechanistically, activation of FXR ameliorated intestinal inflammation and inhibited colitis-associated tumor growth, by regulating gut macrophages' recruitment, polarization, and crosstalk with Th17 cells. However, deletion of FXR in bone marrow or gut macrophages escalated the intestinal inflammation. In summary, our study reveals a distinctive regulatory role of FXR in gut macrophages, suggesting its potential as a therapeutic target for addressing IBD and CAC.

Also flagged:benign recurrent vestibular vertigogeneralized anxiety disorderGADorganizationbenign recurrent vertigovertigo
Journal Article 2024-01-23 No Snippets Wang J, Lei Y, Tian L, Zuo J, Shen Y, Wang J.
Show Full Abstract

<h4>Background</h4>Short-term personalized vestibular rehabilitation (ST-PVR) can establish stable vestibular compensation. However, there is a lack of a clear definition for clinical indicators that can dynamically reflect the progress of vestibular rehabilitation (VR).<h4>Objective</h4>To explore the clinical indicators suitable for evaluating the effectiveness of ST-PVR in treating benign recurrent vertigo (BRV).<h4>Methods</h4>In total, 50 patients diagnosed with BRV were enrolled. All patients received the ST-PVR treatment program. At 2 and 4 weeks after rehabilitation, subjective scales, including the visual analogue scale (VAS), dizziness handicap inventory scale (DHI), activities-specific balance confidence scale (ABC) and generalized anxiety disorder (GAD-7) were assessed. Objective vestibular function tests were performed. VR grading was determined.<h4>Results</h4>At 2 weeks after rehabilitation, significant enhancements were observed in VAS, DHI, ABC, GAD-7, UW, vHIT results, and VR grading scores (p < 0.05). The sensory organization test (SOT) results demonstrated statistically significant improvements at 2 weeks and 4 weeks after rehabilitation (p < 0.05).<h4>Conclusion and significance</h4>Both subjective scales and partial examination results in objective assessment can serve as indicators to dynamically monitor the compensatory process of vestibular function in patients with BRV. The VR efficacy grading score, which incorporates the above indicators, allows for quantification of the changes that occur during the vestibular rehabilitation process.

Also flagged:coagulationFibrinogencoagulopathypostpartum hemorrhagePeripartum hemorrhageDelta
Journal Article 2024-01-23 No Snippets Schmitt FCF, Schöchl H, Brün K, Kreuer S, Schneider S, Hofer S, Weber CF.
Show Full Abstract

Viscoelastic test (VET) procedures suitable for point-of-care (POC) testing are in widespread clinical use. Due to the expanded range of available devices and in particular due to the development of new test approaches and methods, the authors believe that an update of the current treatment algorithms is necessary. The aim of this article is to provide an overview of the currently available VET devices and the associated reagents. In addition, two treatment algorithms for the VET devices most commonly used in German-speaking countries are presented.

HTT
Also flagged:SIRT3lysinelocalizationmitochondrialmetabolismcancer
Journal Article 2024-01-23 ✓ 1 Snippet Lambona C, Zwergel C, Valente S, Mai A.
In-Text Gene Mentions

They focused on HD, which is a hereditary neurodegenerativecondition resulting from an anomalous expansion of polyglutamine inthe protein known as Huntingtin (Htt).236,237 The pathogenesisof HD is not yet well understood, but it seems that energy metabolism,oxidative stress, excitotoxicity, and transcriptional dysregulationare involved.238−241 Several studies reported that mutant Htt-induced neurotoxicity ismediated by mitochondrial dysfunction.242,243 Because SIRT3is implicated in the regulation of several mitochondrial enzymes,its activation could play a protective role in neurodegeneration.Moreover, in HD, aberrant Htt depletes SIRT3 protein levels.

Show Full Abstract

Sirtuins catalyze deacetylation of lysine residues with a NAD<sup>+</sup>-dependent mechanism. In mammals, the sirtuin family is composed of seven members, divided into four subclasses that differ in substrate specificity, subcellular localization, regulation, as well as interactions with other proteins, both within and outside the epigenetic field. Recently, much interest has been growing in SIRT3, which is mainly involved in regulating mitochondrial metabolism. Moreover, SIRT3 seems to be protective in diseases such as age-related, neurodegenerative, liver, kidney, heart, and metabolic ones, as well as in cancer. In most cases, activating SIRT3 could be a promising strategy to tackle these health problems. Here, we summarize the main biological functions, substrates, and interactors of SIRT3, as well as several molecules reported in the literature that are able to modulate SIRT3 activity. Among the activators, some derive from natural products, others from library screening, and others from the classical medicinal chemistry approach.

Also flagged:proteinase KdigestionphenolchloroformTricainechromatin
Journal Article 2024-01-23 No Snippets Marlétaz F, Timoshevskaya N, Timoshevskiy VA, Parey E, Simakov O, Gavriouchkina D, Suzuki M, Kubokawa K, Brenner S, Smith JJ, Rokhsar DS.
Show Full Abstract

As the only surviving lineages of jawless fishes, hagfishes and lampreys provide a crucial window into early vertebrate evolution<sup>1-3</sup>. Here we investigate the complex history, timing and functional role of genome-wide duplications<sup>4-7</sup> and programmed DNA elimination<sup>8,9</sup> in vertebrates in the light of a chromosome-scale genome sequence for the brown hagfish Eptatretus atami. Combining evidence from syntenic and phylogenetic analyses, we establish a comprehensive picture of vertebrate genome evolution, including an auto-tetraploidization (1R<sub>V</sub>) that predates the early Cambrian cyclostome-gnathostome split, followed by a mid-late Cambrian allo-tetraploidization (2R<sub>JV</sub>) in gnathostomes and a prolonged Cambrian-Ordovician hexaploidization (2R<sub>CY</sub>) in cyclostomes. Subsequently, hagfishes underwent extensive genomic changes, with chromosomal fusions accompanied by the loss of genes that are essential for organ systems (for example, genes involved in the development of eyes and in the proliferation of osteoclasts); these changes account, in part, for the simplification of the hagfish body plan<sup>1,2</sup>. Finally, we characterize programmed DNA elimination in hagfish, identifying protein-coding genes and repetitive elements that are deleted from somatic cell lineages during early development. The elimination of these germline-specific genes provides a mechanism for resolving genetic conflict between soma and germline by repressing germline and pluripotency functions, paralleling findings in lampreys<sup>10,11</sup>. Reconstruction of the early genomic history of vertebrates provides a framework for further investigations of the evolution of cyclostomes and jawed vertebrates.

B4GALT5
Also flagged:COVID-19extracellularendomembraneinfectionTP53MYC
Journal Article 2024-01-23 ✓ 2 Snippets Oliveira TT, Freitas JF, de Medeiros VPB, Xavier TJDS, Agnez-Lima LF.
In-Text Gene Mentions

SRPK1, CSGALNACT2, B4GALT5, MEGF9, and KLF5 have increased mRNA expression in patients with severe COVID-19 compared with mild and non-COVID-19 patients.

…, CSGALNACT2 ,B4GALT5, MEGF9 ,…

Show Full Abstract

During the COVID-19 pandemic, RNA-seq datasets were produced to investigate the virus-host relationship. However, much of these data remains underexplored. To improve the search for molecular targets and biomarkers, we performed an integrated analysis of multiple RNA-seq datasets, expanding the cohort and including patients from different countries, encompassing severe and mild COVID-19 patients. Our analysis revealed that severe COVID-19 patients exhibit overexpression of genes coding for proteins of extracellular exosomes, endomembrane system, and neutrophil granules (e.g., <i>S100A9</i>, <i>LY96</i>, and <i>RAB1B</i>), which may play an essential role in the cellular response to infection. Concurrently, these patients exhibit down-regulation of genes encoding components of the T cell receptor complex and nucleolus, including <i>TP53</i>, <i>IL2RB</i>, and <i>NCL</i> Finally, SPI1 may emerge as a central transcriptional factor associated with the up-regulated genes, whereas TP53, MYC, and MAX were associated with the down-regulated genes during COVID-19. This study identified targets and transcriptional factors, lighting on the molecular pathophysiology of syndrome coronavirus 2 infection.

LRRC7
Also flagged:TrkBtropomyosin kinase receptor Bgene expressionimmune responsesnucleusneurodevelopmental disorders
Journal Article 2024-01-23 ✓ 5 Snippets Rodriguez LA, Tran MN, Garcia-Flores R, Oh S, Phillips RA, Pattie EA, Divecha HR, Kim SH, Shin JH, Lee YK, Montoya C, Jaffe AE, Collado-Torres L, Page SC, Martinowich K.
In-Text Gene Mentions

Lrrc7 is a risk gene for both ASDs [81] and emotional dysregulation in children [82], and iPSCs from schizophrenia patients display de novo mutations in Lrrc7 [83].

…, Shc3 ,Lrrc7, Rims2 ,…

Lrrc7encodes Densin-180, which…

…Lrrc7 encodesDensin-180, which interacts with…

…synaptic receptors, andLrrc7mutant mice have…

Show Full Abstract

The lateral septum (LS), a GABAergic structure located in the basal forebrain, is implicated in social behavior, learning, and memory. We previously demonstrated that expression of tropomyosin kinase receptor B (TrkB) in LS neurons is required for social novelty recognition. To better understand molecular mechanisms by which TrkB signaling controls behavior, we locally knocked down TrkB in LS and used bulk RNA-sequencing to identify changes in gene expression downstream of TrkB. TrkB knockdown induces upregulation of genes associated with inflammation and immune responses, and downregulation of genes associated with synaptic signaling and plasticity. Next, we generated one of the first atlases of molecular profiles for LS cell types using single nucleus RNA-sequencing (snRNA-seq). We identified markers for the septum broadly, and the LS specifically, as well as for all neuronal cell types. We then investigated whether the differentially expressed genes (DEGs) induced by TrkB knockdown map to specific LS cell types. Enrichment testing identified that downregulated DEGs are broadly expressed across neuronal clusters. Enrichment analyses of these DEGs demonstrated that downregulated genes are uniquely expressed in the LS, and associated with either synaptic plasticity or neurodevelopmental disorders. Upregulated genes are enriched in LS microglia, associated with immune response and inflammation, and linked to both neurodegenerative disease and neuropsychiatric disorders. In addition, many of these genes are implicated in regulating social behaviors. In summary, the findings implicate TrkB signaling in the LS as a critical regulator of gene networks associated with psychiatric disorders that display social deficits, including schizophrenia and autism, and with neurodegenerative diseases, including Alzheimer's.

PLCL1
Also flagged:Renal cell carcinomaRCCClear cell renal cell carcinomaccRCCtumorslipid droplets
Journal Article 2024-01-23 ✓ 2 Snippets Xiao H, Qu Y, Li H, Zhang Y, Fei M, Liang C, Yang H, Zhang X.
In-Text Gene Mentions

Our previous study showed that lipid browning mediated by PLCL1/UCP1 promotes tumor cell “slimming” and causes abnormal lipid accumulation, which represses the progression of ccRCC [22].

…browning mediated byPLCL1/UCP1 promotes tumor cell…

Show Full Abstract

<h4>Background</h4>The VHL-HIF pathway and lipid droplet accumulation are the main characteristics of clear cell renal cell carcinoma (ccRCC). However, the connection between the two features is largely unknown.<h4>Methods</h4>We used transcriptional sequencing and TCGA database analysis to identify APOL1 as a novel therapeutic target for ccRCC. The oncogenic functions of APOL1 were investigated by cell proliferation, colony formation, migration and invasion assays in ccRCC cells in vitro and xenografts derived from ccRCC cells in vivo. Oil red O staining and quantification were used to detect lipid droplets. Chromatin immunoprecipitation (ChIP) assays and luciferase reporter assays were carried out to identify HIF-2α bound to the promoter of APOL1 and lncRNA LINC02609. RNA-FISH and luciferase reporter assays were performed to determine that LncRNA LINC02609 functions as a competing endogenous RNA to regulate APOL1 expression by sponging miR-149-5p.<h4>Findings</h4>RNA-seq data revealed that HIF2α can regulate APOL1 and lncRNA LINC02609 expression. We also found that HIF-2α can bind to the promoter of APOL1 and lncRNA LINC02609 and transcriptionally regulate their expression directly. We further demonstrated that LncRNA LINC02609 functions as a competing endogenous RNA to regulate APOL1 expression by sponging miR-149-5p in ccRCC. Mechanistically, APOL1-dependent lipid storage is required for endoplasmic reticulum (ER) homeostasis and cell viability and metastasis in ccRCC. We also showed that high APOL1 expression correlated with worse clinical outcomes, and knockdown of APOL1 inhibited tumor cell lipid droplet formation, proliferation, metastasis and xenograft tumor formation abilities. Together, our studies identify that HIF2α can regulate the expression of the lipid metabolism related gene APOL1 by direct and indirect means, which are essential for ccRCC tumorigenesis.<h4>Interpretation</h4>Based on the experimental data, in ccRCC, the HIF-2α/LINC02609/APOL1 axis can regulate the expression of APOL1, thus interfering with lipid storage, promoting endoplasmic reticulum homeostasis and regulating tumor progression in ccRCC. Together, our findings provide potential biomarkers and novel therapeutic targets for future studies in ccRCC.

Also flagged:ADAR1acute lymphoblastic leukemialeukemiaRNA-editing enzymeadenosineinosine
Journal Article 2024-01-23 No Snippets Rivera M, Zhang H, Pham J, Isquith J, Zhou QJ, Balaian L, Sasik R, Enlund S, Mark A, Ma W, Holm F, Fisch KM, Kuo DJ, Jamieson C, Jiang Q.
Show Full Abstract

Leukemia-initiating cells (LICs) are regarded as the origin of leukemia relapse and therapeutic resistance. Identifying direct stemness determinants that fuel LIC self-renewal is critical for developing targeted approaches. Here, we show that the RNA-editing enzyme ADAR1 is a crucial stemness factor that promotes LIC self-renewal by attenuating aberrant double-stranded RNA (dsRNA) sensing. Elevated adenosine-to-inosine editing is a common attribute of relapsed T cell acute lymphoblastic leukemia (T-ALL) regardless of molecular subtype. Consequently, knockdown of ADAR1 severely inhibits LIC self-renewal capacity and prolongs survival in T-ALL patient-derived xenograft models. Mechanistically, ADAR1 directs hyper-editing of immunogenic dsRNA to avoid detection by the innate immune sensor melanoma differentiation-associated protein 5 (MDA5). Moreover, we uncover that the cell-intrinsic level of MDA5 dictates the dependency on the ADAR1-MDA5 axis in T-ALL. Collectively, our results show that ADAR1 functions as a self-renewal factor that limits the sensing of endogenous dsRNA. Thus, targeting ADAR1 presents an effective therapeutic strategy for eliminating T-ALL LICs.

PEBP1
Also flagged:Dexamethasonecytoskeletonsulfur mustardblepharitisphotosensitivitydry eye
Journal Article 2024-01-23 ✓ 1 Snippet Kant R, Mishra N, Kandhari K, Saba L, Michel C, Reisdorph R, Tewari-Singh N, Pantcheva MB, Petrash JM, Agarwal C, Agarwal R.
In-Text Gene Mentions

PEBP1

Show Full Abstract

<h4>Purpose</h4>Sulfur mustard (SM), a bi-functional alkylating agent, was used during World War I and the Iran-Iraq war. SM toxicity is ten times higher in eyes than in other tissues. Cornea is exceptionally susceptible to SM-injuries due to its anterior positioning and mucous-aqueous interphase. Ocular SM exposure induces blepharitis, photosensitivity, dry eye, epithelial defects, limbal ischemia and stem cell deficiency, and mustard gas keratopathy leading to temporary or permanent vision impairments. We demonstrated that dexamethasone (Dex) is a potent therapeutic intervention against SM-induced corneal injuries; however, its mechanism of action is not well known. Investigations employing proteomic profiling (LC-MS/MS) to understand molecular mechanisms behind SM-induced corneal injury and Dex efficacy were performed in the rabbit cornea exposed to SM and then received Dex treatment. PEAKS studio was used to extract, search, and summarize peptide identity. Ingenuity Pathway Analysis was used for pathway identification. Validation was performed using immunofluorescence. One-Way ANOVA (FDR < 0.05; p < 0.005) and Student's t-test (p < 0.05) were utilized for analyzing proteomics and IF data, respectively. Proteomic analysis revealed that SM-exposure upregulated tissue repair pathways, particularly actin cytoskeleton signaling and inflammation. Prominently dysregulated proteins included lipocalin2, coronin1A, actin-related protein2, actin-related protein2/3 complex subunit2, actin-related protein2/3 complex subunit4, cell division cycle42, ezrin, bradykinin/kininogen1, moesin, and profilin. Upregulated actin cytoskeleton signaling increases F-actin formation, dysregulating cell shape and motility. Dex reversed SM-induced increases in the aforementioned proteins levels to near control expression profiles. Dex aids corneal wound healing and improves corneal integrity via actin cytoskeletal signaling and anti-inflammatory effects following SM-induced injuries.

SERPINC1
Also flagged:GBMglucosepenicillinstreptomycinSodium Chloridesalts
Journal Article 2024-01-23 ✓ 3 Snippets Menezes A, Julião G, Mariath F, Ferreira AL, Oliveira-Nunes MC, Gallucci L, Evaristo JAM, Nogueira FCS, Pereira DA, Carneiro K.
In-Text Gene Mentions

…SERPINB, P30740 ;Antithrombin-III, SERPINC1, P01008 ;…

…P30740 ; Antithrombin-III,SERPINC1, P01008 ; Secreted…

…LTBP2, CRM-1, GAS6,SERPINC1, FAM20C).…

Show Full Abstract

Glioblastoma (GBM) is the most aggressive brain tumor and different efforts have been employed in the search for new drugs and therapeutic protocols for GBM. Epitranscriptomics has shed light on new druggable Epigenetic therapies specifically designed to modulate GBM biology and behavior such as Histone Deacetylase inhibitors (iHDAC). Although the effects of iHDAC on GBM have been largely explored, there is a lack of information on the underlaying mechanisms HDAC-dependent that modulate the repertoire of GBM secreted molecules focusing on the set of Extracellular Matrix (ECM) associated proteins, the Matrisome, that may impact the surrounding tumor microenvironment. To acquire a better comprehension of the impacts of HDAC activity on the GBM Matrisome, we studied the alterations on the Matrisome-associated ECM regulators, Core Matrisome ECM glycoproteins, ECM-affiliated proteins and Proteoglycans upon HDAC inhibition in vitro as well as their relationship with glioma pathophysiological/clinical features and angiogenesis. For this, U87MG GBM cells were treated for with iHDAC or vehicle (control) and the whole secretome was processed by Mass Spectrometry NANOLC-MS/MS. In silico analyses revealed that proteins associated to the Angiogenic Matrisome (AngioMatrix), including Decorin, ADAM10, ADAM12 and ADAM15 were differentially regulated in iHDAC versus control secretome. Interestingly, genes coding for the Matrisome proteins differentially regulated were found mutated in patients and were correlated to glioma pathophysiological/clinical features. In vitro functional assays, using HBMEC endothelial cells exposed to the secretome of control or iHDAC treated GBM cells, coupled to 2D and 3D GBM cell culture system, showed impaired migratory capacity of endothelial cells and disrupted tubulogenesis in a Fibronectin and VEGF independent fashion. Collectively, our study provides understanding of epigenetic mechanisms HDAC-dependent to key Matrisomal proteins that may contribute to identify new druggable Epigenetic therapies or gliomagenesis biomarkers with relevant implications to improve therapeutic protocols for this malignancy.

DDX27
Also flagged:AgingRecessive dystrophic epidermolysis bullosaRDEBCOL7A1squamous cell carcinomaskin cancer
Journal Article 2024-01-23 ✓ 1 Snippet Lee CAA, Wu S, Chow YT, Kofman E, Williams V, Riddle M, Eide C, Ebens CL, Frank MH, Tolar J, Hook KP, AlDubayan SH, Frank NY.
In-Text Gene Mentions

DDX27

Show Full Abstract

Recessive dystrophic epidermolysis bullosa (RDEB) is a severely debilitating disorder caused by pathogenic variants in COL7A1 and is characterized by extreme skin fragility, chronic inflammation, and fibrosis. A majority of patients with RDEB develop squamous cell carcinoma, a highly aggressive skin cancer with limited treatment options currently available. In this study, we utilized an approach leveraging whole-genome sequencing and RNA sequencing across 3 different tissues in a single patient with RDEB to gain insight into possible mechanisms of RDEB-associated squamous cell carcinoma progression and to identify potential therapeutic options. As a result, we identified PLK-1 as a possible candidate for targeted therapy and discovered microsatellite instability and accelerated aging as factors potentially contributing to the aggressive nature and early onset of RDEB squamous cell carcinoma. By integrating multitissue genomic and transcriptomic analyses in a single patient, we demonstrate the promise of bridging the gap between genomic research and clinical applications for developing tailored therapies for patients with rare genetic disorders such as RDEB.

HTT
Also flagged:nucleasePCSK9TTRlipidCD19antigen receptor
Journal Article 2024-01-23 ✓ 2 Snippets Sharrar A, Arake de Tacca L, Meacham Z, Staples-Ager J, Collingwood T, Rabuka D, Schelle M.
In-Text Gene Mentions

HD is characterized by expanded CAG repeats in the huntingtin (HTT) gene that lead to mutant protein production.

…the huntingtin (HTT) gene that…

Show Full Abstract

The precision of gene editing technology is critical to creating safe and effective therapies for treating human disease. While the programmability of CRISPR-Cas systems has allowed for rapid innovation of new gene editing techniques, the off-target activity of these enzymes has hampered clinical development for novel therapeutics. Here, we report the identification and characterization of a novel CRISPR-Cas12a enzyme from Acinetobacter indicus (AiCas12a). We engineer the nuclease (termed AiEvo2) for increased specificity, protospacer adjacent motif recognition, and efficacy on a variety of human clinical targets. AiEvo2 is highly precise and able to efficiently discriminate between normal and disease-causing alleles in Huntington's patient-derived cells by taking advantage of a single nucleotide polymorphism on the disease-associated allele. AiEvo2 efficiently edits several liver-associated target genes including PCSK9 and TTR when delivered to primary hepatocytes as mRNA encapsulated in a lipid nanoparticle. The enzyme also engineers an effective CD19 chimeric antigen receptor-T-cell therapy from primary human T cells using multiplexed simultaneous editing and chimeric antigen receptor insertion. To further ensure precise editing, we engineered an anti-CRISPR protein to selectively inhibit off-target gene editing while retaining therapeutic on-target editing. The engineered AiEvo2 nuclease coupled with a novel engineered anti-CRISPR protein represents a new way to control the fidelity of editing and improve the safety and efficacy of gene editing therapies.

DCC
Also flagged:carbon dioxideKanamycinantibodiesCHIPRBM5ubiquitin
Journal Article 2024-01-23 ✓ 1 Snippet Jin B, Wang M, Sun Y, Lee PAH, Zhang X, Lu Y, Zhao B.
In-Text Gene Mentions

…of p53, APC,DCC, and NF2…

Show Full Abstract

The protein kinase RNA-like endoplasmic reticulum kinase (PERK)-eukaryotic translation initiation factor 2 subunit α (eIF2α) pathway plays an essential role in endoplasmic reticulum (ER) stress. When the PERK-eIF2α pathway is activated, PERK phosphorylates eIF2α (p-eIF2α) at Ser51 and quenches global protein synthesis. In this study, we verified eIF2α as a bona fide substrate of the E3 ubiquitin ligase carboxyl terminus of the HSC70-interaction protein (CHIP) both in vitro and in cells. CHIP mediated the ubiquitination and degradation of nonphosphorylated eIF2α in a chaperone-independent manner and promoted the upregulation of the cyclic AMP-dependent transcription factor under endoplasmic reticulum stress conditions. Cyclic AMP-dependent transcription factor induced the transcriptional enhancement of the tumor suppressor genes PTEN and RBM5. Although transcription was enhanced, the PTEN protein was subsequently degraded by CHIP, but the expression of the RBM5 protein was upregulated, thereby suppressing the proliferation and migration of A549 cells. Overall, our study established a new mechanism that deepened the understanding of the PERK-eIF2α pathway through the ubiquitination and degradation of eIF2α. The crosstalk between the phosphorylation and ubiquitination of eIF2α shed light on a new perspective for tumor progression.

HFE
Also flagged:MineralsIronType 2 Diabeteshememineralmagnesium
Journal Article 2024-01-23 ✓ 1 Snippet Xu T, Wan S, Shi J, Xu T, Wang L, Guan Y, Luo J, Luo Y, Sun M, An P, He J.
In-Text Gene Mentions

…murine model ofhemochromatosis, iron deposition decreased…

Show Full Abstract

Inconsistent findings exist regarding the relationship between heme iron intake and type 2 diabetes (T2D) among Western and Eastern populations. Easterners tend to consume a plant-based diet which is abundant in antioxidant minerals. To examine the hypothesis that antioxidant mineral may modify the relationship between iron and T2D, we performed a case-control study by measuring the serum mineral levels in 2198 Chinese subjects. A total of 2113 T2D patients and 2458 controls were invited; 502 T2D patients and 1696 controls were finally analyzed. In the total population, high serum iron showed a positive association with T2D odds (odds ratio [OR] = 1.27 [1.04, 1.55]); high magnesium (OR = 0.18 [0.14, 0.22]), copper (OR = 0.27 [0.21, 0.33]), zinc (OR = 0.37 [0.30, 0.46]), chromium (OR = 0.61 [0.50, 0.74]), or selenium concentrations (OR = 0.39 [0.31, 0.48]) were inversely associated with T2D odds. In contrast, in individuals with higher magnesium (>2673.2 µg/dL), zinc (>136.7 µg/dL), copper (>132.1 µg/dL), chromium (>14.0 µg/dL), or selenium concentrations (>16.8 µg/dL), serum iron displayed no association with T2D (<i>p</i> > 0.05). Serum copper and magnesium were significant modifiers of the association between iron and T2D in individuals with different physiological status (<i>p</i> < 0.05). Our findings support the idea that consuming a diet rich in antioxidant minerals is an effective approach for preventing T2D.

Also flagged:Immunoglobulins Gconjugationprotein Asortase Aagaroseamino
Journal Article 2024-01-23 No Snippets Tereshin MN, Melikhova TD, Eletskaya BZ, Ksenofontova OB, Pantyushenko PV, Berzina MY, Ivanov I, Myagkikh IV, Stepanenko VN.
Show Full Abstract

Affinity chromatography resins that are obtained by conjugation of matrices with proteins of bacterial origin, like protein A, are frequently used for the purification of numerous therapeutic monoclonal antibodies. This article presents the development of a biocatalytic method for the production of novel affinity resins with an immobilized mutant form of protein A via sortase A mediated reaction. The conditions for activation of the agarose Seplife 6FF matrix, selection of different types of linkers with free amino groups and conditions for immobilization of recombinant protein A on the surface of the activated matrix were studied. Finally, the basic operational properties, like dynamic binding capacity (DBC), temperature dependance of DBC and stability during the cleaning-in-place process of the affinity resin with the Gly-Gly-EDA-Gly-Gly linker, were assessed using recombinant hyperchimeric monoclonal antibodies. The main characteristics show comparable results with the widely used commercial samples.

Also flagged:mepivacainesynthesisingamideropivacainebupivacaineCOVID-19
Journal Article 2024-01-23 No Snippets Díaz-Kruik P, Paradisi F.
Show Full Abstract

Local anaesthetics such as mepivacaine are key molecules in the medical sector, so ensuring their supply chain is crucial for every health care system. Rapid production of mepivacaine from readily available commercial reagents and (non-dry) solvents under safe conditions using portable, continuous apparatus could make an impactful difference in underdeveloped countries. In this work, we report a continuous platform for synthesising mepivacaine, one of the most widely used anaesthetics for minor surgeries. With a focus on sustainability, reaction efficiency and seamless implementation, this platform afforded the drug in 44% isolated yield following a concomitant distillation-crystallisation on a gram scale after <i>N</i>-functionalisation and amide coupling, with full recovery of the solvents and excess reagents. The use of flow chemistry as an enabling tool allowed the use of "forbidden" chemistry which is typically challenging for preparative and large scale reactions in batch mode. Overall, this continuous platform presents a promising and sustainable approach that has the potential to meet the demands of the healthcare industry.

HTT
Also flagged:Neurodegenerative Diseasegene expressionamyotrophic lateral sclerosisprion diseasesfatal familial insomniaacquired prion disease
Journal Article 2024-01-23 ✓ 2 Snippets Jackson WS, Bauer S, Kaczmarczyk L, Magadi SS.
In-Text Gene Mentions

HD is caused by the expansion of a CAG repeat in exon 1 of the huntingtin (HTT) gene, which is translated into a polyglutamine tract.

The first genetic mouse model with a disease-relevant phenotype, the R6/2 model, was generated by injecting a fragment of the mutant HTT gene from a human with HD into the pronucleus of a fertilized mouse oocyte, where it integrated into a random location [65].

Show Full Abstract

Neurodegenerative diseases (NDs) manifest a wide variety of clinical symptoms depending on the affected brain regions. Gaining insights into why certain regions are resistant while others are susceptible is vital for advancing therapeutic strategies. While gene expression changes offer clues about disease responses across brain regions, the mixture of cell types therein obscures experimental results. In recent years, methods that analyze the transcriptomes of individual cells (e.g., single-cell RNA sequencing or scRNAseq) have been widely used and have provided invaluable insights into specific cell types. Concurrently, transgene-based techniques that dissect cell type-specific translatomes (CSTs) in model systems, like RiboTag and bacTRAP, offer unique advantages but have received less attention. This review juxtaposes the merits and drawbacks of both methodologies, focusing on the use of CSTs in understanding conditions like amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), Alzheimer's disease (AD), and specific prion diseases like fatal familial insomnia (FFI), genetic Creutzfeldt-Jakob disease (gCJD), and acquired prion disease. We conclude by discussing the emerging trends observed across multiple diseases and emerging methods.

HFE
Also flagged:Fatty AcidSteatosisFatty liver hemorrhagic syndromeFLHSnutritionalmetabolic disease
Journal Article 2024-01-23 ✓ 1 Snippet Cheng X, Hu Y, Yu X, Chen J, Guo X, Cao H, Hu G, Zhuang Y.
In-Text Gene Mentions

…hepatic disorders includinghemochromatosis, hepatitis C virus…

Show Full Abstract

Fatty liver hemorrhagic syndrome (FLHS) in laying hens is a nutritional metabolic disease commonly observed in high-yielding laying hens. Sodium butyrate (NaB) and ferroptosis were reported to contribute to the pathogenesis of fatty liver-related diseases. However, the underlying mechanism of NaB in FLHS and whether it mediates ferroptosis remains unclear. A chicken primary hepatocyte induced by free fatty acids (FFAs, keeping the ratio of sodium oleate and sodium palmitate concentrations at 2:1) was established, which received treatments with NaB, the ferroptosis inducer RAS-selective lethal 3 (RSL3), and the inhibitor ferrostatin-1 (Fer-1). As a result, NaB increased biochemical and lipid metabolism indices, and the antioxidant level, while inhibiting intracellular ROS accumulation and the activation of the ferroptosis signaling pathway, as evidenced by a reduction in intracellular iron concentration, upregulated GPX4 and xCT expression, and inhibited NCOA4 and ACSL4 expression. Furthermore, treatment with Fer-1 reinforced the protective effects of NaB, while RSL3 reversed it by blocking the ROS/GPX4/ferroptosis pathway, leading to the accumulation of lipid droplets and oxidative stress. Collectively, our findings demonstrated that NaB protects hepatocytes by regulating the ROS/GPX4-mediated ferroptosis pathway, providing a new strategy and target for the treatment of FLHS.

Also flagged:chaperoneautophagyprotein degradationpathogenesisneurodegenerative diseasescancer
Journal Article 2024-01-23 No Snippets Valdor R, Martinez-Vicente M.
Show Full Abstract

Chaperone-mediated autophagy (CMA) is a selective proteolytic pathway in the lysosomes. Proteins are recognized one by one through the detection of a KFERQ motif or, at least, a KFERQ-like motif, by a heat shock cognate protein 70 (Hsc70), a molecular chaperone. CMA substrates are recognized and delivered to a lysosomal CMA receptor, lysosome-associated membrane protein 2A (LAMP-2A), the only limiting component of this pathway, and transported to the lysosomal lumen with the help of another resident chaperone HSp90. Since approximately 75% of proteins are reported to have canonical, phosphorylation-generated, or acetylation-generated KFERQ motifs, CMA maintains intracellular protein homeostasis and regulates specific functions in the cells in different tissues. CMA also regulates physiologic functions in different organs, and is then implicated in disease pathogenesis related to aging, cancer, and the central nervous and immune systems. In this minireview, we have summarized the most important findings on the role of CMA in tissue homeostasis and disease pathogenesis, updating the recent advances for this Special Issue.

Also flagged:maleimidecarbonic anhydrasealdolaseacetyltransferaseenzyme activitiessignal transduction
Journal Article 2024-01-23 No Snippets Son S, Song WJ.
Show Full Abstract

Protein design for self-assembly allows us to explore the emergence of protein-protein interfaces through various chemical interactions. Heterooligomers, unlike homooligomers, inherently offer a comprehensive range of structural and functional variations. Besides, the macromolecular repertoire and their applications would significantly expand if protein components could be easily interchangeable. This study demonstrates that a rationally designed bifunctional linker containing an enzyme inhibitor and maleimide can guide the formation of diverse protein heterooligomers in an easily applicable and exchangeable manner without extensive sequence optimizations. As proof of concept, we selected four structurally and functionally unrelated proteins, carbonic anhydrase, aldolase, acetyltransferase, and encapsulin, as building block proteins. The combinations of two proteins with the bifunctional linker yielded four two-component heterooligomers with discrete sizes, shapes, and enzyme activities. Besides, the overall size and formation kinetics of the heterooligomers alter upon adding metal chelators, acidic buffer components, and reducing agents, showing the reversibility and tunability in the protein self-assembly. Given that the functional groups of both the linker and protein components are readily interchangeable, our work broadens the scope of protein-assembled architectures and their potential applications as functional biomaterials.

HFE
Also flagged:IchthyosisHereditary hemochromatosisHHironcardiomyopathiesdiabetes
Journal Article 2024-01-23 ✓ 3 Snippets Arora N, Nguyen K, Hudson A, Bicknell L.
In-Text Gene Mentions

…mutation in theHFEgene [ 1…

…with exacerbations ofhemochromatosisbut are alleviated…

…mutation in theHFEgene, confirming a…

Show Full Abstract

Hereditary hemochromatosis (HH) is characterized by elevated iron absorption in the body, leading to iron accumulation with subsequent dysfunction and end-organ damage. While the progression of the disease can result in arthralgias, hepatomegaly, cardiomyopathies, and diabetes, over a third of HH patients present with cutaneous manifestations. We present the case of a 56-year-old male with HH who presented to dermatology with a rash and diffuse scaling. The patient exhibited brown plate-like scales clinically consistent with diffuse ichthyosis vulgaris. While ichthyosis has been seen in patients with idiopathic hemochromatosis, its association with HH is not well reported. Due to the high prevalence of cutaneous involvement in hereditary hemochromatosis, physicians should familiarize themselves with ichthyosis and the other dermatologic manifestations of this disease.

HTT
Also flagged:neurodegenerative diseasesspinocerebellar ataxiaspolyglutamine diseasesspinocerebellar ataxia 3glutamineATXN3
Journal Article 2024-01-23 ✓ 2 Snippets Hong EP, Ramos EM, Aziz NA, Massey TH, McAllister B, Lobanov S, Jones L, Holmans P, Kwak S, Orth M, Ciosi M, Lomeikaite V, Monckton DG, Long JD, Lucente D, Wheeler VC, Gillis T, MacDonald ME, Sequeiros J, Gusella JF, Lee JM.
In-Text Gene Mentions

…46 AlthoughHTTand ATXN3 have…

…, 47 neitherHTTnor ATXN3 are…

Show Full Abstract

Expansions of glutamine-coding CAG trinucleotide repeats cause a number of neurodegenerative diseases, including Huntington's disease and several of spinocerebellar ataxias. In general, age-at-onset of the polyglutamine diseases is inversely correlated with the size of the respective inherited expanded CAG repeat. Expanded CAG repeats are also somatically unstable in certain tissues, and age-at-onset of Huntington's disease corrected for individual <i>HTT</i> CAG repeat length (i.e. residual age-at-onset), is modified by repeat instability-related DNA maintenance/repair genes as demonstrated by recent genome-wide association studies. Modification of one polyglutamine disease (e.g. Huntington's disease) by the repeat length of another (e.g. <i>ATXN3,</i> CAG expansions in which cause spinocerebellar ataxia 3) has also been hypothesized. Consequently, we determined whether age-at-onset in Huntington's disease is modified by the CAG repeats of other polyglutamine disease genes. We found that the CAG measured repeat sizes of other polyglutamine disease genes that were polymorphic in Huntington's disease participants but did not influence Huntington's disease age-at-onset. Additional analysis focusing specifically on <i>ATXN3</i> in a larger sample set (<i>n</i> = 1388) confirmed the lack of association between Huntington's disease residual age-at-onset and <i>ATXN3</i> CAG repeat length. Additionally, neither our Huntington's disease onset modifier genome-wide association studies single nucleotide polymorphism data nor imputed short tandem repeat data supported the involvement of other polyglutamine disease genes in modifying Huntington's disease. By contrast, our genome-wide association studies based on imputed short tandem repeats revealed significant modification signals for other genomic regions. Together, our short tandem repeat genome-wide association studies show that modification of Huntington's disease is associated with short tandem repeats that do not involve other polyglutamine disease-causing genes, refining the landscape of Huntington's disease modification and highlighting the importance of rigorous data analysis, especially in genetic studies testing candidate modifiers.

HFE
Also flagged:DoxorubicinanthracyclineGSTM1CBR1ERBB2Cas9
Journal Article 2024-01-23 ✓ 5 Snippets Fonoudi H, Jouni M, Cejas RB, Magdy T, Blancard M, Ge N, Shah DA, Lyra-Leite DM, Neupane A, Gharib M, Jiang Z, Sapkota Y, Burridge PW.
In-Text Gene Mentions

HFEencodes the homeostatic…

…However,HFE-KO hiPSC-CMs exposed…

…, HAS3 ,HFE, MLH1 ,…

HFE-KO cardiomyocytes exhibit…

…iron uptake inHFE-KO cardiomyocytes compared…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies and candidate gene association studies have identified more than 180 genetic variants statistically associated with anthracycline-induced cardiotoxicity (AIC). However, the lack of functional validation has hindered the clinical translation of these findings.<h4>Objectives</h4>The aim of this study was to functionally validate all genes associated with AIC using human induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CMs).<h4>Methods</h4>Through a systemic literature search, 80 genes containing variants significantly associated with AIC were identified. Additionally, 3 more genes with potential roles in AIC (<i>GSTM1</i>, <i>CBR1</i>, and <i>ERBB2</i>) were included. Of these, 38 genes exhibited expression in human fetal heart, adult heart, and hiPSC-CMs. Using clustered regularly interspaced short palindromic repeats/Cas9-based genome editing, each of these 38 genes was systematically knocked out in control hiPSC-CMs, and the resulting doxorubicin-induced cardiotoxicity (DIC) phenotype was assessed using hiPSC-CMs. Subsequently, functional assays were conducted for each gene knockout on the basis of hypothesized mechanistic implications in DIC.<h4>Results</h4>Knockout of 26 genes increased the susceptibility of hiPSC-CMs to DIC. Notable genes included efflux transporters (<i>ABCC10</i>, <i>ABCC2</i>, <i>ABCB4</i>, <i>ABCC5</i>, and <i>ABCC9</i>), well-established DIC-associated genes (<i>CBR1</i>, <i>CBR3</i>, and <i>RAC2</i>), and genome-wide association study-discovered genes (<i>RARG</i> and <i>CELF4</i>). Conversely, knockout of <i>ATP2B1</i>, <i>HNMT</i>, <i>POR</i>, <i>CYBA</i>, <i>WDR4</i>, and <i>COL1A2</i> had no significant effect on the in vitro DIC phenotype of hiPSC-CMs. Furthermore, knockout of the uptake transporters (<i>SLC28A3</i>, <i>SLC22A17</i>, and <i>SLC28A1</i>) demonstrated a protective effect against DIC.<h4>Conclusions</h4>The present findings establish a comprehensive platform for the functional validation of DIC-associated genes, providing insights for future studies in DIC variant associations and potential mechanistic targets for the development of cardioprotective drugs.

Also flagged:Superoxide dismutaseSODdetoxificationnitrogenoxygensuperoxide
Journal Article 2024-01-23 No Snippets Chidambaram SB, Anand N, Varma SR, Ramamurthy S, Vichitra C, Sharma A, Mahalakshmi AM, Essa MM.
Show Full Abstract

Superoxide dismutase (SOD) is a common antioxidant enzyme found majorly in living cells. The main physiological role of SOD is detoxification and maintain the redox balance, acts as a first line of defence against Reactive nitrogen species (RNS), Reactive oxygen species (ROS), and other such potentially hazardous molecules. SOD catalyses the conversion of superoxide anion free radicals (O <sub>2 -</sub>.) into molecular oxygen (O <sub>2</sub>) and hydrogen peroxide (H <sub>2</sub>O <sub>2</sub>) in the cells. Superoxide dismutases (SODs) are expressed in neurons and glial cells throughout the CNS both intracellularly and extracellularly. Endogenous oxidative stress (OS) linked with enlarged production of reactive oxygen metabolites (ROMs), inflammation, deregulation of redox balance, mitochondrial dysfunction and bioenergetic crisis are found to be prerequisite for neuronal loss in neurological diseases. Clinical and genetic studies indicate a direct correlation between mutations in SOD gene and neurodegenerative diseases, like Amyotrophic Lateral Sclerosis (ALS), Huntington's disease (HD), Parkinson's Disease (PD) and Alzheimer's Disease (AD). Therefore, inhibitors of OS are considered as an optimistic approach to prevent neuronal loss. SOD mimetics like Metalloporphyrin Mn (II)-cyclic polyamines, Nitroxides and Mn (III)- Salen complexes are designed and used as therapeutic extensively in the treatment of neurological disorders. SODs and SOD mimetics are promising future therapeutics in the field of various diseases with OS-mediated pathology.

HFE
Also flagged:Hepatocellular CarcinomaMetabolic Dysfunctionnonalcoholic fatty liver diseaseliver fibrosisfibrosisSteatotic Liver Disease
Journal Article 2024-01-23 ✓ 1 Snippet Sarkar S, Alurwar A, Ly C, Piao C, Donde R, Wang CJ, Meyers FJ.
In-Text Gene Mentions

…to Wilson's disease,hemochromatosis, autoimmune hepatitis, primar…

Show Full Abstract

<h4>Background and aims</h4>Hepatocellular carcinoma (HCC) incidence is increasing and correlated with metabolic dysfunction-associated steatotic liver disease (MASLD; formerly nonalcoholic fatty liver disease), even in patients without advanced liver fibrosis who are more likely to be diagnosed with advanced disease stages and shorter survival time, and less likely to receive a liver transplant. Machine learning (ML) tools can characterize large datasets and help develop predictive models that can calculate individual HCC risk and guide selective screening and risk mitigation strategies.<h4>Methods</h4>Tableau and KNIME Analytics were used for descriptive analytics and ML tasks. ML models were developed using standard laboratory and clinical parameters. Sci-kit learn algorithms were used for model development. Data from University of California (UC), Davis, were used to develop and train a pilot predictive model, which was subsequently validated in an independent dataset from UC San Francisco. MASLD and HCC patients were identified by International Classification of Diseases-9/10 codes.<h4>Results</h4>Of the patients diagnosed with MASLD (n = 1561 training; n = 686 validation), HCC developed in 14% (n = 227) of the UC Davis training cohort and 25% (n = 176) of the UC San Francisco validation cohort. Liver fibrosis determined by the noninvasive Fibrosis-4 score was the strongest single predictor for HCC in the model. Using the validation cohort, the model predicted HCC development at 92.06% accuracy with an area under the curve of 0.97, F1-score of 0.84, 98.34% specificity, and 74.41% sensitivity.<h4>Conclusion</h4>ML models can aid physicians in providing early HCC risk assessment in patients with MASLD. Further validation will translate to cost-effective, personalized care of at-risk patients.

Research Square 2024-01-23 Preprint (No Snippets API) Pane A, de Brito T, Cardoso M, Atinbayeva N, Brito I, Costa Ld, Iovino N.
Show Full Abstract

<title>Abstract</title> <p>Piwi proteins and the associated Piwi-interacting RNAs (piRNAs) coordinate a surveillance system that protects the animal genome from DNA damage induced by transposable element (TE) mobilization. Here, we investigated the adaptation of the piRNA pathway to horizontally transferred transposons (HTTs) in the assassin bug <italic>Rhodnius prolixus</italic>, a primary vector of Chagas disease. <italic>Rhodnius </italic>acquired specific classes of HTTs by feeding on bats, opossums and squirrel monkeys. By analyzing the temporal dynamics of piRNA cluster expression and piRNA production during critical stages of <italic>Rhodnius </italic>development, we show that peak levels of ~28 nt long piRNAs correlate with reduced HTT and resident TE expression primarily during embryogenesis. Strikingly, while resident TEs piRNAs seem to engage in a typical ping-pong amplification mechanism, sense and antisense HTT piRNAs instead overlap by ~20 nt or do not display ping-pong signatures. These features are explained at least in part by the low number of HTT copies inserted into the piRNA clusters and might point to a non-canonical mechanism of biogenesis. Our data reveal that the piRNA, but not the siRNA pathway, responded to HTTs that were recently transferred from vertebrate tetrapods to a hematophagous insect of medical relevance.</p>

SOX6
Also flagged:Multiple sclerosisMSdemyelinating disease of thenervous systemmyelinExperimental autoimmune encephalomyelitis
Journal Article 2024-01-22 ✓ 2 Snippets Ji XY, Guo YX, Wang LB, Wu WC, Wang JQ, He J, Gao R, Rasouli J, Gao MY, Wang ZH, Xiao D, Zhang WF, Ciric B, Zhang Y, Li X.
In-Text Gene Mentions

…Plp2, Tcf7l2, Cdk5,Sox6.…

…Tcf7l2, Cdk5, andSox6were not significantly…

Show Full Abstract

Demyelination and failure of remyelination in the central nervous system (CNS) characterize a number of neurological disorders. Spontaneous remyelination in demyelinating diseases is limited, as oligodendrocyte precursor cells (OPCs), which are often present in demyelinated lesions in abundance, mostly fail to differentiate into oligodendrocytes, the myelinating cells in the CNS. In addition to OPCs, the lesions are assembled numbers of activated resident microglia/infiltrated macrophages; however, the mechanisms and potential role of interactions between the microglia/macrophages and OPCs are poorly understood. Here, we generated a transcriptional profile of exosomes from activated microglia, and found that miR-615-5p was elevated. miR-615-5p bound to 3'UTR of myelin regulator factor (MYRF), a crucial myelination transcription factor expressed in oligodendrocyte lineage cells. Mechanistically, exosomes from activated microglia transferred miR-615-5p to OPCs, which directly bound to MYRF and inhibited OPC maturation. Furthermore, an effect of AAV expressing miR-615-5p sponge in microglia was tested in experimental autoimmune encephalomyelitis (EAE) and cuprizone (CPZ)-induced demyelination model, the classical mouse models of multiple sclerosis. miR-615-5p sponge effectively alleviated disease progression and promoted remyelination. This study identifies miR-615-5p/MYRF as a new target for the therapy of demyelinating diseases.

HTT
Also flagged:probucolNeurodegenerative disorderslipidneurodegenerative diseasediabetesPD
Journal Article 2024-01-22 ✓ 1 Snippet Sharif A, Mamo J, Lam V, Al-Salami H, Mooranian A, Watts GF, Clarnette R, Luna G, Takechi R.
In-Text Gene Mentions

…expansion in theHTTgene, resulting in…

Show Full Abstract

Neurodegenerative disorders present complex pathologies characterized by various interconnected factors, including the aggregation of misfolded proteins, oxidative stress, neuroinflammation and compromised blood-brain barrier (BBB) integrity. Addressing such multifaceted pathways necessitates the development of multi-target therapeutic strategies. Emerging research indicates that probucol, a historic lipid-lowering medication, offers substantial potential in the realm of neurodegenerative disease prevention and treatment. Preclinical investigations have unveiled multifaceted cellular effects of probucol, showcasing its remarkable antioxidative and anti-inflammatory properties, its ability to fortify the BBB and its direct influence on neural preservation and adaptability. These diverse effects collectively translate into enhancements in both motor and cognitive functions. This review provides a comprehensive overview of recent findings highlighting the efficacy of probucol and probucol-related compounds in the context of various neurodegenerative conditions, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and cognitive impairment associated with diabetes.

PRDX6
Also flagged:Alzheimer's diseaseneurodegenerative disorderADtaupathogenesis
Journal Article 2024-01-22 ✓ 2 Snippets Astillero-Lopez V, Villar-Conde S, Gonzalez-Rodriguez M, Flores-Cuadrado A, Ubeda-Banon I, Saiz-Sanchez D, Martinez-Marcos A.
In-Text Gene Mentions

…PPP1R1B, BAG3, andPRDX6) and downregulated (GSK3B,…

…LMNA, MYL12A, andPRDX6) and 14 decreased…

Show Full Abstract

Alzheimer's disease (AD), the most prevalent neurodegenerative disorder worldwide, is clinically characterized by cognitive deficits. Neuropathologically, AD brains accumulate deposits of amyloid-β (Aβ) and tau proteins. Furthermore, these misfolded proteins can propagate from cell to cell in a prion-like manner and induce native proteins to become pathological. The entorhinal cortex (EC) is among the earliest areas affected by tau accumulation along with volume reduction and neurodegeneration. Neuron-glia interactions have recently come into focus; however, the role of microglia and astroglia in the pathogenesis of AD remains unclear. Proteomic approaches allow the determination of changes in the proteome to better understand the pathology underlying AD. Bioinformatic analysis of proteomic data was performed to compare ECs from AD and non-AD human brain tissue. To validate the proteomic results, western blot, immunofluorescence, and confocal studies were carried out. The findings revealed that the most disturbed signaling pathway was synaptogenesis. Because of their involvement in synapse function, relationship with Aβ and tau proteins and interactions in the pathway analysis, three proteins were selected for in-depth study: HSP90AA1, PTK2B, and ANXA2. All these proteins showed colocalization with neurons and/or astroglia and microglia and with pathological Aβ and tau proteins. In particular, ANXA2, which is overexpressed in AD, colocalized with amoeboid microglial cells and Aβ plaques surrounded by astrocytes. Taken together, the evidence suggests that unbalanced expression of HSP90AA1, PTK2B, and ANXA2 may play a significant role in synaptic homeostasis and Aβ pathology through microglial and astroglial cells in the human EC in AD.

Also flagged:deathHeart Failureferriccarboxymaltoseiron deficiencyCardiomyopathy
Journal Article 2024-01-22 No Snippets Harrington J, Mentz RJ, Rockhold FW, Garg J, Butler J, De Pasquale CG, Ezekowitz JA, Lewis GD, O'Meara E, Ponikowski P, Troughton RW, Wong YW, Adamczyk R, Storie T, Blackman N, Hernandez AF.
Show Full Abstract

<h4>Background</h4>Clinical trials in heart failure (HF) traditionally use time-to-event analyses focusing on death and hospitalization for HF. These time-to-first event analyses may have more limited abilities to assess the probability of benefiting from a therapy, especially if that benefit manifests as improved functional status rather than reduced risk of death or HF hospitalization. Hierarchical end points including clinical outcomes and patient status measures allow for ranked evaluation of outcomes in 1 metric assessing whether patients randomized to intervention or control are more likely to derive an overall benefit while also allowing more patients to contribute to the primary outcome.<h4>Methods</h4>We review the rationale for using hierarchical end points in HF trials, provide examples of HF trials that used this type of end point, and discuss its use in the HEART-FID trial (Randomized Placebo-Controlled Trial of Ferric Carboxymaltose as Treatment for Heart Failure With Iron Deficiency), the largest HF trial to date implementing a hierarchical end point analysis for the primary outcome.<h4>Results</h4>Using a hierarchical end point as the primary outcome allows for the inclusion of different types of outcomes in 1 ranked end point, making it possible to more holistically assess the potential utility of a new therapy on patient well-being and outcomes.<h4>Conclusions</h4>Hierarchical end points assess the potential utility of a new therapy on patient well-being and outcome more holistically than time-to-first event analysis. Trials that would not have been feasible due to decreasing rates of death and hospitalization in the HF population can use hierarchical end points to successfully power studies to identify promising HF therapies. The HEART-FID trial used hierarchical end points to better determine the role of intravenous ferric carboxymaltose in patients with HF.<h4>Registration</h4>URL: https://www.clinicaltrials.gov; Unique identifier: NCT03037931.

Also flagged:Colorectal cancercancertumordeath receptorsDR5death
Journal Article 2024-01-22 No Snippets Yang J, Du Y, Yao Y, Liao Y, Wang B, Yu X, Yuan K, Zhang Y, He F, Yang P.
Show Full Abstract

Although immunogenic cell death (ICD) inducers evidently enhance the effectiveness of immunotherapy, their potential is increasingly restricted by the development of apoptosis resistance in tumor cells, poor immunogenicity, and low T-cell immune responsiveness. In this study, for the first time, piezoelectrically catalyzed Mg<sup>2+</sup>-doped hydroxyapatite (Mg-HAP) nanoparticles, which are coated with a mesoporous silica layer and loaded with ONC201 as an agonist to specifically target the death receptor DR5 on tumor cells, ultimately developing an Mg-HAP@MS/ONC201 nanoparticle (MHMO NP) system, are engineered. Owing to its excellent piezoelectric properties, MHMO facilitates the release of a significant amount of reactive oxygen species and Ca<sup>2+</sup> within tumor cells, effectively promoting the upregulation of DR5 expression and inducing tumor cell necroptosis to ultimately overcome apoptosis resistance. Concurrently, Mg<sup>2+</sup> released in the tumor microenvironment promotes CD8<sup>+</sup> T receptor activation in response to the antitumor immune reaction induced by ICD. Using RNA-seq analysis, it is elucidated that MHMO can activate the NF-κB pathway under piezoelectric catalysis, thus inducing M1-type macrophage polarization. In summary, a dual-targeting therapy system that targets both tumor cells and the tumor microenvironment under piezoelectric catalysis is designed. This system holds substantial potential for advancements in tumor immunotherapy.

HTT
Also flagged:adenylyl cyclaseadenylyl cyclase type 8phosphorylationPKAPI3KAMPK
Journal Article 2024-01-22 ✓ 1 Snippet Qu JH, Chakir K, Tarasov KV, Riordon DR, Perino MG, Silvester AJ, Lakatta EG.
In-Text Gene Mentions

…al., 1995 ),HTT( Kumar et…

Show Full Abstract

Our prior study (Tarasov et al., 2022) discovered that numerous adaptive mechanisms emerge in response to cardiac-specific overexpression of adenylyl cyclase type 8 (TGAC8) which included overexpression of a large number of proteins. Here, we conducted an unbiased phosphoproteomics analysis in order to determine the role of altered protein phosphorylation in the adaptive heart performance and protection profile of adult TGAC8 left ventricle (LV) at 3-4 months of age, and integrated the phosphoproteome with transcriptome and proteome. Based on differentially regulated phosphoproteins by genotype, numerous stress-response pathways within reprogrammed TGAC8 LV, including PKA, PI3K, and AMPK signaling pathways, predicted upstream regulators (e.g. PDPK1, PAK1, and PTK2B), and downstream functions (e.g. cell viability, protein quality control), and metabolism were enriched. In addition to PKA, numerous other kinases and phosphatases were hyper-phosphorylated in TGAC8 vs. WT. Hyper-phosphorylated transcriptional factors in TGAC8 were associated with increased mRNA transcription, immune responses, and metabolic pathways. Combination of the phosphoproteome with its proteome and with the previously published TGAC8 transcriptome enabled the elucidation of cardiac performance and adaptive protection profiles coordinately regulated at post-translational modification (PTM) (phosphorylation), translational, and transcriptional levels. Many stress-response signaling pathways, i.e., PI3K/AKT, ERK/MAPK, and ubiquitin labeling, were consistently enriched and activated in the TGAC8 LV at transcriptional, translational, and PTM levels. Thus, reprogramming of the cardiac phosphoproteome, proteome, and transcriptome confers resilience to chronic adenylyl cyclase-driven stress. We identified numerous pathways/function predictions via gene sets, phosphopeptides, and phosphoproteins, which may point to potential novel therapeutic targets to enhance heart adaptivity, maintaining heart performance while avoiding cardiac dysfunction.

PRDX6
Also flagged:Cognitive DiseasesVascular cognitive impairmentcognitive impairmentagingDOLKTSC1
Journal Article 2024-01-22 ✓ 5 Snippets Zeylan ME, Senyuz S, Picón-Pagès P, García-Elías A, Tajes M, Muñoz FJ, Oliva B, Garcia-Ojalvo J, Barbu E, Vicente R, Nattel S, Ois A, Puig-Pijoan A, Keskin O, Gursoy A.
In-Text Gene Mentions

…YWHAZ, CREB3, HSPB1,PRDX6, and LMNA.…

…YWHAZ, CREB3, HSPB1,PRDX6, ATP13A2, and LMNA…

…genes HSPB1, AKT1,PRDX6, FLNA, VKORC1, ATXN1,…

…, 68 andPRDX6; 69 , 70…

…YWHAZ, CREB3, HSPB1,PRDX6, LMNA) have the…

Show Full Abstract

One of the primary goals of systems medicine is the detection of putative proteins and pathways involved in disease progression and pathological phenotypes. Vascular cognitive impairment (VCI) is a heterogeneous condition manifesting as cognitive impairment resulting from vascular factors. The precise mechanisms underlying this relationship remain unclear, which poses challenges for experimental research. Here, we applied computational approaches like systems biology to unveil and select relevant proteins and pathways related to VCI by studying the crosstalk between cardiovascular and cognitive diseases. In addition, we specifically included signals related to oxidative stress, a common etiologic factor tightly linked to aging, a major determinant of VCI. Our results show that pathways associated with oxidative stress are quite relevant, as most of the prioritized vascular cognitive genes and proteins were enriched in these pathways. Our analysis provided a short list of proteins that could be contributing to VCI: DOLK, TSC1, ATP1A1, MAPK14, YWHAZ, CREB3, HSPB1, PRDX6, and LMNA. Moreover, our experimental results suggest a high implication of glycative stress, generating oxidative processes and post-translational protein modifications through advanced glycation end-products (AGEs). We propose that these products interact with their specific receptors (RAGE) and Notch signaling to contribute to the etiology of VCI.

SOX6
Also flagged:M-CSFRANKLosteoclast differentiationformationsynthesismitochondrial
Journal Article 2024-01-22 ✓ 1 Snippet Zhang Z, Meng Y, Lin T, Zhang Z, Tao Z, Yin H, Yang F, Zhou X.
In-Text Gene Mentions

…ZFHX4, RPC5, andSOX6( Fig. 5…

Show Full Abstract

Long non-coding RNA (lncRNA) serves as a vital regulator of bone metabolism, but its role in pathologically overactive osteoclast differentiation remains elusive. Here, we identify lncRNA Dancr (Differentiation Antagonizing Non-protein Coding RNA) as a critical suppressor of osteoclastogenesis and bone resorption, which is down-regulated in response to estrogen deficiency. Global or osteoclast-specific Dancr Knockout mice display significant trabecular bone deterioration and enhanced osteoclast activity, but minimal alteration of bone formation. Moreover, the bone-targeted delivery of Dancr by Adeno-associated viral remarkably attenuates ovariectomy-induced osteopenia in mice. Mechanistically, Dancr establishes a direct interaction with Brahma-related gene 1 to prevent its binding and preserve H3K27me3 enrichment at the nuclear factor of activated T cells 1 and proliferator-activated receptor gamma coactivator 1-beta promoters, thereby maintaining appropriate expression of osteoclastic genes and metabolic programs during osteoclastogenesis. These results demonstrate that Dancr is a key molecule maintaining proper osteoclast differentiation and bone homeostasis under physiological conditions, and Dancr overexpression constitutes a potential strategy for treating osteoporosis.

HFE
Also flagged:BMPSMADTMPRSS6FKBP12Activin A Receptor type IALK2
Journal Article 2024-01-22 ✓ 1 Snippet Pettinato M, Aghajan M, Guo S, Bavuso Volpe L, Carleo R, Nai A, Pagani A, Altamura S, Silvestri L.
In-Text Gene Mentions

…ALK3, and thehemochromatosisproteins.…

Show Full Abstract

The Activin A Receptor type I (ALK2) is a critical component of BMP-SMAD signaling that, in the presence of ligands, phosphorylates cytosolic SMAD1/5/8 and modulates important biological processes, including bone formation and iron metabolism. In hepatocytes, the BMP-SMAD pathway controls the expression of <i>hepcidin</i>, the liver peptide hormone that regulates body iron homeostasis via the BMP receptors ALK2 and ALK3, and the hemochromatosis proteins. The main negative regulator of the pathway in the liver is transmembrane serine protease 6 (TMPRSS6), which downregulates <i>hepcidin</i> by cleaving the BMP coreceptor hemojuvelin. ALK2 function is inhibited also by the immunophilin FKBP12, which maintains the receptor in an inactive conformation. FKBP12 sequestration by tacrolimus or its silencing upregulates hepcidin in primary hepatocytes and in vivo in acute but not chronic settings. Interestingly, gain-of-function mutations in <i>ALK2</i> that impair FKBP12 binding to the receptor and activate the pathway cause a bone phenotype in patients affected by Fibrodysplasia Ossificans Progressiva but not hepcidin and iron metabolism dysfunction. This observation suggests that additional mechanisms are active in the liver to compensate for the increased BMP-SMAD signaling. Here we demonstrate that <i>Fkbp12</i> downregulation in hepatocytes by antisense oligonucleotide treatment upregulates the expression of the main hepcidin inhibitor <i>Tmprss6,</i> thus counteracting the ALK2-mediated activation of the pathway. Combined downregulation of both <i>Fkbp12</i> and <i>Tmprss6</i> blocks this compensatory mechanism. Our findings reveal a previously unrecognized functional cross talk between FKBP12 and TMPRSS6, the main BMP-SMAD pathway inhibitors, in the control of hepcidin transcription.<b>NEW & NOTEWORTHY</b> This study uncovers a previously unrecognized mechanism of hepcidin and BMP-SMAD pathway regulation in hepatocytes mediated by the immunophilin FKBP12 and the transmembrane serine protease TMPRSS6.

Also flagged:mitochondrialalcoholbrain developmentbehavioralsynapsegene expression
Journal Article 2024-01-22 No Snippets Arzua T, Yan Y, Liu X, Dash RK, Liu QS, Bai X.
Show Full Abstract

Alcohol consumption during pregnancy can significantly impact the brain development of the fetus, leading to long-term cognitive and behavioral problems. However, the underlying mechanisms are not well understood. In this study, we investigated the acute and chronic effects of binge-like alcohol exposure during the third trimester equivalent in postnatal day 7 (P7) mice on brain cell viability, synapse activity, cognitive and behavioral performance, and gene expression profiles at P60. Our results showed that alcohol exposure caused neuroapoptosis in P7 mouse brains immediately after a 6-hour exposure. In addition, P60 mice exposed to alcohol during P7 displayed impaired learning and memory abilities and anxiety-like behaviors. Electrophysiological analysis of hippocampal neurons revealed an excitatory/inhibitory imbalance in alcohol-treated P60 mice compared to controls, with decreased excitation and increased inhibition. Furthermore, our bioinformatic analysis of 376 dysregulated genes in P60 mouse brains following alcohol exposure identified 50 synapse-related and 23 mitochondria-related genes. These genes encoded proteins located in various parts of the synapse, synaptic cleft, extra-synaptic space, synaptic membranes, or mitochondria, and were associated with different biological processes and functions, including the regulation of synaptic transmission, transport, synaptic vesicle cycle, metabolism, synaptogenesis, mitochondrial activity, cognition, and behavior. The dysregulated synapse and mitochondrial genes were predicted to interact in overlapping networks. Our findings suggest that altered synaptic activities and signaling networks may contribute to alcohol-induced long-term cognitive and behavioral impairments in mice, providing new insights into the underlying synaptic and mitochondrial molecular mechanisms and potential neuroprotective strategies.

HFE
Also flagged:Disc degenerationmineralizationdiscagingchondrocyte-likecell differentiation
Journal Article 2024-01-22 ✓ 1 Snippet Novais EJ, Narayanan R, Canseco JA, van de Wetering K, Kepler CK, Hilibrand AS, Vaccaro AR, Risbud MV.
In-Text Gene Mentions

…such as ochronosis,hemochromatosis, chondrocalcinosis, ankylosin…

Show Full Abstract

Disc degeneration primarily contributes to chronic low back and neck pain. Consequently, there is an urgent need to understand the spectrum of disc degeneration phenotypes such as fibrosis, ectopic calcification, herniation, or mixed phenotypes. Amongst these phenotypes, disc calcification is the least studied. Ectopic calcification, by definition, is the pathological mineralization of soft tissues, widely studied in the context of conditions that afflict vasculature, skin, and cartilage. Clinically, disc calcification is associated with poor surgical outcomes and back pain refractory to conservative treatment. It is frequently seen as a consequence of disc aging and progressive degeneration but exhibits unique molecular and morphological characteristics: hypertrophic chondrocyte-like cell differentiation; TNAP, ENPP1, and ANK upregulation; cell death; altered Pi and PPi homeostasis; and local inflammation. Recent studies in mouse models have provided a better understanding of the mechanisms underlying this phenotype. It is essential to recognize that the presentation and nature of mineralization differ between AF, NP, and EP compartments. Moreover, the combination of anatomic location, genetics, and environmental stressors, such as aging or trauma, govern the predisposition to calcification. Lastly, the systemic regulation of calcium and Pi metabolism is less important than the local activity of PPi modulated by the ANK-ENPP1 axis, along with disc cell death and differentiation status. While there is limited understanding of this phenotype, understanding the molecular pathways governing local intervertebral disc calcification may lead to developing disease-modifying drugs and better clinical management of degeneration-related pathologies.

Also flagged:ironIron deficiencyIDiron-regulatory hormoneiron-deficiency anemiaIDA
Journal Article 2024-01-22 No Snippets Ebea-Ugwuanyi PO, Vidyasagar S, Connor JR, Frazer DM, Knutson MD, Collins JF.
Show Full Abstract

Iron deficiency (ID) and iron-deficiency anaemia (IDA) are global public health concerns, most commonly afflicting children, pregnant women and women of childbearing age. Pathological outcomes of ID include delayed cognitive development in children, adverse pregnancy outcomes and decreased work capacity in adults. IDA is usually treated by oral iron supplementation, typically using iron salts (e.g. FeSO<sub>4</sub> ); however, dosing at several-fold above the RDA may be required due to less efficient absorption. Excess enteral iron causes adverse gastrointestinal side effects, thus reducing compliance, and negatively impacts the gut microbiome. Recent research has sought to identify new iron formulations with better absorption so that lower effective dosing can be utilized. This article outlines emerging research on oral iron supplementation and focuses on molecular mechanisms by which different supplemental forms of iron are transported across the intestinal epithelium and whether these transport pathways are subject to regulation by the iron-regulatory hormone hepcidin.

Also flagged:Methyladenosineadeninem6A methyltransferasem6A demethylasemethyltransferase-like 3METTL3
Journal Article 2024-01-22 No Snippets Xu C, Song C, Wang W, Liu B, Li G, Fu T, Hao B, Li N, Geng Q.
Show Full Abstract

<h4>Background</h4>N6-Methyladenosine (m6A) methylation is the most prevalent post-transcriptional modification in mRNA, and plays significant roles in various diseases. Nevertheless, the precise functions of m6A modification in the formation of ALI remain unclear. In this study we explore the transcriptome distribution of m6A methylation and its probable roles of in ALI.<h4>Methods</h4>Lipopolysaccharide (LPS) was utilized to establish an ALI mouse model. Real-time qPCR, Western blotting and m6A dot blot were utilized to assess m6A methylation level and the expression of m6A methylation enzymes. MeRIP-Seq and RNA-seq were utilized to explore differential m6A modifications and differentially expressed genes in ALI mice. The hub genes and enriched pathways were assessed by Real-time qPCR and Western blotting.<h4>Results</h4>Our findings showed that overall m6A methylation level was increased in ALI mice lung tissues, accompanied by lower levels of METTL3 and FTO. Notably, the protein expression of these methylases were different in various cells. There were 772 differently expressed m6A peaks in ALI as compared to the control group, with 316 being hypermethylated and 456 being hypomethylated. GO and KEGG analyses demonstrated these differentially methylated genes were associated with the calcium signaling pathway and cAMP signaling pathway. Furthermore, we identified 50 genes with distinct m6A peaks and mRNA expressions by combined analysis of MeRIP-Seq and RNA-Seq. KEGG analysis also demonstrated that these overlapped genes were closely associated with the calcium signaling pathway, cGMP-PKG signaling pathway, etc. Besides, Western blotting results demonstrated that the protein expression of Fibronectin leucine-rich transmembrane protein 3 (Flrt3) as well as the calcium signaling pathway and cGMP-PKG signaling pathway, increased significantly after ALI.<h4>Conclusions</h4>m6A modification was paramount in the pathogenesis of ALI, and provided a foundation for the further investigation in the prevention and treatment of ALI.

HTT
Also flagged:amyotrophic lateral sclerosisALSneurodegenerative disorderC9orf72neurodegenerative diseasesuperoxide dismutase 1
Journal Article 2024-01-22 ✓ 2 Snippets Nagy ZF, Pál M, Engelhardt JI, Molnár MJ, Klivényi P, Széll M.
In-Text Gene Mentions

Excluding C9orf72 repeat expansions, 17.6% of clinically diagnosed ALS and FTD cases had at least one expanded short tandem repeat (STR) allele reported to be pathogenic or intermediate for another neurodegenerative diseases such as ATXN1 [spinal cerebellar ataxia type 1 (SCA1)], ATXN2 (SCA2), ATXN8 (SCA8), TBP (SCA17), HTT (Huntington’s disease), DMPK [myotonic dystrophy type 1 (DM1)], CNBP (DM2), and FMR1 (fragile-X disorders) [10].

…(SCA8), TBP (SCA17),HTT(Huntington’s disease), DMPK…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disorder which is characterized by the loss of both upper and lower motor neurons in the central nervous system. In a significant fraction of ALS cases - irrespective of family history- a genetic background may be identified. The genetic background of ALS shows a high variability from one ethnicity to another. The most frequent genetic cause of ALS is the repeat expansion of the C9orf72 gene. With the emergence of next-generation sequencing techniques and copy number alteration calling tools the focus in ALS genetics has shifted from disease causing genes and mutations towards genetic susceptibility and risk factors.In this review we aimed to summarize the most widely recognized and studied ALS linked repeat expansions and copy number variations other than the hexanucleotide repeat expansion in the C9orf72 gene. We compare and contrast their involvement and phenotype modifying roles in ALS among different populations.

Also flagged:neurodegenerative diseasesneurodegenerative disordersamyotrophic lateral sclerosisfrontotemporal dementiaTAR DNA-binding protein-43TDP-43
Journal Article 2024-01-22 No Snippets Khalil B, Linsenmeier M, Smith CL, Shorter J, Rossoll W.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are fatal neurodegenerative disorders on a disease spectrum that are characterized by the cytoplasmic mislocalization and aberrant phase transitions of prion-like RNA-binding proteins (RBPs). The common accumulation of TAR DNA-binding protein-43 (TDP-43), fused in sarcoma (FUS), and other nuclear RBPs in detergent-insoluble aggregates in the cytoplasm of degenerating neurons in ALS/FTD is connected to nuclear pore dysfunction and other defects in the nucleocytoplasmic transport machinery. Recent advances suggest that beyond their canonical role in the nuclear import of protein cargoes, nuclear-import receptors (NIRs) can prevent and reverse aberrant phase transitions of TDP-43, FUS, and related prion-like RBPs and restore their nuclear localization and function. Here, we showcase the NIR family and how they recognize cargo, drive nuclear import, and chaperone prion-like RBPs linked to ALS/FTD. We also discuss the promise of enhancing NIR levels and developing potentiated NIR variants as therapeutic strategies for ALS/FTD and related neurodegenerative proteinopathies.

Also flagged:DNA polymeraseβ-lactamaseα-amylaseresveratrolsynthesisrepair polymerase I
Journal Article 2024-01-22 No Snippets Chen S, Yang Z, Zhong Z, Yu S, Zhou J, Li J, Du G, Zhang G.
Show Full Abstract

<h4>Background</h4>Classical directed evolution is a powerful approach for engineering biomolecules with improved or novel functions. However, it traditionally relies on labour- and time-intensive iterative cycles, due in part to the need for multiple molecular biology steps, including DNA transformation, and limited screening throughput.<h4>Results</h4>In this study, we present an ultrahigh throughput in vivo continuous directed evolution system with thermosensitive inducible tunability, which is based on error-prone DNA polymerase expression modulated by engineered thermal-responsive repressor cI857, and genomic MutS mutant with temperature-sensitive defect for fixation of mutations in Escherichia coli. We demonstrated the success of the in vivo evolution platform with β-lactamase as a model, with an approximately 600-fold increase in the targeted mutation rate. Furthermore, the platform was combined with ultrahigh-throughput screening methods and employed to evolve α-amylase and the resveratrol biosynthetic pathway. After iterative rounds of enrichment, a mutant with a 48.3% improvement in α-amylase activity was identified via microfluidic droplet screening. In addition, when coupled with an in vivo biosensor in the resveratrol biosynthetic pathway, a variant with 1.7-fold higher resveratrol production was selected by fluorescence-activated cell sorting.<h4>Conclusions</h4>In this study, thermal-responsive targeted mutagenesis coupled with ultrahigh-throughput screening was developed for the rapid evolution of enzymes and biosynthetic pathways.

OLFM4
Also flagged:Cancercolorectal cancertumorCD44CD133Lgr5
Journal Article 2024-01-22 ✓ 1 Snippet Zhao Q, Zong H, Zhu P, Su C, Tang W, Chen Z, Jin S.
In-Text Gene Mentions

In APC mutant mice, the deletion of Olfm4 leads to colon adenocarcinoma [42].

Show Full Abstract

Cancer immunotherapy has emerged as a promising strategy in the treatment of colorectal cancer, and relapse after tumor immunotherapy has attracted increasing attention. Cancer stem cells (CSCs), a small subset of tumor cells with self-renewal and differentiation capacities, are resistant to traditional therapies such as radiotherapy and chemotherapy. Recently, CSCs have been proven to be the cells driving tumor relapse after immunotherapy. However, the mutual interactions between CSCs and cancer niche immune cells are largely uncharacterized. In this review, we focus on colorectal CSCs, CSC-immune cell interactions and CSC-based immunotherapy. Colorectal CSCs are characterized by robust expression of surface markers such as CD44, CD133 and Lgr5; hyperactivation of stemness-related signaling pathways, such as the Wnt/β-catenin, Hippo/Yap1, Jak/Stat and Notch pathways; and disordered epigenetic modifications, including DNA methylation, histone modification, chromatin remodeling, and noncoding RNA action. Moreover, colorectal CSCs express abnormal levels of immune-related genes such as MHC and immune checkpoint molecules and mutually interact with cancer niche cells in multiple tumorigenesis-related processes, including tumor initiation, maintenance, metastasis and drug resistance. To date, many therapies targeting CSCs have been evaluated, including monoclonal antibodies, antibody‒drug conjugates, bispecific antibodies, tumor vaccines adoptive cell therapy, and small molecule inhibitors. With the development of CSC-/niche-targeting technology, as well as the integration of multidisciplinary studies, novel therapies that eliminate CSCs and reverse their immunosuppressive microenvironment are expected to be developed for the treatment of solid tumors, including colorectal cancer.

Also flagged:nanohydroxyapatitecell proliferationodontogenicalkaline phosphataseALPosteogenesis
Journal Article 2024-01-22 No Snippets Melo EL, Cavalcanti PPAS, Pires CL, Tostes BVA, Miranda JM, Barbosa AA, Rocha SISD, Deama NS, Alves Junior S, Gerbi MEMM.
Show Full Abstract

One of the main challenges of tissue engineering in dentistry is to replace bone and dental tissues with strategies or techniques that simulate physiological tissue repair conditions. This systematic review of in vitro studies aimed to evaluate the influence of the addition of nanohydroxyapatite (NHap) to scaffolds on cell proliferation and osteogenic and odontogenic differentiation of human mesenchymal stem cells. In vitro studies on human stem cells that proliferated and differentiated into odontogenic and osteogenic cells in scaffolds containing NHap were included in this study. Searches in PubMed/MEDLINE, Scopus, Web of Science, OpenGrey, ProQuest, and Cochrane Library electronic databases were performed. The total of 333 articles was found across all databases. After reading and analyzing titles and abstracts, 8 articles were selected for full reading and extraction of qualitative data. Results showed that despite the large variability in scaffold composition, NHap-containing scaffolds promoted high rates of cell proliferation, increased alkaline phosphatase (ALP) activity during short culture periods, and induced differentiation, as evidenced by the high expression of genes involved in osteogenesis and odontogenesis. However, further studies with greater standardization regarding NHap concentration, type of scaffolds, and evaluation period are needed to observe possible interference of these criteria in the action of NHap on the proliferation and differentiation of human stem cells.

DCC
Also flagged:Mast Cell TumorMast cell tumorsSystemic mastocytosisKITCD117CD117 receptor
Journal Article 2024-01-22 ✓ 1 Snippet Zmorzynski S, Kimicka-Szajwaj A, Szajwaj A, Czerwik-Marcinkowska J, Wojcierowski J.
In-Text Gene Mentions

Ripretinib (DCC-2618) is a novel type II tyrosine switch control inhibitor for the treatment of KIT-mutated cancers, including gastrointestinal stromal tumors (GISTs).

Show Full Abstract

Mast cell tumors are a large group of diseases occurring in dogs, cats, mice, as well as in humans. Systemic mastocytosis (SM) is a disease involving the accumulation of mast cells in organs. <i>KIT</i> gene mutations are very often seen in abnormal mast cells. In SM, high KIT/CD117 expression is observed; however, there are usually no <i>KIT</i> gene mutations present. Mastocytoma (MCT)-a form of cutaneous neoplasm-is common in animals but quite rare in humans. KIT/CD117 receptor mutations were studied as the typical changes for human mastocytosis. In 80% of human cases, the <i>KIT</i> gene substitution p.D816H was present. In about 25% of MCTs, metastasis was observed. Changes in the gene expression of certain genes, such as overexpression of the <i>DNAJ3A3</i> gene, promote metastasis. In contrast, the <i>SNORD93</i> gene blocks the expression of metastasis genes. The panel of <i>miR-21-5p</i>, <i>miR-379</i>, and <i>miR-885</i> has a good efficiency in discriminating healthy and MCT-affected dogs, as well as MCT-affected dogs with and without nodal metastasis. Further studies on the pathobiology of mast cells can lead to clinical improvements, such as better MCT diagnosis and treatment. Our paper reviews studies on the topic of mast cells, which have been carried out over the past few years.

VRK2
Also flagged:Abscisic acidphytohormoneresponse to drought stressSNF1-related kinase 2signaling kinasesignal transduction
Journal Article 2024-01-22 ✓ 1 Snippet Horvat B, Shikakura Y, Ohtani M, Demura T, Kikuchi A, Watanabe KN, Oguchi T.
In-Text Gene Mentions

…Subclass II ofSNF1-Related Kinase 2Kinase 2 Improves…

Show Full Abstract

Abscisic acid (ABA) is the most important phytohormone involved in the response to drought stress. Subclass II of SNF1-related kinase 2 (SnRK2) is an important signaling kinase related to ABA signal transduction. It regulates the phosphorylation of the target transcription factors controlling the transcription of a wide range of ABA-responsive genes in <i>Arabidopsis thaliana</i>. The transgenic poplars (<i>Populus tremula</i> × <i>P. tremuloides</i>, clone T89) ectopically overexpressing <i>AtSnRK2.8</i>, encoding a subclass II SnRK2 kinase of <i>A. thaliana</i>, have been engineered but almost no change in its transcriptome was observed. In this study, we evaluated osmotic stress tolerance and stomatal behavior of the transgenic poplars maintained in the netted greenhouse. The transgenic poplars, line S22, showed a significantly higher tolerance to 20% PEG treatment than non-transgenic controls. The stomatal conductance of the transgenic poplars tended to be lower than the non-transgenic control. Microscopic observations of leaf imprints revealed that the transgenic poplars had significantly higher stomatal closures under the stress treatment than the non-transgenic control. In addition, the stomatal index was lower in the transgenic poplars than in the non-transgenic controls regardless of the stress treatment. These results suggested that <i>AtSnRK2.8</i> is involved in the regulation of stomatal behavior. Furthermore, the transgenic poplars overexpressing <i>AtSnRK2.8</i> might have improved abiotic stress tolerance through this stomatal regulation.

Also flagged:Aminocervical cancervirus) infectiononcogenechitosan
Journal Article 2024-01-22 No Snippets Gao X, Dong D, Zhang C, Deng Y, Ding J, Niu S, Tan S, Sun L.
Show Full Abstract

Gene therapy displays great promise in the treatment of cervical cancer. The occurrence of cervical cancer is highly related to persistent human papilloma virus (HPV) infection. The HPV oncogene can be cleaved via gene editing technology to eliminate carcinogenic elements. However, the successful application of the gene therapy method depends on effective gene delivery into the vagina. To improve mucosal penetration and adhesion ability, quaternized chitosan was introduced into the poly(β-amino ester) (PBAE) gene-delivery system in the form of quaternized chitosan-g-PBAE (QCP). At a mass ratio of PBAE:QCP of 2:1, the polymers exhibited the highest green fluorescent protein (GFP) transfection efficiency in HEK293T and ME180 cells, which was 1.1 and 5.4 times higher than that of PEI 25 kD. At this mass ratio, PBAE-QCP effectively compressed the GFP into spherical polyplex nanoparticles (PQ-GFP NPs) with a diameter of 255.5 nm. In vivo results indicated that owing to the mucopenetration and adhesion capability of quaternized CS, the GFP transfection efficiency of the PBAE-QCP hybrid system was considerably higher than those of PBAE and PEI 25 kD in the vaginal epithelial cells of Sprague-Dawley rats. Furthermore, the new system demonstrated low toxicity and good safety, laying an effective foundation for its further application in gene therapy.

Also flagged:CadmiumPhosphatenanowirescadmium oleatesynthesishydroxide
Journal Article 2024-01-22 No Snippets Chen YQ, Zhu YJ, Xiong ZC.
Show Full Abstract

Ultralong nanowires with ultrahigh aspect ratios exhibit high flexibility, and they are promising for applications in various fields. Herein, a cadmium oleate precursor hydrothermal method is developed for the synthesis of ultralong nanowires of cadmium phosphate hydroxide. In this method, water-soluble cadmium salt is used as the cadmium source, water-soluble phosphate is used as the phosphorus source, and sodium oleate is adopted as a reactant to form cadmium oleate precursor and as a structure-directing agent. By using this method, ultralong nanowires of cadmium phosphate hydroxide are successfully synthesized using CdCl<sub>2</sub>, sodium oleate, and NaH<sub>2</sub>PO<sub>4</sub> as reactants in an aqueous solution by hydrothermal treatment at 180 °C for 24 h. In addition, a new type of flexible fire-resistant inorganic paper with good electrical insulation performance is fabricated using ultralong nanowires of cadmium phosphate hydroxide. As an example of the extended application of this synthetic method, ultralong nanowires of cadmium phosphate hydroxide can be converted to ultralong CdS nanowires through a convenient sulfidation reaction. In this way, ultralong CdS nanowires are successfully synthesized by simple sulfidation of ultralong nanowires of cadmium phosphate hydroxide under mild conditions. The as-prepared ultralong nanowires of cadmium phosphate hydroxide are promising for applications as the precursors and templates for synthesizing other inorganic ultralong nanowires and have wide applications in various fields.

Also flagged:Gangliosidesbrain cancersgangliosidetumorbrain tumorstumors
Journal Article 2024-01-22 No Snippets Biricioiu MR, Sarbu M, Ica R, Vukelić Ž, Kalanj-Bognar S, Zamfir AD.
Show Full Abstract

Gangliosides are highly abundant in the human brain where they are involved in major biological events. In brain cancers, alterations of ganglioside pattern occur, some of which being correlated with neoplastic transformation, while others with tumor proliferation. Of all techniques, mass spectrometry (MS) has proven to be one of the most effective in gangliosidomics, due to its ability to characterize heterogeneous mixtures and discover species with biomarker value. This review highlights the most significant achievements of MS in the analysis of gangliosides in human brain cancers. The first part presents the latest state of MS development in the discovery of ganglioside markers in primary brain tumors, with a particular emphasis on the ion mobility separation (IMS) MS and its contribution to the elucidation of the gangliosidome associated with aggressive tumors. The second part is focused on MS of gangliosides in brain metastases, highlighting the ability of matrix-assisted laser desorption/ionization (MALDI)-MS, microfluidics-MS and tandem MS to decipher and structurally characterize species involved in the metastatic process. In the end, several conclusions and perspectives are presented, among which the need for development of reliable software and a user-friendly structural database as a search platform in brain tumor diagnostics.

HTT
Also flagged:Type II Diabetesserotonin transportermetformintype 2 diabetes mellitusType 2 Diabetestriglyceride
Journal Article 2024-01-22 ✓ 5 Snippets Ochi T, de Vos S, Touw D, Denig P, Feenstra T, Hak E.
In-Text Gene Mentions

Four transporters in the gut have been found to be relevant in metformin transport in vitro. Within Caco-2 cell monolayers, a cellular model of the human intestinal epithelium, SLC6A4 (5-HTT, serotonin transporter) accounted for 20% of metformin transport activity [10].

Participants of PROVALID (PROspective cohort study in patients with type 2 diabetes mellitus for VALidation of biomarkers) within the GIANTT (Groningen Initiative to ANalyse Type 2 Diabetes Treatment) cohort who initiated metformin were genotyped for combined 5-HTTLPR/rs25531 (L∗L∗, L∗S∗, and S∗S∗) and 5-HTT VNTR (STin 2.12, 12/-, and 10/-) polymorphisms, respectively.

We therefore hypothesise that polymorphic regions of 5-HTT (i.e., 5-HTTLPR and 5-HTT VNTR) may be associated with HbA1c response in T2D patients after initiating metformin treatment.

Tailoring Type II Diabetes Treatment: Investigating the Effect of 5-HTT Polymorphisms on HbA1c Levels after Metformin Initiation

To investigate the effect of serotonin transporter (5-HTT) polymorphisms on change in HbA1c levels six months after metformin initiation in type 2 diabetes patients.

Show Full Abstract

<h4>Aims</h4>To investigate the effect of serotonin transporter (5-HTT) polymorphisms on change in HbA1c levels six months after metformin initiation in type 2 diabetes patients.<h4>Materials and methods</h4>Participants of PROVALID (PROspective cohort study in patients with type 2 diabetes mellitus for VALidation of biomarkers) within the GIANTT (Groningen Initiative to ANalyse Type 2 Diabetes Treatment) cohort who initiated metformin were genotyped for combined 5-HTTLPR/rs25531 (L<sup>∗</sup>L<sup>∗</sup>, L<sup>∗</sup>S<sup>∗</sup>, and S<sup>∗</sup>S<sup>∗</sup>) and 5-HTT VNTR (STin 2.12, 12/-, and 10/-) polymorphisms, respectively. Multiple linear regression was applied to determine the change in HbA1c level from baseline date to six months across 5-HTTLPR/VNTR genotype groups, adjusted for baseline HbA1c, age, gender, triglyceride level, low-density lipoprotein level, and serum creatinine.<h4>Results</h4>157 participants were included, of which 56.2% were male. The average age was 59.3 ± 9.23 years, and the mean baseline HbA1c was 7.49% ± 1.21%. 5-HTTLPR was characterized in 46 patients as L<sup>∗</sup>L<sup>∗</sup>, 70 patients as L<sup>∗</sup>S<sup>∗</sup>, and 41 patients as S<sup>∗</sup>S<sup>∗</sup> genotypes. No significant association was found between 5-HTTLPR and 5-HTT VNTR genotypes and change in HbA1c after adjustments.<h4>Conclusions</h4>5-HTT polymorphisms did not affect HbA1c levels six months after the start of metformin. Further long-term studies in large samples would be relevant to determine which polymorphisms can explain the variation in response to metformin treatment.

PEBP1
Also flagged:ferroptosisosteoarthritismusculoskeletal diseaseOAPtgs2Pgd
Journal Article 2024-01-22 ✓ 5 Snippets Sun W, Lv Z, Li W, Lu J, Xie Y, Wang P, Jiang R, Dong J, Guo H, Liu Z, Fei Y, Tan G, Wang M, Ren K, Xu J, Sun H, Jiang X, Shi D.
In-Text Gene Mentions

There were several novel and important findings here: (1) XJB-5-131 significantly alleviated chondrocyte ferroptosis and restored cartilage metabolic homeostasis in vitro; (2) XJB-5-131 alleviated articular cartilage degeneration in DMM surgery induced OA mice model by suppressing chondrocyte ferroptosis; (3) XJB-5-131 exerted anti-ferroptotic effect on chondrocytes by restoring Pebp1 expression.

XJB-5-131 significantly protects chondrocytes from ferroptosis in TBHP-induced mouse primary chondrocytes and DMM surgery-induced OA mice model via restoring the expression of Pebp1.

XJB-5-131 protects chondrocytes from ferroptosis to alleviate osteoarthritis progression via restoring Pebp1 expression☆

…Further, we identifiedPebp1as a potential…

…the expression ofPebp1.…

Show Full Abstract

<h4>Background</h4>Osteoarthritis (OA) is the most common age-related musculoskeletal disease. However, there is still a lack of therapy that can modify OA progression due to the complex pathogenic mechanisms. The aim of the study was to explore the role and mechanism of XJB-5-131 inhibiting chondrocytes ferroptosis to alleviate OA progression.<h4>Methods</h4>We treated tert-butyl hydroperoxide (TBHP)-induced ferroptosis of mouse primary chondrocytes with XJB-5-131 in vitro. The intracellular ferroptotic hallmarks, cartilage anabolic and catabolic markers, ferroptosis regulatory genes and proteins were detected. Then we established a mouse OA model via destabilization of the medial meniscus (DMM) surgery. The OA mice were treated with intra-articular injection of XJB-5-131 regularly (2 μM, 3 times per week). After 4 and 8 weeks, we performed micro-CT and histological examination to evaluate the protection role of XJB-5-131 in mouse OA subjects. RNA sequencing analysis was performed to unveil the key downstream gene of XJB-5-131 exerting the anti-ferroptotic effect in OA.<h4>Results</h4>XJB-5-131 significantly suppressed TBHP-induced increases of ferroptotic hallmarks (ROS, lipid peroxidation, and Fe<sup>2+</sup> accumulation), ferroptotic drivers (Ptgs2, Pgd, Tfrc, Atf3, Cdo1), while restored the expression of ferroptotic suppressors (Gpx4, Fth1). XJB-5-131 evidently promoted the expression of cartilage anabolic and decreased the expression of cartilage catabolic markers. Moreover, intra-articular injection of XJB-5-131 significantly inhibited the expression of Cox2 and Mmp13, while promoted the expression of Col2a1, Gpx4 and Fth1 in DMM-induced mouse articular cartilage. Further, we identified Pebp1 as a potential target of XJB-5-131 by RNA sequencing analysis. The anti-ferroptosis and chondroprotective effects of XJB-5-131 were significantly diminished by Locostatin, a specific antagonist of Pebp1.<h4>Conclusion</h4>XJB-5-131 significantly protects chondrocytes from ferroptosis in TBHP-induced mouse primary chondrocytes and DMM surgery-induced OA mice model via restoring the expression of Pebp1. XJB-5-131 is a potential therapeutic drug in the management of OA progression.

Also flagged:DepressionBerberinealkaloidlipidcancermood disorder
Journal Article 2024-01-22 No Snippets Gao Y, Nie K, Wang H, Dong H, Tang Y.
Show Full Abstract

Depression, a global health problem with growing prevalence, brings serious impacts on the daily life of patients. However, the antidepressants currently used in clinical are not perfectly effective, which greatly reduces the compliance of patients. Berberine is a natural quaternary alkaloid which has been shown to have a variety of pharmacological effects, such as hypoglycemic, lipid-regulation, anti-cancer, antibacterial, anti-oxidation, anti-inflammatory, and antidepressant. This review summarizes the evidence of pharmacological applications of berberine in treating depression and elucidates the mechanisms of berberine regulating neurotransmitter levels, promoting the regeneration of hippocampal neurons, improving hypothalamic-pituitary-adrenal axis dysfunction, anti-oxidative stress, and suppressing inflammatory status in order to provide a reference for further research and clinical application of berberine.

Also flagged:Agingchromatinmemory impairmentpathological memory disordersgene expressionimmune response
Journal Article 2024-01-22 No Snippets Achiro JM, Tao Y, Gao F, Lin CH, Watanabe M, Neumann S, Coppola G, Black DL, Martin KC.
Show Full Abstract

Aging-related memory impairment and pathological memory disorders such as Alzheimer's disease differ between males and females, and yet little is known about how aging-related changes in the transcriptome and chromatin environment differ between sexes in the hippocampus. To investigate this question, we compared the chromatin accessibility landscape and gene expression/alternative splicing pattern of young adult and aged mouse hippocampus in both males and females using ATAC-seq and RNA-seq. We detected significant aging-dependent changes in the expression of genes involved in immune response and synaptic function and aging-dependent changes in the alternative splicing of myelin sheath genes. We found significant sex-bias in the expression and alternative splicing of hundreds of genes, including aging-dependent female-biased expression of myelin sheath genes and aging-dependent male-biased expression of genes involved in synaptic function. Aging was associated with increased chromatin accessibility in both male and female hippocampus, especially in repetitive elements, and with an increase in LINE-1 transcription. We detected significant sex-bias in chromatin accessibility in both autosomes and the X chromosome, with male-biased accessibility enriched at promoters and CpG-rich regions. Sex differences in gene expression and chromatin accessibility were amplified with aging, findings that may shed light on sex differences in aging-related and pathological memory loss.

TAOK3
Also flagged:type 2 diabetes mellitusepigenetic modificationsmethylationhistoneacidpathogenesis
Journal Article 2024-01-22 ✓ 1 Snippet Jazieh C, Arabi TZ, Asim Z, Sabbah BN, Alsaud AW, Alkattan K, Yaqinuddin A.
In-Text Gene Mentions

found that a 1% increase in methylation in TAOK3 decreased the odds of child obesity by 0.91 (30).

Show Full Abstract

Type 2 diabetes mellitus (T2DM) is a rapidly escalating global health concern, with its prevalence projected to increase significantly in the near future. This review delves into the intricate role of epigenetic modifications - including DNA methylation, histone acetylation, and micro-ribonucleic acid (miRNA) expression - in the pathogenesis and progression of T2DM. We critically examine how these epigenetic changes contribute to the onset and exacerbation of T2DM by influencing key pathogenic processes such as obesity, insulin resistance, β-cell dysfunction, cellular senescence, and mitochondrial dysfunction. Furthermore, we explore the involvement of epigenetic dysregulation in T2DM-associated complications, including diabetic retinopathy, atherosclerosis, neuropathy, and cardiomyopathy. This review highlights recent studies that underscore the diagnostic and therapeutic potential of targeting epigenetic modifications in T2DM. We also provide an overview of the impact of lifestyle factors such as exercise and diet on the epigenetic landscape of T2DM, underscoring their relevance in disease management. Our synthesis of the current literature aims to illuminate the complex epigenetic underpinnings of T2DM, offering insights into novel preventative and therapeutic strategies that could revolutionize its management.

Also flagged:cisplatinbladder cancerneoplasmnon-muscle-invasive papillary tumorsNMIBC
Journal Article 2024-01-22 No Snippets Hashem M, Mohandesi Khosroshahi E, Aliahmady M, Ghanei M, Soofi Rezaie Y, Alsadat Jafari Y, Rezaei F, Khodaparast Eskadehi R, Kia Kojoori K, Jamshidian F, Nabavi N, Rashidi M, Hasani Sadi F, Taheriazam A, Entezari M.
Show Full Abstract

Bladder cancer (BC) is a highly frequent neoplasm in correlation with significant rate of morbidity, mortality, and cost. The onset of BC is predominantly triggered by environmental and/or occupational exposures to carcinogens, such as tobacco. There are two distinct pathways by which BC can be developed, including non-muscle-invasive papillary tumors (NMIBC) and non-papillary (or solid) muscle-invasive tumors (MIBC). The Cancer Genome Atlas project has further recognized key genetic drivers of MIBC along with its subtypes with particular properties and therapeutic responses; nonetheless, NMIBC is the predominant BC presentation among the suffering individuals. Radical cystoprostatectomy, radiotherapy, and chemotherapy have been verified to be the common therapeutic interventions in metastatic tumors, among which chemotherapeutics are more conventionally utilized. Although multiple chemo drugs have been broadly administered for BC treatment, cisplatin is reportedly the most effective chemo drug against the corresponding malignancy. Notwithstanding, tumor recurrence is usually occurred following the consumption of cisplatin regimens, particularly due to the progression of chemo-resistant trait. In this framework, non-coding RNAs (ncRNAs), as abundant RNA transcripts arise from the human genome, are introduced to serve as crucial contributors to tumor expansion and cisplatin chemo-resistance in bladder neoplasm. In the current review, we first investigated the best-known ncRNAs, i.e. microRNAs (miRNAs), long ncRNAs (lncRNAs), and circular RNAs (circRNAs), correlated with cisplatin chemo-resistance in BC cells and tissues. We noticed that these ncRNAs could mediate the BC-related cisplatin-resistant phenotype through diverse cellular processes and signaling mechanisms, reviewed here. Eventually, diagnostic and prognostic potential of ncRNAs, as well as their therapeutic capabilities were highlighted in regard to BC management.

bioRxiv 2024-01-22 Preprint (No Snippets API) Crawford BI, Talley MJ, Russman J, Riddle J, Torres S, Williams T, Longworth MS.
Show Full Abstract

Neural stem and progenitor cell (NSPC) maintenance are essential for ensuring that organisms are born with proper brain volumes and head sizes. Microcephaly is a disorder in which babies are born with significantly smaller head sizes and cortical volumes. Mutations in subunits of the DNA organizing complexes, condensins have been identified in microcephaly patients. However the molecular mechanisms by which condensin insufficiency causes microcephaly remain elusive. We previously identified conserved roles for condensins in repression of retrotransposable elements (RTEs). Here, we show that condensin subunit knockdown in NSPCs of the Drosophila larval central brain increases RTE expression and mobility which causes cell death, and significantly decreases adult head sizes and brain volumes. These findings suggest that unrestricted RTE expression and activity may lead to improper brain development in condensin insufficient organisms, and lay the foundation for future exploration of causative roles for RTEs in other microcephaly models.

HMGN4
Also flagged:neurodegenerative disorderPDLewy bodiesprotein synthesisdegradationtranslation initiation
Journal Article 2024-01-21 ✓ 5 Snippets D'Angiolini S, Lui M, Mazzon E, Calabrò M.
In-Text Gene Mentions

Kugler et al. observed that increased expression of HMGN4 leads to a decrease in the levels of various tumor suppressors [58].

…cleocytoplasmic transport; forHMGN4, KDM5D ,…

…AlthoughHMGN4, KDM5D ,…

…the down-regulation ofHMGN4and RBBP4 ,…

…increased expression ofHMGN4leads to a…

Show Full Abstract

Parkinson's disease (PD) is a prevalent neurodegenerative disorder characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra region of the brain. The hallmark pathological feature of PD is the accumulation of misfolded proteins, leading to the formation of intracellular aggregates known as Lewy bodies. Recent data evidenced how disruptions in protein synthesis, folding, and degradation are events commonly observed in PD and may provide information on the molecular background behind its etiopathogenesis. In the present study, we used a publicly available transcriptomic microarray dataset of peripheral blood of PD patients and healthy controls (GSE6613) to investigate the potential dysregulation of elements involved in proteostasis-related processes at the transcriptomic level. Our bioinformatics analysis revealed 375 differentially expressed genes (DEGs), of which 281 were down-regulated and 94 were up-regulated. Network analysis performed on the observed DEGs highlighted a cluster of 36 elements mainly involved in the protein synthesis processes. Different enriched ontologies were related to translation initiation and regulation, ribosome structure, and ribosome components nuclear export. Overall, this data consistently points to a generalized impairment of the translational machinery and proteostasis. Dysregulation of these mechanics has been associated with PD pathogenesis. Understanding the precise regulation of such processes may shed light on the molecular mechanisms of PD and provide potential data for early diagnosis.

TNFSF4
Also flagged:Glycolysisnon-small cell lung cancerLUADtumorLung Adenocarcinomaoxygen
Journal Article 2024-01-21 ✓ 1 Snippet Zhao W, Ding C, Zhao M, Li Y, Huang H, Li X, Cheng Q, Shi Z, Gao W, Liu H, Chen J.
In-Text Gene Mentions

…TNFRSF18, CD274, TNFSF9,TNFSF4, TNFRSF9 (Fig. 6…

Show Full Abstract

<b>Background:</b> Lung adenocarcinoma (LUAD) represents a prevalent subtype of non-small cell lung cancer with a complex molecular landscape. Dysregulated cellular energetics, notably the interplay between hypoxia and glycolysis, has emerged as a hallmark feature of LUAD tumorigenesis and progression. In this study, we aimed to identify hypoxia and glycolysis related gene signatures and construct a prognostic model to enhance the clinical management of LUAD. <b>Methods:</b> A gene signature associated with hypoxia and glycolysis was established within the The Cancer Genome Atlas (TCGA) cohort and subsequently validated in the GSE31210 cohort. Additionally, a nomogram was formulated to aid in predictive modeling. Subsequently, an evaluation of the tumor microenvironment and immune checkpoints expression levels was conducted to discern disparities between low risk and high risk groups. Lastly, an exploration for drugs with potential effectiveness was carried out. <b>Results:</b> Our analyses revealed a distinct hypoxia and glycolysis related gene signature consisting of 6 genes significantly associated with LUAD patient survival. Integration of these genes into the prognostic model demonstrated superior predictive accuracy for patient outcomes. Furthermore, we developed a user-friendly nomogram that effectively translates the model's prognostic information into a practical tool for clinical decision-making. <b>Conclusion:</b> This study elucidates the critical role of hypoxia and glycolysis related genes in LUAD and offers a novel prognostic model with promising clinical utility. This model has the potential to refine risk stratification and guide personalized therapeutic interventions, ultimately improving the prognosis of LUAD patients.

HFE
Also flagged:Acute-on-Chronic Liver Failureonliver failureChronic Liver Failurechronic liver diseaseliver disease
Journal Article 2024-01-21 ✓ 1 Snippet Hafsa F, Chaudary ZI, Tariq O, Riaz Z, Shehzad A, Irfan Jamil M, Naeem I.
In-Text Gene Mentions

…for Wilson's disease,hemochromatosis, and autoimmune liver…

Show Full Abstract

Objectives This study aimed to identify the causes, clinical characteristics, and 28-day in-hospital mortality predictors in patients with acute-on-chronic liver failure (ACLF). Methods A cross-sectional study enrolled sixty-four patients aged 18-70 years with acute-on-chronic liver failure. The study was conducted at the Gastroenterology Department, Lahore General Hospital. The study classified ACLF according to the criteria of the European Association for the Study of the Liver - Chronic Liver Failure (EASL-CLIF). Patients were followed for 28 days for mortality outcomes. The outcomes between Survivor and Non-survivor groups were compared using the Chi-Square/Fisher's Exact Test for categorical variables and the Mann-Whitney U test for continuous variables. Results In this study, age and duration of chronic liver disease were not significantly different between survivors and non-survivors. The etiology of liver disease and ACLF causes had no impact on 28-day mortality. Non-survivors had lower mean arterial pressure, and higher mortality was linked with lower Glasgow Coma Scale scores, upper gastrointestinal bleeding, and Grade IV hepatic encephalopathy. Significant differences in bilirubin, serum creatinine, urea, and C-reactive protein levels were observed at 28 days. Survival rates were highest with single organ failure (35.94%) and decreased with multiple organ failures. The overall survival rate was 51.56%. Predictive validity for mortality was assessed using the Area Under the Curve (AUC), with Child-Turcotte-Pugh (CTP) at 0.679, Model for End-Stage Liver Disease (MELD) at 0.819, and Chronic Liver Failure-Sequential Organ Failure Assessment (CLIF-SOFA) at 0.771. Conclusion This study concludes that in acute-on-chronic liver failure, factors like age, gender, and disease etiology do not significantly predict 28-day mortality. Key mortality indicators include clinical parameters such as lower Glasgow Coma Scale scores, hepatic encephalopathy Grade IV, and laboratory findings like elevated bilirubin and serum creatinine. The MELD score is the most compelling prognostic tool.

SOX6
Also flagged:oxygencytoplasmicmembranepolyunsaturated fatty acidsinfertilitysperm nuclear basic proteins
Journal Article 2024-01-20 ✓ 1 Snippet Ferrero G, Festa R, Follia L, Lettieri G, Tarallo S, Notari T, Giarra A, Marinaro C, Pardini B, Marano A, Piaggeschi G, Di Battista C, Trifuoggi M, Piscopo M, Montano L, Naccarati A.
In-Text Gene Mentions

…, TEX15 ,SOX6, and NOL4…

Show Full Abstract

<h4>Background</h4>Molecular techniques can complement conventional spermiogram analyses to provide new information on the fertilizing potential of spermatozoa and to identify early alterations due to environmental pollution.<h4>Methods</h4>Here, we present a multilevel molecular profiling by small RNA sequencing and sperm nuclear basic protein analysis of male germ cells from 33 healthy young subjects residing in low and high-polluted areas.<h4>Results</h4>Although sperm motility and sperm concentration were comparable between samples from the two sites, those from the high-pollution area had a higher concentration of immature/immune cells, a lower protamine/histone ratio, a reduced ability of sperm nuclear basic proteins to protect DNA from oxidative damage, and an altered copper/zinc ratio in sperm. Sperm levels of 32 microRNAs involved in intraflagellar transport, oxidative stress response, and spermatogenesis were different between the two areas. In parallel, a decrease of Piwi-interacting RNA levels was observed in samples from the high-polluted area.<h4>Conclusions</h4>This comprehensive analysis provides new insights into pollution-driven epigenetic alterations in sperm not detectable by spermiogram.

TNFSF4
Also flagged:Cancerheat shock proteinsHSPsHSP90HSP90B1chaperone
Journal Article 2024-01-20 ✓ 1 Snippet Huang X, Zhang W, Yang N, Zhang Y, Qin T, Ruan H, Zhang Y, Tian C, Mo X, Tang W, Liu J, Zhang B.
In-Text Gene Mentions

…PVR, MICB, ULBP1,TNFSF4, while exhibiting a…

Show Full Abstract

Heat shock proteins play crucial roles in various biochemical processes, encompassing protein folding and translocation. HSP90B1, a conserved member of the heat shock protein family, growing evidences have demonstrated that it might be closely associated with cancer development. In the present study, we employed multi-omics analyses and cohort validations to explore the dynamic expression of HSP90B1 in pan-cancer and comprehensively evaluate HSP90B1 as a novel biomarker that hold promise for precision cancer diagnostics and therapeutics. The results suggest HSP90B1 was highly expressed in various kinds of tumors, often correlating with a poor prognosis. Notably, methylation of HSP90B1 emerged as a protective factor in several cancer types. In immune infiltration analysis, the expression of HSP90B1 in most tumors showed a negative association with CD8 + T cells. HSP90B1 expression was positively correlated with microsatellite instability and tumor mutational burden. HSP90B1 expression was also discovered to be positively correlated with tumor metabolism, cell cycle-related pathways and the expression of immune checkpoint genes. The expression of HSP90B1 was mainly negatively correlated with immunostimulatory genes and positively correlated with immunosuppressive genes, as well as strongly correlated with chemokines and their receptor genes. In addition, the HSP90B1 inhibitor PU-WS13 demonstrated significant efficacy in suppressing cancer cell proliferation in both leukemic and solid tumor cells, and remarkably reduced the expression of the cancer cell surface immune checkpoint PD-L1. The single-cell RNA sequencing analysis further highlighted that HSP90B1 was significantly higher in tumor cells compared to surrounding cells, revealing a potential target therapeutic window. Taken together, HSP90B1 emerges as a promising avenue for breakthroughs in cancer diagnosis, prognosis and therapy. This study provides a rationale for HSP90B1 targeted cancer diagnosis and therapy in future.

Also flagged:SalidrosidepyroptosisdiabetesretinopathyNLRP3NFE2L2
Journal Article 2024-01-20 No Snippets Zhang LC, Li N, Xu M, Chen JL, He H, Liu J, Wang TH, Zuo ZF.
Show Full Abstract

<h4>Objective</h4>To investigate the effect of salidroside (SAL) in protecting retinal ganglion cell (RGC) from pyroptosis and explore associated molecular network mechanism in diabetic retinapathy (DR) rats.<h4>Methods</h4>HE, Nissl and immunofluorescence staining were used to observe the retinal morphological change, and the related target genes for salidroside, DR and pyroptosis were downloaded from GeneCard database. Then Venny, PPI, GO, KEGG analysis and molecular docking were used to reveal molecular network mechanism of SAL in inhibiting the pyroptosis of RGC. Lastly, all hub genes were confirmed by using qPCR.<h4>Results</h4>HE and Nissl staining showed that SAL could improve the pathological structure known as pyroptosis in diabetic retina, and the fluorescence detection of pyroptosis marker in DM group was the strongest, while they decreased in the SAL group(P < 0.05)). Network pharmacological analysis showed 6 intersecting genes were obtained by venny analysis. GO and KEGG analysis showed 9 biological process, 3 molecular function and 3 signaling pathways were involved. Importantly, molecular docking showed that NFE2L2, NFKB1, NLRP3, PARK2 and SIRT1 could combine with salidroside, and qPCR validates the convincible change of CASP3, NFE2L2, NFKB1, NLRP3, PARK2 and SIRT1.<h4>Conclusion</h4>Salidroside can significantly improve diabetes-inducedRGC pyrotosis in retina, in which, the underlying mechanism is associated with the NLRP3, NFEZL2 and NGKB1 regulation.

SOX6
Also flagged:LevodopaGeneralized DystoniaAlpha‐MannosidosisMAN2B1Responsive DystoniaMannosidosis
Journal Article 2024-01-20 ✓ 1 Snippet Holla VV, Gurram S, Kamath SD, Kamble N, Yadav R, Pal PK.
In-Text Gene Mentions

SOX6

Show Full Abstract

No abstract available.

HFE
Also flagged:anemiaAnemia ofiron‐deficiencynutritional deficiencieschronic infectionschronic systemic inflammation
Journal Article 2024-01-20 ✓ 2 Snippets Yu Y, Su Y, Yang S, Liu Y, Lin Z, Das NK, Wu Q, Zhou J, Sun S, Li X, Yue W, Shah YM, Min J, Wang F.
In-Text Gene Mentions

…the treatment ofhemochromatosisand anemia.…

…model of hepcidin‐deficienthemochromatosis. […

Show Full Abstract

In clinics, hepcidin levels are elevated in various anemia-related conditions, particularly in iron-refractory anemia and in high inflammatory states that suppress iron absorption, which remains an urgent unmet medical need. To identify effective treatment options for various types of iron-refractory anemia, the potential effect of hypoxia and pharmacologically-mimetic drug FG-4592 (Roxadustat) are evaluated, a hypoxia-inducible factor (HIF)-prolyl hydroxylase (PHD) inhibitor, on mouse models of iron-refractory iron-deficiency anemia (IRIDA), anemia of inflammation and 5-fluorouracil-induced chemotherapy-related anemia. The potent protective effects of both hypoxia and FG-4592 on IRIDA as well as other 2 tested mouse cohorts are found. Mechanistically, it is demonstrated that hypoxia or FG-4592 could stabilize duodenal Hif2α, leading to the activation of Fpn transcription regardless of hepcidin levels, which in turn results in increased intestinal iron absorption and the amelioration of hepcidin-activated anemias. Moreover, duodenal Hif2α overexpression fully rescues phenotypes of Tmprss6 knockout mice, and Hif2α knockout in the gut significantly delays the recovery from 5-fluorouracil-induced anemia, which can not be rescued by FG-4592 treatment. Taken together, the findings of this study provide compelling evidence that targeting intestinal hypoxia-related pathways can serve as a potential therapeutic strategy for treating a broad spectrum of anemia, especially iron refractory anemia.

DCC
Also flagged:tumordeathcancersecretionsEMTsecretion
Journal Article 2024-01-20 ✓ 1 Snippet Wang J, Peng J, Chen Y, Nasser MI, Qin H.
In-Text Gene Mentions

Fortunately, an emerging conception of ‘Dependence Receptors’, such as Deleted in colorectal carcinoma (DCC) [86], Notch [87], and c-Kit [88], may provide a further explanation for the dual role of TMEs in tumor development [89].

Show Full Abstract

The epithelial-mesenchymal transition (EMT) is a critical tumor invasion and metastasis process. EMT enables tumor cells to migrate, detach from their original location, enter the circulation, circulate within it, and eventually exit from blood arteries to colonize in foreign sites, leading to the development of overt metastases, ultimately resulting in death. EMT is intimately tied to stromal cells around the tumor and is controlled by a range of cytokines secreted by stromal cells. This review summarizes recent research on stromal cell-mediated EMT in tumor invasion and metastasis. We also discuss the effects of various stromal cells on EMT induction and focus on the molecular mechanisms by which several significant stromal cells convert from foes to friends of cancer cells to fuel EMT processes via their secretions in the tumor microenvironment (TME). As a result, a better knowledge of the role of stromal cells in cancer cells' EMT may pave the path to cancer eradication.

HFE
Also flagged:behaviourPRM
Journal Article 2024-01-20 ✓ 2 Snippets Moorthy P, Sundaramoorthy S, Roy PD, Usha T, Dash SK, Gowrappan M, Chokklingam L.
In-Text Gene Mentions

…lysis utilizing the HFE-Diagram was employe…

…The HFE-Diagram analysis of hydrochemical f…

Show Full Abstract

This study aims to investigate and understand the temporal and spatial movement of seawater intrusion into the coastal aquifers. Groundwater salinity increase has affected the entire eastern part of the study area and is primarily influenced by direct and reverse ion exchange reactions associated with intrusion and freshwater influx phases, which alternate over monsoons. To gain insights into the spatiotemporal dynamics of the seawater intrusion process, hydrochemical facies analysis utilizing the HFE-Diagram was employed. Additionally, the study considered the major ionic changes during both the monsoons. The HFE-Diagram analysis of hydrochemical facies revealed distinctions in the behaviour of each coastal aquifer concerning seawater intrusion-induced salinization. In PRM 2020, the data shows that approximately 65% of the samples fall under the freshening phase, while the remaining 35% were categorized as intrusion phase. Within the freshening phase, seven different hydrochemical facies were identified, including Na-Cl, Na-MixCl, MixNa-MixCl, Na-MixHCO<sub>3</sub>/MixSO<sub>4</sub>, MixNa-MixSO<sub>4</sub>, Na-HCO<sub>3</sub>, and MixCa-HCO<sub>3</sub>. In contrast, the intrusion phase had four facies: MixCaMixHCO<sub>3</sub>, MixNa-Cl, Ca-Cl, and Na-Cl. Especially, the Na-Cl facies (f<sub>1</sub>) within the freshening phase attributed for the largest percentage, contributing 30% of the samples. In POM 2021, the distribution of samples shifted slightly, with approximately 72.5% belonging to the freshening phase and 27.5% to the intrusion phase. Within the freshening phase of POM 2021, five hydrochemical facies were identified: Na-Cl, Na-MixCl, Na-MixHCO<sub>3</sub>/MixSO<sub>4</sub>, MixNa-MixSO<sub>4</sub>, and Na-HCO<sub>3</sub>. The intrusion phase of POM 2021 had three facies: MixNa-Cl, Na-Cl, and MixCa-Cl. Similar to PRM 2020, the Na-Cl facies (f<sub>1</sub>) remained the most predominant in the freshening phase, comprising 30% of the samples. The relation between total dissolved solids (TDS) and various ionic ratios, such as HCO<sub>3</sub><sup>-</sup>/Cl<sup>-</sup>, Na<sup>+</sup>/Cl<sup>-</sup>, Ca<sup>2+</sup>/Cl<sup>-</sup>, Mg<sup>2+</sup>/Cl<sup>-</sup>, K<sup>+</sup>/Cl<sup>-</sup>, and SO<sub>4</sub><sup>2-</sup>/Cl<sup>-</sup>, clearly demonstrates the presence of seawater influence within the coastal aquifers of the study area.

HFE
Also flagged:Polycythemia VeraJAK2Polycythemiaidiopathic erythrocytosisIETET2
Journal Article 2024-01-20 ✓ 5 Snippets Elli EM, Mauri M, D'Aliberti D, Crespiatico I, Fontana D, Redaelli S, Pelucchi S, Spinelli S, Manghisi B, Cavalca F, Aroldi A, Ripamonti A, Ferrari S, Palamini S, Mottadelli F, Massimino L, Ramazzotti D, Cazzaniga G, Piperno A, Gambacorti-Passerini C, Piazza R.
In-Text Gene Mentions

Plasma Hepcidin levels were potently suppressed (5.4-fold down-modulation) in HIF1A-p.P582S cases (Fig. 6C; p < 0.0001), in line with our cell-models, hence confirming HIF1A-p.P582S variant as a modifier of HFE-hemochromatosis and possibly explaining why healthy blood donors expressing this variant usually do not show evidence of iron deprivation 33.

To confirm this finding, we analyzed hepcidin levels in the plasma of 6 patients affected by hemochromatosis, 3 of them homozygous for HFE-p.C282Y and 3 homozygous for HFE-p.C282Y and heterozygous for HIF1A-p.P582S.

…iron regulatory geneHFE-H63D or C282Y.…

…p.I982L, JAK3 p.V722I,HFE(homeostatic iron regulatory)…

…iron regulatory) p.C282Y,HFEp.H63D, HIF1A p.P582S,…

Show Full Abstract

Polycythemia Vera (PV) is typically caused by V617F or exon 12 JAK2 mutations. Little is known about Polycythemia cases where no JAK2 variants can be detected, and no other causes identified. This condition is defined as idiopathic erythrocytosis (IE). We evaluated clinical-laboratory parameters of a cohort of 56 IE patients and we determined their molecular profile at diagnosis with paired blood/buccal-DNA exome-sequencing coupled with a high-depth targeted OncoPanel to identify a possible underling germline or somatic cause. We demonstrated that most of our cohort (40/56: 71.4%) showed no evidence of clonal hematopoiesis, suggesting that IE is, in large part, a germline disorder. We identified 20 low mutation burden somatic variants (Variant allelic fraction, VAF, < 10%) in only 14 (25%) patients, principally involving DNMT3A and TET2. Only 2 patients presented high mutation burden somatic variants, involving DNMT3A, TET2, ASXL1 and WT1. We identified recurrent germline variants in 42 (75%) patients occurring mainly in JAK/STAT, Hypoxia and Iron metabolism pathways, among them: JAK3-V722I and HIF1A-P582S; a high fraction of patients (48.2%) resulted also mutated in homeostatic iron regulatory gene HFE-H63D or C282Y. By generating cellular models, we showed that JAK3-V722I causes activation of the JAK-STAT5 axis and upregulation of EPAS1/HIF2A, while HIF1A-P582S causes suppression of hepcidin mRNA synthesis, suggesting a major role for these variants in the onset of IE.

Also flagged:glucosidase II betacell adhesion moleculesGlucosidase IIglycoproteinreceptor tyrosine kinasecancer
Journal Article 2024-01-20 No Snippets Khaodee W, Xiyuan G, Han MTT, Tayapiwatana C, Chiampanichayakul S, Anuchapreeda S, Cressey R.
Show Full Abstract

Glucosidase II beta subunit (GluIIß), encoded from PRKCSH, is a subunit of the glucosidase II enzyme responsible for quality control of N-linked glycoprotein folding and suppression of GluIIß led to inhibitory effect of the receptor tyrosine kinase (RTKs) activities known to be critical for survival and development of cancer. In this study, we investigated the effect of GluIIß knockout on the global gene expression of cancer cells and its impact on functions of immune cells. GluIIß knockout lung adenocarcinoma A549 cell line was generated using CRISPR/Cas9-based genome editing system and subjected to transcriptomic analysis. Among 23,502 expressed transcripts, 1068 genes were significantly up-regulated and 807 genes greatly down-regulated. The KEGG enrichment analysis showed significant down-regulation of genes related extracellular matrix (ECM), ECM-receptor interaction, cytokine-cytokine receptor interaction and cell adhesion molecules (CAMs) in GluIIß knockout cells. Of 9 CAMs encoded DEG identified by KEGG enrichment analysis, real time RT-PCR confirmed 8 genes to be significantly down-regulated in all 3 different GluIIß knockout clones, which includes cadherin 4 (CDH4), cadherin 2 (CDH2), versican (VCAN), integrin subunit alpha 4 (ITGA4), endothelial cell-selective adhesion molecule (ESAM), CD274 (program death ligand-1 (PD-L1)), Cell Adhesion Molecule 1 (CADM1), and Nectin Cell Adhesion Molecule 3 (NECTIN3). Whereas PTPRF (Protein Tyrosine Phosphatase Receptor Type F) was significantly decreased only in 1 out of 3 knockout clones. Microscopic analysis revealed distinctively different cell morphology of GluIIβ knockout cells with lesser cytoplasmic and cell surface area compared to parental A549 cells and non-targeted transfected cells.Further investigations revealed that Jurkat E6.1 T cells or human peripheral blood mononuclear cells (PBMCs) co-cultured with GluIIß knockout A549 exhibited significantly increased viability and tumor cell killing activity compared to those co-cultured with non-target transfected cells. Analysis of cytokine released from Jurkat E6.1 T cells co-cultured with GluIIß knockout A549 cells showed significant increased level of angiogenin and significant decreased level of ENA-78. In conclusion, knockout of GluIIß from cancer cells induced altered gene expression profile that improved anti-tumor activities of co-cultured T lymphocytes and PBMCs thus suppression of GluIIß may represent a novel approach of boosting anti-tumor immunity.

LRRC7
Also flagged:MXR2APE1ATG19MXR1EcoRIHA
Journal Article 2024-01-20 ✓ 1 Snippet Chatterjee A, Sepuri NBV.
In-Text Gene Mentions

…four leucine aminopeptidases:Lap1/Ape2, Lap2, Lap3, and…

Show Full Abstract

The reversible oxidation of methionine plays a crucial role in redox regulation of proteins. Methionine oxidation in proteins causes major structural modifications that can destabilize and abrogate their function. The highly conserved methionine sulfoxide reductases protect proteins from oxidative damage by reducing their oxidized methionines, thus restoring their stability and function. Deletion or mutation in conserved methionine sulfoxide reductases leads to aging and several human neurological disorders and also reduces yeast growth on nonfermentable carbon sources. Despite their importance in human health, limited information about their physiological substrates in humans and yeast is available. For the first time, we show that Mxr2 interacts in vivo with two core proteins of the cytoplasm to vacuole targeting (Cvt) autophagy pathway, Atg19, and Ape1 in Saccharomyces cerevisiae. Deletion of MXR2 induces instability and early turnover of immature Ape1 and Atg19 proteins and reduces the leucine aminopeptidase activity of Ape1 without affecting the maturation process of Ape1. Additonally, Mxr2 interacts with the immature Ape1, dependent on Met17 present within the propeptide of Ape1 as a single substitution mutation of Met17 to Leu abolishes this interaction. Importantly, Ape1 M17L mutant protein resists oxidative stress-induced degradation in WT and mxr2Δ cells. By identifying Atg19 and Ape1 as cytosolic substrates of Mxr2, our study maps the hitherto unexplored connection between Mxr2 and the Cvt autophagy pathway and sheds light on Mxr2-dependent oxidative regulation of the Cvt pathway.

HTT
Also flagged:Neurodegenerative Diseaseredox homeostasisoxygennitrogenprotein modificationslocalizations
Journal Article 2024-01-20 ✓ 1 Snippet Cadenas-Garrido P, Schonvandt-Alarcos A, Herrera-Quintana L, Vázquez-Lorente H, Santamaría-Quiles A, Ruiz de Francisco J, Moya-Escudero M, Martín-Oliva D, Martín-Guerrero SM, Rodríguez-Santana C, Aragón-Vela J, Plaza-Diaz J.
In-Text Gene Mentions

HD is an autosomal dominant inherited disease by the overexpression of huntingtin (HTT), a neuronal toxic protein [120,121].

Show Full Abstract

Antioxidant defenses in biological systems ensure redox homeostasis, regulating baseline levels of reactive oxygen and nitrogen species (ROS and RNS). Oxidative stress (OS), characterized by a lack of antioxidant defenses or an elevation in ROS and RNS, may cause a modification of biomolecules, ROS being primarily absorbed by proteins. As a result of both genome and environment interactions, proteomics provides complete information about a cell's proteome, which changes continuously. Besides measuring protein expression levels, proteomics can also be used to identify protein modifications, localizations, the effects of added agents, and the interactions between proteins. Several oxidative processes are frequently used to modify proteins post-translationally, including carbonylation, oxidation of amino acid side chains, glycation, or lipid peroxidation, which produces highly reactive alkenals. Reactive alkenals, such as 4-hydroxy-2-nonenal, are added to cysteine (Cys), lysine (Lys), or histidine (His) residues by a Michael addition, and tyrosine (Tyr) residues are nitrated and Cys residues are nitrosylated by a Michael addition. Oxidative and nitrosative stress have been implicated in many neurodegenerative diseases as a result of oxidative damage to the brain, which may be especially vulnerable due to the large consumption of dioxygen. Therefore, the current methods applied for the detection, identification, and quantification in redox proteomics are of great interest. This review describes the main protein modifications classified as chemical reactions. Finally, we discuss the importance of redox proteomics to health and describe the analytical methods used in redox proteomics.

SERPINC1
Also flagged:Budd-Chiari syndromemembraneProtein Cdeficiencyheart diseasepericardial disease
Journal Article 2024-01-20 ✓ 1 Snippet Rahayatri TH, Ruslie J, Kasahara M.
In-Text Gene Mentions

…protein C andantithrombin-III, but the protein…

Show Full Abstract

<h4>Introduction</h4>The management of Budd-Chiari syndrome is determined on the basis of the severity of the disease. There are no standard guidelines regarding the management of Budd-Chiari syndrome in children, particularly in cases of liver transplantation. Therefore, we present a case of a pediatric patient with Budd-Chiari syndrome treated with liver transplantation.<h4>Case presentation</h4>A female patient aged 1 year and 8 months presented to the hospital with an enlarged stomach in the last 1.5 months before admission. The patient was moderately ill, malnourished, and jaundiced. Liver biopsy revealed fibrosis in the portal area and confluent necrosis caused by vascular disorders. Magnetic resonance imaging (MRI) revealed a nutmeg liver and ascites due to the stenosis of the inferior vena cava at the level of the liver and the middle and left hepatic veins. The patient underwent living-donor liver transplantation. The occlusion of the proximal right hepatic vein due to the presence of a membrane was identified as the cause of Budd-Chiari syndrome in this case. Postoperatively, the patient's condition was stable and there was no sepsis or any other complications.<h4>Clinical discussion</h4>Prothrombotic factors are often the underlying cause of more than 80 % of Budd-Chiari syndrome cases. Protein C deficiency is suspected to be a prothrombotic factor that triggers Budd-Chiari syndrome in patients. Liver transplantation is the treatment of choice for patients with Budd-Chiari syndrome who were not treated with anticoagulation therapy, angioplasty, and TIPS.<h4>Conclusion</h4>Living-donor liver transplantation has a good outcome in the management of pediatric patients with Budd-Chiari syndrome.

Also flagged:strontiumcalcium phosphatecollagenmagnesiumhydroxyapatitesynthesis
Journal Article 2024-01-20 No Snippets Xu J, Vecstaudza J, Wesdorp MA, Labberté M, Kops N, Salerno M, Kok J, Simon M, Harmand MF, Vancíková K, van Rietbergen B, Misciagna MM, Dolcini L, Filardo G, Farrell E, van Osch GJVM, Locs J, Brama PAJ.
Show Full Abstract

Osteochondral defect repair with a collagen/collagen-magnesium-hydroxyapatite (Col/Col-Mg-HAp) scaffold has demonstrated good clinical results. However, subchondral bone repair remained suboptimal, potentially leading to damage to the regenerated overlying neocartilage. This study aimed to improve the bone repair potential of this scaffold by incorporating newly developed strontium (Sr) ion enriched amorphous calcium phosphate (Sr-ACP) granules (100-150 μm). Sr concentration of Sr-ACP was determined with ICP-MS at 2.49 ± 0.04 wt%. Then 30 wt% ACP or Sr-ACP granules were integrated into the scaffold prototypes. The ACP or Sr-ACP granules were well embedded and distributed in the collagen matrix demonstrated by micro-CT and scanning electron microscopy/energy dispersive x-ray spectrometry. Good cytocompatibility of ACP/Sr-ACP granules and ACP/Sr-ACP enriched scaffolds was confirmed with <i>in vitro</i> cytotoxicity assays. An overall promising early tissue response and good biocompatibility of ACP and Sr-ACP enriched scaffolds were demonstrated in a subcutaneous mouse model. In a goat osteochondral defect model, significantly more bone was observed at 6 months with the treatment of Sr-ACP enriched scaffolds compared to scaffold-only, in particular in the weight-bearing femoral condyle subchondral bone defect. Overall, the incorporation of osteogenic Sr-ACP granules in Col/Col-Mg-HAp scaffolds showed to be a feasible and promising strategy to improve subchondral bone repair.

FBXL4
Also flagged:PINK1Obstructive sleep apneasleep disordered breathing diseaseschronic intermittent hypoxiaParkindegradation
Journal Article 2024-01-20 ✓ 5 Snippets Wu R, Xu F, Li J, Wang F, Chen N, Wang X, Chen Q.
In-Text Gene Mentions

Abnormal expression of FbxL4 is also a risk factor for hypertrophic cardiomyopathy and arrhythmia.10

Moreover, MG132 treatment reversed FbxL4 deficiency-mediated downregulation of PINK1 and promotion of PINK1 ubiquitination in H9c2 cells (Figures 3G and 3H).

To validate the biological role of FbxL4 in OSA, FbxL4 was overexpressed or silenced in H9c2 cells.

Also, FbxL4 was upregulated in myocardial tissues of CIH rats, suggesting that it may participate in the progression of OSA (Figure 1H).

…involved in regulatingFbxl4-meidated mitophagy.…

Show Full Abstract

Obstructive sleep apnea (OSA) is a common sleep disordered breathing diseases that characterized by chronic intermittent hypoxia (CIH). This work aimed to explore the role of circ-CIMIRC in CIH-induced myocardial injury. CIH aggravated myocardial tissue damage in rats. Circ_CIMIRC overexpression promoted apoptosis and reduced the colocalization of Tom20 and Parkin and mitophagy in CIH-treated H9c2 cells. Additionally, FbxL4 interacted with PINK1, FbxL4 silencing reduced PINK1 ubiquitination in H9c2 cells. Two major ubiquitination sites (K319 and K433) were responsible for ubiquitination of PINK1. Circ_CIMIRC promoted FbxL4-mediated ubiquitination and degradation of PINK1. Furthermore, circ_CIMIRC inhibition alleviated the pathological damage, fibrosis and apoptosis of myocardial tissues, reduced oxidative stress in CIH rats. In conclusion, circ_CIMIRC silencing repressed FbxL4-mediated ubiquitination and degradation of PINK1 and then enhanced PINK1/Parkin-mediated mitophagy, thereby alleviating myocardial damage in CIH rats. Thus, circ_CIMIRC may be a potential strategy to alleviate CIH-induced myocardial damage.

Also flagged:lung cancercancerdeathmalignantcancer of theprimary malignant cancer
Journal Article 2024-01-20 No Snippets Li H, Du S, Dai J, Jiang Y, Li Z, Fan Q, Zhang Y, You D, Zhang R, Zhao Y, Christiani DC, Shen S, Chen F.
Show Full Abstract

Plasma proteins are promising biomarkers and potential drug targets in lung cancer. To evaluate the causal association between plasma proteins and lung cancer, we performed proteome-wide Mendelian randomization meta-analysis (PW-MR-meta) based on lung cancer genome-wide association studies (GWASs), protein quantitative trait loci (pQTLs) of 4,719 plasma proteins in deCODE and 4,775 in Fenland. Further, causal-protein risk score (CPRS) was developed based on causal proteins and validated in the UK Biobank. 270 plasma proteins were identified using PW-MR meta-analysis, including 39 robust causal proteins (both <i>FDR-q</i> < 0.05) and 78 moderate causal proteins (<i>FDR-q</i> < 0.05 in one and p < 0.05 in another). The CPRS had satisfactory performance in risk stratification for lung cancer (top 10% CPRS:Hazard ratio (HR) (95%CI):4.33(2.65-7.06)). The CPRS [AUC (95%CI): 65.93 (62.91-68.78)] outperformed the traditional polygenic risk score (PRS) [AUC (95%CI): 55.71(52.67-58.59)]. Our findings offer further insight into the genetic architecture of plasma proteins for lung cancer susceptibility.

OLFM4
Also flagged:Retinoic acidgastroenteritisvitamin ARARV infectionRV
Journal Article 2024-01-20 ✓ 3 Snippets Lai X, Wu A, Yu B, Yan H, Luo J, Zheng P, Yu J, Chen D.
In-Text Gene Mentions

…olfactomedin 4 (OLFM4), a marker…

…of SOX9 andOLFM4, which serve…

…of SOX9 andOLFM4was compromised, indicating…

Show Full Abstract

Rotaviruses (RV) are a major cause of severe gastroenteritis, particularly in neonatal piglets. Despite the availability of effective vaccines, the development of antiviral therapies for RV remains an ongoing challenge. Retinoic acid (RA), a metabolite of vitamin A, has been shown to have anti-oxidative and antiviral properties. However, the mechanism by which RA exerts its intestinal-protective and antiviral effects on RV infection is not fully understood. The study investigates the effects of RA supplementation in Duroc × Landrace × Yorkshire (DLY) piglets challenged with RV. Thirty-six DLY piglets were assigned into six treatments, including a control group, RA treatment group with two concentration gradients (5 and 15 mg/d), RV treatment group, and RV treatment group with the addition of different concentration gradients of RA (5 and 15 mg/d). Our study revealed that RV infection led to extensive intestinal architecture damage, which was mitigated by RA treatment at lower concentrations by increasing the villus height and villus height/crypt depth ratio (<i>P</i> < 0.05), enhancing intestinal stem cell signaling and promoting intestinal barrier functions. In addition, 15 mg/d RA supplementation significantly increased NRF2 and HO-1 protein expression (<i>P</i> < 0.05) and GSH content (<i>P</i> < 0.05), indicating that RA supplementation can enhance anti-oxidative signaling and redox homeostasis after RV challenge. Additionally, the research demonstrated that RA exerts a dual impact on the regulation of autophagy, both stimulating the initiation of autophagy and hindering the flow of autophagic flux. Through the modulation of autophagic flux, RA influence the progression of RV infection. These findings provide new insights into the regulation of redox hemostasis and autophagy by RA and its potential therapeutic application in RV infection.

HFE
Also flagged:Hepatocellular CarcinomacancerViral infectionsliver diseaseUninodular tumorsportal vein thrombosis
Journal Article 2024-01-20 ✓ 1 Snippet Badheeb AM, Al Sedran MK, Ahmed F, Al Sidran IK, Al Qurayshah MH, Abu Bakar A, Obied HY, Seada IA, Aman A, Badheeb M.
In-Text Gene Mentions

…causes, such ashemochromatosisand tyrosinemia, collectively…

Show Full Abstract

Background Hepatocellular carcinoma (HCC) represents the most common primary liver malignancy, with a high fatality rate. Relatively, Saudi Arabia has a high incidence of HCC, which is detected in later stages with a poor prognosis. This study aims to investigate the patterns, outcomes, and mortality predictors of HCC in Saudi Arabia. Method A retrospective study from April 2018 to June 2022 included patients with HCC who were diagnosed and managed at the Najran Oncology Center, Saudi Arabia. Through our cancer registry, the patients' clinical, laboratory, radiological, and survival profiles were extracted and analyzed to assess factors associated with mortality using a univariate analysis. The overall survival was calculated by the Kaplan-Meier method. Results The study involved 52 patients with an average age of 74.6 years, predominantly male (the male-to-female ratio is 2.25:1). Viral infections were the primary cause of liver disease in 40.3% (n=21) of patients. At diagnosis, the Child-Pugh class distribution included 23.1% (n=12) patients in class A, 36.5% (n=19) patients in class B, and 40.4% (n=21) patients in class C. Uninodular tumors with ≤50% liver extension were observed in 65.4% (n=34) of cases, and 30.8% (n=16) had portal vein thrombosis. Elevated alpha-fetoprotein (AFP) levels were noted in 48.1% (n=25) of patients, with 23.1% (n=12) exceeding 400 ng/mL. Curative resection was performed in 32.7% (n=17) of patients. The mean survival time was 23±11.8 months (median of 22.5 months, minimum of six, and maximum of 49 months). Relapse occurred in seven (13.5%) cases, while new metastasis occurred in 20 (38.5%) cases. During the study period, 26 (50.0%) patients died. The main cause of death was disease progression in 15 (28.8%) patients. Univariate analysis showed that AFP>400 ng/mL (OR: 4.68; 95% CI: 1.87-11.66, p=0.001), presence of relapse (OR: 0.16; 95% CI: 0.03-0.78, p=0.023), abdominal ascites (OR: 3.38; 95% CI: 1.25-9.14, p=0.016), advanced the Cancer of the Liver Italian Program (CLIP) score (OR: 0.60; 95% CI: 0.41-0.88, p=0.009) were associated with higher mortality rate and were statistically significant. Conclusion Most cases of HCC in our patients were attributed to viral hepatitis, with the majority having liver cirrhosis. Higher AFP (>400 ng/mL), relapse, abdominal ascites, and a higher cancer CLIP score were associated with poorer outcomes. Targeted screening and health education should be advocated; in addition, social determinants should be proactively addressed.

Also flagged:protein degradationproteolysisdegradationpeptidesantibodiesubiquitin
Journal Article 2024-01-20 No Snippets Huang X, Wu F, Ye J, Wang L, Wang X, Li X, He G.
Show Full Abstract

Targeted protein degradation (TPD) represented by proteolysis targeting chimeras (PROTACs) marks a significant stride in drug discovery. A plethora of innovative technologies inspired by PROTAC have not only revolutionized the landscape of TPD but have the potential to unlock functionalities beyond degradation. Non-small-molecule-based approaches play an irreplaceable role in this field. A wide variety of agents spanning a broad chemical spectrum, including peptides, nucleic acids, antibodies, and even vaccines, which not only prove instrumental in overcoming the constraints of conventional small molecule entities but also provided rapidly renewing paradigms. Herein we summarize the burgeoning non-small molecule technological platforms inspired by PROTACs, including three major trajectories, to provide insights for the design strategies based on novel paradigms.

medRxiv 2024-01-20 Preprint (No Snippets API) Vera-Aviles M, Kabir S, Shah A, Polzella P, Lim Y, Buckley P, Ball C, Swinkels D, Matlung H, Blans C, Holdship P, Nugent J, Andreson E, Desborough M, Piechnik S, Ferreira V, Lakhal-Littleton S.
Show Full Abstract

<h4>ABSTRACT</h4> <h4>Background and Aims</h4> Intravenous iron therapies contain iron-carbohydrate complexes, designed to ensure iron becomes bioavailable via the intermediary of spleen and liver reticuloendothelial macrophages. How other tissues obtain and handle this iron remains unknown. This study addresses this question in the context of the heart. <h4>Methods</h4> A prospective observational study was conducted in 12 patients receiving ferric carboxymaltose (FCM) for iron deficiency. Myocardial, spleen and liver magnetic resonance relaxation times, and plasma iron markers were collected longitudinally. To examine the handling of iron taken up by the myocardium, intracellular labile iron pool (LIP) was imaged in FCM-treated mice and cells. <h4>Results</h4> In patients, myocardial relaxation time T1 dropped maximally 3hrs post FCM, remaining low 42 days later, while splenic T1 dropped maximally at 14 days, recovering by 42 days. In plasma, non-transferrin bound iron (NTBI) peaked at 3hrs, while ferritin peaked at 14 days. Changes in liver T1 diverged amongst patients. In mice, myocardial LIP rose 1h and remained elevated 42 days after FCM. In cardiomyocytes, FCM exposure raised LIP rapidly. This was prevented by inhibitors of NTBI transporters T-type and L-Type calcium channels and divalent metal transporter 1. <h4>Conclusions</h4> Intravenous iron therapy with FCM delivers iron to the myocardium rapidly through NTBI transporters, independently of reticuloendothelial macrophages. This iron remains labile for weeks, reflecting the myocardium’s limited iron storage capacity. These findings challenge current notions of how the heart obtains iron from these therapies and highlight the potential for long-term dosing to cause cumulative iron build-up in the heart. <h4>TRANSLATIONAL PERSPECTIVE</h4> Many patients now receive long-term IV iron therapy. The finding that a single standard dose of IV iron causes a sustained rise in myocardial iron underscores the risk for cumulative build-up to occur with multiple doses. Magnetic resonance monitoring of myocardial iron may be required to safeguard against progression towards pathological myocardial iron overload in these patients. Plasma ferritin levels reflect the iron content of reticuloendothelial macrophages. The finding that myocardial iron elevation following IV iron therapy is independent from reticuloendothelial macrophages highlights the limitations of using plasma ferritin cut-offs to safeguard against the risk of tissue iron overload. <h4>GRAPHICAL ABSTRACT</h4>

bioRxiv 2024-01-20 Preprint (No Snippets API) Al-Massadi O, Pins Bd, Longueville S, Giralt A, Irinopoulou T, Savariradjane M, Subashi E, Ginés S, Caboche J, Betuing S, Girault J.
Show Full Abstract

Huntington’s disease (HD) is a devastating disease due to autosomal dominant mutation in the HTT gene. Its pathophysiology involves multiple molecular alterations including transcriptional defects. We previously showed that in HD patients and mouse model, the protein levels of the non-receptor tyrosine kinase PYK2 were decreased in the hippocampus and that viral expression of PYK2 improved the hippocampal phenotype. Here, we investigated the possible contribution of PYK2 in the striatum, a major brain region altered in HD. PYK2 mRNA levels were decreased in the striatum and hippocampus of R6/2 mice, a severe HD model. PYK2 protein levels were also decreased in the dorsal striatum of R6/2 mice and in the putamen of human patients. PYK2 knockout by itself did not result in motor symptoms observed in HD mouse models. Yet, we examined whether PYK2 deficiency participated in the R6/2 mice phenotype by expressing PYK2 in the dorsal striatum using AAV vectors. With an AAV1/ Camk2a promoter, we did not observe significant improvement of body weight, clasping, motor activity and coordination (rotarod) alterations observed in R6/2 mice. With an AAV9/ SYN1 promoter we found an improvement of body weight loss and a tendency to better rotarod performance. DARPP-32 immunofluorescence was increased following AAV9/ SYN1 -PYK2 injection compared to AAV9/ SYN1 -GFP, suggesting a possible partial beneficial effect on striatal projection neurons. We conclude that PYK2 mRNA and protein levels are decreased in the striatum as in hippocampus of HD patients and mouse models. However, in contrast to hippocampus, striatal viral expression of PYK2 has only a slight effect on the R6/2 model striatal motor phenotype. <h4>Highlights</h4> Huntington’s disease is a lethal genetic disease altering striatum, cortex, and hippocampus Restoring PYK2 levels in hippocampus improved hippocampal phenotype of a Huntington mouse model We show that PYK2 levels are decreased in the striatum of R6/2 mice and human patients Viral expression of PYK2 in the striatum has only a small effect on R6/2 mouse model motor phenotype but improves weight loss

ZNFX1
Also flagged:gastroenteritiscapsidnucleolinbindingrotavirus infectionsynthesis
Journal Article 2024-01-19 ✓ 1 Snippet Hernández-Guzmán J, Arias CF, López S, Sandoval-Jaime C.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

Rotavirus infection is a leading cause of gastroenteritis in children worldwide; the genome of this virus is composed of 11 segments of dsRNA packed in a triple-layered protein capsid. Here, we investigated the role of nucleolin, a protein with diverse RNA-binding domains, in rotavirus infection. Knocking down the expression of nucleolin in MA104 cells by RNA interference resulted in a remarkable 6.3-fold increase in the production of infectious rhesus rotavirus (RRV) progeny, accompanied by an elevated synthesis of viral mRNA and genome copies. Further analysis unveiled an interaction between rotavirus segment 10 (S10) and nucleolin, potentially mediated by G-quadruplex domains on the viral genome. To determine whether the nucleolin-RNA interaction regulates RRV replication, MA104 cells were transfected with AGRO100, a compound that forms G4 structures and selectively inhibits nucleolin-RNA interactions by blocking the RNA-binding domains. Under these conditions, viral production increased by 1.5-fold, indicating the inhibitory role of nucleolin on the yield of infectious viral particles. Furthermore, G4 sequences were identified in all 11 RRV dsRNA segments, and transfection of oligonucleotides representing G4 sequences in RRV S10 induced a significant increase in viral production. These findings show that rotavirus replication is negatively regulated by nucleolin through the direct interaction with the viral RNAs by sequences forming G4 structures.IMPORTANCEViruses rely on cellular proteins to carry out their replicative cycle. In the case of rotavirus, the involvement of cellular RNA-binding proteins during the replicative cycle is a poorly studied field. In this work, we demonstrate for the first time the interaction between nucleolin and viral RNA of rotavirus RRV. Nucleolin is a cellular protein that has a role in the metabolism of ribosomal rRNA and ribosome biogenesis, which seems to have regulatory effects on the quantity of viral particles and viral RNA copies of rotavirus RRV. Our study adds a new component to the current model of rotavirus replication, where cellular proteins can have a negative regulation on rotavirus replication.

HFE
Also flagged:ironbindingmanganese-superoxide dismutasesuperoxidemanganeseHfeBCD transporter
Journal Article 2024-01-19 ✓ 2 Snippets Ganio K, Nasreen M, Yang Z, Maunders EA, Luo Z, Hossain SI, Ngu DHY, Ellis D, Gu J, Neville SL, Wilksch J, Gunn AP, Whittall JJ, Kobe B, Deplazes E, Kappler U, McDevitt CA.
In-Text Gene Mentions

…PCR using primersHfe-IA1F and Hfe-IA1R (…

…using the p601-Hihfe AA-comp construct, to…

Show Full Abstract

<i>Haemophilus influenzae</i> is a commensal of the human upper respiratory tract that can infect diverse host niches due, at least in part, to its ability to withstand both endogenous and host-mediated oxidative stresses. Here, we show that <i>hfeA</i>, a gene previously linked to iron import, is essential for <i>H. influenzae</i> manganese recruitment <i>via</i> the HfeBCD transporter. Structural analyses show that metal binding in HfeA uses a unique mechanism that involves substantial rotation of the C-terminal lobe of the protein. Disruption of <i>hfeA</i> reduced <i>H. influenzae</i> manganese acquisition and was associated with decreased growth under aerobic conditions, impaired manganese-superoxide dismutase activity, reduced survival in macrophages, and changes in biofilm production in the presence of superoxide. Collectively, this work shows that HfeA contributes to <i>H. influenzae</i> manganese acquisition and virulence attributes. High conservation of the <i>hfeABCD</i> permease in <i>Haemophilus</i> species suggests that it may serve similar roles in other pathogenic Pasteurellaceae.

HTT
Also flagged:anxietysynaptogenesisendocytic scaffold protein intersectin-1ITSN1endocytosismitogen-activated protein kinase
Journal Article 2024-01-19 ✓ 5 Snippets Sowndharya S, Rajan KE.
In-Text Gene Mentions

…ITSN1 with huntingtin (Htt) [ 11 ].…

Htthas been shown…

…to co-localize withHtt, estimated level of…

…estimated level ofHttwas significantly different…

…P <0.05), estimatedHttlevel was significantly…

Show Full Abstract

Environmental enrichment (EE) through combination of social and non-biological stimuli enhances activity-dependent synaptic plasticity and improves behavioural performance. Our earlier studies have suggested that EE resilience the stress induced depression/ anxiety-like behaviour in Indian field mice Mus booduga. This study was designed to test whether EE reverses the social isolation (SI) induced effect and improve memory. Field-caught mice M. booduga were subjected to behaviour test (Direct wild, DW), remaining animals were housed under SI for ten days and then housed for short-term at standard condition (STSC)/ long-term at standard condition (LTSC) or as group in EE cage. Subsequently, we have examined reference, working memory and expression of genes associated with synaptic plasticity. Our analysis have shown that EE reversed SI induced impairment in reference, working memory and other accompanied changes i.e. increased level of Intersectin 1 (ITSN1), Huntingtin (Htt), Synaptotagmin -IV (SYT4), variants of brain-derived neurotrophic factor (Bdnf - III), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor (GluR1) expression, and decreased variants of Bdnf (IV), BDNF, Reelin, Apolipoprotein E receptor 2 (ApoER2), very low-density lipoprotein receptor (VLDLR), Src family tyrosine kinase (SFKs), Disabled protein (Dab)-1, Protein kinase B (PKB/Akt), GluR2, Mitogen-activated protein kinase (MAPK) and Extracellular signal-regulated kinase (ERK1/2) expression. In addition, SI induced reduction in BDNF expressing neurons in dentate gyrus of hippocampus reversed by EE. Further, we found that SI decreases small neuro-active molecules such as Benzenedicarboxylic acid, and increases 2-Pregnene in the hippocampus and feces reversed by EE. Overall, this study demonstrated that EE is effectively reversed the SI induced memory impairment by potentially regulating the molecules associated with the ITSN1-Reelin-AMPA receptor pathway to increase synaptic plasticity.

Also flagged:Diabetes mellitusperiodontitisinfectious-inflammatory diseaseperiodontal diseasespathogenesishyperglycemia
Journal Article 2024-01-19 No Snippets Duarte PM, Gurgel BCV, Miranda TS, Sardenberg J, Gu T, Aukhil I.
Show Full Abstract

The biological mechanisms underlying the pathogenesis of type 2 diabetes (T2DM)-related periodontitis remain unclear. This cross-sectional study evaluated the distinctive transcriptomic changes between tissues with periodontal health and with periodontitis in patients with T2DM. In this cross-sectional study, whole transcriptome sequencing was performed on gingival biopsies from non-periodontitis and periodontitis tissues from non-diabetic and diabetic patients. A differentially expressed gene (DEG) analysis and Ingenuity Pathway Analysis (IPA) assessed the genes and signaling pathways associated with T2DM-related periodontitis. Immunohistochemistry was performed to validate selected DEGs possibly involved in T2DM-related periodontitis. Four hundred and twenty and one thousand five hundred and sixty-three DEGs (fold change ≥ 2) were uniquely identified in the diseased tissues of non-diabetic and diabetic patients, respectively. The IPA predicted the activation of Phagosome Formation, Cardiac β-adrenergic, tRNA Splicing, and PI3K/AKT pathways. The IPA also predicted the inhibition of Cholesterol Biosynthesis, Adrenomedullin, and Inositol Phosphate Compounds pathways in T2DM-related periodontitis. Validation of DEGs confirmed changes in protein expression of PTPN2, PTPN13, DHCR24, PIK3R2, CALCRL, IL1RN, IL-6R and ITGA4 in diseased tissues in diabetic subjects. Thus, these preliminary findings indicate that there are specific genes and functional pathways that may be involved in the pathogenesis of T2DM-related periodontitis.

PLCL1
Also flagged:gestationpreeclampsiaprogesterone receptorPRPR-APR-B
Journal Article 2024-01-19 ✓ 1 Snippet Wang C, Wang YJ, Ying L, Wong RJ, Quaintance CC, Hong X, Neff N, Wang X, Biggio JR, Mesiano S, Quake SR, Alvira CM, Cornfield DN, Stevenson DK, Shaw GM, Li J.
In-Text Gene Mentions

…C like 1/2 (PLCL1/2) ( 46 )].…

Show Full Abstract

Preterm birth affects ~10% of pregnancies in the US. Despite familial associations, identifying at-risk genetic loci has been challenging. We built deep learning and graphical models to score mutational effects at base resolution via integrating the pregnant myometrial epigenome and large-scale patient genomes with spontaneous preterm birth (sPTB) from European and African American cohorts. We uncovered previously unidentified sPTB genes that are involved in myometrial muscle relaxation and inflammatory responses and that are regulated by the progesterone receptor near labor onset. We studied genomic variants in these genes in our recruited pregnant women administered progestin prophylaxis. We observed that mutation burden in these genes was predictive of responses to progestin treatment for preterm birth. To advance therapeutic development, we screened ~4000 compounds, identified candidate molecules that affect our identified genes, and experimentally validated their therapeutic effects on regulating labor. Together, our integrative approach revealed the druggable genome in preterm birth and provided a generalizable framework for studying complex diseases.

PEBP1
Also flagged:TrametinibagingPol IIIMEKRasMAPK
Journal Article 2024-01-19 ✓ 3 Snippets Ureña E, Xu B, Regan JC, Atilano ML, Minkley LJ, Filer D, Lu YX, Bolukbasi E, Khericha M, Alic N, Partridge L.
In-Text Gene Mentions

Knockdown of MEK (5961GS > MEKRNAi), ERK (5961GS > ERKRNAi), or ectopic expression of the Raf inhibitor PEBP1 (5961GS > PEBP1) all increased fly lifespan (Fig. 3B and SI Appendix, Fig. S3), showing that a decrease in Ras/MAPK signaling in ISCs is sufficient to extend lifespan and supporting the hypothesis that trametinib acts directly in ISCs.

…the Raf inhibitorPEBP1( 5961GS >…

…( 5961GS >PEBP1) all increased…

Show Full Abstract

Pharmacological therapies are promising interventions to slow down aging and reduce multimorbidity in the elderly. Studies in animal models are the first step toward translation of candidate molecules into human therapies, as they aim to elucidate the molecular pathways, cellular mechanisms, and tissue pathologies involved in the anti-aging effects. Trametinib, an allosteric inhibitor of MEK within the Ras/MAPK (Ras/Mitogen-Activated Protein Kinase) pathway and currently used as an anti-cancer treatment, emerged as a geroprotector candidate because it extended lifespan in the fruit fly <i>Drosophila melanogaster</i>. Here, we confirm that trametinib consistently and robustly extends female lifespan, and reduces intestinal stem cell (ISC) proliferation, tumor formation, tissue dysplasia, and barrier disruption in guts in aged flies. In contrast, pro-longevity effects of trametinib are weak and inconsistent in males, and it does not influence gut homeostasis. Inhibition of the Ras/MAPK pathway specifically in ISCs is sufficient to partially recapitulate the effects of trametinib. Moreover, in ISCs, trametinib decreases the activity of the RNA polymerase III (Pol III), a conserved enzyme synthesizing transfer RNAs and other short, non-coding RNAs, and whose inhibition also extends lifespan and reduces gut pathology. Finally, we show that the pro-longevity effect of trametinib in ISCs is partially mediated by Maf1, a repressor of Pol III, suggesting a life-limiting Ras/MAPK-Maf1-Pol III axis in these cells. The mechanism of action described in this work paves the way for further studies on the anti-aging effects of trametinib in mammals and shows its potential for clinical application in humans.

HFE
Also flagged:ironmetalsmenopauseiron deficiencyiron overloadcancer
Journal Article 2024-01-19 ✓ 1 Snippet Von Holle A, O'Brien KM, Sandler DP, Janicek R, Karagas MR, White AJ, Niehoff NM, Levine KE, Jackson BP, Weinberg CR.
In-Text Gene Mentions

…iron overload fromhemochromatosis2 , cancer…

Show Full Abstract

Iron status is often assessed in epidemiologic studies, and toenails offer a convenient alternative to serum because of ease of collection, transport, and storage, and the potential to reflect a longer exposure window. Very few studies have examined the correlation between serum and toenail levels for trace metals. Our aim was to compare iron measures using serum and toenails on both a cross-sectional and longitudinal basis. Using a subset of the US-wide prospective Sister Study cohort, we compared toenail iron measures to serum concentrations for iron, ferritin and percent transferrin saturation. Among 146 women who donated both blood and toenails at baseline, a subsample (59%, n = 86) provided specimens about 8 years later. Cross-sectional analyses included nonparametric Spearman's rank correlations between toenail and serum biomarker levels. We assessed within-woman maintenance of rank across time for the toenail and serum measures and fit mixed effects models to measure change across time in relation to change in menopause status. Spearman correlations at baseline (follow-up) were 0.08 (0.09) for serum iron, 0.08 (0.07) for transferrin saturation, and - 0.09 (- 0.17) for ferritin. The within-woman Spearman correlation for toenail iron between the two time points was higher (0.47, 95% CI 0.30, 0.64) than for serum iron (0.30, 95% CI 0.09, 0.51) and transferrin saturation (0.34, 95% CI 0.15, 0.54), but lower than that for ferritin (0.58, 95% CI 0.43, 0.73). Serum ferritin increased over time while nail iron decreased over time for women who experienced menopause during the 8-years interval. Based on cross-sectional and repeated assessments, our evidence does not support an association between serum biomarkers and toenail iron levels. Toenail iron concentrations did appear to be moderately stable over time but cannot be taken as a proxy for serum iron biomarkers and they may reflect physiologically distinct fates for iron.

Also flagged:methylationagingdeathhypermethylationGIP1ageing
Journal Article 2024-01-19 No Snippets Ying K, Liu H, Tarkhov AE, Sadler MC, Lu AT, Moqri M, Horvath S, Kutalik Z, Shen X, Gladyshev VN.
Show Full Abstract

Machine learning models based on DNA methylation data can predict biological age but often lack causal insights. By harnessing large-scale genetic data through epigenome-wide Mendelian randomization, we identified CpG sites potentially causal for aging-related traits. Neither the existing epigenetic clocks nor age-related differential DNA methylation are enriched in these sites. These CpGs include sites that contribute to aging and protect against it, yet their combined contribution negatively affects age-related traits. We established a new framework to introduce causal information into epigenetic clocks, resulting in DamAge and AdaptAge-clocks that track detrimental and adaptive methylation changes, respectively. DamAge correlates with adverse outcomes, including mortality, while AdaptAge is associated with beneficial adaptations. These causality-enriched clocks exhibit sensitivity to short-term interventions. Our findings provide a detailed landscape of CpG sites with putative causal links to lifespan and healthspan, facilitating the development of aging biomarkers, assessing interventions, and studying reversibility of age-associated changes.

DCC
Also flagged:cancerGene expressionmethylationtumorstumorbreast cancer
Journal Article 2024-01-19 ✓ 1 Snippet Duan X, Ding X, Zhao Z.
In-Text Gene Mentions

DCC[ 27 ].Boxplot…

Show Full Abstract

<h4>Background</h4>Characterizing cancer molecular subtypes is crucial for improving prognosis and individualized treatment. Integrative analysis of multi-omics data has become an important approach for disease subtyping, yielding better understanding of the complex biology. Current multi-omics integration tools and methods for cancer subtyping often suffer challenges of high computational efficiency as well as the problem of weight assignment on data types.<h4>Results</h4>Here, we present an efficient multi-omics integration via weighted affinity and self-diffusion (MOSD) to dissect cancer heterogeneity. MOSD first construct local scaling affinity on each data type and then integrate all affinities by weighted linear combination, followed by the self-diffusion to further improve the patients' similarities for the downstream clustering analysis. To demonstrate the effectiveness and usefulness for cancer subtyping, we apply MOSD across ten cancer types with three measurements (Gene expression, DNA methylation, miRNA).<h4>Conclusions</h4>Our approach exhibits more significant differences in patient survival and computationally efficient benchmarking against several state-of-art integration methods and the identified molecular subtypes reveal strongly biological interpretability. The code as well as its implementation are available in GitHub: https://github.com/DXCODEE/MOSD .

Also flagged:infectionnucleotideCRISPR/CasCaspurinepyrimidine
Journal Article 2024-01-19 No Snippets Zhang L, Parvin R, Lin S, Chen M, Zheng R, Fan Q, Ye F.
Show Full Abstract

The unprecedented demand for variants diagnosis in response to the COVID-19 epidemic has brought the spotlight onto rapid and accurate detection assays for single nucleotide polymorphisms (SNPs) at multiple locations. However, it is still challenging to ensure simplicity, affordability, and compatibility with multiplexing. Here, a novel technique is presented that combines peptide nucleic acid (PNA) clamps and near-infrared (NIR)-driven digital polymerase chain reaction (dPCR) to identify the Omicron and Delta variants. This is achieved by simultaneously identifying highly conserved mutated signatures at codons 19, 614, and 655 of the spike protein gene. By microfluidically introducing graphene-oxide-nanocomposite into the assembled gelatin microcarriers, they achieved a rapid temperature ramping-up rate and switchable gel-to-sol phase transformation synchronized with PCR activation under NIR irradiation. Two sets of duplex PCR reactions, each classifying respective PNA probes, are emulsified in parallel and illuminated together using a homemade vacuum-based droplet generation device and a programmable NIR control module. This allowed for selective amplification of mutant sequences due to single-base-pair mismatch with PNA blockers. Sequence-recognized bioreactions and fluorescent-color scoring enabled quick identification of variants. This technique achieved a detection limit of 5,100 copies and a 5-fold quantitative resolution, which is promising to unfold minor differences and dynamic changes.

Also flagged:degradationbone remodelingagingbiodegradationmitochondrialSIRT4
Journal Article 2024-01-19 No Snippets Han Y, Tong X, Zhou R, Wang Y, Chen Y, Chen L, Hong X, Wu L, Lin Z, Zhang Y, Zhang X, Hu C, Li B, Ping Y, Cao Z, Ye Z, Song Z, Li Y, Wen C, Zhou Y, Lin J, Huang S.
Show Full Abstract

Zinc (Zn)-dysprosium (Dy) binary alloys are promising biodegradable bone fracture fixation implants owing to their attractive biodegradability and mechanical properties. However, their clinical application is a challenge for bone fracture healing, due to the lack of Zn-Dy alloys with tailored proper bio-mechanical and osteointegration properties for bone regeneration. A Zn-5Dy alloy with high strength and ductility and a degradation rate aligned with the bone remodeling cycle is developed. Here, mechanical stability is further confirmed, proving that Zn-5Dy alloy can resist aging in the degradation process, thus meeting the mechanical requirements of fracture fixation. In vitro cellular experiments reveal that the Zn-5Dy alloy enhances osteogenesis and angiogenesis by elevating SIRT4-mediated mitochondrial function. In vivo Micro-CT, SEM-EDS, and immunohistochemistry analyses further indicate good biosafety, suitable biodegradation rate, and great osteointegration of Zn-5Dy alloy during bone healing, which also depends on the upregulation of SIRT4-mediated mitochondrial events. Overall, the study is the first to report a Zn-5Dy alloy that exerts remarkable osteointegration properties and has a strong potential to promote bone healing. Furthermore, the results highlight the importance of mitochondrial modulation and shall guide the future development of mitochondria-targeting materials in enhancing bone fracture healing.

FBXL4
Also flagged:neurulationneurodevelopmental disordersattention deficient hyperactivity disorderADHDdyslexialearning disabilities
Journal Article 2024-01-19 ✓ 1 Snippet Calame DG, Emrick LT.
In-Text Gene Mentions

…, MFF andFBXL4often manifests clinically…

Show Full Abstract

Mitochondria are critical for brain development and homeostasis. Therefore, pathogenic variation in the mitochondrial or nuclear genome which disrupts mitochondrial function frequently results in developmental disorders and neurodegeneration at the organismal level. Large-scale application of genome-wide technologies to individuals with mitochondrial diseases has dramatically accelerated identification of mitochondrial disease-gene associations in humans. Multi-omic and high-throughput studies involving transcriptomics, proteomics, metabolomics, and saturation genome editing are providing deeper insights into the functional consequence of mitochondrial genomic variation. Integration of deep phenotypic and genomic data through allelic series continues to uncover novel mitochondrial functions and permit mitochondrial gene function dissection on an unprecedented scale. Finally, mitochondrial disease-gene associations illuminate disease mechanisms and thereby direct therapeutic strategies involving small molecules and RNA-DNA therapeutics. This review summarizes progress in functional genomics and small molecule therapeutics in mitochondrial neurodevelopmental disorders.

ABT1
Also flagged:PD-1head and neck squamous cell cancerHNSCCCetuximabimmune responseimmune responses
Journal Article 2024-01-19 ✓ 1 Snippet Burcher KM, Bloomer CH, Gavrila E, Kalada JM, Chang MJ, Gebeyehu RR, Song AH, Khoury LM, Lycan TW, Kinney R, D'Agostino R, Bunch PM, Shukla K, Triozzi P, Furdui CM, Zhang W, Porosnicu M.
In-Text Gene Mentions

…interferon γ andactivator of transcription 1of transcription 1…

Show Full Abstract

<h4>Background</h4>Immunotherapy with programmed death receptor-1 (PD-1) inhibitors, as a single agent or in combination with chemotherapy, is the standard first-line treatment for recurrent or metastatic head and neck squamous cell cancer (R/M HNSCC). Unfortunately, there is no established second-line treatment for the many patients who fail immunotherapy. Cetuximab is the only targeted therapy approved in HNSCC but historically has a low response rate of 13%.<h4>Objectives</h4>We hypothesize that cetuximab monotherapy following an immune checkpoint inhibitor (ICI) will lead to increased efficacy due to a potential synergistic effect on the antitumor immune response, as a result of activation effects of both treatments on innate and adaptative immune responses. To the authors' knowledge, this is the only ongoing prospective clinical study that evaluates the combination of cetuximab and ICIs administered sequentially.<h4>Methods and analysis</h4>In this non-randomized, open-label, phase II trial, 30 patients with R/M HNSCC who have previously failed or could not tolerate a PD-1 inhibitor as a single agent or in combination with chemotherapy will subsequently be treated with cetuximab monotherapy. Outcomes of interest include overall response rate, duration of response, progression-free survival, overall survival, and treatment toxicity, as well as treatment outcome measured by a patient-reported outcome questionnaire. Saliva and blood will be collected for correlative studies to investigate the immune response status at the end of therapy with an ICI and the effect of cetuximab on the antitumor immune response. The results will be correlated with the response to cetuximab and the time window between the last administration of an ICI and the loading dose of cetuximab. The clinical study is actively recruiting.<h4>Ethics</h4>This study was approved by the Wake Forest Comprehensive Cancer Center Institutional Review Board: IRB00065239.<h4>Clinical trial registration</h4>This study is registered on ClinicalTrials.gov: NCT04375384.

DCC
Also flagged:antibodyAflatoxin B 1AFB 1aflatoxinshepatocellular carcinomatransportation
Journal Article 2024-01-19 ✓ 1 Snippet Han S, Yang Y, Chen T, Yang B, Ding M, Wen H, Xiao J, Cheng G, Tao Y, Hao H, Hao H, Peng D.
In-Text Gene Mentions

Standard substances (aflatoxin B1, aflatoxin B2, aflatoxin G1, aflatoxin G2), N-hydroxysuccinimide, N′N-Dimethylformamide (DMF), tween-20, bovine serum albumin (BSA), N′N-dicyclohexylcarbodiimide (DCC), keyhole limpet (KLH), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), dimethyl sulfoxide (DMSO), ovalbumin (OVA), O-carboxymethoxylamine hemihydrochloride (CMO), RPMI-1640, and horseradish peroxidase-labeled goat anti-mouse immunoglobulin G (HRP-IgG) were supplied by Thermo Fisher Scientific (Waltham, MA, USA), while hypoxanthine aminopterin thymidine (HAT) 3,3,5,5-tetramethylbenzidine (TMB), polyvinyl pyrrolidone (PVP), complete Freund’s adjuvants, incomplete Freund’s adjuvants, hypoxanthine thymidine (HT), albumin human serum (HSA), and polyethylene glycol 1500 (PEG) were purchased from Sigma-Aldrich (USA).

Show Full Abstract

In this study, a highly sensitive monoclonal antibody (mAb) was developed for the detection of aflatoxin B<sub>1</sub> (AFB<sub>1</sub>) in maize and feed. Additionally, indirect competitive enzyme-linked immunosorbent assay (ic-ELISA) and time-resolved fluorescence immunoassay assay (TRFICA) were established. Firstly, the hapten AFB<sub>1</sub>-CMO was synthesized and conjugated with carrier proteins to prepare the immunogen for mouse immunization. Subsequently, mAb was generated using the classical hybridoma technique. The lowest half-maximal inhibitory concentration (IC50) of ic-ELISA was 38.6 ng/kg with a linear range of 6.25-100 ng/kg. The limits of detections (LODs) were 6.58 ng/kg and 5.54 ng/kg in maize and feed, respectively, with the recoveries ranging from 72% to 94%. The TRFICA was developed with a significantly reduced detection time of only 21 min, from sample processing to reading. Additionally, the limits of detection (LODs) for maize and feed were determined to be 62.7 ng/kg and 121 ng/kg, respectively. The linear ranges were 100-4000 ng/kg, with the recoveries ranging from 90% to 98%. In conclusion, the development of AFB<sub>1</sub> mAb and the establishment of ic-ELISA for high-throughput sample detection, as well as TRFICA for rapid detection presented robust tools for versatile AFB<sub>1</sub> detection in different scenarios.

B4GALT5
Also flagged:pancreatic cancercancerpancreatic ductal adenocarcinomaPDACpancreatic acinar cell carcinomapancreatic tumors
Journal Article 2024-01-19 ✓ 2 Snippets Patel H, Zanos T, Hewitt DB.
In-Text Gene Mentions

Additionally, their neural network was able to identify two mutations, B4GALT5 and GSDMD, which are closely related to PC progression and survival [26].

…identify two mutations,B4GALT5and GSDMD ,…

Show Full Abstract

Pancreatic cancer is one of the most lethal gastrointestinal malignancies. Despite advances in cross-sectional imaging, chemotherapy, radiation therapy, and surgical techniques, the 5-year overall survival is only 12%. With the advent and rapid adoption of AI across all industries, we present a review of applications of DL in the care of patients diagnosed with PC. A review of different DL techniques with applications across diagnosis, management, and monitoring is presented across the different pathological subtypes of pancreatic cancer. This systematic review highlights AI as an emerging technology in the care of patients with pancreatic cancer.

CDK5RAP1
Also flagged:RapamycinSquamous Cell Gingiva CarcinomaCell CycleOral cancermTORcell proliferation
Journal Article 2024-01-19 ✓ 5 Snippets Papadakos S, Issa H, Alamri A, Alamri A, Semlali A.
In-Text Gene Mentions

Overall, our results showed that Rapamycin at 10 μM significantly inhibits the growth of Ca9-22 cells after 24 h of treatment by around 50% by suppression of key modulators in the G2/M transition, namely, Survivin and CDK5RAP1.

Given that BIRC5 increases at the centromeres level during G2/M transition and that it is believed to perform its mitotic role through modulation of microtubule function and participation in spindle checkpoint regulation [15] and taking into account that a CDK5RAP1 deficiency suppresses tumor growth through G2/M cell cycle arrest [16], we propose that the treatment with Rapamycin promotes G2/M-phase arrest of oral cancer cells by suppressing BIRC5 and CDK5RAP1.

2.2. Rapamycin’s Action Is Mediated through the Repression of Cell Division Modulators BIRC5 and CDK5RAP1

…namely, Survivin andCDK5RAP1.…

…Modulators BIRC5 andCDK5RAP1

Show Full Abstract

Oral cancer is considered as one of the most common malignancies worldwide. Its conventional treatment primarily involves surgery with or without postoperative adjuvant therapy. The targeting of signaling pathways implicated in tumorigenesis is becoming increasingly prevalent in the development of new anticancer drug candidates. Based on our recently published data, Rapamycin, an inhibitor of the mTOR pathway, exhibits selective antitumor activity in oral cancer by inhibiting cell proliferation and inducing cancer cell apoptosis, autophagy, and cellular stress. In the present study, our focus is on elucidating the genetic determinants of Rapamycin's action and the interaction networks accountable for tumorigenesis suppression. To achieve this, gingival carcinoma cell lines (Ca9-22) were exposed to Rapamycin at IC<sub>50</sub> (10 µM) for 24 h. Subsequently, we investigated the genetic profiles related to the cell cycle, apoptosis, and autophagy, as well as gene-gene interactions, using QPCR arrays and the Gene MANIA website. Overall, our results showed that Rapamycin at 10 µM significantly inhibits the growth of Ca9-22 cells after 24 h of treatment by around 50% by suppression of key modulators in the G2/M transition, namely, Survivin and CDK5RAP1. The combination of Rapamycin with Cisplatin potentializes the inhibition of Ca9-22 cell proliferation. A P1/Annexin-V assay was performed to evaluate the effect of Rapamycin on cell apoptosis. The results obtained confirm our previous findings in which Rapamycin at 10 μM induces a strong apoptosis of Ca9-22 cells. The live cells decreased, and the late apoptotic cells increased when the cells were treated by Rapamycin. To identify the genes responsible for cell apoptosis induced by Rapamycin, we performed the RT<sup>2</sup> Profiler PCR Arrays for 84 apoptotic genes. The blocked cells were believed to be directed towards cell death, confirmed by the downregulation of apoptosis inhibitors involved in both the extrinsic and intrinsic pathways, including BIRC5, BNIP3, CD40LG, DAPK1, LTA, TNFRSF21 and TP73. The observed effects of Rapamycin on tumor suppression are likely to involve the autophagy process, evidenced by the inhibition of autophagy modulators (TGFβ1, RGS19 and AKT1), autophagosome biogenesis components (AMBRA1, ATG9B and TMEM74) and autophagy byproducts (APP). Identifying gene-gene interaction (GGI) networks provided a comprehensive view of the drug's mechanism and connected the studied tumorigenesis processes to potential functional interactions of various kinds (physical interaction, co-expression, genetic interactions etc.). In conclusion, Rapamycin shows promise as a clinical agent for managing Ca9-22 gingiva carcinoma cells.

DCC
Also flagged:Thy1antimicrobial peptidesimmunoglobulin Atissue homeostasissecretionantibodies
Journal Article 2024-01-19 ✓ 1 Snippet Fan Q, Yan R, Li Y, Lu L, Liu J, Li S, Fu T, Xue Y, Liu J, Li Z.
In-Text Gene Mentions

…the one maleC57BL/six mousemouse ELGs.…

Show Full Abstract

The lacrimal gland is responsible for maintaining the health of the ocular surface through the production of tears. However, our understanding of the immune system within the lacrimal gland is currently limited. Therefore, in this study, we utilized single-cell RNA sequencing and bioinformatic analysis to identify and analyze immune cells and molecules present in the lacrimal glands of normal mice. A total of 34,891 cells were obtained from the lacrimal glands of mice and classified into 18 distinct cell clusters using Seurat clustering. Within these cell populations, 26 different immune cell subpopulations were identified, including T cells, innate lymphocytes, macrophages, mast cells, dendritic cells, and B cells. Network analysis revealed complex cell-cell interactions between these immune cells, with particularly significant interactions observed among T cells, macrophages, plasma cells, and dendritic cells. Interestingly, T cells were found to be the main source of ligands for the Thy1 signaling pathway, while M2 macrophages were identified as the primary target of this pathway. Moreover, some of these immune cells were validated using immunohistological techniques. Collectively, these findings highlight the abundance and interactions of immune cells and provide valuable insights into the complexity of the lacrimal gland immune system and its relevance to associated diseases.

Also flagged:neurogenesisneurodegenerative disordersdimethylaminodihydroxyflavoneacetylmelatonin
Journal Article 2024-01-19 No Snippets Liu SS, Ma CX, Quan ZY, Ding J, Yang L, Liu SM, Zhang HA, Qing H, Liang JH.
Show Full Abstract

We previously discovered <b>WS-6</b> as a new antidepressant in correlation to its function of stimulating neurogenesis. Herein, several different scaffolds (stilbene, 1,3-diphenyl 1-propene, 1,3-diphenyl 2-propene, 1,2-diphenyl acrylo-1-nitrile, 1,2-diphenyl acrylo-2-nitrile, 1,3-diphenyl trimethylamine), further varied through substitutions of twelve amide substituents plus the addition of a methylene unit and an inverted amide, were examined to elucidate the SARs for promoting adult rat neurogenesis. Most of the compounds could stimulate proliferation of progenitors, but just a few chemicals possessing a specific structural profile, exemplified by diphenyl acrylonitrile <b>29b, 32a,</b> and <b>32b</b>, showed better activity than the clinical drug <b>NSI-189</b> in promoting newborn cells differentiation into mature neurons. The most potent diphenyl acrylonitrile <b>32b</b> had an excellent brain AUC to plasma AUC ratio (B/P = 1.6), suggesting its potential for further development as a new lead.

OLFM4
Also flagged:ESR1Head and Neck Squamous Cell CarcinomaHNSCCestrogen receptor 1tumorssolid tumors
Journal Article 2024-01-19 ✓ 2 Snippets Almouhanna F, Hess J.
In-Text Gene Mentions

The risk score for each tumor was calculated using glmnet package (s = lambda.min and type = “response”) based on the following coefficient values for the selected 25 genes: ZNF831 = −0.4258735, FCRL3 = −0.1400017, SOX30 = −0.0956562, LHX9 = −0.0291356, SLC13A5 = −0.0248776, NOBOX = −0.0224077, PRAP1 = −0.0195581, CYP1A1 = −0.0165553, ATP13A5 = −0.012558, NEUROD2 = −0.0118979, WDFY4 = −0.0061702, CYP4X1 = −0.00601, FOXH1 = −0.0059322, SFRP1 = −0.0037341, LIM2 = −0.0013229, FAM25A = −0.0010163, CALB1 = 0.00163639, CHRDL1 = 0.00211768, LGI3 = 0.00365953, CCL26 = 0.00498837, OLFM4 = 0.0054605, GAST = 0.00735744, SMYD1 = 0.00836536, HRH2 = 0.03578589, and HOXB8 = 0.08355879.

…CCL26 = 0.00498837,OLFM4= 0.0054605, GAST…

Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is associated with high morbidity and mortality. New personalized treatment strategies represent an unmet medical need to improve the overall survival and the quality of life of patients, which are often limited by the toxicity of established multimodal treatment protocols. Several studies have reported an increased expression of the estrogen receptor 1 (ESR1) in HNSCC, but its potential role in the disease outcome of these tumors remains elusive. Using an integrative analysis of multiomics and clinical data from The Cancer Genome Atlas (TCGA)-HNSC, we established a prognostic risk model based on an ESR1-related 25-gene set. The prognostic value was confirmed in an independent cohort of HNSCC and other solid tumors from TCGA. Finally, we performed in silico drug sensitivity modeling to explore potential vulnerabilities for both risk groups. This approach predicted a higher sensitivity for HNSCC, with prominent ESR1 pathway activity under treatment with specific estrogen receptor modulators. In conclusion, our data confirm the involvement of ESR1-related pathway activity in the progression of a defined subset of HNSCC, provide compelling evidence that these tumors share a specific vulnerability to endocrine therapy, and pave the way for preclinical studies and clinical trials to demonstrate the efficacy of this new therapeutic option.

DCC
Also flagged:Solitary fibrous tumororbital tumorstumorSolitary fibrous tumorsNAB2STAT6
Journal Article 2024-01-19 ✓ 3 Snippets Medina-Ceballos E, Machado I, Giner F, Bujeda ÁB, Navarro S, Ferrandez A, Lavernia J, Ruíz-Sauri A, Llombart-Bosch A.
In-Text Gene Mentions

The Huang model takes into consideration tumor size, mitotic figures, Ki-67 index, and dominant constituent cell (DCC) as key variables.

…dominant constituent cell (DCC) as key variables.…

…importance of consideringDCC, mitotic count, and…

Show Full Abstract

Solitary fibrous tumors (SFTs) are known for their heterogeneous morphology, characterized by a variety of cell shapes and different growth patterns. They can also arise in various anatomical locations, most commonly in extremities and deep soft tissues. Despite this diversity in morphology and location, all SFTs share a common molecular signature involving the NAB2::STAT6 gene fusion. Due to their unpredictable clinical behavior, establishing prognostic factors is crucial. This study aims to evaluate an orbital risk stratification system (RSS) proposed by Huang et al. for use in extraorbital SFTs using a database of 97 cases. The Huang model takes into consideration tumor size, mitotic figures, Ki-67 index, and dominant constituent cell (DCC) as key variables. Survival analysis confirmed the model's predictive value, with higher-risk scores being associated with poorer outcomes. However, in contrast to the orbital SFTs studied by Huang et al., our study did not find a correlation between tumor size and recurrence in extraorbital cases. While the Huang model performs slightly better than other RSS, it falls short on achieving statistical significance in distinguishing recurrence risk groups in extraorbital locations. In conclusion, this study validates the Huang RSS for use in extraorbital SFTs and underscores the importance of considering DCC, mitotic count, and Ki-67 together. However, we found that including tumor size in this model did not improve prognostic significance in extraorbital SFTs. Despite the benefits of this additional RSS, vigilant monitoring remains essential, even in cases classified as low-risk due to the inherent unpredictability of SFT clinical outcomes.

Also flagged:Ferroptosishead and neck squamous cell carcinomaHNSCCmalignant tumorcell deathtumor
Journal Article 2024-01-19 No Snippets Yang J, Gu Z.
Show Full Abstract

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common malignant tumor worldwide, with high morbidity and mortality. Surgery and postoperative chemoradiotherapy have largely reduced the recurrence and fatality rates for most HNSCCs. Nonetheless, these therapeutic approaches result in poor prognoses owing to severe adverse reactions and the development of drug resistance. Ferroptosis is a kind of programmed cell death which is non-apoptotic. Ferroptosis of tumor cells can inhibit tumor development. Ferroptosis involves various biomolecules and signaling pathways, whose expressions can be adjusted to modulate the sensitivity of cells to ferroptosis. As a tool in the fight against cancer, the activation of ferroptosis is a treatment that has received much attention in recent years. Therefore, understanding the molecular mechanism of ferroptosis in HNSCC is an essential strategy with therapeutic potential. The most important thing to treat HNSCC is to choose the appropriate treatment method. In this review, we discuss the molecular and defense mechanisms of ferroptosis, analyze the role and mechanism of ferroptosis in the inhibition and immunity against HNSCC, and explore the therapeutic strategy for inducing ferroptosis in HNSCC including drug therapy, radiation therapy, immunotherapy, nanotherapy and comprehensive treatment. We find ferroptosis provides a new target for HNSCC treatment.

Also flagged:phosphoruscarbonperoxidasePODsuperoxide dismutaseSOD
Journal Article 2024-01-19 No Snippets Guo Z, Ye W, Wang H, He W, Tian Y, Hu G, Lou Y, Pan H, Yang Q, Zhuge Y.
Show Full Abstract

<h4>Introduction</h4>Straw return has been widely recognized as an important carbon (C) enhancement measure in agroecosystems, but the C-phosphorus (P) interactions and their effects on plants in saline soils are still unclear.<h4>Methods</h4>In this study, we investigated the effects of straw return and three P application levels, no P fertilizer (Non-P), a conventional application rate of P fertilizer (CP), and a high application rate of P fertilizer (HP), on maize growth and soil C and P fractions through a pot experiment.<h4>Results and discussion</h4>The results revealed that the dry matter weight of maize plant was no difference between the two straw return levels and was 15.36% higher under HP treatments than under Non-P treatments. Plant nutrient accumulations were enhanced by straw addition and increased with increasing P application rate. Straw application reduced the activities of peroxidase (POD), superoxide dismutase (SOD), catalase, and the content of malondialdehyde (MDA) in maize plants by 31.69%, 38.99%, 45.96% and 27.04%, respectively. P application decreased SOD, POD activities and MDA content in the absence of straw. The contents of easily oxidized organic carbon (EOC), particulate organic carbon (POC) and the ratio of POC/SOC in straw-added soils were 10.23%, 17.00% and 7.27% higher, respectively, than those in straw-absent soils. Compared with Non-P treatments, HP treatments led to an increase of 12.05%, 23.04% in EOC, POC contents respectively, while a decrease of 18.12% in the contribution of MAOC to the SOC pool. Straw return improved the P status of the saline soil by increasing soil available P (14.80%), organic P (35.91%) and Ca<sub>2</sub>-P contents (4.68%). The structural equation model showed that straw and P applications could promote maize growth (indicated by dry matter weight, P accumulation, antioxidant enzyme activity and MDA content) through improving soil C and P availabilities.<h4>Conclusion</h4>This study provides evidence that straw return together with adequate P supply in saline soil can promote crop nutrient accumulation, attenuate the oxidation damage on crop growth, and be beneficial for SOC turnover and soil P activation.

Also flagged:ferroptosisneurological disordersirondeathpolyunsaturated fatty acidslipid
Journal Article 2024-01-19 No Snippets Mohan S, Alhazmi HA, Hassani R, Khuwaja G, Maheshkumar VP, Aldahish A, Chidambaram K.
Show Full Abstract

Ferroptosis is a newly discovered non-apoptotic and iron-dependent type of cell death. Ferroptosis mainly takes place owing to the imbalance of anti-oxidation and oxidation in the body. It is regulated via a number of factors and pathways both inside and outside the cell. Ferroptosis is closely linked with brain and various neurological disorders (NDs). In the human body, the brain contains the highest levels of polyunsaturated fatty acids, which are known as lipid peroxide precursors. In addition, there is also a connection of glutathione depletion and lipid peroxidation with NDs. There is growing evidence regarding the possible link between neuroinflammation and multiple NDs, such as Alzheimer's disease, amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, and stroke. Recent studies have demonstrated that disruptions of lipid reactive oxygen species (ROS), glutamate excitatory toxicity, iron homeostasis, and various other manifestations linked with ferroptosis can be identified in various neuroinflammation-mediated NDs. It has also been reported that damage-associated molecular pattern molecules including ROS are generated during the events of ferroptosis and can cause glial activation via activating neuroimmune pathways, which subsequently leads to the generation of various inflammatory factors that play a role in various NDs. This review summarizes the regulation pathways of ferroptosis, the link between ferroptosis as well as inflammation in NDs, and the potential of a range of therapeutic agents that can be used to target ferroptosis and inflammation in the treatment of neurological disorders.

TNFSF4
Also flagged:Lactylationtumorbreast cancercancerlung cancerpost-translational modification
Journal Article 2024-01-19 ✓ 1 Snippet Jiao Y, Ji F, Hou L, Lv Y, Zhang J.
In-Text Gene Mentions

…TNFSF14 , andTNFSF4) was high…

Show Full Abstract

<h4>Background</h4>Lactylation is implicated in various aspects of tumor biology, but its relation to breast cancer remains poorly understood. This study aimed to explore the roles of the lactylation-related genes in breast cancer and its association with the tumor microenvironment.<h4>Methods</h4>The expression and mutation patterns of lactylation-related genes were analyzed using the breast cancer data from The Cancer Genome Atlas (TCGA) database and GSE20685 datasets. Unsupervised clustering was used to identify two lactylation clusters. A lactylation-related gene signature was developed and validated using the training and validation cohorts. Immune cell infiltration and drug response were assessed.<h4>Results</h4>We analyzed the mRNA expression, copy number variations, somatic mutations, and correlation networks of 22 lactylation-related genes in breast cancer tissues. We identified two distinct lactylation clusters with different survival outcomes and immune microenvironments. We further classified the patients into two gene subtypes based on lactylation clusters and identified a 7-gene signature for breast cancer survival prognosis. The prognostic score based on this signature demonstrated prognostic value and predicted the therapeutic response.<h4>Conclusion</h4>Lactylation-related genes play a critical role in breast cancer by influencing tumor growth, immune microenvironment, and drug response. This lactylation-related gene signature may serve as a prognostic marker and a potential therapeutic target for breast cancer.

Also flagged:inulincannabidiolpathogenesisulcerative colitismitochondriabromide
Journal Article 2024-01-19 No Snippets Zhang X, Gao X, Yi X, Yu H, Shao M, Li Y, Shen X.
Show Full Abstract

The pathogenesis of ulcerative colitis (UC) is closely related to severe inflammation, damaged colonic mucosal barrier, increased oxidative stress and intestinal ecological imbalance. However, due to the nonspecific distribution and poor bioavailability of drugs, UC treatment is still a serious challenge. Here, a mitochondria/colon dual targeted nanoparticles based on redox response was developed to effectively alleviate UC. Cannabidiol nanoparticles (CBD NPs) with a particle size of 143.2 ± 3.11 nm were prepared by self-assembly using polymers (TPP-IN-LA) obtained by modifying inulin with (5-carboxypentyl) triphenyl phosphonium bromide (TPP) and α-lipoic acid (α-LA). Excitingly, the constructed CBD NPs showed excellent mitochondrial targeting, with a Pearson correlation coefficient of 0.76 at 12 h. The results of animal imaging <i>in vivo</i> showed that CBD NPs could be effectively accumulated in colon tissue. Not only that, CBD showed significant glutathione stimulated release in the presence of 10 mM glutathione at pH 7.4. The results of <i>in vivo</i> animal experiments showed that CBD NPs significantly ameliorated DSS-induced colonic inflammation by modulating the TLR4-NF-κB signaling pathway. Moreover, CBD NPs significantly improved the histological damage of colon in UC mice, increased the expression level of tight junction protein ZO-1, and effectively restored the intestinal mucosal barrier function and intestinal mucosal permeability. More importantly, CBD NPs significantly improved the species composition, abundance and amount of short chain fatty acids of intestinal flora in UC mice, thus effectively maintaining the balance of intestinal flora. The dual-targeted and glutathione-responsive nanoparticles prepared in this study provide a promising idea for achieving targeted delivery of CBD for effective treatment of UC.

HFE
Also flagged:aortic regurgitationmyocardial infarctionhearingvalvulopathyhereditary hemochromatosisiron
Journal Article 2024-01-19 ✓ 2 Snippets Bowman T, O'Donoghue D, Diz Ferre JL, Marquez Roa LA, Hofstra R, Ayad S.
In-Text Gene Mentions

…a relationship withhemochromatosis, did not cause…

…cardiomyopathy due tohemochromatosis[ 3 ].…

Show Full Abstract

Injury of a coronary cusp of the aortic valve is a rare complication that can occur during coronary angiography. It usually occurs from multiple attempts with different catheters to access the ostia of the right coronary artery, but it has also occurred accessing the ostia of the left coronary artery. We present the case of a patient who underwent coronary angiography with suspected coronary cusp injury that remained asymptomatic but was found to have severe aortic regurgitation during coronary artery bypass graft surgery (CABG) one week later, requiring an aortic valve replacement.

HFE
Also flagged:Hereditary HemochromatosisHHgenetic disorderiron metabolism disorderironsystemic disease
Journal Article 2024-01-19 ✓ 5 Snippets Tonna RF, Haddadin R, Iqbal H, Gemil H.
In-Text Gene Mentions

…mutations in theHFEgene, with the…

…in managing heterozygoushemochromatosis.…

HFE-related (C282Y homozygosity, …

…compound heterozygosity, orHFEdeletion), in which…

…Non-HFE-related (hemojuvelin HJV-, he…

Show Full Abstract

Hereditary hemochromatosis (HH) is the most common autosomal recessive genetic disorder globally for Caucasians. HH is known as an iron metabolism disorder where there is an increase in iron absorption in the body. HH is not localized but a systemic disease; the manifestations of HH include cirrhosis, diabetes mellitus, cardiomyopathy, and pancreatitis. This case is about a 53-year-old female with a past medical history of heterozygous hereditary hemochromatosis who presents to the emergency department with abdominal pain, nausea, and vomiting and was found to have acute pancreatitis. This case report helps signify the importance of identifying and treating symptomatic heterozygous carriers of the HH gene mutation.

TNFSF4
Also flagged:inflammatory skin diseaseADpathogenesispruritussleeppsychological stress
Journal Article 2024-01-18 ✓ 2 Snippets Croft M, Esfandiari E, Chong C, Hsu H, Kabashima K, Kricorian G, Warren RB, Wollenberg A, Guttman-Yassky E.
In-Text Gene Mentions

…superfamily, member 4 (TNFSF4)] that may be…

…superfamily, member 4 (TNFSF4)] is increased in…

Show Full Abstract

Atopic dermatitis (AD) is a chronic, heterogeneous, inflammatory disease characterized by skin lesions, pruritus, and pain. Patients with moderate-to-severe AD experience chronic symptoms, intensified by unpredictable flares, and often have comorbidities and secondary complications, which can result in significant clinical burden that impacts the patient's overall quality of life. The complex interplay of immune dysregulation and skin barrier disruption drives AD pathogenesis, of which T-cell-dependent inflammation plays a critical role in patients with AD. Despite new targeted therapies, many patients with moderate-to-severe AD fail to achieve or sustain their individual treatment goals and/or may not be suitable for or tolerate these therapies. There remains a need for a novel, efficacious, well-tolerated therapeutic option that can deliver durable benefits across a heterogeneous AD patient population. Expression of OX40 [tumor necrosis factor receptor superfamily, member 4 (TNFRSF4)], a prominent T-cell co-stimulatory molecule, and its ligand [OX40L; tumor necrosis factor superfamily, member 4 (TNFSF4)] is increased in AD. As the OX40 pathway is critical for expansion, differentiation, and survival of effector and memory T cells, its targeting might be a promising therapeutic approach to provide sustained inhibition of pathogenic T cells and associated inflammation and broad disease control. Antibodies against OX40 [rocatinlimab (AMG 451/KHK4083) and telazorlimab (GBR 830)] or OX40L [amlitelimab (KY1005)] have shown promising results in early-phase clinical studies of moderate-to-severe AD, highlighting the importance of OX40 signaling as a new therapeutic target in AD.

Also flagged:envelopeendoplasmic reticulummembranemitosislipidmetabolism
Journal Article 2024-01-18 No Snippets Deolal P, Scholz J, Ren K, Bragulat-Teixidor H, Otsuka S.
Show Full Abstract

The nuclear envelope (NE) regulates nuclear functions, including transcription, nucleocytoplasmic transport, and protein quality control. While the outer membrane of the NE is directly continuous with the endoplasmic reticulum (ER), the NE has an overall distinct protein composition from the ER, which is crucial for its functions. During open mitosis in higher eukaryotes, the NE disassembles during mitotic entry and then reforms as a functional territory at the end of mitosis to reestablish nucleocytoplasmic compartmentalization. In this review, we examine the known mechanisms by which the functional NE reconstitutes from the mitotic ER in the continuous ER-NE endomembrane system during open mitosis. Furthermore, based on recent findings indicating that the NE possesses unique lipid metabolism and quality control mechanisms distinct from those of the ER, we explore the maintenance of NE identity and homeostasis during interphase. We also highlight the potential significance of membrane junctions between the ER and NE.

POU3F2
Also flagged:Neurodevelopmental disordersbrain developmentDevelopmental DisorderschromatinGATAD2BGAND
Journal Article 2024-01-18 ✓ 1 Snippet Abad C, Robayo MC, Muñiz-Moreno MDM, Bernardi MT, Otero MG, Kosanovic C, Griswold AJ, Pierson TM, Walz K, Young JI.
In-Text Gene Mentions

…reduced expression ofPou3f2/Brn2, a transcriptional regul…

Show Full Abstract

GATAD2B (GATA zinc finger domain containing 2B) variants are associated with the neurodevelopmental syndrome GAND, characterized by intellectual disability (ID), infantile hypotonia, apraxia of speech, epilepsy, macrocephaly and distinct facial features. GATAD2B encodes for a subunit of the Nucleosome Remodeling and Histone Deacetylase (NuRD) complex. NuRD controls transcriptional programs critical for proper neurodevelopment by coupling histone deacetylase with ATP-dependent chromatin remodeling activity. To study mechanisms of pathogenesis for GAND, we characterized a mouse model harboring an inactivating mutation in Gatad2b. Homozygous Gatad2b mutants die perinatally, while haploinsufficient Gatad2b mice exhibit behavioral abnormalities resembling the clinical features of GAND patients. We also observed abnormal cortical patterning, and cellular proportions and cell-specific alterations in the developmental transcriptome in these mice. scRNAseq of embryonic cortex indicated misexpression of genes key for corticogenesis and associated with neurodevelopmental syndromes such as Bcl11b, Nfia and H3f3b and Sox5. These data suggest a crucial role for Gatad2b in brain development.

MRPL39
Also flagged:ADlung cancerCHRNA5mild cognitive impairmentAPOEpioglitazone
Journal Article 2024-01-18 ✓ 1 Snippet Mahedy L, Anderson EL, Tilling K, Thornton ZA, Elmore AR, Szalma S, Simen A, Culp M, Zicha S, Harel BT, Davey Smith G, Smith EN, Paternoster L.
In-Text Gene Mentions

…the nearest gene,MRPL39, >2 Mb…

Show Full Abstract

Cognitive decline is a major health concern and identification of genes that may serve as drug targets to slow decline is important to adequately support an aging population. Whilst genetic studies of cross-sectional cognition have been carried out, cognitive change is less well-understood. Here, using data from the TOMMORROW trial, we investigate genetic associations with cognitive change in a cognitively normal older cohort. We conducted a genome-wide association study of trajectories of repeated cognitive measures (using generalised estimating equation (GEE) modelling) and tested associations with polygenic risk scores (PRS) of potential risk factors. We identified two genetic variants associated with change in attention domain scores, rs534221751 (p = 1 × 10<sup>-8</sup> with slope 1) and rs34743896 (p = 5 × 10<sup>-10</sup> with slope 2), implicating NCAM2 and CRIPT/ATP6V1E2 genes, respectively. We also found evidence for the association between an education PRS and baseline cognition (at >65 years of age), particularly in the language domain. We demonstrate the feasibility of conducting GWAS of cognitive change using GEE modelling and our results suggest that there may be novel genetic associations for cognitive change that have not previously been associated with cross-sectional cognition. We also show the importance of the education PRS on cognition much later in life. These findings warrant further investigation and demonstrate the potential value of using trial data and trajectory modelling to identify genetic variants associated with cognitive change.

Also flagged:intrahepatic cholangiocarcinomacancerICCAtumorliver cancerperihilar cholangiocarcinoma
Journal Article 2024-01-18 No Snippets Liu YG, Jiang ST, Zhang JW, Zhang L, Zhao HT, Sang XT, Lu X, Xu YY.
Show Full Abstract

This study aimed to develop and validate prognostic nomograms that can estimate the probability of 1-, 3- and 5-year overall survival (OS) as well as cancer-specific survival (CSS) for Intrahepatic cholangiocarcinoma (ICCA) patients. Clinical data of 1446 patients diagnosed with ICCA between 2010 and 2017 from the Surveillance, Epidemiology, and End Results (SEER) database were analyzed. In both the OS and the CSS group, the training cohort and validation cohort were divided into a 7:3 ratio. Age, sex, AJCC T stage, AJCC N stage, AJCC M stage, surgical status, and tumor grade were selected as independent prognostic risk factors to build the nomograms. To compare the efficacy of predicting 1-, 3-, and 5-year OS and CSS rates of the nomogram with the 8th edition of the American Joint Committee on Cancer (AJCC) staging system, we evaluated the Harrell's index of concordance (C-index), area under the receiver operating characteristic curve (AUC) and decision curve analysis (DCA) in both cohorts. The results showed the nomogram for 1-, 3-, and 5-year OS and CSS prediction performed better than the AJCC staging system. In the subgroup analysis for patients could not receive surgery as the primary treatment. We developed two nomograms for predicting the 1-, and 2-year OS and CSS rates following the same analysis procedure. Results indicate that the performance of both nomograms, which contained sex, AJCC T stage, AJCC M stage, chemotherapy, and tumor grade and prognostic factors, was also superior to the AJCC staging system. Meanwhile, four dynamic network-based nomograms were published. The survival analysis showed the survival rate of patients classified as high-risk based on the nomogram score was significantly lower compared to those categorized as low-risk (P < 0.0001). Finally, accurate and convenient nomograms were established to assist clinicians in making more personalized prognosis predictions for ICCA patients.

Also flagged:respiratory diseasesRetinoic Acid Receptor Responder 2RARRES2R-Spondin 4RSPO4Alkaline Phosphatase, Placental Like 2
Journal Article 2024-01-18 No Snippets Axelsson GT, Jonmundsson T, Woo Y, Frick EA, Aspelund T, Loureiro JJ, Orth AP, Jennings LL, Gudmundsson G, Emilsson V, Gudmundsdottir V, Gudnason V.
Show Full Abstract

<h4>Background</h4>A decline in forced expiratory volume (FEV1) is a hallmark of respiratory diseases that are an important cause of morbidity among the elderly. While some data exist on biomarkers that are related to FEV1, we sought to do a systematic analysis of causal relations of biomarkers with FEV1.<h4>Methods</h4>Data from the population-based AGES-Reykjavik study were used. Serum proteomic measurements were done using 4782 DNA aptamers (SOMAmers). Data from 1479 participants with spirometric data were used to assess the association of SOMAmer measurements with FEV1 using linear regression. Bi-directional two-sample Mendelian randomisation (MR) analyses were done to assess causal relations of observationally associated SOMAmers with FEV1, using genotype and SOMAmer data from 5368 AGES-Reykjavik participants and genetic associations with FEV1 from a publicly available GWAS (n = 400,102).<h4>Results</h4>In observational analyses, 530 SOMAmers were associated with FEV1 after multiple testing adjustment (FDR < 0.05). The most significant were Retinoic Acid Receptor Responder 2 (RARRES2), R-Spondin 4 (RSPO4) and Alkaline Phosphatase, Placental Like 2 (ALPPL2). Of the 257 SOMAmers with genetic instruments available, eight were associated with FEV1 in MR analyses. Three were directionally consistent with the observational estimate, Thrombospondin 2 (THBS2), Endoplasmic Reticulum Oxidoreductase 1 Beta (ERO1B) and Apolipoprotein M (APOM). THBS2 was further supported by a colocalization analysis. Analyses in the reverse direction, testing whether changes in SOMAmer levels were caused by changes in FEV1, were performed but no significant associations were found after multiple testing adjustments.<h4>Conclusions</h4>In summary, this large scale proteogenomic analyses of FEV1 reveals circulating protein markers of FEV1, as well as several proteins with potential causality to lung function.

Also flagged:thyroid nodulesfollicular neoplasmthyroidnodulemalignant neoplasmsfollicular lesion
Journal Article 2024-01-18 No Snippets Kılınç Uğurlu A, Bitkay A, Gürbüz F, Karakuş E, Bayram Ilıkan G, Damar Ç, Şahin S, Kıran MM, Gülaldı N, Azılı MN, Şenel E, Ergürhan İlhan İ, Boyraz M.
Show Full Abstract

<h4>Objective</h4>The aim was to assess postoperative outcomes in pediatric thyroid nodules with atypia of undetermined significance (AUS/FLUS) or suspicious for a follicular neoplasm (SFN) and their respective the European-Thyroid Imaging Reporting and Data System (EU-TIRADS) scores.<h4>Methods</h4>Forty-four pediatric patients at a single center with thyroid nodules classified as AUS/FLUS or SFN from August 2019 to December 2022 were retrospectively reviewed. Data on demographics, thyroid function, nodule size, and ultrasonographic features were collected. Postoperative pathologies were categorized into benign, low-risk, and malignant neoplasms according to the World Health Organization 2022 criteria, and EU-TIRADS was used for retrospective radiological scoring.<h4>Results</h4>Among 21 (47.7%) of patients who had surgical intervention, 72% had Bethesda 3 and 28% had Bethesda 4 thyroid nodules. Post-surgical histopathological classifications were 43% benign, 19% low-risk, and 38% malignant. Of note, EU-TIRADS 3 and 5 scores were present in 44% and 56% of the benign cases, respectively. Malignant cases tended to produce higher EU-TIRADS scores, with 64% rated as EU-TIRADS 5. Bethesda category 4 nodules had a 66% malignancy rate, significantly higher than the 27% in category 3.<h4>Conclusion</h4>A substantial proportion of histologically benign cases were classified as EU-TIRADS 5, suggesting that EU-TIRADS may lead to unnecessary biopsies in benign cases. Malignant cases were more likely to have a higher EU-TIRADS score, indicating a positive correlation with malignancy risk, particularly in Bethesda 4 cases. However, the EU-TIRADS system’s predictive value for malignancy in Bethesda 3 cases was poorer.

Also flagged:urinary tractlower urinary tract dysfunctionneurogenicNerve growth factorNGFbrain-derived neurotrophic factor
Journal Article 2024-01-18 No Snippets Sekerci CA, Yucel S, Tarcan T.
Show Full Abstract

<h4>Aim</h4>The aim of this systematic review is to assess urinary biomarkers studied in children with neurogenic and non-neurogenic lower urinary tract dysfunction (LUTD).<h4>Materials and methods</h4>The systematic review was conducted in accordance with the PRISMA guidelines. The screening was performed on PUBMED without any publication date limitation. Only original articles were included. Parameters related to the following topics were obtained: study design, characteristics of participants, number of participants, age, control group, types of biomarkers, measurement technique in urine, subgroup analysis, urodynamic findings, and outcome. Dutch Cochrane Checklist (DCC) and level of evidence by EBRO platform were used for quality assessment. Meta-analysis was performed with the Comprehensive Meta-Analysis Version 4 program.<h4>Results</h4>A total of 494 studies were screened and 16 studies were included. 11 (68.75%) were conducted in children with non-neurogenic LUTD and 5 (31.25%) neurogenic LUTD. Nerve growth factor (NGF) was evaluated in 12 studies, brain-derived neurotrophic factor (BDNF) in 5, Tissue Inhibitor of Metalloproteinase-2 (TIMP-2) in 2, transforming growth factor beta-1 (TGF Beta-1) in 2, neutrophil gelatinase-associated lipocalin (NGAL) in 1, and Aquaporin-2 in 1. According to DCC, 10 (62.5%) articles were evaluated on 4 (37.5%) items and 4 articles on 5 items. The average score was 3.91+/-0.56. The level of evidence was found as B for 13 (81.25%) articles and C for 3 (18.75%). In meta-analysis, urinary NGF levels in children with non-neurogenic LUTS were significantly higher than in the healthy control group (Hedges's g = 1.867, standard error = 0.344, variance = 0.119, p = 0.0001).<h4>Conclusion</h4>Urinary biomarkers are promising for the future with their noninvasive features. However, prospective studies with larger sample sizes are needed to better understand the potential of urinary biomarkers to reflect urodynamic and clinical findings in children with LUTD.

Also flagged:Hydroxyapatitetumoralkaline phosphataseALPcalciumextracellular
Journal Article 2024-01-18 No Snippets Tantawy MN, McIntyre JO, Yull F, Calcutt MW, Koktysh DS, Wilson AJ, Zu Z, Nyman J, Rhoades J, Peterson TE, Colvin D, McCawley LJ, Rook JM, Fingleton B, Crispens MA, Alvarez RD, Gore JC.
Show Full Abstract

<h4>Background</h4>It has been shown that tumor microenvironment (TME) hydroxyapatite (HAP) is typically associated with many malignancies and plays a role in tumor progression and growth. Additionally, acidosis in the TME has been reported to play a key role in selecting for a more aggressive tumor phenotype, drug resistance and desensitization to immunotherapy for many types of cancers. TME-HAP is an attractive target for tumor detection and treatment development since HAP is generally absent from normal soft tissue. We provide strong evidence that dissolution of hydroxyapatite (HAP) within the tumor microenvironment (TME-HAP) using a novel therapeutic can be used to kill cancer cells both in vitro and in vivo with minimal adverse effects.<h4>Methods</h4>We developed an injectable cation exchange nano particulate sulfonated polystyrene solution (NSPS) that we engineered to dissolve TME-HAP, inducing localized acute alkalosis and inhibition of tumor growth and glucose metabolism. This was evaluated in cell culture using 4T1, MDA-MB-231 triple negative breast cancer cells, MCF10 normal breast cells, and H292 lung cancer cells, and in vivo using orthotopic mouse models of cancer that contained detectable microenvironment HAP including breast (MMTV-Neu, 4T1, and MDA-MB-231), prostate (PC3) and colon (HCA7) cancer using <sup>18</sup> F-NaF for HAP and <sup>18</sup> F-FDG for glucose metabolism with PET imaging. On the other hand, H292 lung tumor cells that lacked detectable microenvironment HAP and MCF10a normal breast cells that do not produce HAP served as negative controls. Tumor microenvironment pH levels following injection of NSPS were evaluated via Chemical Exchange Saturation (CEST) MRI and via ex vivo methods.<h4>Results</h4>Within 24 h of adding the small concentration of 1X of NSPS (~7 μM), we observed significant tumor cell death (~ 10%, p < 0.05) in 4T1 and MDA-MB-231 cell cultures that contain HAP but ⟨2% in H292 and MCF10a cells that lack detectable HAP and in controls. Using CEST MRI, we found extracellular pH (pHe) in the 4T1 breast tumors, located in the mammary fat pad, to increase by nearly 10% from baseline before gradually receding back to baseline during the first hour post NSPS administration. in the tumors that contained TME-HAP in mouse models, MMTV-Neu, 4T1, and MDA-MB-231, PC3, and HCA7, there was a significant reduction (p<0.05) in <sup>18</sup> F-Na Fuptake post NSPS treatment as expected; <sup>18</sup> F<sup>-</sup>  uptake in the tumor = 3.8 ± 0.5 %ID/g (percent of the injected dose per gram) at baseline compared to 1.8 ±0.5 %ID/g following one-time treatment with 100 mg/kg NSPS. Of similar importance, is that <sup>18</sup> F-FDG uptake in the tumors was reduced by more than 75% compared to baseline within 24 h of treatment with one-time NSPS which persisted for at least one week. Additionally, tumor growth was significantly slower (p < 0.05) in the mice treated with one-time NSPS. Toxicity showed no evidence of any adverse effects, a finding attributed to the absence of HAP in normal soft tissue and to our therapeutic NSPS having limited penetration to access HAP within skeletal bone.<h4>Conclusion</h4>Dissolution of TME-HAP using our novel NSPS has the potential to provide a new treatment paradigm to enhance the management of cancer patients with poor prognosis.

HTT
Also flagged:CofilinNeurodegenerationStrokeactin-binding proteinα-synucleindendritic spine
Journal Article 2024-01-18 ✓ 1 Snippet Shehjar F, Almarghalani DA, Mahajan R, Hasan SA, Shah ZA.
In-Text Gene Mentions

It is an inherited disorder (mutation of the Huntingtin gene, HTT) associated with the deterioration of cortical striatal pathways and abnormal brain structure and metabolism, leading to motor and cognitive impairment [132,133].

Show Full Abstract

This comprehensive review explores the complex role of cofilin, an actin-binding protein, across various neurodegenerative diseases (Alzheimer's, Parkinson's, schizophrenia, amyotrophic lateral sclerosis (ALS), Huntington's) and stroke. Cofilin is an essential protein in cytoskeletal dynamics, and any dysregulation could lead to potentially serious complications. Cofilin's involvement is underscored by its impact on pathological hallmarks like Aβ plaques and α-synuclein aggregates, triggering synaptic dysfunction, dendritic spine loss, and impaired neuronal plasticity, leading to cognitive decline. In Parkinson's disease, cofilin collaborates with α-synuclein, exacerbating neurotoxicity and impairing mitochondrial and axonal function. ALS and frontotemporal dementia showcase cofilin's association with genetic factors like C9ORF72, affecting actin dynamics and contributing to neurotoxicity. Huntington's disease brings cofilin into focus by impairing microglial migration and influencing synaptic plasticity through AMPA receptor regulation. Alzheimer's, Parkinson's, and schizophrenia exhibit 14-3-3 proteins in cofilin dysregulation as a shared pathological mechanism. In the case of stroke, cofilin takes center stage, mediating neurotoxicity and neuronal cell death. Notably, there is a potential overlap in the pathologies and involvement of cofilin in various diseases. In this context, referencing cofilin dysfunction could provide valuable insights into the common pathologies associated with the aforementioned conditions. Moreover, this review explores promising therapeutic interventions, including cofilin inhibitors and gene therapy, demonstrating efficacy in preclinical models. Challenges in inhibitor development, brain delivery, tissue/cell specificity, and long-term safety are acknowledged, emphasizing the need for precision drug therapy. The call to action involves collaborative research, biomarker identification, and advancing translational efforts. Cofilin emerges as a pivotal player, offering potential as a therapeutic target. However, unraveling its complexities requires concerted multidisciplinary efforts for nuanced and effective interventions across the intricate landscape of neurodegenerative diseases and stroke, presenting a hopeful avenue for improved patient care.

Also flagged:Colorectal cancercancertumorgene expressioncardiovascular diseasestumors
Journal Article 2024-01-18 No Snippets Zhao L, Wang Q, Yang C, Ye Y, Shen Z.
Show Full Abstract

Colorectal cancer (CRC) is the third most prevalent and second most lethal cancer globally, with gene mutations and tumor metastasis contributing to its poor prognosis. Single-cell sequencing technology enables high-throughput analysis of the genome, transcriptome, and epigenetic landscapes at the single-cell level. It offers significant insights into analyzing the tumor immune microenvironment, detecting tumor heterogeneity, exploring metastasis mechanisms, and monitoring circulating tumor cells (CTCs). This article provides a brief overview of the technical procedure and data processing involved in single-cell sequencing. It also reviews the current applications of single-cell sequencing in CRC research, aiming to enhance the understanding of intratumoral heterogeneity, CRC development, CTCs, and novel drug targets. By exploring the diverse molecular and clinicopathological characteristics of tumor heterogeneity using single-cell sequencing, valuable insights can be gained into early diagnosis, therapy, and prognosis of CRC. Thus, this review serves as a valuable resource for identifying prognostic markers, discovering new therapeutic targets, and advancing personalized therapy in CRC.

HFE
Also flagged:metabolic dysfunction-associated steatotic liver diseasechronic liver diseasesugarNonalcoholic fatty liver diseasefatty liverliver disease
Journal Article 2024-01-18 ✓ 2 Snippets Parsa AA, Azama KA, Vawer M, Ona MA, Seto TB.
In-Text Gene Mentions

…disease (ie, hepatitis,hemochromatosis), chronic kidney disease,…

…liver disease (ie,hemochromatosis, hepatitis, Wilson disease,…

Show Full Abstract

<h4>Context</h4>Nonalcoholic fatty liver disease, renamed metabolic dysfunction-associated steatotic liver disease (MASLD), is the most common cause of chronic liver disease with an estimated worldwide prevalence of 30.1% while clinical practice observations reflect a disproportionately lower prevalence of 1.9%, indicating a condition that is underrecognized in clinical care settings. Screening for MASLD is rarely performed, and little is known about the prevalence in Hawai'i.<h4>Objective</h4>This pilot aims to develop an understanding of the prevalence and factors associated with MASLD in Hawai'i's adolescent and young adult (AYA) population.<h4>Design/methods</h4>Cross-sectional observational pilot study: We used Fibroscan<sup>®</sup>-liver ultrasonographic vibration-controlled transient elastography (VCTE) to identify MASLD based on controlled attenuation parameter (CAP) scores ≥238 (dB/m) and collected biometric, anthropometric, and Beverage Intake Questionnaire (sugar-sweetened beverage) survey data.<h4>Setting</h4>The study took place at community clinics in Hawai'i on the island of O'ahu.<h4>Participants</h4>One hundred individuals were evaluated, age 14 to 34 years.<h4>Main outcome measures</h4>We used VCTE Fibroscan<sup>®</sup> with CAP scoring to identify the presence of hepatocyte steatosis (fatty liver).<h4>Results</h4>Overall MASLD prevalence in the sample was 44% (95% confidence interval: 34.1%-54.3%). In participants with MASLD, obese Native Hawaiian and other Pacific Islanders (62%) and nonobese Asians (43%) had the highest rates of MASLD.<h4>Conclusion</h4>This pilot evaluation of the AYA NHOPI and Asian MASLD population in Hawai'i shows a higher rate of MASLD than those reported in other parts of the United States. Larger population health studies are indicated to expand our knowledge of MASLD in the Hawaiian Islands.

Also flagged:cancertumorshereditary cancer syndromesgenetic syndromesalcoholcell proliferation
Journal Article 2024-01-18 No Snippets Gazzellone A, Sangiorgi E.
Show Full Abstract

Richard Peto's paradox, first described in 1975 from an epidemiological perspective, established an inverse correlation between the probability of developing cancer in multicellular organisms and the number of cells. Larger animals exhibit fewer tumors compared to smaller ones, though exceptions exist. Mice are more susceptible to cancer than humans, while elephants and whales demonstrate significantly lower cancer prevalence rates than humans. How nature and evolution have addressed the issue of cancer in the animal kingdom remains largely unexplored. In the field of medicine, much attention has been devoted to cancer-predisposing genes, as they offer avenues for intervention, including blocking, downregulating, early diagnosis, and targeted treatment. Predisposing genes also tend to manifest clinically earlier and more aggressively, making them easier to identify. However, despite significant strides in modern medicine, the role of protective genes lags behind. Identifying genes with a mild predisposing effect poses a significant challenge. Consequently, comprehending the protective function conferred by genes becomes even more elusive, and their very existence is subject to questioning. While the role of variable expressivity and penetrance defects of the same variant in a family is well-documented for many hereditary cancer syndromes, attempts to delineate the function of protective/modifier alleles have been restricted to a few instances. In this review, we endeavor to elucidate the role of protective genes observed in the animal kingdom, within certain genetic syndromes that appear to act as cancer-resistant/repressor alleles. Additionally, we explore the role of protective alleles in conditions predisposing to cancer. The ultimate goal is to discern why individuals, like Winston Churchill, managed to live up to 91 years of age, despite engaging in minimal physical activity, consuming large quantities of alcohol daily, and not abstaining from smoking.

SERPINC1
Also flagged:Circadian RhythmsCircadian rhythm disorderscircadian rhythmmetabolismpernicious anemiaeye disease
Journal Article 2024-01-18 ✓ 1 Snippet Tan X, Zhang J, Dong J, Huang M, Zhou Z, Wang D.
In-Text Gene Mentions

…SHMT1 , andSERPINC1) DEGs, respectively…

Show Full Abstract

Circadian rhythm disorders pose major risks to human health and animal production activity, and the hypothalamus is the center of circadian rhythm regulation. However, the epigenetic regulation of circadian rhythm based on farm animal models has been poorly investigated. We collected chicken hypothalamus samples at seven time points in one light/dark cycle and performed long noncoding RNA (lncRNA), circular RNA (circRNA), and mRNA sequencing to detect biomarkers associated with circadian rhythm. We enhanced the comprehensive expression profiling of ncRNAs and mRNAs in the hypothalamus and found two gene sets (circadian rhythm and retinal metabolism) associated with the light/dark cycle. Noncoding RNA networks with circadian expression patterns were identified by differential expression and circadian analysis was provided that included 38 lncRNAs, 15 circRNAs, and 200 candidate genes. Three lncRNAs (ENSGALT00000098661, ENSGALT00000100816, and MSTRG.16980.1) and one circRNA (novel_circ_010168) in the ncRNA-mRNA regulatory network were identified as key molecules influencing circadian rhythm by regulating <i>AOX1</i> in retinal metabolism. These ncRNAs were predicted to be related to pernicious anemia, gonadal, eye disease and other disorders in humans. Together, the findings of this study provide insights into the epigenetic mechanisms of circadian rhythm and reveal <i>AOX1</i> as a promising target of circadian rhythm regulation.

HTTHFE
Also flagged:Autism Spectrum Disorderautismdevelopmental disordersensory disordersneurobiological disorderbrain development
Journal Article 2024-01-18 ✓ 4 Snippets Bar O, Vahey E, Mintz M, Frye RE, Boles RG.
In-Text Gene Mentions

The remaining off-target findings were a Pathogenic HFE variant where a grandparent has hemochromatosis, a Pathogenic GJB2 variant in an individual with severe hearing loss, mosaic monosomy X (Turner syndrome) which was previously identified via other testing, and a variant in PER3 in an adolescent with a significant sleep disorder.

…DMPK, FMR1, FXN,HTT, JPH3, NOP56, NOTCH2NLC,…

…were a PathogenicHFEvariant where a…

…a grandparent hashemochromatosis, a Pathogenic GJB2…

Show Full Abstract

Autism spectrum disorder (ASD) is a common condition with lifelong implications. The last decade has seen dramatic improvements in DNA sequencing and related bioinformatics and databases. We analyzed the raw DNA sequencing files on the Variantyx<sup>®</sup> bioinformatics platform for the last 50 ASD patients evaluated with trio whole-genome sequencing (trio-WGS). "Qualified" variants were defined as coding, rare, and evolutionarily conserved. Primary Diagnostic Variants (PDV), additionally, were present in genes directly linked to ASD and matched clinical correlation. A PDV was identified in 34/50 (68%) of cases, including 25 (50%) cases with heterozygous de novo and 10 (20%) with inherited variants. De novo variants in genes directly associated with ASD were far more likely to be Qualifying than non-Qualifying versus a control group of genes (<i>p</i> = 0.0002), validating that most are indeed disease related. Sequence reanalysis increased diagnostic yield from 28% to 68%, mostly through inclusion of de novo PDVs in genes not yet reported as ASD associated. Thirty-three subjects (66%) had treatment recommendation(s) based on DNA analyses. Our results demonstrate a high yield of trio-WGS for revealing molecular diagnoses in ASD, which is greatly enhanced by reanalyzing DNA sequencing files. In contrast to previous reports, de novo variants dominate the findings, mostly representing novel conditions. This has implications to the cause and rising prevalence of autism.

SOX6
Also flagged:Resistant Arterial HypertensionType 2 Diabetescardiovascular diseasespolymeraseMIR1-1gene expression
Journal Article 2024-01-18 ✓ 5 Snippets Błaszczyk R, Petniak A, Bogucki J, Kocki J, Wysokiński A, Głowniak A.
In-Text Gene Mentions

Huang X et al. examined the expression levels of MIR208 and sex-determining region Y-box 6 (SOX6) in patients with cardiac hypertrophy.

In an in vitro model, SOX6 expression levels were statistically significantly decreased in phenylephrine-stimulated cardiomyocytes compared to normal cardiomyocytes.

…region Y-box 6 (SOX6) in patients with…

…in vitro model,SOX6expression levels were…

…negative regulation ofSOX6[ 31 ].…

Show Full Abstract

<h4>Introduction</h4>In recent years, a very close relationship between miRNA and cardiovascular diseases has been found. RAH and T2DM are accompanied by a change in the microRNA expression spectrum.<h4>Objectives</h4>This study aimed to evaluate the clinical characteristics and expression of selected microRNAs in patients with idiopathic RAH and T2DM.<h4>Patients and methods</h4>A total of 115 patients with RAH were included in this study. Among them were 53 patients (46.09%) with T2DM. miRNA levels were determined using quantitative real-time polymerase chain reaction. The expression of the examined genes was calculated from the formula RQ = 2<sup>-ΔΔCT</sup>.<h4>Results</h4>Analysis using the Mann-Whitney U test showed a statistically significant (<i>p</i> < 0.05) difference in the expression of MIR1-1 (<i>p</i> = 0.031) and MIR195 (<i>p</i> = 0.042) associated with the occurrence of T2DM in the subjects. The value of MIR1-1 gene expression was statistically significantly higher in patients with T2DM (median: 0.352; mean: 0.386; standard deviation: 0.923) compared to patients without T2DM (median: 0.147; mean: -0.02; standard deviation: 0.824). The value of MIR195 gene expression was statistically significantly higher in patients with T2DM (median: 0.389, mean: 0.442; standard deviation: 0.819) compared to patients without T2DM (median: -0.027; mean: 0.08; standard deviation: 0.942).<h4>Conclusions</h4>The values of MIR1-1 and MIR195 gene expression were statistically significantly higher in patients with RAH and T2DM compared to patients with RAH and without T2DM. Further studies are necessary to precisely clarify the roles of miRNAs in patients with RAH and T2DM. They should demonstrate the utility of these genetic markers in clinical practice.

Also flagged:EndometriosisDysmenorrheavirgoestrogen-dependent diseaseDeep
Journal Article 2024-01-18 No Snippets Martire FG, Giorgi M, D'Abate C, Colombi I, Ginetti A, Cannoni A, Fedele F, Exacoustos C, Centini G, Zupi E, Lazzeri L.
Show Full Abstract

Endometriosis has a prevalence of 10% worldwide in premenopausal women. Probably, endometriosis begins early in the life of young girls, and it is commonly diagnosed later in life. The prevalence of deep infiltrating endometriosis (DIE) in adolescence is currently unknown due to diagnostic limits and underestimation of clinical symptoms. Dysmenorrhea is a common symptom in adolescents affected by DIE, often accompanied by dyspareunia and chronic acyclic pelvic pain. Ultrasonography-either performed transabdominal, transvaginal or transrectal-should be considered the first-line imaging technique despite the potential for missed diagnosis due to early-stage disease. Magnetic resonance imaging should be preferred in the case of virgo patients or when ultrasonographic exam is not accepted. Diagnostic laparoscopy is deemed acceptable in the case of suspected DIE not responding to conventional hormonal therapy. An early medical and/or surgical treatment may reduce disease progression with an immediate improvement in quality of life and fertility, but at the same time, painful symptoms may persist or even recur due to the surgery itself. The aim of this narrative review is to report the prevalence of DIE in adolescents, describe the pathogenetic theories and discuss the management in adolescent women, including the challenging road to diagnosis and the treatment alternatives.

Also flagged:HMGA2nasopharyngeal carcinomatumorpathogenesisHigh mobility group AT-hook 2chromatin
Journal Article 2024-01-18 No Snippets Ouyang X, Li K, Wang J, Zhu W, Yi Q, Zhong J.
Show Full Abstract

Nasopharyngeal carcinoma (NPC), as one of the most prevalent malignancies in the head and neck region, still lacks a complete understanding of its pathogenesis. Presently, radiotherapy, concurrent chemoradiotherapy, and targeted therapy stand as the primary modalities for treating NPC. With advancements in medicine, the cure rates for nasopharyngeal carcinoma have been steadily increasing. Nevertheless, recurrence and metastasis persist as the primary reasons for treatment failure. Consequently, a profound exploration of the molecular mechanisms underlying the occurrence and progression of nasopharyngeal carcinoma, along with the exploration of corresponding therapeutic approaches, becomes particularly imperative in the quest for comprehensive solutions to combat this disease. High mobility group AT-hook 2 (HMGA2) is a pivotal protein capable of altering chromatin structure, regulating gene expression, and influencing transcriptional activity. In the realm of cancer research, HMGA2 exhibits widespread dysregulation, playing a crucial role in nearly all malignant tumors. It is implicated in various tumorigenic processes, including cell cycle regulation, cell proliferation, epithelial-mesenchymal transition, angiogenesis, tumor invasion, metastasis, and drug resistance. Additionally, HMGA2 serves as a molecular marker and an independent prognostic factor in certain malignancies. Recent studies have increasingly unveiled the critical role of HMGA2 in nasopharyngeal carcinoma (NPC), particularly in promoting malignant progression, correlating with tumor resistance, and serving as an independent adverse prognostic factor. This review focuses on elucidating the oncogenic role of HMGA2 in NPC, suggesting its potential association with chemotherapy resistance in NPC, and proposing its candidacy as an independent factor in nasopharyngeal carcinoma prognosis assessment.

BTN3A3
Also flagged:breast cancerPEX14CTSFPARK7CSKGDI2
Journal Article 2024-01-18 ✓ 2 Snippets Wang Y, Yi K, Chen B, Zhang B, Jidong G.
In-Text Gene Mentions

…ER-positive breast cancer,BTN3A3, EMILIN3, FOLR3, and…

BTN3A3in ER-positive breast…

Show Full Abstract

<b>Objectives:</b> This study aimed to identify plasma proteins that are associated with and causative of breast cancer through Proteome and Transcriptome-wide association studies combining Mendelian Randomization. <b>Methods:</b> Utilizing high-throughput datasets, we designed a two-phase analytical framework aimed at identifying novel plasma proteins that are both associated with and causative of breast cancer. Initially, we conducted Proteome/Transcriptome-wide association studies (P/TWAS) to identify plasma proteins with significant associations. Subsequently, Mendelian Randomization was employed to ascertain the causation. The validity and robustness of our findings were further reinforced through external validation and various sensitivity analyses, including Bayesian colocalization, Steiger filtering, heterogeneity and pleiotropy. Additionally, we performed functional enrichment analysis of the identified proteins to better understand their roles in breast cancer and to assess their potential as druggable targets. <b>Results:</b> We identified 5 plasma proteins demonstrating strong associations and causative links with breast cancer. Specifically, PEX14 (OR = 1.201, <i>p</i> = 0.016) and CTSF (OR = 1.114, <i>p</i> < 0.001) both displayed positive and causal association with breast cancer. In contrast, SNUPN (OR = 0.905, <i>p</i> < 0.001), CSK (OR = 0.962, <i>p</i> = 0.038), and PARK7 (OR = 0.954, <i>p</i> < 0.001) were negatively associated with the disease. For the ER-positive subtype, 3 plasma proteins were identified, with CSK and CTSF exhibiting consistent trends, while GDI2 (OR = 0.920, <i>p</i> < 0.001) was distinct to this subtype. In ER-negative subtype, PEX14 (OR = 1.645, <i>p</i> < 0.001) stood out as the sole protein, even showing a stronger causal effect compared to breast cancer. These associations were robustly supported by colocalization and sensitivity analyses. <b>Conclusion:</b> Integrating multiple data dimensions, our study successfully pinpointed plasma proteins significantly associated with and causative of breast cancer, offering valuable insights for future research and potential new biomarkers and therapeutic targets.

HTTOLFM4
Also flagged:colorectal cancergene expressioncolorectal cancerscancersmalignant disease ofcancer
Journal Article 2024-01-18 ✓ 5 Snippets Amniouel S, Jafri MS.
In-Text Gene Mentions
⭐ same-sentence co-mention

OLFM4, Histone H3, HTT activate HSPA5, an important molecule that tends to lead to cancer metastasis.

…BothOLFM4, LT4AH, and LYZ…

⭐ same-sentence co-mention

OLFM4, Histone H3, HTT…

⭐ same-sentence co-mention

…OLFM4, Histone H3,HTTactivate HSPA5, an…

OLFM4—Olfactomedin 4 (OLFM4) is…

Show Full Abstract

<b>Introduction:</b> FOLFOX and FOLFIRI chemotherapy are considered standard first-line treatment options for colorectal cancer (CRC). However, the criteria for selecting the appropriate treatments have not been thoroughly analyzed. <b>Methods:</b> A newly developed machine learning model was applied on several gene expression data from the public repository GEO database to identify molecular signatures predictive of efficacy of 5-FU based combination chemotherapy (FOLFOX and FOLFIRI) in patients with CRC. The model was trained using 5-fold cross validation and multiple feature selection methods including LASSO and VarSelRF methods. Random Forest and support vector machine classifiers were applied to evaluate the performance of the models. <b>Results and Discussion:</b> For the CRC GEO dataset samples from patients who received either FOLFOX or FOLFIRI, validation and test sets were >90% correctly classified (accuracy), with specificity and sensitivity ranging between 85%-95%. In the datasets used from the GEO database, 28.6% of patients who failed the treatment therapy they received are predicted to benefit from the alternative treatment. Analysis of the gene signature suggests the mechanistic difference between colorectal cancers that respond and those that do not respond to FOLFOX and FOLFIRI. Application of this machine learning approach could lead to improvements in treatment outcomes for patients with CRC and other cancers after additional appropriate clinical validation.

SOX6
Also flagged:UBE2ScancerUbiquitin Conjugating Enzyme E2 Smyocardial ischemiaviral hepatitisbreast cancer
Journal Article 2024-01-18 ✓ 1 Snippet Zhang M, Wang J, Zhang Z, Guo Y, Lou X, Zhang L.
In-Text Gene Mentions

Presently, mounting evidence suggests that UBE2S impacts cancer progression through multiple mechanisms, such as NF-κB, Cell cycle, SOX6-Catenin, Wnt/β-catenin, PI3K/AKT/mTOR, PTEN-AKT, and VHL/HIF-1α/STAT3 (Fig. 9).

Show Full Abstract

The Ubiquitin Conjugating Enzyme E2 S (UBE2S), was initially identified as a crucial member in controlling substrate ubiquitination during the late promotion of the complex's function. In recent years, UBE2S has emerged as a significant epigenetic modification in various diseases, including myocardial ischemia, viral hepatitis, and notably, cancer. Mounting evidence suggests that UBE2S plays a pivotal role in several human malignancies including breast cancer, lung cancer, hepatocellular carcinoma and etc. However, a comprehensive review of UBE2S in human tumor research remains absent. Therefore, this paper aims to fill this gap. This review provides a comprehensive analysis of the structural characteristics of UBE2S and its potential utility as a biomarker in diverse cancer types. Additionally, the role of UBE2S in conferring resistance to tumor treatment is examined. The findings suggest that UBE2S holds promise as a diagnostic and therapeutic target in multiple malignancies, thereby offering novel avenues for cancer therapy.

Also flagged:tissue remodelingmechanotransductioncollagencell-adhesion ligandextracellularTAZ
Journal Article 2024-01-18 No Snippets Kersey AL, Cheng DY, Deo KA, Dubell CR, Wang TC, Jaiswal MK, Kim MH, Murali A, Hargett SE, Mallick S, Lele TP, Singh I, Gaharwar AK.
Show Full Abstract

Engineered matrices provide a valuable platform to understand the impact of biophysical factors on cellular behavior such as migration, proliferation, differentiation, and tissue remodeling, through mechanotransduction. While recent studies have identified some mechanisms of 3D mechanotransduction, there is still a critical knowledge gap in comprehending the interplay between 3D confinement, ECM properties, and cellular behavior. Specifically, the role of matrix stiffness in directing cellular fate in 3D microenvironment, independent of viscoelasticity, microstructure, and ligand density remains poorly understood. To address this gap, we designed a nanoparticle crosslinker to reinforce collagen-based hydrogels without altering their chemical composition, microstructure, viscoelasticity, and density of cell-adhesion ligand and utilized it to understand cellular dynamics. This crosslinking mechanism utilizes nanoparticles as crosslink epicenter, resulting in 10-fold increase in mechanical stiffness, without other changes. Human mesenchymal stem cells (hMSCs) encapsulated in 3D responded to mechanical stiffness by displaying circular morphology on soft hydrogels (5 kPa) and elongated morphology on stiff hydrogels (30 kPa). Stiff hydrogels facilitated the production and remodeling of nascent extracellular matrix (ECM) and activated mechanotransduction cascade. These changes were driven through intracellular PI3AKT signaling, regulation of epigenetic modifiers and activation of YAP/TAZ signaling. Overall, our study introduces a unique biomaterials platform to understand cell-ECM mechanotransduction in 3D for regenerative medicine as well as disease modelling.

SERPINC1
Also flagged:Purpura FulminansArterial ThrombosisNeonatal purpura fulminansskin disorderdisseminated intravascularcoagulation
Journal Article 2024-01-18 ✓ 1 Snippet Abbaker MM, Edupuganti S, Elmukashfi ST, Elsheikh TAE.
In-Text Gene Mentions

…PC, PS, andantithrombin-IIIis described as…

Show Full Abstract

Neonatal purpura fulminans (PF) is an uncommon skin disorder characterized by acute disseminated intravascular coagulation, tissue necrosis, and small vessel thrombosis. Here, we present a case of a seven-day-old male who was admitted to the Neonatal Intensive Care (NICU) Unit at Gaafar Ibn Auf Tertiary Hospital, in January 2023. He presented with black bullous lesions on the plantar surface of the left foot, deep bluish discoloration over the right buttock and right lower abdomen, and gangrenous changes in the right foot with clear demarcation. Birth history was not significant other than mild pallor and icterus. His blood workup was consistent with severe anemia, thrombocytopenia, elevated prothrombin time, and partial thromboplastin time with decreased protein C and S levels; blood culture yielded no growth. A Doppler ultrasound scan of lower extremities confirmed distal occlusion of the right dorsalis pedis artery. The abdominal ultrasound revealed a free left renal bed and left-sided renal agenesis. We came to a diagnosis of neonatal PF and started administering blood and fresh frozen plasma and subcutaneous heparin injections, but unfortunately, the patient eventually passed away. Hence, we decided to report this case to emphasize the significance of the clinical picture in assisting with early diagnosis, despite limited access to genetic testing. We also want to highlight the importance of a "high index of suspicion" that might be mandatory for better outcomes.

Also flagged:biphenylalkynesdioxacyclodecynesalkyneazideOCT
Journal Article 2024-01-17 No Snippets Forshaw S, Parker JS, Scott WT, Knighton RC, Tiwari N, Oladeji SM, Stevens AC, Chew YM, Reber J, Clarkson GJ, Balasubramanian MK, Wills M.
Show Full Abstract

Biphenyl-fused-dioxacyclodecynes are a promising class of strained alkyne for use in Cu-free 'click' reactions. In this paper, a series of functionalised derivatives of this class of reagent, containing fluorescent groups, are described. Studies aimed at understanding and increasing the reactivity of the alkynes are also presented, together with an investigation of the bioconjugation of the reagents with an azide-labelled protein.

Also flagged:wound healingangiogenesistissue remodelingsecretionMHC IMHC II
Journal Article 2024-01-17 No Snippets Zomer HD, de Souza Lima VJ, Bion MC, Brito KNL, Rode M, Stimamiglio MA, Jeremias TDS, Trentin AG.
Show Full Abstract

<h4>Background</h4>Although the paracrine effects of mesenchymal stem/stromal cells (MSCs) have been recognized as crucial mediators of their regenerative effects on tissue repair, the potential of MSC secretomes as effective substitutes for cellular therapies remains underexplored.<h4>Methods</h4>In this study, we compared MSCs from the human dermis (DSCs) and adipose tissue (ASCs) with their secretomes regarding their efficacy for skin wound healing using a translationally relevant murine model.<h4>Results</h4>Proteomic analysis revealed that while there was a substantial overlap in protein composition between DSC and ASC secretomes, specific proteins associated with wound healing and angiogenesis were differentially expressed. Despite a similar angiogenic potential in vivo, DSC and ASC secretomes were found to be less effective than cells in accelerating wound closure and promoting tissue remodeling.<h4>Conclusions</h4>Overall, secretome-treated groups showed intermediary results between cells- and control-treated (empty scaffold) groups. These findings highlight that although secretomes possess therapeutic potential, their efficacy might be limited compared to cellular therapies. This study contributes to the growing understanding of MSC secretomes, emphasizes the need for further protocol optimization, and offers insights into their potential applications in regenerative medicine.

HTT
Also flagged:NeuroblastomaNBsolid tumorchildhood tumorscancertumor
Journal Article 2024-01-17 ✓ 1 Snippet Sehgal M, Nayak SP, Sahoo S, Somarelli JA, Jolly MK.
In-Text Gene Mentions

…of Huntington’s gene (Htt) in SH-SY5Y NB…

Show Full Abstract

Neuroblastoma is the most frequent extracranial pediatric tumor and leads to 15% of all cancer-related deaths in children. Tumor relapse and therapy resistance in neuroblastoma are driven by phenotypic plasticity and heterogeneity between noradrenergic (NOR) and mesenchymal (MES) cell states. Despite the importance of this phenotypic plasticity, the dynamics and molecular patterns associated with these bidirectional cell-state transitions remain relatively poorly understood. Here, we analyze multiple RNA-seq datasets at both bulk and single-cell resolution, to understand the association between NOR- and MES-specific factors. We observed that NOR-specific and MES-specific expression patterns are largely mutually exclusive, exhibiting a "teams-like" behavior among the genes involved, reminiscent of our earlier observations in lung cancer and melanoma. This antagonism between NOR and MES phenotypes was also associated with metabolic reprogramming and with immunotherapy targets PD-L1 and GD2 as well as with experimental perturbations driving the NOR-MES and/or MES-NOR transition. Further, these "teams-like" patterns were seen only among the NOR- and MES-specific genes, but not in housekeeping genes, possibly highlighting a hallmark of network topology enabling cancer cell plasticity.

PEBP1
Also flagged:15-LipoxygenaseArachidonoylPhosphatidylethanolaminesmembranephospholipidsfatty acyls
Journal Article 2024-01-17 ✓ 1 Snippet Samovich SN, Mikulska-Ruminska K, Dar HH, Tyurina YY, Tyurin VA, Souryavong AB, Kapralov AA, Amoscato AA, Beharier O, Karumanchi SA, St Croix CM, Yang X, Holman TR, VanDemark AP, Sadovsky Y, Mallampalli RK, Wenzel SE, Gu W, Bunimovich YL, Bahar I, Kagan VE, Bayir H.
In-Text Gene Mentions

PEBP1

Show Full Abstract

The vast majority of membrane phospholipids (PLs) include two asymmetrically positioned fatty acyls: oxidizable polyunsaturated fatty acids (PUFA) attached predominantly at the sn2 position, and non-oxidizable saturated/monounsaturated acids (SFA/MUFA) localized at the sn1 position. The peroxidation of PUFA-PLs, particularly sn2-arachidonoyl(AA)- and sn2-adrenoyl(AdA)-containing phosphatidylethanolamines (PE), has been associated with the execution of ferroptosis, a program of regulated cell death. There is a minor subpopulation (≈1-2 mol %) of doubly PUFA-acylated phospholipids (di-PUFA-PLs) whose role in ferroptosis remains enigmatic. Here we report that 15-lipoxygenase (15LOX) exhibits unexpectedly high pro-ferroptotic peroxidation activity towards di-PUFA-PEs. We revealed that peroxidation of several molecular species of di-PUFA-PEs occurred early in ferroptosis. Ferrostatin-1, a typical ferroptosis inhibitor, effectively prevented peroxidation of di-PUFA-PEs. Furthermore, co-incubation of cells with di-AA-PE and 15LOX produced PUFA-PE peroxidation and induced ferroptotic death. The decreased contents of di-PUFA-PEs in ACSL4 KO A375 cells was associated with lower levels of di-PUFA-PE peroxidation and enhanced resistance to ferroptosis. Thus, di-PUFA-PE species are newly identified phospholipid peroxidation substrates and regulators of ferroptosis, representing a promising therapeutic target for many diseases related to ferroptotic death.

Also flagged:cancercancersprostate cancersnerve compression syndromesdeathmetabolism
Journal Article 2024-01-17 No Snippets Zhou H, Zhang W, Li H, Xu F, Yinwang E, Xue Y, Chen T, Chen T, Wang S, Wang Z, Sun H, Wang F, Mou H, Yao M, Chai X, Zhang J, Diarra MD, Li B, Zhang C, Gao J, Ye Z.
Show Full Abstract

Bone is one of the most common sites of tumor metastases. During the last step of bone metastasis, cancer cells colonize and disrupt the bone matrix, which is maintained mainly by osteocytes, the most abundant cells in the bone microenvironment. However, the role of osteocytes in bone metastasis is still unclear. Here, we demonstrated that osteocytes transfer mitochondria to metastatic cancer cells and trigger the cGAS/STING-mediated antitumor response. Blocking the transfer of mitochondria by specifically knocking out mitochondrial Rho GTPase 1 (<i>Rhot1</i>) or mitochondrial mitofusin 2 (<i>Mfn2</i>) in osteocytes impaired tumor immunogenicity and consequently resulted in the progression of metastatic cancer toward the bone matrix. These findings reveal the protective role of osteocytes against cancer metastasis by transferring mitochondria to cancer cells and potentially offer a valuable therapeutic strategy for preventing bone metastasis.

HFE
Also flagged:cancerhepatitiscolitispneumonitismyocarditiscorticosteroids
Journal Article 2024-01-17 ✓ 1 Snippet Daetwyler E, Wallrabenstein T, König D, Cappelli LC, Naidoo J, Zippelius A, Läubli H.
In-Text Gene Mentions

…viral infections, AIH,hemochromatosis, hepatic disease progression…

Show Full Abstract

Immune checkpoint inhibitor (ICI) treatment has become an important therapeutic option for various cancer types. Although the treatment is effective, ICI can overstimulate the patient's immune system, leading to potentially severe immune-related adverse events (irAEs), including hepatitis, colitis, pneumonitis and myocarditis. The initial mainstay of treatments includes the administration of corticosteroids. There is little evidence how to treat steroid-resistant (sr) irAEs. It is mainly based on small case series or single case reports. This systematic review summarizes available evidence about sr-irAEs. We conducted a systematic literature search in PubMed. Additionally, we included European Society for Medical Oncology, Society for Immunotherapy of Cancer, National Comprehensive Cancer Network and American Society of Clinical Oncology Guidelines for irAEs in our assessment. The study population of all selected publications had to include patients with cancer who developed hepatitis, colitis, pneumonitis or myocarditis during or after an immunotherapy treatment and for whom corticosteroid therapy was not sufficient. Our literature search was not restricted to any specific cancer diagnosis. Case reports were also included. There is limited data regarding life-threatening sr-irAEs of colon/liver/lung/heart and the majority of publications are single case reports. Most publications investigated sr colitis (n=26), followed by hepatitis (n=21), pneumonitis (n=17) and myocarditis (n=15). There is most data for mycophenolate mofetil (MMF) to treat sr hepatitis and for infliximab, followed by vedolizumab, to treat sr colitis. Regarding sr pneumonitis there is most data for MMF and intravenous immunoglobulins (IVIG) while data regarding infliximab are conflicting. In sr myocarditis, most evidence is available for the use of abatacept or anti-thymocyte globulin (ATG) (both with or without MMF) or ruxolitinib with abatacept. This review highlights the need for prompt recognition and treatment of sr hepatitis, colitis, pneumonitis and myocarditis. Guideline recommendations for sr situations are not defined precisely. Based on our search, we recommend-as first line treatment-(1) MMF for sr hepatitis, (2) infliximab for sr colitis, followed by vedolizumab, (3) MMF and IVIG for sr pneumonitis and (4) abatacept or ATG (both with or without MMF) or ruxolitinib with abatacept for sr myocarditis. These additional immunosuppressive agents should be initiated promptly if there is no sufficient response to corticosteroids within 3 days.

HFE
Also flagged:Tacrolimusmycophenolatehepatitischronic inflammatory disease of the liveraspartate and alanine aminotransferasesimmunoglobulin gamma
Journal Article 2024-01-17 ✓ 1 Snippet Stoelinga AEC, Tushuizen ME, van den Hout WB, Girondo MDMR, de Vries ES, Levens AD, Moes DAR, Gevers TJG, van der Meer S, Brouwer HT, de Jonge HJM, de Boer YS, Beuers UHW, van der Meer AJ, van den Berg AP, Guichelaar MMJ, Drenth JPH, van Hoek B, Dutch Autoimmune Hepatitis Group.
In-Text Gene Mentions

…(MASLD), Wilson disease,hemochromatosis, alcoholic liver disease…

Show Full Abstract

<h4>Background</h4>Autoimmune hepatitis (AIH) is a rare, chronic inflammatory disease of the liver. The treatment goal is reaching complete biochemical response (CR), defined as the normalisation of aspartate and alanine aminotransferases and immunoglobulin gamma. Ongoing AIH activity can lead to fibrosis and (decompensated) cirrhosis. Incomplete biochemical response is the most important risk factor for liver transplantation or liver-related mortality. First-line treatment consists of a combination of azathioprine and prednisolone. If CR is not reached, tacrolimus (TAC) or mycophenolate mofetil (MMF) can be used as second-line therapy. Both products are registered for the prevention of graft rejection in solid organ transplant recipients. The aim of this study is to compare the effectiveness and safety of TAC and MMF as second-line treatment for AIH.<h4>Methods</h4>The TAILOR study is a phase IIIB, multicentre, open-label, parallel-group, randomised (1:1) controlled trial performed in large teaching and university hospitals in the Netherlands. We will enrol 86 patients with AIH who have not reached CR after at least 6 months of treatment with first-line therapy. Patients are randomised to TAC (0.07 mg/kg/day initially and adjusted by trough levels) or MMF (max 2000 mg/day), stratified by the presence of cirrhosis at inclusion. The primary endpoint is the difference in the proportion of patients reaching CR after 12 months. Secondary endpoints include the difference in the proportion of patients reaching CR after 6 months, adverse effects, difference in fibrogenesis, quality of life and cost-effectiveness.<h4>Discussion</h4>This is the first randomised controlled trial comparing two second-line therapies for AIH. Currently, second-line treatment is based on retrospective cohort studies. The rarity of AIH is the main issue in clinical research for alternative treatment options. The results of this trial can be implemented in existing international clinical guidelines.<h4>Trial registration</h4>ClinicalTrials.gov NCT05221411 . Retrospectively registered on 3 February 2022; EudraCT number 2021-003420-33. Prospectively registered on 16 June 2021.

Also flagged:ADAR1Adenosineinosineadenosine deaminaseADARcardiovascular disease
Journal Article 2024-01-17 No Snippets Jiao Y, Xu Y, Liu C, Miao R, Liu C, Wang Y, Liu J.
Show Full Abstract

Adenosine-to-inosine (A-to-I) editing of RNA, catalyzed by adenosine deaminase acting on RNA (ADAR) enzymes, is a prevalent RNA modification in mammals. It has been shown that A-to-I editing plays a critical role in multiple diseases, such as cardiovascular disease, neurological disorder, and particularly cancer. ADARs are the family of enzymes, including ADAR1, ADAR2, and ADAR3, that catalyze the occurrence of A-to-I editing. Notably, A-to-I editing is mainly catalyzed by ADAR1. Given the significance of A-to-I editing in disease development, it is important to unravel the complex roles of ADAR1 in cancer for the development of novel therapeutic interventions.In this review, we briefly describe the progress of research on A-to-I editing and ADARs in cancer, mainly focusing on the role of ADAR1 in cancer from both editing-dependent and independent perspectives. In addition, we also summarized the factors affecting the expression and editing activity of ADAR1 in cancer.

PTGIS
Also flagged:Arachidonic acidlipidmultiple sclerosispathogenesischronic autoimmune diseasepolyunsaturated fatty acids
Journal Article 2024-01-17 ✓ 1 Snippet Broos JY, van der Burgt RTM, Konings J, Rijnsburger M, Werz O, de Vries HE, Giera M, Kooij G.
In-Text Gene Mentions

…I 2 synthase (PTGIS, Fig. 3 ),…

Show Full Abstract

<h4>Background</h4>Multiple sclerosis (MS) is a chronic autoimmune disease of the central nervous system (CNS), characterized by neuroinflammation, demyelination, and neurodegeneration. Considering the increasing prevalence among young adults worldwide and the disabling phenotype of the disease, a deeper understanding of the complexity of the disease pathogenesis is needed to ultimately improve diagnosis and personalize treatment opportunities. Recent findings suggest that bioactive lipid mediators (LM) derived from ω-3/-6 polyunsaturated fatty acids (PUFA), also termed eicosanoids, may contribute to MS pathogenesis. For example, disturbances in LM profiles and especially those derived from the ω-6 PUFA arachidonic acid (AA) have been reported in people with MS (PwMS), where they may contribute to the chronicity of neuroinflammatory processes. Moreover, we have previously shown that certain AA-derived LMs also associated with neurodegenerative processes in PwMS, suggesting that AA-derived LMs are involved in more pathological events than solely neuroinflammation. Yet, to date, a comprehensive overview of the contribution of these LMs to MS-associated pathological processes remains elusive.<h4>Main body</h4>This review summarizes and critically evaluates the current body of literature on the eicosanoid biosynthetic pathway and its contribution to key pathological hallmarks of MS during different disease stages. Various parts of the eicosanoid pathway are highlighted, namely, the prostanoid, leukotriene, and hydroxyeicosatetraenoic acids (HETEs) biochemical routes that include specific enzymes of the cyclooxygenases (COXs) and lipoxygenases (LOX) families. In addition, cellular sources of LMs and their potential target cells based on receptor expression profiles will be discussed in the context of MS. Finally, we propose novel therapeutic approaches based on eicosanoid pathway and/or receptor modulation to ultimately target chronic neuroinflammation, demyelination and neurodegeneration in MS.<h4>Short conclusion</h4>The eicosanoid pathway is intrinsically linked to specific aspects of MS pathogenesis. Therefore, we propose that novel intervention strategies, with the aim of accurately modulating the eicosanoid pathway towards the biosynthesis of beneficial LMs, can potentially contribute to more patient- and MS subtype-specific treatment opportunities to combat MS.

PRDX6
Also flagged:Glutathionephospholemmanperoxiredoxin 6PLMsodium pumpphosphorylation
Journal Article 2024-01-17 ✓ 5 Snippets Howie J, Tulloch LB, Brown E, Reilly L, Ashford FB, Kennedy J, Wypijewski KJ, Aughton KL, Mak JKC, Shattock MJ, Fraser NJ, Fuller W.
In-Text Gene Mentions

Our data suggest that Prdx6 is a thioesterase that can depalmitoylate proteins by nucleophilic attack via its reactive thiol, linking PLM palmitoylation and hence sodium pump activity to cellular glutathione status.

In vitro, only recombinant Prdx6, among several peroxiredoxin isoforms tested, removes palmitic acid from recombinant palmitoylated PLM.

Here, we show that the anti-oxidant protein peroxiredoxin 6 (Prdx6) interacts with and depalmitoylates PLM in a glutathione-dependent manner.

…protein peroxiredoxin 6 (Prdx6) interacts with and…

Prdx6silencing abolishes these…

Show Full Abstract

Phospholemman (PLM) regulates the cardiac sodium pump: PLM phosphorylation activates the pump whereas PLM palmitoylation inhibits its activity. Here, we show that the anti-oxidant protein peroxiredoxin 6 (Prdx6) interacts with and depalmitoylates PLM in a glutathione-dependent manner. Glutathione loading cells acutely reduce PLM palmitoylation; glutathione depletion significantly increases PLM palmitoylation. Prdx6 silencing abolishes these effects, suggesting that PLM can be depalmitoylated by reduced Prdx6. In vitro, only recombinant Prdx6, among several peroxiredoxin isoforms tested, removes palmitic acid from recombinant palmitoylated PLM. The broad-spectrum depalmitoylase inhibitor palmostatin B prevents Prdx6-dependent PLM depalmitoylation in cells and in vitro. Our data suggest that Prdx6 is a thioesterase that can depalmitoylate proteins by nucleophilic attack via its reactive thiol, linking PLM palmitoylation and hence sodium pump activity to cellular glutathione status. We show that protein depalmitoylation can occur via a catalytic cysteine in which substrate specificity is determined by a protein-protein interaction.

OLFM4
Also flagged:bile acidaspirinbile acidsketolithocholic acidhdhA
Journal Article 2024-01-17 ✓ 1 Snippet Li T, Ding N, Guo H, Hua R, Lin Z, Tian H, Yu Y, Fan D, Yuan Z, Gonzalez FJ, Wu Y.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Aspirin-related gastrointestinal damage is of growing concern. Aspirin use modulates the gut microbiota and associated metabolites, such as bile acids (BAs), but how this impacts intestinal homeostasis remains unclear. Herein, using clinical cohorts and aspirin-treated mice, we identified an intestinal microbe, Parabacteroides goldsteinii, whose growth is suppressed by aspirin. Mice supplemented with P. goldsteinii or its BA metabolite, 7-keto-lithocholic acid (7-keto-LCA), showed reduced aspirin-mediated damage of the intestinal niche and gut barrier, effects that were lost with a P. goldsteinii hdhA mutant unable to generate 7-keto-LCA. Specifically, 7-keto-LCA promotes repair of the intestinal epithelium by suppressing signaling by the intestinal BA receptor, farnesoid X receptor (FXR). 7-Keto-LCA was confirmed to be an FXR antagonist that facilitates Wnt signaling and thus self-renewal of intestinal stem cells. These results reveal the impact of oral aspirin on the gut microbiota and intestinal BA metabolism that in turn modulates gastrointestinal homeostasis.

Also flagged:Calciumirondeathneurological disorderPDα-synuclein
Journal Article 2024-01-17 No Snippets Wang J, Zhao J, Zhao K, Wu S, Chen X, Hu W.
Show Full Abstract

Calcium and iron are essential elements that regulate many important processes of eukaryotic cells. Failure to maintain homeostasis of calcium and iron causes cell dysfunction or even death. PD (Parkinson's disease) is the second most common neurological disorder in humans, for which there are currently no viable treatment options or effective strategies to cure and delay progression. Pathological hallmarks of PD, such as dopaminergic neuronal death and intracellular α-synuclein deposition, are closely involved in perturbations of iron and calcium homeostasis and accumulation. Here, we summarize the mechanisms by which Ca<sup>2+</sup> signaling influences or promotes PD progression and the main mechanisms involved in ferroptosis in Parkinson's disease. Understanding the mechanisms by which calcium and iron imbalances contribute to the progression of this disease is critical to developing effective treatments to combat this devastating neurological disorder.

Also flagged:NucleotideCardiovascular DiseasesType 2 DiabetesCOMThypertensiondyslipidemia
Journal Article 2024-01-17 No Snippets Merzah M, Natae S, Sándor J, Fiatal S.
Show Full Abstract

The mesocorticolimbic (MCL) system is crucial in developing risky health behaviors which lead to cardiovascular diseases (CVDs) and type 2 diabetes (T2D). Although there is some knowledge of the MCL system genes linked to CVDs and T2D, a comprehensive list is lacking, underscoring the significance of this review. This systematic review followed PRISMA guidelines and the Cochrane Handbook for Systematic Reviews of Interventions. The PubMed and Web of Science databases were searched intensively for articles related to the MCL system, single nucleotide variants (SNVs, formerly single nucleotide polymorphisms, SNPs), CVDs, T2D, and associated risk factors. Included studies had to involve a genotype with at least one MCL system gene (with an identified SNV) for all participants and the analysis of its link to CVDs, T2D, or associated risk factors. The quality assessment of the included studies was performed using the Q-Genie tool. The VEP and DAVID tools were used to annotate and interpret genetic variants and identify enriched pathways and gene ontology terms associated with the gene list. The review identified 77 articles that met the inclusion criteria. These articles provided information on 174 SNVs related to the MCL system that were linked to CVDs, T2D, or associated risk factors. The COMT gene was found to be significantly related to hypertension, dyslipidemia, insulin resistance, obesity, and drug abuse, with rs4680 being the most commonly reported variant. This systematic review found a strong association between the MCL system and the risk of developing CVDs and T2D, suggesting that identifying genetic variations related to this system could help with disease prevention and treatment strategies.

HFE
Also flagged:Metabolic Hyperferritinemiametabolic HFmetabolic diseasesHyperferritinemiaFerritiniron
Journal Article 2024-01-17 ✓ 1 Snippet Gensluckner S, Wernly B, Koutny F, Strebinger G, Zandanell S, Stechemesser L, Paulweber B, Iglseder B, Trinka E, Frey V, Langthaler P, Semmler G, Valenti L, Corradini E, Datz C, Aigner E.
In-Text Gene Mentions

…MHF rather thanhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Hyperferritinemia (HF) is a common finding and can be considered as metabolic HF (MHF) in combination with metabolic diseases. The definition of MHF was heterogenous until a consensus statement was published recently. Our aim was to apply the definition of MHF to provide data on the prevalence and characteristics of MHF in a Central-European cohort.<h4>Methods</h4>This study was a retrospective analysis of the Paracelsus 10,000 study, a population-based cohort study from the region of Salzburg, Austria. We included 8408 participants, aged 40-77. Participants with HF were divided into three categories according to their level of HF and evaluated for metabolic co-morbidities defined by the proposed criteria for MHF.<h4>Results</h4>HF was present in 13% (n = 1111) with a clear male preponderance (n = 771, 69% of HF). Within the HF group, 81% (n = 901) of subjects fulfilled the metabolic criteria and were defined as MHF, of which 75% (n = 674) were characterized by a major criterion. In the remaining HF cohort, 52% (n = 227 of 437) of subjects were classified as MHF after application of the minor criteria.<h4>Conclusion</h4>HF is a common finding in the general middle-aged population and the majority of cases are classified as MHF. The new classification provides useful criteria for defining MHF.

Also flagged:AutophagyIronHomeostasisimmune responseoxygendegradation
Journal Article 2024-01-17 No Snippets Wu PC, Choo YL, Wei SY, Yago JI, Chung KR.
Show Full Abstract

The tangerine pathotype of <i>Alternaria alternata</i> produces the <i>Alternaria citri</i> toxin (ACT), which elicits a host immune response characterized by the increase in harmful reactive oxygen species (ROS) production. ROS detoxification in <i>A. alternata</i> relies on the degradation of peroxisomes through autophagy and iron acquisition using siderophores. In this study, we investigated the role of autophagy in regulating siderophore and iron homeostasis in <i>A. alternata</i>. Our results showed that autophagy positively influences siderophore production and iron uptake. The <i>A. alternata</i> strains deficient in autophagy-related genes 1 and 8 (ΔAa<i>atg1</i> and ΔAa<i>atg8</i>) could not thrive without iron, and their adaptability to high-iron environments was also reduced. Furthermore, the ability of autophagy-deficient strains to withstand ROS was compromised. Notably, autophagy deficiency significantly reduced the production of dimerumic acid (DMA), a siderophore in <i>A. alternata</i>, which may contribute to ROS detoxification. Compared to the wild-type strain, ΔAa<i>atg8</i> was defective in cellular iron balances. We also observed iron-induced autophagy and lipid peroxidation in <i>A. alternata</i>. To summarize, our study indicates that autophagy and maintaining iron homeostasis are interconnected and contribute to the stress resistance and the virulence of <i>A. alternata</i>. These results provide new insights into the complex interplay connecting autophagy, iron metabolism, and fungal pathogenesis in <i>A. alternata</i>.

HTT
Also flagged:gestationmetforminlactationmethylationgene expressionmetabolism
Journal Article 2024-01-17 ✓ 1 Snippet Mas-Parés B, Xargay-Torrent S, Carreras-Badosa G, Gómez-Vilarrubla A, Niubó-Pallàs M, Tibau J, Reixach J, Prats-Puig A, de Zegher F, Ibañez L, Bassols J, López-Bermejo A.
In-Text Gene Mentions

…hypermethylated annotated forHTT, NELFB ,…

Show Full Abstract

Limited nutrient supply to the fetus results in physiologic and metabolic adaptations that have unfavorable consequences in the offspring. In a swine animal model, we aimed to study the effects of gestational caloric restriction and early postnatal metformin administration on offspring's adipose tissue epigenetics and their association with morphometric and metabolic variables. Sows were either underfed (30% restriction of total food) or kept under standard diet during gestation, and piglets were randomly assigned at birth to receive metformin (n = 16 per group) or vehicle treatment (n = 16 per group) throughout lactation. DNA methylation and gene expression were assessed in the retroperitoneal adipose tissue of piglets at weaning. Results showed that gestational caloric restriction had a negative effect on the metabolic profile of the piglets, increased the expression of inflammatory markers in the adipose tissue, and changed the methylation of several genes related to metabolism. Metformin treatment resulted in positive changes in the adipocyte morphology and regulated the methylation of several genes related to atherosclerosis, insulin, and fatty acids signaling pathways. The methylation and gene expression of the differentially methylated <i>FASN</i>, <i>SLC5A10</i>, <i>COL5A1</i>, and <i>PRKCZ</i> genes in adipose tissue associated with the metabolic profile in the piglets born to underfed sows. In conclusion, our swine model showed that caloric restriction during pregnancy was associated with impaired inflammatory and DNA methylation markers in the offspring's adipose tissue that could predispose the offspring to later metabolic abnormalities. Early metformin administration could modulate the size of adipocytes and the DNA methylation changes.

Also flagged:phosphatephosphorusCadmiummetalsorganic acidssecretion
Journal Article 2024-01-17 No Snippets Yang S, Ning Y, Li H, Zhu Y.
Show Full Abstract

The application of phosphate-solubilizing bacteria has been widely studied in remediating Cd-contaminated soil, but only a few studies have reported on the interaction of P and Cd as well as the microbiological mechanisms with phosphate-solubilizing bacteria in the soil because the activity of phosphate-solubilizing bacteria is easily inhibited by the toxicity of Cd. This paper investigates the phosphorus solubilization ability of <i>Priestia aryabhattai</i> domesticated under the stress of Cd, which was conducted in a soil experiment with the addition of Cd at different concentrations. The results show that the content of Ca<sub>2</sub>-P increased by 5.12-19.84%, and the content of labile organic phosphorus (LOP) increased by 3.03-8.42% after the addition of <i>Priestia aryabhattai</i> to the unsterilized soil. The content of available Cd decreased by 3.82% in the soil with heavy Cd contamination. <i>Priestia aryabhattai</i> has a certain resistance to Cd, and its relative abundance increased with the increased Cd concentration. The contents of Ca<sub>2</sub>-P and LOP in the soil had a strong positive correlation with the content of Olsen-P (<i>p</i> < 0.01), while the content of available Cd was negatively correlated with the contents of Olsen-P, Ca<sub>2</sub>-P, and LOP (<i>p</i> < 0.05). <i>Priestia aryabhattai</i> inhibits the transport of Cd, facilitates the conversion of low-activity P and insoluble P to Ca<sub>2</sub>-P and LOP in the soil, and increases the bioavailability and seasonal utilization of P in the soil, showing great potential in ecoremediating Cd-contaminated farmland soil with plant-microbe-combined technology.

DCC
Also flagged:axonsextracellularaxonsynapsecerebral malformationsagenesis of the corpus callosum
Journal Article 2024-01-17 ✓ 5 Snippets Gavrish M, Kustova A, Celis Suescún JC, Bessa P, Mitina N, Tarabykin V.
In-Text Gene Mentions

Mutations in the Netrin receptor DCC have been identified in patients with CC agenesis.

Netrin receptor DCCreceptor DCC can…

…receptors of Netrin,DCCand Unc5C.…

…Unc5C andDCCplay important, often…

DCCcan mediate an…

Show Full Abstract

The Corpus Callosum (CC) is a bundle of axons connecting the cerebral hemispheres. It is the most recent structure to have appeared during evolution of placental mammals. Its development is controlled by a very complex interplay of many molecules. In humans it contains almost 80% of all commissural axons in the brain. The formation of the CC can be divided into four main stages, each controlled by numerous intracellular and extracellular molecular factors. First, a newborn neuron has to specify an axon, leave proliferative compartments, the Ventricular Zone (VZ) and Subventricular Zone (SVZ), migrate through the Intermediate Zone (IZ), and then settle at the Cortical Plate (CP). During the second stage, callosal axons navigate toward the midline within a compact bundle. Next stage is the midline crossing into contralateral hemisphere. The last step is targeting a defined area and synapse formation. This review provides an insight into these four phases of callosal axons development, as well as a description of the main molecular players involved.

PRDX6
Also flagged:cancermetabolic diseaseshistonemethylationpost-translationalchromatin
Journal Article 2024-01-17 ✓ 1 Snippet Gavito-Covarrubias D, Ramírez-Díaz I, Guzmán-Linares J, Limón ID, Manuel-Sánchez DM, Molina-Herrera A, Coral-García MÁ, Anastasio E, Anaya-Hernández A, López-Salazar P, Juárez-Díaz G, Martínez-Juárez J, Torres-Jácome J, Albarado-Ibáñez A, Martínez-Laguna Y, Morán C, Rubio K.
In-Text Gene Mentions

…and miR-467c-5p withPRDX6in a PM…

Show Full Abstract

Environmental pollution nowadays has not only a direct correlation with human health changes but a direct social impact. Epidemiological studies have evidenced the increased damage to human health on a daily basis because of damage to the ecological niche. Rapid urban growth and industrialized societies importantly compromise air quality, which can be assessed by a notable accumulation of air pollutants in both the gas and the particle phases. Of them, particulate matter (PM) represents a highly complex mixture of organic and inorganic compounds of the most variable size, composition, and origin. PM being one of the most complex environmental pollutants, its accumulation also varies in a temporal and spatial manner, which challenges current analytical techniques used to investigate PM interactions. Nevertheless, the characterization of the chemical composition of PM is a reliable indicator of the composition of the atmosphere, the quality of breathed air in urbanized societies, industrial zones and consequently gives support for pertinent measures to avoid serious health damage. Epigenomic damage is one of the most promising biological mechanisms of air pollution-derived carcinogenesis. Therefore, this review aims to highlight the implication of PM exposure in diverse molecular mechanisms driving human diseases by altered epigenetic regulation. The presented findings in the context of pan-organic cancer, fibrosis, neurodegeneration and metabolic diseases may provide valuable insights into the toxicity effects of PM components at the epigenomic level and may serve as biomarkers of early detection for novel targeted therapies.

DARS2
Also flagged:Aminoacyl-tRNA synthetasestumorbladder cancerPD-L1cancercell proliferation
Journal Article 2024-01-17 ✓ 5 Snippets Yang H, Ma L, Deng W, Fu B, Nie J, Liu X.
In-Text Gene Mentions

We found DARS2 to be upregulated in bladder cancer, associated with tumor progression and poor prognosis.

We analyzed the correlation between DARS2 expression and prognosis, tumor stage, and immune infiltration in bladder cancer using The Cancer Genome Atlas (TCGA) database.

Cell and animal experiments validated that DARS2 knockdown and overexpress can inhibit or increase cancer cell proliferation, metastasis, tumorigenesis, immune escape, and PD-L1 levels.

Our study reveals DARS2 as a potential prognostic biomarker and immunotherapy target in BLCA.

However, the biological role of DARS2 in bladder cancer remains elusive.

Show Full Abstract

<h4>Background</h4>DARS2 is a pivotal member of the Aminoacyl-tRNA synthetases family that is critical for regulating protein translation. However, the biological role of DARS2 in bladder cancer remains elusive.<h4>Methods</h4>We analyzed the correlation between DARS2 expression and prognosis, tumor stage, and immune infiltration in bladder cancer using The Cancer Genome Atlas (TCGA) database. We validated findings in clinical samples from The First Affiliated Hospital of Nanchang University and explored the biological functions of DARS2 using cell and animal models.<h4>Results</h4>We found DARS2 to be upregulated in bladder cancer, associated with tumor progression and poor prognosis. Immune infiltration analysis suggested that DARS2 may facilitate immune evasion by modulating PD-L1. Cell and animal experiments validated that DARS2 knockdown and overexpress can inhibit or increase cancer cell proliferation, metastasis, tumorigenesis, immune escape, and PD-L1 levels.<h4>Conclusions</h4>Our study reveals DARS2 as a potential prognostic biomarker and immunotherapy target in BLCA.

HFE
Also flagged:IgGantibodiesautoimmune diseaseslymphoproliferative disorderslatent infectionsHPyV infections
Journal Article 2024-01-17 ✓ 1 Snippet Nicol JTJ, Mazzoni E, Iaquinta MR, De Pace R, Gaboriaud P, Maximova N, Cason C, De Martino E, Mazziotta C, Coursaget P, Touzé A, Boz V, Comar M, Tognon M, Martini F.
In-Text Gene Mentions

…liver transplantation inhemochromatosis( n =…

Show Full Abstract

<h4>Introduction</h4>Human polyomaviruses (HPyVs) cause persistent/latent infections in a large fraction of the population. HPyV infections may cause severe diseases in immunocompromised patients. Malawi polyomavirus (MWPyV) is the 10th discovered human polyomavirus (HPyV 10). MWPyV was found in stool samples of healthy children. So far, the few investigations carried out on HPyV 10 did not find an association with human disease.<h4>Methods</h4>In this study, to verify the putative association between MWPyV and human diseases, MWPyV seroprevalence was investigated in patients affected by i) lymphoproliferative disorders (LPDs) and ii) immune system disorders, i.e., autoimmune diseases (ADs), and in iii) healthy subjects. An indirect ELISA, employing virus-like particles (VLPs) to detect serum IgG antibodies against MWPyV/HPyV 10, was carried out. The study also revealed the prevalence of another polyomavirus, Merkel cell polyomavirus (MCPyV).<h4>Results</h4>Sera from patients with distinct autoimmune diseases (<i>n</i> = 44; mean age 20 years) had a prevalence of MWPyV antibodies of 68%, while in patients with lymphoproliferative disorders (<i>n</i> = 15; mean age 14 years), subjected to bone marrow transplantation, the prevalence was 47%. In healthy subjects (<i>n</i> = 66; mean age 13 years), the prevalence of MWPyV antibodies was 67%. Our immunological investigation indicates that MWPyV/HPyV 10 seroconversion occurs early in life and MWPyV/HPyV 10 appears to be another polyomavirus ubiquitous in the human population. A significantly lower MWPyV antibody reactivity together with a lower immunological profile was detected in the sera of LPD patients compared with HS2 (*<i>p</i> < 0.05) (Fisher's exact test). LPD and AD patients have a similar MCPyV seroprevalence compared with healthy subjects.<h4>Discussion</h4>MWPyV seroprevalence indicates that this HPyV is not associated with lymphoproliferative and autoimmune diseases. However, the ability to produce high levels of antibodies against MWPyV appears to be impaired in patients with lymphoproliferative disorders. Immunological investigations indicate that MWPyV seroconversion occurs early in life. MCPyV appears to be a ubiquitous polyomavirus, like other HPyVs, in the human population.

Also flagged:folate receptortransportersNeoplasiasagingcancermembrane receptors
Journal Article 2024-01-17 No Snippets Ahmadi M, Ritter CA, von Woedtke T, Bekeschus S, Wende K.
Show Full Abstract

Neoplasias pose a significant threat to aging society, underscoring the urgent need to overcome the limitations of traditional chemotherapy through pioneering strategies. Targeted drug delivery is an evolving frontier in cancer therapy, aiming to enhance treatment efficacy while mitigating undesirable side effects. One promising avenue utilizes cell membrane receptors like the folate receptor to guide drug transporters precisely to malignant cells. Based on the cellular folate receptor as a cancer cell hallmark, targeted nanocarriers and small molecule-drug conjugates have been developed that comprise different (bio) chemistries and/or mechanical properties with individual advantages and challenges. Such modern folic acid-conjugated stimuli-responsive drug transporters provide systemic drug delivery and controlled release, enabling reduced dosages, circumvention of drug resistance, and diminished adverse effects. Since the drug transporters' structure-based <i>de novo</i> design is increasingly relevant for precision cancer remediation and diagnosis, this review seeks to collect and debate the recent approaches to deliver therapeutics or diagnostics based on folic acid conjugated <i>Trojan Horse</i>s and to facilitate the understanding of the relevant chemistry and biochemical pathways. Focusing exemplarily on brain and breast cancer, recent advances spanning 2017 to 2023 in conjugated nanocarriers and small molecule drug conjugates were considered, evaluating the chemical and biological aspects in order to improve accessibility to the field and to bridge chemical and biomedical points of view ultimately guiding future research in FR-targeted cancer therapy and diagnosis.

SERPINC1
Also flagged:ThrombosisMethicillinphotophobiaC-reactive proteinorbital cellulitissuperior ophthalmic vein
Journal Article 2024-01-16 ✓ 1 Snippet Aldhefeery N, Alrashidi SA, Bouhaimed M.
In-Text Gene Mentions

…ntibodies, anti-thrombin III (ATIII), and factor-V-Leiden mutatio…

Show Full Abstract

BACKGROUND Superior ophthalmic vein thrombosis (SOVT) is a rare condition, with an incidence of 3 to 4 cases per million per year. SOVT can be classified according to the underlying etiology into septic or aseptic SOVT. We present a case of right SOVT in a previously healthy patient with a positive blood culture of methicillin-resistant Staphylococcus aureus (MRSA). CASE REPORT A previously healthy 38-year-old female patient presented with a 2-week history of worsening right-sided headache associated with photophobia, phonophobia, right-sided ear pain, and tinnitus. The best corrected visual acuity was 6/12 in the right eye and 6/6 in the left eye. Ophthalmic examination revealed right eye upper lid edema, proptosis, and diplopia in all gazes, mainly vertical. The fundus examination showed a raised hyperemic right optic disc with blurred margins. Laboratory investigations showed a positive blood culture of MRSA and elevated levels of inflammatory markers erythrocyte sedimentation rate and C-reactive protein. Orbital computed tomography examination showed periorbital and orbital cellulitis with superior ophthalmic vein thrombosis. The patient was treated successfully with antibiotics and anticoagulants. At 1-month follow-up, the patient was compliant with medications and reported full resolution of symptoms, with no visual acuity impairment. CONCLUSIONS SOVT is a challenging ophthalmic condition and can be present concurrent with orbital cellulitis or cavernous sinus thrombosis. Early imaging studies and proper management are important to prevent serious complications. Ophthalmologists need to be alerted of the importance of tailoring antibiotics based on the causative agent, to decrease the risk of therapeutic failure and microbial resistance.

CACNA1E
Also flagged:gene expressionHand, foot, and mouth diseaseinfectionsCA6infectionvirus infection
Journal Article 2024-01-16 ✓ 1 Snippet Zhang L, Peng W, Wu J, Wei X, Rong N, Zhang G, Yang H, Ding X, Zhao B, Liu J.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

Hand, foot, and mouth disease (HFMD) is caused by more than 20 pathogenic enteroviruses belonging to the Picornaviridae family and <i>Enterovirus</i> genus. Since the introduction of the enterovirus-71 (EV71) vaccine in 2016, the number of HFMD cases caused by EV71 has decreased. However, cases of infections caused by other enteroviruses, such as coxsackievirus A6 (CA6) and coxsackievirus A10, have been increasing accordingly. In this study, we used a clinical isolate of CA6 to establish an intragastric infection mouse model using 7-day-old mice to mimic the natural transmission route, by which we investigated the differential gene expression profiles associated with virus infection and pathogenicity. After intragastric infection, mice exhibited hind limb paralysis symptoms and weight loss, similar to those reported for EV71 infection in mice. The skeletal muscle was identified as the main site of virus replication, with a peak viral load reaching 2.31 × 10<sup>7</sup> copies/mg at 5 dpi and increased infiltration of inflammatory cells. RNA sequencing analysis identified differentially expressed genes (DEGs) after CA6 infection. DEGs in the blood, muscle, brain, spleen, and thymus were predominantly enriched in immune system responses, including pathways such as Toll-like receptor signaling and PI3K-Akt signaling. Our study has unveiled the genes involved in the host immune response during CA6 infection, thereby enhancing our comprehension of the pathological mechanism of HFMD.IMPORTANCEThis study holds great significance for the field of hand, foot, and mouth disease (HFMD). It not only delves into the disease's etiology, transmission pathways, and severe complications but also establishes a novel mouse model that mimics the natural coxsackievirus A6 infection process, providing a pivotal platform to delve deeper into virus replication and pathogenic mechanisms. Additionally, utilizing RNA-seq technology, it unveils the dynamic gene expression changes during infection, offering valuable leads for identifying novel therapeutic drug targets. This research has the potential to enhance our understanding of HFMD, offering fresh perspectives for disease prevention and treatment and positively impacting children's health worldwide.

HFE
Also flagged:rheumatoid arthritismethotrexateliver fibrosisRAinflammatory rheumatic diseasesJanus kinase
Journal Article 2024-01-16 ✓ 1 Snippet Schäfer A, Kovacs MS, Eder A, Nigg A, Feuchtenberger M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Aims</h4>To assess the liver stiffness in patients with rheumatoid arthritis treated with methotrexate monotherapy using non-invasive, ultrasound-based elastography (acoustic radiation force impulse (ARFI) imaging) in a longitudinal approach.<h4>Methods</h4>In total, 23 MTX-naive patients were longitudinally assessed using acoustic radiation force impulse (ARFI) imaging. Baseline assessments were carried out between July 2018 and April 2019, and the follow-up evaluations took place after an average of 2.6 years. The main outcome variable was the mean shear wave velocity as measured by the ARFI method. It was calculated from 10 valid ARFI measurements for each patient. Inferential statistical analyses (within-group comparisons) were performed using t-tests for dependent samples or suitable nonparametric procedures.<h4>Results</h4>The main finding was that observed ARFI shear wave velocities did not increase during the observation period. In fact, this parameter decreased over time from 1.07 m/s (SD = 0.23) at baseline without MTX exposure to 0.97 m/s (SD = 0.16) at follow-up after a mean of 2.6 years (P = 0.013). Moreover, the magnitude of the change in shear wave velocity could not be predicted by indicators of inflammation or disease activity, BMI, age, sex or NSAR intake (corresponding regression analysis: corrected R<sup>2</sup> = 0.344; P = 0.296).<h4>Conclusions</h4>No increased risk of liver fibrosis was found in RA patients treated with MTX monotherapy during observation period.

Also flagged:infectionshaemagglutininHARNA polymerase subunit PB2receptorbinding
Journal Article 2024-01-16 No Snippets Brüssow H.
Show Full Abstract

Pandemic preparedness starts with an early warning system of viruses with a pandemic potential. Based on information collected in a multitude of surveys, hazard models were developed identifying influenza viruses presenting a pandemic threat. Scores are attributed for 10 viral traits by expert panels which identified avian influenza viruses (AIV) belonging to subtypes H7N9 and H5N1 as representing the greatest pandemic risk. In 2013, more than 100 human cases infected with AIV H7N9 were observed in China. Case fatality rate (CFR) was high (27%), but the human-to-human transmission rate was low and by serological evidence H7N9 did not spread widely. Nevertheless, until 2019 more than 1500 H7N9 patients were identified characterized by a high CFR of 39%. Serology demonstrated that mild infections with H7N9 were widespread. In 2003, more than 400 people experienced AIV H7N7 cross-infection causing mainly conjunctivitis during a large poultry epidemic in The Netherlands. Between 1996 and 2019, a total of 881 human infections with avian H5N1 viruses were documented showing a CFR of 52%. Outbreaks were centred on South East Asia and showed close associations with epizootics in poultry. Mutations predisposing to human cross-infections were identified in the haemagglutinin (HA) and the RNA polymerase subunit PB2 of human H7N9 isolates. Human H5N1 isolates showed mutations in the receptor binding domain of HA and transmission in mammals could be obtained by as few as four additional aa changes introduced experimentally. Researchers have defined viral point mutations in HA, PB2 and the nucleoprotein NP that allowed AIV to cross the species barrier to mammals with respect to receptor recognition, RNA replication and escape from innate immunity respectively. Based on this insight a sequence-based early warning system for AIV preadapted to human transmission could be envisioned. Mink farms and live poultry markets are prime targets for such sequencing efforts.

OLFM4
Also flagged:Circularcolitisinflammatory bowel diseasesepsispathogenesiscell spreading
Journal Article 2024-01-16 ✓ 1 Snippet Chung HK, Xiao L, Han N, Chen J, Yao V, Cairns CM, Raufman B, Rao JN, Turner DJ, Kozar R, Gorospe M, Wang JY.
In-Text Gene Mentions

…increased numbers ofOLFM4- and LGR5-positive cells…

Show Full Abstract

Circular RNAs (circRNAs) are highly expressed in the mammalian intestinal epithelium, but their functions remain largely unknown. Here, we identified the circRNA Cdr1as as a repressor of intestinal epithelial regeneration and defense. Cdr1as levels increased in mouse intestinal mucosa after colitis and septic stress, as well as in human intestinal mucosa from patients with inflammatory bowel disease and sepsis. Ablation of the Cdr1as locus from the mouse genome enhanced renewal of the intestinal mucosa, promoted injury-induced epithelial regeneration, and protected the mucosa against colitis. We found approximately 40 microRNAs, including miR-195, differentially expressed between intestinal mucosa of Cdr1as-knockout (Cdr1as-/-) versus littermate mice. Increasing the levels of Cdr1as inhibited intestinal epithelial repair after wounding in cultured cells and repressed growth of intestinal organoids cultured ex vivo, but this inhibition was abolished by miR-195 silencing. The reduction in miR-195 levels in the Cdr1as-/- intestinal epithelium was the result of reduced stability and processing of the precursor miR-195. These findings indicate that Cdr1as reduces proliferation and repair of the intestinal epithelium at least in part via interaction with miR-195 and highlight a role for induced Cdr1as in the pathogenesis of unhealed wounds and disrupted renewal of the intestinal mucosa.

Also flagged:Breast cancercancerductal carcinoma in situDCISmembranemetastatic cancer
Journal Article 2024-01-16 No Snippets Nazemi M, Yanes B, Martinez ML, Walker HJ, Pham K, Collins MO, Bard F, Rainero E.
Show Full Abstract

Breast tumours are embedded in a collagen I-rich extracellular matrix (ECM) network, where nutrients are scarce due to limited blood flow and elevated tumour growth. Metabolic adaptation is required for cancer cells to endure these conditions. Here, we demonstrated that the presence of ECM supported the growth of invasive breast cancer cells, but not non-transformed mammary epithelial cells, under amino acid starvation, through a mechanism that required macropinocytosis-dependent ECM uptake. Importantly, we showed that this behaviour was acquired during carcinoma progression. ECM internalisation, followed by lysosomal degradation, contributed to the up-regulation of the intracellular levels of several amino acids, most notably tyrosine and phenylalanine. This resulted in elevated tyrosine catabolism on ECM under starvation, leading to increased fumarate levels, potentially feeding into the tricarboxylic acid (TCA) cycle. Interestingly, this pathway was required for ECM-dependent cell growth and invasive cell migration under amino acid starvation, as the knockdown of p-hydroxyphenylpyruvate hydroxylase-like protein (HPDL), the third enzyme of the pathway, opposed cell growth and motility on ECM in both 2D and 3D systems, without affecting cell proliferation on plastic. Finally, high HPDL expression correlated with poor prognosis in breast cancer patients. Collectively, our results highlight that the ECM in the tumour microenvironment (TME) represents an alternative source of nutrients to support cancer cell growth by regulating phenylalanine and tyrosine metabolism.

SOX6
Also flagged:Non-small cell lung cancercarboplatingemcitabinegene expressioncancerdeath
Journal Article 2024-01-16 ✓ 1 Snippet Zhigulev A, Norberg Z, Cordier J, Spalinskas R, Bassereh H, Björn N, Pradhananga S, Gréen H, Sahlén P.
In-Text Gene Mentions

…TBL1XR1, NR2C2, andSOX6were only found…

Show Full Abstract

Non-small cell lung cancer is often diagnosed at advanced stages, and many patients are still treated with classical chemotherapy. The unselective nature of chemotherapy often results in severe myelosuppression. Previous studies showed that protein-coding mutations could not fully explain the predisposition to myelosuppression. Here, we investigate the possible role of enhancer mutations in myelosuppression susceptibility. We produced transcriptome and promoter-interaction maps (using HiCap) of three blood stem-like cell lines treated with carboplatin or gemcitabine. Taking advantage of publicly available enhancer datasets, we validated HiCap results in silico and in living cells using epigenetic CRISPR technology. We also developed a network approach for interactome analysis and detection of differentially interacting genes. Differential interaction analysis provided additional information on relevant genes and pathways for myelosuppression compared with differential gene expression analysis at the bulk level. Moreover, we showed that enhancers of differentially interacting genes are highly enriched for variants associated with differing levels of myelosuppression. Altogether, our work represents a prominent example of integrative transcriptome and gene regulatory datasets analysis for the functional annotation of noncoding mutations.

TNFSF4
Also flagged:gastric cancerGene ExpressionCGB5SLC10A2THPOPDGFRB
Journal Article 2024-01-16 ✓ 4 Snippets Wang Y, Huang W, Zheng S, Wang L, Zhang L, Pei X.
In-Text Gene Mentions

In both the training dataset and the validation dataset 1, expression of BTLA, CD200, CD28, CD86, HAVCR2, LAIR1, TNFRSF4, and TNFSF4 was upregulated in high risk patients, which indicated the association between the risk score and tumor immunity.

…LAIR1, TNFRSF4, andTNFSF4was upregulated in…

…LAIR1, TNFRSF4, andTNFSF4, was significantly increased…

…and its ligandTNFSF4(OX40L) are members…

Show Full Abstract

Early identification of gastric cancer (GC) is associated with a superior survival rate compared to advanced GC. However, the poor specificity and sensitivity of traditional biomarkers suggest the importance of identifying more effective biomarkers. This study aimed to identify novel biomarkers for the prognosis of GC and construct a risk score (RS) signature based on these biomarkers, with to validation of its predictive performance. We used multi-omics data from The Cancer Genome Atlas to analyze the significance of differences in each omics data and combined the data using Fisher's method. Hub genes were subsequently subjected to univariate Cox and LASSO regression analyses and used to construct the RS signature. The RS of each patient was calculated, and the patients were divided into two subgroups according to the RS. The RS signature was validated in two independent datasets from the Gene Expression Omnibus and subsequent analyses were subsequently conducted. Five immune-related genes strongly linked to the prognosis of GC patients were obtained, namely CGB5, SLC10A2, THPO, PDGFRB, and APOD. The results revealed significant differences in overall survival between the two subgroups (p < 0.001) and indicated the high accuracy of the RS signature. When validated in two independent datasets, the results were consistent with those in the training dataset (p = 0.003 and p = 0.001). Subsequent analyses revealed that the RS signature is independent and has broad applicability among various GC subtypes. In conclusion, we used multi-omics data to obtain five immune-related genes comprising the RS signature, which can independently and effectively predict the prognosis of GC patients with high accuracy.

BTN3A3
Also flagged:infectioninnate immunityOrf6nucleocapsidDeltaresponses
Journal Article 2024-01-16 ✓ 1 Snippet Reuschl AK, Thorne LG, Whelan MVX, Ragazzini R, Furnon W, Cowton VM, De Lorenzo G, Mesner D, Turner JLE, Dowgier G, Bogoda N, Bonfanti P, Palmarini M, Patel AH, Jolly C, Towers GJ.
In-Text Gene Mentions

…restricted by humanBTN3A3(ref.…

Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) human adaptation resulted in distinct lineages with enhanced transmissibility called variants of concern (VOCs). Omicron is the first VOC to evolve distinct globally dominant subvariants. Here we compared their replication in human cell lines and primary airway cultures and measured host responses to infection. We discovered that subvariants BA.4 and BA.5 have improved their suppression of innate immunity when compared with earlier subvariants BA.1 and BA.2. Similarly, more recent subvariants (BA.2.75 and XBB lineages) also triggered reduced innate immune activation. This correlated with increased expression of viral innate antagonists Orf6 and nucleocapsid, reminiscent of VOCs Alpha to Delta. Increased Orf6 levels suppressed host innate responses to infection by decreasing IRF3 and STAT1 signalling measured by transcription factor phosphorylation and nuclear translocation. Our data suggest that convergent evolution of enhanced innate immune antagonist expression is a common pathway of human adaptation and link Omicron subvariant dominance to improved innate immune evasion.

CCDC92
Also flagged:ABCA1cholesteroldiabetic kidney diseaseCoiled-coil domain containing 92metabolic disordersinsulin resistance
Journal Article 2024-01-16 ✓ 5 Snippets Zuo FW, Liu ZY, Wang MW, Du JY, Ding PZ, Zhang HR, Tang W, Sun Y, Wang XJ, Zhang Y, Xie YS, Wu JC, Liu M, Wang ZY, Yi F.
In-Text Gene Mentions

CCDC92 promotes podocyte injury by regulating PA28α/ABCA1/cholesterol efflux axis in type 2 diabetic mice.

Coiled-coil domain containing 92 (CCDC92) is a novel molecule related to metabolic disorders and insulin resistance.

Importantly, upregulation of Ccdc92 in glomeruli was positively correlated with an increased urine albumin-to-creatinine ratio (UACR) and podocyte loss.

Thus, our studies indicate that Ccdc92 contributes to podocyte injury by regulating the PA28α/ABCA1/cholesterol efflux axis in DKD.

Mechanistically, Ccdc92 promoted the degradation of ABCA1 by regulating PA28α-mediated proteasome activity and then reduced cholesterol efflux.

Show Full Abstract

Podocyte lipotoxicity mediated by impaired cellular cholesterol efflux plays a crucial role in the development of diabetic kidney disease (DKD), and the identification of potential therapeutic targets that regulate podocyte cholesterol homeostasis has clinical significance. Coiled-coil domain containing 92 (CCDC92) is a novel molecule related to metabolic disorders and insulin resistance. However, whether the expression level of CCDC92 is changed in kidney parenchymal cells and the role of CCDC92 in podocytes remain unclear. In this study, we found that Ccdc92 was significantly induced in glomeruli from type 2 diabetic mice, especially in podocytes. Importantly, upregulation of Ccdc92 in glomeruli was positively correlated with an increased urine albumin-to-creatinine ratio (UACR) and podocyte loss. Functionally, podocyte-specific deletion of Ccdc92 attenuated proteinuria, glomerular expansion and podocyte injury in mice with DKD. We further demonstrated that Ccdc92 contributed to lipid accumulation by inhibiting cholesterol efflux, finally promoting podocyte injury. Mechanistically, Ccdc92 promoted the degradation of ABCA1 by regulating PA28α-mediated proteasome activity and then reduced cholesterol efflux. Thus, our studies indicate that Ccdc92 contributes to podocyte injury by regulating the PA28α/ABCA1/cholesterol efflux axis in DKD.

Also flagged:glycosyl aminesglycosylazidesHexosegalactoseSynthesis
Journal Article 2024-01-16 No Snippets Traverssi MG, Manzano VE, Varela O, Colomer JP.
Show Full Abstract

The synthesis of <i>N</i>-glycosyl amides typically involves the use of glycosyl amines as direct precursors, resulting in low yields due to hydrolysis and the loss of stereocontrol through anomerization processes. In this study, a sequential synthesis of <i>N</i>-glycosyl amides is proposed, employing glycosyl amines as intermediates obtained from glycosyl azides. Derivatives with <i>gluco</i>, <i>galacto</i>, or <i>xylo</i> configurations were synthesized. Hexose derivatives were obtained under stereocontrol to give only the β anomer, while the <i>xylo</i> derivatives provided a mixture of α and β anomers. Conformational analysis revealed that all β anomers adopted the <sup>4</sup>C<sub>1</sub> conformation, while α anomers were found in the <sup>1</sup>C<sub>4</sub> chair as the major conformer. After de-<i>O</i>-acetylation, the derivatives containing a galactose unit were evaluated as inhibitors of β-galactosidase from <i>E. coli</i> and were found to be moderate inhibitors.

DARS2
Also flagged:Aminoacyl-tRNA synthetasesofProtein synthesisamino acidscytoplasmmitochondria
Journal Article 2024-01-16 ✓ 1 Snippet Zhou F, Yi G, Liu X, Sheng W, Shu J, Li D, Cai C.
In-Text Gene Mentions

…( IARS2 ,DARS2, RARS2 ,…

Show Full Abstract

<b>Background</b>  Aminoacyl-tRNA synthetases (ARSs) are evolutionarily conserved enzymes that ensure the accuracy of the translation process. Isoleucyl-tRNA synthetase 2 ( <i>IARS2</i> ) gene is a type of ARS that encodes mitochondrial isoleucine-tRNA synthetase. Pathogenic variants in the <i>IARS2</i> gene are associated with mitochondrial disease which involves several patients presenting broad clinical phenotypes. These clinical phenotypes include West syndrome, Leigh syndrome, and Cataract, growth hormone deficiency, sensory neuropathy, sensorineural hearing loss, and skeletal dysplasia syndrome. Only 29 cases have been reported worldwide. The patient manifested recurrent convulsions, and specific clinical manifestations included electrolyte disorders and recurrent infections. <b>Methods</b>  Whole-exome sequencing was performed on the child with West syndrome. Three-dimensional structure reconstruction and thermodynamic stability prediction were performed to further analyze the relationship between variation and phenotype. <b>Conclusion</b>  This study further expands the clinical spectrum of <i>IARS2</i> pathogenic variants. The case summaries help raise clinical awareness of <i>IARS2</i> -associated disease and reduce misdiagnosis. <b>Result</b>  In this report, a 13-month-old girl was diagnosed with West syndrome and Leigh syndrome for 7 months. Compound heterozygous variants in the IARS2 gene (NM_018060.4), c.2450G>A (Arg817His) and copy number variation (NC_000001. 11: g. (220267549_220284289) del), were detected by WES. This study further expands the clinical spectrum of IARS2 pathogenic variants. The case summaries help raise clinical awareness of IARS2-associated disease and reduce misdiagnosis.

Also flagged:MAPTneurodegenerative diseasestaumicrotubule-associated proteinneurodegenerationpathogenesis
Journal Article 2024-01-16 No Snippets Rogers BB, Anderson AG, Lauzon SN, Davis MN, Hauser RM, Roberts SC, Rodriguez-Nunez I, Trausch-Lowther K, Barinaga EA, Hall PI, Knuesel MT, Taylor JW, Mackiewicz M, Roberts BS, Cooper SJ, Rizzardi LF, Myers RM, Cochran JN.
Show Full Abstract

Tauopathies are a group of neurodegenerative diseases defined by abnormal aggregates of tau, a microtubule-associated protein encoded by MAPT. MAPT expression is near absent in neural progenitor cells (NPCs) and increases during differentiation. This temporally dynamic expression pattern suggests that MAPT expression could be controlled by transcription factors and cis-regulatory elements specific to differentiated cell types. Given the relevance of MAPT expression to neurodegeneration pathogenesis, identification of such elements is relevant to understanding disease risk and pathogenesis. Here, we performed chromatin conformation assays (HiC & Capture-C), single-nucleus multiomics (RNA-seq+ATAC-seq), bulk ATAC-seq, and ChIP-seq for H3K27ac and CTCF in NPCs and differentiated neurons to nominate candidate cis-regulatory elements (cCREs). We assayed these cCREs using luciferase assays and CRISPR interference (CRISPRi) experiments to measure their effects on MAPT expression. Finally, we integrated cCRE annotations into an analysis of genetic variation in neurodegeneration-affected individuals and control subjects. We identified both proximal and distal regulatory elements for MAPT and confirmed the regulatory function for several regions, including three regions centromeric to MAPT beyond the H1/H2 haplotype inversion breakpoint. We also found that rare and predicted damaging genetic variation in nominated CREs was nominally depleted in dementia-affected individuals relative to control subjects, consistent with the hypothesis that variants that disrupt MAPT enhancer activity, and thereby reduced MAPT expression, may be protective against neurodegenerative disease. Overall, this study provides compelling evidence for pursuing detailed knowledge of CREs for genes of interest to permit better understanding of disease risk.

HFE
Also flagged:CancerIronZincCopperLaryngeal Cancerantibodies
Journal Article 2024-01-16 ✓ 2 Snippets Wojnicka J, Grywalska E, Hymos A, Mertowska P, Mertowski S, Charytanowicz M, Klatka M, Klatka J, Dolliver WR, Błażewicz A.
In-Text Gene Mentions

…astrointestinal tract, causinghemochromatosis, results in abnormal…

…not suffer fromhemochromatosisand did not…

Show Full Abstract

(1) Background: the purpose of the study was to assess the relationship between cancer stage, selected immunological parameters, Epstein-Barr virus (EBV) infection, and total serum content of iron, zinc, and copper in patients with laryngeal cancer (LC). (2) Methods: serum Fe, Zn, and Cu were measured in 40 LC patients and 20 controls. Immunophenotyping of peripheral blood lymphocytes was performed by flow cytometry using fluorescent antibodies against CD3, CD4, CD8, CD19, CD25, CD69, and PD-1. Tumor and lymph node lymphocytes were analyzed by flow cytometry. EBV DNA was quantified by real-time PCR, targeting the <i>EBNA-1</i> gene. Associations between serum elements, immune markers, and cancer grade/stage were evaluated using ANOVA and appropriate nonparametric tests. (3) Results: levels of Fe, Cu, and Zn were lower, while Cu/Zn was statistically higher, in patients with LC than in the control group. Correlation analysis showed a statistically significant association between the levels of these elements and parameters of the TNM (Tumor, Node, Metastasis) staging system, immunophenotype, and the amount of EBV genetic material in patients with LC who survived for more than 5 years. (4) Conclusion: the results suggest that the total serum levels of the determined micronutrients may significantly affect the immunopathogenesis and progression of LC.

HFE
Also flagged:steatosisNAFLDnonalcoholic fatty liver diseasemetabolic syndromeALTcholesterol
Journal Article 2024-01-16 ✓ 1 Snippet Alam S, Datta PK, Alam M, Hasan MJ.
In-Text Gene Mentions

…autoimmune liver diseases,hemochromatosis, cirrhosis of the…

Show Full Abstract

<h4>Background and aim</h4>To compare the effects of probiotics on liver stiffness and steatosis in obese and non-obese patients with nonalcoholic fatty liver disease (NAFLD),the pragmatic clinical trial included 50 obese body mass index (BMI) ≥25 kg/m<sup>2</sup> and 50 non-obese NAFLD BMI <25 kg/m<sup>2</sup> age and sex-matched patients.<h4>Materials and methods</h4>Fibroscan with controlled attenuated parameter (CAP) was done at day 0 and at the end of 6 months. Probiotics supplementation was provided for both groups for 6 months along with lifestyle modifications.<h4>Results</h4>At inclusion, both groups had comparable characteristics except BMI, metabolic syndrome and waist circumference (WC). Beneficial changes occurred in BMI (p=0.024), WC (p=0.045), ALT (p=0.024), total cholesterol (p=0.016), LDL (p=0.025) and triglyceride (p=0.021) of obese group, systolic blood pressure (p=0.003) and LDL level (p=0.018) in non-obese group. No significant change was observed in liver enzymes and glycemic profiles. Significant improvement in CAP was observed in both groups. But after adjusting for changes in BMI and WC, the change in CAP among non-obese participants were significantly higher compared to obese, mean change of 19.33±48.87 and 16.02±51.58 dB/m in non-obese and obese patients, respectively; p=0.044).<h4>Conclusion</h4>Probiotics improve CAP/ steatosis in both obese and non-obese NAFLD patients and improvement was higher in non-obese, irrespective of BMI change.

HFE
Also flagged:steatosisfatty liver diseaseliver steatosisHepatic steatosistriglyceridescytoplasm
Journal Article 2024-01-16 ✓ 1 Snippet Kizildag B, Baykara M, Yurttutan N, Vicdan H.
In-Text Gene Mentions

…as Wilson’s disease,hemochromatosis, etc.).…

Show Full Abstract

<h4>Background and aim</h4>To investigate the relationship between ultrasonography (US) and magnetic resonance (MR) proton density fat fraction (PDFF) techniques, using the modified DIXON method, in determining the severity of liver steatosis.<h4>Materials and methods</h4>This study included seventy consecutive patients who underwent upper abdominal MRI for various reasons between June 2016 and January 2017. Fatty liver staging was performed using US as indicated.The liver fat percentage was measured and staged according to PDFF values.<h4>Results</h4>In the study, of the 70 cases, 36 were male and 34 were female. On US, 18.5% of the cases had stage 0, 32.8% had stage 1, 42.8% had stage 2, and 5.7% had stage 3 liver steatosis. A significant correlation was found between ultrasonographic evaluation and PDFF in determining the percentage of liver fat (r=0.775, p<0.001). When comparing the percentages, MR-evaluated PDFF and ultrasonographic staging were most compatible at grade 3 and least compatible at grade 2. When the PDFF threshold value was set at 8.1%, the sensitivity of US in distinguishing between obvious and indistinct steatosis was 97.1%, and the specificity was 88.9%.<h4>Conclusion</h4>Ultrasound continues to be a useful tool for detecting fatty liver disease. However, magnetic resonance (MR) proton density fat fraction (PDFF) imaging is essential for accurately determining the severity and prevalence of steatosis. Our study revealed inconsistencies between US and MR PDFF in grading liver steatosis, showing higher agreement in severe cases and lower agreement in moderate cases. Therefore, we recommend classifying steatosis as either uncertain or apparent rather than using a grading system in US.

HFE
Also flagged:non-alcoholic fatty liver diseaseNAFLDFibrosisASTLiver fibrosiscirrhosis
Journal Article 2024-01-16 ✓ 1 Snippet Sariyar N, Kani HT, Celikel CA, Yilmaz Y.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosiswere also excluded.…

Show Full Abstract

<h4>Background and aim</h4>This study aimed to investigate the predictive value of various non-invasive scores for identifying the progression of hepatic fibrosis over time in patients with Non-Alcoholic Fatty Liver Disease (NAFLD).<h4>Materials and methods</h4>We examined 69 patients with NAFLD who had undergone two liver biopsies at an average interval of 21.3±9.7 months. Progression and regression of fibrosis were defined as an increase or decrease of at least one stage in fibrosis between the initial and follow-up biopsies, respectively. The Fibrosis-4 Index (FIB-4), NAFLD Fibrosis Score (NFS), Agile 3+, Agile 4, and FibroScan-AST (FAST) scores were calculated at the initial biopsy.<h4>Results</h4>Comparison of paired biopsies revealed that 45% of participants (n=31) exhibited no change in fibrosis stages, 26% (n=18) experienced progression, and 29% (n=20) demonstrated regression. Multivariable logistic regression analysis identified the FAST score as the only independent predictor of progressive fibrosis, with the odds increasing by 19% (95% CI: 8-38%, p<0.05) for each unit increase in the FAST score at the initial biopsy. No independent predictors for fibrosis regression were identified.<h4>Conclusion</h4>Higher baseline FAST scores were associated with an increased likelihood of fibrosis progression, independent of other variables. Thus, the FAST score could serve as both a diagnostic and prognostic tool for fibrosis in patients with NAFLD.

TNFSF4
Also flagged:cancertumorstumorOncoviral infectionsoncogenesimmune responses
Journal Article 2024-01-16 ✓ 2 Snippets Wu J, Zhang P, Mei W, Zeng C.
In-Text Gene Mentions

…and OX40 ligand (TNFSF4).…

…Toll-like receptor 4;TNFSF4, Toll-like receptor (TLR)…

Show Full Abstract

Significant advancements have been made in comprehending the interactions between the microbiome and cancer. However, prevailing research predominantly directs its focus toward the gut microbiome, affording limited consideration to the interactions of intratumoral microbiota and tumors. Within the tumor microenvironment (TME), the intratumoral microbiome and its associated products wield regulatory influence, directing the modulation of cancer cell properties and impacting immune system functionality. However, to grasp a more profound insight into the intratumoral microbiota in cancer, further research into its underlying mechanisms is necessary. In this review, we delve into the intricate associations between intratumoral microbiota and cancer, with a specific focus on elucidating the significant contribution of intratumoral microbiota to the onset and advancement of cancer. Notably, we provide a detailed exploration of therapeutic advances facilitated by intratumoral microbiota, offering insights into recent developments in this burgeoning field.

HTT
Also flagged:neurological diseasesS-acyltransferasefatty acidcysteineneuneurological disorders
Journal Article 2024-01-16 ✓ 4 Snippets Liao D, Huang Y, Liu D, Zhang H, Shi X, Li X, Luo P.
In-Text Gene Mentions

zDHHC17 and zDHHC13 (HIP14 and HIP14L) then induce palmitoylation at HTT cysteine 214 (C214) (Huang et al., 2004).

In addition to focusing on HTT palmitoylation, a potential risk factor controlling the S-palmitoylation of TRPC5 channels could modulate TRPC5 channel expression and activity, providing new insights into novel therapeutic strategies for HD (Hong et al., 2020).

Subsequently, in immortalized cell lines and primary neurons carrying the palmitoylation-resistant mutation HTT (C214 to serine, C214S) and in a YAC128 mouse model (full-length human HTT transgenic mice with 128 CAG repeats), it was demonstrated that zDHHC17 and zDHHC13-associated palmitoylation are both decreased in HD, increasing susceptibility to excitotoxicity (Singaraja et al., 2002).

In the presence of HTT mutations, the interaction of zDHHC17 and zDHHC13 with HTT is altered, resulting in reduced palmitoylation, and it is hypothesized that HD is a disease caused by altered palmitoylation (Sanders and Hayden, 2015).

Show Full Abstract

S-palmitoylation is a reversible posttranslational modification, and the palmitoylation reaction in human-derived cells is mediated by the zDHHC family, which is composed of S-acyltransferase enzymes that possess the DHHC (Asp-His-His-Cys) structural domain. zDHHC proteins form an autoacylation intermediate, which then attaches the fatty acid to cysteine a residue in the target protein. zDHHC proteins sublocalize in different neuronal structures and exert dif-ferential effects on neurons. In humans, many zDHHC proteins are closely related to human neu-rological disor-ders. This review focuses on a variety of neurological disorders, such as AD (Alz-heimer's disease), HD (Huntington's disease), SCZ (schizophrenia), XLID (X-linked intellectual disability), attention deficit hyperactivity disorder and glioma. In this paper, we will discuss and summarize the research progress regarding the role of zDHHC proteins in these neu-rological disorders.

ZNFX1
Also flagged:Tislelizumabnimotuzumaboral squamous cell carcinomahead and neck squamous cell carcinomaprogrammed cell death 1epidermal growth factor receptor
Journal Article 2024-01-16 ✓ 1 Snippet Wu WJ, An PG, Zhong YW, Hu X, Wang L, Zhang J.
In-Text Gene Mentions

…HUWE1, LYST, SYNE1,ZNFX1, DYNC112, NRXN1, CASP8,…

Show Full Abstract

<h4>Objectives</h4>The efficacy of treatments targeting recurrent or metastatic head and neck squamous cell carcinoma are unsatisfactory in practice for patients with a ECOG PS score ≥ 2. Thus, this study retrospectively evaluated the safety and efficacy of a programmed cell death 1 inhibitor (tislelizumab) combined with an epidermal growth factor receptor inhibitor (nimotuzumab) in treating patients with a PS score ≥ 2 who suffer from recurrent or metastatic oral squamous cell carcinoma (OSCC).<h4>Materials and methods</h4>Fifteen patients were treated with tislelizumab (200 mg IV Q3W) and nimotuzumab (200 mg IV Q3W). Programmed cell death-ligand 1 (PD-L1) expression in tumor biopsies was assessed with immunohistochemistry. Whole-exome sequencing was used to evaluate treatment efficacy based on PD-L1 expression and gene mutation.<h4>Results</h4>At a median follow-up of 9.6 months, median overall survival was 10.1 months, and median progression-free survival was 4.0 months. Overall response rate was 40%, with 6/15 patients achieving partial response. Eight patients exhibited nine adverse events, eight out of nine being grade 2 and the remaining being grade 3. Whole-exome sequencing showed that <i>DYNC1I2, THSD7A</i>, and <i>FAT1</i> mutations were associated with patient prognosis.<h4>Conclusion</h4>Combination therapy involving tislelizumab plus nimotuzumab is a promising, low-toxicity treatment for recurrent or metastatic OSCC in patients with a PS score ≥ 2.

Also flagged:sepsisCD44CD163TIMP metallopeptidase inhibitor 1membranemitogen-activated protein kinase 14
Journal Article 2024-01-16 No Snippets Qi P, Huang MJ, Wu W, Ren XW, Zhai YZ, Qiu C, Zhu HY.
Show Full Abstract

<h4>Purpose</h4>Acute kidney injury (AKI) is one of the most common functional injuries observed in trauma patients. However, certain trauma medications may exacerbate renal injury. Therefore, the early detection of trauma-related AKI holds paramount importance in improving trauma prognosis.<h4>Methods</h4>Qualified datasets were selected from public databases, and common differentially expressed genes related to trauma-induced AKI and hub genes were identified through enrichment analysis and the establishment of protein-protein interaction (PPI) networks. Additionally, the specificity of these hub genes was investigated using the sepsis dataset and conducted a comprehensive literature review to assess their plausibility. The raw data from both datasets were downloaded using R software (version 4.2.1) and processed with the "affy" package19 for correction and normalization.<h4>Results</h4>Our analysis revealed 585 upregulated and 629 downregulated differentially expressed genes in the AKI dataset, along with 586 upregulated and 948 downregulated differentially expressed genes in the trauma dataset. Concurrently, the establishment of the PPI network and subsequent topological analysis highlighted key hub genes, including CD44, CD163, TIMP metallopeptidase inhibitor 1, cytochrome b-245 beta chain, versican, membrane spanning 4-domains A4A, mitogen-activated protein kinase 14, and early growth response 1. Notably, their receiver operating characteristic curves displayed areas exceeding 75%, indicating good diagnostic performance. Moreover, our findings postulated a unique molecular mechanism underlying trauma-related AKI.<h4>Conclusion</h4>This study presents an alternative strategy for the early diagnosis and treatment of trauma-related AKI, based on the identification of potential biomarkers and therapeutic targets. Additionally, this study provides theoretical references for elucidating the mechanisms of trauma-related AKI.

SLC2A14
Also flagged:Glucoseglucose transportersfacilitated glucose transportersGLUTssodium-glucose linked transportersco-transportation
Journal Article 2024-01-16 ✓ 1 Snippet Albaik M, Sheikh Saleh D, Kauther D, Mohammed H, Alfarra S, Alghamdi A, Ghaboura N, Sindi IA.
In-Text Gene Mentions

GLUT14 is a transporter for dehydroascorbic acid and glucose that is expressed by the SLC2A14 gene (Liu, 2022).

Show Full Abstract

Glucose is the major source of chemical energy for cell functions in living organisms. The aim of this mini-review is to provide a clearer and simpler picture of the fundamentals of glucose transporters as well as the relationship of these transporters to Alzheimer's disease. This study was conducted in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). Electronic databases (<i>PubMed</i> and <i>ScienceDirect</i>) were used to search for relevant studies mainly published during the period 2018-2023. This mini-review covers the two main types of glucose transporters, facilitated glucose transporters (GLUTs) and sodium-glucose linked transporters (SGLTs). The main difference between these two types is that the first type works through passive transport across the glucose concentration gradient. The second type works through active co-transportation to transport glucose against its chemical gradient. Fluctuation in glucose transporters translates into a disturbance of normal functioning, such as Alzheimer's disease, which may be caused by a significant downregulation of GLUTs most closely associated with insulin resistance in the brain. The first sign of Alzheimer's is a lack of GLUT4 translocation. The second sign is tau hyperphosphorylation, which is caused by GLUT1 and 3 being strongly upregulated. The current study focuses on the use of glucose transporters in treating diseases because of their proven therapeutic potential. Despite this, studies remain insufficient and inconclusive due to the complex and intertwined nature of glucose transport processes. This study recommends further understanding of the mechanisms related to these vectors for promising future therapies.

HFE
Also flagged:AlcoholHereditary hemochromatosisHHironliver damagealcohol use disorder
Journal Article 2024-01-16 ✓ 5 Snippets Sozen S, Shah A.
In-Text Gene Mentions

…mutation in theHFEgene.…

…Further testing forHFEgene mutations revealed…

…homeostatic iron regulator (HFE) gene on chromosome…

…the transmembrane glycoproteinHFEthat is responsible…

…In individuals withhemochromatosis, the HFE gene…

Show Full Abstract

Hereditary hemochromatosis (HH) is an autosomal recessive disorder characterized by excess iron absorption in the body following a mutation in the HFE gene. Though prolonged iron deposition has been shown to cause clinical symptoms such as hyperpigmentation, arthralgias, and liver damage, many individuals remain asymptomatic and exhibit no signs of iron overload. Here, we present a case where a 34-year-old with a history of severe alcohol use disorder presented with high iron, ferritin and transferrin saturation levels indicative of iron overload. Further testing for HFE gene mutations revealed simple heterozygote C282Y status, confirming the diagnosis of hereditary hemochromatosis. Simple heterozygotes, however, typically do not present with any symptoms of iron overload. This patient was counseled on lifestyle modifications which included abstaining from alcohol and reducing iron and vitamin C intake. As a result, his iron panel parameters improved. Thus, our case highlights that excessive alcohol consumption can exacerbate hereditary hemochromatosis and risk for overload even among heterozygotes.

ECI2
Also flagged:aldehydesestersvolatile organic compoundsbiosynthesischromosomesester
Journal Article 2024-01-16 ✓ 1 Snippet Mayobre C, Santo Domingo M, Özkan EN, Fernández-Borbolla A, Ruiz-Lasierra J, Garcia-Mas J, Pujol M.
In-Text Gene Mentions

…enoyl-CoA isomerase 2 (ECI2) genes was found…

Show Full Abstract

The importance of melon aroma in determining fruit quality has been highlighted in recent years. The fruit volatile profile is influenced by the type of fruit ripening. Non-climacteric fruits contain predominantly aldehydes, while climacteric fruits mainly produce esters. Several genes have been described to participate in volatile organic compounds (VOCs) biosynthesis pathways, but knowledge in this area is still incomplete. In this work we analysed the volatile profile of two reciprocal Introgression Line (IL) collections generated from a cross between 'Piel de Sapo' (PS) and 'Védrantais' (VED) melons, differing in their aroma profile and ripening behaviour. SPME GC-MS was performed to identify genes responsible for VOCs formation. More than 1000 QTLs for many volatiles were detected taken together both populations. Introgressions on chromosomes 3, 5, 6, 7 and 8 modified ester-aldehyde balance and were correlated to ripening changes in both genetic backgrounds. Some previously identified QTLs for fruit ripening might be involved in these phenotypes, such as <i>ETHQV8.1</i> on chromosome 8 and <i>ETHQV6.3</i> on chromosome 6. PS alleles on chromosomes 2, 6, 10 and 11 were found to increase ester content when introgressed in VED melons. Terpenes showed to be affected by several genomic regions not related to ripening. In addition, several candidate genes have been hypothesized to be responsible for some of the QTLs detected. The analysis of volatile compounds in two reciprocal IL collections has increased our understanding of the relationship between ripening and aroma and offers valuable plant material to improve food quality in melon breeding programs.

HTT
Also flagged:behavioral variant frontotemporal dementiamonoaminegene expressionlocalizationserotonin5-HT2a
Journal Article 2024-01-15 ✓ 3 Snippets Hahn L, Eickhoff SB, Mueller K, Schilbach L, Barthel H, Fassbender K, Fliessbach K, Kornhuber J, Prudlo J, Synofzik M, Wiltfang J, Diehl-Schmid J, FTLD Consortium, Otto M, Dukart J, Schroeter ML.
In-Text Gene Mentions

More specifically, we wanted to test if the spatial structure of fALFF maps in patients relative to HC is similar to the distribution of nuclear imaging derived neurotransmitter maps from independent healthy volunteer populations included in the toolbox (5-HT1a receptor [Savli et al., 2012], 5-HT1b receptor [Savli et al., 2012], 5-HT2a receptor [Savli et al., 2012], serotonin transporter [5-HTT; Savli et al., 2012], D1 receptor [Kaller et al., 2017], D2 receptor [Sandiego et al., 2015], dopamine transporter [DAT; Dukart et al., 2018], Fluorodopa [FDOPA; García Gómez et al., 2018], γ-aminobutyric acid type A [GABAa] receptors [Dukart et al., 2018; Myers et al., 2012], μ-opioid [MU] receptors [Aghourian et al., 2017], and norepinephrine transporter [NET; Hesse et al., 2017]).

…], serotonin transporter [5-HTT; Savli et al.,…

…with availability of5-HTTand directionally negate…

Show Full Abstract

<h4>Background</h4>Aside to clinical changes, behavioral variant frontotemporal dementia (bvFTD) is characterized by progressive structural and functional alterations in frontal and temporal regions. We examined if there is a selective vulnerability of specific neurotransmitter systems in bvFTD by evaluating the link between disease-related functional alterations and the spatial distribution of specific neurotransmitter systems and their underlying gene expression levels.<h4>Methods</h4>Maps of fractional amplitude of low-frequency fluctuations (fALFF) were derived as a measure of local activity from resting-state functional magnetic resonance imaging for 52 bvFTD patients (mean age = 61.5 ± 10.0 years; 14 females) and 22 healthy controls (HC) (mean age = 63.6 ± 11.9 years; 13 females). We tested if alterations of fALFF in patients co-localize with the non-pathological distribution of specific neurotransmitter systems and their coding mRNA gene expression. Furthermore, we evaluated if the strength of co-localization is associated with the observed clinical symptoms.<h4>Results</h4>Patients displayed significantly reduced fALFF in frontotemporal and frontoparietal regions. These alterations co-localized with the distribution of serotonin (5-HT1b and 5-HT2a) and γ-aminobutyric acid type A (GABAa) receptors, the norepinephrine transporter (NET), and their encoding mRNA gene expression. The strength of co-localization with NET was associated with cognitive symptoms and disease severity of bvFTD.<h4>Conclusions</h4>Local brain functional activity reductions in bvFTD followed the distribution of specific neurotransmitter systems indicating a selective vulnerability. These findings provide novel insight into the disease mechanisms underlying functional alterations. Our data-driven method opens the road to generate new hypotheses for pharmacological interventions in neurodegenerative diseases even beyond bvFTD.<h4>Funding</h4>This study has been supported by the German Consortium for Frontotemporal Lobar Degeneration, funded by the German Federal Ministry of Education and Research (BMBF; grant no. FKZ01GI1007A).

SERPINC1
Also flagged:PROCVenous thromboembolismvenous thrombosisHereditary thrombosisthrombophilianucleotide
Journal Article 2024-01-15 ✓ 5 Snippets Li X, Zhu J, Lv F, Ma W, Zhou W, Zhang W.
In-Text Gene Mentions

Digenic Inheritance of PROC and SERPINC1 Mutations Contributes to Multiple Sites Venous Thrombosis.

…of PROC andSERPINC1Mutations Contributes to…

…(p.W339X) in theSERPINC1gene.…

…G20210A, antithrombin III (ATIII), protein C, and…

…mutations in theSERPINC1and PROC gene.…

Show Full Abstract

Venous thromboembolism (VTE) represents a worldwide health challenge, impacting millions of people each year. The genesis of venous thrombosis is influenced in part by genetic components. Hereditary thrombosis is described as a genetically determined susceptibility to VTE. In the present study, a male patient was referred to our department presenting with multiple venous thrombosis events in different locations. Given a lack of identifiable risk factors, we aimed to investigate the possible genetic factor underlying venous thrombosis. Whole-exome sequencing was employed to examine genes linked to inherited thrombophilia in the proband. Putative variants were subsequently confirmed through Sanger sequencing within the family. The proband was identified as carrying two genetic mutations. One is the novel c.400G > C (p.E134Q) mutation affecting the final nucleotide of exon 5 in the PROC gene, potentially impacting splicing. The other is a previously reported heterozygous nonsense variant c.1016G > A (p.W339X) in the SERPINC1 gene. The proband inherited the former from her mother and the latter from her father. The presence of digenic inheritance in the patient reflects the complex phenotype of venous thrombosis and demonstrates the significance of an unbiased approach to detect pathogenic variants, especially in patients with a high risk of hereditary thrombosis.

Also flagged:dopamineserotoninbradycardiapsychiatric disordersneurotransmitterserotonin transporter
Journal Article 2024-01-15 No Snippets Battaglia S, Nazzi C, Thayer JF.
Show Full Abstract

Fear-induced bradycardia, a transient heartbeat deceleration following exposure to threat, is a physiological index observable in humans, especially in fear conditioning experiments. While gaining interest in recent years, it is still currently underemployed in neuroscientific research compared to more popular physiological indices. Besides its use in research, it could also constitute a valuable resource in a clinical psychiatry setting, as many disorders are also characterized by altered heart rate responses. However, differences in fear-induced bradycardia may also be subtended by genetic interindividual differences, thus suggesting precaution when recommending its use in the clinical setting. Here, we discussed the first endeavors that aimed at clarifying the genetic underpinnings of heart rate variations, which suggest that individual genetic differences have a role in defining the characteristics of heart rate responses. Given this, translating heart rate measurements in the clinical setting must be implemented with caution. Future endeavors in this field will aim at identifying these differences even further, thus allowing for more precise clinical interventions.

HMGN4
Also flagged:tumorOsteosarcomacold tumorcancerSFMBT2SP140
Journal Article 2024-01-15 ✓ 1 Snippet Yu B, Geng C, Wu Z, Zhang Z, Zhang A, Yang Z, Huang J, Xiong Y, Yang H, Chen Z.
In-Text Gene Mentions

…genes (HMGN1, HMGN3,HMGN4) (Fig. 2 D).…

Show Full Abstract

Osteosarcoma is generally considered a cold tumor and is characterized by epigenetic alterations. Although tumor cells are surrounded by many immune cells such as macrophages, T cells may be suppressed, be inactivated, or not be presented due to various mechanisms, which usually results in poor prognosis and insensitivity to immunotherapy. Immunotherapy is considered a promising anti-cancer therapy in osteosarcoma but requires more research, but osteosarcoma does not currently respond well to this therapy. The cancer immunity cycle (CIC) is essential for anti-tumor immunity, and is epigenetically regulated. Therefore, it is possible to modulate the immune microenvironment of osteosarcoma by targeting epigenetic factors. In this study, we explored the correlation between epigenetic modulation and CIC in osteosarcoma through bioinformatic methods. Based on the RNA data from TARGET and GSE21257 cohorts, we identified epigenetic related subtypes by NMF clustering and constructed a clinical prognostic model by the LASSO algorithm. ESTIMATE, Cibersort, and xCell algorithms were applied to analyze the tumor microenvironment. Based on eight epigenetic biomarkers (SFMBT2, SP140, CBX5, HMGN2, SMARCA4, PSIP1, ACTR6, and CHD2), two subtypes were identified, and they are mainly distinguished by immune response and cell cycle regulation. After excluding ACTR6 by LASSO regression, the prognostic model was established and it exhibited good predictive efficacy. The risk score showed a strong correlation with the tumor microenvironment, drug sensitivity and many immune checkpoints. In summary, our study sheds a new light on the CIC-related epigenetic modulation mechanism of osteosarcoma and helps search for potential drugs for osteosarcoma treatment.

SOX6
Also flagged:brainvesiclebrain developmentShhpurmorphaminePAX6
Journal Article 2024-01-15 ✓ 4 Snippets Pavon N, Diep K, Yang F, Sebastian R, Martinez-Martin B, Ranjan R, Sun Y, Pak C.
In-Text Gene Mentions

…BCL11B + andSOX6+ ( Figures…

…56 Moreover, whileSOX6is strongly expressed…

…+ ) lacksSOX6expression and is…

…NKX2.1, LHX6, andSOX6( Figure 3…

Show Full Abstract

In early neurodevelopment, the central nervous system is established through the coordination of various neural organizers directing tissue patterning and cell differentiation. Better recapitulation of morphogen gradient production and signaling will be crucial for establishing improved developmental models of the brain in vitro. Here, we developed a method by assembling polydimethylsiloxane devices capable of generating a sustained chemical gradient to produce patterned brain organoids, which we termed morphogen-gradient-induced brain organoids (MIBOs). At 3.5 weeks, MIBOs replicated dorsal-ventral patterning observed in the ganglionic eminences (GE). Analysis of mature MIBOs through single-cell RNA sequencing revealed distinct dorsal GE-derived CALB2<sup>+</sup> interneurons, medium spiny neurons, and medial GE-derived cell types. Finally, we demonstrate long-term culturing capabilities with MIBOs maintaining stable neural activity in cultures grown up to 5.5 months. MIBOs demonstrate a versatile approach for generating spatially patterned brain organoids for embryonic development and disease modeling.

Also flagged:Left Atrial Septal Pouchcryptogenic strokecryptogenic strokesLASP
Journal Article 2024-01-15 No Snippets Amin A, Augustine M, Shafique MA, Mustafa MS, Mian ZR, Jaimes DCC, Gaudani A, Shaukat B, Kumar S, Aulakh SS, Jami E, Sharifa M, Ahuja K, Maslamani ANJ, Bhudia S.
Show Full Abstract

<h4>Background</h4>The left atrial septal pouch (LASP) is a small anatomical septal recess in the heart that has been linked with cardioembolic events. A systematic appraisal of the existing literature is necessary to establish a better understanding of the risk as studies continue to indicate a correlation between LASPs and cryptogenic strokes.<h4>Objectives</h4>To determine the level of association between the presence of LASP and the risk of developing cryptogenic stroke.<h4>Methods</h4>We searched PubMed, EMBASE and Scopus for studies comparing the prevalence of LASP in patients with cryptogenic stroke against non-cryptogenic stroke control groups from inception till December, 2023. The Newcastle Ottawa scale was used for quality assessment and Comprehensive Meta-Analysis Version 3.3 was used for data analysis with odds ratio (OR) as the effect measure.<h4>Results</h4>Our review included a total of 10 retrospective, observational studies published between 2010 to 2022. A total of 683 cases of cryptogenic strokes were identified, out of which 33.1 % (n = 271) were associated with a LASP. Among the non-cryptogenic stroke controls (n = 2641), LASP was present in 20.6 % cases (n = 476). The aggregate OR for cryptogenic stroke was 1.618 times greater than non-cryptogenic stroke (p < 0.001) among LASP cases, CONCLUSION: The presence of a septal pouch in the left atrium is significantly linked to a higher risk of developing cryptogenic strokes. As a potential site of thrombus formation and subsequent dislodgement, further large-scale studies are necessary to establish the guidelines for management and prophylaxis to prevent embolic events.

Also flagged:agingthyroid diseasesCancerThyroid Follicular Nodular DiseasetumorAnaplastic Thyroid Carcinoma
Journal Article 2024-01-15 No Snippets Kahraman Çetin N, Taşan SC.
Show Full Abstract

Nowadays, the aging human population exerts a notable influence on the treatment of thyroid diseases. The most appropriate approach for the treatment of benign and malignant thyroid diseases in older adults has not yet been determined. The aim of our study is to evaluate the effect of thyroidectomies in geriatric patients considering age, sex and histopathological parameters and to determine the importance of thyroidectomy as a treatment option in the geriatric population. A total of 910 cases from all age groups were included, for which thyroidectomies were examined and reported. In accordance with the College of American Pathologists Cancer Protocol for thyroid reporting, considering geriatric patients, the rate of Thyroid Follicular Nodular Disease was significantly higher among the tumor types in the benign tumor group (<i>p</i> = 0.033), while Anaplastic Thyroid Carcinoma rate was higher in the malignant tumor group. The diagnosis rate of malignant tumors was higher in males, reflecting a more advanced pT stage (<i>p</i> < 0.001), larger tumor size (<i>p</i> < 0.001) and increased lymph node involvement rate (<i>p</i> = 0.039). Given that increasing age is associated with a heightened incidence of thyroid disease, the safety of surgery for geriatric patients is an important issue. Thyroidectomy should be considered in the treatment of these patients, especially in males, as the rate of malignant diagnosis and worse histopathological parameters are seen with increasing age.

HFE
Also flagged:IronAcute Lymphoblastic andoncological diseaseacute myeloblastic leukemiaALLAML
Journal Article 2024-01-15 ✓ 1 Snippet Sawicka-Zukowska M, Kretowska-Grunwald A, Kania A, Topczewska M, Niewinski H, Bany M, Grubczak K, Krawczuk-Rybak M.
In-Text Gene Mentions

…this phenomenon, includingHFEgene mutations, should…

Show Full Abstract

Transfusions of packed red blood cells (PRBCs), given due to an oncological disease and its acute complications, are an indispensable part of anticancer therapy. However, they can lead to post-transfusion iron overload. The study aim was to evaluate the role of ferritin as a nonspecific marker of leukemic growth and marker of transfusion-related iron overload. We performed a longitudinal study of PRBC transfusions and changes in ferritin concentrations during the oncological treatment of 135 patients with childhood acute lymphoblastic and acute myeloblastic leukemia (ALL and AML, median age 5.62 years). At the diagnosis, 41% of patients had a ferritin level over 500 ng/mL, and 14% of patients had a ferritin level over 1000 ng/mL. At the cessation of the treatment, 80% of the children had serum ferritin (SF) over 500 ng/mL, and 31% had SF over 1000 ng/mL. There was no significant difference between SF at the beginning of the treatment between ALL and AML patients, but children with AML finished treatment with statistically higher SF. AML patients had also statistically higher number of transfusions. We found statistically significant positive correlations between ferritin and age, and weight and units of transfused blood. Serum ferritin at the moment of diagnosis can be a useful marker of leukemic growth, but high levels of SF are connected with iron overload in both AML and ALL.

DCC
Also flagged:AndrogenCastration-ResistantProstate CancerPCacastration-resistant PCaCRPC
Journal Article 2024-01-15 ✓ 2 Snippets Yu J, Lim JE, Song W.
In-Text Gene Mentions

…in FBS orDCC-FBS medium in 6-well…

…Finally, usingDCC-stripped serum complicates ou…

Show Full Abstract

Androgen deprivation therapy (ADT) is a primary treatment for advanced prostate cancer (PCa), but resistance often leads to castration-resistant PCa (CRPC). CRPC remains androgen receptor (AR)-dependent, and AR overexpression causes vulnerability to high doses of androgen in CRPC. Bipolar androgen therapy (BAT) refers to the periodic administration of testosterone, resulting in oscillation between supraphysiologic and near-castrate serum testosterone levels. In this study, we evaluated the efficacy of BAT against CRPC in a preclinical setting. To emulate CRPC characteristics, PCa cell lines (LNCaP, VCaP, and 22Rv1) were cultured in phenol red-free RPMI-1640 medium supplemented with 10% dextran-coated charcoal treated FBS (A- cell line). Cell viability, AR, and AR-V7 expression were evaluated using the Cell Counting Kit-8 and Western blotting. In vivo studies involved 12 castrated NOG mice injected with LNCaP/A- cells, treated with testosterone pellets or controls in 2-week cycles. Tumor sizes were measured post a 6-week treatment cycle. Bicalutamide inhibited PCa cell viability but not in the adapted cell lines. Supraphysiologic androgen levels suppressed AR-expressing PCa cell growth in vitro. In vivo, high AR-expressing LNCaP cells proliferated under castrate conditions, while BAT-treated xenografts exhibited significant growth inhibition with low Ki-67 and mitotic indexes and a high cell death index. This study provides preliminary evidence that BAT is effective for the treatment of CRPC through rapid cycling between supraphysiologic and near-castrate serum testosterone levels, inducing an anti-tumor effect.

HTT
Also flagged:CannabinerolCytoskeletonCannabinoidsneurological disordersphytocannabinoidssynaptic transmission
Journal Article 2024-01-15 ✓ 4 Snippets Artimagnella O, Mazzon E, Salamone S, Pollastro F, Gugliandolo A, Chiricosta L.
In-Text Gene Mentions

…, Dgkz ,Htt) were also…

…, Grin1 ,Htt, Kcnc1 ,…

…encoded by theHttgene, is also…

…Presynaptically,Httpositively regulates endocytos…

Show Full Abstract

Cannabinoids are receiving great attention as a novel approach in the treatment of cognitive and motor disabilities, which characterize neurological disorders. To date, over 100 phytocannabinoids have been extracted from <i>Cannabis sativa</i>, and some of them have shown neuroprotective properties and the capacity to influence synaptic transmission. In this study, we investigated the effects of a less-known phytocannabinoid, cannabinerol (CBNR), on neuronal physiology. Using the NSC-34 motor-neuron-like cell line and next-generation sequencing analysis, we discovered that CBNR influences synaptic genes associated with synapse organization and specialization, including genes related to the cytoskeleton and ion channels. Specifically, the calcium, sodium, and potassium channel subunits (<i>Cacna1b</i>, <i>Cacna1c</i>, <i>Cacnb1</i>, <i>Grin1</i>, <i>Scn8a</i>, <i>Kcnc1</i>, <i>Kcnj9</i>) were upregulated, along with genes related to NMDAR (<i>Agap3</i>, <i>Syngap1</i>) and calcium (<i>Cabp1</i>, <i>Camkv</i>) signaling. Moreover, cytoskeletal and cytoskeleton-associated genes (<i>Actn2</i>, <i>Ina</i>, <i>Trio</i>, <i>Marcks</i>, <i>Bsn</i>, <i>Rtn4</i>, <i>Dgkz</i>, <i>Htt</i>) were also regulated by CBNR. These findings highlight the important role played by CBNR in the regulation of synaptogenesis and synaptic transmission, suggesting the need for further studies to evaluate the neuroprotective role of CBNR in the treatment of synaptic dysfunctions that characterize motor disabilities in many neurological disorders.

Also flagged:Colon CancerPrimaryCCtransmembrane proteinscancertumor
Journal Article 2024-01-15 No Snippets Suwatthanarak T, Thanormjit K, Suwatthanarak T, Acharayothin O, Methasate A, Chinswangwatanakul V, Tanjak P.
Show Full Abstract

Stage 4 colon cancer (CC) presents a significant global health challenge due to its poor prognosis and limited treatment options. Tetraspanins, the transmembrane proteins involved in crucial cancer processes, have recently gained attention as diagnostic markers and therapeutic targets. However, their spatial expression and potential roles in stage 4 CC tissues remain unknown. Using the GeoMx digital spatial profiler, we profiled all 33 human tetraspanin genes in 48 areas within stage 4 CC tissues, segmented into immune, fibroblast, and tumor compartments. Our results unveiled diverse gene expression patterns across different primary tumor sub-regions. CD53 exhibited distinct overexpression in the immune compartment, hinting at a potential role in immune modulation. TSPAN9 was specifically overexpressed in the fibroblast compartment, suggesting involvement in tumor invasion and metastasis. CD9, CD151, TSPAN1, TSPAN3, TSPAN8, and TSPAN13 displayed specific overexpression in the tumor compartment, indicating potential roles in tumor growth. Furthermore, our differential analysis revealed significant spatial changes in tetraspanin expression between patient-matched stage 4 primary CC and metastatic liver tissues. These findings provide spatially resolved insights into the expression and potential roles of tetraspanins in stage 4 CC progression, proposing their utility as diagnostic markers and therapeutic targets. Understanding this landscape is beneficial for tailoring therapeutic strategies to specific sub-tumor regions in the context of stage 4 CC and liver metastasis.

PEBP1
Also flagged:Psoriasisatopic dermatitiscutaneousimmune-mediated inflammatory diseasesmycosis fungoidesβ-defensin 2
Journal Article 2024-01-15 ✓ 1 Snippet Rusiñol L, Puig L.
In-Text Gene Mentions

Other genes that are related to ferroptosis and regulate the immune microenvironment in psoriasis are PEBP1, PRKAA2, and ACSF2 [138].

Show Full Abstract

Psoriasis and atopic dermatitis fall within the category of cutaneous immune-mediated inflammatory diseases (IMIDs). The prevalence of IMIDs is increasing in industrialized societies, influenced by both environmental changes and a genetic predisposition. However, the exact immune factors driving these chronic, progressive diseases are not fully understood. By using multi-omics techniques in cutaneous IMIDs, it is expected to advance the understanding of skin biology, uncover the underlying mechanisms of skin conditions, and potentially devise precise and personalized approaches to diagnosis and treatment. We provide a narrative review of the current knowledge in genomics, epigenomics, and proteomics of atopic dermatitis and psoriasis. A literature search was performed for articles published until 30 November 2023. Although there is still much to uncover, recent evidence has already provided valuable insights, such as proteomic profiles that permit differentiating psoriasis from mycosis fungoides and β-defensin 2 correlation to PASI and its drop due to secukinumab first injection, among others.

Also flagged:SynthesisartemisinintumorMMP-9dihydroartemisininsesquiterpene
Journal Article 2024-01-15 No Snippets Zhong H, Jiang Q, Wu C, Yu H, Li B, Zhou X, Fu R, Wang W, Sheng W.
Show Full Abstract

Five artemisinin bivalent ligands molecules <b>4a</b>-<b>4e</b> were designed, synthesized, and confirmed by <sup>1</sup>H NMR, <sup>13</sup>C NMR, and low-resolution mass spectrometry, and the bioactivities of the target compounds were investigated against four human tumor cell lines in vitro, including BGC-823, HepG-2, MCF-7, and HCT-116. The results showed <b>4a</b>, <b>4d,</b> and <b>4e</b> exhibited significantly tumor cell inhibitory activity compared with the artemisinin and dihydroartemisinin; compound <b>4e</b> has good biological activity inhibiting BGC-823 with an IC<sub>50</sub> value of 8.30 μmol/L. Then, the good correlations with biological results were validated by molecular docking through the established bivalent ligands multi-target model, which showed that <b>4e</b> could bind well with the antitumor protein MMP-9.

Also flagged:cariesTrans-cinnamaldehydehydroxyapatiteCinnamaldehydedimethylDental caries
Journal Article 2024-01-15 No Snippets Ngokwe ZB, Wolfoviz-Zilberman A, Sharon E, Zabrovsky A, Beyth N, Houri-Haddad Y, Kesler-Shvero D.
Show Full Abstract

<i>Streptococcus mutans</i> (<i>S. mutans</i>) is the main cariogenic bacterium with acidophilic properties, in part due to its acid-producing and -resistant properties. As a result of this activity, hard tooth structures may demineralize and form caries. Trans-cinnamaldehyde (TC) is a phytochemical from the cinnamon plant that has established antibacterial properties for Gram-positive and -negative bacteria. This research sought to assess the antibacterial and antibiofilm effects of trans-cinnamaldehyde on <i>S. mutans</i>. TC was diluted to a concentration range of 156.25-5000 μg/mL in dimethyl sulfoxide (DMSO) 0.03-1%, an organic solvent. Antibacterial activity was monitored by testing the range of TC concentrations on 24 h planktonic growth compared with untreated <i>S. mutans</i>. The subminimal bactericidal concentrations (MBCs) were used to evaluate the bacterial distribution and morphology in the biofilms. Our in vitro data established a TC MBC of 2500 μg/mL against planktonic <i>S. mutans</i> using a microplate spectrophotometer. Furthermore, the DMSO-only controls showed no antibacterial effect against planktonic <i>S. mutans</i>. Next, the sub-MBC doses exhibited antibiofilm action at TC doses of ≥625 μg/mL on hydroxyapatite discs, as demonstrated through biofilm analysis using spinning-disk confocal microscopy (SDCM) and high-resolution scanning electron microscopy (HR-SEM). Our findings show that TC possesses potent antibacterial and antibiofilm properties against <i>S. mutans</i>. Our data insinuate that the most effective sub-MBC of TC to bestow these activities is 625 μg/mL.

HFE
Also flagged:anorexiaPrussian BlueironsynthesisoxygenIron overload diseases
Journal Article 2024-01-15 ✓ 5 Snippets Choi M, Lee N.
In-Text Gene Mentions

…imaging features ofhemochromatosisin a dog.…

…imaging diagnosis ofhemochromatosisin a dog.…

…imaging features ofhemochromatosisin a dog…

…referred to ashemochromatosis( 2 ).…

…Secondaryhemochromatosisincludes increased iron…

Show Full Abstract

A castrated male mixed-breed dog weighing 7 kg presented with elevated liver enzymes and anorexia. Abdominal radiography revealed hepatomegaly with heterogeneous hepatic opacification, and abdominal ultrasonography showed a fine echotexture and heterogeneous parenchyma concurrent with a suspected acquired portosystemic shunt. Pre-contrast computed tomography (CT) showed marked hepatomegaly with homogeneous increased liver density and multiple enlarged abdominal lymph nodes with markedly increased parenchymal density. Histopathology of the hepatic and lymph node biopsy revealed accumulated abundant hemosiderin, and the Prussian Blue stain confirmed marked iron accumulation within the hepatocytes. Based on our review of the literature, this is the first case report describing the imaging diagnosis of hemochromatosis in a dog.

HFE
Also flagged:ozonediabetic foot ulcerstype 2 diabetesC-reactive proteinCRPvascular endothelial growth factor
Journal Article 2024-01-15 ✓ 1 Snippet Sun H, Heng H, Liu X, Geng H, Liang J.
In-Text Gene Mentions

…Seizure condition; (7)Hemochromatosis; (8)Patients undergoing coppe…

Show Full Abstract

<h4>Background</h4>The availability of research on short-term ozone therapy for diabetic foot ulcers (DFUs) is limited, and even when it is accessible, it mainly comprises of basic analysis conducted during long-term ozone therapy. This study was to evaluate the efficacy of short-term ozone therapy in promoting wound healing in DFUs.<h4>Methods</h4>A retrospective analysis was conducted on 89 patients with type 2 diabetes complicated by DFUs. The patients were divided into two groups: ozone therapy group (n=41) and control group (n=48). Wound condition, change of bacterial types, changes in inflammatory indicators (erythrocyte sedimentation rate [ESR], C-reactive protein [CRP], and procalcitonin [PCT]), vascular endothelial growth factor (VEGF), cytokines [Interleukin 6 (IL-6) and tumor necrosis factor-α(TNF-α)], and oxidative stress levels (superoxide dismutase [SOD], malondialdehyde [MDA], and total antioxidant capacity [T-AOC]) were observed pre-treatment and after 1 week. After a 12-week of follow-up, wound healing rate, amputation rate, inpatient day, duration of antibiotics, reinfection rate, incidence of new ulcers, readmission rate, and reoperation rate, and cumulative wound healing rate using Kaplan-Meier curves were assessed.<h4>Results</h4>After 1 week of treatment, the ozone therapy group showed higher VEGF, SOD, and T-AOC levels compared to the control group (<i>P</i><0.05), while CRP, PCT, ESR, IL-6, TNF-α, MDA levels and bacterial types were lower (<i>P</i><0.05). The ozone therapy group had a higher wound healing rate after a 12-week follow-up (<i>P</i><0.05). Kaplan-Meier curves indicated a higher cumulative wound healing rate in the ozone therapy group (<i>P</i><0.05). Additionally, the ozone therapy group had lower inpatient day, duration of antibiotics, reinfection rate, and readmission rate compared to the control group (<i>P</i><0.05).<h4>Conclusion</h4>Short-term ozone therapy is effective in promoting wound healing in DFUs by reducing inflammation, increasing growth factor levels, improving oxidative stress status, shortening healing time, and improving long-term prognosis. These findings suggest the potential of short-term ozone therapy as a valuable treatment modality for DFUs.

Also flagged:ceramidenon-small cell lung cancerNSCLClung cancercancersphingolipid
Journal Article 2024-01-15 No Snippets Dai L, Goyal N, Liu J, Foroozesh M, Qin Z.
Show Full Abstract

Non-small cell lung cancer (NSCLC) constitutes the predominant form of lung cancer and stands as the leading cause of cancer-related mortality in the United States. Conventional chemotherapy and radiotherapy yield suboptimal responses in a significant portion of lung cancer patients, resulting in a discouraging 5-year survival rate of approximately 15%. Despite advancements in targeted therapy and immunotherapy, many NSCLC patients exhibit either negligible or partial responses, emphasizing the pressing necessity for the discovery of innovative anti-cancer agents. Our previous study demonstrated that ABC294640, an inhibitor of one of the key enzymes in sphingolipid metabolism, sphingosine kinase 2 (SphK2), displayed anti-NSCLC activities <i>in vitro</i> and <i>in vivo</i>. In the current study, through the screening of a series of newly synthesized ceramide analogs, we have identified new compounds, particularly analogs 403 and 953, that exhibit potent anti-NSCLC activities. These compounds induce significant NSCLC apoptosis by elevating intracellular pre-apoptotic ceramide and dihydro(dh)-ceramide production. Lipidomics analyses further elucidate the alterations in ceramide and dh-ceramide species signature/proportion across different NSCLC cell-lines induced by these novel ceramide analogs. Treatments with ceramide analogs 403 and 953 remarkably inhibit NSCLC progression <i>in vivo</i> without observable toxicity. Collectively, these findings establish a foundation for the development of promising sphingolipid-based therapies aimed at enhancing the prognosis of NSCLC.

HFE
Also flagged:β-ThalassemiaThalassemiarecessive disorderHbsynthesisglobin
Journal Article 2024-01-15 ✓ 1 Snippet Hussain A, Singh A, Arora S, Gupta V, Mallimala PR.
In-Text Gene Mentions

…iron regulator protein (HFE)-associated hereditary hemoch…

Show Full Abstract

Thalassemia is a hereditary autosomal recessive disorder that is distinguished by a diminished rate of hemoglobin (Hb) synthesis arising from an anomaly in the synthesis of α or β globin chains. Classical symptoms of β-thalassemia are frequently observed in patients who present late for blood transfusion (BT), which is typical among South Asian countries in light of their limited resources. This case report is an uncommon instance of a typical occurrence that has been infrequently reported in the South Asian region. The reporting of this case will assist healthcare workers in managing cases appropriately. We present a 12-year-old female child diagnosed with β-thalassemia major with a late presentation than usual accompanied by an unusual finding of left hemiparesis at a young age of five years. The patient had been lost to follow-up, presented with easy fatiguability, poor weight gain, and growth restriction, all of which are classic symptoms of β-thalassemia. The patient was treated with a BT and continued to be monitored for transfusion and iron overload management.

Also flagged:tumorcancerGene Expressionmitochondrialchemotaxis-
Journal Article 2024-01-14 No Snippets Liao Y, Rao Z, Huang S, Zhao D.
Show Full Abstract

Immunotherapy is a promising strategy to treat cancer. Here, we present a protocol for analyzing the transcriptome-based phenotypic alterations and immune cell infiltration in the tumor microenvironment. We describe steps for integrating single-cell RNA sequencing (scRNA-seq) data, comparing phenotypes and origins of mononuclear phagocytes, inferring the differentiation trajectory and infiltration process, and identifying infiltration-associated genes using machine learning. We then detail procedures for exploring the impact of these genes in prognosis through the integrated microarray and bulk RNA-seq data to obtain potential drug targets. For complete details on the use and execution of this protocol, please refer to Liao et al.<sup>1</sup>.

HFE
Also flagged:Liver FibrosisMetabolic dysfunction-associated fatty liver diseaseMetabolic Dysfunction-Fatty Liver Diseasenutritional disordersabdominal obesity
Journal Article 2024-01-14 ✓ 1 Snippet Stefanska A, Bergmann K, Suwała S, Mankowska-Cyl A, Kozinski M, Junik R, Krintus M, Panteghini M.
In-Text Gene Mentions

…injury, Wilson’s disease,hemochromatosis, history or active…

Show Full Abstract

Metabolic dysfunction-associated fatty liver disease (MAFLD) may progress to advanced liver fibrosis (ALF). We evaluated the diagnostic accuracy of a novel Liver Fibrosis Risk Index (LFRI) in MAFLD subjects using transient elastography (TE) as the reference method for liver fibrosis measurement and then the diagnostic performance of a new two-step non-invasive algorithm for the detection of ALF risk in MAFLD, using Fibrosis-4 (FIB-4) followed by LFRI and comparing it to the reference algorithm based on FIB-4 and TE. We conducted a prospective study on 104 MAFLD European adult subjects. All consenting subjects underwent TE and measurements of FIB-4 and LFRI. For FIB-4 and TE, validated cut-offs were used. An ROC analysis showed that LFRI diagnosed severe fibrosis with moderate accuracy in MAFLD subjects with a negative predictive value above 90%. Using the new algorithm with LFRI thresholds recommended by the manufacturer, the number of subjects classified into ALF risk groups (low, intermediate, or high) differed significantly when compared with the reference algorithm (<i>p</i> = 0.001), with moderate agreement between them (weighted kappa (95% CI) = 0.59 (0.41-0.77)). To improve the performance of the LFRI-based algorithm, we modified cut-off points based on ROC curves obtained by dividing the study population according to the reference algorithm and observed no difference between algorithms (<i>p</i> = 0.054) in categorizing ALF risk, with a slight increase in the total agreement (weighted kappa (95% CI) = 0.63 (0.44-0.82)). Our findings suggest that using the novel LFRI as a second-line test may represent a potential alternative for liver fibrosis risk stratification in MAFLD patients; however, modified cut-offs are needed to optimize its performance.

PRDX6
Also flagged:Peroxiredoxin-1chaperoneglutathione S-transferase P1Ovarian cancergynecological malignanciesPRDX1
Journal Article 2024-01-14 ✓ 2 Snippets Fan C, Yuan S, Zhang Y, Nie Y, Xiang L, Luo T, Xi Q, Zhang Y, Gu Z, Wang P, Zhou H.
In-Text Gene Mentions

…peroxiredoxins (PRDX1 toPRDX6) localized inside intracellul…

PRDX6: Forward GACTCATGGGGCATTCTCTT…

Show Full Abstract

Ovarian cancer is among the most prevalent gynecological malignancies around the globe. Nonetheless, chemoresistance continues to be one of the greatest obstacles in the treatment of ovarian cancer. Therefore, understanding the mechanisms of chemoresistance and identifying new treatment options for ovarian cancer patients is urgently required. In this study, we found that the mRNA and protein expression levels of PRDX1 were significantly increased in cisplatin resistant A2780/CDDP cells. Cell survival assays revealed that PRDX1 depletion substantially increased ovarian cancer cell sensitivity to cisplatin, docetaxel, and doxorubicin. Additionally, PRDX1 significantly increased GSTP1 activity, resulting in multidrug resistance. Biochemical experiments showed that PRDX1 interacted with GSTP1 through Cysteine 83, which regulated GSTP1 activity as well as chemotherapy resistance in ovarian cancer cells. Our findings indicate that the molecular chaperone activity of PRDX1 is a promising new therapeutic target for ovarian cancer.

Also flagged:agingautophagymitochondrialmetabolismage-related diseasesAlzheimer's disease
Journal Article 2024-01-14 No Snippets Zhao J, Han Z, Ding L, Wang P, He X, Lin L.
Show Full Abstract

Aging is a complex and inevitable biological process affected by a combination of external environmental and genetic factors. Humans are currently living longer than ever before, accompanied with aging-related alterations such as diminished autophagy, decreased immunological function, mitochondrial malfunction, stem cell failure, accumulation of somatic and mitochondrial DNA mutations, loss of telomere, and altered nutrient metabolism. Aging leads to a decline in body functions and age-related diseases, for example, Alzheimer's disease, which adversely affects human health and longevity. The quality of life of the elderly is greatly diminished by the increase in their life expectancy rather than healthy life expectancy. With the rise in the age of the global population, aging and related diseases have become the focus of attention worldwide. In this review, we discuss several major mechanisms of aging, including DNA damage and repair, free radical oxidation, telomeres and telomerase, mitochondrial damage, inflammation, and their role in neurodegenerative diseases to provide a reference for the prevention of aging and its related diseases.

bioRxiv 2024-01-14 Preprint (No Snippets API) Petazzi P, Ventura T, Luongo FP, McClafferty H, May A, Taylor HA, Shipston MJ, Romanò N, Forrester LM, Menéndez P, Fidanza A.
Show Full Abstract

A major challenge in the stem cell biology field is the ability to produce fully functional cells from induced pluripotent stem cells (iPSCs) that are a valuable resource for cell therapy, drug screening and disease modelling. Here we developed a novel inducible CRISPR-mediated activation strategy (iCRISPRa) to drive the expression of multiple endogenous transcription factors important for in vitro cell fate and differentiation of iPSCs to haematopoietic progenitor cells. This work has identified a key role for IGFBP2 in the development of hematopoietic progenitors. We first identified nine candidate transcription factors that we predicted to be involved in blood cell emergence during development, then generated tagged gRNAs directed to the transcriptional start site of these transcription factors that could also be detected during scRNAseq. iCRISPRa activation of these endogenous transcription factors resulted in a significant expansion of arterial-fated endothelial cells expressing high levels of IGFBP2 and our analysis indicated that IGFBP2 is involved in the remodeling of metabolic activity during in vitro endothelial to hematopoietic transition. As well as providing fundamental new insights into the mechanisms of haematopoietic cell fate and differentiation, the broader applicability of iCRISPRa provides a valuable tool for studying dynamic processes controlling developmental events and for recapitulating abnormal phenotypes characterised by ectopic activation of specific endogenous gene expression in a wide range of systems.

Also flagged:metabolismsynthesisenzyme activitydeathFerroptosistumor
Journal Article 2024-01-13 No Snippets Jiang X, Peng Q, Peng M, Oyang L, Wang H, Liu Q, Xu X, Wu N, Tan S, Yang W, Han Y, Lin J, Xia L, Tang Y, Luo X, Dai J, Zhou Y, Liao Q.
Show Full Abstract

Cellular metabolism is the fundamental process by which cells maintain growth and self-renewal. It produces energy, furnishes raw materials, and intermediates for biomolecule synthesis, and modulates enzyme activity to sustain normal cellular functions. Cellular metabolism is the foundation of cellular life processes and plays a regulatory role in various biological functions, including programmed cell death. Ferroptosis is a recently discovered form of iron-dependent programmed cell death. The inhibition of ferroptosis plays a crucial role in tumorigenesis and tumor progression. However, the role of cellular metabolism, particularly glucose and amino acid metabolism, in cancer ferroptosis is not well understood. Here, we reviewed glucose, lipid, amino acid, iron and selenium metabolism involvement in cancer cell ferroptosis to elucidate the impact of different metabolic pathways on this process. Additionally, we provided a detailed overview of agents used to induce cancer ferroptosis. We explained that the metabolism of tumor cells plays a crucial role in maintaining intracellular redox homeostasis and that disrupting the normal metabolic processes in these cells renders them more susceptible to iron-induced cell death, resulting in enhanced tumor cell killing. The combination of ferroptosis inducers and cellular metabolism inhibitors may be a novel approach to future cancer therapy and an important strategy to advance the development of treatments.

SOX6
Also flagged:neurogenesisPrdm16NF-κBWntNotchretinoic acid
Journal Article 2024-01-13 ✓ 1 Snippet Methi A, Islam MR, Kaurani L, Sakib MS, Krüger DM, Pena T, Burkhardt S, Liebetanz D, Fischer A.
In-Text Gene Mentions

…the following genes:Sox6(InN1), Prdm16 (InN2),…

Show Full Abstract

Exercise has been recognized as a beneficial factor for cognitive health, particularly in relation to the hippocampus, a vital brain region responsible for learning and memory. Previous research has demonstrated that exercise-mediated improvement of learning and memory in humans and rodents correlates with increased adult neurogenesis and processes related to enhanced synaptic plasticity. Nevertheless, the underlying molecular mechanisms are not fully understood. With the aim to further elucidate these mechanisms, we provide a comprehensive dataset of the mouse hippocampal transcriptome at the single-cell level after 4 weeks of voluntary wheel-running. Our analysis provides a number of interesting observations. For example, the results suggest that exercise affects adult neurogenesis by accelerating the maturation of a subpopulation of Prdm16-expressing neurons. Moreover, we uncover the existence of an intricate crosstalk among multiple vital signaling pathways such as NF-κB, Wnt/β-catenin, Notch, and retinoic acid (RA) pathways altered upon exercise in a specific cluster of excitatory neurons within the Cornu Ammonis (CA) region of the hippocampus. In conclusion, our study provides an important resource dataset and sheds further light on the molecular changes induced by exercise in the hippocampus. These findings have implications for developing targeted interventions aimed at optimizing cognitive health and preventing age-related cognitive decline.

Also flagged:DNA polymerase λBase excision repairDNA polymerasesPol λnucleotidedRP lyase
Journal Article 2024-01-13 No Snippets Morales-Ruiz T, Beltrán-Melero C, Ortega-Paredes D, Luna-Morillo JA, Martínez-Macías MI, Roldán-Arjona T, Ariza RR, Córdoba-Cañero D.
Show Full Abstract

Base excision repair (BER) generates gapped DNA intermediates containing a 5'-terminal 2-deoxyribose-5-phosphate (5'-dRP) group. In mammalian cells, gap filling and dRP removal are catalyzed by Pol β, which belongs to the X family of DNA polymerases. In higher plants, the only member of the X family of DNA polymerases is Pol λ. Although it is generally believed that plant Pol λ participates in BER, there is limited experimental evidence for this hypothesis. Here we have characterized the biochemical properties of Arabidopsis thaliana Pol λ (AtPol λ) in a BER context, using a variety of DNA repair intermediates. We have found that AtPol λ performs gap filling inserting the correct nucleotide, and that the rate of nucleotide incorporation is higher in substrates containing a C in the template strand. Gap filling catalyzed by AtPol λ is most efficient with a phosphate at the 5'-end of the gap and is not inhibited by the presence of a 5'-dRP mimic. We also show that AtPol λ possesses an intrinsic dRP lyase activity that is reduced by mutations at two lysine residues in its 8-kDa domain, one of which is present in Pol λ exclusively and not in any Pol β homolog. Importantly, we also found that the dRP lyase activity of AtPol λ allows efficient completion of uracil repair in a reconstituted short-patch BER reaction. These results suggest that AtPol λ plays an important role in plant BER.

PCDH17
Also flagged:TumorSolid TumorsmethylationcancerCancershypermethylation
Journal Article 2024-01-13 ✓ 1 Snippet Sacdalan DB, Ul Haq S, Lok BH.
In-Text Gene Mentions

Koudonas et al. [7] demonstrated that hypermethylation of the TSGs PCDH17, NEFH, and RASSF1A in resected renal cell carcinoma compared to normal tissue was associated with worse survival outcomes.

Show Full Abstract

DNA methylation is a fundamental mechanism of epigenetic control in cells and its dysregulation is strongly implicated in cancer development. Cancers possess an extensively hypomethylated genome with focal regions of hypermethylation at CPG islands. Due to the highly conserved nature of cancer-specific methylation, its detection in cell-free DNA in plasma using liquid biopsies constitutes an area of interest in biomarker research. The advent of next-generation sequencing and newer computational technologies have allowed for the development of diagnostic and prognostic biomarkers that utilize methylation profiling to diagnose disease and stratify risk. Methylome-based predictive biomarkers can determine the response to anti-cancer therapy. An additional emerging application of these biomarkers is in minimal residual disease monitoring. Several key challenges need to be addressed before cfDNA-based methylation biomarkers become fully integrated into practice. The first relates to the biology and stability of cfDNA. The second concerns the clinical validity and generalizability of methylation-based assays, many of which are cancer type-specific. The third involves their practicability, which is a stumbling block for translating technologies from bench to clinic. Future work on developing pan-cancer assays with their respective validities confirmed using well-designed, prospective clinical trials is crucial in pushing for the greater use of these tools in oncology.

BTN2A2DNAJC1BTN2A1
Also flagged:Hepatocellular CarcinomaGlycosylationTumorliver cancerpathogenesistumors
Journal Article 2024-01-13 ✓ 5 Snippets Wu Y, Chen J, Zhu R, Huang G, Zeng J, Yu H, He Z, Han C.
In-Text Gene Mentions
⭐ same-sentence co-mention

For the first time, based on analysis, we found that PLOD2 expression was positively correlated with 12 immune checkpoint genes (BTN2A1, BTN2A2, CD209, CD276, CD47, CD80, CD86, CTLA4, HAVCR2, SIRPA, TIGIT, VYCN1) in patients with HCC.

Moreover, according to the CPTAC database, the protein level expression of CHP1 was lower and PPIA, ALG3, CTSA, CAD, B3GAT3, TRAPPC3, HSP90AA1, BAG2, DNAJC1, PLOD2, DYNC1LI1, and ST6GALNAC4 were significantly higher in tumor tissues.

The results revealed that CHP1 had low expression and PPIA, ALG3, CTSA, CAD, B3GAT3, TRAPPC3, HSP90AA1, SRD5A3, BAG2, DNAJC1, ADAMTS5, PLOD2, DYNC1LI1, and ST6GALNAC4 were overexpressed in HCC-LM3 cells compared to MIHA (Figure 2C).

The results revealed that CHP1 had low expression and PPIA, ALG3, CTSA, CAD, B3GAT3, TRAPPC3, HSP90AA1, SRD5A3, BAG2, DNAJC1, ADAMTS5, PLOD2, DYNC1LI1, and ST6GALNAC4 were significantly overexpressed in human hepatocellular carcinoma cells compared to MIHA (Figure 2A).

…Ab (No.ab79406, Abcam),DNAJC1Ab (No.GTX103858, GeneTex),…

Show Full Abstract

The major liver cancer subtype is hepatocellular carcinoma (HCC). Studies have indicated that a better prognosis is related to the presence of tumor-infiltrating lymphocytes (TILs) in HCC. However, the molecular pathways that drive immune cell variation in the tumor microenvironment (TME) remain poorly understood. Glycosylation (GLY)-related genes have a vital function in the pathogenesis of numerous tumors, including HCC. This study aimed to develop a GLY/TME classifier based on glycosylation-related gene scores and tumor microenvironment scores to provide a novel prognostic model to improve the prediction of clinical outcomes. The reliability of the signatures was assessed using receiver operating characteristic (ROC) and survival analyses and was verified with external datasets. Furthermore, the correlation between glycosylation-related genes and other cells in the immune environment, the immune signature of the GLY/TME classifier, and the efficacy of immunotherapy were also investigated. The GLY score low/TME score high subgroup showed a favorable prognosis and therapeutic response based on significant differences in immune-related molecules and cancer cell signaling mechanisms. We evaluated the prognostic role of the GLY/TME classifier that demonstrated overall prognostic significance for prognosis and therapeutic response before treatment, which may provide new options for creating the best possible therapeutic approaches for patients.

DNAH10
Also flagged:Diabetic RetinopathyDRKIR2DS4PDRtype 2 diabetes mellituschronic diabetes mellitus
Journal Article 2024-01-13 ✓ 2 Snippets Zenteno JC, Chacón-Camacho OF, Ordoñez-Labastida V, Miranda-Duarte A, Del Castillo C, Nava J, Mendoza F, Montes-Almanza L, Mora-Roldán G, Gazarian K.
In-Text Gene Mentions

…, AHNAK2 ,DNAH10, KIR2DS4 ,…

…, CFAP74 ,DNAH10, HLA-DRB1 ,…

Show Full Abstract

<h4>Background</h4>Diabetic retinopathy (DR) risk has been shown to vary depending on ethnic backgrounds, and thus, it is worthy that underrepresented populations are analyzed for the potential identification of DR-associated genetic variants. We conducted a case-control study for the identification of DR-risk variants in Mexican population.<h4>Methods</h4>We ascertained 60 type 2 diabetes mellitus (T2DM) patients. Cases (<i>n</i> = 30) were patients with advanced proliferative DR (PDR) with less than 15 years after a T2DM diagnosis while controls (<i>n</i> = 30) were patients with no DR 15 years after the diagnosis of T2DM. Exome sequencing was performed in all patients, and the frequency of rare variants was compared. In addition, the frequency of variants occurring in a set of 169 DR-associated genes were compared.<h4>Results</h4>Statistically significant differences were identified for rare missense and splice variants and for rare splice variants occurring more than once in either group. A strong statistical difference was observed when the number of rare missense variants with an aggregated prediction of pathogenicity and occurring more than once in either group was compared (<i>p</i> = 0.0035). Moreover, 8 variants identified more than once in either group, occurring in previously identified DR-associated genes were recognized. The p.Pro234Ser KIR2DS4 variant showed a strong protective effect (OR = 0.04 [0.001-0.36]; <i>p</i> = 0.04).<h4>Conclusions</h4>Our study showed an enrichment of rare splice acceptor/donor variants in patients with PDR and identified a potential protective variant in <i>KIR2DS4</i>. Although statistical significance was not reached, our results support the replication of 8 previously identified DR-associated genes.

Also flagged:HydroxyapatitePolyvinyl Alcoholsynthesiscarbonoxygenphosphorus
Journal Article 2024-01-13 No Snippets Shalygina K, Lytkina D, Sadykov R, Kurzina I.
Show Full Abstract

Nowadays, due to the increasing number of diseases and injuries related to bone tissue, there is an acute problem of creating a material that could be incorporated into the bone tissue structure and contribute to accelerated bone regeneration. Such materials can be represented by a polymeric matrix that holds the material in the bone and an inorganic component that can be incorporated into the bone structure and promote accelerated bone regeneration. Therefore, in this work we investigated polyvinyl alcohol-based composite cryogels containing an in situ deposited inorganic filler, hydroxyapatite. The freezing temperature was varied during the synthesis process. The composition of the components was determined by infrared spectroscopy and the phase composition by X-ray phase analysis, from which it was found that the main phase of the composite is hydroxyapatite and that the particle size decreases with increasing freezing temperature. The elemental composition of the surface is dominated by carbon, oxygen, phosphorus and calcium; no impurities of other elements not typical for polyvinyl alcohol/ hydroxyapatite cryogels were found. Higher mechanical properties and melting points were observed at -15 °C. Cryogenic treatment parameters did not affect cell viability; however, cell viability was above 80% in all samples.

FBXL4
Also flagged:PolyamineHepatocellular carcinomaliver cancertumormetabolismmitochondrial
Journal Article 2024-01-13 ✓ 1 Snippet Liu Q, Yan X, Li R, Yuan Y, Wang J, Zhao Y, Fu J, Su J.
In-Text Gene Mentions

In addition, FBXL4 mutations cause excessive mitochondrial autophagy through BNIP3/BNIP3L accumulation, leading to mitochondrial DNA depletion syndrome (MTDPS), a group of genetic disorders characterized by a reduction in the number of copies of mitochondrial DNA, resulting in OXPHOS and mitochondrial functional defects [78].

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common primary liver cancer, and, with increasing research on the tumor immune microenvironment (TIME), the immunosuppressive micro-environment of HCC hampers further application of immunotherapy, even though immunotherapy can provide survival benefits to patients with advanced liver cancer. Current studies suggest that polyamine metabolism is not only a key metabolic pathway for the formation of immunosuppressive phenotypes in tumor-associated macrophages (TAMs), but it is also profoundly involved in mitochondrial quality control signaling and the energy metabolism regulation process, so it is particularly important to further investigate the role of polyamine metabolism in the tumor microenvironment (TME). In this review, by summarizing the current research progress of key enzymes and substrates of the polyamine metabolic pathway in regulating TAMs and T cells, we propose that polyamine biosynthesis can intervene in the process of mitochondrial energy metabolism by affecting mitochondrial autophagy, which, in turn, regulates macrophage polarization and T cell differentiation. Polyamine metabolism may be a key target for the interactive dialog between HCC cells and immune cells such as TAMs, so interfering with polyamine metabolism may become an important entry point to break intercellular communication, providing new research space for developing polyamine metabolism-based therapy for HCC.

HTT
Also flagged:skeletal diseasescell cycleextracellularbone diseaseshematopoiesisorgan development
Journal Article 2024-01-13 ✓ 1 Snippet Bombieri C, Corsi A, Trabetti E, Ruggiero A, Marchetto G, Vattemi G, Valenti MT, Zipeto D, Romanelli MG.
In-Text Gene Mentions

Both human iPSCs and brain telencephalic organoids have been developed to evaluate the neuronal defects associated with Huntington’s disease (HD), a neurodegenerative autosomal dominant disease with a late onset caused by a CAG expansion in the huntingtin (HTT) gene.

Show Full Abstract

Organoids are self-organized, three-dimensional structures derived from stem cells that can mimic the structure and physiology of human organs. Patient-specific induced pluripotent stem cells (iPSCs) and 3D organoid model systems allow cells to be analyzed in a controlled environment to simulate the characteristics of a given disease by modeling the underlying pathophysiology. The recent development of 3D cell models has offered the scientific community an exceptionally valuable tool in the study of rare diseases, overcoming the limited availability of biological samples and the limitations of animal models. This review provides an overview of iPSC models and genetic engineering techniques used to develop organoids. In particular, some of the models applied to the study of rare neuronal, muscular and skeletal diseases are described. Furthermore, the limitations and potential of developing new therapeutic approaches are discussed.

HFE
Also flagged:Primaryliver cancertumourliver cancerscholangiocarcinomahematein
Journal Article 2024-01-13 ✓ 1 Snippet Beaufrère A, Ouzir N, Zafar PE, Laurent-Bellue A, Albuquerque M, Lubuela G, Grégory J, Guettier C, Mondet K, Pesquet JC, Paradis V.
In-Text Gene Mentions

…nsumption, metabolic syndrome,hemochromatosis), Child-Pugh score, METAVIR…

Show Full Abstract

<h4>Background & aims</h4>The diagnosis of primary liver cancers (PLCs) can be challenging, especially on biopsies and for combined hepatocellular-cholangiocarcinoma (cHCC-CCA). We automatically classified PLCs on routine-stained biopsies using a weakly supervised learning method.<h4>Method</h4>We selected 166 PLC biopsies divided into training, internal and external validation sets: 90, 29 and 47 samples, respectively. Two liver pathologists reviewed each whole-slide hematein eosin saffron (HES)-stained image (WSI). After annotating the tumour/non-tumour areas, tiles of 256x256 pixels were extracted from the WSIs and used to train a ResNet18 neural network. The tumour/non-tumour annotations served as labels during training, and the network's last convolutional layer was used to extract new tumour tile features. Without knowledge of the precise labels of the malignancies, we then applied an unsupervised clustering algorithm.<h4>Results</h4>Pathological review classified the training and validation sets into hepatocellular carcinoma (HCC, 33/90, 11/29 and 26/47), intrahepatic cholangiocarcinoma (iCCA, 28/90, 9/29 and 15/47), and cHCC-CCA (29/90, 9/29 and 6/47). In the two-cluster model, Clusters 0 and 1 contained mainly HCC and iCCA histological features. The diagnostic agreement between the pathological diagnosis and the two-cluster model predictions (major contingent) in the internal and external validation sets was 100% (11/11) and 96% (25/26) for HCC and 78% (7/9) and 87% (13/15) for iCCA, respectively. For cHCC-CCA, we observed a highly variable proportion of tiles from each cluster (cluster 0: 5-97%; cluster 1: 2-94%).<h4>Conclusion</h4>Our method applied to PLC HES biopsy could identify specific morphological features of HCC and iCCA. Although no specific features of cHCC-CCA were recognized, assessing the proportion of HCC and iCCA tiles within a slide could facilitate the identification of cHCC-CCA.<h4>Impact and implications</h4>The diagnosis of primary liver cancers can be challenging, especially on biopsies and for combined hepatocellular-cholangiocarcinoma (cHCC-CCA). We automatically classified primary liver cancers on routine-stained biopsies using a weakly supervised learning method. Our model identified specific features of hepatocellular carcinoma and intrahepatic cholangiocarcinoma. Despite no specific features of cHCC-CCA being recognized, the identification of hepatocellular carcinoma and intrahepatic cholangiocarcinoma tiles within a slide could facilitate the diagnosis of primary liver cancers, and particularly cHCC-CCA.

Also flagged:Raf kinasesmooth muscle tumours of the uterusleiomyosarcomaRaf kinase inhibitory proteinRKIPleiomyoma
Journal Article 2024-01-13 No Snippets Greco S, Pinheiro J, Cardoso-Carneiro D, Giantomassi F, Pellegrino P, Scaglione G, Delli Carpini G, Ciavattini A, Zannoni GF, Goteri G, Martinho O, Ciarmela P.
Show Full Abstract

<h4>Research question</h4>What is the expression pattern of Raf kinase inhibitory protein (RKIP) in different subtypes of leiomyoma (usual type, cellular, apoplectic or haemorrhagic leiomyoma, leiomyoma with bizarre nuclei and lipoleiomyoma) and leiomyosarcoma specimens, and what is its biological role in leiomyosarcoma cells?<h4>Design</h4>Leiomyoma and leiomyosarcoma specimens underwent immunohistochemistry staining. Leiomyosarcoma SK-LMS-1 cell line was RKIP knocked down and RKIP overexpressed, and cell viability, wound healing migration and clonogenicity assays were carried out.<h4>Results</h4>A higher immunohistochemical expression of RKIP was observed in bizarre leiomyomas, than in usual-type leiomyomas. Decreased expression was also found in cellular leiomyoma, with generally absent staining in leiomyosarcomas. Upon RKIP expression manipulation in SK-LMS-1 cell line, no major differences were observed in cell viability and migration capacity over time. RKIP knockout, however, resulted in a significant increase in the cell's ability to form colonies (P = 0.011).<h4>Conclusion</h4>RKIP distinct expression pattern among leiomyoma histotype and leiomyosarcoma, and its effect on leiomyosarcoma cells on colony formation, encourages further studies of RKIP in uterine smooth muscle disorders.

Also flagged:glaucomaNanofiberschronic eye diseasebrimonidine tartrateD, L-lactidepolycaprolactone
Journal Article 2024-01-13 No Snippets Shaikhi Shoushtari F, Naghshbandy M, Rezaei L, Mehrandish S, Mirzaeei S.
Show Full Abstract

<h4>Purpose</h4>Chronic ailments usually decrease the quality of life due to the requirement for repetitive administration of drugs. Glaucoma is a chronic eye disease occurred because of increased intraocular pressure (IOP). Controlled-release inserts can overcome this challenge by a gradual release of the antiglaucoma drugs. This study aimed to fabricate ocular inserts of brimonidine tartrate (BMD) for the management of glaucoma.<h4>Methods</h4>Different polymers including poly (D, L-lactide), polycaprolactone, cellulose acetate, and Eudragit RL100® were used to develop the BMD-loaded nanofibrous inserts by electrospinning technique. The inserts were characterized. The morphology and drug-polymer compatibility were examined by scanning electron microscopy (SEM), and Fourier-transform infrared (FTIR) spectroscopy and <i>in vitro</i> drug release in PBS. The IOP-lowering efficacy and irritancy of optimized formulation were assessed in the caprines.<h4>Results</h4>SEM images demonstrated nanofibers with uniform morphology and a mean diameter<300 nm were fabricated. The nanofibers were high-strength and flexible enough to be placed in the conjunctival sac. FTIR showed drug-polymer compatibility. <i>In vitro</i> release study indicated a sustained-release profile of the drug during 6 days for inserts. <i>In vivo</i> evaluation indicated that the optimized formulation is capable of maintaining the IOP in a non-glaucomatous range for an extended duration of 6 days. In addition, the formulation was non-irritant to the caprine eye.<h4>Conclusion</h4>Due to the prolonged IOP-lowering efficiency, BMD-loaded nanofibrous inserts can be considered suitable for the controlled release of drugs and thus enhance patient compliance by reducing the frequency of administration.

PRDX6
Also flagged:MethylglyoxalADCCSCYBBPRDX3SPINK1
Journal Article 2024-01-13 ✓ 1 Snippet Shademan B, Yousefi H, Nourazarian A, Nourazarian A.
In-Text Gene Mentions

…HSPA1A, MT3, PRDX3,PRDX6, SLC7A11, and SPINK1…

Show Full Abstract

<h4>Purpose</h4>Alzhеimеr's disеasе (AD) is thе most prеvalеnt form of dеmеntia globally. Rеsеarch links thе incrеasе of rеactivе oxidativе spеciеs (ROS) to thе pathogеnеsis of AD; thus, this study invеstigatеd thе impact of mеthylglyoxal (MGO) on thе еxprеssion of miR-125b, miR-107, and gеnеs involvеd in oxidativе strеss signaling in SH-SY5Y cеlls.<h4>Methods</h4>Thе MTT assay assеssеd MGO's еffеcts on SH-SY5Y viability. miR-125b and miR-107 еxprеssion was analyzеd via rеal-timе PCR. Additionally, thе Human Oxidativе Strеss Pathway Plus RT2 Profilеr PCR array quantifiеd oxidativе pathway gеnе еxprеssion.<h4>Results</h4>MGO concеntrations undеr 700μM did not significantly rеducе SH-SY5Y viability. MiR-125b and miR-107 еxprеssion in SH-SY5Y cеlls incrеasеd and dеcrеasеd rеspеctivеly (<i>P</i><0.05). Cеlls trеatеd with 700μM MGO еxhibitеd incrеasеd CCS, CYBB, PRDX3, SPINK1, CYGB, DHCR24 and BAG2 еxprеssion (<i>P</i><0.05). Thosе trеatеd with 1400μM MGO showеd incrеasеd CCS, CYBB, PRDX3, SPINK1, DUSP1, EPHX2, EPX, FOXM1, and GPX3 еxprеssion (<i>P</i><0.05).<h4>Conclusion</h4>MGO altеrs oxidativе strеss pathway gеnе, miR-125b, and miR-107 еxprеssion in SH-SY5Y cеlls. Targеting MGO or miR-125b and miR-107 may providе novеl AD thеrapеutic stratеgiеs or improvе sеvеrе symptoms. Furthеr rеsеarch should еlucidatе thе prеcisе mеchanisms.

bioRxiv 2024-01-13 Preprint (No Snippets API) Stubbs J, Hornsey T, Hanrahan N, Esteban LB, Bolton R, Malý M, Basu S, Orlans J, de Sanctis D, Shim J, Stewart PDS, Orville AM, Tews I, West J.
Show Full Abstract

Serial crystallography requires large numbers of microcrystals and robust strategies to rapidly apply substrates to initiate reactions in time-resolved studies. Here we report the use of droplet miniaturisation for the controlled production of uniform crystals, providing an avenue for controlled diffusion and synchronous reaction initiation. The approach was evaluated using two enzymatic systems, yielding 3-µm lysozyme crystals and 2-µm crystals of Pdx1, an Arabidopsis enzyme involved in vitamin B6 biosynthesis. A seeding strategy was used to overcome the improbability of Pdx1 nucleation occurring with diminishing droplet volumes. Convection within droplets was exploited for rapid crystal mixing with ligands. Mixing times of <2 milliseconds were achieved. Droplet microfluidics for crystal size engineering and rapid micromixing can be used to advance time-resolved serial crystallography.

Also flagged:Parkinson's DiseasePDidiopathic PDneurotransmitter receptortransporterorganization
Journal Article 2024-01-12 No Snippets Wiesman AI, da Silva Castanheira J, Fon EA, Baillet S, PREVENT‐AD Research Group, Quebec Parkinson Network.
Show Full Abstract

<h4>Objective</h4>Parkinson's disease (PD) affects the structural integrity and neurophysiological signaling of the cortex. These alterations are related to the motor and cognitive symptoms of the disease. How these changes are related to the neurochemical systems of the cortex is unknown.<h4>Methods</h4>We used T1-weighted magnetic resonance imaging (MRI) and magnetoencephalography (MEG) to measure cortical thickness and task-free neurophysiological activity in patients with idiopathic PD (n<sub>MEG</sub> = 79, n<sub>MRI</sub> = 65) and matched healthy controls (n<sub>MEG</sub> = 65, n<sub>MRI</sub> = 37). Using linear mixed-effects models, we examined the topographical alignment of cortical structural and neurophysiological alterations in PD with cortical atlases of 19 neurotransmitter receptor and transporter densities.<h4>Results</h4>We found that neurophysiological alterations in PD occur primarily in brain regions rich in acetylcholinergic, serotonergic, and glutamatergic systems, with protective implications for cognitive and psychiatric symptoms. In contrast, cortical thinning occurs preferentially in regions rich in noradrenergic systems, and the strength of this alignment relates to motor deficits.<h4>Interpretation</h4>This study shows that the spatial organization of neurophysiological and structural alterations in PD is relevant for nonmotor and motor impairments. The data also advance the identification of the neurochemical systems implicated. The approach uses novel nested atlas modeling methodology that is transferrable to research in other neurological and neuropsychiatric diseases and syndromes. ANN NEUROL 2024;95:802-816.

Also flagged:Ironneurodegenerative diseasesiron deficiencydeathmembranemitochondrial
Journal Article 2024-01-12 No Snippets Levi S, Ripamonti M, Moro AS, Cozzi A.
Show Full Abstract

Iron is an essential element for the development and functionality of the brain, and anomalies in its distribution and concentration in brain tissue have been found to be associated with the most frequent neurodegenerative diseases. When magnetic resonance techniques allowed iron quantification in vivo, it was confirmed that the alteration of brain iron homeostasis is a common feature of many neurodegenerative diseases. However, whether iron is the main actor in the neurodegenerative process, or its alteration is a consequence of the degenerative process is still an open question. Because the different iron-related pathogenic mechanisms are specific for distinctive diseases, identifying the molecular mechanisms common to the various pathologies could represent a way to clarify this complex topic. Indeed, both iron overload and iron deficiency have profound consequences on cellular functioning, and both contribute to neuronal death processes in different manners, such as promoting oxidative damage, a loss of membrane integrity, a loss of proteostasis, and mitochondrial dysfunction. In this review, with the attempt to elucidate the consequences of iron dyshomeostasis for brain health, we summarize the main pathological molecular mechanisms that couple iron and neuronal death.

HFE
Also flagged:Bernard-Soulier syndrometype I diabetesHaemochromatosisthrombocytopeniaHLAas
Journal Article 2024-01-12 ✓ 5 Snippets Clancy J, Ritari J, Vaittinen E, Arvas M, Tammi S, FinnGen, Koskela S, Partanen J.
In-Text Gene Mentions

…syndrome and twohemochromatosismutations, (iii) type…

…variants: mutations causinghemochromatosis, an iron accumulation…

…founder mutations forhemochromatosisare shared by…

…Individuals withhemochromatosismutations can be…

…two mutations inHFEgene, H63D and…

Show Full Abstract

Health questionnaires and donation criteria result in accumulation of highly selected individuals in a blood donor population. To understand better the usefulness of a blood donor-based biobank in personalised disease-associated genetic studies, and for possible personalised blood donation policies, we evaluated the occurrence and distributions of common and rare disease-associated genetic variants in Finnish Blood Service Biobank. We analysed among 31,880 blood donors the occurrence and geographical distribution of (i) 53 rare Finnish-enriched disease-associated variants, (ii) mutations assumed to influence blood donation: four Bernard-Soulier syndrome and two hemochromatosis mutations, (iii) type I diabetes risk genotype HLA-DQ2/DQ8. In addition, we analysed the level of consanguinity in Blood Service Biobank. 80.3% of blood donors carried at least one (range 0-9 per donor) of the rare variants, many in homozygous form, as well. Donors carrying multiple rare variants were enriched in Eastern Finland. Haemochromatosis mutation HFE C282Y homozygosity was 43.8% higher than expected, whereas mutations leading to Bernard-Soulier thrombocytopenia were rare. The frequency of HLA-DQ2/DQ8 genotype was slightly lower than expected. First-degree consanguinity was higher in Blood Service Biobank than in the general population. We demonstrate that despite donor selection, the Blood Service Biobank is a valuable resource for personalised medical research and for genotype-selected samples from unaffected individuals. The geographical genetic substructure of Finland enables efficient recruitment of donors carrying rare variants. Furthermore, we show that blood donor biobank material can be utilised for personalised blood donation policies.

TNFSF4
Also flagged:PIEZO2gastric cancermalignant tumorscancerimmunological responsetumor
Journal Article 2024-01-12 ✓ 1 Snippet Zhang YC, Yang M, Lu CD, Li QY, Shi JN, Shi J.
In-Text Gene Mentions

…SELP, TLR4, TGFB1,TNFSF4, CD28, VEGFB, IL10,…

Show Full Abstract

Gastric cancer (GC) is one of the most prevalent malignant tumors of the gastrointestinal system in the globe. The effect of PIEZO2 on the immune function and pathological features of gastric cancer remains to be explored. The Online database of cancer genes and GSE54129 have been used to analyze the clinical characteristics of PIEZO2 expression. We looked at the relationship between PIEZO2 and the immune systems of GC patients. The TIDE algorithm was used to explore the value of PIEZO2 in immunotherapy. Investigated the enrichment of PIEZO2 gene ontology and associated signal pathways using Online gene databases. The results show that overexpression of PIEZO2 was identified as an independent risk factor for patients with GC who had poor overall survival. Individuals may have a better prognosis if they had poorly differentiated GC and increased PIEZO2 expression (P < 0.05). We demonstrated a strong correlation between PIEZO2 and immune cells. The majority of immune checkpoint and immunological-related genes were associated with PIEZO2 expression. And PIEZO2 might be used as an immunotherapy target. Finally, the differential PIEZO2 genes in GC were mostly implicated in the processes of inflammation, immunological response, and tumor metastasis, according to functional analysis. PIEZO2 has a negative correlation with cell stemness and mutation levels in patients with GC and a positive correlation with immune cell infiltration and gene expression in the tumor microenvironment. These findings point to PIEZO2 as a potential new immunotherapy target of GC.

SOX6
Also flagged:CancertumorSchwannoma tumorsschwannomasschwannomacorticosteroids
Journal Article 2024-01-12 ✓ 4 Snippets Liu SJ, Casey-Clyde T, Cho NW, Swinderman J, Pekmezci M, Dougherty MC, Foster K, Chen WC, Villanueva-Meyer JE, Swaney DL, Vasudevan HN, Choudhury A, Pak J, Breshears JD, Lang UE, Eaton CD, Hiam-Galvez KJ, Stevenson E, Chen KH, Lien BV, Wu D, Braunstein SE, Sneed PK, Magill ST, Lim D, McDermott MW, Berger MS, Perry A, Krogan NJ, Hansen MR, Spitzer MH, Gilbert L, Theodosopoulos PV, Raleigh DR.
In-Text Gene Mentions

To determine if these genes promoted schwannoma cell survival, APOD or SOX6 were suppressed in HEI-193 cells using CRISPRi, which each attenuated schwannoma cell proliferation compared to cells expressing sgNTC (Supplementary Fig. 14d, e).

…45 , andSOX6, an inhibitor…

…survival, APOD orSOX6were suppressed in…

…of SHH ,SOX6, or the…

Show Full Abstract

Mechanisms specifying cancer cell states and response to therapy are incompletely understood. Here we show epigenetic reprogramming shapes the cellular landscape of schwannomas, the most common tumors of the peripheral nervous system. We find schwannomas are comprised of 2 molecular groups that are distinguished by activation of neural crest or nerve injury pathways that specify tumor cell states and the architecture of the tumor immune microenvironment. Moreover, we find radiotherapy is sufficient for interconversion of neural crest schwannomas to immune-enriched schwannomas through epigenetic and metabolic reprogramming. To define mechanisms underlying schwannoma groups, we develop a technique for simultaneous interrogation of chromatin accessibility and gene expression coupled with genetic and therapeutic perturbations in single-nuclei. Our results elucidate a framework for understanding epigenetic drivers of tumor evolution and establish a paradigm of epigenetic and metabolic reprograming of cancer cells that shapes the immune microenvironment in response to radiotherapy.

ECI2
Also flagged:Peroxisomal β-oxidation enzymeDECR2lipidmetabolismprostate cancerorganelles
Journal Article 2024-01-12 ✓ 2 Snippets Mah CY, Nguyen ADT, Niijima T, Helm M, Dehairs J, Ryan FJ, Ryan N, Quek LE, Hoy AJ, Don AS, Mills IG, Swinnen JV, Lynn DJ, Nassar ZD, Butler LM.
In-Text Gene Mentions

…delta isomerase 2 (ECI2; involved in β-oxidation…

…several perFAO genes:ECI2, DECR2, ABCD1, CRAT…

Show Full Abstract

<h4>Background</h4>Peroxisomes are central metabolic organelles that have key roles in fatty acid homoeostasis. As prostate cancer (PCa) is particularly reliant on fatty acid metabolism, we explored the contribution of peroxisomal β-oxidation (perFAO) to PCa viability and therapy response.<h4>Methods</h4>Bioinformatic analysis was performed on clinical transcriptomic datasets to identify the perFAO enzyme, 2,4-dienoyl CoA reductase 2 (DECR2) as a target gene of interest. Impact of DECR2 and perFAO inhibition via thioridazine was examined in vitro, in vivo, and in clinical prostate tumours cultured ex vivo. Transcriptomic and lipidomic profiling was used to determine the functional consequences of DECR2 inhibition in PCa.<h4>Results</h4>DECR2 is upregulated in clinical PCa, most notably in metastatic castrate-resistant PCa (CRPC). Depletion of DECR2 significantly suppressed proliferation, migration, and 3D growth of a range of CRPC and therapy-resistant PCa cell lines, and inhibited LNCaP tumour growth and proliferation in vivo. DECR2 influences cell cycle progression and lipid metabolism to support tumour cell proliferation. Further, co-targeting of perFAO and standard-of-care androgen receptor inhibition enhanced suppression of PCa cell proliferation.<h4>Conclusion</h4>Our findings support a focus on perFAO, specifically DECR2, as a promising therapeutic target for CRPC and as a novel strategy to overcome lethal treatment resistance.

ZNFX1
Also flagged:diabetic nephropathiescell proliferationmetabolismbreast cancerdiabetic complicationsheart failure
Journal Article 2024-01-12 ✓ 2 Snippets Han Y, Zhou Q, Liu L, Li J, Zhou Y.
In-Text Gene Mentions

In bladder cancer cells, miR-193a was identified as an upstream target of ZNFX1-AS1, promoting tumor cell proliferation, migration, and invasion [53].

…upstream target ofZNFX1-AS1, promoting tumor cell…

Show Full Abstract

<h4>Background</h4>MiRNAs are involved in the occurrence and development of many diseases. Extensive literature studies have demonstrated that miRNA-disease associations are stratified and encompass ~ 20% causal associations. Computational models that predict causal miRNA-disease associations provide effective guidance in identifying novel interpretations of disease mechanisms and potential therapeutic targets. Although several predictive models for miRNA-disease associations exist, it is still challenging to discriminate causal miRNA-disease associations from non-causal ones. Hence, there is a pressing need to develop an efficient prediction model for causal miRNA-disease association prediction.<h4>Results</h4>We developed DNI-MDCAP, an improved computational model that incorporated additional miRNA similarity metrics, deep graph embedding learning-based network imputation and semi-supervised learning framework. Through extensive predictive performance evaluation, including tenfold cross-validation and independent test, DNI-MDCAP showed excellent performance in identifying causal miRNA-disease associations, achieving an area under the receiver operating characteristic curve (AUROC) of 0.896 and 0.889, respectively. Regarding the challenge of discriminating causal miRNA-disease associations from non-causal ones, DNI-MDCAP exhibited superior predictive performance compared to existing models MDCAP and LE-MDCAP, reaching an AUROC of 0.870. Wilcoxon test also indicated significantly higher prediction scores for causal associations than for non-causal ones. Finally, the potential causal miRNA-disease associations predicted by DNI-MDCAP, exemplified by diabetic nephropathies and hsa-miR-193a, have been validated by recently published literature, further supporting the reliability of the prediction model.<h4>Conclusions</h4>DNI-MDCAP is a dedicated tool to specifically distinguish causal miRNA-disease associations with substantially improved accuracy. DNI-MDCAP is freely accessible at http://www.rnanut.net/DNIMDCAP/ .

TNFSF4
Also flagged:MAPKkidney renal clear cell carcinomacancercancersCOXtumor
Journal Article 2024-01-12 ✓ 1 Snippet Li X, Guan H, Ma C, Dai Y, Su J, Chen X, Yuan Q, Wang J.
In-Text Gene Mentions

…ICOS, CD86, CD44,TNFSF4, CD274, CD200R1, HAVCR2,…

Show Full Abstract

The MAPK signaling pathway significantly impacts cancer progression and resistance; however, its functions remain incompletely assessed across various cancers, particularly in kidney renal clear cell carcinoma (KIRC). Therefore, there is an urgent need for comprehensive pan-cancer investigations of MAPK signaling, particularly within the context of KIRC. In this research, we obtained TCGA pan-cancer multi-omics data and conducted a comprehensive analysis of the genomic and transcriptomic characteristics of the MAPK signaling pathway. For in-depth investigation in KIRC, status of MAPK pathway was quantitatively estimated by ssGSEA and Ward algorithm was utilized for cluster analysis. Molecular characteristics and clinical prognoses of KIRC patients with distinct MAPK activities were comprehensively explored using a series of bioinformatics algorithms. Subsequently, a combination of LASSO and COX regression analyses were utilized sequentially to construct a MAPK-related signature to help identify the risk level of each sample. Patients in the C1 subtype exhibited relatively higher levels of MAPK signaling activity, which were associated with abundant immune cell infiltration and favorable clinical outcomes. Single-cell RNA sequencing (scRNA-seq) analysis of KIRC samples identified seven distinct cell types, and endothelial cells in tumor tissues had obviously higher MAPK scores than normal tissues. The immunohistochemistry results indicated the reduced expression levels of PAPSS1, MAP3K11, and SPRED1 in KIRC samples. In conclusion, our study represents the first integration of bulk RNA sequencing and single-cell RNA sequencing to elucidate the molecular characteristics of MAPK signaling in KIRC, providing a solid foundation for precision oncology.

TNFSF4
Also flagged:cardiac allograft vasculopathypathogenesisantibodiescell activationmetalloproteinaseTP53
Journal Article 2024-01-12 ✓ 2 Snippets Nevarez-Mejia J, Pickering H, Sosa RA, Valenzuela NM, Fishbein GA, Baldwin WM, Fairchild RL, Reed EF.
In-Text Gene Mentions

…genes (STING) andTNFSF4/OX40L, a memory T…

…ll clonal expansion/survival (TNFSF4/OX40L), memory T cells…

Show Full Abstract

Cardiac allograft vasculopathy (CAV) causes late graft failure and mortality after heart transplantation. Donor-specific antibodies (DSAs) lead to chronic endothelial cell injury, inflammation, and arterial intimal thickening. In this study, GeoMx digital spatial profiling was used to analyze arterial areas of interest (AOIs) from CAV+DSA+ rejected cardiac allografts (N = 3; 22 AOIs total). AOIs were categorized based on CAV neointimal thickening and underwent whole transcriptome and protein profiling. By comparing our transcriptomic data with that of healthy control vessels of rapid autopsy myocardial tissue, we pinpointed specific pathways and transcripts indicative of heightened inflammatory profiles in CAV lesions. Moreover, we identified protein and transcriptomic signatures distinguishing CAV lesions exhibiting low and high neointimal lesions. AOIs with low neointima showed increased markers for activated inflammatory infiltrates, endothelial cell activation transcripts, and gene modules involved in metalloproteinase activation and TP53 regulation of caspases. Inflammatory and apoptotic proteins correlated with inflammatory modules in low neointima AOIs. High neointima AOIs exhibited elevated TGFβ-regulated transcripts and modules enriched for platelet activation/aggregation. Proteins associated with growth factors/survival correlated with modules enriched for proliferation/repair in high neointima AOIs. Our findings reveal novel insight into immunological mechanisms mediating CAV pathogenesis.

HTT
Also flagged:serotonin transporteranxietydepressionserotonincorticosteroneBDNF
Journal Article 2024-01-12 ✓ 2 Snippets Sun M, Brivio P, Shan L, Docq S, Heltzel LCMW, Smits CAJ, Middelman A, Vrooman R, Spoelder M, Verheij MMM, Buitelaar JK, Boillot M, Calabrese F, Homberg JR, Hanswijk SI.
In-Text Gene Mentions

Finally, we assessed the effect of paternal 5-HTT genotype on these measurements in 5-HTT<sup>+/-</sup> offspring receiving their knockout allele from their mother or father.<h4>Results</h4>5-HTT<sup>-/-</sup> offspring exhibited increased anxiety- and depression-like behavior in the elevated plus maze and sucrose preference test.

…understanding of the5-HTTgenotype dependent susceptibil…

Show Full Abstract

<h4>Introduction</h4>Developmental changes due to early life variations in the serotonin system affect stress-related behavior and neuroplasticity in adulthood. These outcomes can be caused both by offspring's own and maternal serotonergic genotype. We aimed to dissociate the contribution of the own genotype from the influences of mother genotype.<h4>Methods</h4>Sixty-six male homozygous (5-HTT<sup>-/-)</sup> and heterozygous (5-HTT<sup>+/-)</sup> serotonin transporter knockout and wild-type rats from constant 5-HTT genotype mothers crossed with varying 5-HTT genotype fathers were subjected to tests assessing anxiety- and depression-like behaviors. Additionally, we measured plasma corticosterone levels and mRNA levels of BDNF, GABA system and HPA-axis components in the prelimbic and infralimbic cortex. Finally, we assessed the effect of paternal 5-HTT genotype on these measurements in 5-HTT<sup>+/-</sup> offspring receiving their knockout allele from their mother or father.<h4>Results</h4>5-HTT<sup>-/-</sup> offspring exhibited increased anxiety- and depression-like behavior in the elevated plus maze and sucrose preference test. Furthermore, Bdnf isoform VI expression was reduced in the prelimbic cortex. Bdnf isoform IV and GABA related gene expression was also altered but did not survive false discovery rate (FDR) correction. Finally, 5-HTT<sup>+/-</sup> offspring from 5-HTT<sup>-/-</sup> fathers displayed higher levels of anxiety- and depression-like behavior and changes in GABA, BDNF and HPA-axis related gene expression not surviving FDR correction.<h4>Limitations</h4>Only male offspring was tested.<h4>Conclusions</h4>Offspring's own 5-HTT genotype influences stress-related behaviors and Bdnf isoform VI expression, independently of maternal 5-HTT genotype. Paternal 5-HTT genotype separately influenced these outcomes. These findings advance our understanding of the 5-HTT genotype dependent susceptibility to stress-related disorders.

HFE
Also flagged:photonsulfurwatercancermetalssurface
Journal Article 2024-01-12 ✓ 1 Snippet Siomra A, Wawrzyńczyk D, Samoć M, Nyk M.
In-Text Gene Mentions

…including anaemia orhemochromatosis.…

Show Full Abstract

Spectrally-resolved third-order nonlinear optical properties of water-dispersed sulfur quantum dots (SQDs) were investigated in the wavelength range from 740 nm to 820 nm with the two-photon excited emission technique using a tunable femtosecond laser system. The maximum value of the two-photon absorption (TPA) cross-section (<i>σ</i><sub>2</sub>) for ∼5.4 nm size SQDs was found to be 185 GM (Goeppert-Mayer unit), while the two-photon brightness (<i>σ</i><sub>2</sub> × <i>η</i>) was found to be 1.5 GM at 780 nm, the wavelength being in the first biological transmittance window. The TPA properties are presented here as appropriate cross-sections normalized per molecular weight which enables meaningful comparison of the nonlinear factors of the studied quantum dots with those of various nanomaterials. The optimized TPA properties of these hydrophilic colloidal SQDs may be potentially useful for detection of Fe<sup>3+</sup> metal ions. The experimentally determined limit of Fe<sup>3+</sup> detection for both one- and two-photon regime was 10 μmol L<sup>-1</sup> (0.6 μg mL<sup>-1</sup>). Förster resonance energy transfer between SQDs as donors and Fe<sup>3+</sup> metal ions as acceptors was confirmed as one of the possible detection mechanisms using a time-correlated single photon counting technique.

PRDX6
Also flagged:Prostate CancerExtracellularZincprostatebreast cancercancer
Journal Article 2024-01-12 ✓ 5 Snippets Barman SK, Sen MK, Mahns DA, Wu MJ, Malladi CS.
In-Text Gene Mentions

The upregulated proteins, such as protein S100A6 (S100A6), aldehyde dehydrogenase 1 family member A3 isoform (ALDH1A3), 26S proteasome non-ATPase regulatory subunit 11 (PSMD11), elongation factor 1 δ (EEF1D), 60 kDa heat shock protein mitochondrial (HSPD1), heat shock protein 90 kDa α (cytosolic) class B member 1 isoform (HSP90AB1), heat shock protein β 1 (HSPB1), L-lactate dehydrogenase B chain (LDHB), peroxiredoxin 6 (PRDX6), proteasome subunit α type 1 (PSMA1), superoxide dismutase (Cu-Zn) (SOD1), and acetyltransferase component of pyruvate dehydrogenase complex (DLAT), are related to cancer cell proliferation, growth, and invasion (Table 2).

…peroxiredoxin 6 (PRDX6), protein S100A13…

…peroxiredoxin 6 (PRDX6), proteasome subunit…

…peroxiredoxin 6 (PRDX6) and peroxiredoxin…

…Peroxiredoxin 6 (PRDX6) and 26S…

Show Full Abstract

Zinc dyshomeostasis is manifested in breast and prostate cancer cells. This study attempted to uncover the molecular details prodded by the change of extracellular zinc by employing a panel of normal and cancerous breast and prostate cell lines coupled with the top-down proteomics with two-dimensional gel electrophoresis followed by liquid chromatography-tandem mass spectrometry. The protein samples were generated from MCF-7 breast cancer cells, MCF10A normal breast cells, PC3 prostate cancer cells, and RWPE-1 normal prostate cells with or without exogenous zinc exposure in a time course (<i>T</i><sub>0</sub> and <i>T</i><sub>120</sub>). By comparing the cancer cells vs respective normal epithelial cells without zinc treatment (<i>T</i><sub>0</sub>), differentially expressed proteins (23 upregulated and 18 downregulated in MCF-7 cells; 14 upregulated and 30 downregulated in PC3 cells) were identified, which provides insights into the intrinsic differences of breast and prostate cancer cells. The dynamic protein landscapes in the cancer cells prodded by the extracellular zinc treatment reveal the potential roles of the identified zinc-responsive proteins (e.g., triosephosphate isomerase, S100A13, tumour proteins hD53 and hD54, and tumour suppressor prohibitin) in breast and prostate cancers. This study, for the first time, simultaneously investigated the two kinds of cancer cells related to zinc dyshomeostasis, and the findings shed light on the molecular understanding of the breast and prostate cancer cells in response to extracellular zinc variation.

Also flagged:reproductionclassical swine feverCSFchromosomal regionchromosomeCAP
Journal Article 2024-01-12 No Snippets Hlongwane NL, Dzomba EF, Hadebe K, van der Nest MA, Pierneef R, Muchadeyi FC.
Show Full Abstract

South Africa boasts a diverse range of pig populations, encompassing intensively raised commercial breeds, as well as indigenous and village pigs reared under low-input production systems. The aim of this study was to investigate how natural and artificial selection have shaped the genomic landscape of South African pig populations sampled from different genetic backgrounds and production systems. For this purpose, the integrated haplotype score (iHS), as well as cross population extended haplotype homozygosity (XP-EHH) and Lewontin and Krakauer's extension of the <i>Fst</i> statistic based on haplotype information (HapFLK) were utilised. Our results revealed several population-specific signatures of selection associated with the different production systems. The importance of natural selection in village populations was highlighted, as the majority of genomic regions under selection were identified in these populations. Regions under natural and artificial selection causing the distinct genetic footprints of these populations also allow for the identification of genes and pathways that may influence production and adaptation. In the context of intensively raised commercial pig breeds (Large White, Kolbroek, and Windsnyer), the identified regions included quantitative loci (QTLs) associated with economically important traits. For example, meat and carcass QTLs were prevalent in all the populations, showing the potential of village and indigenous populations' ability to be managed and improved for such traits. Results of this study therefore increase our understanding of the intricate interplay between selection pressures, genomic adaptations, and desirable traits within South African pig populations.

HTT
Also flagged:neurodegenerative disorderssecretionfactorsamyotrophic lateral sclerosisALSNeurodegenerative Diseases
Journal Article 2024-01-12 ✓ 1 Snippet Bruno A, Milillo C, Anaclerio F, Buccolini C, Dell'Elice A, Angilletta I, Gatta M, Ballerini P, Antonucci I.
In-Text Gene Mentions

…an expanded huntingtin (HTT) protein.…

Show Full Abstract

Over the past 20 years, stem cell therapy has been considered a promising option for treating numerous disorders, in particular, neurodegenerative disorders. Stem cells exert neuroprotective and neurodegenerative benefits through different mechanisms, such as the secretion of neurotrophic factors, cell replacement, the activation of endogenous stem cells, and decreased neuroinflammation. Several sources of stem cells have been proposed for transplantation and the restoration of damaged tissue. Over recent decades, intensive research has focused on gestational stem cells considered a novel resource for cell transplantation therapy. The present review provides an update on the recent preclinical/clinical applications of gestational stem cells for the treatment of protein-misfolding diseases including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and amyotrophic lateral sclerosis (ALS). However, further studies should be encouraged to translate this promising therapeutic approach into the clinical setting.

Also flagged:reproductionamphetamineamphetamine addictionextracellular matrix-receptorCol1a1endocrine disorders
Journal Article 2024-01-12 No Snippets Zhang F, Tan Y, Cai Z, An K, Liu Y, Su J.
Show Full Abstract

<h4>Introduction</h4>Captivity serves as the primary method for enhancing animal survival and productivity. However, the stress induced by confinement can hinder animal growth and reproduction. The administration of drugs to captive animals can effectively regulate their stress response and can also be used inartificial breeding, reproduction, and experimental animalization of wild species. The plateau zokor (<i>Eospalax baileyi</i>), a subterranean herbivore, experiences significant stress during the captive process owing to its unique habitat.<h4>Methods</h4>In our study, we utilized <i>Radix astragali</i> (RA) and <i>Acanthopanax senticosus</i> (AS) extracts to intervene in the stress response of plateau zokors.<h4>Results</h4>Our findings demonstrated that RA and AS treatment considerably improved food intake and reduced weight loss, stress-related behavior, and stress hormone levels in plateau zokors. Furthermore, the excitatory pathway of amphetamine addition in the hypothalamus was suppressed by RA and AS treatment, acting through the <i>Grin</i> and <i>Prkc</i> gene families. Notably, after RA treatment, the extracellular matrix-receptor interaction pathway, enriched by the <i>Col1a1/3a1/1a2/6a1</i> gene, was significantly upregulated, potentially enhancing the immune function of captive plateau zokors.<h4>Discussion</h4>In conclusion, our research demonstrates that RA and AS treatment can effectively alleviate the stress response of plateau zokors in captive environments. The downregulation of the excitation pathway and upregulation of the immune pathway offer valuable insights into the response and potential mechanisms of plant-based drugs in mitigating animal stress.

Also flagged:neurological diseasesangiogenesiscerebrovascular diseasesaxonsvasculopathyCNS disease
Journal Article 2024-01-12 No Snippets Shen Z, Zhang S, Yu W, Yue M, Hong C.
Show Full Abstract

Optical coherence tomography angiography (OCTA), as a new generation of non-invasive and efficient fundus imaging technology, can provide non-invasive assessment of vascular lesions in the retina and choroid. In terms of anatomy and development, the retina is referred to as an extension of the central nervous system (CNS). CNS diseases are closely related to changes in fundus structure and blood vessels, and direct visualization of fundus structure and blood vessels provides an effective "window" for CNS research. This has important practical significance for identifying the characteristic changes of various CNS diseases on OCTA in the future, and plays a key role in promoting early screening, diagnosis, and monitoring of disease progression in CNS diseases. This article reviews relevant fundus studies by comparing and summarizing the unique advantages and existing limitations of OCTA in various CNS disease patients, in order to demonstrate the clinical significance of OCTA in the diagnosis and treatment of CNS diseases.

bioRxiv 2024-01-12 Preprint (No Snippets API) Bragg RM, Mathews EW, Grindeland A, Cantle JP, Howland D, Vogt T, Carroll JB.
Show Full Abstract

Huntington’s disease (HD) is a fatal neurogenerative disorder caused by an expanded glutamine-coding CAG tract in the Huntingtin (Htt) gene. HD is believed to primarily arise via a toxic gain of function, and as a result a wide range of Htt-lowering treatments are in clinical trials. The safety of these trials is contingent on the risks imposed by Htt lowering: Htt is widely conserved, ubiquitously expressed and its complete loss causes severe developmental symptoms in mice and humans. Recently, multiple labs have reported on the consequences of widespread inducible Htt loss in mice. One report describes that early induction of global Htt loss causes fatal pancreatitis, but that later onset lowering is benign. Another study did not report fatal pancreatitis but suggested that postnatal Htt loss was associated with widespread progressive phenotypes, including subcortical calcification and neurodegeneration. To better understand the risks posed by widespread inducible Htt loss we established the phenotypes of mice in which we knocked out Htt with two tamoxifen inducible Cre lines, which we have here extensively characterized. In short, we find that widespread loss of Htt at 2 months of age leads to a wide range of phenotypes, including subcortical calcification, but does not result in acute pancreatitis or histological changes in the pancreas. Additionally, we report here for the first time that Htt loss is followed by robust and sustained increases in the levels of neurofilament light chain (NfL), a peripherally accessible biomarker of neuroaxonal stress. These results confirm that complete loss of Htt in mice is associated with pronounced risks, including progressive subcortical calcification and neurodegeneration.

Also flagged:bipolar disorderCACNA1CANK3TRANK1CLOCKdisabling
Journal Article 2024-01-11 No Snippets Kong L, Chen Y, Shen Y, Zhang D, Wei C, Lai J, Hu S.
Show Full Abstract

With the advancements in gene sequencing technologies, including genome-wide association studies, polygenetic risk scores, and high-throughput sequencing, there has been a tremendous advantage in mapping a detailed blueprint for the genetic model of bipolar disorder (BD). To date, intriguing genetic clues have been identified to explain the development of BD, as well as the genetic association that might be applied for the development of susceptibility prediction and pharmacogenetic intervention. Risk genes of BD, such as CACNA1C, ANK3, TRANK1, and CLOCK, have been found to be involved in various pathophysiological processes correlated with BD. Although the specific roles of these genes have yet to be determined, genetic research on BD will help improve the prevention, therapeutics, and prognosis in clinical practice. The latest preclinical and clinical studies, and reviews of the genetics of BD, are analyzed in this review, aiming to summarize the progress in this intriguing field and to provide perspectives for individualized, precise, and effective clinical practice.

Also flagged:cardiovascular diseaseExtracellularCVDgene expressionlipidmetabolism
Journal Article 2024-01-11 No Snippets Searles CD.
Show Full Abstract

<h4>Purpose of review</h4>MicroRNAs (miRNAs)-short, non-coding RNAs-play important roles in almost all aspects of cardiovascular biology, and changes in intracellular miRNA expression are indicative of cardiovascular disease development and progression. Extracellular miRNAs, which are easily measured in blood and can be reflective of changes in intracellular miRNA levels, have emerged as potential non-invasive biomarkers for disease. This review summarizes current knowledge regarding miRNAs as biomarkers for assessing cardiovascular disease risk and prognosis.<h4>Recent findings</h4>Numerous studies over the last 10-15 years have identified associations between extracellular miRNA profiles and cardiovascular disease, supporting the potential use of extracellular miRNAs as biomarkers for risk stratification. However, clinical application of extracellular miRNA profiles has been hampered by poor reproducibility and inter-study variability that is due largely to methodological differences between studies. While recent studies indicate that circulating extracellular miRNAs are promising biomarkers for cardiovascular disease, evidence for clinical implementation is lacking. This highlights the need for larger, well-designed studies that use standardized methods for sample preparation, miRNA isolation, quantification, and normalization.

HTT
Also flagged:IronHDNucleicognitive impairmentsneurodegenerative disordercytosine
Journal Article 2024-01-11 ✓ 1 Snippet Yao J, Morrison MA, Jakary A, Avadiappan S, Rowley P, Glueck J, Driscoll T, Geschwind MD, Nelson AB, Possin KL, Xu D, Hess CP, Lupo JM.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Pathophysiological changes of Huntington's disease (HD) can precede symptom onset by decades. Robust imaging biomarkers are needed to monitor HD progression, especially before the clinical onset.<h4>Purpose</h4>To investigate iron dysregulation and microstructure alterations in subcortical regions as HD imaging biomarkers, and to associate such alterations with motor and cognitive impairments.<h4>Study type</h4>Prospective.<h4>Population</h4>Fourteen individuals with premanifest HD (38.0 ± 11.0 years, 9 females; far-from-onset N = 6, near-onset N = 8), 21 manifest HD patients (49.1 ± 12.1 years, 11 females), and 33 age-matched healthy controls (43.9 ± 12.2 years, 17 females).<h4>Field strength/sequence</h4>7 T, T<sub>1</sub>-weighted imaging, quantitative susceptibility mapping, and diffusion tensor imaging.<h4>Assessment</h4>Volume, susceptibility, fractional anisotropy (FA), and mean diffusivity (MD) within subcortical brain structures were compared across groups, used to establish HD classification models, and correlated to clinical measures and cognitive assessments.<h4>Statistical tests</h4>Generalized linear model, multivariate logistic regression, receiver operating characteristics with the area under the curve (AUC), and likelihood ratio test comparing a volumetric model to one that also includes susceptibility and diffusion metrics, Wilcoxon paired signed-rank test, and Pearson's correlation. A P-value <0.05 after Benjamini-Hochberg correction was considered statistically significant.<h4>Results</h4>Significantly higher striatal susceptibility and FA were found in premanifest and manifest HD preceding atrophy, even in far-from-onset premanifest HD compared to controls (putamen susceptibility: 0.027 ± 0.022 vs. 0.018 ± 0.013 ppm; FA: 0.358 ± 0.048 vs. 0.313 ± 0.039). The model with additional susceptibility, FA, and MD features showed higher AUC compared to volume features alone when differentiating premanifest HD from HC (0.83 vs. 0.66), and manifest from premanifest HD (0.94 vs. 0.83). Higher striatal susceptibility significantly correlated with cognitive deterioration in HD (executive function: r = -0.600; socioemotional function: r = -0.486).<h4>Data conclusion</h4>7 T MRI revealed iron dysregulation and microstructure alterations with HD progression, which could precede volume loss, provide added value to HD differentiation, and might be associated with cognitive changes.<h4>Evidence level</h4>2 TECHNICAL EFFICACY: Stage 2.

HTT
Also flagged:PeptidesHuntington's DiseaseHDneurodegenerative genetic disorderdeathPeptide
Journal Article 2024-01-11 ✓ 2 Snippets Ahamad S, Bano N, Khan S, Hussain MK, Bhat SA.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative genetic disorder characterized by a mutation in the huntingtin (HTT) gene, resulting in the production of a mutant huntingtin protein (mHTT).

…in the huntingtin (HTT) gene, resulting in…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative genetic disorder characterized by a mutation in the huntingtin (HTT) gene, resulting in the production of a mutant huntingtin protein (mHTT). The accumulation of mHTT leads to the development of toxic aggregates in neurons, causing cell dysfunction and, eventually, cell death. Peptide therapeutics target various aspects of HD pathology, including mHTT reduction and aggregation inhibition, extended CAG mRNA degradation, and modulation of dysregulated signaling pathways, such as BDNF/TrkB signaling. In addition, these peptide therapeutics also target the detrimental interactions of mHTT with InsP3R1, CaM, or Caspase-6 proteins to mitigate HD. This Perspective provides a detailed perspective on anti-HD therapeutic peptides, highlighting their design, structural characteristics, neuroprotective effects, and specific mechanisms of action. Peptide therapeutics for HD exhibit promise in preclinical models, but further investigation is required to confirm their effectiveness as viable therapeutic strategies, recognizing that no approved peptide therapy for HD currently exists.

DCC
Also flagged:intrahepatic cholangiocarcinomaliver cancerstumor suppressor genesoncogenesCas9Smad4
Journal Article 2024-01-11 ✓ 1 Snippet Feng Y, Zhao M, Wang L, Li L, Lei JH, Zhou J, Chen J, Wu Y, Miao K, Deng CX.
In-Text Gene Mentions

…both PCC andDCCare located outside…

Show Full Abstract

Intrahepatic cholangiocarcinoma (ICC) is the second most common malignancy among primary liver cancers, with an increasing overall incidence and poor prognosis. The intertumoral and intratumoral heterogeneity of ICC makes it difficult to find efficient drug therapies. Therefore, it is essential to identify tumor suppressor genes and oncogenes that induce ICC formation and progression. Here, we performed CRISPR/Cas9-mediated genome-wide screening in a liver-specific Smad4/Pten knockout mouse model (Smad4<sup>co/co</sup>;Pten<sup>co/co</sup>;Alb-Cre, abbreviated as SPC), which normally generates ICC after 6 months, and detected that mutations in Trp53, Fbxw7, Inppl1, Tgfbr2, or Cul3 markedly accelerated ICC formation. To illustrate the potential mechanisms, we conducted transcriptome sequencing and found that multiple receptor tyrosine kinases were activated, which mainly upregulated the PI3K pathway to induce cell proliferation. Remarkably, the Cul3 mutation stimulated cancer progression mainly by altering the immune microenvironment, whereas other mutations promoted the cell cycle. Moreover, Fbxw7, Inppl1, Tgfbr2, and Trp53 also affect inflammatory responses, apelin signaling, mitotic spindles, ribosome biogenesis, and nucleocytoplasmic transport pathways, respectively. We further examined FDA-approved drugs for the treatment of liver cancer and performed high-throughput drug screening of the gene-mutant organoids. Different drug responses and promising drug therapies, including chemotherapy and targeted drugs, have been discovered for ICC.

HTT
Also flagged:HDkynureninediacylglyceridescysteinenitric oxideurea
Journal Article 2024-01-11 ✓ 1 Snippet McGarry A, Hunter K, Gaughan J, Auinger P, Ferraro TN, Pradhan B, Ferrucci L, Egan JM, Moaddel R.
In-Text Gene Mentions

…vesicle susceptibility tohtt-induced permeability 31 .…

Show Full Abstract

Huntington's disease (HD) is increasingly recognized for diverse pathology outside of the nervous system. To describe the biology of HD in relation to functional progression, we previously analyzed the plasma and CSF metabolome in a cross-sectional study of participants who had various degrees of functional impairment. Here, we carried out an exploratory study in plasma from HD individuals over a 3-year time frame to assess whether differences exist between those with fast or absent clinical progression. There were more differences in circulating metabolite levels for fast progressors compared to absent progressors (111 vs 20, nominal p < 0.05). All metabolite changes in faster progressors were decreases, whereas some metabolite concentrations increased in absent progressors. Many of the metabolite levels that decreased in the fast progressors were higher at Screening compared to absent progressors but ended up lower by Year 3. Changes in faster progression suggest greater oxidative stress and inflammation (kynurenine, diacylglycerides, cysteine), disturbances in nitric oxide and urea metabolism (arginine, citrulline, ornithine, GABR), lower polyamines (putrescine and spermine), elevated glucose, and deficient AMPK signaling. Metabolomic differences between fast and absent progressors suggest the possibility of predicting functional decline in HD, and possibly delaying it with interventions to augment arginine, polyamines, and glucose regulation.

HFE
Also flagged:nonalcoholic fatty liver diseaseNAFLDβ-carotenecalciumcopperfolate
Journal Article 2024-01-11 ✓ 2 Snippets Liu K, Chen Y, Chen J, Chen W, Sun X, Mao Y, Ye D.
In-Text Gene Mentions

…in the geneHFE, rs57659670 is localized…

…TheHFEprotein functions to…

Show Full Abstract

Evidence from epidemiological literature on the association of circulating micronutrients with risk of nonalcoholic fatty liver disease (NAFLD) is inconsistent. We aimed to elucidate the causal relationships using Mendelian randomization (MR). Single-nucleotide polymorphisms associated with 14 circulating micronutrients (β-carotene, calcium, copper, folate, iron, magnesium, phosphorus, selenium, vitamin B6, B12, C, D, K1 and zinc) were employed as instrumental variables. Summary level data for NAFLD were obtained from a genome-wide association study (GWAS) meta-analysis of 8434 cases and 770,180 controls (discovery stage) and another two datasets including 1483 NAFLD cases and 17,781 controls (replication stage 1) and 2134 NAFLD cases and 33,433 controls (replication stage 2). Inverse variance-weighted method (IVW) was used as primary analysis, supplemented with a series of sensitivity analysis. Genetically predicted higher β‑carotene levels were suggestively associated with reduced NAFLD risk [odds ratio (OR) 0.81, 95% confidence interval (CI) 0.66-0.99; P = 0.047], whereas the association did not survive the false discovery rates (FDR) correction (P<sub>FDR</sub> = 0.164). Genetically predicted circulating iron (OR 1.16, 95% CI 1.05-1.29; P = 0.006, P<sub>FDR</sub> = 0.028), selenium (OR 1.11, 95% CI 1.03-1.20; P = 0.005, P<sub>FDR</sub> = 0.028) and vitamin B12 (OR 1.08, 95% CI 1.03-1.13; P = 0.002, P<sub>FDR</sub> = 0.028) were significantly associated with increased risk of NAFLD. Moreover, the findings were consistent in individual datasets (P<sub>heterogeneity</sub> > 0.05) and confirmed in sensitivity analysis. Our study provided evidence that circulating iron, selenium and vitamin B12 might be causally linked to the risk of NAFLD, which deserves further exploration of the potential biological mechanism.

Also flagged:GlioblastomaextracellularvesiclestumourGBMIDH
Journal Article 2024-01-11 No Snippets Hallal SM, Tűzesi Á, Sida LA, Xian E, Madani D, Muralidharan K, Shivalingam B, Buckland ME, Satgunaseelan L, Alexander KL.
Show Full Abstract

<h4>Background</h4>Biomarkers that reflect glioblastoma tumour activity and treatment response are urgently needed to help guide clinical management, particularly for recurrent disease. As the urinary system is a major clearance route of circulating extracellular vesicles (EVs; 30-1000 nm nanoparticles) we explored whether sampling urinary-EVs could serve as a simple and non-invasive liquid biopsy approach for measuring glioblastoma-associated biomarkers.<h4>Methods</h4>Fifty urine specimens (15-60 ml) were collected from 24 catheterised glioblastoma patients immediately prior to primary (n = 17) and recurrence (n = 7) surgeries, following gross total resection (n = 9), and from age/gender-matched healthy participants (n = 14). EVs isolated by differential ultracentrifugation were characterised and extracted proteomes were analysed by high-resolution data-independent acquisition liquid chromatography tandem mass spectrometry (DIA-LC-MS/MS).<h4>Results</h4>Overall, 6857 proteins were confidently identified in urinary-EVs (q-value ≤ 0.01), including 94 EV marker proteins. Glioblastoma-specific proteomic signatures were determined, and putative urinary-EV biomarkers corresponding to tumour burden and recurrence were identified (FC ≥ | 2 | , adjust p-val≤0.05, AUC > 0.9).<h4>Conclusion</h4>In-depth DIA-LC-MS/MS characterisation of urinary-EVs substantiates urine as a viable source of glioblastoma biomarkers. The promising 'liquid gold' biomarker panels described here warrant further investigation.

Also flagged:Agingcognitive declineneurodegenerative diseasesmtdOxidation Resistance 1OXR1
Journal Article 2024-01-11 No Snippets Wilson KA, Bar S, Dammer EB, Carrera EM, Hodge BA, Hilsabeck TAU, Bons J, Brownridge GW, Beck JN, Rose J, Granath-Panelo M, Nelson CS, Qi G, Gerencser AA, Lan J, Afenjar A, Chawla G, Brem RB, Campeau PM, Bellen HJ, Schilling B, Seyfried NT, Ellerby LM, Kapahi P.
Show Full Abstract

Dietary restriction (DR) delays aging, but the mechanism remains unclear. We identified polymorphisms in mtd, the fly homolog of OXR1, which influenced lifespan and mtd expression in response to DR. Knockdown in adulthood inhibited DR-mediated lifespan extension in female flies. We found that mtd/OXR1 expression declines with age and it interacts with the retromer, which regulates trafficking of proteins and lipids. Loss of mtd/OXR1 destabilized the retromer, causing improper protein trafficking and endolysosomal defects. Overexpression of retromer genes or pharmacological restabilization with R55 rescued lifespan and neurodegeneration in mtd-deficient flies and endolysosomal defects in fibroblasts from patients with lethal loss-of-function of OXR1 variants. Multi-omic analyses in flies and humans showed that decreased Mtd/OXR1 is associated with aging and neurological diseases. mtd/OXR1 overexpression rescued age-related visual decline and tauopathy in a fly model. Hence, OXR1 plays a conserved role in preserving retromer function and is critical for neuronal health and longevity.

MLLT10
Also flagged:TumorAMLCD3CD45CD33APC
Journal Article 2024-01-11 ✓ 5 Snippets Umeda M, Ma J, Westover T, Ni Y, Song G, Maciaszek JL, Rusch M, Rahbarinia D, Foy S, Huang BJ, Walsh MP, Kumar P, Liu Y, Yang W, Fan Y, Wu G, Baker SD, Ma X, Wang L, Alonzo TA, Rubnitz JE, Pounds S, Klco JM.
In-Text Gene Mentions

By contrast, defining mutations of AML-MR in WHO5th were overall rare (range 0.1–2.1%), frequently co-occurred with other defining alterations (for example, EZH2 in PICALM::MLLT10), and could be found in various clusters rather than as a distinct group (Extended Data Fig. 3a,f), leading to its exclusion as a defining category for pAML.

Notably, among KMT2A fusion partners, MLLT3 and MLLT10 were found in both monocytic AML and AMKL; however, these fusions preferentially show AMKL phenotypes in infants, suggesting that AMKL phenotypes are defined both by driver alterations and by developmental stages as discussed previously43,44.

…Table 12 ), PICALM::MLLT10, KAT6A rearrangements,…

…example, EZH2 in PICALM::MLLT10), and could…

…partners, MLLT3 andMLLT10were found in…

Show Full Abstract

Recent studies on pediatric acute myeloid leukemia (pAML) have revealed pediatric-specific driver alterations, many of which are underrepresented in the current classification schemas. To comprehensively define the genomic landscape of pAML, we systematically categorized 887 pAML into 23 mutually distinct molecular categories, including new major entities such as UBTF or BCL11B, covering 91.4% of the cohort. These molecular categories were associated with unique expression profiles and mutational patterns. For instance, molecular categories characterized by specific HOXA or HOXB expression signatures showed distinct mutation patterns of RAS pathway genes, FLT3 or WT1, suggesting shared biological mechanisms. We show that molecular categories were strongly associated with clinical outcomes using two independent cohorts, leading to the establishment of a new prognostic framework for pAML based on these updated molecular categories and minimal residual disease. Together, this comprehensive diagnostic and prognostic framework forms the basis for future classification of pAML and treatment strategies.

DDX27
Also flagged:SLMO2lipid transporterphosphatidylserinemitochondriaPRELID3Blipid
Journal Article 2024-01-11 ✓ 5 Snippets Liu X, Yuan R, Peng J, Xu A, Nie X, Tang R, Li G.
In-Text Gene Mentions

And we found the DDX27, DEGS1, MRPL15, MTAP, NAA50, TRAM2, TRIAP1, TUBB1, WAC and SLMO2 present obvious positive correlation in most tumors (Fig. 8B).

…we found theDDX27, DEGS1, MRPL15, MTAP,…

DDX27and NELFCD were…

…analysis indicated thatDDX27and NELFCD were…

…SLMO2 showed thatDDX27and NELFCD were…

Show Full Abstract

SLMO2 is a lipid transporter that transports phosphatidylserine to the interior of mitochondria, also known as PRELID3B, which plays an important role in lipid metabolism. It has also been reported to be involved in the growth process of breast and lung tumors. However, its functions and underlying mechanisms in cancer progress remain elusive, and the potential as pan-cancer biomarker and therapeutic target remains unexplored. Using the TCGA project and GEO database, we performed pan-cancer analysis of SLMO2, which including the expression pattern, prognostic value, mutation landscape, methylation modification, protein-protein interaction network and the relationship between SLMO2 expression and immune infiltration. KEGG enrichment analysis was also performed to predict function and relevant cellular pathways of SLMO2. In addition, proliferation and migration assays were performed to detect the proliferation and metastasis capacity of breast cancer and lung cancer cells. In our study, we found that SLMO2 was overexpressed in pan-cancer and the elevated expression of SLMO2 was correlated with poorer prognosis. SLMO2 mutations were distributed in a variety of tumors and correlated with prognosis. Promoter methylation analysis showed that SLMO2 methylation levels were lower in most tumors compared with normal tissues, while a few tumors showed increased methylation levels of SLMO2. SLMO2 expression was also positively correlated with immune infiltration of MDSCs. Further pathway enrichment analysis indicated that SLMO2 was involved in regulating of cytoplasmic transport and other oncogenic processes. In vitro experiments have shown that SLMO2 promotes the proliferation and migration of breast cancer and lung cancer cells. In conclusion, our findings suggested that SLMO2 was a potential prognostic and immunological marker in pan-cancer. This study suggested a potential strategy for targeting SLMO2 to treat tumors, including manipulating tumor growth or the tumor microenvironment, especially the infiltration of MDSC.

Also flagged:agingcollagendegradationCHSCDXSkin disorder
Journal Article 2024-01-11 No Snippets Hoang TH, Vu DM, Vu GM, Nguyen TK, Do NM, Duong VC, Pham TL, Tran MH, Khanh Nguyen LT, Han HTT, Can TT, Pham TH, Pham TD, Nguyen TH, Do HP, Vo NS, Nguyen XH.
Show Full Abstract

<h4>Background</h4>Most skin-related traits have been studied in Caucasian genetic backgrounds. A comprehensive study on skin-associated genetic effects on underrepresented populations such as Vietnam is needed to fill the gaps in the field.<h4>Objectives</h4>We aimed to develop a computational pipeline to predict the effect of genetic factors on skin traits using public data (GWAS catalogs and whole-genome sequencing (WGS) data from the 1000 Genomes Project-1KGP) and in-house Vietnamese data (WGS and genotyping by SNP array). Also, we compared the genetic predispositions of 25 skin-related traits of Vietnamese population to others to acquire population-specific insights regarding skin health.<h4>Methods</h4>Vietnamese cohorts of whole-genome sequencing (WGS) of 1008 healthy individuals for the reference and 96 genotyping samples (which do not have any skin cutaneous issues) by Infinium Asian Screening Array-24 v1.0 BeadChip were employed to predict skin-associated genetic variants of 25 skin-related and micronutrient requirement traits in population analysis and correlation analysis. Simultaneously, we compared the landscape of cutaneous issues of Vietnamese people with other populations by assessing their genetic profiles.<h4>Results</h4>The skin-related genetic profile of Vietnamese cohorts was similar at most to East Asian cohorts (JPT: Fst = 0.036, CHB: Fst = 0.031, CHS: Fst = 0.027, CDX: Fst = 0.025) in the population study. In addition, we identified pairs of skin traits at high risk of frequent co-occurrence (such as skin aging and wrinkles (r = 0.45, p = 1.50e-5) or collagen degradation and moisturizing (r = 0.35, p = 1.1e-3)).<h4>Conclusion</h4>This is the first investigation in Vietnam to explore genetic variants of facial skin. These findings could improve inadequate skin-related genetic diversity in the currently published database.

Also flagged:epilepsyprotein tyrosine phosphatase receptor-type OPTPROLRRK2GADD45Aneurological disorder
Journal Article 2024-01-11 No Snippets Wang S, Xie Z, Jun T, Ma X, Zhang M, Rao F, Xu H, Lu J, Ding X, Li Z.
Show Full Abstract

<h4>Background</h4>Epilepsy, a central neurological disorder, has a complex genetic architecture. There is some evidence suggesting that genetic factors play a role in both the occurrence of epilepsy and its treatment. However, the genetic determinants of epilepsy are largely unknown. This study aimed to identify potential therapeutic targets for epilepsy.<h4>Methods</h4>Differentially expressed genes (DEGs) were extracted from the expression profiles of GSE44031 and GSE1834. Gene co-expression analysis was used to confirm the regulatory relationship between newly discovered epilepsy candidate genes and known epilepsy genes. Expression quantitative trait loci analysis was conducted to determine if epilepsy risk single-nucleotide polymorphisms regulate DEGs' expression in human brain tissue. Finally, protein-protein interaction analysis and drug-gene interaction analysis were performed to assess the role of DEGs in epilepsy treatment.<h4>Results</h4>The study found that the protein tyrosine phosphatase receptor-type O gene (PTPRO) and the growth arrest and DNA damage inducible alpha gene (GADD45A) were significantly upregulated in epileptic rats compared to controls in both datasets. Gene co-expression analysis revealed that PTPRO was co-expressed with RBP4, NDN, PAK3, FOXG1, IDS, and IDS, and GADD45A was co-expressed with LRRK2 in human brain tissue. Expression quantitative trait loci analysis suggested that epilepsy risk single-nucleotide polymorphisms could be responsible for the altered PTPRO and GADD45A expression in human brain tissue. Moreover, the protein encoded by GADD45A had a direct interaction with approved antiepileptic drug targets, and GADD45A interacts with genistein and cisplatin.<h4>Conclusions</h4>The results of this study highlight PTPRO and GADD45A as potential genes for the diagnosis and treatment of epilepsy.

Also flagged:gene expressionchromosomedilated cardiomyopathychromatinnucleuscell cycle
Journal Article 2024-01-11 No Snippets Patil AH, McCall MN, Halushka MK.
Show Full Abstract

Altered open chromatin regions, impacting gene expression, is a feature of some human disorders. We discovered it is possible to detect global changes in genomically-related adjacent gene co-expression within single cell RNA sequencing (scRNA-seq) data. We built a software package to generate and test non-randomness using 'Brooklyn plots' to identify the percent of genes significantly co-expressed from the same chromosome in ∼10 MB intervals across the genome. These plots establish an expected low baseline of co-expression in scRNA-seq from most cell types, but, as seen in dilated cardiomyopathy cardiomyocytes, altered patterns of open chromatin appear. These may relate to larger regions of transcriptional bursting, observable in single cell, but not bulk datasets.

PLCL1
Also flagged:cancertumorcutaneous melanomasBRAFRasMEK
Journal Article 2024-01-11 ✓ 1 Snippet Schillo JL, Feddersen CR, Peplinski RM, Powell LS, Varzavand A, Stipp CS, Riordan JD, Dupuy AJ.
In-Text Gene Mentions

…MITF, LPAR1 andPLCL1have all been…

Show Full Abstract

The evolution of therapeutic resistance is a major obstacle to the success of targeted oncology drugs. While both inter- and intratumoral heterogeneity limit our ability to detect resistant subpopulations that pre-exist or emerge during treatment, our ability to analyze tumors with single-cell resolution is limited. Here, we utilized a cell-based transposon mutagenesis method to identify mechanisms of BRAF inhibitor resistance in a model of cutaneous melanoma. This screen identified overexpression of NEDD4L and VGLL3 as significant drivers of BRAF inhibitor resistance <i>in vivo</i>. In addition, we describe a novel single-cell genomics profiling method to genotype thousands of individual cells within tumors driven by transposon mutagenesis. This approach revealed a surprising genetic diversity among xenograft tumors and identified recurrent co-occurring mutations that emerge within distinct tumor subclones. Taken together, these observations reveal an unappreciated genetic complexity that drives BRAF inhibitor resistance.

DCC
Also flagged:distal cholangiocarcinoma
Journal Article 2024-01-11 ✓ 1 Snippet Zhang C, Wang L, Zheng Z, Wang L, Xiao Y, Zhao B, Dong H, Li J.
In-Text Gene Mentions

…for ER ofDCC(All P values…

Show Full Abstract

<h4>Purpose</h4>To improve the preoperative prediction efficacy for patients with risk for early recurrence (ER) of distal cholangiocarcinoma (DCC).<h4>Methods</h4>56 patients pathologically diagnosed as DCC were included. Their clinical data and preoperative upper abdominal enhanced MSCT images were retrospectively reviewed to look for risk factors associated with ER. ER scores were calculated by Distal Cholangiocarcinoma Early Recurrence (DICER) score and optimized ER score (OERS). Chi-square test or Mann-Whitney U test was used to compare the differences between ER group and Non-ER group, DICER score and OERS, and TNM stage and OERS. Binary logistic regression analyses were performed to identify risk factors of ER.<h4>Results</h4>Of 56 DCC patients, 15 (26.8 %) experienced ER who were classified as ER group. Patients in ER group had significantly higher percentage of soft tissue around superior mesenteric artery (STASMA), positive lymph node, microvascular invasion and TNM stage III than those in Non-ER group, among which STASMA and positive lymph node were found to be independent risk factors for ER of DCC (All P values < 0.050). DICER score was optimized by adding STASMA and positive lymph node score to form OERS. OERS predicted more accurately than DICER score in low- and high-risk patients for ER of DCC (30.0 % vs. 0 %, 50.0 % vs. 75.0 %, P < 0.001).<h4>Conclusions</h4>By adding preoperative imaging indicators, OERS could improve the predictive efficacy for ER of DCC.

Also flagged:immune responsedemineralizationperiodontal lesionsmineralsapatitetricalcium phosphate
Journal Article 2024-01-11 No Snippets Kučera J, Lofaj F, Nagyová-Krchova Z, Šurín Hudáková N, Vojtko M, Březina V.
Show Full Abstract

The issue of bone volume loss is playing an increasing role in bone tissue engineering. Research has focused on studying the preparation and use of different types of human or xenogenic materials and their osteogenic properties. An alternative source for this purpose could be autologous extracted teeth. The simple preparation protocol, minimal immune response, and rapid organizing of the newly formed bone with optimal mechanical properties predispose autologous hard teeth tissues (HTTs) as a promising material suitable in the indication of augmentation of maxillary and mandible defects, comparable to other high-end augmentation materials. The aim of this study was to experimentally evaluate the osteogenic potential of ground native autologous HTTs prepared by different demineralization procedures, aimed at potentiating the osteoinductive and osteoconductive properties of their organic components. The results indicate that the most effective preparation process for HTT stimulation is the application of Cleanser for 10 min followed by exposure to 0.6 N HCl for 5 min with a wash in phosphate-buffered saline solution.

Also flagged:Calciumfermentationorganic acidpeptidemineralcations
Journal Article 2024-01-11 No Snippets Meng J, Wang Y, Cao J, Teng W, Wang J, Zhang Y.
Show Full Abstract

Two fermenters, <i>Lactobacillus acidophilus</i> (LA) and the active dry yellow wine yeast (HY), were utilized to ferment cattle bones in order to release calcium. The influences of fermenters and the fermentation process on the calcium release capacity, particle properties, morphology, and chemical composition of bone powders were assessed, and the underlying mechanism was discussed. The results showed that LA had a better capacity of acid production than yeast, and therefore released more calcium during the fermentation of bone powders. The released calcium in the fermentation broth mainly existed in the forms of free Ca<sup>2+</sup> ions, organic acid-bound calcium and a small amount of calcium-peptide chelate. For bone powders, the fermentation induced swollen bone particles, increased particle size, and significant changes of the internal chemical structure. Therefore, fermentation has a great potential in the processing of bone-derived products, particularly to provide new ideas for the development of calcium supplement products.

OLFM4
Also flagged:digestiontrypsinchymotrypsinpeptidesEndopeptidasecolitis
Journal Article 2024-01-11 ✓ 1 Snippet Wang H, Chi X, Zhang D.
In-Text Gene Mentions

…Lgr5, Ascl2, OCT4,Olfm4, etc. […

Show Full Abstract

Oat protein is unstable in intestinal fluid digestion, and it is easily degraded by trypsin and chymotrypsin, producing low molecular weight peptides. Endopeptidase hydrolysis can improve the bioavailability of active peptides and avoid further digestion in the gastrointestinal tract. Antimicrobial peptides (AMPs) can effectively improve host immunity, but most related studies focus on physiology and ecology, and there are few reports on their molecular level. Therefore, in this article, oat peptides were prepared via the simulated digestion method in vitro, and the main metabolites and action factors affecting colitis were screened by using the multi-omics methods in a high-throughput mode to analyze the effect and mechanism of colitis. Firstly, oat antimicrobial peptides were prepared from cationic resin combined with HPLC, and the anti-inflammatory effects of antimicrobial peptides were analyzed in vitro through the use of human colon epithelial (HCoEpiC) anti-inflammatory cells. In vivo experiments using rats have verified that AMPs can effectively prevent colitis caused by dextran sodium sulfate (DSS), reduce intestinal inflammatory cell infiltration and glandular disappearance in the colon, and reduce the apoptosis rate of colon cells. Secondly, metabolomics and transcriptomics were combined to analyze the mechanism of preventing enteritis, and it was found that oat antimicrobial peptides can promote DAG diglycerol production and inhibit the activation of T helper cells (TH), resulting in the down-regulation of key factors in the main downstream pathways of TH1, TH2 and TH17, and inhibit the production of inflammatory cells. At the same time, AMP can activate the wnt pathway, improve the expression of key genes of wnt and frizzled, promote the generation of intestinal stem cells, facilitate the differentiation and repair of intestinal epithelial cells, and prevent the generation of enteritis. Finally, the underlying genetic regulatory network of the important pathway was constructed from the effect of AMP on rat colitis.

Also flagged:TumorCancercell growthMalignant tumorscytoskeletonextracellular
Journal Article 2024-01-11 No Snippets Graf J, Schulz H, Wehland M, Corydon TJ, Sahana J, Abdelfattah F, Wuest SL, Egli M, Krüger M, Kraus A, Wise PM, Infanger M, Grimm D.
Show Full Abstract

Cancer is defined as a group of diseases characterized by abnormal cell growth, expansion, and progression with metastasis. Various signaling pathways are involved in its development. Malignant tumors exhibit a high morbidity and mortality. Cancer research increased our knowledge about some of the underlying mechanisms, but to this day, our understanding of this disease is unclear. High throughput omics technology and bioinformatics were successful in detecting some of the unknown cancer mechanisms. However, novel groundbreaking research and ideas are necessary. A stay in orbit causes biochemical and molecular biological changes in human cancer cells which are first, and above all, due to microgravity (µ<i>g</i>). The µ<i>g</i>-environment provides conditions that are not reachable on Earth, which allow researchers to focus on signaling pathways controlling cell growth and metastasis. Cancer research in space already demonstrated how cancer cell-exposure to µ<i>g</i> influenced several biological processes being involved in cancer. This novel approach has the potential to fight cancer and to develop future cancer strategies. Space research has been shown to impact biological processes in cancer cells like proliferation, apoptosis, cell survival, adhesion, migration, the cytoskeleton, the extracellular matrix, focal adhesion, and growth factors, among others. This concise review focuses on publications related to genetic, transcriptional, epigenetic, proteomic, and metabolomic studies on tumor cells exposed to real space conditions or to simulated µ<i>g</i> using simulation devices. We discuss all omics studies investigating different tumor cell types from the brain and hematological system, sarcomas, as well as thyroid, prostate, breast, gynecologic, gastrointestinal, and lung cancers, in order to gain new and innovative ideas for understanding the basic biology of cancer.

SOX6
Also flagged:gelatincalcium chlorideplatelet growth factorsPlatelet activationgene expressionwound healing
Journal Article 2024-01-11 ✓ 5 Snippets Mata M, Salvador-Clavell R, Ródenas-Rochina J, Sancho-Tello M, Gallego Ferrer G, Gómez Ribelles JL.
In-Text Gene Mentions

…, MMP13 ,SOX6and SOX9 and,…

…the expression ofSOX6and SOX9 was…

…the expression ofSOX6and SOX9 ,…

…regulation of the SOX5-SOX6axis, which leads…

…inducers, such asSOX6[ 41 ].…

Show Full Abstract

The aim of this work is to study the effect of platelet factors on the differentiation of mesenchymal stem cells (MSCs) to hyaline cartilage chondrocytes in a three-dimensional environment. MSCs were cultured in a microgel environment with a chondrogenic medium. The microgel consisted of microspheres that combine gelatin and platelet-rich plasma (PRP). The gelatin/PRP microdroplets were produced by emulsion. The gelatin containing the microdroplets was enzymatically gelled, retaining PRP and, just before seeding the cells, platelets were activated by adding calcium chloride so that platelet growth factors were released into the culture media but not before. Platelet activation was analyzed before activation to rule out the possibility that the gelatin cross-linking process itself activated the platelets. The gene expression of characteristic chondrogenic markers and miRNA expression were analyzed in cells cultured in a differentiation medium and significant differences were found between gelation/PRP microgels and those containing only pure gelatin. In summary, the gelatin microspheres effectively encapsulated platelets that secreted and released factors that significantly contributed to cellular chondrogenic differentiation. At the same time, the microgel constituted a 3D medium that provided the cells with adherent surfaces and the possibility of three-dimensional cell-cell contact.

Also flagged:protein degradationinflammatory diseasesneurodegenerative diseasesmalignant tumorsautophagylysosomes
Journal Article 2024-01-11 No Snippets Wang S, He F, Tian C, Sun A.
Show Full Abstract

PROTAC is a rapidly developing engineering technology for targeted protein degradation using the ubiquitin-proteasome system, which has promising applications for inflammatory diseases, neurodegenerative diseases, and malignant tumors. This paper gives a brief overview of the development and design principles of PROTAC, with a special focus on PROTAC-based explorations in recent years aimed at achieving controlled protein degradation and improving the bioavailability of PROTAC, as well as TPD technologies that use other pathways such as autophagy and lysosomes to achieve targeted protein degradation.

Also flagged:cancerangiogenesistriterpenesVEGF165cell proliferationmadecassoside
Journal Article 2024-01-11 No Snippets Zhao B, Li Y, Wang B, Liu J, Yang Y, Quan Q, An Q, Liang R, Liu C, Yang C.
Show Full Abstract

<h4>Background</h4><i>Centella asiatica</i> (CA) has been used to address cancer for centuries in traditional Chinese medicine (TCM). Previous studies demonstrated its anti-angiogenesis efficacy, but the underlying mechanism of its action remains to be further clarified. This study aims to investigate the underlying mechanisms of CA and its triterpenes in anti-angiogenesis for cancer therapeutics through network pharmacology and experimental validation.<h4>Methods</h4>Cytoscape was used to construct a network of compound-disease targets and protein-protein interactions (PPIs) from which core targets were identified. GO and KEGG analyses were performed using Metascape, and the AutoDock-Vina program was used to realize molecular docking for further verification. Then, VEGF165 was employed to establish an induced angiogenesis model. The anti-angiogenic effects of CA were evaluated through assays measuring cell proliferation, migration, and tubular structure formation.<h4>Results</h4>Twenty-five active ingredients in CA had potential targets for anti-angiogenesis including madecassoside, asiaticoside, madecassic acid, asiatic acid, and asiaticoside B. In total, 138 potential targets for CA were identified, with 19 core targets, including STAT3, SRC, MAPK1, and AKT1. A KEGG analysis showed that CA is implicated in cancer-related pathways, specifically PD-1 and AGE-RAGE. Molecular docking verified that the active components of CA have good binding energy with the first four important targets of angiogenesis. In experimental validation, the extracts and triterpenes of CA improved VEGF165-induced angiogenesis by reducing the proliferation, migration, and tube formation of human umbilical vein endothelial cells (HUVECs).<h4>Conclusions</h4>Our results initially demonstrate the effective components and great anti-angiogenic activity of CA. Evidence of the satisfactory anti-angiogenic action of the extracts and triterpenes from CA was verified, suggesting CA's significant potential as a prospective agent for the therapy of cancer.

Also flagged:microspheresbacterial infectionhydroxyapatitewaterdegradationgraphene
Journal Article 2024-01-11 No Snippets Wu J, Wang C, Zhang S, Zhang L, Hao J, Jia Z, Zheng X, Lv Y, Fu S, Zhang G.
Show Full Abstract

The purpose of this study is to explore the possibility of using graphene-zinc oxide-hydroxyapatite (GO/ZnO/nHAp) composite microspheres as bone regeneration materials by making use of the complementary advantages of nanocomposites, so as to provide reference for the clinical application of preventing and solving bacterial infection after implantation of synthetic materials. Firstly, GO/ZnO composites and hydroxyapatite nanoparticles were synthesized using the hydrothermal method, and then GO/ZnO/nHAp composite microspheres were prepared via high-temperature sintering. The graphene-zinc oxide-calcium phosphate composite microspheres were characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FE-SEM), X-ray photoelectron spectroscopy (XPS), energy dispersion spectroscopy (EDS), water contact angle measurement, degradation and pH determination, and differential thermal analysis (DiamondTG/DTA). The biocompatibility, osteogenic activity, and antibacterial activity of GO/ZnO/nHAp composite microspheres were further studied. The results of the cell experiment and antibacterial experiment showed that 0.5% and 1% GO-ZnO-nHAp composite microspheres not only had good biocompatibility and osteogenic ability but also inhibited <i>Escherichia coli</i> and <i>Staphylococcus aureus</i> by more than 45% and 70%. Therefore, GO/ZnO/nHAp composite microspheres have good physical and chemical properties and show good osteogenic induction and antibacterial activity, and this material has the possibility of being used as a bone regeneration material.

Also flagged:immunometabolismColitiscolorectal cancerimmune responsesimmune diseasescancer
Journal Article 2024-01-11 No Snippets Zhang J, Chen C, Yan W, Fu Y.
Show Full Abstract

Colitis associated colorectal cancer is a disease with a high incidence and complex course that develops from chronic inflammation and deteriorates after various immune responses and inflammation-induced attacks. Colitis associated colorectal cancer has the characteristics of both immune diseases and cancer, and the similarity of treatment models contributes to the similar treatment dilemma. Immunometabolism contributes to the basis of life and is the core of many immune diseases. Manipulating metabolic signal transduction can be an effective way to control the immune process, which is expected to become a new target for colitis associated colorectal cancer therapy. Immune cells participate in the whole process of colitis associated colorectal cancer development by transforming their functional condition via changing their metabolic ways, such as glucose, lipid, and amino acid metabolism. The same immune and metabolic processes may play different roles in inflammation, dysplasia, and carcinoma, so anti-inflammation agents, immunomodulators, and agents targeting special metabolism should be used in combination to prevent and inhibit the development of colitis associated colorectal cancer.

Also flagged:pigmentationreproductionnucleotidechromosomesReplication forkreplication forks
Journal Article 2024-01-11 No Snippets Liu X, Chen W, Huang B, Wang X, Peng Y, Zhang X, Chai W, Khan MZ, Wang C.
Show Full Abstract

Copy number variations (CNVs) have garnered increasing attention within the realm of genetics due to their prevalence in human, animal, and plant genomes. These structural genetic variations have demonstrated associations with a broad spectrum of phenotypic diversity, economic traits, environmental adaptations, epidemics, and other essential aspects of both plants and animals. Furthermore, CNVs exhibit extensive sequence variability and encompass a wide array of genomes. The advancement and maturity of microarray and sequencing technologies have catalyzed a surge in research endeavors pertaining to CNVs. This is particularly prominent in the context of livestock breeding, where molecular markers have gained prominence as a valuable tool in comparison to traditional breeding methods. In light of these developments, a contemporary and comprehensive review of existing studies on CNVs becomes imperative. This review serves the purpose of providing a brief elucidation of the fundamental concepts underlying CNVs, their mutational mechanisms, and the diverse array of detection methods employed to identify these structural variations within genomes. Furthermore, it seeks to systematically analyze the recent advancements and findings within the field of CNV research, specifically within the genomes of herbivorous livestock species, including cattle, sheep, horses, and donkeys. The review also highlighted the role of CNVs in shaping various phenotypic traits including growth traits, reproductive traits, pigmentation and disease resistance etc., in herbivorous livestock. The main goal of this review is to furnish readers with an up-to-date compilation of knowledge regarding CNVs in herbivorous livestock genomes. By integrating the latest research findings and insights, it is anticipated that this review will not only offer pertinent information but also stimulate future investigations into the realm of CNVs in livestock. In doing so, it endeavors to contribute to the enhancement of breeding strategies, genomic selection, and the overall improvement of herbivorous livestock production and resistance to diseases.

TNFSF4
Also flagged:blindnesskeratitiskeratoconusfungal keratitishostadaptive immunity
Journal Article 2024-01-11 ✓ 4 Snippets Lapp T, Kammrath Betancor P, Schlunck G, Auw-Hädrich C, Maier P, Lange C, Reinhard T, Wolf J.
In-Text Gene Mentions

A functionally grouped network analysis identified subnetworks of signaling pathways involved in the response to viral infections in the human cornea (Figures 2B, C), among them T cell related pathways (e.g., IKZF3, ZAP70, CD8A, and SIT1), T cell receptor signaling (e.g., CXCL9, FYN, and CXCL13), B cell related pathways (e.g., IGKC, IGLC2, and CD79A), and interferon gamma signaling pathways (e.g., IRF8, TNFSF4, and CCR7).

Some of the identified viral genes are also involved in other viral diseases, such as IKZF3 which promotes proliferation of HIV-1-infected cells (Wei et al., 2023), IRF8 which is involved in the induction of downstream antiviral genes in monocytes by DNA viruses (such as HSV-1) but not RNA viruses (Luo et al., 2022), and variants in TNFSF4 which are associated with the risk of HCV infection (Fu et al., 2021).

…(e.g., IRF8 ,TNFSF4, and CCR7…

…and variants inTNFSF4which are associated…

Show Full Abstract

<h4>Purpose</h4>Corneal infections are a leading cause of visual impairment and blindness worldwide. Here we applied high-resolution transcriptomic profiling to assess the general and pathogen-specific molecular and cellular mechanisms during human corneal infection.<h4>Methods</h4>Clinical diagnoses of herpes simplex virus (HSV) (n=5) and bacterial/fungal (n=5) keratitis were confirmed by histology. Healthy corneas (n=7) and keratoconus (n=4) samples served as controls. Formalin-fixed, paraffin-embedded (FFPE) human corneal specimens were analyzed using the 3' RNA sequencing method Massive Analysis of cDNA Ends (MACE RNA-seq). The cellular host response was investigated using comprehensive bioinformatic deconvolution (xCell and CYBERSORTx) analyses and by integration with published single cell RNA-seq data of the human cornea.<h4>Results</h4>Our analysis identified 216 and 561 genes, that were specifically overexpressed in viral or bacterial/fungal keratitis, respectively, and allowed to distinguish the two etiologies. The virus-specific host response was driven by adaptive immunity and associated molecular signaling pathways, whereas the bacterial/fungal-specific host response mainly involved innate immunity signaling pathways and cell types. We identified several genes and pathways involved in the host response to infectious keratitis, including CXCL9, CXCR3, and MMP9 for viral, and S100A8/A9, MMP9, and the IL17 pathway for bacterial/fungal keratitis.<h4>Conclusions</h4>High-resolution molecular profiling provides new insights into the human corneal host response to viral and bacterial/fungal infection. Pathogen-specific molecular profiles may provide the foundation for novel diagnostic biomarker and therapeutic approaches that target inflammation-induced damage to corneal host cells with the goal to improve the outcome of infectious keratitis.

BTN2A1
Also flagged:cancerschimeric antigen receptorhematologicalhuman leukocyte antigengraft-versus-host diseaseadaptive immunity
Journal Article 2024-01-11 ✓ 1 Snippet Wang CQ, Lim PY, Tan AH.
In-Text Gene Mentions

Based on newly acquired knowledge on the mechanism of Vγ9Vδ2 T cell activation, agonistic antibodies directed against BTN3A1 and BTN2A1 (90, 91) can be used to heighten sensitivity of tumor cells to γδ T cell killing and offers a promising therapeutic strategy to enhance γδ T cell cytotoxicity.

Show Full Abstract

Adoptive cellular immunotherapy as a new paradigm to treat cancers is exemplified by the FDA approval of six chimeric antigen receptor-T cell therapies targeting hematological malignancies in recent years. Conventional αβ T cells applied in these therapies have proven efficacy but are confined almost exclusively to autologous use. When infused into patients with mismatched human leukocyte antigen, αβ T cells recognize tissues of such patients as foreign and elicit devastating graft-versus-host disease. Therefore, one way to overcome this challenge is to use naturally allogeneic immune cell types, such as γδ T cells. γδ T cells occupy the interface between innate and adaptive immunity and possess the capacity to detect a wide variety of ligands on transformed host cells. In this article, we review the fundamental biology of γδ T cells, including their subtypes, expression of ligands, contrasting roles in and association with cancer prognosis or survival, as well as discuss the gaps in knowledge pertaining to this cell type which we currently endeavor to elucidate. In addition, we propose how to harness the unique properties of γδ T cells for cellular immunotherapy based on lessons gleaned from past clinical trials and provide an update on ongoing trials involving these cells. Lastly, we elaborate strategies that have been tested or can be explored to improve the anti-tumor activity and durability of γδ T cells <i>in vivo</i>.

SOX6
Also flagged:CRYABgliomaglioblastomatumors-cell differentiationGliomas
Journal Article 2024-01-11 ✓ 5 Snippets Cai HB, Zhao MY, Li XH, Li YQ, Yu TH, Wang CZ, Wang LN, Xu WY, Liang B, Cai YP, Zhang F, Hong WM.
In-Text Gene Mentions

Notably, the C1 SOX6+ Oligodendrocytes subpopulation showed a higher percentage in state1 and state6, while the C0 DOCK5+ GBM subpopulation was almost 100% present in state3 and state5.

Our results indicated that PSAP released from eight cell types could potentially target the C0 DOCK5+ GBM subpopulation, the C1 SOX6+ Oligodendrocytes subpopulation, and the C2 CRYAB+ GBM subpopulation, while PSAP released from the other six cell types did not target any specific cells (Figure 5K).

According to the proposed chronology, the C1 SOX6+ Oligodendrocytes subpopulation corresponds to the early stages of tumor development and continues to differentiate into other subpopulations.

…(3133 cells), C1SOX6+ Oligodendrocytes (1271 cells…

…Notably, the C1SOX6+ Oligodendrocytes subpopulati…

Show Full Abstract

<h4>Background</h4>We explored the characteristics of single-cell differentiation data in glioblastoma and established prognostic markers based on CRYAB to predict the prognosis of glioblastoma patients. Aberrant expression of CRYAB is associated with invasive behavior in various tumors, including glioblastoma. However, the specific role and mechanisms of CRYAB in glioblastoma are still unclear.<h4>Methods</h4>We assessed RNA-seq and microarray data from TCGA and GEO databases, combined with scRNA-seq data on glioma patients from GEO. Utilizing the Seurat R package, we identified distinct survival-related gene clusters in the scRNA-seq data. Prognostic pivotal genes were discovered through single-factor Cox analysis, and a prognostic model was established using LASSO and stepwise regression algorithms. Moreover, we investigated the predictive potential of these genes in the immune microenvironment and their applicability in immunotherapy. Finally, <i>in vitro</i> experiments confirmed the functional significance of the high-risk gene CRYAB.<h4>Results</h4>By analyzing the ScRNA-seq data, we identified 28 cell clusters representing seven cell types. After dimensionality reduction and clustering analysis, we obtained four subpopulations within the oligodendrocyte lineage based on their differentiation trajectory. Using CRYAB as a marker gene for the terminal-stage subpopulation, we found that its expression was associated with poor prognosis. <i>In vitro</i> experiments demonstrated that knocking out CRYAB in U87 and LN229 cells reduced cell viability, proliferation, and invasiveness.<h4>Conclusion</h4>The risk model based on CRYAB holds promise in accurately predicting glioblastoma. A comprehensive study of the specific mechanisms of CRYAB in glioblastoma would contribute to understanding its response to immunotherapy. Targeting the CRYAB gene may be beneficial for glioblastoma patients.

PTGIS
Also flagged:cuproptosistricarboxylic acidmitochondrialmetabolismtumorgastric cancer
Journal Article 2024-01-11 ✓ 2 Snippets Wang Y, Guo F, Song W, Guo W, Shao J, Liu Y.
In-Text Gene Mentions

…, SGCE ,PTGIS, ASCL2 ,…

…of FLNA andPTGISwas downregulated in…

Show Full Abstract

<h4>Background</h4>Cuproptosis is a novel form of cellular demise that occurs through a unique pathway involving lipoylated proteins in the tricarboxylic acid (TCA) cycle and is closely linked to mitochondrial metabolism. Nevertheless, the comprehensive elucidation of the impact of carcinogenesis-associated genes (CRGs) on prognosis, tumor microenvironment (TME), and therapeutic response in patients with gastric cancer (GC) remains unclear.<h4>Methods</h4>In total, 1374 GC samples were gathered from three Gene Expression Omnibus (GEO) datasets and The Cancer Genome Atlas database. The samples were then stratified into different subtypes through unsupervised clustering of the 13 CRG profiles. The CRG_score was developed to quantify CRG patterns of individual tumors. Subsequently, we investigated the associations among the various groups and clinicopathological features, immune infiltration features, TME mutation status, and response to immunotherapy.<h4>Results</h4>The GC samples were divided into two clusters based on their distinct clinicopathological features, prognosis, and immune characteristics. Using LASSO and Cox regression analyses, 9 genes were identified for constructing a prognostic signature related to cuproptosis. The novel signature displayed outstanding durability and prognostic capability for the overall lifespan of individuals. Additionally, the expression levels of signature genes in GC tissues and adjacent normal tissues were tested by qRT-PCR. Moreover, we developed a remarkably dependable nomogram to enhance the practicality of the CRG_score in clinical settings. High tumor mutation burden, increased microsatellite instability-high, immune activation, along with good survival probability and increased immunoreactivity to immune checkpoint inhibitors, were distinguishing features of low CRG_scores.<h4>Conclusions</h4>The findings of this study revealed the possible impacts of CRGs on the TME, clinical and pathological characteristics, and outlook of patients with GC. This signature was strongly linked to the immune response against GC and has the potential to serve as a valuable tool for predicting patient prognosis.

Also flagged:gastric cancercancermultidrug-resistant gastric cancertumorstumorcell proliferation
Journal Article 2024-01-11 No Snippets Wang XT, Li L, Zhu Z, Huang YL, Chen HH, Shi ZY, Deng QM, Wu K, Xia LJ, Mai W, Yang JR, Kong FB.
Show Full Abstract

SIVA-1 has been shown to affect apoptotic processes in various different cell lines, and SIVA-1 significantly contributes to the decreased responsiveness of cancer cells to some chemotherapy agents. However, whether SIVA-1 has potential application in gastric cancer remains unknown. Therefore, the objective of this investigation was to clarify the distinct function of SIVA-1 in chemotherapeutic drug resistance within a living murine model with gastric malignancy, and initially elucidate the underlying mechanisms. In an established multidrug-resistant gastric cancer xenograft mouse model, lentivirus, named Lv-SIVA-1, was injected into xenograft tumors, and increased the mRNA and protein expression of endogenous SIVA-1 in tumors. Immunohistochemical assays of xenograft tumor showed that SIVA-1 was significantly upregulated, and the protein expression levels of SIVA-1 were highly increased, as detected by Western blotting. In addition, we detected the role of SIVA-1 in cell proliferation and cell apoptosis in gastric cancer cells by TUNEL and found that SIVA-1 decreased tumor cell apoptosis and promoted tumor growth in vivo. Using a TMT assay between tumor tissues of experimental and control groups, differentially expressed proteins were examined and three potential biomarkers of multidrug resistance (ARF, MDM2, and p53) were screened. We further investigated the molecular mechanism by which SIVA-1 played an efficient role against chemotherapies and found that overexpressed SIVA-1 leads to increased ARF and MDM2 expression and suppressed expression of p53 in tumor tissue. In conclusion, SIVA-1 plays a significant role in the multidrug resistance of gastric tumors. In addition, overexpressed SIVA-1 positively regulates cell proliferation, adjusts cycle progression, and reduces the response to drug treatment for gastric cancer in an ARF/MDM2/p53-dependent manner. This novel research provides a basis for chemical management of gastric cancer through regulation of SIVA-1 expression.

DNAH10
Also flagged:asthenoteratozoospermiaATmale infertilityinfertileHaematoxylininfertility
Journal Article 2024-01-11 ✓ 4 Snippets Meng GQ, Wang Y, Luo C, Tan YM, Li Y, Tan C, Tu C, Zhang QJ, Hu L, Zhang H, Meng LL, Liu CY, Deng L, Lu GX, Lin G, Du J, Tan YQ, Sha Y, Wang L, He WB.
In-Text Gene Mentions

…to DNAH8 ,DNAH10, and DNAH17…

…our group (i.e.DNAH10( Tu et…

…DNAH6 , orDNAH10present with obviously…

…DNAH8 , andDNAH10, can achieve…

Show Full Abstract

<h4>Study question</h4>Are there other pathogenic genes for asthenoteratozoospermia (AT)?<h4>Summary answer</h4><i>DNAH3</i> is a novel candidate gene for AT in humans and mice.<h4>What is known already</h4>AT is a major cause of male infertility. Several genes underlying AT have been reported; however, the genetic aetiology remains unknown in a majority of affected men.<h4>Study design size duration</h4>A total of 432 patients with AT were recruited in this study. <i>DNAH3</i> mutations were identified by whole-exome sequencing (WES). <i>Dnah3</i> knockout mice were generated using the genome editing tool. The morphology and motility of sperm from <i>Dnah3</i> knockout mice were investigated. The entire study was conducted over 3 years.<h4>Participants/materials setting methods</h4>WES was performed on 432 infertile patients with AT. In addition, two lines of <i>Dnah3</i> knockout mice were generated. Haematoxylin and eosin (H&E) staining, transmission electron microscopy (TEM), immunostaining, and computer-aided sperm analysis (CASA) were performed to investigate the morphology and motility of the spermatozoa. ICSI was used to overcome the infertility of one patient and of the <i>Dnah3</i> knockout mice.<h4>Main results and the role of chance</h4><i>DNAH3</i> biallelic variants were identified in three patients from three unrelated families. H&E staining revealed various morphological abnormalities in the flagella of sperm from the patients, and TEM and immunostaining further showed the loss of the central pair of microtubules, a dislocated mitochondrial sheath and fibrous sheath, as well as a partial absence of the inner dynein arms. In addition, the two <i>Dnah3</i> knockout mouse lines demonstrated AT. One patient and the <i>Dnah3</i> knockout mice showed good treatment outcomes after ICSI.<h4>Large scale data</h4>N/A.<h4>Limitations reasons for caution</h4>This is a preliminary report suggesting that defects in <i>DNAH3</i> can lead to asthenoteratozoospermia in humans and mice. The pathogenic mechanism needs to be further examined in a future study.<h4>Wider implications of the findings</h4>Our findings show that <i>DNAH3</i> is a novel candidate gene for AT in humans and mice and provide crucial insights into the biological underpinnings of this disorder. The findings may also be beneficial for counselling affected individuals.<h4>Study funding/competing interests</h4>This work was supported by grants from National Natural Science Foundation of China (82201773, 82101961, 82171608, 32322017, 82071697, and 81971447), National Key Research and Development Program of China (2022YFC2702604), Scientific Research Foundation of the Health Committee of Hunan Province (B202301039323, B202301039518), Hunan Provincial Natural Science Foundation (2023JJ30716), the Medical Innovation Project of Fujian Province (2020-CXB-051), the Science and Technology Project of Fujian Province (2023D017), China Postdoctoral Science Foundation (2022M711119), and Guilin technology project for people's benefit (20180106-4-7). The authors declare no competing interests.

Also flagged:peptidescyclic peptidesmembranebindingcyclicpeptide
Journal Article 2024-01-11 No Snippets Du Z, Ma Y, Shen Y, Jiang X, Zhou Y, Shi T.
Show Full Abstract

SurE, the first reported penicillin-binding protein-like thioesterase (PBP-like TE), is known as a new off-loading cyclase, which catalyzes heterochiral coupling in nonribosomal peptides (NRPs). However, the structural rationale for substrate stereoselectivity and enzymatic mechanism remains mysterious. Here, computational models, integrating MD simulations and QM/MM methods, unveiled SurE's substrate recognition and catalytic process. An oxyanion hole stabilized the <i>C</i>-terminal D-residue during recognition. Residue R446 anchored the substrate for macrocyclization. A vital hydrogen-bonding network (Y154, K66, N156), verified by mutation results, was responsible for the recognition of <i>N</i>-terminal L-residue and involvement in catalytic process with a calculated 19.4 kcal/mol energy barrier. Four novel-designed peptide precursors were effectively cyclized into cyclopeptides by SurE based on computational analysis. Our results provide a comprehensive understanding of SurE's catalytic mechanism and guiding design of versatile PBP-like TEs for novel macrocyclic NRPs.

Also flagged:Magnesiumdegradationcalcium phosphatelayeredhydroxidetitanium
Journal Article 2024-01-11 No Snippets Shi B, Li YR, Xu J, Zou J, Zhou Z, Jia Q, Jiang HB, Liu K.
Show Full Abstract

Magnesium and its alloys are considered excellent materials for biodegradable implants because of their good biocompatibility and biodegradability as well as their mechanical properties. However, the rapid degradation rate severely limits their clinical applications. Plasma electrolytic oxidation (PEO), also known as micro-arc oxidation (MAO), is an effective surface modification technique. However, there are many pores and cracks on the coating surface under conventional PEO process. The corrosive products tend to penetrate deeply into the substrate, reducing its corrosion resistance and the biocompatibility, which makes PEO-coated Mg difficult to meet the long-term needs of <i>in vivo</i> implants. Hence, it is necessary to modify the PEO coating. This review discusses the formation mechanism and the influential parameters of PEO coatings on Mg. This is followed by a review of the latest research of the pretreatment and typical amelioration of PEO coating on biodegradable Mg alloys in the past 5 years, including calcium phosphate (Ca-P) coating, layered double hydroxide (LDH)-PEO coating, ZrO<sub>2</sub> incorporated-PEO coating, antibacterial ingredients-PEO coating, drug-PEO coating, polymer-PEO composite coating, Plasma electrolytic fluorination (PEF) coating and self-healing coating. Meanwhile, the improvements of morphology, corrosion resistance, wear resistance, biocompatibility, antibacterial abilities, and drug loading abilities and the preparation methods of the modified PEO coatings are deeply discussed as well. Finally, the challenges and prospects of PEO coatings are discussed in detail for the purpose of promoting the clinical application of biodegradable Mg alloys.

Also flagged:mitochondrialDiGeorge syndromeHOGA1CFTRBRCA1fertilization
Journal Article 2024-01-11 No Snippets Xia Y, Katz M, Chandramohan D, Bechor E, Podgursky B, Hoxie M, Zhang Q, Chertman W, Kang J, Blue E, Chen J, Schleede J, Slotnick NR, Du X, Boostanfar R, Urcia E, Behr B, Cohen J, Siddiqui N.
Show Full Abstract

<h4>Objective</h4>To validate the performance of our laboratory-developed whole-genome screening assay within clinical preimplantation genetic testing environments.<h4>Design</h4>Perform a laboratory-developed whole-genome assay on both cell lines and trophectoderm biopsies, subsequently employing the next-generation sequencing procedure to reach a sequencing depth of 30X. Adhere to the Genome Analysis Toolkit best practices for accuracy, sensitivity, specificity, and precision calculations by comparing samples with references. Our assay was then applied to cell lines and biopsies harboring known pathogenic variants, aiming to ascertain these changes solely from the next-generation sequencing data, independent of parental genome information.<h4>Settings</h4>Clinical laboratory.<h4>Patients</h4>Coriell cell lines and research embryos with known chromosomal or genetic variants. Research trophectoderm biopsies from a couple that are heterozygous carriers for distinct variants in the same autosomal recessive gene (<i>HOGA1</i>).<h4>Intervention</h4>Not applicable.<h4>Main outcome measures</h4>Accuracy, sensitivity, specificity, and precision were assessed by comparing the samples to their references. For samples with known variants, we calculated our sensitivity to detecting established variants. For the research embryos, noncarrier, carrier, and compound heterozygous states of inherited <i>HOGA1</i> variants were distinguished independently of parental samples.<h4>Results</h4>Amplification of DNA from cell lines and embryos yielded success rates exceeding 99.9% and 98.2%, respectively, although maintaining an accuracy of >99.9% for aneuploidy assessment. The accuracy (99.99%), specificity (99.99%), sensitivity (98.0%), and precision (98.1%) of amplified genome in the bottle (reference NA12878) and embryo biopsies were comparable to results on genomic DNA, including mitochondrial heteroplasmy. Using our assay, we achieved >99.99% sensitivity when examining samples with known chromosomal and genetic variants. This encompassed pathogenic <i>CFTR</i>, <i>BRCA1</i>, and other variants, along with uniparental isodisomies and microdeletions such as DiGeorge syndrome. Our research study identified noncarrier, carrier, and compound heterozygous states within trophectoderm biopsies while simultaneously screening for 1,300 other severe monogenic diseases.<h4>Conclusion</h4>To our knowledge, this is the first clinical validation of whole-genome embryo screening. In this study, we demonstrated high accuracy for aneuploidy calls (>99.9%) and genetic variants (99.99%), even in the absence of parental genomes. This assay demonstrates advancements in genomic screening and an extended scope for testing capabilities in the realm of preimplantation genetic testing.

Also flagged:gene expressioninherited diseasescancersoligonucleotidessplicing factorsspliceosome
Journal Article 2024-01-11 No Snippets Bouton L, Ecoutin A, Malard F, Campagne S.
Show Full Abstract

In eukaryotic cells, RNA splicing is crucial for gene expression. Dysregulation of this process can result in incorrect mRNA processing, leading to aberrant gene expression patterns. Such abnormalities are implicated in many inherited diseases and cancers. Historically, antisense oligonucleotides, which bind to specific RNA targets, have been used to correct these splicing abnormalities. Despite their high specificity of action, these oligonucleotides have drawbacks, such as lack of oral bioavailability and the need for chemical modifications to enhance cellular uptake and stability. As a result, recent efforts focused on the development of small organic molecules that can correct abnormal RNA splicing event under disease conditions. This review discusses known and potential targets of these molecules, including RNA structures, <i>trans</i>-acting splicing factors, and the spliceosome - the macromolecular complex responsible for RNA splicing. We also rely on recent advances to discuss therapeutic applications of RNA-targeting small molecules in splicing correction. Overall, this review presents an update on strategies for RNA splicing modulation, emphasizing the therapeutic promise of small molecules.

HFE
Also flagged:Deferoxaminebeta-thalassemiaironBeta-Thalassemia Woundanemiassickle cell
Journal Article 2024-01-11 ✓ 2 Snippets Perrault D, Chattopadhyay A, Sivaraj D, Wan D, Chen K, Gurtner G, Sen S.
In-Text Gene Mentions

…in patients withhemochromatosis.…

…and those withhemochromatosisrecieving intramuscular inject…

Show Full Abstract

<h4>Mini-abstract</h4>In this study, we present the first-in-human use of topical deferoxamine (DFO) in the treatment of a beta-thalassemia wound. We elected to use DFO on a patient that suffered from a chronic nonhealing wound in the setting of beta-thalassemia. Despite approximately 55 weeks of marginal improvement in healing, this patient's wound healed completely after 21 weeks of treatment with DFO. We believe that DFO has the potential to accelerate healing in beta-thalassemia wounds through iron chelation.

Research Square 2024-01-11 Preprint (No Snippets API) Nelander S, Larsson I, Held F, Popova G, Koc A, Kundu S, Jörnsten R.
Show Full Abstract

<title>Abstract</title> <p>Nervous system cancers contain a large spectrum of transcriptional cell states, reflecting processes active during normal development, injury response and growth. However, we lack a good understanding of these states' regulation and pharmacological importance. Here, we describe the integrated reconstruction of such cellular regulatory programs and their therapeutic targets from extensive collections of single-cell RNA sequencing data (scRNA-seq) from both tumors and developing tissues. Our method, termed single-cell Regulatory-driven Clustering (<italic>scRegClust</italic>), splits target genes into modules and predicts essential kinases and transcription factors in little computational time thanks to a new efficient optimization strategy. Using this method, we analyze scRNA-seq data from both adult and childhood brain cancers to identify transcription factors and kinases that regulate distinct tumor cell states. In adult glioblastoma, our model predicts that blocking the activity of <italic>PDGFRA</italic>, <italic>DDR1</italic>, <italic>ERBB3 </italic>or <italic>SOX6</italic>, or increasing <italic>YBX1</italic>-activity, would potentiate temozolomide treatment. We further perform an integrative study of scRNA-seq data from both cancer and the developing brain to uncover the regulation of emerging meta-modules. We find a meta-module regulated by the transcription factors <italic>SPI1 </italic>and <italic>IRF8 </italic>and link it to an immune-mediated mesenchymal-like state. Our algorithm is available as an easy-to-use R package and companion visualization tool that help uncover the regulatory programs underlying cell plasticity in cancer and other diseases.</p>

HTT
Also flagged:infectionmetalsrenal failureinfectious diseasereproductionfluoxetine
Journal Article 2024-01-10 ✓ 2 Snippets Aulsebrook LC, Wong BBM, Hall MD.
In-Text Gene Mentions

As a selective serotonin reuptake inhibiter, fluoxetine acts to prevent the reuptake of the neurotransmitter serotonin by interacting with the serotonin transporter (5-HTT or SERT), causing the effect of serotonin to be prolonged [45].

…the serotonin transporter (5-HTTor SERT), causing…

Show Full Abstract

The relationship between pathogen proliferation and the cost of infection experienced by a host drives the ecology and evolution of host-pathogen dynamics. While environmental factors can shape this relationship, there is currently limited knowledge on the consequences of emerging contaminants, such as pharmaceutical pollutants, on the relationship between a pathogen's growth within the host and the damage it causes, termed its virulence. Here, we investigated how exposure to fluoxetine (Prozac), a commonly detected psychoactive pollutant, could alter this key relationship using the water flea <i>Daphnia magna</i> and its bacterial pathogen <i>Pasteuria ramosa</i> as a model system. Across a variety of fluoxetine concentrations, we found that fluoxetine shaped the damage a pathogen caused, such as the reduction in fecundity or intrinsic growth experienced by infected individuals, but with minimal change in average pathogen spore loads. Instead, fluoxetine modified the relationship between the degree of pathogen proliferation and its virulence, with both the strength of this trade-off and the component of host fitness most affected varying by fluoxetine concentration and host genotype. Our study underscores the potential for pharmaceutical pollution to modify the virulence of an invading pathogen, as well as the fundamental trade-off between host and pathogen fitness, even at the trace amounts increasingly found in natural waterways.

Also flagged:Ceramideinfectionimmediate early geneBZLF1EBV infectiongastric cancer
Journal Article 2024-01-10 No Snippets Kim JY, Min YJ, Lee M-H, An YR, Ashktorab H, Smoot DT, Kwon SW, Lee SK.
Show Full Abstract

Epstein-Barr virus (EBV) has a lifelong latency period after initial infection. Rarely, however, when the EBV immediate early gene BZLF1 is expressed by a specific stimulus, the virus switches to the lytic cycle to produce progeny viruses. We found that EBV infection reduced levels of various ceramide species in gastric cancer cells. As ceramide is a bioactive lipid implicated in the infection of various viruses, we assessed the effect of ceramide on the EBV lytic cycle. Treatment with C<sub>6</sub>-ceramide (C<sub>6</sub>-Cer) induced an increase in the endogenous ceramide pool and increased production of the viral product as well as BZLF1 expression. Treatment with the ceramidase inhibitor ceranib-2 induced EBV lytic replication with an increase in the endogenous ceramide pool. The glucosylceramide synthase inhibitor Genz-123346 inhibited C<sub>6</sub>-Cer-induced lytic replication. C<sub>6</sub>-Cer induced extracellular signal-regulated kinase 1/2 (ERK1/2) and CREB phosphorylation, c-JUN expression, and accumulation of the autophagosome marker LC3B. Treatment with MEK1/2 inhibitor U0126, siERK1&2, or siCREB suppressed C<sub>6</sub>-Cer-induced EBV lytic replication and autophagy initiation. In contrast, siJUN transfection had no impact on BZLF1 expression. The use of 3-methyladenine (3-MA), an inhibitor targeting class III phosphoinositide 3-kinases (PI3Ks) to inhibit autophagy initiation, resulted in reduced beclin-1 expression, along with suppressed C<sub>6</sub>-Cer-induced BZLF1 expression and LC3B accumulation. Chloroquine, an inhibitor of autophagosome-lysosome fusion, increased BZLF1 protein intensity and LC3B accumulation. However, siLC3B transfection had minimal effect on BZLF1 expression. The results suggest the significance of ceramide-related sphingolipid metabolism in controlling EBV latency, highlighting the potential use of drugs targeting sphingolipid metabolism for treating EBV-positive gastric cancer.IMPORTANCEEpstein-Barr virus remains dormant in the host cell but occasionally switches to the lytic cycle when stimulated. However, the exact molecular mechanism of this lytic induction is not well understood. In this study, we demonstrate that Epstein-Barr virus infection leads to a reduction in ceramide levels. Additionally, the restoration of ceramide levels triggers lytic replication of Epstein-Barr virus with increase in phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) and CREB. Our study suggests that the Epstein-Barr virus can inhibit lytic replication and remain latent through reduction of host cell ceramide levels. This study reports the regulation of lytic replication by ceramide in Epstein-Barr virus-positive gastric cancer.

DCC
Also flagged:microtubule-associated protein taunetrin-1bindingnetrin receptorsmicrotubulesgrowth cone
Journal Article 2024-01-10 ✓ 5 Snippets Huang H, Majumder T, Khot B, Suriyaarachchi H, Yang T, Shao Q, Tirukovalluru S, Liu G.
In-Text Gene Mentions

…of netrin-1 receptorDCCwith tau (MAPT)-regulated…

…directly interacts withDCCand partially overlaps…

…partially overlaps withDCCin the growth…

…the colocalization ofDCCand tau in…

…of tau withDCCrelies on MT…

Show Full Abstract

Direct binding of netrin receptors with dynamic microtubules (MTs) in the neuronal growth cone plays an important role in netrin-mediated axon guidance. However, how netrin-1 (NTN1) regulates MT dynamics in axon turning remains a major unanswered question. Here, we show that the coupling of netrin-1 receptor DCC with tau (MAPT)-regulated MTs is involved in netrin-1-promoted axon attraction. Tau directly interacts with DCC and partially overlaps with DCC in the growth cone of primary neurons. Netrin-1 induces this interaction and the colocalization of DCC and tau in the growth cone. The netrin-1-induced interaction of tau with DCC relies on MT dynamics and TUBB3, a highly dynamic β-tubulin isotype in developing neurons. Netrin-1 increased cosedimentation of DCC with tau and TUBB3 in MTs, and knockdown of either tau or TUBB3 mutually blocked this effect. Downregulation of endogenous tau levels by tau shRNAs inhibited netrin-1-induced axon outgrowth, branching and commissural axon attraction in vitro, and led to defects in spinal commissural axon projection in vivo. These findings suggest that tau is a key MT-associated protein coupling DCC with MT dynamics in netrin-1-promoted axon attraction.

HTT
Also flagged:IκB kinaseTDP-43amyotrophic lateral sclerosisALSfrontotemporal lobar degenerationFTLD
Journal Article 2024-01-10 ✓ 1 Snippet Iguchi Y, Takahashi Y, Li J, Araki K, Amakusa Y, Kawakami Y, Kobayashi K, Yokoi S, Katsuno M.
In-Text Gene Mentions

…to phosphorylate Huntingtin (Htt) at Ser13 and…

Show Full Abstract

Cytoplasmic aggregation of TDP-43 in neurons is a pathological feature common to amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). We demonstrate that the IκB kinase (IKK) complex promotes the degradation of cytoplasmic TDP-43 through proteasomes. While IKKβ is a major factor in TDP-43 degradation, IKKα acts as a cofactor, and NEMO functions as a scaffold for the recruitment of TDP-43 to the IKK complex. Furthermore, we identified IKKβ-induced phosphorylation sites of TDP-43 and found that phosphorylation at Thr8 and Ser92 is important for the reduction of TDP-43 by IKK. TDP-43 phosphorylation at Ser92 was detected in a pattern different from that of C-terminal phosphorylation in the pathological inclusion of ALS. IKKβ was also found to significantly reduce the expression level and toxicity of the disease-causing TDP-43 mutation. Finally, the favorable effect of IKKβ on TDP-43 aggregation was confirmed in the hippocampus of mice. IKK and the N-terminal phosphorylation of TDP-43 are potential therapeutic targets for ALS and FTLD.

PLCL1SOX6
Also flagged:PDaddictiondopamineironaxonalidiopathic PD
Journal Article 2024-01-10 ✓ 2 Snippets Wang Q, Wang M, Choi I, Sarrafha L, Liang M, Ho L, Farrell K, Beaumont KG, Sebra R, De Sanctis C, Crary JF, Ahfeldt T, Blanchard J, Neavin D, Powell J, Davis DA, Sun X, Zhang B, Yue Z.
In-Text Gene Mentions

…showed much higherSOX6cell fractions (22.25%)…

…commonly down-regulated, whilePLCL1and MTRNR2L1 were…

Show Full Abstract

Parkinson's disease (PD) is characterized pathologically by the loss of dopaminergic (DA) neurons in the substantia nigra (SN). Whether cell types beyond DA neurons in the SN show vulnerability in PD remains unclear. Through transcriptomic profiling of 315,867 high-quality single nuclei in the SN from individuals with and without PD, we identified cell clusters representing various neuron types, glia, endothelial cells, pericytes, fibroblasts, and T cells and investigated cell type-dependent alterations in gene expression in PD. Notably, a unique neuron cluster marked by the expression of <i>RIT2</i>, a PD risk gene, also displayed vulnerability in PD. We validated <i>RIT2</i>-enriched neurons in midbrain organoids and the mouse SN. Our results demonstrated distinct transcriptomic signatures of the <i>RIT2</i>-enriched neurons in the human SN and implicated reduced RIT2 expression in the pathogenesis of PD. Our study sheds light on the diversity of cell types, including DA neurons, in the SN and the complexity of molecular and cellular changes associated with PD pathogenesis.

HFE
Also flagged:Psoriasispsoriasis vulgarischronic inflammatory skin diseaseplaque psoriasisacneeczema
Journal Article 2024-01-10 ✓ 1 Snippet Ali Z, Al-Mousawi A, Björnsson BÞ, Egeberg A, Riemer C, Thomsen SF.
In-Text Gene Mentions

…most probably representingtype 1 psoriasis1 psoriasis, which…

Show Full Abstract

<h4>Introduction</h4>Digital advancements have given access to huge amounts of real-world data (RWD) widely used for dermatological research.<h4>Objectives</h4>The objective of this study was to investigate the agreement between consumer-driven self-assessed psoriasis severity and physician-assessed severity based on photographs.<h4>Methods</h4>Customer IDs in the NØIE database (Danish skincare company) from 2009 to 2022 with a smartphone photograph of psoriasis vulgaris on the body and a corresponding completed questionnaire were included. Smartphone photographs were evaluated by a physician-assessing erythema, induration, and scaling on a scale from 0 to 4 based on Psoriasis Area Severity Index (PASI). Self-assessment was done on a scale from 0 to 10 and converted to 0-4 scale (0 converted to 0; 1-3 to 1; 4-6 to 2; 7-8 to 3; and 9-10 to 4). Intraclass correlation coefficients with 95% confidence intervals (CIs) were calculated.<h4>Results</h4>In total, 187 patients (63% women) with mean age of 38 years were included. Self-assessment scores were higher than physicians' assessment scores for all groups, and scaling was closest to the physicians' assessment, while erythema and induration had a greater distance between the physicians' and patients' assessment. The correlation between self-assessed and physician-assessed psoriasis severity for all patients was 0.23 (95% CI: 0.0-0.92); 0.34 (95% CI: 0.0-0.95) for chronic patients; and 0.09 (-0.01 to 0.82) for non-chronic patients. The agreement was better for men (0.53 [-0.02 to 0.98]) than for women (0.12 [-0.01 to 0.84]).<h4>Conclusion</h4>There was weak agreement between self-assessed psoriasis severity and photographically assessed severity by the physician. Consumer-driven RWD should be interpreted with caution.

TRIM38
Also flagged:TRIM22ubiquitinproteasomeprotein degradationcell cyclecancer
Journal Article 2024-01-10 ✓ 2 Snippets Kang D, Hwang HJ, Baek Y, Sung JY, Kim K, Park HJ, Ko YG, Kim YN, Lee JS.
In-Text Gene Mentions

When we validated these findings by RT-qPCR, we found that the mRNAs encoding MIB2, PML, TRIM22, TRIM38, HERC6, and TRIM21 were increased by more than 1.5 times in IR-treated HepG2 cells (Fig. 1A).

…MIB2, PML, TRIM22,TRIM38, HERC6, and TRIM21…

Show Full Abstract

The ubiquitin-proteasome system is a vital protein degradation system that is involved in various cellular processes, such as cell cycle progression, apoptosis, and differentiation. Dysregulation of this system has been implicated in numerous diseases, including cancer, vascular disease, and neurodegenerative disorders. Induction of cellular senescence in hepatocellular carcinoma (HCC) is a potential anticancer strategy, but the precise role of the ubiquitin-proteasome system in cellular senescence remains unclear. In this study, we show that the E3 ubiquitin ligase, TRIM22, plays a critical role in the cellular senescence of HCC cells. TRIM22 expression is transcriptionally upregulated by p53 in HCC cells experiencing ionizing radiation (IR)-induced senescence. Overexpression of TRIM22 triggers cellular senescence by targeting the AKT phosphatase, PHLPP2. Mechanistically, the SPRY domain of TRIM22 directly associates with the C-terminal domain of PHLPP2, which contains phosphorylation sites that are subject to IKKβ-mediated phosphorylation. The TRIM22-mediated PHLPP2 degradation leads to activation of AKT-p53-p21 signaling, ultimately resulting in cellular senescence. In both human HCC databases and patient specimens, the levels of TRIM22 and PHLPP2 show inverse correlations at the mRNA and protein levels. Collectively, our findings reveal that TRIM22 regulates cancer cell senescence by modulating the proteasomal degradation of PHLPP2 in HCC cells, suggesting that TRIM22 could potentially serve as a therapeutic target for treating cancer.

OLFM4
Also flagged:Death receptor 5DR5TRAILWntNotchBMP
Journal Article 2024-01-10 ✓ 5 Snippets Liu J, Liu K, Wang Y, Shi Z, Xu R, Zhang Y, Li J, Liu C, Xue B.
In-Text Gene Mentions

…the number ofOlfm4+ ISCs, and…

…(Lgr5, Ascl2, Axin2,Olfm4) and +4 ISC…

…the number ofOlfm4+ ISCs (Fig.…

…Lgr5, Ascl2, Axin2,Olfm4, Bmi1, and Hopx,…

…target genes, andOlfm4is Notch signalling…

Show Full Abstract

Intestinal epithelial renewal, which depends on the proliferation and differentiation of intestinal stem cells (ISCs), is essential for epithelial homoeostasis. Understanding the mechanism controlling ISC activity is important. We found that death receptor 5 (DR5) gene deletion (DR5<sup>-/-</sup>) mice had impaired epithelial absorption and barrier function, resulting in delayed weight gain, which might be related to the general reduction of differentiated epithelial cells. In DR5<sup>-/-</sup> mice, the expression of ISC marker genes, the number of Olfm4<sup>+</sup> ISCs, and the number of Ki67<sup>+</sup> and BrdU<sup>+</sup> cells in crypt were reduced. Furthermore, DR5 deletion inhibited the expression of lineage differentiation genes driving ISC differentiation into enterocytes, goblet cells, enteroendocrine cells, and Paneth cells. Therefore, DR5 gene loss may inhibit the intestinal epithelial renewal by dampening ISC activity. The ability of crypts from DR5<sup>-/-</sup> mice to form organoids decreased, and selective DR5 activation by Bioymifi promoted organoid growth and the expression of ISC and intestinal epithelial cell marker genes. Silencing of endogenous DR5 ligand TRAIL in organoids down-regulated the expression of ISC and intestinal epithelial cell marker genes. So, DR5 expressed in intestinal crypts was involved in the regulation of ISC activity. DR5 deletion in vivo or activation in organoids inhibited or enhanced the activity of Wnt, Notch, and BMP signalling through regulating the production of Paneth cell-derived ISC niche factors. DR5 gene deletion caused apoptosis and DNA damage in transit amplifying cells by inhibiting ERK1/2 activity in intestinal crypts. Inhibition of ERK1/2 with PD0325901 dampened the ISC activity and epithelial regeneration. In organoids, when Bioymifi's effect in activating ERK1/2 activity was completely blocked by PD0325901, its role in stimulating ISC activity and promoting epithelial regeneration was also eliminated. In summary, DR5 in intestinal crypts is essential for ISC activity during epithelial renewal under homoeostasis.

Also flagged:ureaseinfectiousurinary stonesInfectious urolithiasisurolithiasisinfections of the urinary tract
Journal Article 2024-01-10 No Snippets Szczerbiec D, Bednarska-Szczepaniak K, Torzewska A.
Show Full Abstract

Infectious urolithiasis is a type of urolithiasis, that is caused by infections of the urinary tract by bacteria producing urease such as Proteus mirabilis. Lactobacillus spp. have an antagonistic effect against many pathogens by secreting molecules, including organic acids. The aim of the study was to determine the impact of Lactobacillus strains isolated from human urine on crystallization of urine components caused by P. mirabilis by measuring bacterial viability (CFU/mL), pH, ammonia release, concentration of crystallized salts and by observing crystals by phase contrast microscopy. Moreover, the effect of lactic acid on the activity of urease was examined by the kinetic method and in silico study. In the presence of selected Lactobacillus strains, the crystallization process was inhibited. The results indicate that one of the mechanisms of this action was the antibacterial effect of Lactobacillus, especially in the presence of L. gasseri, where ten times less P. mirabilis bacteria was observed, compared to the control. It was also demonstrated that lactic acid inhibited urease activity by a competitive mechanism and had a higher binding affinity to the enzyme than urea. These results demonstrate that Lactobacillus and lactic acid have a great impact on the urinary stones development, which in the future may help to support the treatment of this health problem.

Also flagged:polyaminescutaneous leishmaniasisamino acidarginineinfectionnitric oxide synthase 2
Journal Article 2024-01-10 No Snippets Fernandes JCR, Muxel SM, López-Gonzálvez MA, Barbas C, Floeter-Winter LM.
Show Full Abstract

Leishmania amazonensis is a protozoan that primarily causes cutaneous leishmaniasis in humans. The parasite relies on the amino acid arginine to survive within macrophages and establish infection, since it is a precursor for producing polyamines. On the other hand, arginine can be metabolized via nitric oxide synthase 2 (NOS2) to produce the microbicidal molecule nitric oxide (NO), although this mechanism does not apply to human macrophages since they lack NOS2 activity. MicroRNAs (miRNAs) are small noncoding RNAs that regulate gene expression at posttranscriptional levels. Our previous work showed that mmu-miR-294 targets Nos2 favoring Leishmania survival in murine macrophages. Here, we demonstrate that human macrophages upregulate the hsa-miR-372, hsa-miR-373, and hsa-miR-520d, which present the same seed sequence as the murine mmu-miR-294. Inhibition of the miR-372 impaired Leishmania survival in THP-1 macrophages and the effect was further enhanced with combinatorial inhibition of the miR-372/373/520d family, pointing to a cooperative mechanism. However, this reduction in survival is not caused by miRNA-targeting of NOS2, since the seed-binding motif found in mice is not conserved in the human 3'UTR. Instead, we showed the miR-372/373/520d family targeting the macrophage's main arginine transporter SLC7A2/CAT2 during infection. Arginine-related metabolism was markedly altered in response to infection and miRNA inhibition, as measured by Mass Spectrometry-based metabolomics. We found that Leishmania infection upregulates polyamines production in macrophages, as opposed to simultaneous inhibition of miR-372/373/520d, which decreased putrescine and spermine levels compared to the negative control. Overall, our study demonstrates miRNA-dependent modulation of polyamines production, establishing permissive conditions for intracellular parasite survival. Although the effector mechanisms causing host cell immunometabolic adaptations involve various parasite and host-derived signals, our findings suggest that the miR-372/373/520d family may represent a potential target for the development of new therapeutic strategies against cutaneous leishmaniasis.

Also flagged:neurodevelopmental disordersmembraneschorioamnionitisneurological impairmentcerebral palsyattention deficit and hyperactivity disorder
Journal Article 2024-01-10 No Snippets Newman J, Tong X, Tan A, Yeasky T, De Paiva VN, Presicce P, Kannan PS, Williams K, Damianos A, Tamase Newsam M, Benny MK, Wu S, Young KC, Miller LA, Kallapur SG, Chougnet CA, Jobe AH, Brambilla R, Schmidt AF.
Show Full Abstract

<h4>Background</h4>Preterm birth is often associated with chorioamnionitis and leads to increased risk of neurodevelopmental disorders, such as autism. Preterm birth can lead to cerebellar underdevelopment, but the mechanisms of disrupted cerebellar development in preterm infants are not well understood. The cerebellum is consistently affected in people with autism spectrum disorders, showing reduction of Purkinje cells, decreased cerebellar grey matter, and altered connectivity.<h4>Methods</h4>Preterm rhesus macaque fetuses were exposed to intra-amniotic LPS (1 mg, E. coli O55:B5) at 127 days (80%) gestation and delivered by c-section 5 days after injections. Maternal and fetal plasma were sampled for cytokine measurements. Chorio-decidua was analyzed for immune cell populations by flow cytometry. Fetal cerebellum was sampled for histology and molecular analysis by single-nuclei RNA-sequencing (snRNA-seq) on a 10× chromium platform. snRNA-seq data were analyzed for differences in cell populations, cell-type specific gene expression, and inferred cellular communications.<h4>Results</h4>We leveraged snRNA-seq of the cerebellum in a clinically relevant rhesus macaque model of chorioamnionitis and preterm birth, to show that chorioamnionitis leads to Purkinje cell loss and disrupted maturation of granule cells and oligodendrocytes in the fetal cerebellum at late gestation. Purkinje cell loss is accompanied by decreased sonic hedgehog signaling from Purkinje cells to granule cells, which show an accelerated maturation, and to oligodendrocytes, which show accelerated maturation from pre-oligodendrocytes into myelinating oligodendrocytes.<h4>Conclusion</h4>These findings suggest a role of chorioamnionitis on disrupted cerebellar maturation associated with preterm birth and on the pathogenesis of neurodevelopmental disorders among preterm infants.

SERPINC1
Also flagged:Enoxaparinacute ischemic strokespinal cord injuryvenous thromboembolismcreatininedeep venous thrombosis
Journal Article 2024-01-10 ✓ 1 Snippet Haim A, Avnery O, Rubin-Asher D, Amir H, Hashem K, Zvi HB, Ratmansky M.
In-Text Gene Mentions

…with the patientsATIIIand FXa inhibition…

Show Full Abstract

<h4>Background</h4>We aimed to examine the efficiency of fixed daily dose enoxaparin (40 mg) thromboprophylaxis strategy for patients undergoing inpatient rehabilitation.<h4>Methods</h4>This was an observational, prospective, cohort study that included 63 hospitalized patients undergoing rehabilitative treatment following sub-acute ischemic stroke (SAIS) or spinal cord injury (SCI), with an indication for thromboprophylaxis. Anti-Xa level measured three hours post-drug administration (following three consecutive days of enoxaparin treatment or more) was utilised to assess in vivo enoxaparin activity. An anti-Xa level between 0.2-0.5 U/ml was considered evidence of effective antithrombotic activity.<h4>Results</h4>We found sub-prophylactic levels of anti-Xa (<0.2 U/ml) in 19% (12/63). Results were within the recommended prophylactic range (0.2-0.5 U/ml) in 73% (46/63) and were supra-prophylactic (>0.5 U/ml) in 7.9% (5/63) of patients. Anti-Xa levels were found to inversely correlate with patients' weight and renal function as defined by creatinine clearance (CrCl) (p<0.05).<h4>Conclusions</h4>Our study confirmed that a one-size-fits-all approach for venous thromboembolism (VTE) prophylaxis may be inadequate for rehabilitation patient populations. The efficacy of fixed-dose enoxaparin prophylaxis is limited and may be influenced by renal function and weight. This study suggests that anti-Xa studies and prophylactic enoxaparin dose adjustments should be considered in certain patients, such as those who are underweight, overweight and or have suboptimal renal function.<h4>Trial registration</h4>No. NCT103593291, registered August 2018.

Also flagged:inclisiranmembranedegradationexcretionextracellularlipid
Journal Article 2024-01-10 No Snippets Moazzam M, Zhang M, Hussain A, Yu X, Huang J, Huang Y.
Show Full Abstract

Five small interfering RNA (siRNA)-based therapeutics have been approved by the Food and Drug Administration (FDA), namely patisiran, givosiran, lumasiran, inclisiran, and vutrisiran. Besides, siRNA delivery to the target site without toxicity is a big challenge for researchers, and naked-siRNA delivery possesses several challenges, including membrane impermeability, enzymatic degradation, mononuclear phagocyte system (MPS) entrapment, fast renal excretion, endosomal escape, and off-target effects. The siRNA therapeutics can silence any disease-specific gene, but their intracellular and extracellular barriers limit their clinical applications. For this purpose, several modifications have been employed to siRNA for better transfection efficiency. Still, there is a quest for better delivery systems for siRNA delivery to the target site. In recent years, nanoparticles have shown promising results in siRNA delivery with minimum toxicity and off-target effects. Patisiran is a lipid nanoparticle (LNP)-based siRNA formulation for treating hereditary transthyretin-mediated amyloidosis that ultimately warrants the use of nanoparticles from different classes, especially lipid-based nanoparticles. These nanoparticles may belong to different categories, including lipid-based, polymer-based, and inorganic nanoparticles. This review briefly discusses the lipid, polymer, and inorganic nanoparticles and their sub-types for siRNA delivery. Finally, several clinical trials related to siRNA therapeutics are addressed, followed by the future prospects and conclusions.

POU3F2
Also flagged:behavioralTopoisomerase 3BTop3bTudor domain containing 3Tdrd3topoisomerase
Journal Article 2024-01-10 ✓ 1 Snippet Zhu X, Joo Y, Bossi S, McDevitt RA, Xie A, Wang Y, Xue Y, Su S, Lee SK, Sah N, Zhang S, Ye R, Pinto A, Zhang Y, Araki K, Araki M, Morales M, Mattson MP, van Praag H, Wang W.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

The Topoisomerase 3B (Top3b) - Tudor domain containing 3 (Tdrd3) protein complex is the only dual-activity topoisomerase complex that can alter both DNA and RNA topology in animals. TOP3B mutations in humans are associated with schizophrenia, autism and cognitive disorders; and Top3b-null mice exhibit several phenotypes observed in animal models of psychiatric and cognitive disorders, including impaired cognitive and emotional behaviors, aberrant neurogenesis and synaptic plasticity, and transcriptional defects. Similarly, human TDRD3 genomic variants have been associated with schizophrenia, verbal short-term memory and educational attainment. However, the importance of Tdrd3 in normal brain function has not been examined in animal models. Here we generated a Tdrd3-null mouse strain and demonstrate that these mice display both shared and unique defects when compared to Top3b-null mice. Shared defects were observed in cognitive behaviors, synaptic plasticity, adult neurogenesis, newborn neuron morphology, and neuronal activity-dependent transcription; whereas defects unique to Tdrd3-deficient mice include hyperactivity, changes in anxiety-like behaviors, olfaction, increased new neuron complexity, and reduced myelination. Interestingly, multiple genes critical for neurodevelopment and cognitive function exhibit reduced levels in mature but not nascent transcripts. We infer that the entire Top3b-Tdrd3 complex is essential for normal brain function, and that defective post-transcriptional regulation could contribute to cognitive and psychiatric disorders.

Also flagged:Epilepsyneuronal dischargesepileptic syndromesepileptic disordersepilepsiesepileptic syndrome
Journal Article 2024-01-10 No Snippets Boleti APA, Cardoso PHO, Frihling BEF, de Moraes LFRN, Nunes EAC, Mukoyama LTH, Nunes EAC, Carvalho CME, Macedo MLR, Migliolo L.
Show Full Abstract

Epilepsy represents a condition in which abnormal neuronal discharges or the hyperexcitability of neurons occur with synchronicity, presenting a significant public health challenge. Prognostic factors, such as etiology, electroencephalogram (EEG) abnormalities, the type and number of seizures before treatment, as well as the initial unsatisfactory effects of medications, are important considerations. Although there are several third-generation antiepileptic drugs currently available, their multiple side effects can negatively affect patient quality of life. The inheritance and etiology of epilepsy are complex, involving multiple underlying genetic and epigenetic mechanisms. Different neurotransmitters play crucial roles in maintaining the normal physiology of different neurons. Dysregulations in neurotransmission, due to abnormal transmitter levels or changes in their receptors, can result in seizures. In this review, we address the roles played by various neurotransmitters and their receptors in the pathophysiology of epilepsy. Furthermore, we extensively explore the neurological mechanisms involved in the development and progression of epilepsy, along with its risk factors. Furthermore, we highlight the new therapeutic targets, along with pharmacological and non-pharmacological strategies currently employed in the treatment of epileptic syndromes, including drug interventions employed in clinical trials related to epilepsy.

PRDX6
Also flagged:TumorSuppressorSOCS1hepatocellular carcinomaNRF2cisplatin
Journal Article 2024-01-10 ✓ 3 Snippets Shukla A, Khan MGM, Cayarga AA, Namvarpour M, Chowdhury MMH, Levesque D, Lucier JF, Boisvert FM, Ramanathan S, Ilangumaran S.
In-Text Gene Mentions

…upregulation, whereas PRDX3,PRDX6and PRDX6b were…

…proteins, PRDX1 andPRDX6are known NRF2…

…was downregulated butPRDX6and PRDX6B upregulated…

Show Full Abstract

SOCS1 is a tumor suppressor in hepatocellular carcinoma (HCC). Recently, we showed that a loss of SOCS1 in hepatocytes promotes NRF2 activation. Here, we investigated how SOCS1 expression in HCC cells affected oxidative stress response and modulated the cellular proteome. Murine Hepa1-6 cells expressing SOCS1 (Hepa-SOCS1) or control vector (Hepa-Vector) were treated with cisplatin or tert-butyl hydroperoxide (<i>t</i>-BHP). The induction of NRF2 and its target genes, oxidative stress, lipid peroxidation, cell survival and cellular proteome profiles were evaluated. NRF2 induction was significantly reduced in Hepa-SOCS1 cells. The gene and protein expression of NRF2 targets were differentially induced in Hepa-Vector cells but markedly suppressed in Hepa-SOCS1 cells. Hepa-SOCS1 cells displayed an increased induction of reactive oxygen species but reduced lipid peroxidation. Nonetheless, Hepa-SOCS1 cells treated with cisplatin or <i>t</i>-BHP showed reduced survival. <i>GCLC</i>, poorly induced in Hepa-SOCS1 cells, showed a strong positive correlation with <i>NFE2L2</i> and an inverse correlation with <i>SOCS1</i> in the TCGA-LIHC transcriptomic data. A proteomic analysis of Hepa-Vector and Hepa-SOCS1 cells revealed that SOCS1 differentially modulated many proteins involved in diverse molecular pathways, including mitochondrial ROS generation and ROS detoxification, through peroxiredoxin and thioredoxin systems. Our findings indicate that maintaining sensitivity to oxidative stress is an important tumor suppression mechanism of SOCS1 in HCC.

Also flagged:Lung CancerNon-small cell lung cancerNSCLCcancertumorsoropharyngeal cancer
Journal Article 2024-01-10 No Snippets Nachira D, Congedo MT, D'Argento E, Meacci E, Evangelista J, Sassorossi C, Calabrese G, Nocera A, Kuzmych K, Santangelo R, Rindi G, Margaritora S.
Show Full Abstract

Non-small cell lung cancer (NSCLC) is the leading cause of cancer-related mortality worldwide. Notably, the incidence of lung cancer among never-smokers, predominantly women, has been rising in recent years. Among the various implicated risk factors, human papilloma virus (HPV) may play a role in the development of NSCLC in a certain subset of patients. The prevalence of high-risk HPV-DNA within human neoplastic lung cells varies across the world; however, the carcinogenetic role of HPV in NSCLC has not been completely understood. Bloodstream could be one of the routes of transmission from infected sites to the lungs, along with oral (through unprotected oral sex) and airborne transmission. Previous studies reported an elevated risk of NSCLC in patients with prior HPV-related tumors, such as cervical, laryngeal, or oropharyngeal cancer, with better prognosis for HPV-positive lung cancers compared to negative forms. On the other hand, 16% of NSCLC patients present circulating HPV-DNA in peripheral blood along with miRNAs expression. Typically, these patients have a poorly differentiated NSCLC, often diagnosed at an advanced stage. However, HPV-positive lung cancers seem to have a better response to target therapies (EGFR) and immune checkpoint inhibitors and show an increased sensitivity to platinum-based treatments. This review summarizes the current evidence regarding the role of HPV in NSCLC development, especially among patients with a history of HPV-related cancers. It also examines the diagnostic and prognostic significance of HPV, investigating new future perspectives to enhance cancer screening, diagnostic protocols, and the development of more targeted therapies tailored to specific cohorts of NSCLC patients with confirmed HPV infection.

Also flagged:Heat shock proteinsHsp40Hsp60Hsp70Hsp90breast cancer
Journal Article 2024-01-10 No Snippets Zhang M, Bi X.
Show Full Abstract

Heat shock proteins (Hsps) are a group of stress-induced proteins involved in protein folding and maturation. Based on their molecular weight, Hsps can be divided into six families: small Hsps, Hsp40, Hsp60, Hsp70, Hsp90, and large Hsps. In the process of breast cancer tumorigenesis, Hsps play a central role in regulating cell reactions and functions including proliferation, metastasis, and apoptosis. Moreover, some of the critical Hsps also regulate the fine balance between the protective and destructive immunological responses within the tumor microenvironment. In this review, we systematically summarize the roles of major Hsps in breast cancer biology and point out the potential uses of these proteins in breast cancer diagnosis and therapy. Understanding the roles of different families of Hsps in breast cancer pathogenesis will help in the development of more effective prevention and treatment measures for breast cancer.

SOX6
Also flagged:Yes-Associated Protein 1DegradationdeoxynivalenolextracellularSOX9MMP13
Journal Article 2024-01-10 ✓ 2 Snippets Liu L, Liu H, Meng P, Zhang Y, Zhang F, Jia Y, Cheng B, Lammi MJ, Zhang F, Guo X.
In-Text Gene Mentions

…YAP interacts withSOX6and COL10A1 to…

…factors Sox5 andSox6to promote both…

Show Full Abstract

T-2 toxin and deoxynivalenol (DON) are two prevalent mycotoxins that cause cartilage damage in Kashin-Beck disease (KBD). Cartilage extracellular matrix (ECM) degradation in chondrocytes is a significant pathological feature of KBD. It has been shown that the Hippo pathway is involved in cartilage ECM degradation. This study aimed to examine the effect of YAP, a major regulator of the Hippo pathway, on the ECM degradation in the hiPS-derived chondrocytes (hiPS-Ch) model of KBD. The hiPS-Ch injury models were established via treatment with T-2 toxin/DON alone or in combination. We found that T-2 toxin and DON inhibited the proliferation of hiPS-Ch in a dose-dependent manner; significantly increased the levels of YAP, SOX9, and MMP13; and decreased the levels of COL2A1 and ACAN (all <i>p</i> values < 0.05). Immunofluorescence revealed that YAP was primarily located in the nuclei of hiPS-Ch, and its expression level increased with toxin concentrations. The inhibition of YAP resulted in the dysregulated expression of chondrogenic markers (all <i>p</i> values < 0.05). These findings suggest that T-2 toxin and DON may inhibit the proliferation of, and induce the ECM degradation, of hiPS-Ch mediated by YAP, providing further insight into the cellular and molecular mechanisms contributing to cartilage damage caused by toxins.

HTT
Also flagged:TauTauopathiesneurodegenerative diseasesmicrotubule-associated protein tauMAPTtauopathy
Journal Article 2024-01-10 ✓ 1 Snippet Pena E, San Martin-Salamanca R, El Alam S, Flores K, Arriaza K.
In-Text Gene Mentions

Specifically, in Huntington’s disease (HD), a correlation has been found between the levels of tau and huntingtin (Htt), a ubiquitous protein abundantly expressed in the brain and testes.

Show Full Abstract

Tauopathies are a group of neurodegenerative diseases whose central feature is dysfunction of the microtubule-associated protein tau (MAPT). Although the exact etiology of tauopathies is still unknown, it has been hypothesized that their onset may occur up to twenty years before the clear emergence of symptoms, which has led to questions about whether the prognosis of these diseases can be improved by, for instance, targeting the factors that influence tauopathy development. One such factor is hypoxia, which is strongly linked to Alzheimer's disease because of its association with obstructive sleep apnea and has been reported to affect molecular pathways related to the dysfunction and aggregation of tau proteins and other biomarkers of neurological damage. In particular, hypobaric hypoxia exposure increases the activation of several kinases related to the hyperphosphorylation of tau in neuronal cells, such as ERK, GSK3β, and CDK5. In addition, hypoxia also increases the levels of inflammatory molecules (IL-β1, IL-6, and TNF-α), which are also associated with neurodegeneration. This review discusses the many remaining questions regarding the influence of hypoxia on tauopathies and the contribution of high-altitude exposure to the development of these diseases.

SERPINC1
Also flagged:rheumatoid arthritislung adenocarcinomatumorchronic autoimmune diseasecancerLUAD
Journal Article 2024-01-10 ✓ 1 Snippet Shi L, Zou H, Yi J.
In-Text Gene Mentions

…HPD,SERPINC1, PKLR, PTGR1, KLB,…

Show Full Abstract

<b>Introduction:</b> Rheumatoid arthritis (RA) is a common chronic autoimmune disease with high incidence rate and high disability rate. One of the top complications is cancer, especially lung adenocarcinoma (LUAD). However, the molecular mechanisms linking RA and LUAD are still not clear. Therefore, in this study, we tried to identify the shared genetic signatures and local immune microenvironment between RA and LUAD and construct a clinical model for survival prediction. <b>Methods:</b> We obtained gene expression profiles and clinical information of patients with RA and LUAD from GEO and TCGA datasets. We performed differential analysis and Weighted Gene Co-expression Network Analysis (WGCNA) to discover the shared genes between RA and LUAD. Then, COX regression and LASSO analysis were employed to figure out genes significantly associated with survival. qRT-PCR and Western blot were utilized to validate the expression level of candidate genes. For clinical application, we constructed a nomogram, and also explored the value of RALUADS in characterizing immune infiltration features by CIBERSORT and xCell. Finally, responses to different drug therapy were predicted according to different RALUADS. <b>Results:</b> Our analysis identified two gene sets from differentially expressed genes and WGCNA gene modules of RA and LUAD. Filtered by survival analysis, three most significant shared genes were selected, CCN6, CDCA4 and ERLIN1, which were all upregulated in tumors and associated with poor prognosis. The three genes constituted RA and LUAD score (RALUADS). Our results demonstrated that RALUADS was higher in tumor patients and predicted poor prognosis in LUAD patients. Clinical nomogram combining RALUADS and other clinicopathological parameters had superior performance in survival prediction (AUC = 0.722). We further explored tumor immune microenvironment (TME) affected by RALUADS and observed RALUADS was closely related to the sensitivity of multiple immune blockades, chemotherapy and targeted drugs. <b>Conclusion:</b> Our findings suggest that there are shared physiopathologic processes and molecular profiles between RA and LUAD. RALUADS represents an excellent prognosis predictor and immune-related biomarker, which can be applied to select potential effective drugs and for LUAD patients with RA.

Also flagged:Irinotecanzincprolinebiotintumorcolon cancer
Journal Article 2024-01-10 No Snippets Giram PS, Nimma R, Bulbule A, Yadav AS, Gorain M, Venkata Radharani NN, Kundu GC, Garnaik B.
Show Full Abstract

A poly(d,l-lactide-<i>co</i>-glycolide) (PLGA) copolymer was synthesized using the ring-opening polymerization of d,l-lactide and glycolide monomers in the presence of zinc proline complex in bulk through the green route and was well characterized using attenuated total reflectance-Fourier transform infrared, <sup>1</sup>H and <sup>13</sup>C nuclear magnetic resonance, gel permeation chromatography, differential scanning calorimetry, X-ray diffraction, matrix-assisted laser desorption/ionization time-of-flight, etc. Furthermore, PLGA-conjugated biotin (PLGA-B) was synthesized using the synthesized PLGA and was employed to fabricate nanoparticles for irinotecan (Ir) delivery. These nanoparticles (PLGA-NP-Ir and PLGA-B-NP-Ir) were tested for physicochemical and biological characteristics. PLGA-B-NP-Ir exhibited a stronger cellular uptake and anticancer activity as compared to PLGA-NP-Ir in CT-26 cancer cells (log <i>p</i> < 0.05). The accumulation and retention of fluorescence-labeled nanoparticles were observed to be better in CT-26-inoculated solid tumors in Balb/c mice. The PLGA-B-NP-Ir-treated group inhibited tumor growth significantly more (log <i>p</i> < 0.001) than the untreated control, PLGA-NP-Ir, and Ir-treated groups. Furthermore, no body weight loss, hematological, and blood biochemical tests demonstrated the nanocarriers' nontoxic nature. This work presents the use of safe PLGA and the demonstration of a proof-of-concept of biotin surface attached PLGA nanoparticle-mediated active targeted Ir administration to combat colon cancer. To treat colon cancer, PLGA-B-NP-Ir performed better due to specific active tumor targeting and greater cellular uptake due to biotin.

Also flagged:Flavin mononucleotideriboflavinbindingvitamin B 2gene expressionlinezolid
Journal Article 2024-01-10 No Snippets Bekker GJ, Fukunishi Y, Higo J, Kamiya N.
Show Full Abstract

Flavin mononucleotide riboswitches are common among many pathogenic bacteria and are therefore considered to be an attractive target for antibiotics development. The riboswitch binds riboflavin (RBF, also known as vitamin B<sub>2</sub>), and although an experimental structure of their complex has been solved with the ligand bound deep inside the RNA molecule in a seemingly unreachable state, the binding mechanism between these molecules is not yet known. We have therefore used our Multicanonical Molecular Dynamics (McMD)-based dynamic docking protocol to analyze their binding mechanism by simulating the binding process between the riboswitch aptamer domain and the RBF, starting from the apo state of the riboswitch. Here, the refinement stage was crucial to identify the native binding configuration, as several other binding configurations were also found by McMD-based docking simulations. RBF initially binds the interface between P4 and P6 including U61 and G62, which forms a gateway where the ligand lingers until this gateway opens sufficiently to allow the ligand to pass through and slip into the hidden binding site including A48, A49, and A85.

Also flagged:cancersmetal nanoclustersperoxidasemetalsnanoclusterssynthesis
Journal Article 2024-01-10 No Snippets Mohseni N, Moodi M, Kefayat A, Shokati F, Molaabasi F.
Show Full Abstract

Development of rapid colorimetric methods based on novel optical-active metal nanomaterials has provided methods for the detection of ions, biomarkers, cancers, etc. Fluorescent metal nanoclusters (FMNCs) have gained a lot of attention due to their unique physical, chemical, and optical properties providing numerous applications from rapid and sensitive detection to cellular imaging. However, because of very small color changes, their colorimetric applications for developing rapid tests based on the naked eye or simple UV-vis absorption spectrophotometry are still limited. FMNCs with peroxidase-like activity have significant potential in a wide variety of applications, especially for point-of-care diagnostics. In this review, the effect of using various capping agents and metals for the preparation of nanoclusters in their colorimetric sensing properties is explored, and the synthesis and detection mechanisms and the recent advances in their application for ultrasensitive chemical and biological analysis regarding human health are highlighted. Finally, the challenges that remain as well as the future perspectives are briefly discussed. Overcoming these limitations will allow us to expand the nanocluster's application for colorimetric diagnostic purposes in medical practice.

HTT
Also flagged:neurodegenerative diseasesneurological disordersneurodegenerative disordersautophagyAlzheimer's diseaseAD
Journal Article 2024-01-10 ✓ 1 Snippet Hamedani SG, Pourmasoumi M, Zarifi SH, Askari G, Jamialahmadi T, Bagherniya M, Sahebkar A.
In-Text Gene Mentions

HD is a progressive neurodegenerative disorder caused by the repetition of cytosine-adenine-guanine (CAG) trinucleotide in the huntingtin (HTT) gene [64].

Show Full Abstract

Due to an increase in the number of older people in recent years, neurodegenerative diseases as the most important age-related neurological disorders are considered as a great threat to human health. The treatment strategies for these disorders are symptomatic and there is no known definitive treatment; however, recently, several studies have investigated the effectiveness of some herbs and their components in limiting the progression and treatment of neurodegenerative disorders. In this study, we searched Medline (via PubMed), Scopus, Science Direct, and Google Scholar databases. The keywords used in the search were: saffron [title/abstract] or (saffron compound [title/abstract]) and (neurological disorders [title/abstract]), publication date range (2010-2023), and language (English). After applying inclusion and exclusion criteria, 30 articles remained. Of the 30 articles included in the study, six studies on the treatment of neurodegenerative disorders by saffron and its components were in the clinical trial phase, and 24 studies were in the preclinical phase. Saffron and its compounds can play an important role in inhibiting neuroinflammation and excitotoxic pathways, modulating autophagy and apoptosis, attenuating oxidative damage, and activating defensive antioxidant enzymes, resulting in neuroprotection against neurodegenerative diseases. Therefore, this study aimed to review the studies on the effects of saffron and its compounds on the treatment of neurodegenerative diseases.

HFE
Also flagged:Hemoglobin FHydroxyureathalidomidebeta-thalassemiahemoglobin A2hemoglobinopathies
Journal Article 2024-01-10 ✓ 1 Snippet Nawaz K, Khan SN, Bashir A, Rehman A, Tariq Masood Khan M, Mir A, Ahmad S.
In-Text Gene Mentions

…β-thalassemia and otherhemochromatosisconditions.…

Show Full Abstract

<h4>Background</h4>Fetal hemoglobin (HbF) has been reported to be associated with disease severity and treatment response to HbF-inducing therapies like Hydroxyurea and thalidomide in patients suffering from transfusion-dependent beta-thalassemia (TDT). However, the role of hemoglobin A2 (HbA2) remains less clear in TDT, therefore this study aims to determine the impact of both HbF and HbA2 levels on disease severity and treatment response.<h4>Methodology</h4>A prospective observational study was conducted at the Peshawar Institute of Medical Sciences and Fatimid Foundation Peshawar from May 2023 to October 2023. A total of 232 TDT-diagnosed patients were enrolled using a convenient sampling technique, whereas coinheritance of beta-thalassemia with other hemoglobinopathies was excluded.<h4>Result</h4>This study reveals a significant impact of HbF on disease severity (p<0.05) but finds no substantial correlation (p>0.05) between HbA2 levels and disease severity. Additionally, HbF and HbA2 levels exhibit no association with treatment response categories in patients receiving HbF induction therapy, and various mutations do not significantly alter HbF and HbA2 levels or disease severity parameters in TDT patients.<h4>Conclusion</h4>The study established a significant association between HbF and disease severity. However, regarding treatment response, neither HbF nor HbA2 levels impact response categories. Combinatorial treatment with hydroxyurea and thalidomide showed superior efficacy compared to monotherapy. A larger sample size and extended follow-up are recommended to further explore the impact of HbF, HbA2, and various mutations on disease severity and treatment response.

ZNFX1
Also flagged:tuberculosisTBinfectious diseasecytokineantimicrobial peptidesautophagy
Journal Article 2024-01-09 ✓ 5 Snippets Liu H, Han Z, Chen L, Zhang J, Zhang Z, Chen Y, Liu F, Wang K, Liu J, Sai N, Zhou X, Zhou C, Hu S, Wen Q, Ma L.
In-Text Gene Mentions

Znfx1–/– BMDMs expressed significantly reduced levels of CD80, CD86, and MHC-II in response to H37Rv infection, without influencing the expression of CD206, a marker of type II macrophages (Figure 3D).

Subsequently, the DEGs enriched in the common KEGG pathways in BMDMs without infection, and in BMDMs with H37Rv infection, with the appearance frequency greater than or equal to 3, were analyzed using Venn analysis again to find out genes generally regulated by ZNFX1.

Similar to previous reports, the expression levels of IFIT1, IRF1, and MX1 in Znfx1–/– BMDMs were higher than those in WT BMDMs following H37Rv infection, despite the increased intracellular M. tuberculosis burden in Znfx1–/– BMDMs (Supplemental Figure 4A).

qPCR and Western blot analysis validated that the absence of ZNFX1 led to a significant downregulation of Prkaa2, irrespective of H37Rv infection (Figure 5, B and C).

Using criteria log2 fold-change (log2FC) > 1 and P < 0.05, we performed serial Venn analysis and identified 3 genes (protein kinase AMP-activated catalytic subunit alpha 2 [Prkaa2], Mmp9, and Gdf3) with significantly differential expression in Znfx1–/– BMDMs compared with in WT BMDMs at both 6 and 24 hpi, regardless of H37Rv infection (Supplemental Table 3).

Show Full Abstract

Tuberculosis has the highest mortality rate worldwide for a chronic infectious disease caused by a single pathogen. RNA-binding proteins (RBPs) are involved in autophagy - a key defense mechanism against Mycobacterium tuberculosis (M. tuberculosis) infection - by modulating RNA stability and forming intricate regulatory networks. However, the functions of host RBPs during M. tuberculosis infection remain relatively unexplored. Zinc finger NFX1-type containing 1 (ZNFX1), a conserved RBP critically involved in immune deficiency diseases and mycobacterial infections, is significantly upregulated in M. tuberculosis-infected macrophages. Here, we aimed to explore the immunoregulatory functions of ZNFX1 during M. tuberculosis infection. We observed that Znfx1 knockout markedly compromised the multifaceted immune responses mediated by macrophages. This compromise resulted in reduced phagocytosis, suppressed macrophage activation, increased M. tuberculosis burden, progressive lung tissue injury, and chronic inflammation in M. tuberculosis-infected mice. Mechanistic investigations revealed that the absence of ZNFX1 inhibited autophagy, consequently mediating immune suppression. ZNFX1 critically maintained AMPK-regulated autophagic flux by stabilizing protein kinase AMP-activated catalytic subunit alpha 2 mRNA, which encodes a key catalytic α subunit of AMPK, through its zinc finger region. This process contributed to M. tuberculosis growth suppression. These findings reveal a function of ZNFX1 in establishing anti-M. tuberculosis immune responses, enhancing our understanding of the roles of RBPs in tuberculosis immunity and providing a promising approach to bolster antituberculosis immunotherapy.

Also flagged:Glutamatevesicular glutamate transporter type 2VGLUT2calciumaxonaxons
Journal Article 2024-01-09 No Snippets Liu J, Zhang S, Emadi S, Guo T, Chen L, Feng B.
Show Full Abstract

The enteric nervous system (ENS) functions largely independently of the central nervous system (CNS). Glutamate, the dominant neurotransmitter in the CNS and sensory afferents, is not a primary neurotransmitter in the ENS. Only a fraction (∼2%) of myenteric neurons in the mouse distal colon and rectum (colorectum) are positive for vesicular glutamate transporter type 2 (VGLUT2), the structure and function of which remain undetermined. Here, we systematically characterized VGLUT2-positive enteric neurons (VGLUT2-ENs) through sparse labeling with adeno-associated virus, single-cell mRNA sequencing (scRNA-seq), and GCaMP6f calcium imaging. Our results reveal that the majority of VGLUT2-ENs (29 of 31, 93.5%) exhibited Dogiel type I morphology with a single aborally projecting axon; most axons (26 of 29, 89.7%) are between 4 and 10 mm long, each traversing 19 to 34 myenteric ganglia. These anatomical features exclude the VGLUT2-ENs from being intrinsic primary afferent or motor neurons. The scRNA-seq conducted on 52 VGLUT2-ENs suggests different expression profiles from conventional descending interneurons. Ex vivo GCaMP6f recordings from flattened colorectum indicate that almost all VGLUT2-EN (181 of 215, 84.2%) are indirectly activated by colorectal stretch via nicotinic cholinergic neural transmission. In conclusion, VGLUT2-ENs are a functionally unique group of enteric neurons with single aborally projecting long axons that traverse multiple myenteric ganglia and are activated indirectly by colorectal mechanical stretch. This knowledge will provide a solid foundation for subsequent studies on the potential interactions of VGLUT2-EN with extrinsic colorectal afferents via glutamatergic neurotransmission.<b>NEW & NOTEWORTHY</b> We reveal that VGLUT2-positive enteric neurons (EN), although constituting a small fraction of total EN, are homogeneously expressed in the myenteric ganglia, with a slight concentration at the intermediate region between the colon and rectum. Through anatomic, molecular, and functional analyses, we demonstrated that VGLUT2-ENs are activated indirectly by noxious circumferential colorectal stretch via nicotinic cholinergic transmission, suggesting their participation in mechanical visceral nociception.

Also flagged:DNAJC5Hsp40co-chaperonescysteinesynaptic vesiclesautosomal dominant,
Journal Article 2024-01-09 No Snippets Barker E, Milburn A, Helassa N, Hammond D, Sanchez-Soriano N, Morgan A, Barclay J.
Show Full Abstract

Cysteine string protein α (CSPα), also known as DNAJC5, is a member of the DnaJ/Hsp40 family of co-chaperones. The name derives from a cysteine-rich domain, palmitoylation of which enables localization to intracellular membranes, notably neuronal synaptic vesicles. Mutations in the DNAJC5 gene that encodes CSPα cause autosomal dominant, adult-onset neuronal ceroid lipofuscinosis (ANCL), a rare neurodegenerative disease. As null mutations in CSP-encoding genes in flies, worms and mice similarly result in neurodegeneration, CSP is evidently an evolutionarily conserved neuroprotective protein. However, the client proteins that CSP chaperones to prevent neurodegeneration remain unclear. Traditional methods for identifying protein-protein interactions such as yeast 2-hybrid and affinity purification approaches are poorly suited to CSP, due to its requirement for membrane anchoring and its tendency to aggregate after cell lysis. Therefore, we employed proximity labelling, which enables identification of interacting proteins in situ in living cells via biotinylation. Neuroendocrine PC12 cell lines stably expressing wild type or L115R ANCL mutant CSP constructs fused to miniTurbo were generated; then the biotinylated proteomes were analysed by liquid chromatographymass spectrometry (LCMS) and validated by western blotting. This confirmed several known CSP-interacting proteins, such as Hsc70 and SNAP-25, but also revealed novel binding proteins, including STXBP1/Munc18-1. Interestingly, some protein interactions (such as Hsc70) were unaffected by the L115R mutation, whereas others (including SNAP-25 and STXBP1/Munc18-1) were inhibited. These results define the CSP interactome in a neuronal model cell line and reveal interactions that are affected by ANCL mutation and hence may contribute to the neurodegeneration seen in patients.

Also flagged:SynthesisChroman-2,4-dionesPalladium-iodochromoneaminescarbon monoxide
Journal Article 2024-01-09 No Snippets Chniti S, Pongrácz P, Kollár L, Bényei A, Dörnyei Á, Takács A.
Show Full Abstract

Palladium-catalyzed aminocarbonylation of 3-iodochromone was studied in the presence of primary and secondary amines using atmospheric pressure of carbon monoxide as a carbonyl source. This procedure successfully provided a library of chromone-3-carboxamides and 3-substituted chroman-2,4-diones in 40 to 92% isolated yields. The reaction proceeded via highly chemoselective aminocarbonylation (up to 100%) in the presence of secondary amines by using monodentate or bidentate phosphine ligands. The tendency of 3-iodochromone substrate to undergo ANRORC rearrangement with N-nucleophiles was crucial to shift the reaction toward an unprecedented chemoselective carbonylative transformation, where a late-stage carbonyl insertion is favored concomitantly to the last ring-closure step. The proposed aza-Michael addition/ring-opening/intramolecular aryloxycarbonylation sequence showed compatibility, uniquely, to primary amines when XantPhos was used as a ligand. The solid-state structures of chromone-3-carboxamide (2a) and chroman-2,4-dione (3s) were undoubtedly established by single-crystal XRD analysis. A catalytic cycle was proposed to rationalize the formation of the two types of carbonylated compounds.

OLFM4
Also flagged:infectioninterferonzoonosesLyme diseasebabesiosisanaplasmosis
Journal Article 2024-01-09 ✓ 1 Snippet Milovic A, Duong JV, Barbour AG.
In-Text Gene Mentions

…Nox1, Nr3c1, Oas1,Olfm4, Padi4, Pbib, Pkm,…

Show Full Abstract

The white-footed deermouse <i>Peromyscus leucopus</i>, a long-lived rodent, is a key reservoir in North America for agents of several zoonoses, including Lyme disease, babesiosis, anaplasmosis, and a viral encephalitis. While persistently infected, this deermouse is without apparent disability or diminished fitness. For a model for inflammation elicited by various pathogens, the endotoxin lipopolysaccharide (LPS) was used to compare genome-wide transcription in blood by <i>P. leucopus</i>, <i>Mus musculus,</i> and <i>Rattus norvegicus</i> and adjusted for white cell concentrations. Deermice were distinguished from the mice and rats by LPS response profiles consistent with non-classical monocytes and alternatively-activated macrophages. LPS-treated <i>P. leucopus</i>, in contrast to mice and rats, also displayed little transcription of interferon-gamma and lower magnitude fold-changes in type 1 interferon-stimulated genes. These characteristics of <i>P. leucopus</i> were also noted in a <i>Borrelia hermsii</i> infection model. The phenomenon was associated with comparatively reduced transcription of endogenous retrovirus sequences and cytoplasmic pattern recognition receptors in the deermice. The results reveal a mechanism for infection tolerance in this species and perhaps other animal reservoirs for agents of human disease.

Also flagged:MAPKcancereupatilincarvacroloridoninsophoridine
Journal Article 2024-01-09 No Snippets Shi A, Liu L, Li S, Qi B.
Show Full Abstract

<h4>Purpose</h4>This article summarizes natural products that target the MAPK-signaling pathway in cancer therapy. The classification, chemical structures, and anti-cancer mechanisms of these natural products are elucidated, and comprehensive information is provided on their potential use in cancer therapy.<h4>Methods</h4>Using the PubMed database, we searched for keywords, including "tumor", "cancer", "natural product", "phytochemistry", "plant chemical components", and "MAPK-signaling pathway". We also screened for compounds with well-defined structures that targeting the MAPK-signaling pathway and have anti-cancer effects. We used Kingdraw software and Adobe Photoshop software to draw the chemical compound structural diagrams.<h4>Results</h4>A total of 131 papers were searched, from which 85 compounds with well-defined structures were selected. These compounds have clear mechanisms for targeting cancer treatment and are mainly related to the MAPK-signaling pathway. Examples include eupatilin, carvacrol, oridonin, sophoridine, diosgenin, and juglone. These chemical components are classified as flavonoids, phenols, terpenoids, alkaloids, steroidal saponins, and quinones.<h4>Conclusions</h4>Certain MAPK pathway inhibitors have been used for clinical treatment. However, the clinical feedback has not been promising because of genomic instability, drug resistance, and side effects. Natural products have few side effects, good medicinal efficacy, a wide range of sources, individual heterogeneity of biological activity, and are capable of treating disease from multiple targets. These characteristics make natural products promising drugs for cancer treatment.

LRRC7
Also flagged:secretionmembranecytoplasmextracellularVIItype
Journal Article 2024-01-09 ✓ 4 Snippets Klein TA, Shah PY, Gkragkopoulou P, Grebenc DW, Kim Y, Whitney JC.
In-Text Gene Mentions

…downstream of aLap1–Lap2 pair (formerly DUF3130-D…

…predicted similarity toLap1and Lap2, respectively…

…mechanistically distinct fromLap1–Lap2.…

…TelC LXG ,Lap1, and Lap2 sequences,…

Show Full Abstract

Type VII secretion systems are membrane-embedded nanomachines used by Gram-positive bacteria to export effector proteins from the cytoplasm to the extracellular environment. Many of these effectors are polymorphic toxins comprised of an N-terminal Leu-x-Gly (LXG) domain of unknown function and a C-terminal toxin domain that inhibits the growth of bacterial competitors. In recent work, it was shown that LXG effectors require two cognate Lap proteins for T7SS-dependent export. Here, we present the 2.6 Å structure of the LXG domain of the TelA toxin from the opportunistic pathogen <i>Streptococcus intermedius</i> in complex with both of its cognate Lap targeting factors. The structure reveals an elongated α-helical bundle within which each Lap protein makes extensive hydrophobic contacts with either end of the LXG domain. Remarkably, despite low overall sequence identity, we identify striking structural similarity between our LXG complex and PE-PPE heterodimers exported by the distantly related ESX type VII secretion systems of Mycobacteria implying a conserved mechanism of effector export among diverse Gram-positive bacteria. Overall, our findings demonstrate that LXG domains, in conjunction with their cognate Lap targeting factors, represent a tripartite secretion signal for a widespread family of T7SS toxins.

Also flagged:α-synucleinsynucleinopathiesfibrilsantibodydementiaLewy bodies
Journal Article 2024-01-09 No Snippets Gilboa T, Swank Z, Thakur R, Gould RA, Ooi KH, Norman M, Flynn EA, Deveney BT, Chen A, Borberg E, Kuzkina A, Ndayisaba A, Khurana V, Weitz DA, Walt DR.
Show Full Abstract

The quantification and characterization of aggregated α-synuclein in clinical samples offer immense potential toward diagnosing, treating, and better understanding neurodegenerative synucleinopathies. Here, we developed digital seed amplification assays to detect single α-synuclein aggregates by partitioning the reaction into microcompartments. Using pre-formed α-synuclein fibrils as reaction seeds, we measured aggregate concentrations as low as 4 pg/mL. To improve our sensitivity, we captured aggregates on antibody-coated magnetic beads before running the amplification reaction. By first characterizing the pre-formed fibrils with transmission electron microscopy and size exclusion chromatography, we determined the specific aggregates targeted by each assay platform. Using brain tissue and cerebrospinal fluid samples collected from patients with Parkinson's Disease and multiple system atrophy, we demonstrated that the assay can detect endogenous pathological α-synuclein aggregates. Furthermore, as another application for these assays, we studied the inhibition of α-synuclein aggregation in the presence of small-molecule inhibitors and used a custom image analysis pipeline to quantify changes in aggregate growth and filament morphology.

Also flagged:Cancercancerslung cancercolorectal cancertumorAFP
Journal Article 2024-01-09 No Snippets Min Y, Deng W, Yuan H, Zhu D, Zhao R, Zhang P, Xue J, Yuan Z, Zhang T, Jiang Y, Xu K, Wu D, Cai Y, Suo C, Chen X.
Show Full Abstract

Extracellular vesicles (EVs) and EV proteins are promising biomarkers for cancer liquid biopsy. Herein, we designed a case-control study involving 100 controls and 100 patients with esophageal, stomach, colorectal, liver, or lung cancer to identify common and type-specific biomarkers of plasma-derived EV surface proteins for the five cancers. EV surface proteins were profiled using a sequencing-based proximity barcoding assay. In this study, five differentially expressed proteins (DEPs) and eight differentially expressed protein combinations (DEPCs) showed promising performance (area under curve, AUC > 0.900) in pan-cancer identification [e.g., TENM2 (AUC = 0.982), CD36 (AUC = 0.974), and CD36-ITGA1 (AUC = 0.971)]. Our classification model could properly discriminate between cancer patients and controls using DEPs (AUC = 0.981) or DEPCs (AUC = 0.965). When distinguishing one cancer from the other four, the accuracy of the classification model using DEPCs (85-92%) was higher than that using DEPs (78-84%). We validated the performance in an additional 14 cancer patients and 14 controls, and achieved an AUC value of 0.786 for DEPs and 0.622 for DEPCs, highlighting the necessity to recruit a larger cohort for further validation. When clustering EVs into subpopulations, we detected cluster-specific proteins highly expressed in immune-related tissues. In the context of colorectal cancer, we identified heterogeneous EV clusters enriched in cancer patients, correlating with tumor initiation and progression. These findings provide epidemiological and molecular evidence for the clinical application of EV proteins in cancer prediction, while also illuminating their functional roles in cancer physiopathology.

HFE
Also flagged:hereditary spherocytosishaemochromatosishyperferritinaemiaSLC4A1ironanaemia
Journal Article 2024-01-09 ✓ 2 Snippets Soldin IH, Ferro A, Eremina YO, Bibi MSN.
In-Text Gene Mentions

HFE -related

HFE

Show Full Abstract

We report the case of a man in his 50s with extravascular haemolysis, fluctuating indirect hyperbilirubinaemia, elevated transferrin saturation with hyperferritinaemia and normal liver enzymes. Spherocytes were detected in a blood smear and a mutation of unknown significance, c.1626+1G>A p.?, in intron 13 of the <i>SLC4A1</i> gene, was identified by next-generation sequencing (NGS). The same mutation was found in his daughter, who presented with similar laboratory changes, confirming the diagnosis of hereditary spherocytosis. Abdominal MRI showed hepatosplenomegaly with hepatic iron overload. In this context of haemolysis (without anaemia) and iron overload, a diagnosis of haemochromatosis was presumed. NGS confirmed the presence of the variants p.(His63Asp) and p.(Cys282Tyr) in heterozygosity in the <i>HFE</i> gene. We report this case for the rarity of co-existing two haematological diseases counteracting each other.

SOX6
Also flagged:gene expressiondiabetesinsulinvisionolfactiontransporter
Journal Article 2024-01-09 ✓ 1 Snippet Gordon WE, Baek S, Nguyen HP, Kuo YM, Bradley R, Fong SL, Kim N, Galazyuk A, Lee I, Ingala MR, Simmons NB, Schountz T, Cooper LN, Georgakopoulos-Soares I, Hemberg M, Ahituv N.
In-Text Gene Mentions

SOX6is upregulated after…

Show Full Abstract

Frugivory evolved multiple times in mammals, including bats. However, the cellular and molecular components driving it remain largely unknown. Here, we use integrative single-cell sequencing (scRNA-seq and scATAC-seq) on insectivorous (Eptesicus fuscus; big brown bat) and frugivorous (Artibeus jamaicensis; Jamaican fruit bat) bat kidneys and pancreases and identify key cell population, gene expression and regulatory differences associated with the Jamaican fruit bat that also relate to human disease, particularly diabetes. We find a decrease in loop of Henle and an increase in collecting duct cells, and differentially active genes and regulatory elements involved in fluid and electrolyte balance in the Jamaican fruit bat kidney. The Jamaican fruit bat pancreas shows an increase in endocrine and a decrease in exocrine cells, and differences in genes and regulatory elements involved in insulin regulation. We also find that these frugivorous bats share several molecular characteristics with human diabetes. Combined, our work provides insights from a frugivorous mammal that could be leveraged for therapeutic purposes.

HTT
Also flagged:pexophagyautophagydegradationperoxisomesmitochondriaautophagy initiation factor
Journal Article 2024-01-09 ✓ 5 Snippets Germain K, So RWL, DiGiovanni LF, Watts JC, Bandsma RHJ, Kim PK.
In-Text Gene Mentions

Further, the HTT-depleted cells showed similar levels of peroxisome loss compared to control when pexophagy was induced by either amino acid starvation (Supplementary Data Fig. 6a–f), or by expressing PMP34-GFP-UBKo (Supplementary Data Fig. 6g–i).

Complex autophagic dysfunction has been documented in HD models, and wild-type HTT protein has been proposed to mediate the selective autophagy of protein aggregates, lipid droplets, and mitochondria in response to autophagic stimuli35,38–40.

Therefore, we investigated whether HTT was required for pexophagy by examining both amino acid starvation and PMP34-GFP-UBKo-induced pexophagy in HeLa cells siRNA-depleted of HTT.

…models, and wild-typeHTTprotein has been…

…we investigated whetherHTTwas required for…

Show Full Abstract

Selective autophagy is an essential process to maintain cellular homeostasis through the constant recycling of damaged or superfluous components. Over a dozen selective autophagy pathways mediate the degradation of diverse cellular substrates, but whether these pathways can influence one another remains unknown. We address this question using pexophagy, the autophagic degradation of peroxisomes, as a model. We show in cells that upregulated pexophagy impairs the selective autophagy of both mitochondria and protein aggregates by exhausting the autophagy initiation factor, ULK1. We confirm this finding in cell models of the pexophagy-mediated form of Zellweger Spectrum Disorder, a disease characterized by peroxisome dysfunction. Further, we extend the generalizability of limited selective autophagy by determining that increased protein aggregate degradation reciprocally reduces pexophagy using cell models of Parkinson's Disease and Huntington's Disease. Our findings suggest that the degradative capacity of selective autophagy can become limited by an increase in one substrate.

HFE
Also flagged:retinolhydroxyvitamin Dvitamin Aironmicronutrient deficiencies
Journal Article 2024-01-09 ✓ 1 Snippet Owolabi AJ, Ayede IA, Akinrinoye OO, Falade AG, Ajibola GB, Christopher OO, Arifalo GO, Abiona AO, Feskens EJM, Melse-Boonstra A, Schaafsma A.
In-Text Gene Mentions

…metabolism (haptoglobin Hp2-2,hemochromatosis, sickle cell anemia,…

Show Full Abstract

<h4>Background</h4>Moderate-to-late preterm infants (32-34 weeks GA) have increased risk of neonatal morbidities compared to term infants, however dedicated nutritional guidelines are lacking.<h4>Methods</h4>Moderate-to-late preterm infants received a preterm formula (n = 17) or breastmilk (n = 24) from age 2-10 weeks in a non-randomized, open-label observational study. Anthropometric measurements were assessed bi-weekly. Blood concentrations of hemoglobin, ferritin, serum retinol, and 25-hydroxy-vitamin D (25OHD) were analyzed at age 2 and 10 weeks.<h4>Result</h4>Average growth per day was 14.7 g/kg BW/day in formula-fed and 12.8 g/kg BW/day in breastmilk-fed infants but not different from each other. Length and head circumference in both groups were in line with the median reference values of the Fenton growth chart. At 10 weeks of age, hemoglobin tended to be higher in the formula-fed group (10.2 g/dL vs. 9.6 g/dL, p = 0.053). 25OHD increased in formula- and breastmilk-fed infants from 73.8 to 180.9 nmol/L and from 70.7 to 97.6 nmol/L, respectively. Serum retinol only increased in the formula-fed group (0.63 to 1.02 µmol/L, p < 0.001).<h4>Conclusion</h4>Breastfeeding resulted in adequate growth in moderate-late preterm infants but was limiting in some micronutrients. The preterm formula provided adequate micronutrients, but weight gain velocity was higher than the Fenton reference value.<h4>Impact statement</h4>Unfortified breastmilk resulted in adequate growth in weight, length and head circumference in Nigerian moderate to late preterm infants during an study period of 8 weeks, but status of vitamin D, vitamin A and iron needs to be monitored. The high-energy formula, developed for very preterm infants, resulted in higher growth in body weight in moderate to late preterm infants than the median of the Fenton preterm growth chart. This study supports the necessity of dedicated nutritional guidelines, and regular monitoring of growth and nutritional status of moderate to late preterm infants.

CDK5RAP1
Also flagged:METTL17FXNmitochondrialironpathogenesisbinding
Journal Article 2024-01-09 ✓ 2 Snippets Ast T, Itoh Y, Sadre S, McCoy JG, Namkoong G, Wengrod JC, Chicherin I, Joshi PR, Kamenski P, Suess DLM, Amunts A, Mootha VK.
In-Text Gene Mentions

…the absence ofCDK5RAP1, a bona-fide Fe-S…

…in contrast toCDK5RAP1depleted cells.…

Show Full Abstract

Friedreich's ataxia (FA) is a debilitating, multisystemic disease caused by the depletion of frataxin (FXN), a mitochondrial iron-sulfur (Fe-S) cluster biogenesis factor. To understand the cellular pathogenesis of FA, we performed quantitative proteomics in FXN-deficient human cells. Nearly every annotated Fe-S cluster-containing protein was depleted, indicating that as a rule, cluster binding confers stability to Fe-S proteins. We also observed depletion of a small mitoribosomal assembly factor METTL17 and evidence of impaired mitochondrial translation. Using comparative sequence analysis, mutagenesis, biochemistry, and cryoelectron microscopy, we show that METTL17 binds to the mitoribosomal small subunit during late assembly and harbors a previously unrecognized [Fe<sub>4</sub>S<sub>4</sub>]<sup>2+</sup> cluster required for its stability. METTL17 overexpression rescued the mitochondrial translation and bioenergetic defects, but not the cellular growth, of FXN-depleted cells. These findings suggest that METTL17 acts as an Fe-S cluster checkpoint, promoting translation of Fe-S cluster-rich oxidative phosphorylation (OXPHOS) proteins only when Fe-S cofactors are replete.

Also flagged:degradationgene expressionpairingRBPtranslation initiationtranslation elongation
Journal Article 2024-01-09 No Snippets Bose R, Saleem I, Mustoe AM.
Show Full Abstract

RNA secondary structure plays essential roles in encoding RNA regulatory fate and function. Most RNAs populate ensembles of alternatively paired states and are continually unfolded and refolded by cellular processes. Measuring these structural ensembles and their contributions to cellular function has traditionally posed major challenges, but new methods and conceptual frameworks are beginning to fill this void. In this review, we provide a mechanism- and function-centric compendium of the roles of RNA secondary structural ensembles and minority states in regulating the RNA life cycle, from transcription to degradation. We further explore how dysregulation of RNA structural ensembles contributes to human disease and discuss the potential of drugging alternative RNA states to therapeutically modulate RNA activity. The emerging paradigm of RNA structural ensembles as central to RNA function provides a foundation for a deeper understanding of RNA biology and new therapeutic possibilities.

BTN2A1
Also flagged:pyroptosistumormesenchymal tumorsdeathGene Expressionliposarcoma
Journal Article 2024-01-09 ✓ 1 Snippet Chen W, Cheng J, Cai Y, Wang P, Jin J.
In-Text Gene Mentions

…p < 0.05),BTN2A1( p <…

Show Full Abstract

<h4>Background</h4>Dedifferentiated liposarcoma (DDL), a member of malignant mesenchymal tumors, has a high local recurrence rate and poor prognosis. Pyroptosis, a newly discovered programmed cell death, is tightly connected with the progression and outcome of tumor.<h4>Objective</h4>The aim of this study was to explore the role of pyroptosis in DDL.<h4>Methods</h4>We obtained the RNA sequencing data from The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression databases to identify different pyroptosis-related genes (PRGs) expression pattern. An unsupervised method for clustering based on PRGs was performed. Based on the result of cluster analysis, we researched clinical outcomes and immune microenvironment between clusters. The differentially expressed genes (DEGs) between the two clusters were used to develop a prognosis model by the LASSO Cox regression method, followed by the performance of functional enrichment analysis and single-sample gene set enrichment analysis. All of the above results were validated in the Gene Expression Omnibus (GEO) dataset.<h4>Results</h4>Forty-one differentially expressed PRGs were found between tumor and normal tissues. A consensus clustering analysis based on PRGs was conducted and classified DDL patients into two clusters. Cluster 2 showed a better outcome, higher immune scores, higher immune cells abundances, and higher expression levels in numerous immune checkpoints. DEGs between clusters were identified. A total of 5 gene signatures was built based on the DEGs and divided all DDL patients of the TCGA cohort into low-risk and high-risk groups. The low-risk group indicates greater inflammatory cell infiltration and better outcome. For external validation, the survival difference and immune landscape between the two risk groups of the GEO cohort were also significant. Receiver operating characteristic curves implied that the risk model could exert its function as an outstanding predictor in predicting DDL patients' prognoses.<h4>Conclusion</h4>Our findings revealed the clinical implication and key role in tumor immunity of PRGs in DDL. The risk model is a promising predictive tool that could provide a fundamental basis for future studies and individualized immunotherapy.

TNFSF4
Also flagged:OX40LNS1hepatocellular carcinomatumorimmune responsecancer
Journal Article 2024-01-09 ✓ 4 Snippets Yang H, Lei G, Deng Z, Sun F, Tian Y, Cheng J, Yu H, Li C, Bai C, Zhang S, An G, Yang P.
In-Text Gene Mentions

OX40L (CD252, TNFSF4) is a type II transmembrane protein, which is a class of proteins involved in the costimulation and differentiation of T cells with a positive role in the immune response.19,20 OX40L is predominantly expressed by antigen-presenting cells (APCs), including activated dendritic cells (DCs), B cells, macrophages, Langerhans cells, T cells, and endothelial cells.21 Previous studies have shown that OX40L can enhance the antitumor activity of T cells by delivering effective costimulatory signals to CD4+ and CD8 T+ cells, which is critical for the activation and survival of T cells and the generation of memory T cells from activated effector T cells.22,23 Plasmacytoid DCs can regulate T helper responses by balancing OX40 and type I interferon (IFN) expression.24,25 Another study reported that OX40–OX40L interactions play a critical role in key immunomodulatory checkpoints that may be involved in the development of autoimmune disease.26 A cancer mRNA vaccine delivering the OX40L gene has been developed by the pharmaceutical and biotechnology company Moderna and is under investigation for colon adenocarcinoma, HCC and lung cancer.26,27 To this end, we speculated that OX40L-expressing OV would show promising results and hold potential for the treatment of cancer.

…OX40L (CD252,TNFSF4) is a type…

…A) and recombinant anti-OX40L/TNFSF4antibody (EPR23155–317, Abcam,…

…(OX40L, CD252, andTNFSF4) belong to the…

Show Full Abstract

<h4>Background</h4>Oncolytic virus (OV) therapy has emerged as a promising novel form of immunotherapy. Moreover, an increasing number of studies have shown that the therapeutic efficacy of OV can be further improved by arming OVs with immune-stimulating molecules.<h4>Methods</h4>In this study, we used reverse genetics to produce a novel influenza A virus, termed IAV-OX40L, which contained the immune-stimulating molecule OX40L gene in the influenza virus nonstructural (NS1) protein gene. The oncolytic effect of IAV-OX40L was explored on hepatocellular carcinoma (HCC)HCC cells in vitro and in vivo.<h4>Results</h4>Hemagglutination titers of the IAV-OX40L virus were stably 2<sup>7</sup>-2<sup>8</sup> in specific-pathogen-free chicken embryos. The morphology and size distribution of IAV-OX40L are similar to those of the wild-type influenza. Expression of OX40L protein was confirmed by Western blot and immunofluorescence. MTS assays showed that the cytotoxicity of IAV-OX40L was higher in HCC cells (HepG2 and Huh7) than in normal liver cells (MIHA) in a time- and dose-dependent manner in vitro. We found that intratumoral injection of IAV-OX40L reduced tumor growth and increased the survival rate of mice compared with PR8-treated controls in vivo. In addition, the pathological results showed that IAV-OX40L selectively destroyed tumor tissues without harming liver and lung tissues. CD4<sup>+</sup> and CD8<sup>+</sup> T cells of the IAV-OX40L group were significantly increased in the splenic lymphocytes of mice. Further validation confirmed that IAV-OX40L enhanced the immune response mainly by activating Th1-dominant immune cells, releasing interferon-γ and interleukin-2.<h4>Conclusion</h4>Taken together, our findings demonstrate the novel chimeric influenza OV could provide a potential therapeutic strategy for combating HCC and improve the effectiveness of virotherapy for cancer therapy.

Also flagged:ChlorantraniliprolediamideCAPantibodiesgold nanoparticletetraniliprole
Journal Article 2024-01-09 No Snippets Wu Y, Li J, Zhu J, Zhang Z, Zhang S, Wang M, Hua X.
Show Full Abstract

Chlorantraniliprole (CAP) is a new type of diamide insecticide that is mainly used to control lepidopteran pests. However, it has been proven to be hazardous to nontarget organisms, and the effects of its residues need to be monitored. In this study, five hybridoma cell lines were developed that produced anti-CAP monoclonal antibodies (mAbs), of which the mAb originating from the cell line 5C5B9 showed the highest sensitivity and was used to develop a gold nanoparticle-based lateral flow immunoassay (AuNP-LFIA) for CAP. The visible limit of detection of the AuNP-LFIA was 1.25 ng/mL, and the detection results were obtained in less than 10 min. The AuNP-LFIA showed no cross-reactivity for CAP analogs, except for tetraniliprole (50%) and cyclaniliprole (5%). In the detection of spiked and blind samples, the accuracy and reliability of the AuNP-LFIA were confirmed by a comparison with spiked concentrations and verified by ultra-performance liquid chromatography-tandem mass spectrometry. Thus, this study provides the core reagents for establishing CAP immunoassays and a AuNP-LFIA for the detection of residual CAP.

Also flagged:Cyclohexene oxidecancerglioblastomaG1 phaseGBMcyclohexenes
Journal Article 2024-01-09 No Snippets Su R, Cao W, Ma G, Li W, Li Z, Liu Y, Chen L, Chen Z, Li X, Cui P, Huang G.
Show Full Abstract

<b>Introduction:</b> Due to its highly aggressiveness and malignancy, glioblastoma (GBM) urgently requires a safe and effective treatment strategy. Zeylenone, a natural polyoxygenated cyclohexenes compound isolated from <i>Uvaria grandiflora</i>, has exhibited potential biological activities in various human diseases, including tumors. <b>Methods:</b> We designed and synthesized a series of (+)-Zeylenone analogues and evaluated their anti-GBM roles through structural-activity analysis. Cell Counting Kit-8, TUNEL, transwell and flow cytometry were employed for investigating the anticancer effects of CA on GBM cells. Western blotting, molecular docking, qRT-PCR and ChIP assays were performed to reveal the underlying mechanisms by which CA regulates the GBM cell cycle. The nude mouse xenograft model, HE staining, immunohistochemistry and was used to evaluate the anticancer effect of CA <i>in vivo</i>. <b>Results:</b> We identified CA ((1R, 2R, 3S)-3-p-fluorobenzoyl-zeylenone) as having the lowest IC<sub>50</sub> value in GBM cells. CA treatment significantly inhibited the malignant behaviors of GBM cells and induced G0/G1 phase arrest <i>in vitro</i>. Furthermore, we validated the molecular mechanism by which CA interferes with EZH2, attenuating the down-regulation of cyclin-dependent kinase inhibitors p27 and p16 by the PRC2 complex. By establishing orthotopic nude mice models, we further validated the inhibitory role of CA on tumorigenesis of GBM cells <i>in vivo</i> and its potential values to synergistically potentiate the anti-tumor effects of EZH2 inhibitors. <b>Conclusion:</b> Overall, this paper elucidated the anti-GBM effects and potential mechanisms of CA, and may provide a therapeutic drug candidate for GBM treatment.

HTT
Also flagged:generalized anxiety disorderemotional disorderpsychiatric disordersGADCD27CD4
Journal Article 2024-01-09 ✓ 2 Snippets Ma Z, Zhao M, Zhao H, Qu N.
In-Text Gene Mentions

Furthermore, studies have found evidence of familial heritability in GAD and have focused on candidate genes such as 5-HTT, 5-HT1A, MAOA, and BDNF to explore the clinical genetics of GAD (10).

…genes such as5-HTT, 5-HT1A, MAOA, and…

Show Full Abstract

<h4>Background</h4>Generalized anxiety disorder (GAD) is a prevalent emotional disorder that has received relatively little attention regarding its immunological basis. Recent years have seen the widespread use of high-density genetic markers such as SNPs or CNVs for genotyping, as well as the advancement of genome-wide association studies (GWAS) technologies, which have facilitated the understanding of immunological mechanisms underlying several major psychiatric disorders. Despite these advancements, the immunological basis of GAD remains poorly understood. In light of this, we aimed to explore the causal relationship between immune cells and the disease through a Mendelian randomization study.<h4>Methods</h4>The summary information for GAD (Ncase=4,666, Ncontrol=337,577) was obtained from the FinnGen dataset. Summary statistics for the characterization of 731 immune cells, including morphological parameters (MP=32), median fluorescence intensity (MFI=389), absolute cells (AC=118), and relative cells (RC=192), were derived from the GWAS catalog. The study involved both forward MR analysis, with immune cell traits as the exposure and GAD as the outcome, and reverse MR analysis, with GAD as the exposure and immune cell traits as the outcome. We performed extensive sensitivity analyses to confirm the robustness, heterogeneity, and potential multi-biological effects of the study results. Also, to control for false positive results during multiple hypothesis testing, we adopted a false discovery rate (FDR) to control for statistical bias due to multiple comparisons.<h4>Results</h4>After FDR correction, GAD had no statistically significant effect on immunophenotypes. Several phenotypes with unadjusted low P-values are worth mentioning, including decreased PB/PC levels on B cells(β=-0.289, 95%CI=0.044~0.194, <i>P</i>=0.002), reduced PB/PC AC in GAD patients (β=-0.270, 95% CI=0.77~0.92, <i>P</i>=0.000), and diminished PB/PC on lymphocytes (β=-0.315, 95% CI=0.77~0.93, <i>P</i>=0.001). GAD also exerted a causal effect on CD27 on IgD-CD38br (β=-0.155,95%CI=0.78~0.94,<i>P</i>=0.002), CD20-%B cell (β= -0.105,95% CI=0.77~0.94, <i>P</i>=0.002), IgD-CD38br%lymphocyte(β=-0.305, 95%CI=0.79~0.95, <i>P</i>=0.002), FSC-A level on granulocytes (β=0.200, 95%CI=0.75~0.91, <i>P</i>=8.35×10<sup>-5</sup>), and CD4RA on TD CD4+(β=-0.150, 95% CI=0.82~1.02, <i>P</i>=0.099). Furthermore, Two lymphocyte subsets were identified to be significantly associated with GAD risk: CD24+ CD27+ B cell (OR=1.066,95%CI=1.04~1.10,<i>P</i>=1.237×10<sup>-5</sup>),CD28+CD4+T cell (OR=0.927, 95%CI=0.89~0.96, <i>P</i>=8.085×10<sup>-5</sup>).<h4>Conclusion</h4>The study has shown the close association between immune cells and GAD through genetic methods, thereby offering direction for future clinical research.

HFE
Also flagged:FibrosisHepatic SteatosisNonalcoholic Fatty Liver Disease FibrosisNAFLDNAFLD Fibrosisaspartate transaminase
Journal Article 2024-01-09 ✓ 1 Snippet Yendewa GA, Khazan A, Jacobson JM.
In-Text Gene Mentions

…hepatitis, Wilson disease,hemochromatosis, or cryptogenic liver…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) and subsequent progression to fibrosis is increasingly prevalent in people with HIV (PWH). We used noninvasive methods to stratify risk and identify associated factors of advanced fibrosis in PWH with NAFLD.<h4>Methods</h4>We conducted a retrospective study of PWH in our clinic from 2005 to 2022. We used liver imaging or biopsy reports to identify cases of hepatic steatosis after excluding specified etiologies. We used the Fibrosis-4 (FIB-4), NAFLD Fibrosis (NFS), and body mass index, aspartate transaminase/alanine transaminase ratio, and diabetes score scores to stratify fibrosis. We used logistic regression to identify factors associated with advanced fibrosis.<h4>Results</h4>Among 3959 PWH in care, 1201 had available imaging or liver biopsies. After exclusions, 114 of 783 PWH had evidence of hepatic steatosis (14.6%). Most were male (71.1%), with a median age of 47 years, and median body mass index of 30.1 kg/m<sup>2</sup>. Approximately 24% had lean NAFLD (ie, body mass index < 25 kg/m<sup>2</sup>). Based on the FIB-4 and NFS, 34 (29.8%) and 36 (31.6%) had advanced fibrosis, whereas 1 in 4 had low risk of fibrosis based on FIB-4, NFS, and BARD scores. In adjusted analysis using FIB-4, advanced fibrosis was associated with age > 45 years (adjusted odds ratio, 6.29; 95% confidence interval, 1.93-20.50) and hypoalbuminemia (adjusted odds ratio, 9.45; 95% confidence interval, 2.45-32.52) in addition to elevated transaminases and thrombocytopenia, whereas using the NFS did not identify associations with advanced fibrosis.<h4>Conclusions</h4>We found 14.6% of PWH had NAFLD, with 1 in 3 having advanced fibrosis. Our study provides practical insights into fibrosis risk stratification in HIV primary care settings.

Also flagged:aneurysmsubarachnoid hemorrhageGene ExpressionATP6V1G1KBTBD6VIM
Journal Article 2024-01-09 No Snippets Xu D, Gareev I, Beylerli O, Pavlov V, Le H, Shi H.
Show Full Abstract

<h4>Background</h4>Intracranial aneurysms (IAs) represent protrusions in the vascular wall, with their growth and wall thinning influenced by various factors. These processes can culminate in the rupture of the aneurysm, leading to subarachnoid hemorrhage (SAH). Unfortunately, over half of the patients prove unable to withstand SAH, succumbing to adverse outcomes despite intensive therapeutic interventions, even in premier medical facilities. This study seeks to discern the pivotal microRNAs (miRNAs) and genes associated with the formation and progression of IAs.<h4>Methods</h4>The investigation gathered expression data of miRNAs (from GSE66240) and mRNAs (from GSE158558) within human aneurysm tissue and superficial temporal artery (STA) samples, categorizing them into IA and normal groups. This classification was based on the Gene Expression Omnibus (GEO) database.<h4>Results</h4>A total of 70 differentially expressed microRNAs (DEMs) and 815 differentially expressed mRNAs (DEGs) were pinpointed concerning IA. Subsequently, a miRNA-mRNA network was constructed, incorporating 9 significantly upregulated DEMs and 211 significantly downregulated DEGs. Simultaneously, functional enrichment and pathway analyses were conducted on both DEMs and DEGs. Through protein-protein interaction (PPI) network analysis and functional enrichment, 9 significantly upregulated DEMs (hsa-miR-188-5p, hsa-miR-590-5p, hsa-miR-320b, hsa-miR-423-5p, hsa-miR-140-5p, hsa-miR-486-5p, hsa-miR-320a, hsa-miR-342-3p, and hsa-miR-532-5p) and 50 key genes (such as ATP6V1G1, KBTBD6, VIM, PA2G4, DYNLL1, METTL21A, MDH2, etc.) were identified, suggesting their potential significant role in IA. Among these genes, ten were notably negatively regulated by at least two key miRNAs.<h4>Conclusions</h4>The findings of this study provide valuable insights into the potential pathogenic mechanisms underlying IA by elucidating a miRNA-mRNA network. This comprehensive approach sheds light on the intricate interplay between miRNAs and genes, offering a deeper understanding of the molecular dynamics involved in IA development and progression.

medRxiv 2024-01-09 Preprint (No Snippets API) Salenius K, Väljä N, Thusberg S, Iris F, Ladd-Acosta C, Roos C, Nykter M, Fasano A, Autio R, Lin J.
Show Full Abstract

<h4>Background</h4> Autism is a partially heritable neurodevelopmental condition, and people with autism may also have other co-occurring conditions such as ADHD, anxiety disorders, depression, mental health issues, learning difficulty, physical health conditions and communication challenges. The concomitant development of autism and other neurological conditions is assumed to result from a complex interplay between genetics and the environment. However, only a limited number of studies have performed analysis on multivariate genetic autism associations. <h4>Methods</h4> We conducted to-date the largest multivariate GWAS on autism and 8 autism co-occurring condition traits (ADHD, ADHD childhood, anxiety stress, bipolar, disruptive behaviour, educational attainment, major depression, and schizophrenia) using summary statistics from leading studies. Multivariate associations and central traits were further identified. Subsequently, colocalization and Mendelian randomization (MR) analysis were performed on the associations identified with the central traits containing autism. To further validate our findings, pathway and quantified trait loci (QTL) resources as well as independent datasets consisting of 92 (30 probands) whole genome sequence data from the GEMMA project were utilized. <h4>Results</h4> Multivariate GWAS resulted in 637 significant associations (p < 5e-8), among which 322 are reported for the first time for any trait. 37 SNPs were identified to contain autism and one or more traits in their central trait set, including variants mapped to known SFARI autism genes MAPT and NEGR1 as well as novel ASD genes KANSL1, NSF and NTM, associated with immune response, synaptic transmission, and neurite growth respectively. Mendelian randomization analyses found that all 8 co-occuring conditions are associated with autism while colocalization provided strong evidence of shared genetic aetiology between autism and education attainment, schizophrenia and bipolar traits. Allele proportions differences between MAPT (17q21.31) region aberrations and MAPT H1/H2 haplotypes, known to associate with neurodevelopment wwere found between GEMMA autism probands and controls. Pathway, QTL and cell type enrichment implicated microbiome, enteric inflammation, and central nervous system enrichments. <h4>Conclusions</h4> Our study, combining multivariate genome-wide association testing with systematic decomposition identified novel genetic associations related to autism and autism co-occurring driver traits. Statistical tests were applied to discern evidence for shared and interpretable liability between autism and co-occurring traits. These findings expand upon the current understanding of the complex genetics regulating autism and reveal insights of neuronal brain disruptions potentially driving development and manifestation. <h4>Highlights:</h4> Multivariate GWAS resulted in 637 significant ASD associations (p < 5e-8), among which 322 are reported for the first time. The novel associations mapped to known SFARI autism genes MAPT and NEGR1 and novel ASD markers KANSL1, NSF and NTM markers, associated with immune response, synaptic transmission, and neurite growth, potentially driving the gut brain-barrier hypothesis driving ASD. Mendelian randomization analyses found that the co-occuring traits ADHD, ADHD childhood, anxiety stress, bipolar, disruptive behaviour, educational attainment, major depression, and schizophrenia are strongly associated with autism.

MLLT10
Also flagged:endometriosisSjögren's syndromeautoimmune diseasesrheumatoid arthritisankylosing spondylitissystemic lupus erythematosus
Journal Article 2024-01-08 ✓ 1 Snippet Zervou MI, Tarlatzis BC, Grimbizis GF, Spandidos DA, Niewold TB, Goulielmos GN.
In-Text Gene Mentions

As a consequence, a number of disease-associated gene polymorphisms have been detected, which are involved in estrogen-induced cell growth (WNT4 rs7521902), vascular function (KDR rs17773813), cell adhesion (VEZT rs10859871, KAZN rs10928050), growth and migration (FN1 rs1250241), matrix remodeling and angiogenesis (VEGF rs699947, LAMA5 rs2427284), cell cycle regulation (FAS rs1341643), transcription (ID4 rs7739264, MLLT10 rs1802669), differentiation (GDAP1 rs554964149), proliferation (MUC4 rs882605), oncogenesis (TP53 rs1042522, CHD5 rs9434741), inflammation (COX-2 rs20417), sex steroid hormone activity and metabolism (GREB1 rs13394619, FSHB rs74485684, SYNE1 rs71575922, CCDC170 rs1971256, ESR1 rs2206949), immunity (STAT4 rs7574865, IL-1A rs6542095, IL-10 rs1800871, IL-16 rs4072111) and oxidative stress (HIF-1α rs11549465) (41,42,46,47,52,53).

Show Full Abstract

Patients with a history of endometriosis have an increased risk of developing various autoimmune diseases such as rheumatoid arthritis, ankylosing spondylitis, systemic lupus erythematosus, multiple sclerosis and celiac disease. There is a potential association between endometriosis and an increased susceptibility for Sjögren's syndrome (SS). SS is a common chronic, inflammatory, systemic, autoimmune, multifactorial disease of complex pathology, with genetic, epigenetic and environmental factors contributing to the development of this condition. It occurs in 0.5‑1% of the population, is characterized by the presence of ocular dryness, lymphocytic infiltrations and contributes to neurological, gastrointestinal, vascular and dermatological manifestations. Endometriosis is an inflammatory, estrogen‑dependent, multifactorial, heterogeneous gynecological disease, affecting ≤10% of reproductive‑age women. It is characterized by the occurrence of endometrial tissue outside the uterine cavity, mainly in the pelvic cavity, and is associated with pelvic pain, dysmenorrhea, deep dyspareunia and either subfertility or infertility. It is still unclear whether SS appears as a secondary response to endometriosis, or it is developed due to any potential shared mechanisms of these conditions. The aim of the present review was to explore further the biological basis only of the co‑occurrence of these disorders but not their association at clinical basis, focusing on the analysis of the partially shared genetic background between endometriosis and SS, and the clarification of the possible similarities in the underlying pathogenetic mechanisms and the relevant molecular pathways.

Also flagged:neutrophilneutropeniacytokineangiogenesisneutrophiliainfections
Journal Article 2024-01-08 No Snippets Rizo-Téllez SA, Filep JG.
Show Full Abstract

Neutrophils, the most abundant immune cells in human blood, play a fundamental role in host defense against invading pathogens and tissue injury. Neutrophils carry potentially lethal weaponry to the affected site. Inadvertent and perpetual neutrophil activation could lead to nonresolving inflammation and tissue damage, a unifying mechanism of many common diseases. The prevailing view emphasizes the dichotomy of their function, host defense versus tissue damage. However, tissue injury may also persist during neutropenia, which is associated with disease severity and poor outcome. Numerous studies highlight neutrophil phenotypic heterogeneity and functional versatility, indicating that neutrophils play more complex roles than previously thought. Emerging evidence indicates that neutrophils actively orchestrate resolution of inflammation and tissue repair and facilitate return to homeostasis. Thus, neutrophils mobilize multiple mechanisms to limit the inflammatory reaction, assure debris removal, matrix remodeling, cytokine scavenging, macrophage reprogramming, and angiogenesis. In this review, we will summarize the homeostatic and tissue-reparative functions and mechanisms of neutrophils across organs. We will also discuss how the healing power of neutrophils might be harnessed to develop novel resolution and repair-promoting therapies while maintaining their defense functions.

OLFM4
Also flagged:Inflammatory bowel diseaseCrohn's diseaseulcerative colitischronic relapsing inflammatory disorderspathogenesisimmune response
Journal Article 2024-01-08 ✓ 1 Snippet Li J, Niu C, Ai H, Li X, Zhang L, Lang Y, Wang S, Gao F, Mei X, Yu C, Sun L, Huang Y, Zheng L, Wang G, Sun Y, Yang X, Song Z, Bao Y.
In-Text Gene Mentions

…such as Lgr5,Olfm4, Ascl2, Smoc2, etc,…

Show Full Abstract

The integrity of the intestinal mucosal barrier is crucial for protecting the intestinal epithelium against invasion by commensal bacteria and pathogens, thereby combating colitis. The investigation revealed that the absence of TSP50 compromised the integrity of the intestinal mucosal barrier in murine subjects. This disruption facilitated direct contact between intestinal bacteria and the intestinal epithelium, thereby increasing susceptibility to colitis. Mechanistic analysis indicated that TSP50 deficiency in intestinal stem cells (ISCs) triggered aberrant activation of the TGF-β signaling pathway and impeded the differentiation of goblet cells in mice, leading to impairment of mucosal permeability. By inhibiting the TGF-β pathway, the functionality of the intestinal mucosal barrier is successfully restored and mitigated colitis in TSP50-deficient mice. In conclusion, TSP50 played a crucial role in maintaining the intestinal mucosal barrier function and exhibited the preventive effect against the development of colitis by regulating the TGF-β signaling pathway.

SERPINC1
Also flagged:antithrombin IIIchronic renal insufficiencychronic coronary artery diseasetype 2 diabetes mellituschronic renal dysfunction
Journal Article 2024-01-08 ✓ 5 Snippets Sun R, Jia J, Wang S, Wang Z, Wang C, Xu Y, Yuan Y.
In-Text Gene Mentions

…of Antithrombin III (ATIII) between chronic renal…

…between renal function,ATIII, and chronic CAD…

…were investigated betweenATIIIand renal function…

…the role ofATIIIwas determined by…

…LowATIIIlevel was statistically…

Show Full Abstract

<h4>Purpose</h4>The study aimed to investigate the potential effect of Antithrombin III (ATIII) between chronic renal insufficiency and chronic coronary artery disease (chronic CAD) in type 2 diabetes mellitus (T2DM) patients.<h4>Methods</h4>T2DM patients hospitalized in ZhongDa Hospital from 2013 to 2018 were enrolled. Relationships between renal function, ATIII, and chronic CAD risk were explored using multivariate regression models. Multiplicative and additive interactions were investigated between ATIII and renal function for CAD risk, and the role of ATIII was determined by bootstrap mediation analysis in patients with chronic renal dysfunction.<h4>Results</h4>A total of 4197 patients were included in the study, with a chronic CAD prevalence of 23.02%. Low ATIII level was statistically associated with chronic renal insufficiency and elevated CAD risk even after adjustments (P < 0.05). A positive correlation between renal function and ATIII was demonstrated, and each 1 SD increase in renal function, ATIII increased by 2.947% (2.406-3.488%, P < 0.001) and 0.969% (0.297-1.642%, P < 0.001) in crude and adjusted models respectively. Patients with decreased renal function and ATIII were at the highest chronic CAD risk (OR = 1.51, 95%CI:1.15-1.98, P < 0.05), while no multiplicative and additive interaction effects were significant. Bootstrap mediation analysis estimated that ATIII mediated approximately 4.27% of the effect of chronic renal insufficiency on chronic CAD risk.<h4>Conclusion</h4>ATIII may serve as a mediator between chronic renal insufficiency and chronic CAD, providing mechanistic clues for renal-heart association and new insight into clinical therapies.

HTT
Also flagged:HDtrypsinchromatintranscription factorsMYT1LDLX2
Journal Article 2024-01-08 ✓ 1 Snippet Kraskovskaya NA, Khotin MG, Tomilin AN, Mikhailova NA.
In-Text Gene Mentions

Huntington’s disease (HD) is an incurable human genetic disease with dominant inheritance and is caused when the CAG codon expands beyond the threshold of 36 in the IT15 gene, which is also known as the HTT gene and codes for the protein hungtingtin [1].

Show Full Abstract

A new in vitro model of Huntington's disease (HD) was developed via a direct reprogramming of dermal fibroblasts from HD patients into striatal neurons. A reprogramming into induced pluripotent stem (iPS) cells is obviated in the case of direct reprogramming, which thus yields neurons that preserve the epigenetic information inherent in cells of a particular donor and, consequently, the age-associated disease phenotype. A main histopathological feature of HD was reproduced in the new model; i.e., aggregates of mutant huntingtin accumulated in striatal neurons derived from a patient's fibroblasts. Experiments with cultured neurons obtained via direct reprogramming make it possible to individually assess the progression of neuropathology and to implement a personalized approach to choosing the treatment strategy and drugs for therapy. The in vitro model of HD can be used in preclinical drug studies.

SERPINC1
Also flagged:cerebral amyloid angiopathysmall vessel diseasecognitive impairmentproteasescathepsinCTSB
Journal Article 2024-01-08 ✓ 5 Snippets Vervuurt M, Schrader JM, de Kort AM, Kersten I, Wessels HJCT, Klijn CJM, Schreuder FHBM, Kuiperij HB, Gloerich J, Van Nostrand WE, Verbeek MM.
In-Text Gene Mentions

SERPINA3 and SERPINC1 specifically have also been associated specifically with amyloidotic disorders: both are increased in CSF in early-stage AD, and SERPINA3 has been confirmed to be a major component of senile plaques and to be involved in defibrillation of amyloid in CAA and AD [56, 57].

SERPINC1 is known as the most important inhibitor of coagulation factor XI, and is expressed in multiple cell types of CAA and AD brains, and increased AD plasma [58, 59].

…family (including SERPINA3,SERPINC1and SERPING1) were…

…p = 0.05),antithrombin-III(SERPINC1; p <…

…= 0.05), antithrombin-III (SERPINC1; p < 0.001)…

Show Full Abstract

Cerebral amyloid angiopathy (CAA) is a form of small vessel disease characterised by the progressive deposition of amyloid β protein in the cerebral vasculature, inducing symptoms including cognitive impairment and cerebral haemorrhages. Due to their accessibility and homogeneous disease phenotypes, animal models are advantageous platforms to study diseases like CAA. Untargeted proteomics studies of CAA rat models (e.g. rTg-DI) and CAA patients provide opportunities for the identification of novel biomarkers of CAA. We performed untargeted, data-independent acquisition proteomic shotgun analyses on the cerebrospinal fluid of rTg-DI rats and wild-type (WT) littermates. Rodents were analysed at 3 months (n = 6/10), 6 months (n = 8/8), and 12 months (n = 10/10) for rTg-DI and WT respectively. For humans, proteomic analyses were performed on CSF of sporadic CAA patients (sCAA) and control participants (n = 39/28). We show recurring patterns of differentially expressed (mostly increased) proteins in the rTg-DI rats compared to wild type rats, especially of proteases of the cathepsin protein family (CTSB, CTSD, CTSS), and their main inhibitor (CST3). In sCAA patients, decreased levels of synaptic proteins (e.g. including VGF, NPTX1, NRXN2) and several members of the granin family (SCG1, SCG2, SCG3, SCG5) compared to controls were discovered. Additionally, several serine protease inhibitors of the SERPIN protein family (including SERPINA3, SERPINC1 and SERPING1) were differentially expressed compared to controls. Fifteen proteins were significantly altered in both rTg-DI rats and sCAA patients, including (amongst others) SCG5 and SERPING1. These results identify specific groups of proteins likely involved in, or affected by, pathophysiological processes involved in CAA pathology such as protease and synapse function of rTg-DI rat models and sCAA patients, and may serve as candidate biomarkers for sCAA.

SLC2A14
Also flagged:Schizophreniabipolar disorderspsychosisasphyxiaoxygenresponse to hypoxia
Journal Article 2024-01-08 ✓ 5 Snippets Wortinger LA, Stavrum AK, Shadrin AA, Szabo A, Rukke SH, Nerland S, Smelror RE, Jørgensen KN, Barth C, Andreou D, Weibell MA, Djurovic S, Andreassen OA, Thoresen M, Ursini G, Agartz I, Le Hellard S.
In-Text Gene Mentions

Significant interactions between four DMRs and PA on case-control status were identified in genes encoding leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 3 (LINGO3, Šidák corrected p = 1.71E-03), the overlapping bladder cancer-associated protein and neuronatin (BLCAP; NNAT, Šidák corrected p = 4.88E-03), nanos C2HC-type zinc finger 2 (NANOS2, Šidák corrected p = 6.92E-03) and solute carrier family 2 member 14 protein (SLC2A14, Šidák corrected p = 3.95E-02; Fig. 2 and Table 2), so that HC with PA had higher methylation at these DMRs compared with HC without PA, while the opposite was the case in patients (PT).

…14 protein (SLC2A14, Šidák corrected…

…NNAT, NANOS2 andSLC2A14may reflect a…

…BLCAP;NNAT, NANOS2 andSLC2A14(Supplementary Figs. 3…

…for the HOXA4,SLC2A14, CTBP1;C4orf42, MOBP, BAHCC1…

Show Full Abstract

Epigenetic modifications influenced by environmental exposures are molecular sources of phenotypic heterogeneity found in schizophrenia and bipolar disorder and may contribute to shared etiopathogenetic mechanisms of these two disorders. Newborns who experienced perinatal asphyxia have suffered reduced oxygen delivery to the brain around the time of birth, which increases the risk of later psychiatric diagnosis. This study aimed to investigate DNA methylation in blood cells for associations with a history of perinatal asphyxia, a neurologically harmful condition occurring within the biological environment of birth. We utilized prospective data from the Medical Birth Registry of Norway to identify incidents of perinatal asphyxia in 643 individuals with schizophrenia or bipolar disorder and 676 healthy controls. We performed an epigenome wide association study to distinguish differentially methylated positions associated with perinatal asphyxia. We found an interaction between methylation and exposure to perinatal asphyxia on case-control status, wherein having a history of perinatal asphyxia was associated with an increase of methylation in healthy controls and a decrease of methylation in patients on 4 regions of DNA important for brain development and function. The differentially methylated regions were observed in genes involved in oligodendrocyte survival and axonal myelination and functional recovery (LINGO3); assembly, maturation and maintenance of the brain (BLCAP;NNAT and NANOS2) and axonal transport processes and neural plasticity (SLC2A14). These findings are consistent with the notion that an opposite epigenetic response to perinatal asphyxia, in patients compared with controls, may contribute to molecular mechanisms of risk for schizophrenia and bipolar disorder.

Also flagged:dyneinRSprimary ciliary dyskinesiaasthenospermiaIDA-bTektin
Journal Article 2024-01-08 No Snippets Meng X, Xu C, Li J, Qiu B, Luo J, Hong Q, Tong Y, Fang C, Feng Y, Ma R, Shi X, Lin C, Pan C, Zhu X, Yan X, Cong Y.
Show Full Abstract

Radial spokes (RS) transmit mechanochemical signals between the central pair (CP) and axonemal dynein arms to coordinate ciliary motility. Atomic-resolution structures of metazoan RS and structures of axonemal complexes in ependymal cilia, whose rhythmic beating drives the circulation of cerebrospinal fluid, however, remain obscure. Here, we present near-atomic resolution cryo-EM structures of mouse RS head-neck complex in both monomer and dimer forms and reveal the intrinsic flexibility of the dimer. We also map the genetic mutations related to primary ciliary dyskinesia and asthenospermia on the head-neck complex. Moreover, we present the cryo-ET and sub-tomogram averaging map of mouse ependymal cilia and build the models for RS1-3, IDAs, and N-DRC. Contrary to the conserved RS structure, our cryo-ET map reveals the lack of IDA-b/c/e and the absence of Tektin filaments within the A-tubule of doublet microtubules in ependymal cilia compared with mammalian respiratory cilia and sperm flagella, further exemplifying the structural diversity of mammalian motile cilia. Our findings shed light on the stepwise mammalian RS assembly mechanism, the coordinated rigid and elastic RS-CP interaction modes beneficial for the regulation of asymmetric ciliary beating, and also facilitate understanding on the etiology of ciliary dyskinesia-related ciliopathies and on the ependymal cilia in the development of hydrocephalus.

PRDX6
Also flagged:cell proliferationmetabolismCas9cell cyclenucleotidesnucleus
Journal Article 2024-01-08 ✓ 2 Snippets Muñoz-Gallardo MDM, Garcia-Padilla C, Vicente-Garcia C, Carvajal J, Arenega A, Franco D.
In-Text Gene Mentions

…Prdx3, Prdx5 andPrdx6.…

…Curiously, Prdx2 andPrdx6are upregulated in…

Show Full Abstract

Over the last decade we have witnessed an increasing number of studies revealing the functional role of non-coding RNAs in a multitude of biological processes, including cellular homeostasis, proliferation and differentiation. Impaired expression of non-coding RNAs can cause distinct pathological conditions, including herein those affecting the gastrointestinal and cardiorespiratory systems, respectively. miR-15/miR-16/miR-195 family members have been broadly implicated in multiple biological processes, including regulation of cell proliferation, apoptosis and metabolism within distinct tissues, such as heart, liver and lungs. While the functional contribution of miR-195a has been reported in multiple biological contexts, the role of miR-195b remains unexplored. In this study we dissected the functional role of miR-195b by generating CRISPR-Cas9 gene edited miR-195b deficient mice. Our results demonstrate that miR-195b is dispensable for embryonic development. miR-195b<sup>-/-</sup> mice are fertile and displayed no gross anatomical and/or morphological defects. Mechanistically, cell cycle regulation, metabolism and oxidative stress markers are distinctly impaired in the heart, liver and lungs of aged mice, a condition that is not overtly observed at midlife. The lack of overt functional disarray during embryonic development and early adulthood might be due to temporal and tissue-specific compensatory mechanisms driven by selective upregulation miR-15/miR-16/miR-195 family members. Overall, our data demonstrated that miR-195b is dispensable for embryonic development and adulthood but is required for cellular homeostasis in the elderly.

MLLT10PCDH17
Also flagged:B-ALLoncogenesALLleukemiaDUX4PDE4DIP
Journal Article 2024-01-08 ✓ 2 Snippets Podgorica M, Drivet E, Viken JK, Richman A, Vestbøstad J, Szodoray P, Kvam AK, Wik HS, Tjønnfjord GE, Munthe LA, Frietze S, Schjerven H.
In-Text Gene Mentions

MLLT10

PCDH17

Show Full Abstract

<h4>Background</h4>B-cell acute lymphoblastic leukemia (B-ALL) is classified into subgroups based on known driver oncogenes and molecular lesions, including translocations and recurrent mutations. However, the current diagnostic tests do not identify subtypes or oncogenic lesions for all B-ALL samples, creating a heterogeneous B-ALL group of unknown subtypes.<h4>Methods</h4>We sorted primary adult B-ALL cells and performed transcriptome analysis by bulk RNA sequencing (RNA-seq).<h4>Results</h4>Transcriptomic analysis of an adult B-ALL cohort allowed the classification of four patient samples with subtypes that were not previously revealed by standard gene panels. The leukemia of two patients were of the DUX4 subtype and two were CRLF2<sup>+</sup> Ph-like B-ALL. Furthermore, single nucleotide variant analysis detected the oncogenic NRAS-G12D, KRAS-G12D, and KRAS-G13D mutations in three of the patient samples, presenting targetable mutations. Additional oncogenic variants and gene fusions were uncovered, as well as multiple variants in the PDE4DIP gene across five of the patient samples.<h4>Conclusion</h4>We demonstrate that RNA-seq is an effective tool for precision medicine in B-ALL by providing comprehensive molecular profiling of leukemia cells, identifying subtype and oncogenic lesions, and stratifying patients for appropriate therapy.

HTT
Also flagged:Movements Disordersmovement disordersmovement disorderpathogenesispolymeraseataxia
Journal Article 2024-01-08 ✓ 1 Snippet Yeow D, Rudaks LI, Siow SF, Davis RL, Kumar KR.
In-Text Gene Mentions

Some examples include: LY3884961, an intra-cisterna magna injected AAV-based gene transfer therapy to restore glucocerebrosidase function in PD patients with pathogenic GBA1 variants (NCT04127578); BIIB094, an intrathecal antisense oligonucleotide designed to knockdown LRRK2 expression in PD patients with gain of function LRRK2 variants (NCT03976349); and PTC518, an oral small molecule splicing modifier that knocks down HTT expression in Huntington’s disease (NCT05358717).

Show Full Abstract

Currently, pathogenic variants in more than 500 different genes are known to cause various movement disorders. The increasing accessibility and reducing cost of genetic testing has resulted in increasing clinical use of genetic testing for the diagnosis of movement disorders. However, the optimal use case(s) for genetic testing at a patient level remain ill-defined. Here, we review the utility of genetic testing in patients with movement disorders and also highlight current challenges and limitations that need to be considered when making decisions about genetic testing in clinical practice.<h4>Highlights</h4>The utility of genetic testing extends across multiple clinical and non-clinical domains. Here we review different aspects of the utility of genetic testing for movement disorders and the numerous associated challenges and limitations. These factors should be weighed on a case-by-case basis when requesting genetic tests in clinical practice.

Also flagged:Liposarcomasoft-tissue sarcomaslocalized diseasepathogenesiskinaseanlotinib
Journal Article 2024-01-08 No Snippets Lesovaya EA, Fetisov TI, Bokhyan BY, Maksimova VP, Kulikov EP, Belitsky GA, Kirsanov KI, Yakubovskaya MG.
Show Full Abstract

Liposarcoma (LPS) is one of the most common adult soft-tissue sarcomas (STS), characterized by a high diversity of histopathological features as well as to a lesser extent by a spectrum of molecular abnormalities. Current targeted therapies for STS do not include a wide range of drugs and surgical resection is the mainstay of treatment for localized disease in all subtypes, while many LPS patients initially present with or ultimately progress to advanced disease that is either unresectable, metastatic or both. The understanding of the molecular characteristics of liposarcoma subtypes is becoming an important option for the detection of new potential targets and development novel, biology-driven therapies for this disease. Innovative therapies have been introduced and they are currently part of preclinical and clinical studies. In this review, we provide an analysis of the molecular genetics of liposarcoma followed by a discussion of the specific epigenetic changes in these malignancies. Then, we summarize the peculiarities of the key signaling cascades involved in the pathogenesis of the disease and possible novel therapeutic approaches based on a better understanding of subtype-specific disease biology. Although heterogeneity in liposarcoma genetics and phenotype as well as the associated development of resistance to therapy make difficult the introduction of novel therapeutic targets into the clinic, recently a number of targeted therapy drugs were proposed for LPS treatment. The most promising results were shown for <i>CDK4</i>/6 and <i>MDM2</i> inhibitors as well as for the multi-kinase inhibitors anlotinib and sunitinib.

Also flagged:Schizophreniamental disorderacutecognitiondrug abusefirst-episode psychosis
Journal Article 2024-01-08 No Snippets Lorca C, Fernández-Rhodes M, Sánchez Milán JA, Mulet M, Elortza F, Ramos-Miguel A, Callado LF, Meana JJ, Mur M, Batalla I, Vilella E, Serra A, Gallart-Palau X.
Show Full Abstract

Extracellular vesicles (EVs) are tiny membranous structures that mediate intercellular communication. The role(s) of these vesicles have been widely investigated in the context of neurological diseases; however, their potential implications in the neuropathology subjacent to human psychiatric disorders remain mostly unknown. Here, by using next-generation discovery-driven proteomics, we investigate the potential role(s) of brain EVs (bEVs) in schizophrenia (SZ) by analyzing these vesicles from the three post-mortem anatomical brain regions: the prefrontal cortex (PFC), hippocampus (HC), and caudate (CAU). The results obtained indicate that bEVs from SZ-affected brains contain region-specific proteins that are associated with abnormal GABAergic and glutamatergic transmission. Similarly, these vesicles from the analyzed regions were implicated in synaptic decay, abnormal brain immunity, neuron structural imbalances, and impaired cell homeostasis. Our findings also provide evidence, for the first time, that networks of molecular exchange (involving the PFC, HC, and CAU) are potentially active and mediated by EVs in non-diseased brains. Additionally, these bEV-mediated networks seem to have become partially reversed and largely disrupted in the brains of subjects affected by SZ. Taken as a whole, these results open the door to the uncovering of new biological markers and therapeutic targets, based on the compositions of bEVs, for the benefit of patients affected by SZ and related psychotic disorders.

PEBP1
Also flagged:depressionmental disorderFerroptosisdeathMajor depressive disorderemotional depression
Journal Article 2024-01-08 ✓ 1 Snippet Zhang G, Lv S, Zhong X, Li X, Yi Y, Lu Y, Yan W, Li J, Teng J.
In-Text Gene Mentions

Fer-1: ferrostatin-1; DHA: docosahexaenoic acid; EPA: eicosapentaenoic acid; SSB2: Saikosaponin B2; DFP: Deferiprone; TCM: traditional chinese medicine; PEBP1: Phosphatidylethanolamine Binding Protein 1; EDA: Edaravone; Sirt1: silent mating-type information regulation 2 homolog 1; HO-1: Heme oxygenase-1; Nrf2: Nuclear Factor erythroid 2-Related Factor 2; BDNF: brain-derived neurotrophic factor; EPK: extracellular regulated protein kinases; LbGp: Lycium barbarum glycopeptide; STAT3: signal transducers and activator of transcription 3; H2S: Hydrogen sulfide; CP: Ceruloplasmin.

Show Full Abstract

The incidence rate of depression, a mental disorder, is steadily increasing and has the potential to become a major global disability factor. Given the complex pathological mechanisms involved in depression, the use of conventional antidepressants may lead to severe complications due to their side effects. Hence, there is a critical need to explore the development of novel antidepressants. Ferroptosis, a newly recognized form of cell death, has been found to be closely linked to the onset of depression. Several studies have indicated that certain active ingredients can ameliorate depression by modulating the ferroptosis signaling pathway. Notably, traditional Chinese medicine (TCM) active ingredients and TCM prescriptions have demonstrated promising antidepressant effects in previous investigations owing to their unique advantages in antidepressant therapy. Building upon these findings, our objective was to review recent relevant research and provide new insights and directions for the development and application of innovative antidepressant strategies.

TNFSF4
Also flagged:obesityasthmachronic respiratory diseaseairway inflammationmucus hypersecretioneosinophilia
Journal Article 2024-01-08 ✓ 1 Snippet Garg D, Que LG, Ingram JL.
In-Text Gene Mentions

…they found thatTnfsf4−/− ovalbumin-sensitized mice…

Show Full Abstract

Over 20 million adults and 6 million children in the United States (US) have asthma, a chronic respiratory disease characterized by airway inflammation, bronchoconstriction, and mucus hypersecretion. Obesity, another highly prevalent disease in the US, is a major risk factor for asthma and a significant cause of diminished asthma control, increased submucosal eosinophilia, and reduced quality of life. A large subgroup of these patients experiences severe symptoms and recurrent exacerbations despite maximal dosage of standard asthma therapies. In the past two decades, the development of biological therapies has revolutionized the field and advanced our understanding of type 2 inflammatory biomarkers. However, patients with obesity and comorbid asthma are not principally considered in clinical trials of biologics. Large landmark cluster analyses of patients with asthma have consistently identified specific asthma phenotypes that associate with obesity but may be differentiated by age of asthma onset and inflammatory cell profiles in sputum. These patterns suggest that biologic processes driving asthma pathology are heterogenous among patients with obesity. The biological mechanisms driving pathology in patients with asthma and comorbid obesity are not well understood and likely multifactorial. Future research needs to be done to elicit the cellular and metabolic functions in the relationship of obesity and asthma to yield the best treatment options for this multiplex condition. In this review, we explore the key features of type 2 inflammation in asthma and discuss the effectiveness, safety profile, and research gaps regarding the currently approved biological therapies in asthma patients with obesity.

CA10
Also flagged:immunoglobulindiffuse vasculitischromatinpathogenesisKawasaki diseaseFANK1
Journal Article 2024-01-08 ✓ 2 Snippets Shrestha S, Wiener HW, Kajimoto H, Srinivasasainagendra V, Ledee D, Chowdhury S, Cui J, Chen JY, Beckley MA, Padilla LA, Dahdah N, Tiwari HK, Portman MA.
In-Text Gene Mentions

…in FANK1, MAP2K3:KCNJ12,CA10, FRG1DP, CWH43 regions.…

…intronic region ofCA10; in chromosome…

Show Full Abstract

<h4>Introduction</h4>Kawasaki disease (KD) is a diffuse vasculitis in children. Response to high dose intravenous gamma globulin (IVIG), the primary treatment, varies according to genetic background. We sought to identify genetic loci, which associate with treatment response using whole genome sequencing (WGS).<h4>Method</h4>We performed WGS in 472 KD patients with 305 IVIG responders and 167 non-responders defined by AHA clinical criteria. We conducted logistic regression models to test additive genetic effect in the entire cohort and in four subgroups defined by ancestry information markers (Whites, African Americans, Asians, and Hispanics). We performed functional mapping and annotation using FUMA to examine genetic variants that are potentially involved IVIG non-response. Further, we conducted SNP-set [Sequence] Kernel Association Test (SKAT) for all rare and common variants.<h4>Results</h4>Of the 43,288,336 SNPs (23,660,970 in intergenic regions, 16,764,594 in introns and 556,814 in the exons) identified, the top ten hits associated with IVIG non-response were in <i>FANK1, MAP2K3:KCNJ12, CA10, FRG1DP, CWH43</i> regions. When analyzed separately in ancestry-based racial subgroups, SNPs in several novel genes were associated. A total of 23 possible causal genes were pinpointed by positional and chromatin mapping. SKAT analysis demonstrated association in the entire <i>MANIA2, EDN1, SFMBT2</i>, and <i>PPP2R5E</i> genes and segments of CSMD2<i>, LINC01317, HIVEPI, HSP90AB1</i>, and <i>TTLL11</i> genes.<h4>Conclusions</h4>This WGS study identified multiple predominantly novel understudied genes associated with IVIG response. These data can serve to inform regarding pathogenesis of KD, as well as lay ground work for developing treatment response predictors.

HTT
Also flagged:COVID-19preeclampsiacoronavirus disease 2019vascular disordersinfectiongene expression
Journal Article 2024-01-08 ✓ 1 Snippet Chu Y, Li M, Sun M, Wang J, Xin W, Xu L.
In-Text Gene Mentions

…this study, ILF3,HTT, AR, MYC, RARA,…

Show Full Abstract

<h4>Background</h4>The extensive spread of coronavirus disease 2019 (COVID-19) has led to a rapid increase in global mortality. Preeclampsia is a commonly observed pregnancy ailment characterized by high maternal morbidity and mortality rates, in addition to the restriction of fetal growth within the uterine environment. Pregnant individuals afflicted with vascular disorders, including preeclampsia, exhibit an increased susceptibility to severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection via mechanisms that have not been fully delineated. Additionally, the intricate molecular mechanisms underlying preeclampsia and COVID-19 have not been fully elucidated. This study aimed to discern commonalities in gene expression, regulators, and pathways shared between COVID-19 and preeclampsia. The objective was to uncover potential insights that could contribute to novel treatment strategies for both COVID-19 and preeclampsia.<h4>Method</h4>Transcriptomic datasets for COVID-19 peripheral blood (GSE152418) and preeclampsia blood (GSE48424) were initially sourced from the Gene Expression Omnibus (GEO) database. Subsequent to that, we conducted a subanalysis by selecting females from the GSE152418 dataset and employed the "Deseq2" package to identify genes that exhibited differential expression. Simultaneously, the "limma" package was applied to identify differentially expressed genes (DEGs) in the preeclampsia dataset (GSE48424). Following that, an intersection analysis was conducted to identify the common DEGs obtained from both the COVID-19 and preeclampsia datasets. The identified shared DEGs were subsequently utilized for functional enrichment analysis, transcription factor (TF) and microRNAs (miRNA) prediction, pathway analysis, and identification of potential candidate drugs. Finally, to validate the bioinformatics findings, we collected peripheral blood mononuclear cell (PBMC) samples from healthy individuals, COVID-19 patients, and Preeclampsia patients. The abundance of the top 10 Hub genes in both diseases was assessed using real-time quantitative polymerase chain reaction (RT-qPCR).<h4>Result</h4>A total of 355 overlapping DEGs were identified in both preeclampsia and COVID-19 datasets. Subsequent ontological analysis, encompassing Gene Ontology (GO) functional assessment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, revealed a significant association between the two conditions. Protein-protein interactions (PPIs) were constructed using the STRING database. Additionally, the top 10 hub genes (MRPL11, MRPS12, UQCRH, ATP5I, UQCRQ, ATP5D, COX6B1, ATP5O, ATP5H, NDUFA6) were selected based on their ranking scores using the degree algorithm, which considered the shared DEGs. Moreover, transcription factor-gene interactions, protein-drug interactions, co-regulatory networks of DEGs and miRNAs, and protein-drug interactions involving the shared DEGs were also identified in the datasets. Finally, RT-PCR results confirmed that 10 hub genes do exhibit distinct expression profiles in the two diseases.<h4>Conclusion</h4>This study successfully identified overlapping DEGs, functional pathways, and regulatory elements between COVID-19 and preeclampsia. The findings provide valuable insights into the shared molecular mechanisms and potential therapeutic targets for both diseases. The validation through RT-qPCR further supports the distinct expression profiles of the identified hub genes in COVID-19 and preeclampsia, emphasizing their potential roles as biomarkers or therapeutic targets in these conditions.

TNFSF4
Also flagged:autoimmune diseasesimmune responsepathogenesisPTPN22systemic lupus erythematosusSLE
Journal Article 2024-01-08 ✓ 4 Snippets Wang Y, Yang Y, Jia X, Zhao C, Yang C, Fan J, Wang N, Shi X.
In-Text Gene Mentions

TNFSF4encoded a membrane-bound…

…evidence supported thatTNFSF4-TNFRSF4 pair could promote…

…analysis found thatTNFSF4participated in controlling…

…between PTPN22 andTNFSF4highlighting the significant…

Show Full Abstract

<h4>Background</h4>The common clinical symptoms and immunopathological mechanisms have been observed among multiple autoimmune diseases (ADs), but the shared genetic etiology remains unclear.<h4>Methods</h4>GWAS summary statistics of seven ADs were downloaded from Open Targets Genetics and Dryad. Linkage disequilibrium score regression (LDSC) was applied to estimate overall genetic correlations, bivariate causal mixture model (MiXeR) was used to qualify the polygenic overlap, and stratified-LDSC partitioned heritability to reveal tissue and cell type specific enrichments. Ultimately, we conducted a novel adaptive association test called MTaSPUsSet for identifying pleiotropic genes.<h4>Results</h4>The high heritability of seven ADs ranged from 0.1228 to 0.5972, and strong genetic correlations among certain phenotypes varied between 0.185 and 0.721. There was substantial polygenic overlap, with the number of shared SNPs approximately 0.03K to 0.21K. The specificity of SNP heritability was enriched in the immune/hematopoietic related tissue and cells. Furthermore, we identified 32 pleiotropic genes associated with seven ADs, 23 genes were considered as novel genes. These genes were involved in several cell regulation pathways and immunologic signatures.<h4>Conclusion</h4>We comprehensively explored the shared genetic architecture across seven ADs. The findings progress the exploration of common molecular mechanisms and biological processes involved, and facilitate understanding of disease etiology.

HTT
Also flagged:poliomyelitissecretionswaterdeathpoliosmallpox
Journal Article 2024-01-08 ✓ 1 Snippet Devaux CA, Pontarotti P, Levasseur A, Colson P, Raoult D.
In-Text Gene Mentions

…The simianENV-B107and ENV-90 were…

Show Full Abstract

The polioviruses (PVs) are mainly transmitted by direct contact with an infected person through the fecal-oral route and respiratory secretions (or more rarely via contaminated water or food) and have a primary tropism for the gut. After their replication in the gut, in rare cases (far less than 1% of the infected individuals), PVs can spread to the central nervous system leading to flaccid paralysis, which can result in respiratory paralysis and death. By the middle of the 20th century, every year the wild polioviruses (WPVs) are supposed to have killed or paralyzed over half a million people. The introduction of the oral poliovirus vaccines (OPVs) through mass vaccination campaigns (combined with better application of hygiene measures), was a success story which enabled the World Health Organization (WHO) to set the global eradication of poliomyelitis as an objective. However this strategy of viral eradication has its limits as the majority of poliomyelitis cases today arise in individuals infected with circulating vaccine-derived polioviruses (cVDPVs) which regain pathogenicity following reversion or recombination. In recent years (between January 2018 and May 2023), the WHO recorded 8.8 times more cases of polio which were linked to the attenuated OPV vaccines (3,442 polio cases after reversion or recombination events) than cases linked to a WPV (390 cases). Recent knowledge of the evolution of RNA viruses and the exchange of genetic material among biological entities of the intestinal microbiota, call for a reassessment of the polio eradication vaccine strategies.

POU3F2
Also flagged:NSF attachment protein betaepilepsyautismearly-onset epilepsyCas9NAPB
Journal Article 2024-01-08 ✓ 2 Snippets Ali G, Shin KC, Habbab W, Alkhadairi G, AbdelAleem A, AlShaban FA, Park Y, Stanton LW.
In-Text Gene Mentions

…transcription factor BRN2 (POU3F2) and SATB2 (…

…neurons markers Brn2 (POU3F2) and Satb2 (E)…

Show Full Abstract

We investigated whether a homozygous recessive genetic variant of NSF attachment protein beta (<i>NAPB</i>) gene inherited by monozygotic triplets contributed to their phenotype of early-onset epilepsy and autism. Induced pluripotent stem cell (iPSC) lines were generated from all three probands and both parents. The <i>NAPB</i> genetic variation was corrected in iPSC lines from two probands by CRISPR/Cas9 gene editing. Cortical neurons were produced by directed, <i>in vitro</i> differentiation from all iPSC lines. These cell line-derived neurons enabled us to determine that the genetic variation in the probands causes exon skipping and complete absence of NAPB protein. Electrophysiological and transcriptomic comparisons of cortical neurons derived from parents and probands cell lines indicate that loss of NAPB function contributes to alterations in neuronal functions and likely contributed to the impaired neurodevelopment of the triplets.

Also flagged:sarcopeniamalignant pancreatic tumorschronic illnessdeathMuscular Atrophymalignant tumors
Journal Article 2024-01-08 No Snippets Zhong L, Liu J, Xia M, Zhang Y, Liu S, Tan G.
Show Full Abstract

<h4>Background</h4>Numerous studies have reported sarcopenia to be associated with unfavorable outcomes in patients who have undergone pancreatectomy. Therefore, in this meta-analysis, we examined the relationship between sarcopenia and survival after pancreatic surgery.<h4>Methods</h4>PubMed, Embase, and Cochrane Library were searched for studies that examined the association between sarcopenia and survival after pancreatic surgery from the inception of the database until June 1, 2023. Hazard ratio (HR) for overall survival (OS) and/or progression-free survival (PFS) of sarcopenia and pancreatic surgery were extracted from the selected studies and random or fixed-effect models were used to summarize the data according to the heterogeneity. Publication bias was assessed using Egger's linear regression test and a funnel plot.<h4>Results</h4>Sixteen studies met the inclusion criteria. For 13 aggregated univariate and 16 multivariate estimates, sarcopenia was associated with decreased OS (univariate analysis: HR 1.69, 95% CI 1.48-1.93; multivariate analysis: HR 1.69; 95% CI 1.39-2.05, I<sup>2</sup> = 77.4%). Furthermore, sarcopenia was significantly associated with poor PFS of pancreatic resection (Change to univariate analysis: HR 1.74, 95% CI 1.47-2.05; multivariate analysis: HR 1.54; 95% CI 1.23-1.93, I<sup>2</sup> = 63%).<h4>Conclusion</h4>Sarcopenia may be a significant prognostic factor for a shortened survival following pancreatectomy since it is linked to an elevated risk of mortality. Further studies are required to understand how sarcopenia affects long-term results after pancreatic resection.Systematic review registrationRegistration ID: CRD42023438208 https://www.crd.york.ac.uk/PROSPERO/#recordDetails.

HFE
Also flagged:fatty liver diseasemetabolic dysfunction-associated fatty liver diseasenon-alcoholic steatohepatitisNASHcirrhosisliver failure
Journal Article 2024-01-08 ✓ 1 Snippet Ramaiah P, Jamel Baljon K, Alsulami SA, Lindsay GM, Chinnasamy L.
In-Text Gene Mentions

…autoimmune liver disease,hemochromatosis, Wilson's disease, and…

Show Full Abstract

<h4>Objectives</h4>There are only limited studies investigating the impact of dietary quality indicators, such as dietary quality index (DQI), dietary diversity score (DDS), and alternative healthy eating index (AHEI), on metabolic dysfunction-associated fatty liver disease (MASLD). Furthermore, these indicators may have different components that could lead to varying results. Therefore, this study aims to assess the nutritional quality indicators and their potential association with MASLD.<h4>Methods</h4>The study included 128 recently diagnosed MASLD patients and 256 controls aged between 20 and 60 years. The dietary intake of participants was evaluated using a validated semi-quantitative food frequency questionnaire that consisted of 168 items. In this study, the method used to evaluate dietary diversity was based on five main food groups, specifically bread and grains, vegetables, fruits, meat, and dairy. The AHEI-2010 was computed using data collected from the FFQ.<h4>Results</h4>After adjusting for confounders in the fully adjusted model, a significant negative correlation was observed between DDS and the risk of MASLD (OR 0.41, 95% CI 0.20, 0.97). Participants in the top quartile of AHEI had a 76% lower risk of MASLD compared with those in the bottom quartile after controlling for all potential confounders in the fully adjusted model (OR 0.24, 95% CI 0.12, 0.56).<h4>Conclusion</h4>The results of our study suggest that there is a significant association between adherence to a high-diversity diet and a reduced likelihood of developing MASLD. Similarly, we observed a similar association between adherence to the AHEI diet and a lower risk of MASLD.

PRDX6
Also flagged:Intrahepatic cholestasis of pregnancypathogenesisintrahepatic cholestasisbile acidsgestationMDR3
Journal Article 2024-01-08 ✓ 1 Snippet Wang M, Chen L, Li J, You Y, Qian Z, Liu J, Jiang Y, Zhou T, Gu Y, Zhang Y.
In-Text Gene Mentions

…proteins (including ERp29,PRDX6and MPO).…

Show Full Abstract

Intrahepatic cholestasis of pregnancy (ICP) is one of the common pregnancy complications that may threaten the health of both pregnant women and their fetuses. Hence, it is of vital importance to identify key moleculars and the associated functional pathways of ICP, which will help us to better understand the pathological mechanisms as well as to develop precise clinical biomarkers. The emerging and developing of multiple omics approaches enable comprehensive studies of the genome, transcriptome, proteome and metabolome of clinical samples. The present review collected and summarized the omics based studies of ICP, aiming to provide an overview of the current progress, limitations and future directions. Briefly, these studies covered a broad range of research contents by the comparing of different experimental groups including ICP patients, ICP subtypes, ICP fetuses, ICP models and other complications. Correspondingly, the studied samples contain various types of clinical samples, <i>in vitro</i> cultured tissues, cell lines and the samples from animal models. According to the main research objectives, we further categorized these studies into two groups: pathogenesis and diagnosis analyses. The pathogenesis studies identified tens of functional pathways that may represent the key regulatory events for the occurrence, progression, treatment and fetal effects of ICP. On the other hand, the diagnosis studies tested more than 40 potential models for the early-prediction, diagnosis, grading, prognosis or differential diagnosis of ICP. Apart from these achievements, we also evaluated the limitations of current studies, and emphasized that many aspects of clinical characteristics, sample processing, and analytical method can greatly affect the reliability and repeatability of omics results. Finally, we also pointed out several new directions for the omics based analyses of ICP and other perinatal associated conditions in the future.

Also flagged:degenerative diseasesdegenerative spine diseasestraumatic spine diseasescalcium phosphatemusculoskeletal diseasesHOX
Journal Article 2024-01-08 No Snippets Salamanna F, Tedesco G, Sartori M, Griffoni C, Spinnato P, Romeo P, Ghermandi R, Fini M, Giavaresi G, Gasbarrini A, Barbanti Brodano G.
Show Full Abstract

<h4>Background</h4>Bone marrow aspirate (BMA), when combined with graft substitutes, has long been introduced as a promising alternative to iliac crest bone graft in spinal fusion. However, the use of BMA is limited by the absence of a standardized procedure, a structural texture, and the potential for diffusion away from the implant site. Recently, the potential use of a new formulation of BMA, named BMA clot, has been preclinically described. In this report, we present the results of a prospective pilot clinical study aimed at evaluating the safety and efficacy of autologous vertebral BMA (vBMA) clot as a three-dimensional and multifunctional bioscaffold in instrumented posterior lumbar fusion.<h4>Methods</h4>Ten consecutive patients with an indication of multilevel (≤5) posterior spinal fusion due to lumbar spine degenerative diseases were included in the study and treated with vBMA. Clinical outcomes were assessed using the Visual Analog Scale (VAS), Oswestry Disability Index (ODI), and EuroQoL-5L (EQ-5L) preoperatively and at 3 months and 12 months after spinal fusion. Bone fusion quality was evaluated at the 12-month follow-up using the Brantigan classification on radiography (XR) imaging. Bone density was measured on computed tomography (CT) scans at 6 and 12 months of follow-up visits at the intervertebral arches and intervertebral joint areas and expressed in Hounsfield unit (HU).<h4>Results</h4>The results indicate a successful posterolateral fusion rate of approximately 100% (considering levels with C, D, and E grades according to the Brantigan classification) at the 12-month follow-up, along with an increase in bone density from 6 to 12 months of follow-up. An improvement in the quality of life and health status following surgery, as assessed by clinical scores (ODI, VAS, and EQ-5L), was also observed as early as 3 months postsurgery. No adverse events related to the vBMA clot were reported.<h4>Conclusion</h4>This prospective pilot study demonstrates the effectiveness and safety profile of vBMA clot as an advanced bioscaffold capable of achieving posterior lumbar fusion in the treatment of degenerative spine diseases. This lays the groundwork for a larger randomized clinical study.

SERPINC1
Also flagged:COVID-19antibodiesantibodyLXRFXRACE2
Journal Article 2024-01-08 ✓ 1 Snippet Hu C, Hu W, Tang B, Bao Q, Jiang X, Tang L, Wang H, He L, Lv M, Xiao Y, Liu C, Li X, Liu Y, Li J, Huang G, Dong Z, Li Z, Guo T, Yang S.
In-Text Gene Mentions

…KRT9, KLKB1, FGB,SERPINC1, LYVE1, AGT, and…

Show Full Abstract

The efficacy of COVID-19 vaccination relies on the induction of neutralizing antibodies, which can vary among vaccine recipients. In this study, we investigated the potential factors affecting the neutralizing antibody response by combining plasma and urine proteomics and gut microbiota analysis. We found that activation of the LXR/FXR pathway in plasma was associated with the production of ACE2-RBD-inhibiting antibodies, while urine proteins related to complement system, acute phase response signaling, LXR/FXR, and STAT3 pathways were correlated with neutralizing antibody production. Moreover, we observed a correlation between the gut microbiota and plasma and urine proteins, as well as the vaccination response. Based on the above data, we built a predictive model for vaccination response (AUC = 0.85). Our study provides insights into characteristic plasma and urine proteins and gut microbiota associated with the ACE2-RBD-inhibiting antibodies, which could benefit our understanding of the host response to COVID-19 vaccination.

BTN2A1
Also flagged:Liver Cancertumorsecretionchemokinesmalignant tumorpathogenesis
Journal Article 2024-01-08 ✓ 2 Snippets Yin KL, Chu KJ, Li M, Duan YX, Yu YX, Kang MQ, Fu D, Fu D, Liao R.
In-Text Gene Mentions

He et al. used single-cell sequencing to explain the metabolic changes of HCC-infiltrating γδ T cells which are significantly inhibited in oxygen metabolism, lipid metabolism, and amino acid synthesis, and tilt towards glutamine-rich metabolism, providing nutrients for tumor cell metabolism.90 Combined with a genome-wide CRISPR screening of target cancer cells, another study found that the triggering of γδ T cells by BTN3A and BTN2A1 depended on AMP-activated protein kinase (AMPK), and demonstrated that γδ T cells are regulated by multiple layers of BTN3A, such as transcription, post-translational modifications, and membrane transport, further deepening our understanding of γδ T cell stress monitoring.96 The homeostasis of IL-17A-producing γδ T cells retained in the liver is regulated by palmitic acid and CD1d, a necessary lipid antigen.97 Moreover, apoptosis, ferroptosis, and pyroptosis significantly induce an immunosuppressive microenvironment in HCC, in which an imbalance in γδ T cells and an increase in the Vd1+/Vd2+ ratio are markers of poor prognosis in HCC patients.98 Several reports have shown that the tumor-killing ability of γδ T cells is related to external factors.

BTN2A1 is essential for BTN3A1-dependent Vg9Vd2 T-cell activation against cancer cells, regulating Vγ9Vδ2 T-cell binding to the TCR.43 Representative molecules of the NK recognition mechanism include NKG2D,44 NKp30,45 and NKp44.45 Various cytokines and chemokines assist γδ T cells in achieving cytotoxic functions while acting as regulators in the immune microenvironment.

Show Full Abstract

The roles of γδ T cells in liver cancer, especially in the potential function of immunotherapy due to their direct cytotoxic effects on tumor cells and secretion of important cytokines and chemokines, have aroused research interest. This review briefly describes the basic characteristics of γδ T cells, focusing on their diverse effects on liver cancer. In particular, different subtypes of γδ T cells have diverse or even opposite effects on liver cancer. We provide a detailed description of the immune regulatory network of γδ T cells in liver cancer from two aspects: immune components and nonimmune components. The interactions between various components in this immune regulatory network are dynamic and pluralistic, ultimately determining the biological effects of γδ T cells in liver cancer. We also integrate the current knowledge of γδ T-cell immunotherapy for liver cancer treatment, emphasizing the potential of these cells in liver cancer immunotherapy.

Also flagged:deathcaspasecancerscancerferroptosisiron
Journal Article 2024-01-08 No Snippets Claudio-Ares O, Luciano-Rodríguez J, Del Valle-González YL, Schiavone-Chamorro SL, Pastor AJ, Rivera-Reyes JO, Metzler CL, Domínguez-Orona LM, Vargas-Pérez BL, Skouta R, Tinoco AD.
Show Full Abstract

The discovery of regulated cell death (RCD) revolutionized chemotherapy. With caspase-dependent apoptosis initially being thought to be the only form of RCD, many drug development strategies aimed to synthesize compounds that turn on this kind of cell death. While yielding a variety of drugs, this approach is limited, given the acquired resistance of cancers to these drugs and the lack of specificity of the drugs for targeting cancer cells alone. The discovery of non-apoptotic forms of RCD is leading to new avenues for drug design. Evidence shows that ferroptosis, a relatively recently discovered iron-based cell death pathway, has therapeutic potential for anticancer application. Recent studies point to the interrelationship between iron and other essential metals, copper and zinc, and the disturbance of their respective homeostasis as critical to the onset of ferroptosis. Other studies reveal that several coordination complexes of non-iron metals have the capacity to induce ferroptosis. This collective knowledge will be assessed to determine how chelation approaches and coordination chemistry can be engineered to program ferroptosis in chemotherapy.

bioRxiv 2024-01-08 Preprint (No Snippets API) van Hooff JJ, Raas MW, Tromer EC, Eme L.
Show Full Abstract

<h4>Summary</h4> Chromosome organization ensures accurate DNA replication, segregation, gene regulation and DNA damage repair. Across the tree of life, protein assemblages termed Structural Maintenance of Chromosomes (SMC) complexes determine chromosome organization. Eukaryotes usually have four SMC complex types (condensin I, condensin II, cohesin, and SMC5/6), whereas prokaryotes mostly have one. The expanded set is probably needed to accommodate the considerably larger eukaryotic genomes. Despite their essential functions, SMC complexes exhibit notable variation among model organisms, suggesting underexplored diversity across eukaryotes. Here, we provide a thorough reconstruction of the evolution of SMC complex subunits and accessory proteins across eukaryotes. We show that the last eukaryotic common ancestor (LECA) had all four complete SMC complexes, supporting the notion that LECA was already a sophisticated cell. At later timepoints, condensin II was lost at least thirty times, rendering it one of the most frequently lost eukaryotic cellular machineries. We identify multiple components (e.g., Sororin, Securin, Nse5, and Nse6) as much more ancient and widespread than previously appreciated. Finally, we traced the prokaryotic origins of these complexes and propose an ancient SMC complex was already duplicated in the ancestor of TACK and Asgard archaea, suggesting a sophisticated chromosome organization in the archaeal ancestor of eukaryotes. The eukaryotic SMC complex inventory was further expanded through gene duplications, highlighting the importance of these events in the emergence of eukaryotic complexity. Altogether, our results address questions and raise new ones about how SMC complex evolution affected the genome organizations of ancestral and contemporary organisms.

HTT
Also flagged:AzilsartanNeurotoxicityNF-ĸBautosomal-dominant neurodegenerative disorder3-nitropropionic acidHD
Journal Article 2024-01-07 ✓ 2 Snippets Hamouda HA, Sayed RH, Eid NI, El-Sayeh BM.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal-dominant neurodegenerative disorder caused by the expansion of the CAG trinucleotide repeat in the Huntingtin (Htt) gene leading to the production of a mutant huntingtin protein (mHtt) [1–3].

…in the Huntingtin (Htt) gene leading to…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder characterized by motor, psychiatric and cognitive symptoms. Injection of 3-nitropropionic acid (3-NP) is a widely used experimental model for induction of HD. The current study aimed to inspect the potential neuroprotective properties of azilsartan (Azil), an angiotensin II type 1 receptor blocker (ATR1), in 3-NP-induced striatal neurotoxicity in rats. Rats were randomly allocated into five groups and treated for 14 days as follows: group I received normal saline; group II received Azil (10 mg/kg, p.o.); group III received 3-NP (10 mg/kg, i.p); group IV and V received Azil (5 or 10 mg/kg, p.o, respectively) 1 h prior to 3-NP injection. Both doses of Azil markedly attenuated motor and behavioural dysfunction as well as striatal histopathological alterations caused by 3-NP. In addition, Azil balanced striatal neurotransmitters levels as evidenced by the increase of striatal gamma-aminobutyric acid content and the decrease of glutamate content. Azil also amended neuroinflammation and oxidative stress via modulating IĸB/NF-ĸB and KEAP1/Nrf2 downstream signalling pathways, as well as reducing iNOS and COX2 levels. Moreover, Azil demonstrated an anti-apoptotic activity by reducing caspase-3 level and BAX/BCL2 ratio. In conclusion, the present study reveals the neuroprotective potential of Azil in 3-NP-induced behavioural, histopathological and biochemical changes in rats. These findings might be attributed to inhibition of ATR1/NF-κB signalling, modulation of Nrf2/KEAP1 signalling, anti-inflammatory, anti-oxidant and anti-apoptotic properties.

HFE
Also flagged:alcoholhepatocellular carcinomaCancersorafenibtumorTERT
Journal Article 2024-01-07 ✓ 1 Snippet Huang J, Sun M, Wang M, Yu A, Zheng H, Bu C, Zhou J, Zhang Y, Qiao Y, Hu Z.
In-Text Gene Mentions

…hepatitis infection, andhemochromatosis[ 31 ].…

Show Full Abstract

The prevalence of alcohol-related hepatocellular carcinoma (HCC) has been increasing during the last decade. Cancer research requires cell lines suitable for both <i>in vitro</i> and <i>in vivo</i> assays. However, there is a lack of cell lines with a high <i>in vivo</i> metastatic capacity for this HCC subtype. Herein, a new HCC cell line was established, named HCC-ZJ, using cells from a patient diagnosed with alcohol-related HCC. The karyotype of HCC-ZJ was 46, XY, del (p11.2). Whole-exome sequencing identified several genetic variations in HCC-Z that occur frequently in alcohol-associated HCC, such as mutations in <i>TERT</i>, <i>CTNNB1</i>, <i>ARID1A</i>, <i>CDKN2A</i>, <i>SMARCA2</i>, and <i>HGF</i>. Cell counting kit-8 assays, colony formation assays, and Transwell assays were performed to evaluate the proliferation, migration, and sensitivity to sorafenib and lenvatinib of HCC-Z <i>in vitro</i>. HCC-ZJ showed a robust proliferation rate, a weak foci-forming ability, a strong migration capacity, and a moderate invasion tendency <i>in vitro</i>. Finally, the tumorigenicity and metastatic capacity of HCC-Z were evaluated using a subcutaneous xenograft model, an orthotopic xenograft model, and a tail-veil injection model. HCCZJ exhibited strong tumorigenicity in the subcutaneous xenograft and orthotopic tumor models. Moreover, HCC-ZJ spontaneously formed pulmonary metastases in the orthotopic tumor model. In summary, a new HCC cell line derived from a patient with alcohol-related HCC was established, which showed a high metastatic capacity and could be applied for <i>in vitro</i> and <i>in vivo</i> experiments during pre-clinical research.<b>Highlights</b>• An alcohol-related HCC cell line, HCC-ZJ, was established• HCC-ZJ was applicable for <i>in vitro</i> functional experiment and gene editing• HCC-ZJ was applicable for <i>in vivo</i> tumor growth and spontaneous metastasis models.

Also flagged:lipidpneumoconiotic diseasessilicosispneumoconiosisphagocytosisdust disease
Journal Article 2024-01-07 No Snippets Kamanzi C, Becker M, Von Holdt J, Hsu NJ, Konečný P, Broadhurst J, Jacobs M.
Show Full Abstract

Mine dust has been linked to the development of pneumoconiotic diseases such as silicosis and coal workers' pneumoconiosis. Currently, it is understood that the physicochemical and mineralogical characteristics drive the toxic nature of dust particles; however, it remains unclear which parameter(s) account for the differential toxicity of coal dust. This study aims to address this issue by demonstrating the use of the partial least squares regression (PLSR) machine learning approach to compare the influence of D<sub>50</sub> sub 10 μm coal particle characteristics against markers of cellular damage. The resulting analysis of 72 particle characteristics against cytotoxicity and lipid peroxidation reflects the power of PLSR as a tool to elucidate complex particle-cell relationships. By comparing the relative influence of each characteristic within the model, the results reflect that physical characteristics such as shape and particle roughness may have a greater impact on cytotoxicity and lipid peroxidation than composition-based parameters. These results present the first multivariate assessment of a broad-spectrum data set of coal dust characteristics using latent structures to assess the relative influence of particle characteristics on cellular damage.

Also flagged:Protein SpalmitoylationCadmiummetabolismcell growthresponse to
Journal Article 2024-01-07 No Snippets Lee CM, Jarrell ZR, Lee HY, Singer G, Tran VT, Orr M, Jones DP, Go YM.
Show Full Abstract

Cadmium (Cd) is a naturally occurring, toxic environmental metal found in foods. Humans do not have an efficient mechanism for Cd elimination; thus, Cd burden in humans increases with age. Cell and mouse studies show that Cd burden from low environmental levels of exposure impacts lung cell metabolism, proliferation signaling and cell growth as part of disease-promoting profibrotic responses in the lungs. Prior integrative analysis of metabolomics and transcriptomics identified the zDHHC11 transcript as a central functional hub in response to Cd dose. zDHHC11 encodes a protein S-palmitoyltransferase, but no evidence is available for effects of Cd on protein S-palmitoylation. In the present research, we studied palmitoylation changes in response to Cd and found increased protein S-palmitoylation in human lung fibroblasts that was inhibited by 2-bromopalmitate (2-BP), an irreversible palmitoyltransferase inhibitor. Mass spectrometry-based proteomics showed palmitoylation of proteins involved in divalent metal transport and in fibrotic signaling. Mechanistic studies showed that 2-BP inhibited palmitoylation of divalent metal ion transporter ZIP14 and also inhibited cellular Cd uptake. Transcription analyses showed that Cd stimulated transforming growth factor (TGF)-β1 and β3 expression within 8 h and lung fibrotic markers α-smooth muscle actin, matrix metalloproteinase-2, and collagen 1α1 gene expression and that these effects were blocked by 2-BP. Because 2-BP also blocked palmitoylation of proteins controlled by TGFβ1, these results show that palmitoylation impacts Cd-dependent fibrotic signaling both by enhancing cellular Cd accumulation and by supporting post-translational processing of TGFβ1-dependent proteins.

Also flagged:Dental cariescarbohydratessugarsdemineralizationcariesfluoride
Journal Article 2024-01-07 No Snippets Spatafora G, Li Y, He X, Cowan A, Tanner ACR.
Show Full Abstract

Dental caries is a significant oral and public health problem worldwide, especially in low-income populations. The risk of dental caries increases with frequent intake of dietary carbohydrates, including sugars, leading to increased acidity and disruption of the symbiotic diverse and complex microbial community of health. Excess acid production leads to a dysbiotic shift in the bacterial biofilm composition, demineralization of tooth structure, and cavities. Highly acidic and acid-tolerant species associated with caries include <i>Streptococcus mutans</i>, <i>Lactobacillus</i>, <i>Actinomyces</i>, <i>Bifidobacterium</i>, and <i>Scardovia</i> species. The differences in microbiotas depend on tooth site, extent of carious lesions, and rate of disease progression. Metagenomics and metatranscriptomics not only reveal the structure and genetic potential of the caries-associated microbiome, but, more importantly, capture the genetic makeup of the metabolically active microbiome in lesion sites. Due to its multifactorial nature, caries has been difficult to prevent. The use of topical fluoride has had a significant impact on reducing caries in clinical settings, but the approach is costly; the results are less sustainable for high-caries-risk individuals, especially children. Developing treatment regimens that specifically target <i>S. mutans</i> and other acidogenic bacteria, such as using nanoparticles, show promise in altering the cariogenic microbiome, thereby combatting the disease.

CDK5RAP1
Also flagged:infectionsex chromosomespreeclampsiafetal growth restrictiongestational diabetesmembrane
Journal Article 2024-01-06 ✓ 1 Snippet Legault LM, Breton-Larrivée M, Langford-Avelar A, Lemieux A, McGraw S.
In-Text Gene Mentions

…Zfp64 ; female:Cdk5rap1, 4833420G17Rik, Scd2 )…

Show Full Abstract

<h4>Background</h4>The placenta is vital for fetal development and its contributions to various developmental issues, such as pregnancy complications, fetal growth restriction, and maternal exposure, have been extensively studied in mice. The placenta forms mainly from fetal tissue and therefore has the same biological sex as the fetus it supports. Extensive research has delved into the placenta's involvement in pregnancy complications and future offspring development, with a notable emphasis on exploring sex-specific disparities. However, despite these investigations, sex-based disparities in epigenetic (e.g., DNA methylation) and transcriptomic features of the late-gestation mouse placenta remain largely unknown.<h4>Methods</h4>We collected male and female mouse placentas at late gestation (E18.5, n = 3/sex) and performed next-generation sequencing to identify genome-wide sex differences in transcription and DNA methylation.<h4>Results</h4>Our comparison between male and female revealed 358 differentially expressed genes (DEGs) on autosomes, which were associated with signaling pathways involved in transmembrane transport and the responses to viruses and external stimuli. X chromosome DEGs (n = 39) were associated with different pathways, including those regulating chromatin modification and small GTPase-mediated signal transduction. Differentially methylated regions (DMRs) were more common on the X chromosomes (n = 3756) than on autosomes (n = 1705). Interestingly, while most X chromosome DMRs had higher DNA methylation levels in female placentas and tended to be included in CpG dinucleotide-rich regions, 73% of autosomal DMRs had higher methylation levels in male placentas and were distant from CpG-rich regions. Several DEGs were correlated with DMRs. A subset of the DMRs present in late-stage placentas were already established in mid-gestation (E10.5) placentas (n = 348 DMRs on X chromosome and 19 DMRs on autosomes), while others were acquired later in placental development.<h4>Conclusion</h4>Our study provides comprehensive lists of DEGs and DMRs between male and female that collectively cause profound differences in the DNA methylation and gene expression profiles of late-gestation mouse placentas. Our results demonstrate the importance of incorporating sex-specific analyses into epigenetic and transcription studies to enhance the accuracy and comprehensiveness of their conclusions and help address the significant knowledge gap regarding how sex differences influence placental function.

Also flagged:phosphine oxidesaltphosphinicwaterphosphine oxidespeptides
Journal Article 2024-01-06 No Snippets Tang X, Lv S, Mou Z, Liu X, Li Z.
Show Full Abstract

<h4>Background</h4>The <sup>18</sup>F/<sup>19</sup>F-isotope exchange method employing P(V)-centered prosthetic groups demonstrates advantages in addressing mild one-step aqueous <sup>18</sup>F-labeling of peptides and proteins. However, the molar activity (A<sub>m</sub>) achieved through isotope exchange remains relatively low, unless employing a high initial activity of [<sup>18</sup>F]F<sup>-</sup>. To overcome this drawback, our work introduces a novel approach through a Cu-mediated direct <sup>18</sup>F-dehydrofluorination of phosphine oxides. This method leverages the straightforward separation of the <sup>18</sup>F-labeled product from the phosphine oxide precursors, aiming to primarily increase A<sub>m</sub>.<h4>Results</h4>Through a <sup>19</sup>F-dehydrofluorination efficiency test, Cu(OAc)<sub>2</sub> was identified as the optimal oxidative metal salt, exhibiting a remarkable 100% conversion within one hour. Leveraging the straightforward separation of phosphine oxide precursors and phosphinic fluoride products, the A<sub>m</sub> of an activated ester, [<sup>18</sup>F]4, sees an impressive nearly 15-fold increase compared to the <sup>18</sup>F/<sup>19</sup>F-isotope exchange, with the same initial activity of [<sup>18</sup>F]F<sup>-</sup>. Furthermore, this Cu(II)-mediated <sup>18</sup>F-dehydrofluorination approach demonstrates tolerance up to 20% solvent water content, which enables the practical radiosynthesis of <sup>18</sup>F-labeled water-soluble molecules under non-drying conditions.<h4>Conclusions</h4>The direct <sup>18</sup>F-dehydrofluorination of phosphine oxide prosthetic groups has been successfully accomplished, achieving a high A<sub>m</sub> via Cu(II)-mediated oxidative addition and reductive elimination.

PRDX6
Also flagged:antibodyreceptorbindingDuffy binding proteinFc gamma receptorIgG
Journal Article 2024-01-06 ✓ 2 Snippets Martinez FJ, White M, Guillotte-Blisnick M, Huon C, Boucharlat A, Agou F, England P, Popovici J, Hou MM, Silk SE, Barrett JR, Nielsen CM, Reimer JM, Mukherjee P, Chauhan VS, Minassian AM, Draper SJ, Chitnis CE.
In-Text Gene Mentions

…protein, peroxiredoxin 6 (PRDX6) 49 , was…

…recombinant protein orPRDX6(reference biosensor) were…

Show Full Abstract

The receptor-binding domain, region II, of the Plasmodium vivax Duffy binding protein (PvDBPII) binds the Duffy antigen on the reticulocyte surface to mediate invasion. A heterologous vaccine challenge trial recently showed that a delayed dosing regimen with recombinant PvDBPII SalI variant formulated with adjuvant Matrix-M<sup>TM</sup> reduced the in vivo parasite multiplication rate (PMR) in immunized volunteers challenged with the Thai P. vivax isolate PvW1. Here, we describe extensive analysis of the polyfunctional antibody responses elicited by PvDBPII immunization and identify immune correlates for PMR reduction. A classification algorithm identified antibody features that significantly contribute to PMR reduction. These included antibody titre, receptor-binding inhibitory titre, dissociation constant of the PvDBPII-antibody interaction, complement C1q and Fc gamma receptor binding and specific IgG subclasses. These data suggest that multiple immune mechanisms elicited by PvDBPII immunization are likely to be associated with protection and the immune correlates identified could guide the development of an effective vaccine for P. vivax malaria. Importantly, all the polyfunctional antibody features that correlated with protection cross-reacted with both PvDBPII SalI and PvW1 variants, suggesting that immunization with PvDBPII should protect against diverse P. vivax isolates.

NEGR1
Also flagged:menopauseGCKRFOXO3SEMA3GPATE4AZGP1
Journal Article 2024-01-06 ✓ 5 Snippets Yazdanpanah N, Jumentier B, Yazdanpanah M, Ong KK, Perry JRB, Manousaki D.
In-Text Gene Mentions

Using Metascape, we found that 4 genes (AZGP1, DLK1, GCKR and NEGR1) are linked to diabetes (Supplementary Data 26).

…SEMA3G, PATE4, AZGP1,NEGR1, LHB, DLK1, ANXA2,…

…ranging from 35.12 (NEGR1) to 25208.6 (TXNDC15),…

…8 additional proteins (NEGR1, LHB, DLK1, ANXA2,…

…(DLK1, DBAJB12, GCKR,NEGR1, TXNDC15, MST1), but…

Show Full Abstract

Age at menarche (AAM) and age at natural menopause (ANM) are highly heritable traits and have been linked to various health outcomes. We aimed to identify circulating proteins associated with altered ANM and AAM using an unbiased two-sample Mendelian randomization (MR) and colocalization approach. By testing causal effects of 1,271 proteins on AAM, we identified 22 proteins causally associated with AAM in MR, among which 13 proteins (GCKR, FOXO3, SEMA3G, PATE4, AZGP1, NEGR1, LHB, DLK1, ANXA2, YWHAB, DNAJB12, RMDN1 and HPGDS) colocalized. Among 1,349 proteins tested for causal association with ANM using MR, we identified 19 causal proteins among which 7 proteins (CPNE1, TYMP, DNER, ADAMTS13, LCT, ARL and PLXNA1) colocalized. Follow-up pathway and gene enrichment analyses demonstrated links between AAM-related proteins and obesity and diabetes, and between AAM and ANM-related proteins and various types of cancer. In conclusion, we identified proteomic signatures of reproductive ageing in women, highlighting biological processes at both ends of the reproductive lifespan.

SOX6
Also flagged:Kashin-Beck diseaseosteochondropathySRY-box transcription factor 6degenerative osteoarthropathyseleniumABI3BP
Journal Article 2024-01-06 ✓ 5 Snippets He N, Hong A, Zhao K, Zhang Z, Wang S, Jia Y.
In-Text Gene Mentions

Hypertensive and diabetes complications stratified analyses showed that (Tables S10 and S11) the link between SOX6 SNPs and the KBD risk was not markedly impacted by whether or not the patient had hypertension or diabetes.

Association of SOX6 gene polymorphisms with Kashin-Beck disease risk in the Chinese Han population

Meanwhile, SOX6 is a multi-effector gene in osteoporosis, and there is a latent interaction between its multiple genetic mutations and the risk of osteoporosis [17,18].

A cross-sectional study by Correa-Rodríguez et al. revealed that SOX6 rs7117858 can affect the fat free mass and quantitative ultra sound characteristics of young people, indicating the significance of SOX6 variants in obesity and osteoporosis-related phenotypes during early adulthood [17].

It was reported that SOX6 is necessary for effective cartilage formation, as its inactivation can affect the differentiation of chondrocytes and neuronal cells, resulting in mild bone defects and bone-related disorders like Tolchin-Le Caignec syndrome, osteoporosis, and osteochondroma [14,15].

Show Full Abstract

Kashin-Beck disease (KBD) is an endemic osteochondropathy. A specific gene called SRY-box transcription factor 6 (<i>SOX6</i>) is important for forming cartilage. This study aims to explore the potential correlation between <i>SOX6</i> single nucleotide polymorphisms (SNPs) and KBD risk for the first time. In the case-control study, 735 unrelated Chinese Han individuals were enrolled. The four mutation sites of the <i>SOX6</i> gene (rs4539287 G/A, rs3203295 C/A, rs7928675 C/A, and rs10832681 A/G) were screened and genotyped on the Agena MassARRAY platform. The correlation between <i>SOX6</i> SNPs and KBD risk was explored based on logistic regression analysis. The interaction between SNP and SNP was analyzed based on the multi-factor dimensionality reduction (MDR) method. Overall analysis revealed a remarkable correlation between rs7928675 and rs10832681 and the reduction of KBD risk (<i>p</i> < 0.05). Subgroup analyses further indicated that these two SNPs have a significant protective effect on KBD risk among participants aged ≤65 years, males, and non-smokers (<i>p</i> < 0.05). MDR displayed a marked interaction between rs3203295 and rs10832681. Our study revealed that <i>SOX6</i> rs7928675 and rs10832681 are markedly correlated with a reduced risk of KBD in the Chinese Han population, providing a new direction for the prevention, diagnosis, and treatment of KBD.

Antibodies to watch in 2024.

Also flagged:antibodyCOVID-19complement C5aCD20HER2PD-1
Journal Article 2024-01-05 No Snippets Crescioli S, Kaplon H, Chenoweth A, Wang L, Visweswaraiah J, Reichert JM.
Show Full Abstract

The 'Antibodies to Watch' article series provides an annual summary of commercially sponsored monoclonal antibody therapeutics currently in late-stage clinical development, regulatory review, and those recently granted a first approval in any country. In this installment, we discuss key details for 16 antibody therapeutics granted a first approval in 2023, as of November 17 (lecanemab (Leqembi), rozanolixizumab (RYSTIGGO), pozelimab (VEOPOZ), mirikizumab (Omvoh), talquetamab (Talvey), elranatamab (Elrexfio), epcoritamab (EPKINLY), glofitamab (COLUMVI), retifanlimab (Zynyz), concizumab (Alhemo), lebrikizumab (EBGLYSS), tafolecimab (SINTBILO), narlumosbart (Jinlitai), zuberitamab (Enrexib), adebrelimab (Arelili), and divozilimab (Ivlizi)). We briefly review 26 product candidates for which marketing applications are under consideration in at least one country or region, and 23 investigational antibody therapeutics that are forecast to enter regulatory review by the end of 2024 based on company disclosures. These nearly 50 product candidates include numerous innovative bispecific antibodies, such as odronextamab, ivonescimab, linvoseltamab, zenocutuzumab, and erfonrilimab, and antibody-drug conjugates, such as trastuzumab botidotin, patritumab deruxtecan, datopotamab deruxtecan, and MRG002, as well as a mixture of two immunocytokines (bifikafusp alfa and onfekafusp alfa). We also discuss clinical phase transition and overall approval success rates for antibody therapeutics, which are crucial to the biopharmaceutical industry because these rates inform decisions about resource allocation. Our analyses indicate that these molecules have approval success rates in the range of 14-32%, with higher rates associated with antibodies developed for non-cancer indications. Overall, our data suggest that antibody therapeutic development efforts by the biopharmaceutical industry are robust and increasingly successful.

HTT
Also flagged:Huntington's DiseaseHDchromosomelocalizationMovement Disorder
Journal Article 2024-01-05 ✓ 1 Snippet Franklin GL, Teive HAG, Tensini FS, Camargo CHF, de Lima NSC, de Dos Santos DC, Meira AT, Tabrizi SJ.
In-Text Gene Mentions

…identification of theHTTgene.…

Show Full Abstract

The gene for Huntington's disease (HD) was discovered in 1993, after an international collaborative initiative that led researchers to remote regions of South America. It was the most remarkable milestone, since George Huntington's initial description. Through the phenomenological discussions led by Jean-Martin Charcot and Willian Osler, and finally Americo Negrette's reports, which served as the inspiration for the Venezuela Project led by Nancy Wexler, the journey toward discovering the Huntington's disease (HD) gene was marked by substantial efforts. This monumental achievement involved the analysis of more than 18,000 blood samples and gathered dozens of researchers in an integrated effort, enabling the mapping of the gene on chromosome 4 in 1983 and leading, a decade later, to the precise localization and identification of the HTT gene. The discovery of the HD mutation represented a pivotal moment in the field of genetics and neurology, significantly enhancing our understanding of the disease and creating opportunities for future treatments. The progress made and the knowledge gained during this journey catalyzed the development of many innovative molecular techniques that have advanced research in other medical conditions. In this article, the authors celebrate three decades of this memorable event, revisiting the historical aspects, providing insights into the techniques developed, and delving into the paths that ultimately led to the discovery of the HD gene. © 2024 International Parkinson and Movement Disorder Society.

SOX6
Also flagged:Sox9AgingExtracellularSRY-box transcription factor 9p16cyclin-dependent kinase inhibitor 2A
Journal Article 2024-01-05 ✓ 1 Snippet Faleeva M, Ahmad S, Theofilatos K, Lynham S, Watson G, Whitehead M, Marhuenda E, Iskratsch T, Cox S, Shanahan CM.
In-Text Gene Mentions

…for Sox5 andSox6, 2 transcriptional…

Show Full Abstract

<h4>Background</h4>Vascular calcification and increased extracellular matrix (ECM) stiffness are hallmarks of vascular aging. Sox9 (SRY-box transcription factor 9) has been implicated in vascular smooth muscle cell (VSMC) osteo/chondrogenic conversion; however, its relationship with aging and calcification has not been studied.<h4>Methods</h4>Immunohistochemistry was performed on human aortic samples from young and aged patients. Young and senescent primary human VSMCs were induced to produce ECM, and Sox9 expression was manipulated using adenoviral overexpression and depletion. ECM properties were characterized using atomic force microscopy and proteomics, and VSMC phenotype on hydrogels and the ECM were examined using confocal microscopy.<h4>Results</h4>In vivo, Sox9 was not spatially associated with vascular calcification but correlated with the senescence marker p16 (cyclin-dependent kinase inhibitor 2A). In vitro Sox9 showed mechanosensitive responses with increased expression and nuclear translocation in senescent cells and on stiff matrices. Sox9 was found to regulate ECM stiffness and organization by orchestrating changes in collagen (Col) expression and reducing VSMC contractility, leading to the formation of an ECM that mirrored that of senescent cells. These ECM changes promoted phenotypic modulation of VSMCs, whereby senescent cells plated on ECM synthesized from cells depleted of Sox9 returned to a proliferative state, while proliferating cells on a matrix produced by Sox9 expressing cells showed reduced proliferation and increased DNA damage, reiterating features of senescent cells. LH3 (procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3) was identified as an Sox9 target and key regulator of ECM stiffness. LH3 is packaged into extracellular vesicles and Sox9 promotes extracellular vesicle secretion, leading to increased LH3 deposition within the ECM.<h4>Conclusions</h4>These findings highlight the crucial role of ECM structure and composition in regulating VSMC phenotype. We identify a positive feedback cycle, whereby cellular senescence and increased ECM stiffening promote Sox9 expression, which, in turn, drives further ECM modifications to further accelerate stiffening and senescence.

Also flagged:mineralsSporulationmetabolismminerallignincarbon
Journal Article 2024-01-05 No Snippets Gadd GM, Fomina M, Pinzari F.
Show Full Abstract

SUMMARYFungi are ubiquitous and important biosphere inhabitants, and their abilities to decompose, degrade, and otherwise transform a massive range of organic and inorganic substances, including plant organic matter, rocks, and minerals, underpin their major significance as biodeteriogens in the built environment and of cultural heritage. Fungi are often the most obvious agents of cultural heritage biodeterioration with effects ranging from discoloration, staining, and biofouling to destruction of building components, historical artifacts, and artwork. Sporulation, morphological adaptations, and the explorative penetrative lifestyle of filamentous fungi enable efficient dispersal and colonization of solid substrates, while many species are able to withstand environmental stress factors such as desiccation, ultra-violet radiation, salinity, and potentially toxic organic and inorganic substances. Many can grow under nutrient-limited conditions, and many produce resistant cell forms that can survive through long periods of adverse conditions. The fungal lifestyle and chemoorganotrophic metabolism therefore enable adaptation and success in the frequently encountered extremophilic conditions that are associated with indoor and outdoor cultural heritage. Apart from free-living fungi, lichens are a fungal growth form and ubiquitous pioneer colonizers and biodeteriogens of outdoor materials, especially stone- and mineral-based building components. This article surveys the roles and significance of fungi in the biodeterioration of cultural heritage, with reference to the mechanisms involved and in relation to the range of substances encountered, as well as the methods by which fungal biodeterioration can be assessed and combated, and how certain fungal processes may be utilized in bioprotection.

PTGIS
Also flagged:PCOShyperandrogenismmetabolic disordersGene expressionphosphorylationmethylation
Journal Article 2024-01-05 ✓ 1 Snippet Stener-Victorin E, Eriksson G, Mohan Shrestha M, Rodriguez Paris V, Lu H, Banks J, Samad M, Perian C, Jude B, Engman V, Boi R, Nilsson E, Ling C, Nyström J, Wernstedt Asterholm I, Turner N, Lanner J, Benrick A.
In-Text Gene Mentions

…treatment: FCGR3A, FAP,PTGIS, COL1A2, COL14A1, COL1A1,…

Show Full Abstract

<h4>Background</h4>Polycystic ovary syndrome's (PCOS) main feature is hyperandrogenism, which is linked to a higher risk of metabolic disorders. Gene expression analyses in adipose tissue and skeletal muscle reveal dysregulated metabolic pathways in women with PCOS, but these differences do not necessarily lead to changes in protein levels and biological function.<h4>Methods</h4>To advance our understanding of the molecular alterations in PCOS, we performed global proteomic and phosphorylation site analysis using tandem mass spectrometry, and analyzed gene expression and methylation. Adipose tissue and skeletal muscle were collected at baseline from 10 women with and without PCOS, and in women with PCOS after 5 weeks of treatment with electrical stimulation.<h4>Results</h4>Perilipin-1, a protein that typically coats the surface of lipid droplets in adipocytes, was increased whereas proteins involved in muscle contraction and type I muscle fiber function were downregulated in PCOS muscle. Proteins in the thick and thin filaments had many altered phosphorylation sites, indicating differences in protein activity and function. A mouse model was used to corroborate that androgen exposure leads to a shift in muscle fiber type in controls but not in skeletal muscle-specific androgen receptor knockout mice. The upregulated proteins in muscle post treatment were enriched in pathways involved in extracellular matrix organization and wound healing, which may reflect a protective adaptation to repeated contractions and tissue damage due to needling. A similar, albeit less pronounced, upregulation in extracellular matrix organization pathways was also seen in adipose tissue.<h4>Conclusions</h4>Our results suggest that hyperandrogenic women with PCOS have higher levels of extra-myocellular lipids and fewer oxidative insulin-sensitive type I muscle fibers. These could be key factors leading to insulin resistance in PCOS muscle while electric stimulation-induced tissue remodeling may be protective.<h4>Funding</h4>Swedish Research Council (2020-02485, 2022-00550, 2020-01463), Novo Nordisk Foundation (NNF22OC0072904), and IngaBritt and Arne Lundberg Foundation. Clinical trial number NTC01457209.

PRDX6
Also flagged:cardiovascular diseaseCVDphosphorylationmitochondriaPGRmetabolism
Journal Article 2024-01-05 ✓ 2 Snippets Visker JR, Leszczynski EC, Wellette-Hunsucker AG, McPeek AC, Quinn MA, Kim SH, Bazil JN, Ferguson DP.
In-Text Gene Mentions

…abundance of UCP3,PRDX6, VDAC, and ANT1…

PRDX6

Show Full Abstract

Postnatal growth restriction (PGR) can increase the risk of cardiovascular disease (CVD) potentially due to impairments in oxidative phosphorylation (OxPhos) within cardiomyocyte mitochondria. The purpose of this investigation was to determine if PGR impairs cardiac metabolism, specifically OxPhos. FVB (Friend Virus B-type) mice were fed a normal-protein (NP: 20% protein), or low-protein (LP: 8% protein) isocaloric diet 2 weeks before mating. LP dams produce ∼20% less milk, and pups nursed by LP dams experience reduced growth into adulthood as compared to pups nursed by NP dams. At birth (PN1), pups born to dams fed the NP diet were transferred to LP dams (PGR group) or a different NP dam (control group: CON). At weaning (PN21), all mice were fed the NP diet. At PN22 and PN80, mitochondria were isolated for respirometry (oxygen consumption rate, JO2${J_{{{\mathrm{O}}_{\mathrm{2}}}}}$ ) and fluorimetry (reactive oxygen species emission, JH2O2${J_{{{\mathrm{H}}_{\mathrm{2}}}{{\mathrm{O}}_{\mathrm{2}}}}}$ ) analysis measured as baseline respiration (LEAK) and with saturating ADP (OxPhos). Western blotting at PN22 and PN80 determined protein abundance of uncoupling protein 3, peroxiredoxin-6, voltage-dependent anion channel and adenine nucleotide translocator 1 to provide further insight into mitochondrial function. ANOVAs with the main effects of diet, sex and age with α-level of 0.05 was set a priori. Overall, PGR (7.8 ± 1.1) had significant (P = 0.01) reductions in respiratory control in complex I when compared to CON (8.9 ± 1.0). In general, our results show that PGR led to higher electron leakage in the form of free radical production and reactive oxygen species emission. No significant diet effects were found in protein abundance. The observed reduced respiratory control and increased ROS emission in PGR mice may increase risk for CVD in mice.

Also flagged:arthralgia syndromerheumatoid arthritisrheumatismRAsystemic autoimmune diseasemultiple arthritis
Journal Article 2024-01-05 No Snippets Li P, Wang C, Huo H, Xu C, Sun H, Wang X, Wang L, Li L.
Show Full Abstract

Most antirheumatic drugs with high toxicity exhibit a narrow therapeutic window due to their nonspecific distribution in the body, leading to undesirable side effects and reduced patient compliance. To in response to these challenges, prodrug-based nanoparticulate drug delivery systems (PNDDS), which combines prodrug strategy and nanotechnology into a single system, resulting their many advantages, including stability for prodrug structure, the higher drug loading capacity of the system, improving the target activity and bioavailability, and reducing their untoward effects. PNDDS have gained attention as a method for relieving arthralgia syndrome of rheumatoid arthritis in recent years. This article systematically reviews prodrug-based nanocarriers for rheumatism treatment, including Nano systems based on prodrug-encapsulated nanomedicines and conjugate-based nanomedicines. It provides a new direction for the clinical treatment of rheumatoid arthritis.

OLFM4
Also flagged:amino acidCysteinemethioninecystine/glutamate exchange transporterxCTsulfate
Journal Article 2024-01-05 ✓ 3 Snippets de Jong JCW, van Rooijen KS, Stigter ECA, Gülersönmez MC, de Zoete MR, Top J, Baars MJD, Vercoulen Y, Kuipers F, van Mil SWC, Ijssennagger N.
In-Text Gene Mentions

Stem cell markers (Lgr5, Sox9, Olfm4) were, or tended to be, significantly increased upon cystine restriction in the small intestine.

…, Sox9 ,Olfm4) , proliferative cell…

…, Sox9 ,Olfm4) were, or tended…

Show Full Abstract

Currently, over 88 million people are estimated to have adopted a vegan or vegetarian diet. Cysteine is a semi-essential amino acid, which availability is largely dependent on dietary intake of meat, eggs and whole grains. Vegan/vegetarian diets are therefore inherently low in cysteine. Sufficient uptake of cysteine is crucial, as it serves as substrate for protein synthesis and can be converted to taurine and glutathione. We found earlier that intermolecular cystine bridges are essential for the barrier function of the intestinal mucus layer. Therefore, we now investigate the effect of low dietary cystine on the intestine. Mice (8/group) received a high fat diet with a normal or low cystine concentration for 2 weeks. We observed no changes in plasma methionine, cysteine, taurine or glutathione levels or bile acid conjugation after 2 weeks of low cystine feeding. In the colon, dietary cystine restriction results in an increase in goblet cell numbers, and a borderline significant increase mucus layer thickness. Gut microbiome composition and expression of stem cell markers did not change on the low cystine diet. Remarkably, stem cell markers, as well as the proliferation marker Ki67, were increased upon cystine restriction in the small intestine. In line with this, gene set enrichment analysis indicated enrichment of Wnt signaling in the small intestine of mice on the low cystine diet, indicative of increased epithelial proliferation. In conclusion, 2 weeks of cystine restriction did not result in apparent systemic effects, but the low cystine diet increased the proliferative capacity specifically of the small intestine and induced the number of goblet cells in the colon.

SERPINC1
Also flagged:clottingcoagulationfractureliver cirrhosisCOVID-19sepsis
Journal Article 2024-01-05 ✓ 5 Snippets Ghetmiri DE, Venturi AJ, Cohen MJ, Menezes AA.
In-Text Gene Mentions

…that antithrombin III (ATIII) had on a…

…mechanistic biology, becauseATIIIis an anticoagulant…

…SinceATIIIis a primary…

…n p andATIII.…

…IX, X, andATIII.…

Show Full Abstract

Cybermedical systems that regulate patient clotting in real time with personalized blood product delivery will improve treatment outcomes. These systems will harness popular viscoelastic assays of clot strength such as thromboelastography (TEG), which help evaluate coagulation status in numerous conditions: major surgery (e.g., heart, vascular, hip fracture, and trauma); liver cirrhosis and transplants; COVID-19; ICU stays; sepsis; obstetrics; diabetes; and coagulopathies like hemophilia. But these measurements are time-consuming, and thus impractical for urgent care and automated coagulation control. Because protein concentrations in a blood sample can be measured in about five minutes, we develop personalized, phenomenological, quick, control-oriented models that predict TEG curve outputs from input blood protein concentrations, to facilitate treatment decisions based on TEG curves. Here, we accurately predict, experimentally validate, and mechanistically justify curves and parameters for common TEG assays (Functional Fibrinogen, Citrated Native, Platelet Mapping, and Rapid TEG), and verify results with trauma patient clotting data.

GPR52
Also flagged:FrizzledG proteinFrizzled receptorsWntFZD6FZD3
Journal Article 2024-01-05 ✓ 1 Snippet Zhang Z, Lin X, Wei L, Wu Y, Xu L, Wu L, Wei X, Zhao S, Zhu X, Xu F.
In-Text Gene Mentions

…A2AR–miniGs–Nb35 57 andGPR52-miniGs-Nb35 58 .…

Show Full Abstract

The ten Frizzled receptors (FZDs) are essential in Wnt signaling and play important roles in embryonic development and tumorigenesis. Among these, FZD6 is closely associated with lens development. Understanding FZD activation mechanism is key to unlock these emerging targets. Here we present the cryo-EM structures of FZD6 and FZD3 which are known to relay non-canonical planar cell polarity (PCP) signaling pathways as well as FZD1 in their G protein-coupled states and in the apo inactive states, respectively. Comparison of the three inactive/active pairs unveiled a shared activation framework among all ten FZDs. Mutagenesis along with imaging and functional analysis on the human lens epithelial tissues suggested potential crosstalk between the G-protein coupling of FZD6 and the PCP signaling pathways. Together, this study provides an integrated understanding of FZD structure and function, and lays the foundation for developing therapeutic modulators to activate or inhibit FZD signaling for a range of disorders including cancers and cataracts.

Also flagged:nucleusmetabolismdeathcognitionneurological disorderspsychiatric illnesses
Journal Article 2024-01-05 No Snippets Petersen KA, Zong W, Depoy LM, Scott MR, Shankar VG, Burns JN, Cerwensky AJ, Kim SM, Ketchesin KD, Tseng GC, McClung CA.
Show Full Abstract

The human striatum can be subdivided into the caudate, putamen, and nucleus accumbens (NAc). In mice, this roughly corresponds to the dorsal medial striatum (DMS), dorsal lateral striatum (DLS), and ventral striatum (NAc). Each of these structures have some overlapping and distinct functions related to motor control, cognitive processing, motivation, and reward. Previously, we used a "time-of-death" approach to identify diurnal rhythms in RNA transcripts in these three human striatal subregions. Here, we identify molecular rhythms across similar striatal subregions collected from C57BL/6J mice across 6 times of day and compare results to the human striatum. Pathway analysis indicates a large degree of overlap between species in rhythmic transcripts involved in processes like cellular stress, energy metabolism, and translation. Notably, a striking finding in humans is that small nucleolar RNAs (snoRNAs) and long non-coding RNAs (lncRNAs) are among the most highly rhythmic transcripts in the NAc and this is not conserved in mice, suggesting the rhythmicity of RNA processing in this region could be uniquely human. Furthermore, the peak timing of overlapping rhythmic genes is altered between species, but not consistently in one direction. Taken together, these studies reveal conserved as well as distinct transcriptome rhythms across the human and mouse striatum and are an important step in understanding the normal function of diurnal rhythms in humans and model organisms in these regions and how disruption could lead to pathology.

Also flagged:keratinocyte carcinomaimmunosuppressionskin cancersskin cancersquamous cell carcinomaAging
Journal Article 2024-01-05 No Snippets Choquet H, Jiang C, Yin J, Kim Y, Hoffmann TJ, 23andMe Research Team, Jorgenson E, Asgari MM.
Show Full Abstract

Basal cell carcinoma (BCC) is one of the most common malignancies worldwide, yet its genetic determinants are incompletely defined. We perform a European ancestry genome-wide association (GWA) meta-analysis and a Hispanic/Latino ancestry GWA meta-analysis and meta-analyze both in a multi-ancestry GWAS meta-analysis of BCC, totaling 50,531 BCC cases and 762,234 controls from four cohorts (GERA, Mass-General Brigham Biobank, UK Biobank, and 23andMe research cohort). Here we identify 122 BCC-associated loci, of which 36 were novel, and subsequently fine-mapped these associations. We also identify an association of the well-known pigment gene SLC45A2 as well as associations at RCC2 and CLPTM1L with BCC in Hispanic/Latinos. We examine these BCC loci for association with cutaneous squamous cell carcinoma (cSCC) in 16,407 SCC cases and 762,486 controls of European ancestry, and 33 SNPs show evidence of association. Our study findings provide important insights into the genetic basis of BCC and cSCC susceptibility.

DCC
Also flagged:Sleepbehavioralcognitionextracellulardegradationsleeping
Journal Article 2024-01-05 ✓ 1 Snippet Xu Y, Schneider A, Wessel R, Hengen KB.
In-Text Gene Mentions

DCC

Show Full Abstract

Sleep is assumed to subserve homeostatic processes in the brain; however, the set point around which sleep tunes circuit computations is unknown. Slow-wave activity (SWA) is commonly used to reflect the homeostatic aspect of sleep; although it can indicate sleep pressure, it does not explain why animals need sleep. This study aimed to assess whether criticality may be the computational set point of sleep. By recording cortical neuron activity continuously for 10-14 d in freely behaving rats, we show that normal waking experience progressively disrupts criticality and that sleep functions to restore critical dynamics. Criticality is perturbed in a context-dependent manner, and waking experience is causal in driving these effects. The degree of deviation from criticality predicts future sleep/wake behavior more accurately than SWA, behavioral history or other neural measures. Our results demonstrate that perturbation and recovery of criticality is a network homeostatic mechanism consistent with the core, restorative function of sleep.

Also flagged:STX17SNAP47VAMP7VAMP8autophagySNAP29
Journal Article 2024-01-05 No Snippets Jian F, Wang S, Tian R, Wang Y, Li C, Li Y, Wang S, Fang C, Ma C, Rong Y.
Show Full Abstract

Autophagosome-lysosome fusion mediated by SNARE complexes is an essential step in autophagy. Two SNAP29-containing SNARE complexes have been extensively studied in starvation-induced bulk autophagy, while the relevant SNARE complexes in other types of autophagy occurring under non-starvation conditions have been overlooked. Here, we found that autophagosome-lysosome fusion in selective autophagy under non-starvation conditions does not require SNAP29-containing SNARE complexes, but requires the STX17-SNAP47-VAMP7/VAMP8 SNARE complex. Further, the STX17-SNAP47-VAMP7/VAMP8 SNARE complex also functions in starvation-induced autophagy. SNAP47 is recruited to autophagosomes following concurrent detection of ATG8s and PI(4,5)P<sub>2</sub> via its Pleckstrin homology domain. By contrast, SNAP29-containing SNAREs are excluded from selective autophagy due to inactivation by O-GlcNAcylation under non-starvation conditions. These findings depict a previously unknown, default SNARE complex responsible for autophagosome-lysosome fusion in both selective and bulk autophagy, which could guide research and therapeutic development in autophagy-related diseases.

OLFM4
Also flagged:Tumorcolorectal cancerNotchcell adhesionstem cell growtholfactomedin 4
Journal Article 2024-01-05 ✓ 5 Snippets Sakahara M, Okamoto T, Srivastava U, Natsume Y, Yamanaka H, Suzuki Y, Obama K, Nagayama S, Yao R.
In-Text Gene Mentions

We found that these cells were rarely detected in established organoids but appeared in the early phases of organoid reconstruction from single OLFM4+ cells, raising the possibility that Paneth-like cells can be generated by cell fate conversion in response to alteration in tumor integrity.

This study sheds light on the significance of cell-cell interaction between OLFM4+ cancer stem cells and Paneth-like cells on tumor homeostasis.

These findings indicate that Paneth-like cells are directly produced by OLFM4+ stem cells and that their interaction contributes to tumor formation by providing niche factors.

However, human CRC is a heterogenic disease, and OLFM4+ cells do not function as cancer stem cells in a subset of CRC-derived organoids11.

…cells produced fromOLFM4+ stem cells…

Show Full Abstract

Tumor tissues consist of heterogeneous cells that originate from stem cells; however, their cell fate determination program remains incompletely understood. Using patient-derived organoids established from patients with advanced colorectal cancer (CRC), we evaluated the potential of olfactomedin 4 (OLFM4)<sup>+</sup> stem cells to produce a bifurcated lineage of progenies with absorptive and secretory properties. In the early phases of organoid reconstruction, OLFM4<sup>+</sup> cells preferentially gave rise to secretory cells. Additionally, we found that Paneth-like cells, which do not exist in the normal colon, were induced in response to Notch signaling inhibition. Video recordings of single OLFM4<sup>+</sup> cells revealed that organoids containing Paneth-like cells were effectively propagated and that their selective ablation led to organoid collapse. In tumor tissues, Paneth-like cells were identified only in the region where tumor cells lost cell adhesion. These findings indicate that Paneth-like cells are directly produced by OLFM4<sup>+</sup> stem cells and that their interaction contributes to tumor formation by providing niche factors. This study reveals the importance of the cell fate specification program for building a complete tumor cellular ecosystem, which might be targeted with novel therapeutics.

ZNFX1
Also flagged:ferroptosiscancertumorcardiovascular diseasecardiovascular diseasestumors
Journal Article 2024-01-05 ✓ 1 Snippet Hou K, Liu L, Fang ZH, Zong WX, Sun D, Guo Z, Cao L.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

With the rapid development of new generations of antitumor therapies, the average survival time of cancer patients is expected to be continuously prolonged. However, these therapies often lead to cardiotoxicity, resulting in a growing number of tumor survivors with cardiovascular disease. Therefore, a new interdisciplinary subspecialty called "cardio-oncology" has emerged, aiming to detect and treat cardiovascular diseases associated with tumors and antitumor therapies. Recent studies have highlighted the role of ferroptosis in both cardiovascular and neoplastic diseases. The balance between intracellular oxidative stress and antioxidant defense is crucial in regulating ferroptosis. Tumor cells can evade ferroptosis by upregulating multiple antioxidant defense pathways, while many antitumor therapies rely on downregulating antioxidant defense and promoting ferroptosis in cancer cells. Unfortunately, these ferroptosis-inducing antitumor therapies often lack tissue specificity and can also cause injury to the heart, resulting in ferroptosis-induced cardiotoxicity. A range of cardioprotective agents exert cardioprotective effects by inhibiting ferroptosis. However, these cardioprotective agents might diminish the efficacy of antitumor treatment due to their antiferroptotic effects. Most current research on ferroptosis only focuses on either tumor treatment or heart protection but rarely considers both in concert. Therefore, further research is needed to study how to protect the heart during antitumor therapies by regulating ferroptosis. In this review, we summarized the role of ferroptosis in the treatment of neoplastic diseases and cardiovascular diseases and also attempted to propose further research directions for ferroptosis in the field of cardio-oncology.

Also flagged:infectiongBhematoxylinvirus infectionorganelleorganization
Journal Article 2024-01-05 No Snippets Wang C, Liu Y, Yang Y, Teng M, Wan X, Wu Z, Zhang Z.
Show Full Abstract

Marek's disease virus (MDV) strain GX0101 was the first reported field strain of recombinant gallid herpesvirus type 2 (GaHV-2). However, the splenic proteome of MDV-infected chickens remains unclear. In this study, a total of 28 1-day-old SPF chickens were intraperitoneally injected with chicken embryo fibroblast (CEF) containing 2000 PFU GX0101. Additionally, a control group, consisting of four one-day-old SPF chickens, received intraperitoneal equal doses of CEF. Blood and various tissue samples were collected at different intervals (7, 14, 21, 30, 45, 60, and 90 days post-infection; dpi) for histopathological, real-time PCR, and label-free quantitative analyses. The results showed that the serum expressions of MDV-related genes, meq and gB, peaked at 45 dpi. The heart, liver, and spleen were dissected at 30 and 45 dpi, and their hematoxylin-eosin staining indicated that virus infection compromised the normal organizational structure at 45 dpi. Particularly, the spleen structure was severely damaged, and the lymphocytes in the white medulla were significantly reduced. Furthermore, liquid chromatography-mass spectrometry (LC-MS) and label-free techniques were used to analyze the difference in splenic proteome profiles of the experimental and control groups at 30 and 45 dpi. Proteomic analysis identified 1660 and 1244 differentially expressed proteins (DEPs) at 30 and 40 dpi, respectively, compared with the uninfected spleen tissues. According to GO analysis, these DEPs were involved in processes such as organelle organization, cellular component biogenesis, cellular component assembly, anion binding, small molecule binding, metal ion binding, cation binding, cytosol, nuclear part, etc. Additionally, KEGG analysis indicated that the following pathways were linked to MDV-induced inflammation, apoptosis, and tumor: Wnt, Hippo, AMPK, cAMP, Notch, TGF-β, PI3K-Akt, Rap1, Ras, Calcium, NF-κB, PPAR, cGMP-PKG, Apoptosis, VEGF, mTOR, FoxO, TNF, JAK-STAT, MAPK, Prion disease, T cell receptor, and B cell receptor. We finally screened 674 DEPs that were linked to MDV infection in spleen tissue. This study improves our understanding of the MDV response mechanism in the spleen.

Also flagged:gliomaskinasechromatinhigh-grade gliomashistone deacetylaseHDAC
Journal Article 2024-01-05 No Snippets Stitzlein LM, Adams JT, Stitzlein EN, Dudley RW, Chandra J.
Show Full Abstract

Targeted therapies, including small molecule inhibitors directed against aberrant kinase signaling and chromatin regulators, are emerging treatment options for high-grade gliomas (HGG). However, when translating these inhibitors into the clinic, their efficacy is generally limited to partial and transient responses. Recent studies in models of high-grade gliomas reveal a convergence of epigenetic regulators and kinase signaling networks that often cooperate to promote malignant properties and drug resistance. This review examines the interplay between five well-characterized groups of chromatin regulators, including the histone deacetylase (HDAC) family, bromodomain and extraterminal (BET)-containing proteins, protein arginine methyltransferase (PRMT) family, Enhancer of zeste homolog 2 (EZH2), and lysine-specific demethylase 1 (LSD1), and various signaling pathways essential for cancer cell growth and progression. These specific epigenetic regulators were chosen for review due to their targetability via pharmacological intervention and clinical relevance. Several studies have demonstrated improved efficacy from the dual inhibition of the epigenetic regulators and signaling kinases. Overall, the interactions between epigenetic regulators and kinase signaling pathways are likely influenced by several factors, including individual glioma subtypes, preexisting mutations, and overlapping/interdependent functions of the chromatin regulators. The insights gained by understanding how the genome and epigenome cooperate in high-grade gliomas will guide the design of future therapeutic strategies that utilize dual inhibition with improved efficacy and overall survival.

Also flagged:vitronectinhydroxyapatitecalciumwaterorganizationHAP
Journal Article 2024-01-05 No Snippets Gopinath T, Shin K, Tian Y, Im W, Struppe J, Perrone B, Hassan A, Marassi FM.
Show Full Abstract

The low sensitivity of nuclear magnetic resonance (NMR) is a major bottleneck for studying biomolecular structures of complex biomolecular assemblies. Cryogenically cooled probe technology overcomes the sensitivity limitations enabling NMR applications to challenging biomolecular systems. Here we describe solid-state NMR studies of the human blood protein vitronectin (Vn) bound to hydroxyapatite (HAP), the mineralized form of calcium phosphate, using a CryoProbe designed for magic angle spinning (MAS) experiments. Vn is a major blood protein that regulates many different physiological and pathological processes. The high sensitivity of the CryoProbe enabled us to acquire three-dimensional solid-state NMR spectra for sequential assignment and characterization of site-specific water-protein interactions that provide initial insights into the organization of the Vn-HAP complex. Vn associates with HAP in various pathological settings, including macular degeneration eyes and Alzheimer's disease brains. The ability to probe these assemblies at atomic detail paves the way for understanding their formation.

Also flagged:chitosanchitincellulosealbuminnanohydroxyapatitecollagen
Journal Article 2024-01-05 No Snippets Saurav S, Sharma P, Kumar A, Tabassum Z, Girdhar M, Mamidi N, Mohan A.
Show Full Abstract

Numerous surgeries are carried out to replace tissues that have been harmed by an illness or an accident. Due to various surgical interventions and the requirement of bone substitutes, the emerging field of bone tissue engineering attempts to repair damaged tissues with the help of scaffolds. These scaffolds act as template for bone regeneration by controlling the development of new cells. For the creation of functional tissues and organs, there are three elements of bone tissue engineering that play very crucial role: cells, signals and scaffolds. For the achievement of these aims, various types of natural polymers, like chitosan, chitin, cellulose, albumin and silk fibroin, have been used for the preparation of scaffolds. Scaffolds produced from natural polymers have many advantages: they are less immunogenic as well as being biodegradable, biocompatible, non-toxic and cost effective. The hierarchal structure of bone, from microscale to nanoscale, is mostly made up of organic and inorganic components like nanohydroxyapatite and collagen components. This review paper summarizes the knowledge and updates the information about the use of natural polymers for the preparation of scaffolds, with their application in recent research trends and development in the area of bone tissue engineering (BTE). The article extensively explores the related research to analyze the advancement of nanotechnology for the treatment of bone-related diseases and bone repair.

HTT
Also flagged:neurodegenerative diseasesapelinkynurenic acidlactatepathogenesisaging
Journal Article 2024-01-05 ✓ 1 Snippet Bian X, Wang Q, Wang Y, Lou S.
In-Text Gene Mentions

Huntington’s disease is caused by an unstable expansion of glutamine encoded by the genetic codon CAG within exon 1 of the HTT gene, which encodes the huntingtin protein (Author, 1993).

Show Full Abstract

The initiation and progression of neurodegenerative diseases (NDs), distinguished by compromised nervous system integrity, profoundly disrupt the quality of life of patients, concurrently exerting a considerable strain on both the economy and the social healthcare infrastructure. Exercise has demonstrated its potential as both an effective preventive intervention and a rehabilitation approach among the emerging therapeutics targeting NDs. As the largest secretory organ, skeletal muscle possesses the capacity to secrete myokines, and these myokines can partially improve the prognosis of NDs by mediating the muscle-brain axis. Besides the well-studied exerkines, which are secreted by skeletal muscle during exercise that pivotally exert their beneficial function, the physiological function of novel exerkines, e.g., apelin, kynurenic acid (KYNA), and lactate have been underappreciated previously. Herein, this review discusses the roles of these novel exerkines and their mechanisms in regulating the progression and improvement of NDs, especially the significance of their functions in improving NDs' prognoses through exercise. Furthermore, several myokines with potential implications in ameliorating ND progression are proposed as the future direction for investigation. Elucidation of the function of exerkines secreted by skeletal muscle in the regulation of NDs advances the understanding of its pathogenesis and facilitates the development of therapeutics that intervene in these processes to cure NDs.

PRDX6
Also flagged:CarnosolcancerP5CStumorDelta-1-pyrroline-5-carboxylate synthaseamino acid
Journal Article 2024-01-05 ✓ 5 Snippets Fang QY, Wang YP, Zhang RQ, Fan M, Feng LX, Guo XD, Cheng CR, Zhang XW, Liu X.
In-Text Gene Mentions

As shown in Figure 6, in the network, Aldh18a1 (P5CS, the protein marked in red and with a red asterisk) exhibited interaction mainly with three subsets of proteins including proteins related to glutathione metabolism and antioxidant system (proteins marked in light yellow) such as Gclm, Slc7a11, Prdx6 and Gsta5, and proteins related to heat shock response (proteins marked in blue) such as Hsp90aa1 and Hspb1.

The individual histogram (Figure 3B) of the expression of proteins related to the glutathione metabolism and antioxidant system showed that proteins such as Glutathione S-transferases (Gsta5, Gsta1, Gsta4) and Peroxiredoxins (Prdx6, Prdx1) were upregulated in C26+CS group compared with the control group.

…such as Peroxiredoxins (Prdx6) and Glutathione-S transferas…

…Gsta4) and Peroxiredoxins (Prdx6, Prdx1) were upregulated…

…as Gclm, Slc7a11,Prdx6and Gsta5, and…

Show Full Abstract

<b>Introduction:</b> Carnosol exhibited ameliorating effects on muscle atrophy of mice developed cancer cachexia in our previous research. <b>Method:</b> Here, the ameliorating effects of carnosol on the C2C12 myotube atrophy result from simulated cancer cachexia injury, the conditioned medium of the C26 tumor cells or the LLC tumor cells, were observed. To clarify the mechanisms of carnosol, the possible direct target proteins of carnosol were searched using DARTS (drug affinity responsive target stability) assay and then confirmed using CETSA (cellular thermal shift assay). Furthermore, proteomic analysis was used to search its possible indirect target proteins by comparing the protein expression profiles of C2C12 myotubes under treatment of C26 medium, with or without the presence of carnosol. The signal network between the direct and indirect target proteins of carnosol was then constructed. <b>Results:</b> Our results showed that, Delta-1-pyrroline-5-carboxylate synthase (P5CS) might be the direct target protein of carnosol in myotubes. The influence of carnosol on amino acid metabolism downstream of P5CS was confirmed. Carnosol could upregulate the expression of proteins related to glutathione metabolism, anti-oxidant system, and heat shock response. Knockdown of P5CS could also ameliorate myotube atrophy and further enhance the ameliorating effects of carnosol. <b>Discussion:</b> These results suggested that carnosol might ameliorate cancer cachexia-associated myotube atrophy by targeting P5CS and its downstream pathways.

HTT
Also flagged:depressionpathogenesismethylationhistonemental disorderssleep
Journal Article 2024-01-05 ✓ 1 Snippet Yuan D, Meng Y, Ai Z, Zhou S.
In-Text Gene Mentions

…protein (SLC6A4 or5-HTT), and catechol-O-methyltransf…

Show Full Abstract

<h4>Objective</h4>With its high prevalence, depression's pathogenesis remains unclear. Recent attention has turned to the interplay between depression and epigenetic modifications. However, quantitative bibliometric analyses are lacking. This study aims to visually analyze depression epigenetics trends, utilizing bibliometric tools, while comprehensively reviewing its epigenetic mechanisms.<h4>Methods</h4>Utilizing the Web of Science core dataset, we collected depression and epigenetics-related studies. Employing VOSViewer software, we visualized data on authors, countries, journals, and keywords. A ranking table highlighted field leaders.<h4>Results</h4>Analysis encompassed 3,469 depression epigenetics studies published from January 2002 to June 2023. Key findings include: (1) Gradual publication growth, peaking in 2021; (2) The United States and its research institutions leading contributions; (3) Need for enhanced collaborations, spanning international and interdisciplinary efforts; (4) Keyword clustering revealed five main themes-early-life stress, microRNA, genetics, DNA methylation, and histone acetylation-highlighting research hotspots; (5) Limited focus on adolescent depression epigenetics, warranting increased attention.<h4>Conclusion</h4>Taken together, this study revealed trends and hotspots in depression epigenetics research, underscoring global collaboration, interdisciplinary fusion, and multi-omics data's importance. It discussed in detail the potential of epigenetic mechanisms in depression diagnosis and treatment, advocating increased focus on adolescent research in this field. Insights aid researchers in shaping their investigative paths toward understanding depression's epigenetic mechanisms and antidepressant interventions.

HTT
Also flagged:ADIL1BIL10CX3CR1IL6PTGS1
Journal Article 2024-01-05 ✓ 3 Snippets Wang T, Zhang X, Liu W, Ning F, Hu X, Qin L, Cui M, Yang J, Lv S, Wang Q.
In-Text Gene Mentions

…7 genes (CD36,HTT, RENBP, IL10, CX3CR1,…

…Seven genes (CD36,HTT, RENBP, IL10, CX3CR1,…

…Five genes (HTT, IL10, CX3CR1, IL1B,…

Show Full Abstract

<h4>Background</h4>Single-cell RNA sequencing (scRNA-Seq) provides new perspectives and ideas to investigate the interactions between different cell types and organisms. By integrating scRNA-seq with new computational frameworks or specific technologies, better Alzheimer's disease (AD) treatments may be developed.<h4>Methods</h4>The single-cell sequencing dataset GSE158234 was obtained from the GEO database. Preprocessing, quality control, dimensionality-reducing clustering, and annotation to identify cell types were performed on it. RNA-seq profiling dataset GSE238013 was used to determine the components of specific cell subpopulations in diverse samples. A set of genes included in the OMIM, Genecards, CTD, and DisGeNET databases were selected as highly plausible AD-related genes. Then, ROC curves were created to predict the diagnostic value using the significantly expressed genes in the KO group as hub genes. The genes mentioned above were mapped to the Coremine Medical database to forecast prospective therapeutic Chinese medicines, and a "Chinese medicine-ingredient-target" network was constructed to screen for potential therapeutic targets. The last step was to undertake Mendelian randomization research to determine the causal link between the critical gene IL1B and AD in the genome-wide association study.<h4>Results</h4>Using the scRNA-seq dataset, five unique cell clusters were discovered. These clusters were further subdivided into four distinct cell types using marker genes. The KO group showed a more substantial differential subgroup of macrophages than the WT group. By using the available datasets and PPI network analysis, 54 common genes were discovered. Four clusters were identified using the MCODE approach, and correlation analysis showed that seven genes in those four clusters had a significantly negative correlation with macrophages. Six genes in four sets had a significantly positive correlation. Five genes had different levels of expression in the WT and KO groups. The String database was used to identify the regulatory relationships between the four genes (IL10, CX3CR1, IL1B, and IL6) that were finally selected as AD hub genes. Screening identified potential traditional Chinese medicine to intervene in the transformation process of AD, including Radix Salviae, ginseng, Ganoderma, licorice, Coptidis Rhizoma, and Scutellariae Radix, in addition to promising therapeutic targets, such as PTGS1, PTGS2, and RXRA. Finally, it was shown that IL1B directly correlated with immune cell infiltration in AD. In inverse variance weighting, we found that IL1B was associated with a higher risk of AD, with an OR of 1.003 (95% CI = 1.001-1.006, <i>p</i> = 0.038).<h4>Conclusion</h4>Our research combined network pharmacology and the scRNA-seq computational framework to uncover pertinent hub genes and prospective traditional Chinese medicine potential therapeutic targets for AD. These discoveries may aid in understanding the molecular processes behind AD genes and the development of novel medications to treat the condition.

OLFM4
Also flagged:Notchpathogenesisulcerative colitisdigestive disorderbarrierdisease
Journal Article 2024-01-05 ✓ 2 Snippets Ning H, Liu J, Tan J, Yi M, Lin X.
In-Text Gene Mentions

Olfm4 expression is significantly increased in inflamed tissues of patients with UC, extending to the surface of epithelial cells and crypts; however, under normal conditions, Olfm4 expression is limited to the lower one-third of the crypts in normal tissues (29).

TNF-α is one of the most important pro-inflammatory cytokines promoting IBD, further highlighting the role of Olfm4 in intestinal inflammation (Figure 3).

Show Full Abstract

Ulcerative colitis is a common digestive disorder worldwide, with increasing incidence in recent years. It is an urgent problem to be solved, as it seriously affects and threatens the health and life of the global population. Studies have shown that dysfunction of the intestinal mucosal barrier is a critical pathogenic factor and molecular basis of ulcerative colitis, and some scholars have described it as a "barrier organ disease." While the Notch signalling pathway affects a series of cellular processes, including proliferation, differentiation, development, migration, and apoptosis. Therefore, it can regulate intestinal stem cells, CD4<sup>+</sup> T cells, innate lymphoid cells, macrophages, and intestinal microbiota and intervene in the chemical, physical, immune, and biological mucosal barriers in cases of ulcerative colitis. The Notch signalling pathway associated with the pathogenesis of ulcerative colitis has distinct characteristics, with good regulatory effects on the mucosal barrier. However, research on ulcerative colitis has mainly focused on immune regulation, anti-inflammatory activity, and antioxidant stress; therefore, the study of the Notch signalling pathway suggests the possibility of understanding the pathogenesis of ulcerative colitis from another perspective. In this article we explore the role and mechanism of the Notch signalling pathway in the pathogenesis of ulcerative colitis from the perspective of the intestinal mucosal barrier to provide new targets and theoretical support for further research on the pathogenesis and clinical treatment of ulcerative colitis.

Also flagged:infectious diseaseschronic diseasesthalassemiaanemiaorganizationCOVID-19
Journal Article 2024-01-05 No Snippets Jiang JH, Ren RT, Cheng YJ, Li XX, Zhang GR.
Show Full Abstract

Blood has an important role in the healthcare system, particularly in blood transfusions and immunotherapy. However, the occurrence of outbreaks of infectious diseases worldwide and seasonal fluctuations, blood shortages are becoming a major challenge. Moreover, the narrow specificity of immune cells hinders the widespread application of immune cell therapy. To address this issue, researchers are actively developing strategies for differentiating induced pluripotent stem cells (iPSCs) into blood cells <i>in vitro</i>. The establishment of iPSCs from terminally differentiated cells such as fibroblasts and blood cells is a straightforward process. However, there is need for further refinement of the protocols for differentiating iPSCs into immune cells and red blood cells to ensure their clinical applicability. This review aims to provide a comprehensive overview of the strategies and challenges facing the generation of iPSC-derived immune cells and red blood cells.

PEBP1
Also flagged:Deathcell divisionProgrammed Cell DeathcaspaseEmperitosisWallerian Degeneration
Journal Article 2024-01-05 ✓ 1 Snippet Fernández-Lázaro D, Sanz B, Seco-Calvo J.
In-Text Gene Mentions

…ethanolamine-binding protein (PEBP1) was identified as…

Show Full Abstract

Billions of cells die in us every hour, and our tissues do not shrink because there is a natural regulation where Cell Death (CD) is balanced with cell division. The process in which cells eliminate themselves in a controlled manner is called Programmed Cell Death (PCD). The PCD plays an important role during embryonic development, in maintaining homeostasis of the body's tissues, and in the elimination of damaged cells, under a wide range of physiological and developmental stimuli. A multitude of protein mediators of PCD have been identified and signals have been found to utilize common pathways elucidating the proteins involved. This narrative review focuses on caspase-dependent and caspase-independent PCD pathways. Included are studies of caspase-dependent PCD such as Anoikis, Catastrophe Mitotic, Pyroptosis, Emperitosis, Parthanatos and Cornification, and Caspase-Independent PCD as Wallerian Degeneration, Ferroptosis, Paraptosis, Entosis, Methuosis, and Extracellular Trap Abnormal Condition (ETosis), as well as neutrophil extracellular trap abnormal condition (NETosis) and Eosinophil Extracellular Trap Abnormal Condition (EETosis). Understanding PCD from those reported in this review could shed substantial light on the processes of biological homeostasis. In addition, identifying specific proteins involved in these processes is mandatory to identify molecular biomarkers, as well as therapeutic targets. This knowledge could provide the ability to modulate the PCD response and could lead to new therapeutic interventions in a wide range of diseases.

Also flagged:translationalmonogeneticmultifactorial diseasesnonalcoholic steatohepatitisNASHreverse translation
Journal Article 2024-01-05 No Snippets Gabriel V, Zdyrski C, Sahoo DK, Ralston A, Wickham H, Bourgois-Mochel A, Ahmed B, Merodio MM, Paukner K, Piñeyro P, Kopper J, Rowe EW, Smith JD, Meyerholz D, Kol A, Viall A, Elbadawy M, Mochel JP, Allenspach K.
Show Full Abstract

Preclinical biomedical research is limited by the predictiveness of in vivo and in vitro models. While in vivo models offer the most complex system for experimentation, they are also limited by ethical, financial, and experimental constraints. In vitro models are simplified models that do not offer the same complexity as living animals but do offer financial affordability and more experimental freedom; therefore, they are commonly used. Traditional 2D cell lines cannot fully simulate the complexity of the epithelium of healthy organs and limit scientific progress. The One Health Initiative was established to consolidate human, animal, and environmental health while also tackling complex and multifactorial medical problems. Reverse translational research allows for the sharing of knowledge between clinical research in veterinary and human medicine. Recently, organoid technology has been developed to mimic the original organ's epithelial microstructure and function more reliably. While human and murine organoids are available, numerous other organoids have been derived from traditional veterinary animals and exotic species in the last decade. With these additional organoid models, species previously excluded from in vitro research are becoming accessible, therefore unlocking potential translational and reverse translational applications of animals with unique adaptations that overcome common problems in veterinary and human medicine.

PEBP1
Also flagged:Y-Box Binding ProteinCancerY-box binding protein 1YBX1Cold Shock Domain proteincancers
Journal Article 2024-01-05 ✓ 1 Snippet Dinh NTM, Nguyen TM, Park MK, Lee CH.
In-Text Gene Mentions

Additionally, YBX1 reads m5C PEBP1 (Phosphatidylethanolamine Binding Protein 1) mRNA in clear cell renal cell carcinoma [161] and 5mC keratin 13 mRNA in gynecologic cancers [162], preventing their decay, which contributes to tumor progression.

Show Full Abstract

Y-box binding protein 1 (YBX1), a member of the Cold Shock Domain protein family, is overexpressed in various human cancers and is recognized as an oncogenic gene associated with poor prognosis. YBX1's functional diversity arises from its capacity to interact with a broad range of DNA and RNA molecules, implicating its involvement in diverse cellular processes. Independent investigations have unveiled specific facets of YBX1's contribution to cancer development. This comprehensive review elucidates YBX1's multifaceted role in cancer across cancer hallmarks, both in cancer cell itself and the tumor microenvironment. Based on this, we proposed YBX1 as a potential target for cancer treatment. Notably, ongoing clinical trials addressing YBX1 as a target in breast cancer and lung cancer have showcased its promise for cancer therapy. The ramp up in in vitro research on targeting YBX1 compounds also underscores its growing appeal. Moreover, the emerging role of YBX1 as a neural input is also proposed where the high level of YBX1 was strongly associated with nerve cancer and neurodegenerative diseases. This review also summarized the up-to-date advanced research on the involvement of YBX1 in pancreatic cancer.

Also flagged:Calcium Phosphatehydroxyapatitecalciumchitosancalcium phosphatespore
Journal Article 2024-01-05 No Snippets Wu MY, Huang SW, Kao IF, Yen SK.
Show Full Abstract

In this study, we successfully prepared porous composite microspheres composed of hydroxyapatite (HAp), di-calcium phosphate di-hydrated (DCPD), and chitosan through the hydrothermal method. The chitosan played a crucial role as a chelating agent to facilitate the growth of related calcium phosphates. The synthesized porous composite microspheres exhibit a specific surface area of 38.16 m<sup>2</sup>/g and a pore volume of 0.24 cm<sup>3</sup>/g, with the pore size ranging from 4 to 100 nm. Given the unique properties of chitosan and the exceptional porosity of these composite microspheres, they may serve as carriers for pharmaceuticals. After being annealed, the chitosan transforms into a condensed form and the DCPD transforms into Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> at 300 °C. Then, the Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> initially combines with HAp to transform into β tricalcium phosphate (β-TCP) at 500 °C where the chitosan is also completely combusted. Finally, the microspheres are composed of Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub>, β-TCP, and HAp, also making them suitable for applications such as injectable bone graft materials.

Also flagged:cariescyststumorssystemic diseasespericoronitiscystic lesions
Journal Article 2024-01-05 No Snippets Yacoub S, Dammak N, Zaalouni S, Hrizi MA, Ben Khelifa M.
Show Full Abstract

<h4>Introduction</h4>Third molars are the most commonly concerned teeth with the impaction. Impacted third molar (ITM) can be associated to various clinical pathologies Aim: To determine the prevalence of ITM, its pattern and associated affections in Tunisian patients.<h4>Methods</h4>The study reviewed panoramic radiographs of patients consulting the Fattouma Bourguiba University Hospital, Monastir (Tunisia). Orthopantomograms were analyzed to define the prevalence of ITM; its angulation, depth and relation with the anterior border of mandibular ramus. Associated pathologies were also assessed.<h4>Results</h4>Seven hundred and thirty patients were included (286 men and 444 women). The age ranged from 19 to 89 years. Half of the patients (50.3%) showed at least one ITM. The total number of ITM was 881 with a statistical difference between arches (respectively 34.3% and 65.7% in the maxilla and in the mandible). The most common number of ITM was two (35.4%). Level C of impaction was observed more frequently in the maxilla and level A in the mandible. The most common angulation was the vertical one for both arches. Seventy six percent of ITM were presented with class II in relation with the anterior border of mandibular ramus. There was no significant difference in the frequency of impaction between gender and sides. The number of ITM associated with pathological conditions was 199 (22.6%). The most frequently observed pathology was the distal caries on the second molars (11.7%) followed by the caries of the third molars (5.2%).<h4>Conclusion</h4>The prevalence of ITM among Tunisian patients was high.

Book of Posters

Also flagged:traumatic brain injuryMild traumatic brain injuryanxietysleepinnervationnucleus
Journal Article 2024-01-05 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

TRIM38
Also flagged:TRIM28nucleocapsid proteinhost cellspost-translational modificationsSARS2NP
Journal Article 2024-01-04 ✓ 1 Snippet Ren J, Wang S, Zong Z, Pan T, Liu S, Mao W, Huang H, Yan X, Yang B, He X, Zhou F, Zhang L.
In-Text Gene Mentions

…TRIM27, TRIM28, TRIM32,TRIM38, TRIM39, ZBED1, and…

Show Full Abstract

Viruses, as opportunistic intracellular parasites, hijack the cellular machinery of host cells to support their survival and propagation. Numerous viral proteins are subjected to host-mediated post-translational modifications. Here, we demonstrate that the SARS-CoV-2 nucleocapsid protein (SARS2-NP) is SUMOylated on the lysine 65 residue, which efficiently mediates SARS2-NP's ability in homo-oligomerization, RNA association, liquid-liquid phase separation (LLPS). Thereby the innate antiviral immune response is suppressed robustly. These roles can be achieved through intermolecular association between SUMO conjugation and a newly identified SUMO-interacting motif in SARS2-NP. Importantly, the widespread SARS2-NP R203K mutation gains a novel site of SUMOylation which further increases SARS2-NP's LLPS and immunosuppression. Notably, the SUMO E3 ligase TRIM28 is responsible for catalyzing SARS2-NP SUMOylation. An interfering peptide targeting the TRIM28 and SARS2-NP interaction was screened out to block SARS2-NP SUMOylation and LLPS, and consequently inhibit SARS-CoV-2 replication and rescue innate antiviral immunity. Collectively, these data support SARS2-NP SUMOylation is critical for SARS-CoV-2 virulence, and therefore provide a strategy to antagonize SARS-CoV-2.

Also flagged:limb ischemiaPeripheral Artery DiseasePADatherosclerotic diseaseatherosclerotic occlusive diseasediabetes
Journal Article 2024-01-04 No Snippets Huang NF, Stern B, Oropeza BP, Zaitseva TS, Paukshto MV, Zoldan J.
Show Full Abstract

Peripheral artery disease is an atherosclerotic disease associated with limb ischemia that necessitates limb amputation in severe cases. Cell therapies comprised of adult mononuclear or stromal cells have been clinically tested and show moderate benefits. Bioengineering strategies can be applied to modify cell behavior and function in a controllable fashion. Using mechanically tunable or spatially controllable biomaterials, we highlight examples in which biomaterials can increase the survival and function of the transplanted cells to improve their revascularization efficacy in preclinical models. Biomaterials can be used in conjunction with soluble factors or genetic approaches to further modulate the behavior of transplanted cells and the locally implanted tissue environment in vivo. We critically assess the advances in bioengineering strategies such as 3-dimensional bioprinting and immunomodulatory biomaterials that can be applied to the treatment of peripheral artery disease and then discuss the current challenges and future directions in the implementation of bioengineering strategies.

DCC
Also flagged:ejaculationIGFALSestruslactationpubertyInsulin like peptide 3
Journal Article 2024-01-04 ✓ 1 Snippet Ma Z, Wang W, Zhang D, Wang X, Li S, Zhao L, Zhang Y, Zhao Y, Li X, Lin C, Wang J, Cheng J, Xu D, Yang X, Huang Y, Cui P, Liu J, Zeng X, Zhai R, Huang Z, Weng X, Zhang X.
In-Text Gene Mentions

…factors, in whichinsulin growth factors Igrowth factors I…

Show Full Abstract

Scrotal circumference is an important reproductive index of breeding rams, which has a high genetic correlation with ejaculation volume and semen quality. In this study, the scrotal circumference of 1353 male Hu sheep at different stages of development was measured and descriptive statistical analysis was performed. The results showed that the coefficient of variation of scrotal circumference at each stage was greater than 10%, and its heritability were moderately to high, ranging from 0.318 to 0.719. We used PCR amplification and Sanger sequencing to scan the polymorphisms of the <i>IGFALS</i> gene, and performed association analysis with the circumference of the scrotum at different stages. We identified a synonymous mutation g.918 G > C in exon 1 of the <i>IGFALS</i> gene, and this mutation was significantly associated with scrotal circumference at 100, 120, 140, 160 and 180 days (<i>p</i> < 0.05). Therefore, <i>IGFALS</i> gene polymorphism can be used as a molecular marker affecting scrotal circumference of Hu sheep, which can provide a reference for future molecular marker-assisted selection of scrotal circumference in sheep.

Also flagged:Ovarian CancerCA125serous ovarian cancerdeathgynecologic malignanciesHigh grade serous carcinoma
Journal Article 2024-01-04 No Snippets Greenwood A, Woodruff ER, Nguyen C, Piper C, Clauset A, Brubaker LW, Behbakht K, Bitler BG.
Show Full Abstract

<h4>Objective</h4>To determine biomarkers other than CA 125 that could be used in identifying early-stage ovarian cancer.<h4>Data sources</h4>Ovid MEDLINE ALL, EMBASE, Web of Science Core Collection, ScienceDirect, Clinicaltrials.gov , and CAB Direct were searched for English-language studies between January 2008 and April 2023 for the concepts of high-grade serous ovarian cancer, testing, and prevention or early diagnosis.<h4>Methods of study selection</h4>The 5,523 related articles were uploaded to Covidence. Screening by two independent reviewers of the article abstracts led to the identification of 245 peer-reviewed primary research articles for full-text review. Full-text review by those reviewers led to the identification of 131 peer-reviewed primary research articles used for this review.<h4>Tabulation, integration, and results</h4>Of 131 studies, only 55 reported sensitivity, specificity, or area under the curve (AUC), with 36 of the studies reporting at least one biomarker with a specificity of 80% or greater specificity or 0.9 or greater AUC.<h4>Conclusion</h4>These findings suggest that although many types of biomarkers are being tested in ovarian cancer, most have similar or worse detection rates compared with CA 125 and have the same limitations of poor detection rates in early-stage disease. However, 27.5% of articles (36/131) reported biomarkers with better sensitivity and an AUC greater than 0.9 compared with CA 125 alone and deserve further exploration.

HFE
Also flagged:ironcoeliac diseaseiron deficiencyinfectionstransmembrane protease serine 6TMPRSS6
Journal Article 2024-01-04 ✓ 5 Snippets Hujoel IA, Hujoel MLA.
In-Text Gene Mentions

In more detail, if the mechanisms linking the variants to iron status were unclear, it would be possible these variants could influence risk of coeliac disease and cause a downstream effect on iron status, however most of our instruments affect genes known to influence iron status (HFE and TMPRSS6).

The increased risk for coeliac disease extends beyond 5 years after hemochromatosis diagnosis, when theoretically treatment has been started to decrease iron stores.17 Indeed, several studies have suggested that the association between the two conditions may be genetic in origin, and that HFE gene mutations (which are common in coeliac disease) may provide a survival advantage in coeliac disease by reducing iron deficiency (Supplementary Note).54 Notably, in hereditary hemochromatosis, the body does not appear to recognise true iron stores, and soluble transferrin receptor levels are elevated up to a transferrin saturation of 50% (whereas in controls they are elevated only to around 30%).55 This suggests increased transferrin receptor 1 levels even at higher iron levels in hereditary hemochromatosis and may suggest an additional explanation for the increased coeliac disease risk in the condition.

As previous studies have done, selected genetic instruments were associated with all four of these biomarkers in a manner consistent with an effect on systemic iron status.21 22 A recent meta-analysis of three genome-wide association studies (GWASs; from Iceland, the UK and Denmark) identified four such SNPs: rs1800562 and rs1799945 in the hemochromatosis (HFE) gene, rs855791 in the transmembrane protease serine 6 (TMPRSS6) gene and rs57659670 predicted to affect the Dual Oxidase 2 (DUOX2) gene; the three former instruments were found in a previous iron GWAS whereas the latter variant is novel to this recent meta-analysis.23 24 We used publicly available GWAS summary statistics from the aforementioned meta-analysis (see the Data availability section).

…in those withhemochromatosis.…

…rs1799945 in thehemochromatosis( HFE )…

Show Full Abstract

<h4>Objective</h4>The environmental trigger behind the increasing prevalence of coeliac disease is not known. One suggested cause is iron deficiency, which is common in coeliac disease. We aimed to evaluate this possible association with Mendelian randomisation (MR), which under certain assumptions can suggest a causal relationship.<h4>Design</h4>We conducted a two-sample MR study examining the relationship between single nucleotide polymorphisms (SNPs) associated with iron status and the presence of coeliac disease. The SNPs were drawn from a meta-analysis of three genome-wide association studies (GWAS). The association between these SNPs and coeliac disease was assessed using GWAS summary statistics from the UK Biobank. This consists of 336 638 white British individuals, 1855 with coeliac disease. We performed an MR Egger test for pleiotropy and assessed the plausibility of the assumptions of MR to evaluate for possible causality.<h4>Results</h4>There were four SNPs strongly associated with systemic iron status. These were not associated with known risk factors for coeliac disease. All four SNPs were available in the UK Biobank coeliac disease summary statistics. Harmonising exposure and outcome associations, we found that higher iron status was negatively associated with risk of coeliac disease (OR per 1 SD increase in serum iron: 0.65, 95% CI 0.47 to 0.91). Leave-one-out analyses had consistent results, and no single SNP drove the association. All three assumptions of MR appeared plausible.<h4>Conclusion</h4>We found that genetically lower iron levels were associated with an increased risk of coeliac disease. Our findings highlight a potential opportunity for coeliac disease prevention.

SOX6
Also flagged:canceradvanced cancerautoimmuneresponsesPD-1PD-L1
Journal Article 2024-01-04 ✓ 2 Snippets Meng L, Wu H, Wu J, Ding P, He J, Sang M, Liu L.
In-Text Gene Mentions

In glioma, circ-MAPK4 affects cell proliferation and apoptosis by functioning as a miR-125a-3p sponge to activate p38/MAPK signaling pathway [195]; circular RNA Pleiotrophin (circ_PTN) promotes proliferation and carcinogenesis through modulating miR-122/SOX6 axis to activate MAPK/ERK pathway [196]; circ-TLK1 facilitates cell proliferation and tumor growth by sponging miR-17-5p to target PANX1/MAPK/ERK axis [197].

…is through modulating miR-122/SOX6axis to activate…

Show Full Abstract

Current treatment strategies for cancer, especially advanced cancer, are limited and unsatisfactory. One of the most substantial advances in cancer therapy, in the last decades, was the discovery of a new layer of immunotherapy approach, immune checkpoint inhibitors (ICIs), which can specifically activate immune cells by targeting immune checkpoints. Immune checkpoints are a type of immunosuppressive molecules expressed on immune cells, which can regulate the degree of immune activation and avoid autoimmune responses. ICIs, such as anti-PD-1/PD-L1 drugs, has shown inspiring efficacy and broad applicability across various cancers. Unfortunately, not all cancer patients benefit remarkably from ICIs, and the overall response rates to ICIs remain relatively low for most cancer types. Moreover, the primary and acquired resistance to ICIs pose serious challenges to the clinical application of cancer immunotherapy. Thus, a deeper understanding of the molecular biological properties and regulatory mechanisms of immune checkpoints is urgently needed to improve clinical options for current therapies. Recently, circular RNAs (circRNAs) have attracted increasing attention, not only due to their involvement in various aspects of cancer hallmarks, but also for their impact on immune checkpoints in shaping the tumor immune microenvironment. In this review, we systematically summarize the current status of immune checkpoints in cancer and the existing regulatory roles of circRNAs on immune checkpoints. Meanwhile, we also aim to settle the issue in an evidence-oriented manner that circRNAs involved in cancer hallmarks regulate the effects and resistance of ICIs by targeting immune checkpoints.

Also flagged:cancerPD-1PD-L1CTLA4colorectal cancermismatch repair
Journal Article 2024-01-04 No Snippets Luo Z, Huang Y, Batra N, Chen Y, Huang H, Wang Y, Zhang Z, Li S, Chen CY, Wang Z, Sun J, Wang QJ, Yang D, Lu B, Conway JF, Li LY, Yu AM, Li S.
Show Full Abstract

The multifaceted chemo-immune resistance is the principal barrier to achieving cure in cancer patients. Identifying a target that is critically involved in chemo-immune-resistance represents an attractive strategy to improve cancer treatment. iRhom1 plays a role in cancer cell proliferation and its expression is negatively correlated with immune cell infiltration. Here we show that iRhom1 decreases chemotherapy sensitivity by regulating the MAPK14-HSP27 axis. In addition, iRhom1 inhibits the cytotoxic T-cell response by reducing the stability of ERAP1 protein and the ERAP1-mediated antigen processing and presentation. To facilitate the therapeutic translation of these findings, we develop a biodegradable nanocarrier that is effective in codelivery of iRhom pre-siRNA (pre-siiRhom) and chemotherapeutic drugs. This nanocarrier is effective in tumor targeting and penetration through both enhanced permeability and retention effect and CD44-mediated transcytosis in tumor endothelial cells as well as tumor cells. Inhibition of iRhom1 further facilitates tumor targeting and uptake through inhibition of CD44 cleavage. Co-delivery of pre-siiRhom and a chemotherapy agent leads to enhanced antitumor efficacy and activated tumor immune microenvironment in multiple cancer models in female mice. Targeting iRhom1 together with chemotherapy could represent a strategy to overcome chemo-immune resistance in cancer treatment.

TNFSF4
Also flagged:ZDHHC4cancersmalignant tumorslung adenocarcinomaLUADAPT2
Journal Article 2024-01-04 ✓ 1 Snippet Bian J, Xiong W, Yang Z, Li M, Song D, Zhang Y, Liu C.
In-Text Gene Mentions

…with BTNL2 andTNFSF4.…

Show Full Abstract

S-palmitoylases and S-depalmitoylases are differentially expressed in various cancers and several malignant tumors and show a strong prognostic ability. Notwithstanding, the potential clinical impact of S-palmitoylases and S-depalmitoylases, particularly in the prognosis and progression of lung adenocarcinoma (LUAD), has not been clarified. Expression levels of S-palmitoylases and S-depalmitoylases in LUAD were investigated using TCGA. GEPIA was used to evaluate the mRNA levels of S-palmitoylases and S-depalmitoylases at different pathological stages. Metascape was used to investigate the biological significance of S-palmitoylases and S-depalmitoylases. The Kaplan-Meier plotter was used to analyze the prognostic value of S-palmitoylases and S-depalmitoylases. CBioportal was used to analyze gene alterations in S-palmitoylases and S-depalmitoylases. UALCAN was used to examine DNA promoter methylation levels of S-palmitoylases and S-depalmitoylases. Finally, we investigated the relationship between S-palmitoylases, S-depalmitoylases, and tumor-infiltrating immune cells using TIMER. Correlations with immune checkpoint-related genes were determined using the R packages reshape2, ggpubr, ggplot2, and corrplot. PCR was also performed to assess the degree of ZDHHC4/12/18/24 and APT2 transcript expression in lung adenocarcinoma and adjacent normal lung tissues. HPA was utilized to investigate protein levels of S-palmitoylases and S-depalmitoylases in LUAD and normal lung tissue. Our study found that ZDHHC2/3/4/5/6/7/9/12/13/16/18/20/21/23/24, APT1/2, PPT1, LYPLAL1, ABHD4/10/11/12/13 and ABHD17C mRNA expression was significantly upregulated in LUAD, whereas ZDHHC1/8/11/11B/14/15/17/19/22, ABHD6/16A and ABHD17A mRNA expression was significantly downregulated. The functions of the differentially expressed S-palmitoylases and S-depalmitoylases were mainly associated with protein-cysteine S-palmitoyltransferase and protein-cysteine S-acyltransferase activities. Patients with high expression of ZDHHC4/12/18/24, APT2, ABHD4, ABHD11 and ABHD12 had a shorter overall survival. Infiltration of six immune cells (B cells, CD8<sup>+</sup> T cells, CD4<sup>+</sup> T cells, macrophages, neutrophils, and dendritic cells) was closely associated with the expression of ZDHHC4/12/18/24 and APT2. ZDHHC4/12/18/24 and APT2 positively correlated with the immune checkpoint-related gene CD276. We assessed the mRNA levels of ZDHHC4/12/18/24 and APT2 using qRT-PCR and found increased expression of ZDHHC4/12/18/24 in LUAD compared with healty control lung tissues. ZDHHC4/12/18/24, and APT2 are potential prognostic biomarkers of LUAD. Their expression levels could be related to the tumor microenvironment in LUAD.

NEGR1
Also flagged:MDMDD2depressionAgingchromosomeCKB
Journal Article 2024-01-04 ✓ 4 Snippets Meng X, Navoly G, Giannakopoulou O, Levey DF, Koller D, Pathak GA, Koen N, Lin K, Adams MJ, Rentería ME, Feng Y, Gaziano JM, Stein DJ, Zar HJ, Campbell ML, van Heel DA, Trivedi B, Finer S, McQuillin A, Bass N, Chundru VK, Martin HC, Huang QQ, Valkovskaya M, Chu CY, Kanjira S, Kuo PH, Chen HC, Tsai SJ, Liu YL, Kendler KS, Peterson RE, Cai N, Fang Y, Sen S, Scott LJ, Burmeister M, Loos RJF, Preuss MH, Actkins KV, Davis LK, Uddin M, Wani AH, Wildman DE, Aiello AE, Ursano RJ, Kessler RC, Kanai M, Okada Y, Sakaue S, Rabinowitz JA, Maher BS, Uhl G, Eaton W, Cruz-Fuentes CS, Martinez-Levy GA, Campos AI, Millwood IY, Chen Z, Li L, Wassertheil-Smoller S, Jiang Y, Tian C, Martin NG, Mitchell BL, Byrne EM, Awasthi S, Coleman JRI, Ripke S, PGC-MDD Working Group, China Kadoorie Biobank Collaborative Group, 23andMe Research Team, Genes and Health Research Team, BioBank Japan Project, Sofer T, Walters RG, McIntosh AM, Polimanti R, Dunn EC, Stein MB, Gelernter J, Lewis CM, Kuchenbaecker K.
In-Text Gene Mentions

…−26 ) andNEGR1(GTEx brain caudate…

…relevance in MD:NEGR1, DRD2 ,…

…TWAS features, includingNEGR1, ESR2 and…

…, 33 :NEGR1, DRD2 ,…

Show Full Abstract

Most genome-wide association studies (GWAS) of major depression (MD) have been conducted in samples of European ancestry. Here we report a multi-ancestry GWAS of MD, adding data from 21 cohorts with 88,316 MD cases and 902,757 controls to previously reported data. This analysis used a range of measures to define MD and included samples of African (36% of effective sample size), East Asian (26%) and South Asian (6%) ancestry and Hispanic/Latin American participants (32%). The multi-ancestry GWAS identified 53 significantly associated novel loci. For loci from GWAS in European ancestry samples, fewer than expected were transferable to other ancestry groups. Fine mapping benefited from additional sample diversity. A transcriptome-wide association study identified 205 significantly associated novel genes. These findings suggest that, for MD, increasing ancestral and global diversity in genetic studies may be particularly important to ensure discovery of core genes and inform about transferability of findings.

Also flagged:deathalcoholdrug dependencealcohol use disordersuse disorderdepression
Journal Article 2024-01-04 No Snippets Peng Q, Gilder DA, Bernert RA, Karriker-Jaffe KJ, Ehlers CL.
Show Full Abstract

American Indians (AI) demonstrate the highest rates of both suicidal behaviors (SB) and alcohol use disorders (AUD) among all ethnic groups in the US. Rates of suicide and AUD vary substantially between tribal groups and across different geographical regions, underscoring a need to delineate more specific risk and resilience factors. Using data from over 740 AI living within eight contiguous reservations, we assessed genetic risk factors for SB by investigating: (1) possible genetic overlap with AUD, and (2) impacts of rare and low-frequency genomic variants. Suicidal behaviors included lifetime history of suicidal thoughts and acts, including verified suicide deaths, scored using a ranking variable for the SB phenotype (range 0-4). We identified five loci significantly associated with SB and AUD, two of which are intergenic and three intronic on genes AACSP1, ANK1, and FBXO11. Nonsynonymous rare and low-frequency mutations in four genes including SERPINF1 (PEDF), ZNF30, CD34, and SLC5A9, and non-intronic rare and low-frequency mutations in genes OPRD1, HSD17B3 and one lincRNA were significantly associated with SB. One identified pathway related to hypoxia-inducible factor (HIF) regulation, whose 83 nonsynonymous rare and low-frequency variants on 10 genes were significantly linked to SB as well. Four additional genes, and two pathways related to vasopressin-regulated water metabolism and cellular hexose transport, also were strongly associated with SB. This study represents the first investigation of genetic factors for SB in an American Indian population that has high risk for suicide. Our study suggests that bivariate association analysis between comorbid disorders can increase statistical power; and rare and low-frequency variant analysis in a high-risk population enabled by whole-genome sequencing has the potential to identify novel genetic factors. Although such findings may be population specific, rare functional mutations relating to PEDF and HIF regulation align with past reports and suggest a biological mechanism for suicide risk and a potential therapeutic target for intervention.

SERPINC1
Also flagged:acute respiratory distress syndromeARDSpulmonary edemamembranecarbon dioxidetrauma
Journal Article 2024-01-04 ✓ 1 Snippet Li M, Liu F, Yang Y, Lao J, Yin C, Wu Y, Yuan Z, Wei Y, Tang F.
In-Text Gene Mentions

…P < 0.001),APS-III( P <…

Show Full Abstract

<h4>Background</h4>The mortality rate of acute respiratory distress syndrome (ARDS) increases with age (≥ 65 years old) in critically ill patients, and it is necessary to prevent mortality in elderly patients with ARDS in the intensive care unit (ICU). Among the potential risk factors, dynamic subphenotypes of respiratory rate (RR), heart rate (HR), and respiratory rate-oxygenation (ROX) and their associations with 28-day mortality have not been clearly explored.<h4>Methods</h4>Based on the eICU Collaborative Research Database (eICU-CRD), this study used a group-based trajectory model to identify longitudinal subphenotypes of RR, HR, and ROX during the first 72 h of ICU stays. A logistic model was used to evaluate the associations of trajectories with 28-day mortality considering the group with the lowest rate of mortality as a reference. Restricted cubic spline was used to quantify linear and nonlinear effects of static RR-related factors during the first 72 h of ICU stays on 28-day mortality. Receiver operating characteristic (ROC) curves were used to assess the prediction models with the Delong test.<h4>Results</h4>A total of 938 critically ill elderly patients with ARDS were involved with five and 5 trajectories of RR and HR, respectively. A total of 204 patients fit 4 ROX trajectories. In the subphenotypes of RR, when compared with group 4, the odds ratios (ORs) and 95% confidence intervals (CIs) of group 3 were 2.74 (1.48-5.07) (P = 0.001). Regarding the HR subphenotypes, in comparison to group 1, the ORs and 95% CIs were 2.20 (1.19-4.08) (P = 0.012) for group 2, 2.70 (1.40-5.23) (P = 0.003) for group 3, 2.16 (1.04-4.49) (P = 0.040) for group 5. Low last ROX had a higher mortality risk (P linear = 0.023, P nonlinear = 0.010). Trajectories of RR and HR improved the predictive ability for 28-day mortality (AUC increased by 2.5%, P = 0.020).<h4>Conclusions</h4>For RR and HR, longitudinal subphenotypes are risk factors for 28-day mortality and have additional predictive enrichment, whereas the last ROX during the first 72 h of ICU stays is associated with 28-day mortality. These findings indicate that maintaining the health dynamic subphenotypes of RR and HR in the ICU and elevating static ROX after initial critical care may have potentially beneficial effects on prognosis in critically ill elderly patients with ARDS.

SERPINC1
Also flagged:sepsisdysfunctionseptic shockresponse toinfectionendothelial dysfunction
Journal Article 2024-01-04 ✓ 1 Snippet Kuklin V, Sovershaev M, Bjerner J, Keith P, Scott LK, Thomas OMT, Szpirt W, Rock G, Stegmayr B.
In-Text Gene Mentions

…factors such asantithrombin-III(AT III), protein…

Show Full Abstract

<h4>Introduction</h4>The impact of therapeutic plasma exchange (TPE) on short-term mortality in adult patients with sepsis-induced organ dysfunction remains uncertain. The objective of the study is to assess the effect of adjunct TPE in this setting through a comprehensive literature review.<h4>Methods</h4>The National Library of Medicine's Medline, Ovid (Embase), the Cochrane Library database and clinicaltrial.gov from January 01, 1966, until October 01, 2022, were searched for terms: therapeutic plasma exchange, plasmapheresis, sepsis, and septic shock. We reviewed, selected and extracted data from relevant randomized clinical trials (RCTs) and matched cohort studies (MCSs) comparing short-term mortality in critically ill adult septic patients treated with standard therapy versus those receiving adjunct TPE. Risk of bias was assessed in the RCTs using Cochrane Collaboration tool and in MCSs using ROBINS-I tool. Summary statistics, risk ratios (RRs), and confidence intervals (CIs) were calculated using random effects model.<h4>Results</h4>This systematic review included 937 adult critically ill septic patients from five RCTs (n = 367) and fifteen MCSs (n = 570). Of these total, 543 received treatment with TPE in addition to standard care. The meta-analysis includes all five RCTs and only six MCSs (n = 627). The adjunct TPE treatment (n = 300) showed a significant reduction in short-term mortality (RR 0.59, 95% CI 0.47-0.74, I2 3%) compared to standard therapy alone (n = 327). The systematic review of all 20 trials revealed that adding TPE to the standard therapy of critically ill septic patients resulted in faster clinical and/or laboratory recovery.<h4>Conclusions</h4>Our comprehensive and up-to-date review demonstrates that adjunct TPE may provide potential survival benefits when compared to standard care for critically ill adult patients with sepsis-induced organ dysfunction. While results of this meta-analysis are encouraging, large well-designed randomized trials are required to identify the optimal patient population and TPE procedure characteristics prior to widespread adoption into practice.

Also flagged:ovarian cancergynecologic cancerFerroptosisironoxygendeath
Journal Article 2024-01-04 No Snippets Xiong T, Wang Y, Zhu C.
Show Full Abstract

Ovarian cancer is the deadliest gynecologic cancer due to its high rate of recurrence and limited early diagnosis. For certain patients, particularly those with recurring disorders, standard treatment alone is insufficient in the majority of cases. Ferroptosis, an iron- and ROS (reactive oxygen species)-reliant cell death, plays a vital role in the occurrence of ovarian cancer. Herein, subjects from TCGA-OV were calculated for immune scores using the ESTIMATE algorithm and assigned into high- (N = 185) or low-immune (N = 193) score groups; 259 ferroptosis regulators and markers were analyzed for expression, and 64 were significantly differentially expressed between two groups. These 64 differentially expressed genes were applied for LASSO-regularized linear Cox regression for establishing ferroptosis regulators and a markers-based risk model, and a 10-gene signature was established. The ROC curve indicated that the risk score-based curve showed satisfactory predictive efficiency. Univariate and multivariate Cox risk regression analyses showed that age and risk score were risk factors for ovarian cancer patients' overall survival; patients in the high-risk score group obtained lower immune scores. The Nomogram analysis indicated that the model has a good prognostic performance. GO functional enrichment annotation confirmed again the involvement of these 10 genes in ferroptosis and immune activities. TIMER online analysis showed that risk factors and immune cells were significantly correlated. In conclusion, the risk model based on 10 ferroptosis regulators and markers has a good prognostic value for ovarian cancer patients.

HTT
Also flagged:irondeferiproneserotonin transporterdepressionproteinsphosphoproteins
Journal Article 2024-01-04 ✓ 5 Snippets Uzungil V, Luza S, Opazo CM, Mees I, Li S, Ang CS, Williamson NA, Bush AI, Hannan AJ, Renoir T.
In-Text Gene Mentions

We confirmed the deferiprone-induced increase in tyrosine hydroxylase serine 40 residue phosphorylation (pTH-Ser40) (initially revealed in our phosphoproteomics study) by Western blot analysis, with deferiprone increasing pTH-Ser40 expression in WT and 5-HTT KO mice.<h4>Conclusion</h4>As glutamatergic and synaptic signalling are dysfunctional in 5-HTT KO mice (and are the target of fast-acting antidepressant drugs such as ketamine), these molecular effects may underpin deferiprone's antidepressant-like properties.

In 5-HTT KO mice treated with deferiprone, we found 33 differentially expressed phosphosites.

Furthermore, deferiprone was found to alter neural activity in the prefrontal cortex of both wild-type (WT) and 5-HTT KO mice.<h4>Methods</h4>In the current study, we examined the molecular effects of acute deferiprone treatment in the prefrontal cortex of both genotypes via phosphoproteomics analysis.<h4>Results</h4>In WT mice treated with deferiprone, there were 22 differentially expressed phosphosites, with gene ontology analysis implicating cytoskeletal proteins.

…the serotonin transporter (5-HTT) gene have been…

…deferiprone in the5-HTTknock-out (KO) mouse…

Show Full Abstract

<h4>Background</h4>Current antidepressants have limitations due to insufficient efficacy and delay before improvement in symptoms. Polymorphisms of the serotonin transporter (5-HTT) gene have been linked to depression (when combined with stressful life events) and altered response to selective serotonergic reuptake inhibitors. We have previously revealed the antidepressant-like properties of the iron chelator deferiprone in the 5-HTT knock-out (KO) mouse model of depression. Furthermore, deferiprone was found to alter neural activity in the prefrontal cortex of both wild-type (WT) and 5-HTT KO mice.<h4>Methods</h4>In the current study, we examined the molecular effects of acute deferiprone treatment in the prefrontal cortex of both genotypes via phosphoproteomics analysis.<h4>Results</h4>In WT mice treated with deferiprone, there were 22 differentially expressed phosphosites, with gene ontology analysis implicating cytoskeletal proteins. In 5-HTT KO mice treated with deferiprone, we found 33 differentially expressed phosphosites. Gene ontology analyses revealed phosphoproteins that were predominantly involved in synaptic and glutamatergic signalling. In a drug-naïve cohort (without deferiprone administration), the analysis revealed 21 differentially expressed phosphosites in 5-HTT KO compared to WT mice. We confirmed the deferiprone-induced increase in tyrosine hydroxylase serine 40 residue phosphorylation (pTH-Ser40) (initially revealed in our phosphoproteomics study) by Western blot analysis, with deferiprone increasing pTH-Ser40 expression in WT and 5-HTT KO mice.<h4>Conclusion</h4>As glutamatergic and synaptic signalling are dysfunctional in 5-HTT KO mice (and are the target of fast-acting antidepressant drugs such as ketamine), these molecular effects may underpin deferiprone's antidepressant-like properties. Furthermore, dopaminergic signalling may also be involved in deferiprone's antidepressant-like properties.

Also flagged:AutophagyhomeostasisMacroautophagycytoplasmic-membrane
Journal Article 2024-01-04 No Snippets Liénard C, Pintart A, Bomont P.
Show Full Abstract

Autophagy is a major degradative pathway that plays a key role in sustaining cell homeostasis, integrity, and physiological functions. Macroautophagy, which ensures the clearance of cytoplasmic components engulfed in a double-membrane autophagosome that fuses with lysosomes, is orchestrated by a complex cascade of events. Autophagy has a particularly strong impact on the nervous system, and mutations in core components cause numerous neurological diseases. We first review the regulation of autophagy, from autophagosome biogenesis to lysosomal degradation and associated neurodevelopmental/neurodegenerative disorders. We then describe how this process is specifically regulated in the axon and in the somatodendritic compartment and how it is altered in diseases. In particular, we present the neuronal specificities of autophagy, with the spatial control of autophagosome biogenesis, the close relationship of maturation with axonal transport, and the regulation by synaptic activity. Finally, we discuss the physiological functions of autophagy in the nervous system, during development and in adulthood.

Also flagged:obesitydiabetes mellitus type 2coronary heart diseasehypertensionstrokedyslipidemia
Journal Article 2024-01-04 No Snippets Dalamaga M, Kounatidis D, Tsilingiris D, Vallianou NG, Karampela I, Psallida S, Papavassiliou AG.
Show Full Abstract

Excess body weight constitutes one of the major health challenges for societies and healthcare systems worldwide. Besides the type of diet, calorie intake and the lack of physical exercise, recent data have highlighted a possible association between endocrine-disrupting chemicals (EDCs), such as bisphenol A, phthalates and their analogs, and obesity. EDCs represent a heterogeneous group of chemicals that may influence the hormonal regulation of body mass and adipose tissue morphology. Based on the available data from mechanistic, animal and epidemiological studies including meta-analyses, the weight of evidence points towards the contribution of EDCs to the development of obesity, associated disorders and obesity-related adipose tissue dysfunction by (1) impacting adipogenesis; (2) modulating epigenetic pathways during development, enhancing susceptibility to obesity; (3) influencing neuroendocrine signals responsible for appetite and satiety; (4) promoting a proinflammatory milieu in adipose tissue and inducing a state of chronic subclinical inflammation; (5) dysregulating gut microbiome and immune homeostasis; and (6) inducing dysfunction in thermogenic adipose tissue. Critical periods of exposure to obesogenic EDCs are the prenatal, neonatal, pubertal and reproductive periods. Interestingly, EDCs even at low doses may promote epigenetic transgenerational inheritance of adult obesity in subsequent generations. The aim of this review is to summarize the available evidence on the role of obesogenic EDCs, specifically BPA and phthalate plasticizers, in the development of obesity, taking into account in vitro, animal and epidemiologic studies; discuss mechanisms linking EDCs to obesity; analyze the effects of EDCs on obesity in critical chronic periods of exposure; and present interesting perspectives, challenges and preventive measures in this research area.

Also flagged:Cas9CRISPRzinc-finger nucleasestranscription activator-like effector nucleasescancerinfection
Journal Article 2024-01-04 No Snippets Li X, Chen Z, Ye W, Yu J, Zhang X, Li Y, Niu Y, Ran S, Wang S, Luo Z, Zhao J, Hao Y, Zong J, Xia C, Xia J, Wu J.
Show Full Abstract

Organ transplantation is the gold standard therapy for end-stage organ failure. However, the shortage of available grafts and long-term graft dysfunction remain the primary barriers to organ transplantation. Exploring approaches to solve these issues is urgent, and CRISPR/Cas9-based transcriptome editing provides one potential solution. Furthermore, combining CRISPR/Cas9-based gene editing with an <i>ex vivo</i> organ perfusion system would enable pre-implantation transcriptome editing of grafts. How to determine effective intervention targets becomes a new problem. Fortunately, the advent of high-throughput CRISPR screening has dramatically accelerated the effective targets. This review summarizes the current advancements, utilization, and workflow of CRISPR screening in various immune and non-immune cells. It also discusses the ongoing applications of CRISPR/Cas-based gene editing in transplantation and the prospective applications of CRISPR screening in solid organ transplantation.

DCC
Also flagged:NUT carcinomaNCtumorNUTkeratinizationCK
Journal Article 2024-01-04 ✓ 1 Snippet Chen M, Li S, Jiang L.
In-Text Gene Mentions

…in colorectal cancer (DCC), mixed lineage leukemia…

Show Full Abstract

<h4>Background</h4>Nuclear protein in testis (NUT) carcinoma (NC) is a rare, aggressive tumor with a typical NUTM1 gene rearrangement.<h4>Methods</h4>Herein, we report a series of 2 cases of sinonasal NC: one in a 16-year-old woman and one in a 37-year-old man. Immunohistochemistry (IHC) staining for NUT (C52B1), fluorescence in situ hybridization (FISH), and next generation sequencing (NGS) sequencing were performed to investigate the morphological and genetic features of sinonasal NC.<h4>Results</h4>The two cases presented similar pathological features and IHC markers, and typical morphological changes, including undifferentiated cells and abrupt keratinization, were observed, with numerous mitotic figures and widespread tumor necrosis. Diffuse expression of NUT, CK, p63, and p40 was noted, while the tumors were negative for synaptophysin, chromogranin A, S-100, EBV-ISH, and PD-L1. Both tumors harbored a NUTM1 rearrangement. Subsequent sequencing revealed a rare BRD3::NUTM1 fusion and a classic BRD4::NUTM1 fusion. In addition, MCL1 copy number gain (2.1), low tumor mutation burden and stable microsatellites, were also confirmed. Case 1 received surgery and chemoradiotherapy but died 13 months after local recurrence and subsequent lung and bone metastasis. Case 2 underwent chemoradiotherapy and unfortunately died from the disease 6 months later. A review of all previously reported cases of sinonasal NCs (n=55) revealed that these tumors occur more frequently in female pediatric patients (n=11, male: female =3:8), whereas this sex difference is not observed in adult patients (n=44, male: female =23:21). The median survival times of pediatric and adult patients were 17 and 13.8 months, respectively.<h4>Conclusion</h4>Sinonasal NC presents typical undifferentiated or poorly differentiated cells, abrupt keratinization features and heterogeneous genotypes, including BRD4::NUTM1 and BRD3::NUTM1 fusions, with low tumor mutation burden and stable microsatellites.

Also flagged:Amyotrophic lateral sclerosisALSneurodegenerative diseasesporadic ALSfamilial-inherited ALSfALS
Journal Article 2024-01-04 No Snippets Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Show Full Abstract

The nematode <i>Caenorhabditis elegans</i> are a powerful model system to study human disease, with numerous experimental advantages including significant genetic and cellular homology to vertebrate animals, a short lifespan, and tractable behavioral, molecular biology and imaging assays. Beginning with the identification of SOD1 as a genetic cause of amyotrophic lateral sclerosis (ALS), <i>C. elegans</i> have contributed to a deeper understanding of the mechanistic underpinnings of this devastating neurodegenerative disease. More recently this work has expanded to encompass models of other types of ALS and the related disease frontotemporal lobar degeneration (FTLD-TDP), including those characterized by mutation or accumulation of the proteins TDP-43, C9orf72, FUS, HnRNPA2B1, ALS2, DCTN1, CHCHD10, ELP3, TUBA4A, CAV1, UBQLN2, ATXN3, TIA1, KIF5A, VAPB, GRN, and RAB38. In this review we summarize these models and the progress and insights from the last ten years of using <i>C. elegans</i> to study the neurodegenerative diseases ALS and FTLD-TDP.

FBXL4
Also flagged:MitophagyHypertensionmitochondriaautophagymitochondrialubiquitin
Journal Article 2024-01-04 ✓ 1 Snippet Ma Y, Zhou X, Gui M, Yao L, Li J, Chen X, Wang M, Lu B, Fu D.
In-Text Gene Mentions

…The SCF-FBXL4complex, operating as…

Show Full Abstract

Hypertension constitutes a pervasive chronic ailment on a global scale, frequently inflicting damage upon vital organs, such as the heart, blood vessels, kidneys, brain, and others. And this is a complex clinical dilemma that requires immediate attention. The mitochondria assume a crucial function in the generation of energy, and it is of utmost importance to eliminate any malfunctioning or surplus mitochondria to uphold intracellular homeostasis. Mitophagy is considered a classic example of selective autophagy, an important component of mitochondrial quality control, and is closely associated with many physiological and pathological processes. The ubiquitin-dependent pathway, facilitated by PINK1/Parkin, along with the ubiquitin-independent pathway, orchestrated by receptor proteins such as BNIP3, NIX, and FUNDC1, represent the extensively investigated mechanisms underlying mitophagy. In recent years, research has increasingly shown that mitophagy plays an important role in organ damage associated with hypertension. Exploring the molecular mechanisms of mitophagy in hypertension-mediated organ damage could represent a critical avenue for future research in the development of innovative therapeutic modalities. Therefore, this article provides a comprehensive review of the impact of mitophagy on organ damage due to hypertension.

Also flagged:bone disorderscalcium phosphatesmanganesehydroxyapatitepolycaprolactonecollagen I
Journal Article 2024-01-04 No Snippets Bauer L, Antunović M, Ivanković H, Ivanković M.
Show Full Abstract

The occurrence of bone disorders is steadily increasing worldwide. Bone tissue engineering (BTE) has emerged as a promising alternative to conventional treatments of bone defects, developing bone scaffolds capable of promoting bone regeneration. In this research, biomimetic scaffolds based on ion-substituted calcium phosphates, derived from cuttlefish bone, were prepared using a hydrothermal method. To synthesize Mn<sup>2+</sup>-substituted scaffolds, three different manganese concentrations (corresponding to 1, 2.5, and 5 mol% Mn substitutions for Ca into hydroxyapatite) were used. Also, syntheses with the simultaneous addition of an equimolar amount (1 mol%) of two (Mg<sup>2+</sup> and Sr<sup>2+</sup>) or three ions (Mn<sup>2+</sup>, Mg<sup>2+</sup>, and Sr<sup>2+</sup>) were performed. A chemical, structural, and morphological characterization was carried out using X-ray diffraction, Fourier transform infrared spectroscopy, and scanning electron microscopy. The effects of the ion substitutions on the lattice parameters, crystallite sizes, and fractions of the detected phases were discussed. Multi-substituted (Mn<sup>2+</sup>, Mg<sup>2+</sup>, and Sr<sup>2+</sup>) scaffolds were coated with polycaprolactone (PCL) using simple vacuum impregnation. The differentiation of human mesenchymal stem cells (hMSCs), cultured on the PCL-coated scaffold, was evaluated using histology, immunohistochemistry, and reverse transcription-quantitative polymerase chain reaction analyses. The expression of collagen I, alkaline phosphatase, and dentin matrix protein 1 was detected. The influence of PCL coating on hMSCs behavior is discussed.

ARFGEF2
Also flagged:neuropsychiatric disorderspurine nucleotideADHDbehavioralsystemic diseaseattention-deficit/hyperactivity disorder
Journal Article 2024-01-04 ✓ 5 Snippets Chen D, Zhou Y, Zhang Y, Zeng H, Wu L, Liu Y.
In-Text Gene Mentions

This locus is associated with the protein-coding gene ARFGEF2. ARFGEF2 encodes the large brefeldin A (BFA)-inhibited GEF2 protein (BIG2), which is involved in vesicle and membrane trafficking originating from the trans-Golgi network (37).

For instance, mutations in the ARFGEF2 gene, responsible for encoding the BIG2 protein and identified in patients with autosomal recessive periventricular heterotopia with microcephaly, are closely associated with neuronal migration disorders (57).

Noteworthy, our findings emphasized the potentially intriguing roles of novel associations involving ARFGEF2 in the context of the relationship between EA and PTSD.

…(rs71351952, mapped gene:ARFGEF2).…

…the protein-coding geneARFGEF2.…

Show Full Abstract

<h4>Background</h4>Empirical studies have demonstrated that educational attainment (EA) is associated with neuropsychiatric disorders (NPDs), suggesting a shared etiological basis between them. However, little is known about the shared genetic mechanisms and causality behind such associations.<h4>Methods</h4>This study explored the shared genetic basis and causal relationships between EA and NPDs using the high-definition likelihood (HDL) method, cross phenotype association study (CPASSOC), transcriptome-wide association study (TWAS), and bidirectional Mendelian randomization (MR) with summary-level data for EA (<i>N</i> = 293,723) and NPDs (<i>N</i> range = 9,725 to 455,258).<h4>Results</h4>Significant genetic correlations between EA and 12 NPDs (<i>r</i><sub>g</sub> range - 0.49 to 0.35; all <i>p</i> < 3.85 × 10<sup>-3</sup>) were observed. CPASSOC identified 37 independent loci shared between EA and NPDs, one of which was novel (rs71351952, mapped gene: <i>ARFGEF2</i>). Functional analyses and TWAS found shared genes were enriched in brain tissue, especially in the cerebellum and highlighted the regulatory role of neuronal signaling, purine nucleotide metabolic process, and cAMP-mediated signaling pathways. CPASSOC and TWAS supported the role of three regions of 6q16.1, 3p21.31, and 17q21.31 might account for the shared causes between EA and NPDs. MR confirmed higher genetically predicted EA lower the risk of ADHD (OR<sub>IVW</sub>: 0.50; 95% CI: 0.39 to 0.63) and genetically predicted ADHD decreased the risk of EA (Causal effect: -2.8 months; 95% CI: -3.9 to -1.8).<h4>Conclusion</h4>These findings provided evidence of shared genetics and causation between EA and NPDs, advanced our understanding of EA, and implicated potential biological pathways that might underlie both EA and NPDs.

HFE
Also flagged:cortisolepinephrinegestationanxietyhearingloss
Journal Article 2024-01-04 ✓ 1 Snippet Hidayati E, Rauf S, Hatta M, Lisal ST, Wibisono JJ, Syamsuddin S, Chalid MT, Saleh A, Zainuddin AA, Hamidah H, Fatimah F, Hapsah H, Permatasari TAE, Lusida N.
In-Text Gene Mentions

…as anemia, cancer,hemochromatosis, hemolytic anemia, leukemia,…

Show Full Abstract

Infant mortality is caused by various health problems, especially since the gestation period, even starting before the gestation period. Stress during pregnancy affects the motor, cognitive, and emotional development of the baby. This study aims to determine the effect of interactive pregnancy education (IPE) on decreasing levels of cortisol, epinephrine, and its relationship with stress levels in third-trimester primigravida pregnant women. This research is a quasi-experimental study using a nonequivalent control group design, which has two groups, namely the experimental group and the control group. The authors compared the experimental group that was given the intervention with the control group that was not given any treatment. This research was conducted in the three Community Health Centers in Indonesia from June 2022 until December 2022. The samples were 30 third-trimester primigravida pregnant women for the intervention and control groups. Data were analyzed using the Mann-Whitney and Wilcoxon tests with SPSS 22 software. The results of this study indicate that IPE has a good impact on pregnant women, where there is a significant relationship in the post-test cortisol and epinephrine levels in the intervention group. This indicates that IPE contributed to the difference in post-test scores in the intervention group. The IPE method is effective in reducing stress levels and cortisol levels in pregnant women, especially in pregnant women with high levels of stress.

CACNA1E
Also flagged:oxytocinOTbehavioralregulation ofgene expressionnucleus
Journal Article 2024-01-04 ✓ 1 Snippet Danoff JS, Carter CS, Gordevičius J, Milčiūtė M, Brooke RT, Connelly JJ, Perkeybile AM.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

Exogenous oxytocin (OT) is widely used to induce or augment labor with little understanding of the impact on offspring development. In rodent models, including the prairie vole (<i>Microtus ochrogaster</i>), it has been shown that oxytocin administered to mothers can affect the nervous system of the offspring with long lasting behavioral effects especially on sociality. Here, we examined the hypothesis that perinatal oxytocin exposure could have epigenetic and transcriptomic consequences. Prairie voles were exposed to exogenous oxytocin, through injections given to the mother just prior to birth, and were studied at the time of weaning. The outcome of this study revealed increased epigenetic age in oxytocin-exposed animals compared to the saline-exposed group. Oxytocin exposure led to 900 differentially methylated CpG sites (annotated to 589 genes), and 2 CpG sites (2 genes) remained significantly different after correction for multiple comparisons. Differentially methylated CpG sites were enriched in genes known to be involved in regulation of gene expression and neurodevelopment. Using RNA-sequencing we also found 217 nominally differentially expressed genes (p<0.05) in nucleus accumbens, a brain region involved in reward circuitry and social behavior; after corrections for multiple comparisons 6 genes remained significantly differentially expressed. Finally, we found that maternal oxytocin administration led to widespread alternative splicing in the nucleus accumbens. These results indicate that oxytocin exposure during birth may have long lasting epigenetic consequences. A need for further investigation of how oxytocin administration impacts development and behavior throughout the lifespan is supported by these outcomes.

FBXL4
Also flagged:HSD10mitochondrialmitochondrial diseasesdeficiencymicrocephalydevelopmental delay
Journal Article 2024-01-04 ✓ 1 Snippet Ciki K, Alavanda C, Kara M.
In-Text Gene Mentions

FBXL4

Show Full Abstract

<h4>Introduction</h4>Hydroxysteroid 17-beta dehydrogenase type 10 (HSD10) protein is a mitochondrial enzyme. Multisystemic involvement occurs in HSD10 deficiency as in other mitochondrial diseases. HSD10 deficiency (disease) is rare. Less than 40 index cases have been reported so far. A female patient is even rarer because of X-linked transmission. Five index female cases have been reported.<h4>Case presentation</h4>We report a three-year-old female patient who was investigated due to microcephaly and global developmental delay. She had significant dysmorphic findings. The tiglylglycine peak was detected in urinary organic acid analysis. Other metabolic investigations and laboratory tests were unremarkable. Mild cerebral atrophy, mild ventricular dilation, thin corpus callosum, and an increase in T2 signal in the globus pallidus were revealed at brain magnetic resonance imaging. Heterozygous novel mutation in the <i>HSD17B10</i> gene was found by whole-exome sequencing (WES) analysis. We started isoleucine-restricted diet and a "cocktail" of the mitochondrial vitamin.<h4>Discussion/conclusion</h4>We will see HSD10 disease patients more frequently with the increasing use of WES and genetic panels. Thus, different findings and phenotypes of the HSD10 disease will be revealed.

HFE
Also flagged:periodontitisILDR1DMXL2LFNGLENG8NPHS1
Journal Article 2024-01-03 ✓ 5 Snippets Xue F, Zhao J, Gao X, Jiang X, Lan Z.
In-Text Gene Mentions

The allele frequencies at the mutation loci of LFNG, LENG8, NPHS1, HFE, ILDR1, and DMXL2 genes were analyzed in the 15 patients with severe periodontitis.

HFE gene deficiency leads to hereditary hemochromatosis, a recessive iron storage disorder [22, 23].

…LFNG, LENG8, NPHS1,HFE, ILDR1, and DMXL2…

…LENG8 , NPHS1,HFE, ILDR1 ,…

…c.187C>G (rs1799945) inHFE, exon6: c.772C>T…

Show Full Abstract

The aim of this study was to screen potential susceptibility genes using whole-exome sequencing (WES) in 15 Han Chinese patients with stage III or IV periodontitis and to evaluate the quantity and quality of genomic DNA extracted from saliva. DNA was extracted from saliva epithelial cells, quality-tested, and then subjected to WES and bioinformatics analyses. All variation loci were analyzed and interpreted following the American College of Medical Genetics and Genomics (ACMG) criteria. Candidate pathogenic variation loci were identified and verified using Sanger sequencing. Correlation and functional analyses of the candidate genes were used to identify potential susceptibility genes in patients with severe periodontitis. LFNG, LENG8, NPHS1, HFE, ILDR1, and DMXL2 genes were identified in over two cases each with shared mutations. Following these analyses, the DMXL2 gene was identified as being associated with stage III and IV periodontitis. These results suggest a potential pathophysiological risk mechanism for periodontitis, but need to be verified through larger clinical studies and mechanistic experiments to determine the pathogenicity of these gene mutations and their generalizability to a wider population of periodontitis patients. By screening candidate pathogenic variation loci using WES in 15 Han Chinese patients with stage III or IV periodontitis, our study could provide a pipeline and feasibility support for the identification of susceptibility genes in patients with stage III and IV periodontitis.

TNFSF4
Also flagged:CLEC11AGastric cancermalignant cancerC-type lectin domain family 11 member AC-type lectincancers
Journal Article 2024-01-03 ✓ 1 Snippet Fang W, Wan D, Yu Y, Zhang L.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4) (rho ═ 0.469)…

Show Full Abstract

Gastric cancer (GC) is a prevalent malignant cancer characterized by a poor survival rate. The C-type lectin domain family 11 member A (CLEC11A) is part of the C-type lectin superfamily, and its dysregulation has been implicated in the progression of several cancers. The specific role of CLEC11A and its association with immune infiltration in GC, however, remains unclear. In this study, we employed The Cancer Genome Atlas (TCGA) database, Gene Expression Omnibus (GEO) database, Tumor IMmune Estimation Resource (TIMER) database, Gene Expression Profiling Interactive Analysis (GEPIA), UALCAN, Kaplan-Meier plotter databases, gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Set Enrichment Analysis (GSEA), and the CIBERSORT algorithm to investigate CLEC11A expression, its prognostic significance, its association with tumor immune infiltration, and gene function enrichment in GC. We conducted western blotting, Cell Counting Kit-8 (CCK-8), wound healing, and transwell assays to validate CLEC11A's function. We found that CLEC11A expression was significantly elevated in GC when compared to adjacent non-tumor tissues. Elevated CLEC11A expression was strongly associated with poor survival outcomes and advanced clinicopathological stages.  Moreover, heightened CLEC11A expression positively correlated with immunomodulators, chemokines, and the infiltration of immune cells, especially M2 macrophages, in GC. Additionally, CLEC11A silencing suppressed GC cells proliferation, migration and invasion in vitro. Our results elucidate the functions of CLEC11A in GC, suggesting its potential as a valuable prognostic biomarker and therapeutic target for GC immunotherapy.

Also flagged:Spinal Cord Injuryspasmsbaclofenclonidinetizanidinecord injury
Journal Article 2024-01-03 No Snippets Mahrous A, Birch D, Heckman CJ, Tysseling V.
Show Full Abstract

Muscle spasms are common in chronic spinal cord injury (SCI), posing challenges to rehabilitation and daily activities. Pharmacological management of spasms mostly targets suppression of excitatory inputs, an approach known to hinder motor recovery. To identify better targets, we investigated changes in inhibitory and excitatory synaptic inputs to motoneurons as well as motoneuron excitability in chronic SCI. We induced either a complete or incomplete SCI in adult mice of either sex and divided those with incomplete injury into low or high functional recovery groups. Their sacrocaudal spinal cords were then extracted and used to study plasticity below injury, with tissue from naive animals as a control. Electrical stimulation of the dorsal roots elicited spasm-like activity in preparations of chronic severe SCI but not in the control. To evaluate overall synaptic inhibition activated by sensory stimulation, we measured the rate-dependent depression of spinal root reflexes. We found inhibitory inputs to be impaired in chronic injury models. When synaptic inhibition was blocked pharmacologically, all preparations became clearly spastic, even the control. However, preparations with chronic injuries generated longer spasms than control. We then measured excitatory postsynaptic currents (EPSCs) in motoneurons during sensory-evoked spasms. The data showed no difference in the amplitude of EPSCs or their conductance among animal groups. Nonetheless, we found that motoneuron persistent inward currents activated by the EPSCs were increased in chronic SCI. These findings suggest that changes in motoneuron excitability and synaptic inhibition, rather than excitation, contribute to spasms and are better suited for more effective therapeutic interventions.<b>Significance Statement</b> Neural plasticity following spinal cord injury is crucial for recovery of motor function. Unfortunately, this process is blemished by maladaptive changes that can cause muscle spasms. Pharmacological alleviation of spasms without compromising the recovery of motor function has proven to be challenging. Here, we investigated changes in fundamental spinal mechanisms that can cause spasms post-injury. Our data suggest that the current management strategy for spasms is misdirected toward suppressing excitatory inputs, a mechanism that we found unaltered after injury, which can lead to further motor weakness. Instead, this study shows that more promising approaches might involve restoring synaptic inhibition or modulating motoneuron excitability.

Also flagged:alcohol use disorderalcoholAlcohol Withdrawal Syndromeautonomic dysregulationdeliriumAlcohol withdrawal
Journal Article 2024-01-03 No Snippets Andersen A, Milefchik E, Papworth E, Penaluna B, Dawes K, Moody J, Weeks G, Froehlich E, deBlois K, Long JD, Philibert R.
Show Full Abstract

Currently, clinicians use their judgement and indices such as the Prediction of Alcohol Withdrawal Syndrome Scale (PAWSS) to determine whether patients are admitted to hospitals for consideration of withdrawal syndrome (AWS). However, only a fraction of those admitted will experience severe AWS. Previously, we and others have shown that epigenetic indices, such as the Alcohol T-Score (ATS), can quantify recent alcohol consumption. However, whether these or other alcohol biomarkers, such as carbohydrate deficient transferrin (CDT), could identify those at risk for severe AWS is unknown. To determine this, we first conducted genome-wide DNA methylation analyses of subjects entering and exiting alcohol treatment to identify loci whose methylation quickly reverted as a function of abstinence. We then tested whether methylation at a rapidly reverting locus, cg07375256, or other existing metrics including PAWSS scores, CDT levels, or ATS, could predict outcome in 125 subjects admitted for consideration of AWS. We found that PAWSS did not significantly predict severe AWS nor seizures. However, methylation at cg07375256 (<i>ZSCAN25</i>) and CDT strongly predicted severe AWS with ATS (<i>p</i> < 0.007) and cg07375256 (<i>p</i> < 6 × 10-5) methylation also predicting AWS associated seizures. We conclude that epigenetic methods can predict those likely to experience severe AWS and that the use of these or similar Precision Epigenetic approaches could better guide AWS management.

Also flagged:hydroxyltumorglucose oxidaseβ-lapachoneglucosenicotinamide adenine dinucleotide
Journal Article 2024-01-03 No Snippets Zhao P, Gong L, Chang L, Du H, Geng M, Meng S, Dai L.
Show Full Abstract

Chemodynamic therapy (CDT) is seriously limited by the inadequacy of exogenous catalytic ions and endogenous H<sub>2</sub>O<sub>2</sub> in tumors. Herein, a multifunction nano-bomb integrated with calcium peroxide (CaO<sub>2</sub>) and β-lapachone as donors of H<sub>2</sub>O<sub>2</sub> and GSH-sensitive Fe-based coordination polymer as provider of catalytic ions was constructed for dual cascade-amplified tumor CDT. This hyaluronic acid (HA)-modified nano-bomb could be specially endocytosed by breast cancer cells through a targeting pathway, degraded and released cargoes in response to the GSH-rich cytoplasm. Furthermore, the released CaO<sub>2</sub> and β-lapachone could significantly self-generated sufficient H<sub>2</sub>O<sub>2</sub>, which could dual-cascade amplify CDT and induce severe oxidative to tumors via cooperating with the delivered iron ions from nano-bombs. Moreover, the unloaded iron and calcium ions could further accelerate tumor damage by overloading Ca<sup>2+</sup> and ferroptosis, as accompanied by good magnetic resonance imaging (MRI). In vitro and in vivo studies collectively reveal that this nano-bomb not only self-initiates double cascade-amplified CDT via self-generation of H<sub>2</sub>O<sub>2</sub>, but also efficiently activates ferroptosis and initiates Ca<sup>2+</sup> overloading, consequently significantly tumor growth suppression. This study offers a novel tumor-initiated nano-bomb for dual cascade-amplified CDT and bioimaging with activated ferroptosis and self-supplying H<sub>2</sub>O<sub>2</sub>.

HTT
Also flagged:zincmetabolismcancerzinc transporterstransportationtransporter
Journal Article 2024-01-03 ✓ 1 Snippet Chen B, Yu P, Chan WN, Xie F, Zhang Y, Liang L, Leung KT, Lo KW, Yu J, Tse GMK, Kang W, To KF.
In-Text Gene Mentions

Synaptic dysfunction significantly contributes to the pathogenesis of HD,565 with vesicular zinc playing a significant role in synaptic function.566,567 Specifically, increased levels of zinc have been measured in HD patients, suggesting that mutant Htt (mHtt) may disturb zinc metabolism.568 mHtt decreased ZnT3 expression by suppressing the conjugation of Sp1 with ZnT3 promoter.569 As a result, it downregulates vesicular zinc levels in the brains of N171-82Q HD transgenic mice.

Show Full Abstract

Zinc metabolism at the cellular level is critical for many biological processes in the body. A key observation is the disruption of cellular homeostasis, often coinciding with disease progression. As an essential factor in maintaining cellular equilibrium, cellular zinc has been increasingly spotlighted in the context of disease development. Extensive research suggests zinc's involvement in promoting malignancy and invasion in cancer cells, despite its low tissue concentration. This has led to a growing body of literature investigating zinc's cellular metabolism, particularly the functions of zinc transporters and storage mechanisms during cancer progression. Zinc transportation is under the control of two major transporter families: SLC30 (ZnT) for the excretion of zinc and SLC39 (ZIP) for the zinc intake. Additionally, the storage of this essential element is predominantly mediated by metallothioneins (MTs). This review consolidates knowledge on the critical functions of cellular zinc signaling and underscores potential molecular pathways linking zinc metabolism to disease progression, with a special focus on cancer. We also compile a summary of clinical trials involving zinc ions. Given the main localization of zinc transporters at the cell membrane, the potential for targeted therapies, including small molecules and monoclonal antibodies, offers promising avenues for future exploration.

HTT
Also flagged:visionneurotransmitter receptorneurotransmitter receptors5-HT1B5-HT2A5-HT1A
Journal Article 2024-01-03 ✓ 1 Snippet Aqil M, Knapen T, Dumoulin SO.
In-Text Gene Mentions

…correlation between the5-HTT(serotonin transporter) recept…

Show Full Abstract

A goal of cognitive neuroscience is to provide computational accounts of brain function. Canonical computations-mathematical operations used by the brain in many contexts-fulfill broad information-processing needs by varying their algorithmic parameters. A key question concerns the identification of biological substrates for these computations and their algorithms. Chemoarchitecture-the spatial distribution of neurotransmitter receptor densities-shapes brain function. Here, we propose that local variations in specific receptor densities implement algorithmic modulations of canonical computations. To test this hypothesis, we combine mathematical modeling of brain responses with chemoarchitecture data. We compare parameters of divisive normalization obtained from 7-tesla functional magnetic resonance imaging with receptor density maps obtained from positron emission tomography. We find evidence that serotonin and γ-aminobutyric acid receptor densities are the biological substrate for algorithmic modulations of divisive normalization in the human visual system. Our model links computational and biological levels of vision, explaining how canonical computations allow the brain to fulfill broad information-processing needs.

Also flagged:Lymphangiogenesislipidimmune responsetransportationpathogenesislymphedema
Journal Article 2024-01-03 No Snippets Hu Z, Zhao X, Wu Z, Qu B, Yuan M, Xing Y, Song Y, Wang Z.
Show Full Abstract

Lymphatic vessels, comprising the secondary circulatory system in human body, play a multifaceted role in maintaining homeostasis among various tissues and organs. They are tasked with a serious of responsibilities, including the regulation of lymph absorption and transport, the orchestration of immune surveillance and responses. Lymphatic vessel development undergoes a series of sophisticated regulatory signaling pathways governing heterogeneous-origin cell populations stepwise to assemble into the highly specialized lymphatic vessel networks. Lymphangiogenesis, as defined by new lymphatic vessels sprouting from preexisting lymphatic vessels/embryonic veins, is the main developmental mechanism underlying the formation and expansion of lymphatic vessel networks in an embryo. However, abnormal lymphangiogenesis could be observed in many pathological conditions and has a close relationship with the development and progression of various diseases. Mechanistic studies have revealed a set of lymphangiogenic factors and cascades that may serve as the potential targets for regulating abnormal lymphangiogenesis, to further modulate the progression of diseases. Actually, an increasing number of clinical trials have demonstrated the promising interventions and showed the feasibility of currently available treatments for future clinical translation. Targeting lymphangiogenic promoters or inhibitors not only directly regulates abnormal lymphangiogenesis, but improves the efficacy of diverse treatments. In conclusion, we present a comprehensive overview of lymphatic vessel development and physiological functions, and describe the critical involvement of abnormal lymphangiogenesis in multiple diseases. Moreover, we summarize the targeting therapeutic values of abnormal lymphangiogenesis, providing novel perspectives for treatment strategy of multiple human diseases.

Also flagged:mental illnessesdepressionpsychiatric disordersCAP1CAP2CAP3
Journal Article 2024-01-03 No Snippets An Z, Tang K, Xie Y, Tong C, Liu J, Tao Q, DIRECT Consortium, Feng Y.
Show Full Abstract

Major depressive disorder (MDD) is a globally prevalent and highly disabling disease characterized by dysfunction of large-scale brain networks. Previous studies have found that static functional connectivity is not sufficient to reflect the complicated and time-varying properties of the brain. The underlying dynamic interactions between brain functional networks of MDD remain largely unknown, and it is also unclear whether neuroimaging-based dynamic properties are sufficiently robust to discriminate individuals with MDD from healthy controls since the diagnosis of MDD mainly depends on symptom-based criteria evaluated by clinical observation. Resting-state functional magnetic resonance imaging (fMRI) data of 221 MDD patients and 215 healthy controls were shared by REST-meta-MDD consortium. We investigated the spatial-temporal dynamics of MDD using co-activation pattern analysis and made individual diagnoses using support vector machine (SVM). We found that MDD patients exhibited aberrant dynamic properties (such as dwell time, occurrence rate, transition probability, and entropy of Markov trajectories) in some transient networks including subcortical network (SCN), activated default mode network (DMN), de-activated SCN-cerebellum network, a joint network, activated attention network (ATN), and de-activated DMN-ATN, where some dynamic properties were indicative of depressive symptoms. The trajectories of other networks to deactivated DMN-ATN were more accessible in MDD patients. Subgroup analyses also showed subtle dynamic changes in first-episode drug-naïve (FEDN) MDD patients. Finally, SVM achieved preferable accuracies of 84.69%, 76.77%, and 88.10% in discriminating patients with MDD, FEDN MDD, and recurrent MDD from healthy controls with their dynamic metrics. Our findings reveal that MDD is characterized by aberrant dynamic fluctuations of brain network and the feasibility of discriminating MDD patients using dynamic properties, which provide novel insights into the neural mechanism of MDD.

TNFSF4
Also flagged:Systemic sclerosissclerodermaconnective tissue diseasemetastatic cancersextracellulartype I collagen
Journal Article 2024-01-03 ✓ 4 Snippets Ma F, Tsou PS, Gharaee-Kermani M, Plazyo O, Xing X, Kirma J, Wasikowski R, Hile GA, Harms PW, Jiang Y, Xing E, Nakamura M, Ochocki D, Brodie WD, Pillai S, Maverakis E, Pellegrini M, Modlin RL, Varga J, Tsoi LC, Lafyatis R, Kahlenberg JM, Billi AC, Khanna D, Gudjonsson JE.
In-Text Gene Mentions

Many of these mediators have been implicated in SSc pathogenesis including CCL2 and CCL8 in promoting dendritic cell differentiation66, IL6 and IL11 in promoting fibrosis39,59,67, TNFSF4 as genetic predisposition in SSc68, FGF7 in fibroblast activation69, VEGF in vascular dysfunction70, and WNT2 in dermal fibrillin deposition40.

…, CCL11 ,TNFSF4, TNFSF9 ,…

…, TFGB3 ,TNFSF4, TNFSF9 ,…

…, 67 ,TNFSF4as genetic predisposition…

Show Full Abstract

Systemic sclerosis (SSc) is a devastating autoimmune disease characterized by excessive production and accumulation of extracellular matrix, leading to fibrosis of skin and other internal organs. However, the main cellular participants in SSc skin fibrosis remain incompletely understood. Here using differentiation trajectories at a single cell level, we demonstrate a dual source of extracellular matrix deposition in SSc skin from both myofibroblasts and endothelial-to-mesenchymal-transitioning cells (EndoMT). We further define a central role of Hippo pathway effectors in differentiation and homeostasis of myofibroblast and EndoMT, respectively, and show that myofibroblasts and EndoMTs function as central communication hubs that drive key pro-fibrotic signaling pathways in SSc. Together, our data help characterize myofibroblast differentiation and EndoMT phenotypes in SSc skin, and hint that modulation of the Hippo pathway may contribute in reversing the pro-fibrotic phenotypes in myofibroblasts and EndoMTs.

CA10
Also flagged:RetinoblastomaRBocular tumorchromosomeSOX4retinoma
Journal Article 2024-01-03 ✓ 1 Snippet Liu Y, Hu W, Xie Y, Tang J, Ma H, Li J, Nie J, Wang Y, Gao Y, Cheng C, Li C, Ma Y, Su S, Zhang Z, Bao Y, Ren Y, Wang X, Sun F, Li S, Lu R.
In-Text Gene Mentions

…bipolar cells (CA10, LRTM1 ,…

Show Full Abstract

Retinoblastoma (RB) is the most prevalent ocular tumor of childhood, and its extraocular invasion significantly increases the risk of metastasis. Nevertheless, a single-cell characterization of RB local extension has been lacking. Here, we perform single-cell RNA sequencing on four RB samples (two from intraocular and two from extraocular RB patients), and integrate public datasets of five normal retina samples, four intraocular samples, and three extraocular RB samples to characterize RB local extension at the single-cell level. A total of 128,454 qualified cells are obtained in nine major cell types. Copy number variation inference reveals chromosome 6p amplification in cells derived from extraocular RB samples. In cellular heterogeneity analysis, we identified 10, 8, and 7 cell subpopulations in cone precursor like cells, retinoma like cells, and MKI67<sup>+</sup> photoreceptorness decreased (MKI67<sup>+</sup> PhrD) cells, respectively. A high expression level of SOX4 was detected in cells from extraocular samples, especially in MKI67<sup>+</sup> PhrD cells, which was verified in additional clinical RB samples. These results suggest that SOX4 might drive RB local extension. Our study presents a single-cell transcriptomic landscape of intraocular and extraocular RB samples, improving our understanding of RB local extension at the single-cell resolution and providing potential therapeutic targets for RB patients.

DCC
Also flagged:Chronic Hepatitis DHDV infectionliver diseasealanine aminotransferaseviral hepatitishepatocellular carcinoma
Journal Article 2024-01-03 ✓ 2 Snippets Kaushik A, Dusheiko G, Kim C, Smith NJ, Kinyik-Merena C, Di Tanna GL, Wong RJ.
In-Text Gene Mentions

Over the course of a simulation, patients can achieve spontaneous or treatment-induced virologic responses (e.g., HBsAg loss or seroconversion, or the combined response endpoint of HDV-RNA undetectability/≥2-log10 decline and ALT normalization) or advanced liver disease (e.g., CC, DCC, HCC, or LT).

…events for CC,DCC, and HCC, as…

Show Full Abstract

<h4>Background</h4>As new therapeutic options become available, better understanding the potential impact of emerging therapies on clinical outcomes of hepatits D virus (HDV) is critical.<h4>Objective</h4>The aim of this study was to develop a natural history model for patients with hepatitis D virus.<h4>Methods</h4>We developed a model (decision tree followed by a Markov cohort model) in adults with chronic HDV infection to assess the natural history and impact of novel treatments on disease progression versus best supportive care (BSC). The model time horizon was over a lifetime (up to 100 years of age); state transitions and health states were defined by responder status. Patients in fibrosis stages 0 through 4 received treatment; decompensated patients were not treated. Response was defined as the combined response endpoint of achievement of HDV-RNA undetectability/≥2-log<sub>10</sub> decline and alanine aminotransferase normalization; response rates of 50% and 75% were explored. Health events associated with advanced liver disease were modeled as the number of events per 10,000 patients. Scenario analyses of early treatment, alternate treatment response, and no fibrosis regression for treatment responders were also explored.<h4>Results</h4>The model was able to reflect disease progression similarly to published natural history studies for patients with HBV/HDV infection. In a hypothetical cohort of patients reflecting a population enrolled in a recent clinical trial, fewer advanced liver disease events were observed with a novel HDV treatment versus BSC. Fewer liver-related deaths were observed under 50% and 75% response (900 and 1,358 fewer deaths, respectively, per 10,000 patients). Scenario analyses showed consistently fewer advanced liver disease events with HDV treatment compared with BSC, with greater reductions observed with earlier treatment.<h4>Conclusion</h4>This HDV disease progression model replicated findings from natural history studies. Furthermore, it found that a hypothetical HDV treatment results in better clinical outcomes for patients versus BSC, with greater benefit observed when starting treatment early. This validated natural history model for HBV/HDV infection can serve as a foundation for future clinical and economic analyses of novel HDV treatments that can support healthcare stakeholders in the management of patients with chronic HDV.

HFE
Also flagged:Type 2 diabetes mellitusprediabetesagingobesitydiabetesdeath
Journal Article 2024-01-03 ✓ 1 Snippet Vinokur V, Berenshtein E, Chevion M, Chevion D.
In-Text Gene Mentions

…primary or secondaryhemochromatosis[ 15 ],…

Show Full Abstract

<h4>Backgruound</h4>The inflammatory process is known to be an integral part of the pathophysiology of type 2 diabetes mellitus (T2DM). The "labile," redox-active iron, serving as a catalyst in Fenton reaction, producing the deleterious reactive oxygen species, triggering and maintaining inflammation, is hypothesized to play a causative role in this process. Concenter Biopharma continued the development of a new platform of iron chelators (Zygosids), first initiated at the Hebrew University of Jerusalem, Israel (HUJI), acting via the novel mechanism, based on a sequestration of the labile redox-active iron and its substitution by zinc or gallium. The mode of action of Zygosids is based on the higher affinity of the metal-binding moiety of the complex to Fe3+ in comparison to already bound ion, leading to rapid release of the ion of another metal and chelation of Fe3+. Concomitantly, zinc ion, released by the complex, is known for its antidiabetic and anti-inflammatory role.<h4>Methods</h4>The therapeutic effect of zinc-desferrioxamine (Zygosid-50) and gallium-desferrioxamine, was tested on fat sand rat (Psammomys obesus) model of diet-induced T2DM and on Leprdb transgenic diabetic mice.<h4>Results</h4>Zygosids demonstrated an ability to noticeably reduce blood glucose and insulin levels and improve the lipid profile. Moreover, an ability to mitigate insulin resistance by >90% was shown on the sand rat model. In addition, a potent anti-inflammatory effect, expressed as a diminishment of the proinflammatory cytokines in tissue levels, was demonstrated.<h4>Conclusion</h4>Zygosids demonstrated robust therapeutic efficacy in treatment of T2DM. Importantly, no adverse effects were detected, in all the experiments, indicating high safety profile.

TNFSF4
Also flagged:Lymphotoxin beta receptorLTBRcell proliferationtumorcancermismatch repair
Journal Article 2024-01-03 ✓ 2 Snippets Wu Y, Zhao S, Guo W, Liu Y, Requena Mullor MDM, Rodrìguez RA, Wei R.
In-Text Gene Mentions

In terms of immune checkpoint genes, LTBR had significant positive correlations with TGFB1, C10orf54, CD276, VEGFA, EDNRB, CX3CL1, TNFSF9, TNF, TNFRSF18, IL1A, IL1B, TNFSF4, BTN3A1, BTN3A2, and HMGB1 in most tumors (Figure 6B).

…TNFRSF18, IL1A, IL1B,TNFSF4, BTN3A1, BTN3A2, and…

Show Full Abstract

Lymphotoxin beta receptor (LTBR) is a positive T cell proliferation regulator gene. It is closely associated with the tumor immune microenvironment. However, its role in cancer and immunotherapy is unclear. Firstly, the expression level and prognostic value of LTBR were analyzed. Secondly, the expression of LTBR in clinical stages, immune subtypes, and molecular subtypes was analyzed. The correlation between LTBR and immune regulatory genes, immune checkpoint genes, and RNA modification genes was then analyzed. Correlations between LTBR and immune cells, scores, cancer-related functional status, tumor stemness index, mismatch repair (MMR) genes, and DNA methyltransferase were also analyzed. In addition, we analyzed the role of LTBR in DNA methylation, mutational status, tumor mutation burden (TMB), and microsatellite instability (MSI). Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Set Enrichment Analysis (GSEA) were used to explore the role of LTBR in pan-cancer. Finally, the drugs associated with LTBR were analyzed. The expression of LTBR was confirmed using quantitative real-time PCR and Western blot. LTBR is significantly overexpressed in most cancers and is associated with low patient survival. In addition, LTBR expression was strongly correlated with immune cells, score, cancer-related functional status, tumor stemness index, MMR genes, DNA methyltransferase, DNA methylation, mutational status, TMB, and MSI. Enrichment analysis revealed that LTBR was associated with apoptosis, necroptosis, and immune-related pathways. Finally, multiple drugs targeting LTBR were identified. LTBR is overexpressed in several tumors and is associated with a poor prognosis. It is related to immune-related genes and immune cell infiltration.

HFE
Also flagged:PorphyriasPorphyriaorganizationdepressionmetabolic diseasesheme
Journal Article 2024-01-03 ✓ 2 Snippets Gerischer L, Mainert M, Wohmann N, Kubisch I, Stölzel U, Stauch T, von Wegerer S, Braun F, Weiler-Normann C, Blaschke S, Frank J, Somasundaram R, Diehl-Wiesenecker E.
In-Text Gene Mentions

…alcohol abuse, smoking,hemochromatosisdue to pathogenetic…

…due to pathogeneticHFEgen variants, hepatitis…

Show Full Abstract

Porphyrias, as most rare diseases, are characterized by complexity and scarcity of knowledge. A national registry in one of the largest European populations that prospectively collects longitudinal clinical and laboratory data are an important and effective tool to close this gap. The German Porphyria Registry (PoReGer) was founded by four centers with longstanding expertise in the field of porphyrias and rare diseases (Charité-Universitätsmedizin Berlin, Porphyria Center Saxony Chemnitz, University Medical Center Hamburg-Eppendorf, University Medical Center Göttingen) and the German reference laboratory for porphyria, and is supported by the largest German porphyria patient organization. A specified data matrix for three subgroups (acute, chronic blistering cutaneous, acute non-blistering cutaneous) includes data on demographics, specific porphyria-related symptoms, clinical course, general medical history, necessary follow-up assessments (including laboratory and imaging results), symptomatic and disease-modifying therapies, and side-effects. Additionally, the registry includes patient-reported outcome measures on quality of life, depression, and fatigue. PoReGer aims to broaden and deepen the understanding on all porphyria-related subjects. We expect these data to significantly improve the management and care of porphyria patients. Additionally, the data can be used for educational purposes to increase awareness, for the planning of healthcare services, and for machine learning algorithms for early detection of porphyrias.

Also flagged:Hydroxyapatitebiomineralizationcitric acidcalciumphosphorouscalcium ions
Journal Article 2024-01-03 No Snippets Jang WY, Pyun JC, Chang JH.
Show Full Abstract

This study reports the effect of the not-calcining process on the bioresorption and biomineralization of hydroxyapatite through in vitro dissolution assessment. The prepared calcined hydroxyapatite (c-HAp) and uncalcined hydroxyapatite (unc-HAp) have a particle size of 2 μm and 13 μm, surface areas of 4.47 m<sup>2</sup>/g and 108.08 m<sup>2</sup>/g, and a Ca/P ratio of 1.66 and 1.52, respectively. In vitro dissolution assessments of c-HAp and unc-HAp were performed for 20 days at 37 °C in a citric acid buffer according to ISO 10993-14. During the dissolution, the c-HAp and unc-HAp confirmed an increase in weight, and the calcium and phosphorous ions were rapidly released. The calcium ions released from c-HAp formed rod-shaped particles with a longer and thinner morphology, while in unc-HAp, they appeared thicker and shorter. In the ICP-OES results, the concentrations of calcium elements were initially increased and then decreased by this formation. The rod-shaped particles identified as calcium citrate (Ca-citrate) through the XRD pattern. The calcium content of Ca-citrate particles from unc-HAp was higher than that from c-HAp. The unc-HAp demonstrated non-toxic properties in a cytotoxicity evaluation. Therefore, due to its higher bioresorption and biomineralization, unc-HAp exhibits enhanced biocompatibility compared to c-HAp.

TNFSF4
Also flagged:hepatocellular carcinomamalignant tumordeathribonucleic acidimmune responseN-myc downregulated gene1
Journal Article 2024-01-03 ✓ 1 Snippet Yang T, Liu J, Liu F, Lei J, Chen S, Ma Z, Ke P, Yang Q, Wen J, He Y, Duan J, Zeng X.
In-Text Gene Mentions

…CD47, CD86, LGALS9,TNFSF4, and TNFSF9.…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a malignant tumor with a high rate of recurrence and m metastasis that does not respond well to current therapies and has a very poor prognosis. Disulfidptosis is a novel mode of cell death that has been analyzed as a novel therapeutic target for HCC cells.<h4>Methods</h4>This study integrated bulk ribonucleic acid (RNA) sequencing datasets, spatial transcriptomics (ST), and single-cell RNA sequencing to explore the landscape of disulfidptosis and the immune microenvironment of HCC cells.<h4>Results</h4>We developed a novel model to predict the prognosis of patients with HCC based on disulfidptosis. The model has good stability, applicability, and prognostic and immune response prediction abilities. N-myc downregulated gene1 (NDRG1) may contribute to poor prognosis by affecting macrophage differentiation, thus allowing HCC cells to evade the immune system.<h4>Conclusion</h4>Our study explores the disulfidptosis of HCC cells through multi-omics and establishes a new putative model that explores possible targets for HCC treatment.

HTT
Also flagged:neurodegenerativeprotein-misfolding diseasesPMDsHuntington's diseaseHDsynaptic transmission
Journal Article 2024-01-03 ✓ 5 Snippets Dinamarca MC, Colombo L, Brykczynska U, Grimm A, Fruh I, Hossain I, Gabriel D, Eckert A, Müller M, Pecho-Vrieseling E.
In-Text Gene Mentions

…disease (HD)-associated mutantHTTexon 1 protein…

…stretch in theHTTprotein (The Huntington's…

…using the MAB5492 anti-HTTantibody (1:5,000; Sigma-Aldri…

…Sigma, A5441), and anti-HTT(1:5,000; Sigma-Aldrich, MAB54…

…1:500; Abcam, ab186735), anti-HTTantibody (1:500; Merck,…

Show Full Abstract

Neuron-to-neuron transmission of aggregation-prone, misfolded proteins may potentially explain the spatiotemporal accumulation of pathological lesions in the brains of patients with neurodegenerative protein-misfolding diseases (PMDs). However, little is known about protein transmission from the central nervous system to the periphery, or how this propagation contributes to PMD pathology. To deepen our understanding of these processes, we established two functional neuromuscular systems derived from human iPSCs. One was suitable for long-term high-throughput live-cell imaging and the other was adapted to a microfluidic system assuring that connectivity between motor neurons and muscle cells was restricted to the neuromuscular junction. We show that the Huntington's disease (HD)-associated mutant HTT exon 1 protein (mHTTEx1) is transmitted from neurons to muscle cells across the human neuromuscular junction. We found that transmission is an active and dynamic process that starts before aggregate formation and is regulated by synaptic activity. We further found that transmitted mHTTEx1 causes HD-relevant pathology at both molecular and functional levels in human muscle cells, even in the presence of the ubiquitous expression of mHTTEx1. In conclusion, we have uncovered a causal link between mHTTEx1 synaptic transmission and HD pathology, highlighting the therapeutic potential of blocking toxic protein transmission in PMDs.

TNFSF4
Also flagged:STINGmelanomacancersInterferon alphaIFN-αtumor
Journal Article 2024-01-03 ✓ 1 Snippet Monti M, Ferrari G, Grosso V, Missale F, Bugatti M, Cancila V, Zini S, Segala A, La Via L, Consoli F, Orlandi M, Valerio A, Tripodo C, Rossato M, Vermi W.
In-Text Gene Mentions

…superfamily member 4 (TNFSF4; also known as…

Show Full Abstract

<h4>Introduction</h4>Plasmacytoid dendritic cells (pDCs) infiltrate a large set of human cancers. Interferon alpha (IFN-α) produced by pDCs induces growth arrest and apoptosis in tumor cells and modulates innate and adaptive immune cells involved in anti-cancer immunity. Moreover, effector molecules exert tumor cell killing. However, the activation state and clinical relevance of pDCs infiltration in cancer is still largely controversial. In Primary Cutaneous Melanoma (PCM), pDCs density decreases over disease progression and collapses in metastatic melanoma (MM). Moreover, the residual circulating pDC compartment is defective in IFN-α production.<h4>Methods</h4>The activation of tumor-associated pDCs was evaluated by <i>in silico</i> and microscopic analysis. The expression of human myxovirus resistant protein 1 (MxA), as surrogate of IFN-α production, and proximity ligation assay (PLA) to test dsDNA-cGAS activation were performed on human melanoma biopsies. Moreover, IFN-α and CXCL10 production by <i>in vitro</i> stimulated (i.e. with R848, CpG-A, ADU-S100) pDCs exposed to melanoma cell lines supernatants (SN-mel) was tested by intracellular flow cytometry and ELISA. We also performed a bulk RNA-sequencing on SN-mel-exposed pDCs, resting or stimulated with R848. Glycolytic rate assay was performed on SN-mel-exposed pDCs using the Seahorse XFe24 Extracellular Flux Analyzer.<h4>Results</h4>Based on a set of microscopic, functional and <i>in silico</i> analyses, we demonstrated that the melanoma milieu directly impairs IFN-α and CXCL10 production by pDCs <i>via</i> TLR-7/9 and cGAS-STING signaling pathways. Melanoma-derived immunosuppressive cytokines and a metabolic drift represent relevant mechanisms enforcing pDC-mediated melanoma escape.<h4>Discussion</h4>These findings propose a new window of intervention for novel immunotherapy approaches to amplify the antitumor innate immune response in cutaneous melanoma (CM).

B4GALT5
Also flagged:lipidoxidoreductasecollagenphagosomeendocytosislactation
Journal Article 2024-01-03 ✓ 1 Snippet Zhao H, Zhao S, Zhu Q, Chen J, Quan Z, Yue X, Cao X.
In-Text Gene Mentions

…carboxylesterase 1 (CES1),β-1,4-galactosyltransferase 55, MACPF domain-containing…

Show Full Abstract

In this study, label-free proteomic technology was applied to analyze and compare the whey proteomes of porcine colostrum and mature milk. In total, 2993 and 2906 whey proteins were detected in porcine colostrum and mature milk, respectively. A total of 2745 common proteins were identified in the two milk samples, and 280 proteins were found to be significantly differentially expressed whey proteins in porcine milk. Gene Ontology analysis demonstrated that the differentially expressed whey proteins were primarily enriched in lipid homeostasis, oxidoreductase activity, and the collagen trimer. Kyoto Encyclopedia of Genes and Genomes analysis suggested that the phagosome and endocytosis were the crucial pathways. This study provides systematic and in-depth insight into the compositions and functional properties of whey proteins in porcine milk during different periods of lactation, which may be beneficial for the development of porcine whey proteins in the future.

Also flagged:Glycerolpolyglycerol-6acrylatesynthesisPolyglycerol-6-acrylateadipate acrylate
Journal Article 2024-01-03 No Snippets Krumins E, Lentz JC, Sutcliffe B, Sohaib A, Jacob PL, Brugnoli B, Cuzzucoli Crucitti V, Cavanagh R, Owen R, Moloney C, Ruiz-Cantu L, Francolini I, Howdle SM, Shusteff M, Rose FRAJ, Wildman RD, He Y, Taresco V.
Show Full Abstract

Volumetric Additive Manufacturing (VAM) represents a revolutionary advancement in the field of Additive Manufacturing, as it allows for the creation of objects in a single, cohesive process, rather than in a layer-by-layer approach. This innovative technique offers unparalleled design freedom and significantly reduces printing times. A current limitation of VAM is the availability of suitable resins with the required photoreactive chemistry and from sustainable sources. To support the application of this technology, we have developed a sustainable resin based on polyglycerol, a bioderived (<i>e.g.</i>, vegetable origin), colourless, and easily functionisable oligomer produced from glycerol. To transform polyglycerol-6 into an acrylate photo-printable resin we adopted a simple, one-step, and scalable synthesis route. Polyglycerol-6-acrylate fulfils all the necessary criteria for volumetric printing (transparency, photo-reactivity, viscosity) and was successfully used to print a variety of models with intricate geometries and good resolution. The waste resin was found to be reusable with minimal performance issues, improving resin utilisation and minimising waste material. Furthermore, by incorporating dopants such as poly(glycerol) adipate acrylate (PGA-A) and 10,12-pentacosadyinoic acid (PCDA), we demonstrated the ability to print objects with a diverse range of functionalities, including temperature sensing probes and a polyester excipient, highlighting the potential applications of these new resins.

HFE
Also flagged:Ferroptosisirondeathdoxorubicinlipidglutathione
Journal Article 2024-01-03 ✓ 1 Snippet Wu L, Zhang Y, Wang G, Ren J.
In-Text Gene Mentions

Moreover, previous evidence indicated that carriers of the HFE C282Y mutation display a higher risk of myocardial infarction and cardiovascular death compared with noncarriers.53

Show Full Abstract

Ferroptosis, an iron-dependent form of regulated cell death, has received increasing attention for its pathophysiologic contribution to the onset and development of doxorubicin-induced cardiotoxicity. Moreover, modulation of ferroptosis with specific inhibitors may provide new therapeutic opportunities for doxorubicin-induced cardiotoxicity. Here, we will review the molecular mechanisms and therapeutic promise of targeting ferroptosis in doxorubicin-induced cardiotoxicity.

Research Square 2024-01-03 Preprint (No Snippets API) Nguyen BT, Balzanelli MG, Distratis P, Lazzaro R, Nguyen KH, Huong HK, Tran TTT, Nhan NH, Nguyen HTT, Ngo TMQ, Nguyen TK, Inchingolo F, Santacroce L, Dipalma G, Nguyen KC, Isacco CG, Duy TH.
Show Full Abstract

<title>Abstract</title> <p>Due to its outstanding biological properties human amniotic membrane (hAM) has been a topic of medical research for many years in trying to treat, repair and regenerate difficult damages related to the epithelial surface, corneal epithelial, orthopedic, and infected body parts. The hAM’s showed also to possess crucial anti-inflammatory, anti-bacterial, and anti-viral properties and immunomodulating qualities. As a consequence, the hAM is one of the most used natural bio-materials in tissue engineering for the construction of bio-scaffolds. We used human hAM (hAM) as a raw material source to home umbilical cord mesenchymal stem cells (hUCB-MSCs) to manufacture collagen membranes that could fully meet the standards for making a skin scaffold, with suitable mechanical strength whilst limiting the risk graft rejection. Among the varieties of stem cells currently being researched MSCs are the most studied and applied due to their outstanding bio-qualities and regenerative features. We used International Society for Cells and Gene Therapy (ISCT) standards to identify and characterize the hUCB-MSCs obtained from a consent donor’s umbilical cord blood. In this study, we used hAM as a scaffold to culture domestic hUBC-MSCs to create human-like epithelial tissues aimed at repairing and regenerating the epithelial layer following trauma, deep damage from accidents, burns, and/or conditions post-operative. We used an inverted phase contrast microscope to observe the cultured growing cells on the amniotic specimens to evaluate morphological changes and epithelial stratification. Staining techniques such as H&E and Trichrome were used to evaluate the morphology and structure of the new epithelial construct, histochemical staining with p63 and ck 1/10 markers was instead used to evaluate the cellular characteristics, the transmission electron microscopy (TEM) was used to validate cell junctions. Ultimately, the results successfully showed the possibility of obtaining human-like epithelial tissue with multiple cell layers with morphology and characteristics similar to human epithelial-like tissue. The results of this study will constitute a potential alternative to autologous skin grafting in cases of heavy skin loss and deep lesions.</p>

Also flagged:immune dysregulationinfectious diseaseantimicrobialinfectioninfectionsmetabolism
Journal Article 2024-01-02 No Snippets Liu HY, Zhu C, Zhu M, Yuan L, Li S, Gu F, Hu P, Chen S, Cai D.
Show Full Abstract

In the livestock production system, the evolution of porcine gut microecology is consistent with the idea of "The Hygiene Hypothesis" in humans. I.e., improved hygiene conditions, reduced exposure to environmental microorganisms in early life, and frequent use of antimicrobial drugs drive immune dysregulation. Meanwhile, the overuse of antibiotics as feed additives for infectious disease prevention and animal growth induces antimicrobial resistance genes in pathogens and spreads related environmental pollutants. It justifies our attempt to review alternatives to antibiotics that can support optimal growth and improve the immunophysiological state of pigs. In the current review, we first described porcine mucosal immunity, followed by discussions of gut microbiota dynamics during the critical weaning period and the impacts brought by antibiotics usage. Evidence of in-feed additives with immuno-modulatory properties highlighting probiotics, prebiotics, and phytobiotics and their cellular and molecular networking are summarized and reviewed. It may provide insights into the immune regulatory mechanisms of antibiotic alternatives and open new avenues for health management in pig production.

Also flagged:ironpolycythemiahyperbilirubinemiaintraventricular hemorrhagenecrotizing enterocolitissepsis
Journal Article 2024-01-02 No Snippets Malik S, Kapu M, Jain MK, Patel B, Kabra N.
Show Full Abstract

<h4>Background</h4>Delayed cord clamping (DCC) is a proven beneficial intervention, but the suggested timings of DCC vary from 30 to 300 seconds after birth or until cord pulsation stops. This study aimed to find the optimum timing of DCC to maximize the benefits such as an increase in hemoglobin, and hematocrit without increasing the risks of polycythemia and hyperbilirubinemia.<h4>Methods</h4>We conducted a single-center prospective observational cohort study. All singleton neonates with gestational age ≥ 28 weeks born at the center in the 17 months of the study period from November 2020 to March 2022 were enrolled. Participants were divided into four groups based on DCC time: group A: <60 sec, group B: 60-119 sec, group C: 120-180 sec, and group D: >180 sec. The primary outcome was the levels of hemoglobin, hematocrit, and bilirubin at 48 hours of life.<h4>Results</h4>Four hundred and eight neonates were enrolled. They were divided into four groups based on the timing of DCC (group A: n = 52, group B: n = 137, group C: n = 155, group D: n = 64). With an increase in the duration of DCC, there was an increase in the level of hemoglobin and hematocrit without an increase in the risk of polycythemia or neonatal hyperbilirubinemia. The benefits were best in group C (120-180 sec) and group D (>180 sec).<h4>Conclusions</h4>DCC of ≥ 120 seconds appears to be optimal where hemoglobin and hematocrit are highest without an increase in the risk of neonatal hyperbilirubinemia. The risk of adverse effects like polycythemia or neonatal hyperbilirubinemia requiring phototherapy did not increase even after extending the time of cord clamping to >180 seconds.

TAOK3
Also flagged:SHP-1degradationThousand-and-one-amino acid kinase 3serine and threonine kinaseSTEkinases
Journal Article 2024-01-02 ✓ 5 Snippets Poirier A, Ormonde JVS, Aubry I, Abidin BM, Feng CH, Martinez-Cordova Z, Hincapie AM, Wu C, Pérez-Quintero LA, Wang CL, Gingras AC, Madrenas J, Tremblay ML.
In-Text Gene Mentions

The loss of TAOK3 had no effect on the abundance of SHP-2, which lacks a residue corresponding to SHP-1 threonine-394.

TAOK3 phosphorylated threonine-394 in the phosphatase domain of SHP-1, which promoted its ubiquitylation and proteasomal degradation.

…SHP-1 degradation byTAOK3ensures the responsiveness…

…acid kinase 3 (TAOK3) is a serine…

…mechanism by whichTAOK3limits the interaction…

Show Full Abstract

Thousand-and-one-amino acid kinase 3 (TAOK3) is a serine and threonine kinase that belongs to the STE-20 family of kinases. Its absence reduces T cell receptor (TCR) signaling and increases the interaction of the tyrosine phosphatase SHP-1, a major negative regulator of proximal TCR signaling, with the kinase LCK, a component of the core TCR signaling complex. Here, we used mouse models and human cell lines to investigate the mechanism by which TAOK3 limits the interaction of SHP-1 with LCK. The loss of TAOK3 decreased the survival of naïve CD4<sup>+</sup> T cells by dampening the transmission of tonic and ligand-dependent TCR signaling. In mouse T cells, Taok3 promoted the secretion of interleukin-2 (IL-2) in response to TCR activation in a manner that depended on <i>Taok3</i> gene dosage and on Taok3 kinase activity. TCR desensitization in <i>Taok3<sup>-/-</sup></i> T cells was caused by an increased abundance of Shp-1, and pharmacological inhibition of Shp-1 rescued the activation potential of these T cells. TAOK3 phosphorylated threonine-394 in the phosphatase domain of SHP-1, which promoted its ubiquitylation and proteasomal degradation. The loss of TAOK3 had no effect on the abundance of SHP-2, which lacks a residue corresponding to SHP-1 threonine-394. Modulation of SHP-1 abundance by TAOK3 thus serves as a rheostat for TCR signaling and determines the activation threshold of T lymphocytes.

TAOK3
Also flagged:amino acid kinasesprotein kinasesaminophosphorylationserinethreonine
Journal Article 2024-01-02 ✓ 1 Snippet Byeon S, Yadav S.
In-Text Gene Mentions

TAOK3

Show Full Abstract

Thousand and one amino acid kinases (TAOKs) are relatively understudied and functionally pleiotropic protein kinases that have emerged as important regulators of neurodevelopment. Through their conserved amino-terminal catalytic domain, TAOKs mediate phosphorylation at serine/threonine residues in their substrates, but it is their divergent regulatory carboxyl-terminal domains that confer both exquisite functional specification and cellular localization. In this Review, we discuss the physiological roles of TAOKs and the intricate signaling pathways, molecular interactions, and cellular behaviors they modulate-from cell stress responses, division, and motility to tissue homeostasis, immunity, and neurodevelopment. These insights are then integrated into an analysis of the known and potential impacts of disease-associated variants of TAOKs, with a focus on neurodevelopmental disorders, pain and addiction, and neurodegenerative diseases. Translating this foundation into clinical benefits for patients will require greater structural and functional differentiation of the TAOKs afforded by their individually specialized domains.

Also flagged:breast cancerestrogenprogesteroneERPRGene Expression
Journal Article 2024-01-02 No Snippets Cheng M, Wang L, Xuan Y, Zhai Z.
Show Full Abstract

<h4>Background</h4>Menopausal status has a known relationship with the levels of estrogen, progesterone, and other sex hormones, potentially influencing the activity of ER, PR, and many other signaling pathways involved in the initiation and progression of breast cancer. However, the differences between premenopausal and postmenopausal breast cancer patients at the molecular level are unclear.<h4>Methods</h4>We retrieved eight datasets from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) associated with menopausal status in breast cancer patients were identified using the MAMA and LIMMA methods. Based on these validated DEGs, we performed Gene Ontology (GO) functional enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. Protein-protein interaction (PPI) networks were constructed. We used DrugBank data to investigate which of these validated DEGs are targetable. Survival analysis was performed to explore the influence of these genes on breast cancer patient prognosis.<h4>Results</h4>We identified 762 DEGs associated with menopausal status in breast cancer patients. PPI network analysis indicated that these genes are primarily involved in pathways such as the cell cycle, oocyte meiosis and progesterone-mediated oocyte maturation pathways. Notably, several genes played roles in multiple signaling pathways and were associated with patient survival. These genes were also observed to be targetable according to the DrugBank database.<h4>Conclusion</h4>We identified DEGs associated with menopausal status in breast cancer patients. The association of these genes with several key pathways may promote understanding of the complex characterizations of breast cancer. Our findings offer valuable insights for developing new therapeutic strategies tailored to the menopausal status of breast cancer patients.

Also flagged:Liver cancermalignant tumortumorinfectiontumorscancer
Journal Article 2024-01-02 No Snippets Zhang J, Xiao Y, Zhang J, Yang Y, Zhang L, Liang F.
Show Full Abstract

Liver cancer is a major malignant tumor, which seriously threatens human health and increases the economic burden on patients. At present, gene therapy has been comprehensively studied as an excellent therapeutic measure in liver cancer treatment. Oncolytic virus (OV) is a kind of virus that can specifically infect and kill tumor cells. After being modified by genetic engineering, the specificity of OV infection to tumor cells is increased, and its influence on normal cells is reduced. To date, OV has shown its effectiveness and safety in experimental and clinical studies on a variety of tumors. Thus, this review primarily introduces the current status of different genetically engineered OVs used in gene therapy for liver cancer, focuses on the application of OVs and different target genes for current liver cancer therapy, and identifies the problems encountered in OVs-based combination therapy and the corresponding solutions, which will provide new insights into the treatment of liver cancer.

SERPINC1
Also flagged:heparinsepsiscoagulation disorderdisseminated intravascular coagulationcoagulation disorderscoagulation
Journal Article 2024-01-02 ✓ 1 Snippet Sun Y, Ding R, Sun H, Liang Y, Ma X.
In-Text Gene Mentions

…D-dimer, FDP, andantithrombin-III), and blood gas…

Show Full Abstract

<h4>Background</h4>Disseminated intravascular coagulation (DIC) occurs in 30-50% of septic patients and contributes to high mortality in the intensive care unit (ICU). However, there are few proven interventions for coagulation disorder management in sepsis. Experimental and clinical data have demonstrated that sepsis could benefit from unfractionated heparin (UFH) treatment. To date, there are no large multicenter trials to determine the safety and efficacy of UFH in septic patients with suspected DIC.<h4>Methods</h4>A multicenter, double-blinded, placebo-controlled randomized trial is designed to recruit 600 patients who met sepsis 3.0 criteria and suspected DIC. Participants will be randomized (1:1) to receive UFH or saline via continuous intravenous administration for 7 days within 6 h of enrolment. The primary outcome is ICU mortality. The secondary outcome includes 28-day all-cause mortality, the improvement of Sequential Organ Failure Assessment scores, and the incidence of major hemorrhage. Investigators, participants, and statisticians will be blinded to the allocation.<h4>Discussion</h4>The HepSIC trial is to evaluate the efficacy and safety of UFH on sepsis-related DIC across different areas of China. The small dosage of UFH administration would offer a new potential approach for treating sepsis-related coagulation disorders.<h4>Ethics and dissemination</h4>Ethical approval was granted by all the ethics committees of 20 participant centers. Results will be disseminated via peer-reviewed publications and presented at conferences.<h4>Trial registration</h4>ClinicalTrials.gov NCT02654561. Registered on 13 January 2016.

OLFM4
Also flagged:p53MHC class IIgastrointestinal syndromeTumor suppressor p53IL12p40
Journal Article 2024-01-02 ✓ 5 Snippets Wang J, Chang CY, Yang X, Zhou F, Liu J, Bargonetti J, Zhang L, Xie P, Feng Z, Hu W.
In-Text Gene Mentions

…performed using an anti-Olfm4antibody (Cata#: 39141…

…Abcam, 1:5000 dilution), anti-Olfm4(Cata#: 39141 S,…

…(IF) staining ofOlfm4, an ISC marker…

…the number ofOlfm4+ viable ISCs…

…reduced number ofOlfm4+ viable ISCs…

Show Full Abstract

Radiation-induced gastrointestinal syndrome is a major complication and limiting factor for radiotherapy. Tumor suppressor p53 has a protective role in radiation-induced gastrointestinal toxicity. However, its underlying mechanism remains unclear. Here we report that regulating the IL12-p40/MHC class II signaling pathway is a critical mechanism by which p53 protects against radiation-induced gastrointestinal syndrome. p53 inhibits the expression of inflammatory cytokine IL12-p40, which in turn suppresses the expression of MHC class II on intestinal epithelial cells to suppress T cell activation and inflammation post-irradiation that causes intestinal stem cell damage. Anti-IL12-p40 neutralizing antibody inhibits inflammation and rescues the defects in intestinal epithelial regeneration post-irradiation in p53-deficient mice and prolongs mouse survival. These results uncover that the IL12-p40/MHC class II signaling mediates the essential role of p53 in ensuring intestinal stem cell function and proper immune reaction in response to radiation to protect mucosal epithelium, and suggest a potential therapeutic strategy to protect against radiation-induced gastrointestinal syndrome.

Also flagged:Melanomacutaneous cancerskin cancerbasal cell carcinomasquamous cell carcinomatumor
Journal Article 2024-01-02 No Snippets Feng C, Yu A, Wang Z, Wang K, Chen J, Wu Y, Deng T, Chen H, Hou Y, Ma S, Dai X, Huang L.
Show Full Abstract

<h4>Background</h4>Podoplanin (PDPN) is a highly conserved, mucin-type protein specific to the lymphatic system. Overexpression of PDPN is associated with the progression of various solid tumors, and plays an important roles in the tumor microenvironment by regulating the immune system. However, the role of PDPN-mediated signal activation in the progression of melanoma is still unknown.<h4>Methods</h4>PDPN expression was first analyzed in 112 human melanoma tissue microarrays and melanoma cell lines. Functional experiments including proliferation, clone formation, migration, and metastasis were utilized to identify the suppressive effects of PDPN. The Ph.D.TM-12 Phage Display Peptide Library was used to obtain a PDPN antagonist peptide, named CY12-RP2. The immunofluorescence, SPR assay, and flow cytometry were used to identify the binding specificity of CY12-RP2 with PDPN in melanoma cells. Functional and mechanistic assays in vivo and in vitro were performed for discriminating the antitumor and immune activation effects of CY12-RP2.<h4>Results</h4>PDPN was overexpressed in melanoma tissue and cells, and inhibited melanoma cells proliferation, migration, and metastasis by blocking the EMT and Wnt/β-catenin pathway. PDPN antagonistic peptide, CY12-RP2, could specifically bind with PDPN, suppressing melanoma various functions inducing apoptosis in both melanoma cells and 3D spheroids. CY12-RP2 also enhanced the anti-tumor capacity of PBMC, and inhibited melanoma cells growth both in xenografts and allogeneic mice model. Moreover, CY12-RP2 could inhibit melanoma lung metastasis, and abrogated the immunosuppressive effects of PDPN by increasing the proportion of CD3 + CD4 + T cells, CD3 + CD8 + T cells, CD49b + Granzyme B + NK cells, and CD11b + CD86 + M1-like macrophages and the levels of IL-1β, TNF-α, and IFN-γ.<h4>Conclusions</h4>This study has demonstrated the important role of PDPN in the progression of melanoma and formation of immunosuppressive environment, and provided a potential approach of treating melanoma using the novel CY12-RP2 peptide. In melanoma, PDPN is overexpressed in the cancer cells, and promotes melanoma cells growth and metastasis through activating the Wnt/β-catenin pathway. Treatment with the PDPN antagonistic peptide CY12-RP2 could not only inhibit the melanoma growth and metastasis both in vitro and in vivo through Wnt/β-catenin pathway blockade, but also abrogate the immunosuppressive effects of PDPN through modulating immune cells.

ZNF644
Also flagged:G9aPrdm12neurogenesismethyltransferasezincgene expression
Journal Article 2024-01-02 ✓ 1 Snippet Tsimpos P, Desiderio S, Cabochette P, Poelvoorde P, Kricha S, Vanhamme L, Poulard C, Bellefroid EJ.
In-Text Gene Mentions

…proteins WIZ andZNF644have been also…

Show Full Abstract

Prdm12 is an epigenetic regulator expressed in developing and mature nociceptive neurons, playing a key role in their specification during neurogenesis and modulating pain sensation at adulthood. In vitro studies suggested that Prdm12 recruits the methyltransferase G9a through its zinc finger domains to regulate target gene expression, but how Prdm12 interacts with G9a and whether G9a plays a role in Prdm12's functional properties in sensory ganglia remain unknown. Here we report that Prdm12-G9a interaction is likely direct and that it involves the SET domain of G9a. We show that both proteins are largely co-expressed in dorsal root ganglia during early murine development, opening the possibility that G9a plays a role in DRG and may act as a mediator of Prdm12's function in the development of nociceptive sensory neurons. To test this hypothesis, we conditionally inactivated G9a in neural crest using a Wnt1-Cre transgenic mouse line. We found that the specific loss of G9a in the neural crest lineage does not lead to dorsal root ganglia hypoplasia due to the loss of somatic nociceptive neurons nor to the ectopic expression of the visceral determinant Phox2b as observed upon Prdm12 ablation. These findings suggest that Prdm12 function in the initiation of the nociceptive lineage does not critically involves its interaction with G9a.

Also flagged:phosphoruscarbonphosphatasedegradationNitrogenP deficiency
Journal Article 2024-01-02 No Snippets Dutta A, Hazra KK, Nath CP, Kumar N, Singh SS, Praharaj CS.
Show Full Abstract

An insight into the dynamics of soil phosphorus (P) pools with long-term cropping/management practices would help in designing efficient and sustainable management module(s). The study aimed to investigate the long-term impact of diversified rice-based rotations and variable nutrient management practices on the dynamic composition of P pools and their influence on systems' base-crop productivity in an alkaline soil of Indo-Gangetic plain (Fluvisol). Treatments consisted of four rotations [rice-wheat (R-W), rice-wheat-mungbean (R-W-Mb), rice-wheat-rice-chickpea (R-W-R-C), rice-chickpea (R-C)] each with three nutrient treatments [control (CT), integrated nutrient management (INM), sole-chemical fertilizers (CF)]. Notably, R-C exhibited higher levels of bioavailable-P (soluble-P, Ca<sub>2</sub>-P, labile-Po), particularly in subsurface soil depth (0.2-0.4 m) compared to other rotations. Likewise, the inclusion of chickpea every alternate year (R-W-R-C) resulted in higher Ca<sub>2</sub>-P (40%), labile-Pi (15%), labile-Po (11%), and moderately labile Po (8%) compared to R-W rotation demonstrating an increased significance of chickpea in maintaining a favorable soil P regime in alkaline soil. Both R-C and R-W-R-C reduced the surface-to-subsurface depth ratio (SSBR) of soluble-P and Ca<sub>2</sub>-P while increasing the ratio for microbial biomass P. Even with a suboptimal fertilizer-P rate, INM significantly increased soluble-P (4-33%), labile-Po (13-17%), microbial biomass P (10-26%), moderately labile-Po (4-17%) compared to CF and exhibited higher SSBR values. Correlation analysis demonstrated the substantial influence of very-labile carbon, microbial and phosphatase activities on P availability. The treatment-induced changes in labile-P pools significantly influenced rice (base-crop) yields. In conclusion, chickpea-inclusive diversification and INM could be a sustainable approach to enhance P bioavailability and crop productivity in tropical rice soils.

Also flagged:cancermultidrug resistanceleukemiaChronic myelogenous leukemiaCMLmyeloproliferative disorder
Journal Article 2024-01-02 No Snippets Laiolo J, Graikioti DG, Barbieri CL, Joray MB, Antoniou AI, Vera DMA, Athanassopoulos CM, Carpinella MC.
Show Full Abstract

Chemotherapy is a powerful means of cancer treatment but its efficacy is compromised by the emergence of multidrug resistance (MDR), mainly linked to the efflux transporter ABCB1/P-glycoprotein (P-gp). Based on the chemical structure of betulin, identified in our previous work as an effective modulator of the P-gp function, a series of analogs were designed, synthesized and evaluated as a source of novel inhibitors. Compounds 6g and 6i inhibited rhodamine 123 efflux in the P-gp overexpressed leukemia cells, K562/Dox, at concentrations of 0.19 µM and 0.39 µM, respectively, and increased the intracellular accumulation of doxorubicin at the submicromolar concentration of 0.098 µM. Compounds 6g and 6i were able to restore the sensitivity of K562/Dox to Dox at 0.024 µM and 0.19 µM, respectively. Structure-activity relationship analysis and molecular modeling revealed important information about the structural features conferring activity. All the active compounds fitted in a specific region involving mainly transmembrane helices (TMH) 4-6 from one homologous half and TMH 7 and 12 from the other, also showing close contacts with TMH 6 and 12. Compounds that bound preferentially to another region were inactive, regardless of their free energy of binding. It should be noted that compounds 6g and 6i were devoid of toxic effects against peripheral blood mononuclear normal cells and erythrocytes. The data obtained indicates that both compounds might be proposed as scaffolds for obtaining promising P-gp inhibitors for overcoming MDR.

DCC
Also flagged:lung carcinomaLewis lung carcinomacancerCdkn2aCdkn2bRAS
Journal Article 2024-01-02 ✓ 4 Snippets He Q, Sun C, Pan Y.
In-Text Gene Mentions

…, Trp53 ,Dcc, and Cacna1d…

…other TSGs, i.e.,Dccand Cacna1d ,…

…Csmd3 25 ,Dcc25 , Epha3…

…the Trp53 ,Dcc, and Cacna1d…

Show Full Abstract

Lewis lung carcinoma (LLC), as a widely used preclinical cancer model, has still not been genetically and genomically characterized. Here, we performed a whole-exome sequencing analysis on the LLC cell line to elucidate its molecular characteristics and etiologies. Our data showed that LLC originated from a male mouse belonging to C57BL/6L (a transitional strain between C57BL/6J and C57BL/6N) and contains substantial somatic SNV and InDel mutations (> 20,000). Extensive regional mutation clusters are present in its genome, which were caused mainly by the mutational processes underlying the SBS1, SBS5, SBS15, SBS17a, and SBS21 signatures during frequent structural rearrangements. Thirty three deleterious mutations are present in 30 cancer genes including Kras, Nras, Trp53, Dcc, and Cacna1d. Cdkn2a and Cdkn2b are biallelically deleted from the genome. Five pathways (RTK/RAS, p53, cell cycle, TGFB, and Hippo) are oncogenically deregulated or affected. The major mutational processes in LLC include chromosomal instability, exposure to metabolic mutagens, spontaneous 5-methylcytosine deamination, defective DNA mismatch repair, and reactive oxygen species. Our data also suggest that LLC is a lung cancer similar to human lung adenocarcinoma. This study lays a molecular basis for the more targeted application of LLC in preclinical research.

Also flagged:watersynthesisantibodypolycarbonatesiliconpore
Journal Article 2024-01-02 No Snippets Lashkaripour A, McIntyre DP, Calhoun SGK, Krauth K, Densmore DM, Fordyce PM.
Show Full Abstract

Droplet microfluidics enables kHz screening of picoliter samples at a fraction of the cost of other high-throughput approaches. However, generating stable droplets with desired characteristics typically requires labor-intensive empirical optimization of device designs and flow conditions that limit adoption to specialist labs. Here, we compile a comprehensive droplet dataset and use it to train machine learning models capable of accurately predicting device geometries and flow conditions required to generate stable aqueous-in-oil and oil-in-aqueous single and double emulsions from 15 to 250 μm at rates up to 12000 Hz for different fluids commonly used in life sciences. Blind predictions by our models for as-yet-unseen fluids, geometries, and device materials yield accurate results, establishing their generalizability. Finally, we generate an easy-to-use design automation tool that yield droplets within 3 μm (<8%) of the desired diameter, facilitating tailored droplet-based platforms and accelerating their utility in life sciences.

PEBP1
Also flagged:bindingpeptideslocalizationpost-translational modificationsamino aciddiazirines
Journal Article 2024-01-02 ✓ 1 Snippet Wozniak JM, Li W, Governa P, Chen LY, Jadhav A, Dongre A, Forli S, Parker CG.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Photoaffinity probes are routinely utilized to identify proteins that interact with small molecules. However, despite this common usage, resolving the specific sites of these interactions remains a challenge. Here we developed a chemoproteomic workflow to determine precise protein binding sites of photoaffinity probes in cells. Deconvolution of features unique to probe-modified peptides, such as their tendency to produce chimeric spectra, facilitated the development of predictive models to confidently determine labeled sites. This yielded an expansive map of small-molecule binding sites on endogenous proteins and enabled the integration with multiplexed quantitation, increasing the throughput and dimensionality of experiments. Finally, using structural information, we characterized diverse binding sites across the proteome, providing direct evidence of their tractability to small molecules. Together, our findings reveal new knowledge for the analysis of photoaffinity probes and provide a robust method for high-resolution mapping of reversible small-molecule interactions en masse in native systems.

Also flagged:immune responseCHI1chromosomesnucleotideARS1RCC
Journal Article 2024-01-02 No Snippets Chessari G, Criscione A, Marletta D, Crepaldi P, Portolano B, Manunza A, Cesarani A, Biscarini F, Mastrangelo S.
Show Full Abstract

Heterozygosity-rich regions (HRR) are genomic regions of high heterozygosity, which may harbor loci related to key functional traits such as immune response, survival rate, fertility, and other fitness traits. This study considered 30 Italian and 19 worldwide goat breeds genotyped with the Illumina GoatSNP50k BeadChip. The aim of the work was to study inter-breed relationships and HRR patterns using Sliding Window (SW) and Consecutive Runs (CR) detection methods. Genetic relationships highlighted a clear separation between non-European and European breeds, as well as the north-south geographic cline within the latter. The Pearson correlation coefficients between the descriptive HRR parameters obtained with the SW and CR methods were higher than 0.9. A total of 166 HRR islands were detected. CHI1, CHI11, CHI12 and CHI18 were the chromosomes harboring the highest number of HRR islands. The genes annotated in the islands were linked to various factors such as productive, reproductive, immune, and environmental adaptation mechanisms. Notably, the Montecristo feral goat showed the highest number of HRR islands despite the high level of inbreeding, underlining potential balancing selection events characterizing its evolutionary history. Identifying a species-specific HRR pattern could provide a clearer view of the mechanisms regulating the genome modelling following anthropogenic selection combined with environmental interaction.

SERPINC1
Also flagged:Methylphenyl1,2,3,6-tetrahydropyridinegastrointestinal ulcersdopaminegastric ulcer disease
Journal Article 2024-01-02 ✓ 1 Snippet Wang CY, Ye YS, Long WH, Li ZL, Zheng H, Lin XR, Zhou W, Tang DH.
In-Text Gene Mentions

…RPL18, SERPINA1, SERPINA6,SERPINC1, SOD1, SST, VASP,…

Show Full Abstract

1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) is a neurotoxin that can cause gastrointestinal ulcers by affecting dopamine levels. Therefore, MPTP has been considered a toxic substance that causes gastric ulcer disease in experimental animals. In this study, tree shrews were used as the animal model of gastric mucosa injury, and MPTP was intraperitoneally injected at a lower MPTP dosage 2 mg/kg/day for 13 weeks, while tree shrews were not injected as the control group. Under the light microscope, local congestion or diffuse bleeding points of gastric mucosa and multiple redness and swelling bleeding symptoms on the inner wall were observed in the treatment group, as well as immune cell infiltration was found in HE staining, but no such phenomenon was observed in the control group. In order to explore the molecular basis of changes in MPTP induced gastric mucosa injury, the transcriptome and proteome data of gastric mucosa were analyzed. We observed significant differences in mRNA and protein expression levels under the influence of MPTP. The changes in mRNA and proteins are related to increased immune infiltration, cellular processes and angiogenesis. More differentially expressed genes play a role in immune function, especially the candidate genes RPL4 and ANXA1 with significant signal and core role. There are also differentially expressed genes that play a role in mucosal injury and shedding, especially candidate genes GAST and DDC with certain signaling and corresponding functions. Understanding the factors and molecular basis that affect the expression of related genes is crucial for coping with Emotionality gastric mucosa injury disease and developing new treatment methods to establish the ability to resist disease.

STAU1
Also flagged:RBPamino acidpolymeraseoligonucleotideattBBP
Journal Article 2024-01-02 ✓ 2 Snippets Schmok JC, Jain M, Street LA, Tankka AT, Schafer D, Her HL, Elmsaouri S, Gosztyla ML, Boyle EA, Jagannatha P, Luo EC, Kwon EJ, Jovanovic M, Yeo GW.
In-Text Gene Mentions

STAU1, which scored 2.68/5,…

…similarity with paralogueSTAU1: a multi-functional RBP…

Show Full Abstract

RNA-binding proteins (RBPs) modulate alternative splicing outcomes to determine isoform expression and cellular survival. To identify RBPs that directly drive alternative exon inclusion, we developed tethered function luciferase-based splicing reporters that provide rapid, scalable and robust readouts of exon inclusion changes and used these to evaluate 718 human RBPs. We performed enhanced cross-linking immunoprecipitation, RNA sequencing and affinity purification-mass spectrometry to investigate a subset of candidates with no prior association with splicing. Integrative analysis of these assays indicates surprising roles for TRNAU1AP, SCAF8 and RTCA in the modulation of hundreds of endogenous splicing events. We also leveraged our tethering assays and top candidates to identify potent and compact exon inclusion activation domains for splicing modulation applications. Using these identified domains, we engineered programmable fusion proteins that outperform current artificial splicing factors at manipulating inclusion of reporter and endogenous exons. This tethering approach characterizes the ability of RBPs to induce exon inclusion and yields new molecular parts for programmable splicing control.

SERPINC1
Also flagged:thrombosespulmonary artery thrombosismesenteric vein thrombosisarterial thrombosis of theclottingchromosome
Journal Article 2024-01-02 ✓ 1 Snippet Wei X, Zhang H, Chen W, Zhang J, Dai J.
In-Text Gene Mentions

…VWF, PROC, PROS1,SERPINC1, SERPIND1, PROCR, THBD,…

Show Full Abstract

Hereditary predisposition play an important role in thrombosis, especially in younger patients. Here we studied a young patient who experienced three different episodes of severe thromboses, some of which were life-threatening (pulmonary artery thrombosis, portal and mesenteric vein thrombosis, and arterial thrombosis of the lower leg). Blood levels of clotting related indicators were assessed. We screened 35 genes linked to thrombosis. We discovered a 756 kb duplication that spanned the F9 gene in region q27.1 of the X chromosome. The repeat includes the full F9 gene, thus, the patient had two functional copies of FIX with the FIX activity 192%. An identical repetition was found in the patient's mother. Both the patient and his mother had high, but variable, plasma FIX activities that promote coagulation. The patient's frequent, severe thrombolic events maybe attributed to the duplication of a big portion of the F9 gene and lupus anticoagulant positive.

Also flagged:aginghypoxia-inducible factor 1-alphainflammatory responseCD62L-associatedcancer
Journal Article 2024-01-02 No Snippets Lv J, Zhang C, Liu X, Gu C, Liu Y, Gao Y, Huang Z, Jiang Q, Chen B, He D, Wang T, Xu Z, Su W.
Show Full Abstract

<h4>Background</h4>Aging is a holistic change that has a major impact on the immune system, and immunosenescence contributes to the overall progression of aging. The bone marrow is the most important hematopoietic immune organ, while the spleen, as the most important extramedullary hematopoietic immune organ, maintains homeostasis of the human hematopoietic immune system (HIS) in cooperation with the bone marrow. However, the overall changes in the HIS during aging have not been described. Here, we describe a hematopoietic immune map of the spleen and bone marrow of young and old mice using single-cell sequencing and flow cytometry techniques.<h4>Results</h4>We observed extensive, complex changes in the HIS during aging. Compared with young mice, the immune cells of aged mice showed a marked tendency toward myeloid differentiation, with the neutrophil population accounting for a significant proportion of this response. In this change, hypoxia-inducible factor 1-alpha (Hif1α) was significantly overexpressed, and this enhanced the immune efficacy and inflammatory response of neutrophils. Our research revealed that during the aging process, hematopoietic stem cells undergo significant changes in function and composition, and their polymorphism and differentiation abilities are downregulated. Moreover, we found that the highly responsive CD62L + HSCs were obviously downregulated in aging, suggesting that they may play an important role in the aging process.<h4>Conclusions</h4>Overall, aging extensively alters the cellular composition and function of the HIS. These findings could potentially give high-dimensional insights and enable more accurate functional and developmental analyses as well as immune monitoring in HIS aging.

SERPINC1
Also flagged:SHHmyosin 10MYO10WNTtissue developmentneural tube
Journal Article 2024-01-02 ✓ 1 Snippet Hall ET, Dillard ME, Cleverdon ER, Zhang Y, Daly CA, Ansari SS, Wakefield R, Stewart DP, Pruett-Miller SM, Lavado A, Carisey AF, Johnson A, Wang YD, Selner E, Tanes M, Ryu YS, Robinson CG, Steinberg J, Ogden SK.
In-Text Gene Mentions

Protease-III

Show Full Abstract

During development, morphogens pattern tissues by instructing cell fate across long distances. Directly visualizing morphogen transport in situ has been inaccessible, so the molecular mechanisms ensuring successful morphogen delivery remain unclear. To tackle this longstanding problem, we developed a mouse model for compromised sonic hedgehog (SHH) morphogen delivery and discovered that endocytic recycling promotes SHH loading into signaling filopodia called cytonemes. We optimized methods to preserve in vivo cytonemes for advanced microscopy and show endogenous SHH localized to cytonemes in developing mouse neural tubes. Depletion of SHH from neural tube cytonemes alters neuronal cell fates and compromises neurodevelopment. Mutation of the filopodial motor myosin 10 (MYO10) reduces cytoneme length and density, which corrupts neuronal signaling activity of both SHH and WNT. Combined, these results demonstrate that cytoneme-based signal transport provides essential contributions to morphogen dispersion during mammalian tissue development and suggest MYO10 is a key regulator of cytoneme function.

Also flagged:aminoesterosteoarthritisOAchronic inflammatory diseaseacetaminophen
Journal Article 2024-01-02 No Snippets Alghamdi R, Pertusati F, Prokopovich P.
Show Full Abstract

Disease-modifying osteoarthritis drugs (DMOADs) are a new therapeutic class for osteoarthritis (OA) prevention or inhibition of the disease development. Unfortunately, none of the DMOADs have been clinically approved due to their poor therapeutic performances in clinical trials. The joint environment has played a role in this process by limiting the amount of drug effectively delivered as well as the time that the drug stays within the joint space. The current study aimed to improve the delivery of the DMOADs into cartilage tissue by increasing uptake and retention time of the DMOADs within the tissue. Licofelone was used a model DMOAD due to its significant therapeutic effect against OA progression as shown in the recent phase III clinical trial. For this purpose licofelone was covalently conjugated to the two different A16 and A87 poly-beta-amino-ester (PBAEs) polymers taking advantage of their hydrolysable, cytocompatible, and cationic nature. We have shown cartilage uptake of the licofelone-PBAE conjugates increased 18 times and retention in tissues was prolonged by 37 times compared to the equivalent dose of the free licofelone. Additionally, these licofelone conjugates showed no detrimental effect on the chondrocyte viability. In conclusion, the cationic A87 and A16 PBAE polymers increased the amount of licofelone within the cartilage, which could potentially enhance the therapeutic effect and pharmacokinetic performance of this drug and other DMOADs clinically.

Also flagged:ApelinVEGF-CSecondary lymphedemaAPLNlymphatic endothelial cell gene expressionbinding
Journal Article 2024-01-02 No Snippets Creff J, Lamaa A, Benuzzi E, Balzan E, Pujol F, Draia-Nicolau T, Nougué M, Verdu L, Morfoisse F, Lacazette E, Valet P, Chaput B, Gross F, Gayon R, Bouillé P, Malloizel-Delaunay J, Bura-Rivière A, Prats AC, Garmy-Susini B.
Show Full Abstract

Secondary lymphedema (LD) corresponds to a severe lymphatic dysfunction leading to the accumulation of fluid and fibrotic adipose tissue in a limb. Here, we identified apelin (APLN) as a powerful molecule for regenerating lymphatic function in LD. We identified the loss of APLN expression in the lymphedematous arm compared to the normal arm in patients. The role of APLN in LD was confirmed in APLN knockout mice, in which LD is increased and associated with fibrosis and dermal backflow. This was reversed by intradermal injection of APLN-lentivectors. Mechanistically, APLN stimulates lymphatic endothelial cell gene expression and induces the binding of E2F8 transcription factor to the promoter of CCBE1 that controls VEGF-C processing. In addition, APLN induces Akt and eNOS pathways to stimulate lymphatic collector pumping. Our results show that APLN represents a novel partner for VEGF-C to restore lymphatic function in both initial and collecting vessels. As LD appears after cancer treatment, we validated the APLN-VEGF-C combination using a novel class of nonintegrative RNA delivery LentiFlash® vector that will be evaluated for phase I/IIa clinical trial.

Also flagged:HydroxyapatiteBumetanideMeloxicamwaternanorodssynthesis
Journal Article 2024-01-02 No Snippets Friuli V, Maggi L, Bruni G, Caso F, Bini M.
Show Full Abstract

Poorly water-soluble drugs represent a challenge for the pharmaceutical industry because it is necessary to find properly tuned and efficient systems for their release. In this framework, organic-inorganic hybrid systems could represent a promising strategy. A largely diffused inorganic host is hydroxyapatite (HAP, Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>), which is easily synthesized with different external forms and can adsorb different kinds of molecules, thereby allowing rapid drug release. Hybrid nanocomposites of HAP nanorods, obtained through hydrothermal synthesis, were prepared with two model pharmaceutical molecules characterized by low and pH-dependent solubility: meloxicam, a non-steroidal anti-inflammatory drug, and bumetanide, a diuretic drug. Both hybrids were physically and chemically characterized through the combined use of X-ray powder diffraction, scanning electron microscopy with energy-dispersive spectroscopy, differential scanning calorimetry, and infrared spectroscopy measurements. Then, their dissolution profiles and hydrophilicity (contact angles) in different media as well as their solubility were determined and compared to the pure drugs. This hybrid system seems particularly suitable as a drug carrier for bumetanide, as it shows higher drug loading and good dissolution profiles, while is less suitable for meloxicam, an acid molecule.

CCPG1ZNFX1
Also flagged:Hepatocellular carcinomaobesitymetabolic-dysfunction-related fatty liver diseasehistone modificationscancerviral hepatitis
Journal Article 2024-01-02 ✓ 5 Snippets Shah M, Sarkar D.
In-Text Gene Mentions

lncRNA ZFAS1 (ZNFX1 antisense RNA1) levels correlated with intra- and extrahepatic HCC metastasis and poor prognosis, and it promoted HCC progression by squelching miRNA-150 with resultant upregulation of ZEB1 and matrix metalloproteinases MMP14 and MMP16 [170].

Sorafenib-resistant Hep3B and HuH-7 cells showed the enrichment of genes related to stemness and EMT, and single-cell RNA-sequencing in sorafenib-resistant HuH-7 cells identified the lncRNA ZFAS1 (ZNFX1 antisense RNA 1) as the highest upregulated transcript, which positively correlated with multiple stemness and EMT-associated genes in HCC patients [199].

…the lncRNA ZFAS1 (ZNFX1 antisense RNAantisense RNA 1)…

Cell cycle associated protein 1cycle associated protein…

ZNFX1antisense RNA 1…

Show Full Abstract

Hepatocellular carcinoma (HCC) presents a significant global health threat, particularly in regions endemic to hepatitis B and C viruses, and because of the ongoing pandemic of obesity causing metabolic-dysfunction-related fatty liver disease (MAFLD), a precursor to HCC. The molecular intricacies of HCC, genetic and epigenetic alterations, and dysregulated signaling pathways facilitate personalized treatment strategies based on molecular profiling. Epigenetic regulation, encompassing DNA methyltion, histone modifications, and noncoding RNAs, functions as a critical layer influencing HCC development. Long noncoding RNAs (lncRNAs) are spotlighted for their diverse roles in gene regulation and their potential as diagnostic and therapeutic tools in cancer. In this review, we explore the pivotal role of lncRNAs in HCC, including MAFLD and viral hepatitis, the most prevalent risk factors for hepatocarcinogenesis. The dysregulation of lncRNAs is implicated in HCC progression by modulating chromatin regulation and transcription, sponging miRNAs, and influencing structural functions. The ongoing studies on lncRNAs contribute to a deeper comprehension of HCC pathogenesis and offer promising routes for precision medicine, highlighting the utility of lncRNAs as early biomarkers, prognostic indicators, and therapeutic targets.

Also flagged:neurodegenerative disordersoxygenpathogenesissynapseautophagiamanganese superoxide dismutase
Journal Article 2024-01-02 No Snippets Houldsworth A.
Show Full Abstract

Neurological disorders include a variety of conditions, including Alzheimer's disease, motor neuron disease and Parkinson's disease, affecting longevity and quality of life, and their pathogenesis is associated with oxidative stress. Several of the chronic neurodegenerative pathologies of the CNS share some common features, such as oxidative stress, inflammation, synapse dysfunctions, protein misfolding and defective autophagia. Neuroinflammation can involve the activation of mast cells, contributing to oxidative stress, in addition to other sources of reactive oxygen species. Antioxidants can powerfully neutralize reactive oxygen species and free radicals, decreasing oxidative damage. Antioxidant genes, like the manganese superoxide dismutase enzyme, can undergo epigenetic changes that reduce their expression, thus increasing oxidative stress in tissue. Alternatively, DNA can be altered by free radical damage. The epigenetic landscape of these genes can change antioxidant function and may result in neurodegenerative disease. This imbalance of free radical production and antioxidant function increases the reactive oxygen species that cause cell damage in neurons and is often observed as an age-related event. Increased antioxidant expression in mice is protective against reactive oxygen species in neurons as is the exogenous supplementation of antioxidants. Manganese superoxide dismutase requires manganese for its enzymic function. Antioxidant therapy is considered for age-related neurodegenerative diseases, and a new mimetic of a manganese superoxide dismutase, avasopasem manganese, is described and suggested as a putative treatment to reduce the oxidative stress that causes neurodegenerative disease. The aim of this narrative review is to explore the evidence that oxidative stress causes neurodegenerative damage and the role of antioxidant genes in inhibiting reactive oxygen species damage. Can the neuronal environment of oxidative stress, causing neuroinflammation and neurodegeneration, be reduced or reversed?

Also flagged:steroidogenic enzymes17β-HSD5α-reductaseandrogen receptorsARgestation
Journal Article 2024-01-02 No Snippets Lemos GAA, Santos AC, Brito DCC, Novaes MAS, Assis Neto AC.
Show Full Abstract

The present study aims to establish the morphological, morphometric, and immunostaining patterns of the steroidogenic enzymes 17β-HSD and 5α-reductase and androgen receptors (AR) during the prenatal development of the male gonad and epididymis of Cavia porcellus. Fetuses at 22, 25, 30, 40, 45, 50, and 60 days of gestation (DG) were used. Specimens were dissected and subjected to macroscopic, histological, histomorphometric, and immunohistochemical analyses. Genital and scrotal protrusions were identified in 22 DG embryos. Gonocytes were identified at 25 DG and the formation of primary testicular cords was observed at 30 DG. Through anatomical evaluation, we observed differentiation of the epididymis into the head, body, and tail at 45 DG. During development, there is a progressive decrease in the diameters of the testicular cords and epididymal ducts. 17β-HSD enzyme immunostaining was observed in Leydig cells at all ages, while 5α-reductase was observed in Leydig cell cytoplasm and gonocytes at 40, 50, and 60 DG. AR shows gonocyte labeling at 30 DG. Thus, from the second trimester of pregnancy, it is possible to observe patterns of anatomical development, such as genital and scrotal prominence (22 DG), the appearance of gonocytes in the testicular cords at 25 DG, and the beginning of the organization of primary testicular cords at 30 DG, suggesting sexual differentiation. The 17β-HSD, 5α-reductase, and ARs play an essential role in sexual development and differentiation, presenting immunostaining at different reproductive process times.

HTT
Also flagged:Amyloid-βtauAlzheimer diseaseADbrain diseasesmild cognitive impairment
Journal Article 2024-01-02 ✓ 1 Snippet Tao QQ, Cai X, Xue YY, Ge W, Yue L, Li XY, Lin RR, Peng GP, Jiang W, Li S, Zheng KM, Jiang B, Jia JP, Guo T, Wu ZY.
In-Text Gene Mentions

…and a positiveHTTgene genetic test.…

Show Full Abstract

Amyloid-β, tau pathology, and biomarkers of neurodegeneration make up the core diagnostic biomarkers of Alzheimer disease (AD). However, these proteins represent only a fraction of the complex biological processes underlying AD, and individuals with other brain diseases in which AD pathology is a comorbidity also test positive for these diagnostic biomarkers. More AD-specific early diagnostic and disease staging biomarkers are needed. In this study, we performed tandem mass tag proteomic analysis of paired cerebrospinal fluid (CSF) and serum samples in a discovery cohort comprising 98 participants. Candidate biomarkers were validated by parallel reaction monitoring-based targeted proteomic assays in an independent multicenter cohort comprising 288 participants. We quantified 3,238 CSF and 1,702 serum proteins in the discovery cohort, identifying 171 and 860 CSF proteins and 37 and 323 serum proteins as potential early diagnostic and staging biomarkers, respectively. In the validation cohort, 58 and 21 CSF proteins, as well as 12 and 18 serum proteins, were verified as early diagnostic and staging biomarkers, respectively. Separate 19-protein CSF and an 8-protein serum biomarker panels were built by machine learning to accurately classify mild cognitive impairment (MCI) due to AD from normal cognition with areas under the curve of 0.984 and 0.881, respectively. The 19-protein CSF biomarker panel also effectively discriminated patients with MCI due to AD from patients with other neurodegenerative diseases. Moreover, we identified 21 CSF and 18 serum stage-associated proteins reflecting AD stages. Our findings provide a foundation for developing blood-based tests for AD screening and staging in clinical practice.

Also flagged:Hydroxyapatitewatermetalsmembranemetal oxidescarbons
Journal Article 2024-01-02 No Snippets Kim HJ, Choi JH, Lee S, Han GS, Jung HS.
Show Full Abstract

To address the growing concerns regarding severe water pollution, effective and environmentally friendly adsorbents must be identified. In this study, we prepared hydroxyapatite (HAp, Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) as an eco-friendly absorbent via simple precipitation and obtained rod- (r-HAp) and plate-shaped HAp (p-HAp). The approach to obtaining p-HAp involved a low pH titration rate, promoting growth along the <i>c</i>-axis due to the adsorption of OH<sup>-</sup> on the (110) facet. Conversely, r-HAp was obtained by maintaining a high concentration of OH<sup>-</sup> during the initial stage through rapid pH titration, leading to a stronger restrictive effect on the growth of positively charged <i>a</i>(<i>b</i>)-planes. p-HAp demonstrated superior adsorption capacity, removing Pb through dissolution and recrystallization, achieving an impressive 625 mg/g within a 60 min reaction time compared to r-HAp. Our findings afford insights into the Pb removal mechanisms of HAp with different morphologies and can aid in the development of water purification strategies against heavy metal contamination.

Also flagged:hydroxyapatitesilanewaterSynthesis-hydroxybutyrate-hydroxyvalerate
Journal Article 2024-01-02 No Snippets Sadat-Shojai M, Kalantari-Lalari M, Asadnia M.
Show Full Abstract

In general, the efficiency of reinforcement for filler-based composites is greatly influenced by the filler properties. While much research has been conducted on filler percentage and filler-matrix bonding quality, there is not much research directed to the effect of filler geometry. Therefore, the aim of this article is to examine how a three-dimensional (3D) bioactive filler influences the strength enhancement of biomedical polymers. This was accomplished by first synthesizing highly regular dandelion-like hydroxyapatite (DHA) as a 3D bioactive filler using an optimized hydrothermal method, followed by surface modification with silane molecules. Poly(3-hydroxybutyrate-<i>co</i>-3-hydroxyvalerate) (PHBV) was then used as a biomedical polymer model to fabricate solution-casted composites by using the as-synthesized DHA particles. The results showed that the composites loaded with the surface-modified DHA particles had significantly higher tensile strength and elastic modulus compared to the neat PHBV and composites having irregular particles. In addition to the mechanical properties, our research found that the 3D DHA filler had a significant impact on the biological characteristics of the PHBV, such as water wettability, biodegradability, bioactivity, and in vitro cell response. These findings suggested that particle geometry can play a more significant role in affecting the biological and mechanical performance of biomedical polymers than previously thought.

Also flagged:tumorangiogenesiscancerpiwibloodmalignant tumors
Journal Article 2024-01-02 No Snippets Su Z, Li W, Lei Z, Hu L, Wang S, Guo L.
Show Full Abstract

Non-coding RNAs, including microRNAs, long non-coding RNAs, and circular RNAs, have been identified as crucial regulators of various biological processes through epigenetic regulation, transcriptional regulation, and post-transcriptional regulation. Growing evidence suggests that dysregulation and activation of non-coding RNAs are closely associated with tumor angiogenesis, a process essential for tumor growth and metastasis and a major contributor to cancer-related mortality. Therefore, understanding the molecular mechanisms underlying tumor angiogenesis is of utmost importance. Numerous studies have documented the involvement of different types of non-coding RNAs in the regulation of angiogenesis. This review provides an overview of how non-coding RNAs regulate tumor angiogenesis. Additionally, we discuss emerging strategies that exploit non-coding RNAs for anti-angiogenic therapy in cancer treatment. Ultimately, this review underscores the crucial role played by non-coding RNAs in tumor angiogenesis and highlights their potential as therapeutic targets for anti-angiogenic interventions against cancer.

SERPINC1
Also flagged:neurological diseaseneurologic diseaseshomeostasisobesitymetabolic syndrometype 2 diabetes mellitus
Journal Article 2024-01-02 ✓ 1 Snippet Hayden MR.
In-Text Gene Mentions

…endfeet; AQP4, aquaporin-4;ATIII, BBB, blood–brain barrier;…

Show Full Abstract

The recently described perivascular unit (PVU) resides immediately adjacent to the true capillary neurovascular unit (NVU) in the postcapillary venule and contains the normal-benign perivascular spaces (PVS) and pathological enlarged perivascular spaces (EPVS). The PVS are important in that they have recently been identified to be the construct and the conduit responsible for the delivery of metabolic waste from the interstitial fluid to the ventricular cerebrospinal fluid for disposal into the systemic circulation, termed the glymphatic system. Importantly, the outermost boundary of the PVS is lined by protoplasmic perivascular astrocyte endfeet (pvACef) that communicate with regional neurons. As compared to the well-recognized and described neurovascular unit (NVU) and NVU coupling, the PVU is less well understood and remains an emerging concept. The primary focus of this narrative review is to compare the similarities and differences between these two units and discuss each of their structural and functional relationships and how they relate not only to brain homeostasis but also how they may relate to the development of multiple clinical neurological disease states and specifically how they may relate to obesity, metabolic syndrome, and type 2 diabetes mellitus. Additionally, the concept and importance of a perisynaptic astrocyte coupling to the neuronal synapses with pre- and postsynaptic neurons will also be considered as a perisynaptic unit to provide for the creation of the information transfer in the brain via synaptic transmission and brain homeostasis. Multiple electron microscopic images and illustrations will be utilized in order to help explain these complex units.

Also flagged:diabetessynthesislipiddiacylglycerolstriglyceridesphospholipids
Journal Article 2024-01-02 No Snippets Guan A, Hou Y, Yang R, Qin J.
Show Full Abstract

Functional lipids, primarily derived through the modification of natural lipids by various processes, are widely acknowledged for their potential to impart health benefits. In contrast to chemical methods for lipid modification, enzymatic catalysis offers distinct advantages, including high selectivity, mild operating conditions, and reduced byproduct formation. Nevertheless, enzymes face challenges in industrial applications, such as low activity, stability, and undesired selectivity. To address these challenges, protein engineering techniques have been implemented to enhance enzyme performance in functional lipid synthesis. This article aims to review recent advances in protein engineering, encompassing approaches from directed evolution to rational design, with the goal of improving the properties of lipid-modifying enzymes. Furthermore, the article explores the future prospects and challenges associated with enzyme-catalyzed functional lipid synthesis.

HTT
Also flagged:Neurodegenerative DiseasesNeurodegenerative diseasedeathoxygenmitochondrialsynaptic transmission
Journal Article 2024-01-01 ✓ 1 Snippet Bandiwadekar A, Khot KB, Gopan G, Jose J.
In-Text Gene Mentions

The cause of Huntington's disease is the repeat expansion of CAG in the mutant HTT gene, which leads to polyglutamine tract enlargement in the N‐terminal of the Huntington (Htt) protein.

Show Full Abstract

Neurodegenerative disease (ND) is the fourth leading cause of death worldwide, with limited symptomatic therapies. Mitochondrial dysfunction is a major risk factor in the progression of ND, and it-increases the generation of reactive oxygen species (ROS). Overexposure to these ROS induces apoptotic changes leading to neuronal cell death. Many studies have shown the prominent effect of phytobioactive compounds in managing mitochondrial dysfunctions associated with ND, mainly due to their antioxidant properties. The drug delivery to the brain is limited due to the presence of the blood-brain barrier (BBB), but effective drug concentration needs to reach the brain for the therapeutic action. Therefore, developing safe and effective strategies to enhance drug entry in the brain is required to establish ND's treatment. The microneedle-based drug delivery system is one of the effective non-invasive techniques for drug delivery through the transdermal route. Microneedles are micronsized drug delivery needles that are self-administrable. It can penetrate through the stratum corneum skin layer without hitting pain receptors, allowing the phytobioactive compounds to be released directly into systemic circulation in a controlled manner. With all of the principles mentioned above, this review discusses microneedles as a versatile drug delivery carrier for the phytoactive compounds as a therapeutic potentiating agent for targeting mitochondrial dysfunction for the management of ND.

DCC
Also flagged:GISTKITPDGFRAKDRVEGFR2FLT3
Journal Article 2024-01-01 ✓ 1 Snippet Huang C, Ma X, Wang M, Cao H.
In-Text Gene Mentions

Ripretinib (Qinlock; DCC-2618) is a kinase inhibitor of KIT and PDGFRA.

Show Full Abstract

<h4>Background</h4>Molecular targeted therapies are the most important type of medical treatment for GIST, but the development of GIST drugs and their targets have not been summarized.<h4>Methods</h4>Drugs in the field of GIST were analyzed and collated through Pharmaprojects, ClinicalTrials. gov and PharmaGO databases.<h4>Results</h4>As of 2021, there are 75 drugs that have appeared in the GIST clinical trials. The six most frequent targets in GIST clinical trials, in descending order of frequency, were KIT, PDGFRA, KDR (VEGFR2), FLT3, FLT1 (VEGFR1), and FLT4/VEGFR3. Only 8 drugs are in preclinical research. There are challenges in the development of new drugs for GIST.<h4>Conclusion</h4>This article analyzes and summarizes the general situation of GIST drugs, the target distribution of GIST drugs, and the trends in GIST drug-related clinical trials.

HTT
Also flagged:Neurodegenerative disorderssclerosisADPDHDtranslational
Journal Article 2024-01-01 ✓ 2 Snippets Singh S, Chib S, Akhtar MJ, Kumar B, Chawla PA, Bhatia R.
In-Text Gene Mentions

In Drosphilia melanogaster HD flies, crocin has been reported to prevent Escherichia coli colonization, which is implicated in HTT aggregation and HD-associated immobility [169].

Besides, luteolin is reported to interact with the mutant form of HTT.

Show Full Abstract

Neurodegenerative disorders (NDDs) are multifaceted complex disorders that have put a great health and economic burden around the globe nowadays. The multi-factorial nature of NDDs has presented a great challenge in drug discovery and continuous efforts are in progress in search of suitable therapeutic candidates. Nature has a great wealth of active principles in its lap that has cured the human population since ancient times. Natural products have revealed several benefits over conventional synthetic medications and scientists have shifted their vision towards exploring the therapeutic potentials of natural products in the past few years. The structural mimicking of natural compounds to endogenous ligands has presented them as a potential therapeutic candidate to prevent the development of NDDs. In the presented review, authors have summarized demographical facts about various NDDs including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD) and various types of sclerosis in the brain. The significant findings of new active principles of natural origin along with their therapeutic potentials on NDDs have been included. Also, a description of clinical trials and patents on natural products has been enlisted in this compilation. Although natural products have shown promising success in drug discovery against NDDs, still their use is associated with several ethical issues which need to be solved in the upcoming time.

Also flagged:neurological illnessesneurodegenerative diseasespathogenesisneurodegenerative disordersbrain-derived neurotrophic factorBDNF
Journal Article 2024-01-01 No Snippets Koyya P, Manthari RK, Pandrangi SL.
Show Full Abstract

The burden of neurological illnesses on global health is significant. Our perception of the molecular and biological mechanisms underlying intellectual processing and behavior has significantly advanced over the last few decades, laying the groundwork for potential therapies for various neurodegenerative diseases. A growing body of literature reveals that most neurodegenerative diseases could be due to the gradual failure of neurons in the brain's neocortex, hippocampus, and various subcortical areas. Research on various experimental models has uncovered several gene components to understand the pathogenesis of neurodegenerative disorders. One among them is the brain-derived neurotrophic factor (BDNF), which performs several vital functions, enhancing synaptic plasticity and assisting in the emergence of long-term thoughts. The pathophysiology of some neurodegenerative diseases, including Alzheimer's, Parkinson's, Schizophrenia, and Huntington's, has been linked to BDNF. According to numerous research, high levels of BDNF are connected to a lower risk of developing a neurodegenerative disease. As a result, we want to concentrate on BDNF in this article and outline its protective role against neurological disorders.

Also flagged:Alzheimer's DiseaseADoxygenangiogenesisPDEPDGF
Journal Article 2024-01-01 No Snippets Chum PP, Bishara MA, Solis SR, Behringer EJ.
Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is associated with impaired cerebral circulation which underscores diminished delivery of blood oxygen and nutrients to and throughout the brain. In the 3xTg-AD mouse model, we have recently found that > 10 cerebrovascular miRNAs pertaining to vascular permeability, angiogenesis, and inflammation (e.g., let-7d, miR-99a, miR-132, miR-133a, miR-151-5p, and miR-181a) track early development of AD. Further, endothelial-specific miRNAs (miR-126-3p, miR-23a/b, miR-27a) alter with onset of overall AD pathology relative to stability of smooth muscle/pericyte-specific miRNAs (miR-143, miR-145).<h4>Objective</h4>We tested the hypothesis that cerebrovascular miRNAs indicating AD pathology share mRNA targets that regulate key endothelial cell functions such as angiogenesis, vascular permeability, and blood flow regulation.<h4>Methods</h4>As detected by NanoString nCounter miRNA Expression panel for 3xTg-AD mice, 61 cerebrovascular miRNAs and respective mRNA targets were examined using Ingenuity Pathway Analysis for canonical Cardiovascular (Cardio) and Nervous System (Neuro) Signaling.<h4>Results</h4>The number of targets regulated per miRNA were 21±2 and 33±3 for the Cardio and Neuro pathways respectively, whereby 14±2 targets overlap among pathways. Endothelial miRNAs primarily target members of the PDE, PDGF, SMAD, and VEGF families. Individual candidates regulated by≥4 miRNAs that best mark AD pathology presence in 3xTg-AD mice include CFL2, GRIN2B, PDGFB, SLC6A1, SMAD3, SYT3, and TNFRSF11B.<h4>Conclusion</h4>miRNAs selective for regulation of endothelial function and respective downstream mRNA targets support a molecular basis for dysregulated cerebral blood flow regulation coupled with enhanced cell growth, proliferation, and inflammation.

Also flagged:Hypoxia-inducible Factor-1Bladder cancermalignant tumorsHypoxia-inducible factorHIFtranscription factor
Journal Article 2024-01-01 No Snippets Chai J, Yin S, Feng W, Zhang T, Ke C.
Show Full Abstract

Bladder cancer (BC) is one of the most common malignant tumors worldwide and poses a significant hazard to human health. During the development of BC, hypoxia plays a crucial role. Hypoxia-inducible factor (HIF) is a key transcription factor for hypoxic adaptation, which regulates the transcription of various genes, including inflammation, angiogenesis, and glycolytic metabolism. Recent studies have shown the precise role of HIF in various biological behaviors of BC. More importantly, a new antitumor medication targeting HIF-2 has been used to treat renal cancer. However, therapies targeting HIF-1 in BC have not yet been developed. In this review, we discussed how HIF-1 is expressed and affects the growth, metastasis, and angiogenesis of BC. At the same time, we investigated several HIF-1 inhibitors that provide new perspectives for targeting HIF-1.

SOX6
Also flagged:neurogenesisdelusionneural stem cell proliferationsynapseneurotransmittercancer
Journal Article 2024-01-01 ✓ 1 Snippet Hussain G, Akram R, Anwar H, Sajid F, Iman T, Han HS, Raza C, De Aguilar JG.
In-Text Gene Mentions

Aldh1L1: A kind of gene; BLBP: brain lipid binding protein; CD24: singnal transducer; DCX: doublecortin; Dgx: digoxin; DLX2: distal-less homeobox 2; Fox03: forkhead box O-3; GFAP: glial fibrillary acidic protein; GjA1: gap junction alpha 1 protein; GLAST: glutamate transporter; Glul: glutamate-ammonia ligase; Ki67: nuclear antigen; Mash1: transcription factor; MCM2: minichromosome maintaince complex component 2; NeuroD: neuronal differentiation factor; PAX6: paired box protein; Ph3: phosphine; Prox1: prospero homeobox protein 1; PSA-NCAM: polysialylated neuronal cell adhesion molecule; PygB: glycogen phosphorylase B; S100β: calcium binding protein; SGZ: subgranular zone; Sox2: SRY-box 2; Sox6: a kind of gene; SVZ: subventricular zone; TBR2: transcription factor; TLX: orphan nuclear receptor; Tuj1: beta III tublin antibody.

Show Full Abstract

Adult neurogenesis, the process of creating new neurons, involves the coordinated division, migration, and differentiation of neural stem cells. This process is restricted to neurogenic niches located in two distinct areas of the brain: the subgranular zone of the dentate gyrus of the hippocampus and the subventricular zone of the lateral ventricle, where new neurons are generated and then migrate to the olfactory bulb. Neurogenesis has been thought to occur only during the embryonic and early postnatal stages and to decline with age due to a continuous depletion of neural stem cells. Interestingly, recent years have seen tremendous progress in our understanding of adult brain neurogenesis, bridging the knowledge gap between embryonic and adult neurogenesis. Here, we discuss the current status of adult brain neurogenesis in light of what we know about neural stem cells. In this notion, we talk about the importance of intracellular signaling molecules in mobilizing endogenous neural stem cell proliferation. Based on the current understanding, we can declare that these molecules play a role in targeting neurogenesis in the mature brain. However, to achieve this goal, we need to avoid the undesired proliferation of neural stem cells by controlling the necessary checkpoints, which can lead to tumorigenesis and prove to be a curse instead of a blessing or hope.

Also flagged:cannabinoidschizophreniaendocannabinoidpsychosistraumaCNR1
Journal Article 2024-01-01 No Snippets Colizzi M, Bortoletto R, Antolini G, Bhattacharyya S, Balestrieri M, Solmi M.
Show Full Abstract

<h4>Background</h4>The diathesis-stress paradigm and the cannabinoid-hypothesis have been proposed as possible pathophysiological models of schizophrenia. However, they have historically been studied independently of each other.<h4>Objective</h4>This PRISMA 2020-compliant systematic review aimed at reappraising the interplay between the hypothalamic-pituitary-adrenal (HPA) axis and the endocannabinoid (eCB) system in psychosis- spectrum disorder risk and outcome.<h4>Methods</h4>All pathophysiological and outcome clinical studies, concomitantly evaluating the two systems in psychosis-spectrum disorder risk and different stages of illness, were gathered from electronic databases (Pubmed, Web of Science, and Scopus), and discussed.<h4>Results</h4>41 eligible outputs were extracted, focusing on at least a biological measure (9 HPA-related studies: 4 eCB-interventional, 1 HPA-interventional, 1 both HPA-interventional and non-interventional, 3 non-interventional; 2 eCB-related studies: non-interventional), environmental measures only (29 studies: 1 eCB- interventional, 28 non-interventional), and genetic measures (1 study: non-interventional). Independent contributions of aberrancies in the two systems to the physiopathology and outcome of psychosis were confirmed. Also, concomitant alterations in the two systems, either genetically defined (e.g., CNR1 genetic variation), biologically determined (e.g., dysfunctional HPA axis or endocannabinoid signaling), or behaviorally imputed (e.g., cannabis use, stress exposure, and response), were consistently reported in psychosis. Further, a complex biobehavioral perturbation was revealed not only within each system (e.g., cannabis use affecting the eCB tone, stress exposure affecting the HPA axis), but also across the two systems (e.g., THC affecting the HPA axis, childhood trauma affecting the endocannabinoid signaling).<h4>Conclusion</h4>There is a need to concomitantly study the two systems' mechanistic contribution to psychosis in order to establish more refined biological relevance.

CACNA1E
Also flagged:calciumVoltage-gated calcium channelsmigrainecell bodiesdepolarizationglutamate
Journal Article 2024-01-01 ✓ 5 Snippets de Amorim Ferreira M, Ferreira J.
In-Text Gene Mentions

There are three studies that reported the association of single-nucleotide polymorphisms in the Cav2.3 gene (CACNA1E) with postoperative pain and opioid consumption as well as with the prevalence of migraine in patients.<h4>Conclusion</h4>Cav2.3 is a target for some analgesic drugs and has a pro-nociceptive role in pain.

…the Cav2.3 gene (CACNA1E) with postoperative pain…

…a polymorphism inCACNA1Egene and phenotypes…

…gle-nucleotide polymorphism inCACNA1Egene required less…

…same polymorphism inCACNA1Eled to higher…

Show Full Abstract

<h4>Background</h4>Voltage-gated calcium channels (VGCCs) play an important role in pain development and maintenance. As Cav2.2 and Cav3.2 channels have been identified as potential drug targets for analgesics, the participation of Cav2.3 (that gives rise to R-type calcium currents) in pain and analgesia remains incompletely understood.<h4>Objective</h4>Identify the participation of Cav2.3 in pain and analgesia.<h4>Methods</h4>To map research in this area as well as to identify any existing gaps in knowledge on the potential role of Cav2.3 in pain signalling, we conducted this scoping review. We searched PubMed and SCOPUS databases, and 40 articles were included in this study. Besides, we organized the studies into 5 types of categories within the broader context of the role of Cav2.3 in pain and analgesia.<h4>Results</h4>Some studies revealed the expression of Cav2.3 in pain pathways, especially in nociceptive neurons at the sensory ganglia. Other studies demonstrated that Cav2.3-mediated currents could be inhibited by analgesic/antinociceptive drugs either indirectly or directly. Some articles indicated that Cav2.3 modulates nociceptive transmission, especially at the pre-synaptic level at spinal sites. There are studies using different rodent pain models and approaches to reduce Cav2.3 activity or expression and mostly demonstrated a pro-nociceptive role of Cav2.3, despite some contradictory findings and deficiencies in the description of study design quality. There are three studies that reported the association of single-nucleotide polymorphisms in the Cav2.3 gene (CACNA1E) with postoperative pain and opioid consumption as well as with the prevalence of migraine in patients.<h4>Conclusion</h4>Cav2.3 is a target for some analgesic drugs and has a pro-nociceptive role in pain.

HTT
Also flagged:NucleotidedepressionAffective DisordersCYP2D6BDNFCOMT
Journal Article 2024-01-01 ✓ 3 Snippets Zhang Z, Yang Y, Kong W, Huang S, Tan Y, Huang S, Zhang M, Lu H, Li Y, Li X, Liu S, Wen Y, Shang D.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) gene may be…

…correlation between the5-HTTand childhood adversity,…

…allele of the5-HTTare less likely…

Show Full Abstract

<h4>Background</h4>Genetic polymorphism has been proven to have an important association with depression, which can influence the risk of developing depression, the efficacy of medications, and adverse effects <i>via</i> metabolic and neurological pathways. Nonetheless, aspects of the association between single nucleotide polymorphisms and depression have not been systematically investigated by bibliometric analysis.<h4>Objective</h4>The aim of this study was to analyze the current status and trends of single nucleotide polymorphism research on depression through bibliometric and visual analysis.<h4>Methods</h4>The Web of Science Core Collection was used to retrieve 10,043 articles that were published between 1998 and 2021. CiteSpace (6.1 R4) was used to perform collaborative network analysis, co-citation analysis, co-occurrence analysis, and citation burst detection.<h4>Results</h4>The most productive and co-cited journals were the Journal of Affective Disorders and Biological Psychiatry, respectively, and an analysis of the references showed that the most recent research focused on the largest thematic cluster, "5-HT", reflecting the important research base in this area. "<i>CYP2D6</i>" has been in the spotlight since its emergence in 2009 and has become a research hotspot since its outbreak in 2019. However, "<i>BDNF ", "COMT </i>", "older adults", "loci", and "DNA methylation" are also the new frontier of research, and some of them are currently in the process of exploration.<h4>Conclusion</h4>These findings offer a useful perspective on existing research and potential future approaches in the study of the association between single nucleotide polymorphisms and depression, which may assist researchers in selecting appropriate collaborators or journals.

PRDX6
Also flagged:colorectal cancergene expressionPDE7BTRPS1METRNLC14orf166
Journal Article 2024-01-01 ✓ 1 Snippet Chen Z, Song W, Shu XO, Wen W, Devall M, Dampier C, Moratalla-Navarro F, Cai Q, Long J, Van Kaer L, Wu L, Huyghe JR, Thomas M, Hsu L, Woods MO, Albanes D, Buchanan DD, Gsur A, Hoffmeister M, Vodicka P, Wolk A, Marchand LL, Wu AH, Phipps AI, Moreno V, Ulrike P, Zheng W, Casey G, Guo X.
In-Text Gene Mentions

PRDX6

Show Full Abstract

<h4>Background</h4>Transcriptome-wide association studies have been successful in identifying candidate susceptibility genes for colorectal cancer (CRC). To strengthen susceptibility gene discovery, we conducted a large transcriptome-wide association study and an alternative splicing transcriptome-wide association study in CRC using improved genetic prediction models and performed in-depth functional investigations.<h4>Methods</h4>We analyzed RNA-sequencing data from normal colon tissues and genotype data from 423 European descendants to build genetic prediction models of gene expression and alternative splicing and evaluated model performance using independent RNA-sequencing data from normal colon tissues of the Genotype-Tissue Expression Project. We applied the verified models to genome-wide association studies (GWAS) summary statistics among 58 131 CRC cases and 67 347 controls of European ancestry to evaluate associations of genetically predicted gene expression and alternative splicing with CRC risk. We performed in vitro functional assays for 3 selected genes in multiple CRC cell lines.<h4>Results</h4>We identified 57 putative CRC susceptibility genes, which included the 48 genes from transcriptome-wide association studies and 15 genes from splicing transcriptome-wide association studies, at a Bonferroni-corrected P value less than .05. Of these, 16 genes were not previously implicated in CRC susceptibility, including a gene PDE7B (6q23.3) at locus previously not reported by CRC GWAS. Gene knockdown experiments confirmed the oncogenic roles for 2 unreported genes, TRPS1 and METRNL, and a recently reported gene, C14orf166.<h4>Conclusion</h4>This study discovered new putative susceptibility genes of CRC and provided novel insights into the biological mechanisms underlying CRC development.

HTT
Also flagged:Antibodyimmunoglobulinsbindingantibodiesmultiple sclerosisMS
Journal Article 2024-01-01 ✓ 1 Snippet Manoutcharian K, Gevorkian G.
In-Text Gene Mentions

…studies reporting varioushtt-targeting antibody fragments …

Show Full Abstract

Recombinant antibody fragments are promising alternatives to full-length immunoglobulins, creating big opportunities for the pharmaceutical industry. Nowadays, antibody fragments such as antigen-binding fragments (Fab), single-chain fragment variable (scFv), single-domain antibodies (sdAbs), and bispecific antibodies (bsAbs) are being evaluated as diagnostics or therapeutics in preclinical models and in clinical trials. Immunotherapy approaches, including passive transfer of protective antibodies, have shown therapeutic efficacy in several animal models of Alzheimer's disease (AD), Parkinson's disease (PD), frontotemporal dementia (FTD), Huntington's disease (HD), transmissible spongiform encephalopathies (TSEs) and multiple sclerosis (MS). There are various antibodies approved by the Food and Drug Administration (FDA) for treating multiple sclerosis and two amyloid beta-specific humanized antibodies, Aducanumab and Lecanemab, for AD. Our previous review summarized data on recombinant antibodies evaluated in pre-clinical models for immunotherapy of neurodegenerative diseases. Here, we explore recent studies in this fascinating research field, give an update on new preventive and therapeutic applications of recombinant antibody fragments for neurological disorders and discuss the potential of antibody fragments for developing novel approaches for crossing the blood-brain barrier (BBB) and targeting cells and molecules of interest in the brain.

Also flagged:aginggene expressionmethylationactivityFOXO3APOE
Journal Article 2024-01-01 No Snippets Rafikova E, Nemirovich-Danchenko N, Ogmen A, Parfenenkova A, Velikanova A, Tikhonov S, Peshkin L, Rafikov K, Spiridonova O, Belova Y, Glinin T, Egorova A, Batin M.
Show Full Abstract

The Open Genes database was created to enhance and simplify the search for potential aging therapy targets. We collected data on 2402 genes associated with aging and developed convenient tools for searching and comparing gene features. A comprehensive description of genes has been provided, including lifespan-extending interventions, age-related changes, longevity associations, gene evolution, associations with diseases and hallmarks of aging, and functions of gene products. For each experiment, we presented the necessary structured data for evaluating the experiment's quality and interpreting the study's findings. Our goal was to stay objective and precise while connecting a particular gene to human aging. We distinguished six types of studies and 12 criteria for adding genes to our database. Genes were classified according to the confidence level of the link between the gene and aging. All the data collected in a database are provided both by an API and a user interface. The database is publicly available on a website at https://open-genes.org/.

Also flagged:peptidepeptidasescysteine proteasesamideesterthiol ester
Journal Article 2024-01-01 No Snippets Dos Santos Nascimento IJ, Gomes JNS, de Oliveira Viana J, de Medeiros E Silva YMS, Barbosa EG, de Moura RO.
Show Full Abstract

A large family of enzymes with the function of hydrolyzing peptide bonds, called peptidases or cysteine proteases (CPs), are divided into three categories according to the peptide chain involved. CPs catalyze the hydrolysis of amide, ester, thiol ester, and thioester peptide bonds. They can be divided into several groups, such as papain-like (CA), viral chymotrypsin-like CPs (CB), papainlike endopeptidases of RNA viruses (CC), legumain-type caspases (CD), and showing active residues of His, Glu/Asp, Gln, Cys (CE). The catalytic mechanism of CPs is the essential cysteine residue present in the active site. These mechanisms are often studied through computational methods that provide new information about the catalytic mechanism and identify inhibitors. The role of computational methods during drug design and development stages is increasing. Methods in Computer-Aided Drug Design (CADD) accelerate the discovery process, increase the chances of selecting more promising molecules for experimental studies, and can identify critical mechanisms involved in the pathophysiology and molecular pathways of action. Molecular dynamics (MD) simulations are essential in any drug discovery program due to their high capacity for simulating a physiological environment capable of unveiling significant inhibition mechanisms of new compounds against target proteins, especially CPs. Here, a brief approach will be shown on MD simulations and how the studies were applied to identify inhibitors or critical information against cysteine protease from several microorganisms, such as <i>Trypanosoma cruzi</i> (cruzain), <i>Trypanosoma brucei</i> (rhodesain), <i>Plasmodium spp</i>. (falcipain), and SARS-CoV-2 (M<sup>pro</sup>). We hope the readers will gain new insights and use our study as a guide for potential compound identifications using MD simulations.

Also flagged:RBPpeptidereverse transcriptionbindingpeptidesRNase R
Journal Article 2024-01-01 No Snippets Wu W, Zhao F, Zhang J.
Show Full Abstract

Recent studies have demonstrated the important regulatory role of circRNAs, but an in-depth understanding of the comprehensive landscape of circRNAs across various species still remains unexplored. The current circRNA databases are often species-restricted or based on outdated datasets. To address this challenge, we have developed the circAtlas 3.0 database, which contains a rich collection of 2674 circRNA sequencing datasets, curated to delineate the landscape of circRNAs within 33 distinct tissues spanning 10 vertebrate species. Notably, circAtlas 3.0 represents a substantial advancement over its precursor, circAtlas 2.0, with the number of cataloged circRNAs escalating from 1 007 087 to 3 179 560, with 2 527 528 of them being reconstructed into full-length isoforms. circAtlas 3.0 also introduces several notable enhancements, including: (i) integration of both Illumina and Nanopore sequencing datasets to detect circRNAs of extended lengths; (ii) employment of a standardized nomenclature scheme for circRNAs, providing information of the host gene and full-length circular exons; (iii) inclusion of clinical cancer samples to explore the biological function of circRNAs within the context of cancer and (iv) links to other useful resources to enable user-friendly analysis of target circRNAs. The updated circAtlas 3.0 provides an important platform for exploring the evolution and biological implications of vertebrate circRNAs, and is freely available at http://circatlas.biols.ac.cn and https://ngdc.cncb.ac.cn/circatlas.

Also flagged:RNF185COL3A1Prostate CancerRING finger domain-containing ubiquitin ligasedegradationProstate tumor
Journal Article 2024-01-01 No Snippets Van Espen B, Oo HZ, Collins C, Fazli L, Molinolo A, Yip K, Murad R, Gleave M, Ronai ZA.
Show Full Abstract

RNF185 is a RING finger domain-containing ubiquitin ligase implicated in ER-associated degradation. Prostate tumor patient data analysis revealed a negative correlation between RNF185 expression and prostate cancer progression and metastasis. Likewise, several prostate cancer cell lines exhibited greater migration and invasion capabilities in culture upon RNF185 depletion. Subcutaneous inoculation of mouse prostate cancer MPC3 cells stably expressing short hairpin RNA against RNF185 into mice resulted in larger tumors and more frequent lung metastases. RNA-sequencing and Ingenuity Pathway Analysis identified wound-healing and cellular movement among the most significant pathways upregulated in RNF185-depleted lines, compared with control prostate cancer cells. Gene Set Enrichment Analyses performed in samples from patients harboring low RNF185 expression and in RNF185-depleted lines confirmed the deregulation of genes implicated in epithelial-to-mesenchymal transition. Among those, COL3A1 was identified as the primary mediator of RNF185's ability to impact migration phenotypes. Correspondingly, enhanced migration and metastasis of RNF185 knockdown (KD) prostate cancer cells were attenuated upon co-inhibition of COL3A1. Our results identify RNF185 as a gatekeeper of prostate cancer metastasis, partly via its control of COL3A1 availability.<h4>Implications</h4>RNF185 is identified as an important regulator of prostate cancer migration and metastasis, in part due to its regulation of COL3A1. Both RNF185 and COL3A1 may serve as novel markers for prostate tumors.

HTT
Also flagged:Neurodegenerative Diseasesregulation ofgene expressionAlzheimer's diseaseADParkinson's disease
Journal Article 2024-01-01 ✓ 2 Snippets Saleem A, Javed M, Akhtar MF, Sharif A, Akhtar B, Naveed M, Saleem U, Baig MMFA, Zubair HM, Bin Emran T, Saleem M, Ashraf GM.
In-Text Gene Mentions

In HD, mutation in the huntingtin (Htt) protein interferes with Ago1 and Ago2, thus affecting the miRNA biogenesis.

…in the huntingtin (Htt) protein interferes with…

Show Full Abstract

<h4>Background</h4>MicroRNAs (miRNA) are small noncoding RNAs that play a significant role in the regulation of gene expression. The literature has explored the key involvement of miRNAs in the diagnosis, prognosis, and treatment of various neurodegenerative diseases (NDD), such as Alzheimer's disease (AD), Parkinson's disease (PD), and Huntington's disease (HD). The miRNA regulates various signalling pathways; its dysregulation is involved in the pathogenesis of NDD.<h4>Objective</h4>The present review is focused on the involvement of miRNAs in the pathogenesis of NDD and their role in the treatment or management of NDD. The literature provides comprehensive and cutting-edge knowledge for students studying neurology, researchers, clinical psychologists, practitioners, pathologists, and drug development agencies to comprehend the role of miRNAs in the NDD's pathogenesis, regulation of various genes/signalling pathways, such as α-synuclein, P53, amyloid-β, high mobility group protein (HMGB1), and IL-1β, NMDA receptor signalling, cholinergic signalling, etc. Methods: The issues associated with using anti-miRNA therapy are also summarized in this review. The data for this literature were extracted and summarized using various search engines, such as Google Scholar, Pubmed, Scopus, and NCBI using different terms, such as NDD, PD, AD, HD, nanoformulations of mRNA, and role of miRNA in diagnosis and treatment.<h4>Results</h4>The miRNAs control various biological actions, such as neuronal differentiation, synaptic plasticity, cytoprotection, neuroinflammation, oxidative stress, apoptosis and chaperone-mediated autophagy, and neurite growth in the central nervous system and diagnosis. Various miRNAs are involved in the regulation of protein aggregation in PD and modulating β-secretase activity in AD. In HD, mutation in the huntingtin (Htt) protein interferes with Ago1 and Ago2, thus affecting the miRNA biogenesis. Currently, many anti-sense technologies are in the research phase for either inhibiting or promoting the activity of miRNA.<h4>Conclusion</h4>This review provides new therapeutic approaches and novel biomarkers for the diagnosis and prognosis of NDDs by using miRNA.

Also flagged:Methylationbrain tumorsCNS tumorstumorstumorBRAF
Journal Article 2024-01-01 No Snippets Galbraith K, Serrano J, Shen G, Tran I, Slocum CC, Ketchum C, Abdullaev Z, Turakulov R, Bale T, Ladanyi M, Sukhadia P, Zaidinski M, Mullaney K, DiNapoli S, Liechty BL, Barbaro M, Allen JC, Gardner SL, Wisoff J, Harter D, Hidalgo ET, Golfinos JG, Orringer DA, Aldape K, Benhamida J, Wrzeszczynski KO, Jour G, Snuderl M.
Show Full Abstract

DNA methylation is an essential molecular assay for central nervous system (CNS) tumor diagnostics. While some fusions define specific brain tumors, others occur across many different diagnoses. We performed a retrospective analysis of 219 primary CNS tumors with whole genome DNA methylation and RNA next-generation sequencing. DNA methylation profiling results were compared with RNAseq detected gene fusions. We detected 105 rare fusions involving 31 driver genes, including 23 fusions previously not implicated in brain tumors. In addition, we identified 6 multi-fusion tumors. Rare fusions and multi-fusion events can impact the diagnostic accuracy of DNA methylation by decreasing confidence in the result, such as BRAF, RAF, or FGFR1 fusions, or result in a complete mismatch, such as NTRK, EWSR1, FGFR, and ALK fusions.<h4>Implications</h4>DNA methylation signatures need to be interpreted in the context of pathology and discordant results warrant testing for novel and rare gene fusions.

Also flagged:cancerkinaseBCRABL1amino acidMetabolism
Journal Article 2024-01-01 No Snippets Kumar H, Tang LY, Yang C, Kim P.
Show Full Abstract

Tumorigenic functions due to the formation of fusion genes have been targeted for cancer therapeutics (i.e. kinase inhibitors). However, many fusion proteins involved in various cellular processes have not been studied for targeted therapeutics. This is because the lack of complete fusion protein sequences and their whole 3D structures has made it challenging to develop new therapeutic strategies. To fill these critical gaps, we developed a computational pipeline and a resource of human fusion proteins named FusionPDB, available at https://compbio.uth.edu/FusionPDB. FusionPDB is organized into four levels: 43K fusion protein sequences (14.7K in-frame fusion genes, Level 1), over 2300 + 1267 fusion protein 3D structures (from 2300 recurrent and 266 manually curated in-frame fusion genes, Level 2), pLDDT score analysis for the 1267 fusion proteins from 266 manually curated fusion genes (Level 3), and virtual screening outcomes for 68 selected fusion proteins from 266 manually curated fusion genes (Level 4). FusionPDB is the only resource providing whole 3D structures of fusion proteins and comprehensive knowledge of human fusion proteins. It will be regularly updated until it covers all human fusion proteins in the future.

BTN2A1
Also flagged:cytokineIFN-γIL-17AIL-4NKG2DNK group 2 member D
Journal Article 2024-01-01 ✓ 3 Snippets Wang C, Lai AY, Baiu DC, Smith KA, Odorico JS, Wilson K, Schreiber T, de Silva S, Gumperz JE.
In-Text Gene Mentions

…to recombinant butyrophilinBTN2A1and BTN3A1 demonstrated…

…extracellular domain ofBTN2A1, whereas the addition…

…shared recognition ofBTN2A1, differential effects of…

Show Full Abstract

There is considerable interest in therapeutically engaging human γδ T cells. However, due to the unique TCRs of human γδ T cells, studies from animal models have provided limited directly applicable insights, and human γδ T cells from key immunological tissues remain poorly characterized. In this study, we investigated γδ T cells from human spleen tissue. Compared to blood, where Vδ2+Vγ9+ T cells are the dominant subset, splenic γδ T cells included a variety of TCR types, with Vδ1+ T cells typically being the most frequent. Intracellular cytokine staining revealed that IFN-γ was produced by a substantial fraction of splenic γδ T cells, IL-17A by a small fraction, and IL-4 was minimal. Primary splenic γδ T cells frequently expressed NKG2D (NK group 2 member D) and CD16, whereas expression of DNAM-1 (DNAX accessory molecule 1), CD28, PD-1, TIGIT, and CD94 varied according to subset, and there was generally little expression of natural cytotoxicity receptors, TIM-3, LAG-3, or killer Ig-like receptors. In vitro expansion was associated with marked changes in expression of these activating and inhibitory receptors. Analysis of functional responses of spleen-derived Vδ2+Vγ9+, Vδ1+Vγ9+, and Vδ1+Vγ9- T cell lines to recombinant butyrophilin BTN2A1 and BTN3A1 demonstrated that both Vδ2+Vγ9+ and Vδ1+Vγ9+ T cells were capable of responding to the extracellular domain of BTN2A1, whereas the addition of BTN3A1 only markedly enhanced the responses of Vδ2+Vγ9+ T cells. Conversely, Vδ1+Vγ9+ T cells appeared more responsive than Vδ2+Vγ9+ T cells to TCR-independent NKG2D stimulation. Thus, despite shared recognition of BTN2A1, differential effects of BTN3A1 and coreceptors may segregate target cell responses of Vδ2+Vγ9+ and Vδ1+Vγ9+ T cells.

DARS2
Also flagged:transcription factorLrpbindingchromosomecell cycleorigins
Journal Article 2024-01-01 ✓ 1 Snippet Doan A, Chatterjee S, Kothapalli R, Khan Z, Sen S, Kedei N, Jha JK, Chattoraj DK, Ramachandran R.
In-Text Gene Mentions

DARS2

Show Full Abstract

Replication of Vibrio cholerae chromosome 2 (Chr2) initiates when the Chr1 locus, crtS (Chr2 replication triggering site) duplicates. The site binds the Chr2 initiator, RctB, and the binding increases when crtS is complexed with the transcription factor, Lrp. How Lrp increases the RctB binding and how RctB is subsequently activated for initiation by the crtS-Lrp complex remain unclear. Here we show that Lrp bends crtS DNA and possibly contacts RctB, acts that commonly promote DNA-protein interactions. To understand how the crtS-Lrp complex enhances replication, we isolated Tn-insertion and point mutants of RctB, selecting for retention of initiator activity without crtS. Nearly all mutants (42/44) still responded to crtS for enhancing replication, exclusively in an Lrp-dependent manner. The results suggest that the Lrp-crtS controls either an essential function or more than one function of RctB. Indeed, crtS modulates two kinds of RctB binding to the origin of Chr2, ori2, both of which we find to be Lrp-dependent. Some point mutants of RctB that are optimally modulated for ori2 binding without crtS still remained responsive to crtS and Lrp for replication enhancement. We infer that crtS-Lrp functions as a unit, which has an overarching role, beyond controlling initiator binding to ori2.

Also flagged:CopperNeurodegenerative Diseasesneurological disordersmetabolismneurotransmissionAlzheimer's disease
Journal Article 2024-01-01 No Snippets Zhong G, Wang X, Li J, Xie Z, Wu Q, Chen J, Wang Y, Chen Z, Cao X, Li T, Liu J, Wang Q.
Show Full Abstract

Neurodegenerative diseases encompass a collection of neurological disorders originating from the progressive degeneration of neurons, resulting in the dysfunction of neurons. Unfortunately, effective therapeutic interventions for these diseases are presently lacking. Copper (Cu), a crucial trace element within the human body, assumes a pivotal role in various biological metabolic processes, including energy metabolism, antioxidant defense, and neurotransmission. These processes are vital for the sustenance, growth, and development of organisms. Mounting evidence suggests that disrupted copper homeostasis contributes to numerous age-related neurodegenerative diseases, such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), Wilson's disease (WD), Menkes disease (MD), prion diseases, and multiple sclerosis (MS). This comprehensive review investigates the connection between the imbalance of copper homeostasis and neurodegenerative diseases, summarizing pertinent drugs and therapies that ameliorate neuropathological changes, motor deficits, and cognitive impairments in these conditions through the modulation of copper metabolism. These interventions include Metal-Protein Attenuating Compounds (MPACs), copper chelators, copper supplements, and zinc salts. Moreover, this review highlights the potential of active compounds derived from natural plant medicines to enhance neurodegenerative disease outcomes by regulating copper homeostasis. Among these compounds, polyphenols are particularly abundant. Consequently, this review holds significant implications for the future development of innovative drugs targeting the treatment of neurodegenerative diseases.

HFE
Also flagged:PIWIgene expressiontumourPIWILPIWIL1PIWIL2
Journal Article 2024-01-01 ✓ 1 Snippet Hammad G, Mamdouh S, Seoudi DM, Seleem MI, Safwat G, Mohamed RH.
In-Text Gene Mentions

…(e.g., Autoimmune hepatitis,Hemochromatosis, Schistosoma), or diseases…

Show Full Abstract

<h4>Background</h4>P-Element-induced wimpy testis (PIWI) proteins, when in combination with PIWI-interacting RNA (piRNA), are engaged in the epigenetic regulation of gene expression in germline cells. Different types of tumour cells have been found to exhibit abnormal expression of piRNA, PIWIL-mRNAs, and proteins. We aimed to determine the mRNA expression profiles of PIWIL1, PIWIL2, PIWIL3, & PIWIL4, in hepatocellular carcinoma patients, and to associate their expression patterns with clinicopathological features.<h4>Methods</h4>The expression patterns of PIWIL1, PIWIL2, PIWIL3, PIWIL4 mRNA, was assessed via real-time quantitative polymerase chain reaction (RT-QPCR), on tissue and serum samples from HCC patients, their impact for diagnosis was evaluated by ROC curves, prognostic utility was determined, and In Silico analysis was conducted for predicted variant detection, association with HCC microRNAs and Network Analysis.<h4>Results</h4>Expression levels were significantly higher in both HCC tissue and serum samples than in their respective controls (p< 0.001). Additionally, the diagnostic performance was assessed, Risk determination was found to be statistically significant.<h4>Conclusion</h4>PIWIL mRNAs are overexpressed in HCC tissue and serum samples, the expression patterns could be valuable molecular markers for HCC, due to their association with age, tumour grade and pattern. To the best of our knowledge, our study is the first to report the expression levels of all PIWIL mRNA and to suggest their remarkable values as diagnostic and prognostic biomarkers, in addition to their correlation to HCC development. Additionally, a therapeutic opportunity might be also suggested through in silico miRNA prediction for HCC and PIWIL genes through DDX4 and miR-124-3p.

SUDS3
Also flagged:EZH2FGFRBAP1Malignant mesotheliomatumoripilimumab
Journal Article 2024-01-01 ✓ 1 Snippet Badhai J, Landman N, Pandey GK, Song JY, Hulsman D, Krijgsman O, Chandrasekaran G, Berns A, van Lohuizen M.
In-Text Gene Mentions

…core of thepolycomb repressive deubiquitinatingrepressive deubiquitinating (P…

Show Full Abstract

Malignant mesothelioma is a highly aggressive tumor with a survival of only 4-18 months after diagnosis. Treatment options for this disease are limited. Immune checkpoint blockade using ipilimumab and nivolumab has recently been approved as a frontline therapy, but this led to only a small improvement in overall patient survival. As more than half of patients with mesothelioma have alterations in the gene encoding for BAP1 this could be a potential marker for targeted therapies. In this study, we investigated the synergistic potential of combining EZH2 inhibition together with FGFR inhibition for treatment of BAP1-deficient malignancies. The efficacy of the combination was evaluated using human and murine preclinical models of mesothelioma and uveal melanoma in vitro. The efficacy of the combination was further validated in vivo by using BAP1-deficient mesothelioma xenografts and autochthonous mouse models. In vitro data showed sensitivity to the combined inhibition in BAP1-deficient mesothelioma and uveal melanoma tumor cell lines but not for BAP1-proficient subtypes. In vivo data showed susceptibility to the combination of BAP1-deficient xenografts and demonstrated an increase of survival in autochthonous models of mesothelioma. These results highlight the potential of this novel drug combination for the treatment of mesothelioma using BAP1 as a biomarker. Given these encouraging preclinical results, it will be important to clinically explore dual EZH2/FGFR inhibition in patients with BAP1-deficient malignant mesothelioma and justify further exploration in other BAP1 loss-associated tumors.<h4>Significance</h4>Despite the recent approval of immunotherapy, malignant mesothelioma has limited treatment options and poor prognosis. Here, we observe that EZH2 inhibitors dramatically enhance the efficacy of FGFR inhibition, sensitising BAP1-mutant mesothelioma and uveal melanoma cells. The striking synergy of EZH2 and FGFR inhibition supports clinical investigations for BAP1-mutant tumors.

Also flagged:sleepcognitive impairmentcriticalgeriatric syndromesgeriatric syndromecognitive decline
Journal Article 2024-01-01 No Snippets Elias MN, Ahrens EA, Schumacher FA, Liang Z, Munro CL.
Show Full Abstract

<h4>Background/introduction</h4>Critically ill older adults are profoundly inactive while in the intensive care unit (ICU), and this inactivity persists after discharge from the ICU. Older ICU survivors who were mechanically ventilated are at high risk for post-ICU cognitive impairment.<h4>Objectives/aims</h4>The present study examined the relationship between the ratio of daytime to nighttime activity and executive function in older ICU survivors.<h4>Methods</h4>This was a secondary analysis of pooled data from 2 primary studies of older adults who were functionally independent prior to hospitalization, mechanically ventilated while in ICU, and within 24 to 48 hours post-ICU discharge. Actigraphy recorded daytime activity (mean activity counts per minute, 6 am to 9:59 pm) and nighttime activity (mean activity counts per minute, 10 pm to 5:59 am). A daytime-to-nighttime activity ratio was calculated by dividing daytime activity by nighttime activity. The NIH Toolbox Dimensional Change Card Sort Test assessed cognitive flexibility (DCCST: fully corrected T score). Multivariate regression examined the association between the daytime-to-nighttime activity ratio and DCCST scores, adjusting for 2 covariates (age in years and NIH Toolbox Grip Strength fully corrected T score).<h4>Results</h4>The mean daytime-to-nighttime activity ratio was 2.10 ± 1.17 (interquartile range, 1.42). Ratios for 6 participants (13.6%) were less than 1, revealing higher activity during nighttime hours rather than daytime hours. Higher daytime-to-nighttime ratios were associated with better DCCST scores (β = .364, P = .005).<h4>Conclusions</h4>The proportion of daytime activity versus nighttime activity was considerably low, indicating severe alterations in the rest/activity cycle. Higher daytime-to-nighttime activity ratios were associated with better executive function scores, suggesting that assessment of daytime activity could identify at-risk older ICU survivors during the early post-ICU transition period. Promotion of daytime activity and nighttime sleep may accelerate recovery and improve cognitive function.

HFE
Also flagged:diabetesglucosehyperglycemiawaterhyperglycemic crisisGlycohemoglobin
Journal Article 2024-01-01 ✓ 1 Snippet American Diabetes Association Professional Practice Committee.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The American Diabetes Association (ADA) "Standards of Care in Diabetes" includes the ADA's current clinical practice recommendations and is intended to provide the components of diabetes care, general treatment goals and guidelines, and tools to evaluate quality of care. Members of the ADA Professional Practice Committee, an interprofessional expert committee, are responsible for updating the Standards of Care annually, or more frequently as warranted. For a detailed description of ADA standards, statements, and reports, as well as the evidence-grading system for ADA's clinical practice recommendations and a full list of Professional Practice Committee members, please refer to Introduction and Methodology. Readers who wish to comment on the Standards of Care are invited to do so at professional.diabetes.org/SOC.

SOX6OLFM4
Also flagged:digestiongene expressiontranscription factorsCD8Granzyme AGZMA
Journal Article 2024-01-01 ✓ 5 Snippets Xiao YY, Zhang Q, Huang F, Rao L, Yao TX, Yang SY, Xie L, Zou XX, Cai LP, Yang JW, Yang B, Huang LS.
In-Text Gene Mentions

…Here, stem cells were characterized byhigh expression of OLFM4( Figure 2B ), consistent with previous human colonic study ( van der Flier et al., 2009 ).…

…in T cells,SOX6and SOX10 in…

…stem cells (OLFM4and SMOC2 ),…

…progenitor cells (OLFM4, APOBEC1 ,…

…high expression ofOLFM4( Figure 2B…

Show Full Abstract

The gastrointestinal tract is essential for food digestion, nutrient absorption, waste elimination, and microbial defense. Single-cell transcriptome profiling of the intestinal tract has greatly enriched our understanding of cellular diversity, functional heterogeneity, and their importance in intestinal tract development and disease. Although such profiling has been extensively conducted in humans and mice, the single-cell gene expression landscape of the pig cecum remains unexplored. Here, single-cell RNA sequencing was performed on 45 572 cells obtained from seven cecal samples in pigs at four different developmental stages (days (D) 30, 42, 150, and 730). Analysis revealed 12 major cell types and 38 subtypes, as well as their distinctive genes, transcription factors, and regulons, many of which were conserved in humans. An increase in the relative proportions of CD8 <sup>+</sup> T and Granzyme A (low expression) natural killer T cells (GZMA <sup>low</sup> NKT) cells and a decrease in the relative proportions of epithelial stem cells, Tregs, RHEX <sup>+</sup> T cells, and plasmacytoid dendritic cells (pDCs) were noted across the developmental stages. Moreover, the post-weaning period exhibited an up-regulation in mitochondrial genes, <i>COX2</i> and <i>ND2</i>, as well as genes involved in immune activation in multiple cell types. Cell-cell crosstalk analysis indicated that IBP6 <sup>+</sup> fibroblasts were the main signal senders at D30, whereas IBP6 <sup>-</sup> fibroblasts assumed this role at the other stages. NKT cells established interactions with epithelial cells and IBP6 <sup>+</sup> fibroblasts in the D730 cecum through mediation of <i>GZMA-F2RL1/F2RL2</i> pairs. This study provides valuable insights into cellular heterogeneity and function in the pig cecum at different development stages.

HFE
Also flagged:IronCopperdextranwaterpentobarbitalheme
Journal Article 2024-01-01 ✓ 1 Snippet Koide R, Shigemasa R, Hashimoto K, Tatsumi Y, Hayashi H, Suzuki T, Wakusawa S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background/aim</h4>Our recent studies have indicated that trace copper co-existed with iron in hemosiderin particles of human genetic iron overload. To understand this phenomenon, we analyzed hemosiderin particles in iron-overloaded rat liver by using scanning transmission electron microscopy - energy-dispersive X-ray (STEM-EDX) spectroscopy.<h4>Materials and methods</h4>Samples for STEM-EDX spectroscopy were prepared from the liver of rats administered an intraperitoneal injection of dextran iron.<h4>Results</h4>The micro-domain analysis with STEM-EDX spectroscopy showed that dense bodies contained high levels of iron and trace copper. Quantitative analysis of copper levels in the liver specimen using atomic spectrophotometry showed that copper concentration in the liver was not increased by iron overload. These findings suggest that the overload of iron induced distribution of trace copper to hemosiderin particles without changing cellular copper levels.<h4>Conclusion</h4>Co-existence of copper with iron was observed in hemosiderin particles of the liver of an experimental model of iron overload, suggesting that iron overload induced distribution of trace copper into hemosiderin particles.

Also flagged:ion channelsinflammatory responsepathogenesistumorsrespiratory diseasesacetaminophen
Journal Article 2024-01-01 No Snippets Golmakani H, Azimian A, Golmakani E.
Show Full Abstract

Neuropathic pain is a widespread clinical issue caused by somatosensory nervous system damage, affecting numerous individuals. It poses considerable economic and public health challenges, and managing it can be challenging due to unclear underlying mechanisms. Nevertheless, emerging evidence suggests that neurogenic inflammation and neuroinflammation play a role in developing pain patterns. Emerging evidence suggests that neurogenic inflammation and neuroinflammation play significant roles in developing neuropathic pain within the nervous system. Increased/decreased miRNA expression patterns could affect the progression of neuropathic and inflammatory pain by controlling nerve regeneration, neuroinflammation, and the expression of abnormal ion channels. However, our limited knowledge of miRNA targets hinders a complete grasp of miRNA's functions. Meanwhile, exploring exosomal miRNA, a recently uncovered role, has significantly advanced our comprehension of neuropathic pain's pathophysiology in recent times. In this review, we present a comprehensive overview of the latest miRNA studies and explore the possible ways miRNAs might play a role in the development of neuropathic pain.

MLLT10
Also flagged:MPALreverse transcriptionPICALMchromosomesRUNX1chromosome
Journal Article 2024-01-01 ✓ 4 Snippets Panagopoulos I, Andersen K, Johannsdottir IMR, Tandsæther MR, Micci F, Heim S.
In-Text Gene Mentions

We herein report the genetic findings in bone marrow cells from two pediatric MPAL patients.<h4>Patients and methods</h4>Bone marrow cells were examined using G-banding, array comparative genomic hybridization, RNA sequencing, reverse transcription polymerase chain reaction, Sanger sequencing, and fluorescence in situ hybridization.<h4>Results</h4>In the first patient, the genetic analyses revealed structural aberrations of chromosomal bands 8p11, 10p11, 11q21, and 17p11, the chimeras MLLT10::PICALM and PICALM::MLLT10, and imbalances (gains/losses) on chromosomes 2, 4, 8, 13, and 21.

…17p11, the chimerasMLLT10::PICALM and PICALM::MLLT10, a…

…as MLLT10::PICALM and PICALM::MLLT10, and imbalances (gains/losses…

MLLT10

Show Full Abstract

<h4>Background/aim</h4>Mixed phenotype acute leukemia (MPAL) is a rare hematologic malignancy in which the leukemic cells cannot be assigned to any specific lineage. The lack of well-defined, pathogenetically relevant diagnostic criteria makes the clinical handling of MPAL patients challenging. We herein report the genetic findings in bone marrow cells from two pediatric MPAL patients.<h4>Patients and methods</h4>Bone marrow cells were examined using G-banding, array comparative genomic hybridization, RNA sequencing, reverse transcription polymerase chain reaction, Sanger sequencing, and fluorescence in situ hybridization.<h4>Results</h4>In the first patient, the genetic analyses revealed structural aberrations of chromosomal bands 8p11, 10p11, 11q21, and 17p11, the chimeras MLLT10::PICALM and PICALM::MLLT10, and imbalances (gains/losses) on chromosomes 2, 4, 8, 13, and 21. A submicroscopic deletion in 21q was also found including the RUNX1 locus. In the second patient, there were structural aberrations of chromosome bands 1p32, 8p11, 12p13, 20p13, and 20q11, the chimeras ETV6::LEXM and NCOA6::ETV6, and imbalances on chromosomes 2, 8, 11, 12, 16, 19, X, and Y.<h4>Conclusion</h4>The leukemic cells from both MPAL patients carried chromosome aberrations resulting in fusion genes as well as genomic imbalances resulting in gain and losses of many gene loci. The detected fusion genes probably represent the main leukemogenic events, although the gains and losses are also likely to play a role in leukemogenesis.

OLFM4
Also flagged:Prostate cancerPCatumorcastration-resistant prostate cancertumorsPPAT
Journal Article 2024-01-01 ✓ 1 Snippet Cao H, Wang Y, Zhang D, Liu B, Zhou H, Wang S.
In-Text Gene Mentions

…the 3-genes (IGHA1,OLFM4, and RERGL) signature…

Show Full Abstract

Prostate cancer (PCa) is the most common tumor of the male genitourinary system. It will eventually progress to fatal metastatic castration-resistant prostate cancer, for which treatment options are limited. Adipose tissues are distributed in various parts of the body. They have different morphological structures and functional characteristics and are associated with the development of various tumors. Periprostatic adipose tissue (PPAT) is the closest white visceral adipose tissue to the prostate and is part of the PCa tumor microenvironment. Studies have shown that PPAT is involved in PCa development, progression, invasion, and metastasis through the secretion of multiple active molecules. Factors such as obesity, diet, exercise, and organochlorine pesticides can affect the development of PCa indirectly or directly through PPAT. Based on the mechanism of PPAT's involvement in regulating PCa, this review summarized various diagnostic and therapeutic approaches for PCa with potential applications to assess the progression of patients' disease and improve clinical outcomes.

HTT
Also flagged:neurodegenerative diseaseslipidNeurodegenerative disordersAlzheimer's diseaseADParkinson's disease
Journal Article 2024-01-01 ✓ 1 Snippet Rafe MR.
In-Text Gene Mentions

Chromosome 4 has the huntingtin (HTT) gene, which increases the CAG trinucleotide repeats and causes HD.

Show Full Abstract

Neurodegenerative disorders encompass diseases that involve the degeneration of neurons, particularly those within the central nervous system. These are the most commonly observed disorders among the geriatric population. The treatment or management of this condition presents additional challenges due to therapeutics that may not be as effective as desired. The primary obstacle that often hinders the efficacy of therapy is the existence of a blood-brain barrier (BBB). The BBB serves as a vital safeguard for the brain, effectively obstructing the passage of drugs into the brain cells. Hence, the management of damaging neurodegenerative conditions such as Alzheimer's disease (AD), Parkinson's disease (PD), Cerebrovascular diseases (CVDs), Huntington's disease (HD), and Multiple sclerosis (MS) is currently the primary area of research interest. The innovative utilization of nanoparticles as drug carriers provides renewed optimism in addressing many complicated medical conditions. In this article, I have aimed to gather published information regarding various lipid nanoparticles that can efficiently transport medication to the brain to address neurodegenerative disorders. According to the published literature, liposomes, solid-lipid nanoparticles, nanostructured nanoparticles, microemulsions, and nanoemulsions are potential nanocarriers that can treat neurodegenerative disorders.

TNFSF4
Also flagged:membranedigestive system cancerBMFAM83ALY6DMET
Journal Article 2024-01-01 ✓ 1 Snippet Zhou F, Liu Y, Liu D, Xie Y, Zhou X.
In-Text Gene Mentions

…CD44, CD70, HHLA2,TNFSF4and TNFSF9 in…

Show Full Abstract

<b>Background:</b> Pancreatic adenocarcinoma (PAAD) is a frequent digestive system cancer, which has high mortality and bad outcome. However, the role of basement membrane (BM)-related gene in assessing patient's outcome, microenvironment and treatment response remain unclear. <b>Methods:</b> Basement membrane (BM)-associated genes were detected by univariate and least absolute shrinkage and selection operator (LASSO) Cox regression analyses using data from the TCGA databases. A risk score system was constructed to distinguish patients in the high- and low-risk groups. Prognostic gene distribution in various immune cell forms was explored through scRNA-seq. Immune cell infiltration was assessed using CIBERSORT and ESTIMATE. The IC50 of common chemotherapeutic drugs and useful molecule compounds were evaluated. The mRNA and protein expression of important signatures were validated utilizing GEPIA and HPA databases. <b>Results:</b> Compared to low risk PAAD patients, PAAD patients with high risk showed a significant much worse overall survival (OS). Risk score of BM-associated genes could estimate patient outcome well, and areas under the curve (AUC) of receiver operating characteristic (ROC) survival curve were 0.76, 0.85, and 0.85 at 1-, 3-, and 5-year. Clinical impact curve (CIC) curve demonstrated the clinical importance of risk score. scRNA-seq revealed that BM-related genes were mainly distributed in malignant cells. Significant variations existed in the immune microenvironment, immune checkpoint expression and chemotherapy response between the studied groups. Furthermore, the mRNA expression levels of FAM83A, LY6D, MET, MUC16, MYEOV, and WNT7A were elevated in PAAD tissues, while the protein expression patterns of LY6D, MET, MUC16, and WNT7A were higher in tumor sample. RO-90-7501, Scriptaid, TG-101348, XMD-892, and XMD-1150 may be valuable small molecule drugs to treat PAAD. <b>Conclusions:</b> In conclusion, we develop a novel BM-related gene signature provide new insights and targets for the diagnosis, outcome estimation, candidate drugs and therapy management of PAAD patients.

POU3F2
Also flagged:LINC00662melanomabindingtumortumorsmelanomas
Journal Article 2024-01-01 ✓ 5 Snippets Luo M, Lei R, Zhao Q, Shen Y, He Z, Xu J.
In-Text Gene Mentions

In addition to competitively targeting the expression of miR-107 and then regulating the downstream gene POU3F2, whether LINC00662 has another mechanism of action in melanoma to regulate tumor progression requires further verification.

Collectively, these results indicated that LINC00662 acted as a ceRNA to regulate POU3F2 expression by sponging miR-107 in melanomas.

Overall, our results confirmed that LINC00662 promoted melanoma progression by sponging miR107 and inducing POU3F2, highlighting the mechanism of the LINC00662/miR-107/POU3F2 axis in melanoma cell proliferation and invasion.

The negative effect of silencing LINC00662 on melanoma cell proliferation and migration was partially abrogated by miR-107 mimetic inhibitors or POU3F2 overexpression.

We aimed to demonstrate that LINC00662 may regulate POU3F2 expression in melanoma by competitively binding miR-107 in this study.

Show Full Abstract

Melanoma is a highly malignant tumor in the body. Long non-coding RNAs (lncRNAs) have been reported to be involved in the development of various tumors. Emerging evidence demonstrates the critical role of lncRNAs in melanoma development. In this study, we aimed to investigate the expression, biological function and regulatory mechanism of LINC00662 in melanomas. First, we found that LINC00662 was up-regulated in melanoma tissues and cell lines. High expression of LINC00662 in melanomas was associated with a poor patient prognosis. Silencing of LINC00662 suppressed the proliferation, migration, and invasion of melanoma cells <i>in vitro</i> and <i>in vivo</i>, while overexpression of LINC00662 promoted melanoma cell proliferation <i>in vitro</i>. Bioinformatics analysis, dual-luciferase assay, and RIP assay confirmed that LINC00662 competitively regulated miR-107. Silencing of LINC00662 upregulated miR-107 expression in a melanoma cell line. Inhibition of miR-107 significantly reversed the inhibitory effect of LINC00662 silencing on cell proliferation and migration. Furthermore, POU3F2 was validated as a downstream target of LINC00662/miR107 and was downregulated when LINC00662 was silenced. Overexpressing POU3F2 attenuated the effect of si-LINC00662 on cellular functions. In addition, the results also showed that the β-catenin pathway was involved in a si-LINC00662-induced function in melanoma. Overall, our results confirmed that LINC00662 promoted melanoma progression by sponging miR107 and inducing POU3F2, highlighting the mechanism of the LINC00662/miR-107/POU3F2 axis in melanoma cell proliferation and invasion.

PRDX6
Also flagged:Diabetic cardiomyopathydiabetes mellitusheart failuremyocardial fibrosisclinicalcollagen
Journal Article 2024-01-01 ✓ 1 Snippet Wei C, Shi M, Dong S, Li Z, Zhao B, Liu D, Li G, Cen J, Yu L, Liang X, Shi L.
In-Text Gene Mentions

…including ALDOB, GNMT,PRDX6, OTC, ALDOA, GSTP1,…

Show Full Abstract

Sirtuin 5 (SIRT5), localized in the mitochondria, has been identified as a protein desuccinylase and demalonylase in the mitochondria since the depletion of SIRT5 boosted the global succinylation and malonylation of mitochondrial proteins. We investigated the role of SIRT5 in diabetic cardiomyopathy (DCM) and identified the mechanism regarding lysine demalonylation in this process. Wild-type and SIRT5 knockout mice were induced with DCM, and primary cardiomyocytes and cardiac fibroblasts extracted from wild-type and SIRT5 knockout mice were subjected to high glucose (HG). SIRT5 deficiency exacerbated myocardial injury in DCM mice, aggravated HG-induced oxidative stress and mitochondrial dysfunction in cardiomyocytes, and intensified cardiomyocyte senescence, pyroptosis, and DNA damage. DCM-induced SIRT5 loss diminished glutathione S-transferase P (GSTP1) protein stability, represented by significantly increased lysine malonylation (Mal-Lys) modification of GSTP1. SIRT5 overexpression alleviated DCM-related myocardial injury, which was reversed by GSTP1 knockdown. Reduced SIRT5 transcription in DCM resulted from the downregulation of SPI1. SPI1 promoted the transcription of SIRT5, thereby ameliorating DCM-associated myocardial injury. However, SIRT5 deletion resulted in a significant reversal of the protective effect of SPI1. These observations suggest that SPI1 activates SIRT5 transcriptionally to mediate GSTP1 Mal-Lys modification and protein stability, thus ameliorating DCM-associated myocardial injury.

Also flagged:Macroautophagyautophagydegradationcytoplasmicmammalian target of rapamycinmTOR
Journal Article 2024-01-01 No Snippets Wu MY, Li ZW, Lu JH.
Show Full Abstract

Autophagy is a highly conserved physiological process that maintains cellular homeostasis by recycling cellular contents. Selective autophagy is based on the specificity of cargo recognition and has been implicated in various human diseases, including neurodegenerative diseases and cancer. Selective autophagy receptors and modulators play key roles in this process. Identifying these receptors and modulators and their roles is critical for understanding the machinery and physiological function of selective autophagy and providing therapeutic value for diseases. Using modern researching tools and novel screening technologies, an increasing number of selective autophagy receptors and modulators have been identified. A variety of Strategies and approaches, including protein-protein interactions (PPIs)-based identification and genome-wide screening, have been used to identify selective autophagy receptors and modulators. Understanding the strengths and challenges of these approaches not only promotes the discovery of even more such receptors and modulators but also provides a useful reference for the identification of regulatory proteins or genes involved in other cellular mechanisms. In this review, we summarize the functions, disease association, and identification strategies of selective autophagy receptors and modulators.

TNFSF4
Also flagged:NF-κBtranscription factorschromatinPDX1glucoseSIN3A
Journal Article 2024-01-01 ✓ 1 Snippet Weidemann BJ, Marcheva B, Kobayashi M, Omura C, Newman MV, Kobayashi Y, Waldeck NJ, Perelis M, Lantier L, McGuinness OP, Ramsey KM, Stein RW, Bass J.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Interactions between lineage-determining and activity-dependent transcription factors determine single-cell identity and function within multicellular tissues through incompletely known mechanisms. By assembling a single-cell atlas of chromatin state within human islets, we identified β cell subtypes governed by either high or low activity of the lineage-determining factor pancreatic duodenal homeobox-1 (PDX1). β cells with reduced PDX1 activity displayed increased chromatin accessibility at latent nuclear factor κB (NF-κB) enhancers. Pdx1 hypomorphic mice exhibited de-repression of NF-κB and impaired glucose tolerance at night. Three-dimensional analyses in tandem with chromatin immunoprecipitation (ChIP) sequencing revealed that PDX1 silences NF-κB at circadian and inflammatory enhancers through long-range chromatin contacts involving SIN3A. Conversely, Bmal1 ablation in β cells disrupted genome-wide PDX1 and NF-κB DNA binding. Finally, antagonizing the interleukin (IL)-1β receptor, an NF-κB target, improved insulin secretion in Pdx1 hypomorphic islets. Our studies reveal functional subtypes of single β cells defined by a gradient in PDX1 activity and identify NF-κB as a target for insulinotropic therapy.

Also flagged:somatic cell differentiationtranscription factorsneurodegenerative illnessesstrokeneurodegenerative diseasesbrain injury
Journal Article 2024-01-01 No Snippets Huang L, Lai X, Liang X, Chen J, Yang Y, Xu W, Qin Q, Qin R, Huang X, Xie M, Chen L.
Show Full Abstract

Massive loss of neurons following brain injury or disease is the primary cause of central nervous system dysfunction. Recently, much research has been conducted on how to compensate for neuronal loss in damaged parts of the nervous system and thus restore functional connectivity among neurons. Direct somatic cell differentiation into neurons using pro-neural transcription factors, small molecules, or microRNAs, individually or in association, is the most promising form of neural cell replacement therapy available. This method provides a potential remedy for cell loss in a variety of neurodegenerative illnesses, and the development of reprogramming technology has made this method feasible. This article provides a comprehensive review of reprogramming, including the selection and methods of reprogramming starting cell populations as well as the signaling methods involved in this process. Additionally, we thoroughly examine how reprogramming astrocytes into neurons can be applied to treat stroke and other neurodegenerative diseases. Finally, we discuss the challenges of neuronal reprogramming and offer insights about the field.

Also flagged:cytosinethymineadenineguaninep53genetic disease
Journal Article 2024-01-01 No Snippets Park CS, Habib O, Lee Y, Hur JK.
Show Full Abstract

Advancements in gene and cell therapy have resulted in novel therapeutics for diseases previously considered incurable or challenging to treat. Among the various contributing technologies, genome editing stands out as one of the most crucial for the progress in gene and cell therapy. The discovery of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and the subsequent evolution of genetic engineering technology have markedly expanded the field of target-specific gene editing. Originally studied in the immune systems of bacteria and archaea, the CRISPR system has demonstrated wide applicability to effective genome editing of various biological systems including human cells. The development of CRISPR-based base editing has enabled directional cytosine-tothymine and adenine-to-guanine substitutions of select DNA bases at the target locus. Subsequent advances in prime editing further elevated the flexibility of the edit multiple consecutive bases to desired sequences. The recent CRISPR technologies also have been actively utilized for the development of in vivo and ex vivo gene and cell therapies. We anticipate that the medical applications of CRISPR will rapidly progress to provide unprecedented possibilities to develop novel therapeutics towards various diseases. [BMB Reports 2024; 57(1): 2-11].

SOX6
Also flagged:TYROBPcholangiocarcinomarenal cancerabdominal aortic aneurysmtumorrenal cell carcinoma
Journal Article 2024-01-01 ✓ 3 Snippets Jia W, Chen L, Hou S, Kang C, Deng H.
In-Text Gene Mentions

When TYROBP binds to its activating receptors, it activates several downstream signaling pathways, such as Syk, ZAP-70, and PI3K, which promote cell proliferation, cytokine production, and cytotoxic killing, and TYROBP also binds to other receptors, and plays a role in the regulation of monocytes Biological processes such as macrophages and dendritic cells play a role.[30,31] There are studies suggesting an interaction between TYROBP, Sox6 and renal tumors, with higher inferred scores for TYROBP and Sox6 for renal tumors.[32] The high expression of TYROBP is closely related to the poor prognosis and immune cell infiltration of clear cell renal cell carcinoma.[33] It has also been shown that in vivo experiments revealed that TYROBP is significantly underexpressed in AAA abdominal aortic tissue.[34] Therefore, it is speculated that TYROBP may influence the occurrence and development of cholangiocarcinoma, renal cell carcinoma, and abdominal aortic aneurysm.

…interaction between TYROBP,Sox6and renal tumors,…

…for TYROBP andSox6for renal tumors.…

Show Full Abstract

Cholangiocarcinoma occurs when there is a malignant tumor in the bile duct system. Renal cancer originates from renal tubular epithelial cells. Abdominal aortic aneurysm (AAA) is a permanently localized dilation caused by a lesion or injury to abdominal aortic wall. However, the relationship between TYROBP and cholangiocarcinoma, renal cancer and AAA remains unclear. The profiles of cholangiocarcinoma dataset GSE107943, renal cell carcinoma dataset GSE213324, and AAA dataset GSE47472 were downloaded from the GEO database using the platforms GPL18573, GPL24676, and GPL10558. DEGs were screened, WGCNA was performed as well as construction and analysis of PPI network. Functional enrichment analysis, GSEA, heat map of gene expression, survival analysis, and immune infiltration analysis were performed. The most relevant diseases to core genes were found by CTD. The GSE107943 dataset identified 3383 DEGs for cholangiocarcinoma, GSE47472 identified 95 DEGs for abdominal aortic aneurysm, and GSE213324 identified 10245 DEGs for renal cell carcinoma. For the GSE107943 cholangiocarcinoma dataset, GO analysis revealed enrichment in immune response, cell adhesion, extracellular space, and oxidoreductase activity. KEGG analysis indicated enrichment in metabolic pathways, the PI3K-Akt signaling pathway, cell apoptosis, the cell cycle, and the NF-kappa B signaling pathway. In the GSE47472 AAA dataset, GO analysis showed enrichment in neuroblast differentiation, cardiac muscle myofilament complex, and alkaline binding. KEGG analysis indicated enrichment in mRNA surveillance pathway and purine metabolism. In the GSE213324 renal cell carcinoma dataset, GO analysis indicated enrichment in immune system processes, cell adhesion, and membrane parts. KEGG analysis showed enrichment in cytokine-cytokine receptor interaction, calcium signaling pathway, and hematopoietic cell lineage. Furthermore, for cholangiocarcinoma (GSE107943), enriched terms associated with DEGs were in metabolic pathways, cell apoptosis, and the cell cycle. For AAA (GSE47472), enriched terms were in alkaline binding and cellular redox homeostasis. For renal cell carcinoma (GSE213324), enriched terms were in biological adhesion, regulation of immune system processes, and cell surface. Common core genes (ADH6, AGXT, CYP3A43, TYROBP) were identified for cholangiocarcinoma, renal cell carcinoma, and AAA. ADH6 and TYROBP were associated with cholangiocarcinoma, AAA, renal tumors, kidney diseases, atherosclerosis, and inflammation. TYROBP is abnormally expressed in cholangiocarcinoma, renal cancer and abdominal aortic aneurysm.

HFE
Also flagged:translationalCOVID-19Nucleic acidAsthmadeathhereditary hemochromatosis
Journal Article 2024-01-01 ✓ 5 Snippets Wiley LK, Shortt JA, Roberts ER, Lowery J, Kudron E, Lin M, Mayer D, Wilson M, Brunetti TM, Chavan S, Phang TL, Pozdeyev N, Lesny J, Wicks SJ, Moore ET, Morgenstern JL, Roff AN, Shalowitz EL, Stewart A, Williams C, Edelmann MN, Hull M, Patton JT, Axell L, Ku L, Lee YM, Jirikowic J, Tanaka A, Todd E, White S, Peterson B, Hearst E, Zane R, Greene CS, Mathias R, Coors M, Taylor M, Ghosh D, Kahn MG, Brooks IM, Aquilante CL, Kao D, Rafaels N, Crooks KR, Hess S, Barnes KC, Gignoux CR.
In-Text Gene Mentions

…hereditary hemochromatosis (HFE), and (3)…

…order for geneticHFEtesting is completed…

…(p.Cys282Tyr) variant inHFEthat is associated…

…genetic testing forHFE(unpublished data).…

…athogenic variants, hereditaryhemochromatosis, and pharmacogenomic results.…

Show Full Abstract

Precision medicine initiatives across the globe have led to a revolution of repositories linking large-scale genomic data with electronic health records, enabling genomic analyses across the entire phenome. Many of these initiatives focus solely on research insights, leading to limited direct benefit to patients. We describe the biobank at the Colorado Center for Personalized Medicine (CCPM Biobank) that was jointly developed by the University of Colorado Anschutz Medical Campus and UCHealth to serve as a unique, dual-purpose research and clinical resource accelerating personalized medicine. This living resource currently has more than 200,000 participants with ongoing recruitment. We highlight the clinical, laboratory, regulatory, and HIPAA-compliant informatics infrastructure along with our stakeholder engagement, consent, recontact, and participant engagement strategies. We characterize aspects of genetic and geographic diversity unique to the Rocky Mountain region, the primary catchment area for CCPM Biobank participants. We leverage linked health and demographic information of the CCPM Biobank participant population to demonstrate the utility of the CCPM Biobank to replicate complex trait associations in the first 33,674 genotyped individuals across multiple disease domains. Finally, we describe our current efforts toward return of clinical genetic test results, including high-impact pathogenic variants and pharmacogenetic information, and our broader goals as the CCPM Biobank continues to grow. Bringing clinical and research interests together fosters unique clinical and translational questions that can be addressed from the large EHR-linked CCPM Biobank resource within a HIPAA- and CLIA-certified environment.

Also flagged:agingneurodegenerative diseaseAlzheimer diseaseamyotrophic lateral sclerosisnucleusriluzole
Journal Article 2024-01-01 No Snippets Alvarado CX, Makarious MB, Weller CA, Vitale D, Koretsky MJ, Bandres-Ciga S, Iwaki H, Levine K, Singleton A, Faghri F, Nalls MA, Leonard HL.
Show Full Abstract

Treatments for neurodegenerative disorders remain rare, but recent FDA approvals, such as lecanemab and aducanumab for Alzheimer disease (MIM: 607822), highlight the importance of the underlying biological mechanisms in driving discovery and creating disease modifying therapies. The global population is aging, driving an urgent need for therapeutics that stop disease progression and eliminate symptoms. In this study, we create an open framework and resource for evidence-based identification of therapeutic targets for neurodegenerative disease. We use summary-data-based Mendelian randomization to identify genetic targets for drug discovery and repurposing. In parallel, we provide mechanistic insights into disease processes and potential network-level consequences of gene-based therapeutics. We identify 116 Alzheimer disease, 3 amyotrophic lateral sclerosis (MIM: 105400), 5 Lewy body dementia (MIM: 127750), 46 Parkinson disease (MIM: 605909), and 9 progressive supranuclear palsy (MIM: 601104) target genes passing multiple test corrections (p<sub>SMR_multi</sub> < 2.95 × 10<sup>-6</sup> and p<sub>HEIDI</sub> > 0.01). We created a therapeutic scheme to classify our identified target genes into strata based on druggability and approved therapeutics, classifying 41 novel targets, 3 known targets, and 115 difficult targets (of these, 69.8% are expressed in the disease-relevant cell type from single-nucleus experiments). Our novel class of genes provides a springboard for new opportunities in drug discovery, development, and repurposing in the pre-competitive space. In addition, looking at drug-gene interaction networks, we identify previous trials that may require further follow-up such as riluzole in Alzheimer disease. We also provide a user-friendly web platform to help users explore potential therapeutic targets for neurodegenerative diseases, decreasing activation energy for the community.

SOX6
Also flagged:Glucosepathogenesisdiabetic nephropathyInflammatory cytokinesinflammatory responseLuciferase
Journal Article 2024-01-01 ✓ 1 Snippet Du H, Wang Y, Zhu Y, Li X, Zhu T, Wu Q, Zha F.
In-Text Gene Mentions

…of SRY-box 6 (SOX6) [ 31 ].…

Show Full Abstract

<h4>Background</h4>Podocyte injury and inflammatory response are the core contributors to the pathogenesis of diabetic nephropathy. This study aims to identify novel regulatory miRNAs and elucidate their underlying mechanisms, which will help us understand the pathogenesis of diabetic nephropathy more comprehensively.<h4>Materials and methods</h4>Different glucose concentrations were used to treat podocytes to mimic the pathology of diabetic nephropathy <i>in vitro</i>. Flow cytometry was used to determine cell apoptosis. Inflammatory cytokines released by podocytes were measured by using an enzymelinked immunosorbent assay (ELISA). Western Blot was used to detect the expression of PRKAB2 protein in podocytes.<h4>Results</h4>Genecard and g: profiler results revealed that miR-29b might be involved in regulating HG-induced cell injury. QRT-PCR indicated that HG-induced downregulation of miR-29b in podocytes. MiR-29b knockdown promoted cell apoptosis and inflammatory response in podocytes. MiR-29b overexpression repressed cell apoptosis and inflammatory response induced by high glucose treatment in podocytes. Luciferase reporter assay and Western Blot showed that miR-29b targeted PRKAB2 to negatively regulate PRKAB2 expression directly. Knockdown of PRKAB2 reversed the increased cell apoptosis and inflammation induced by miR-29b inhibitors.<h4>Conclusion</h4>MiR-29b plays a role in inhibiting inflammation and apoptosis in high glucose (HG) treated podocytes by negatively regulating PRKAB2 expression. This study provides new potential targets and ideas for the treatment of diabetic nephropathy.

Also flagged:FerroptosisGinsenosideginsenosidesirondeathlipid
Journal Article 2024-01-01 No Snippets Feng J, Chen H, Liu Y, Ai Q, Yang Y, He W, Zhao L, Chu S, Chen N.
Show Full Abstract

Ginsenoside is the principal active ingredient in ginseng. Several investigations have found that ginsenosides have anti-inflammatory, antioxidant, anti-apoptotic, anti-cancer, and antiallergic activities. Ferroptosis is an iron-dependent, non-apoptotic form of cell-regulated death caused by lipid peroxidation. Iron, lipid, and amino acid metabolism orchestrate the complex ferroptosis response through direct or indirect regulation of iron accumulation or lipid peroxidation. More and more research has demonstrated that ginsenoside impacts illnesses via ferroptosis, implying that ferroptosis might be employed as a novel target of ginsenoside for disease therapy. This article examines the molecular mechanism of ferroptosis as well as the current advancement of ginsenoside in influencing disorders via ferroptosis.

OLFM4
Also flagged:tumortumorscolorectal canceroxaliplatinSIRT3PIK3CA
Journal Article 2024-01-01 ✓ 1 Snippet Pan YB, Xu WJ, Huang MS, Lu YD, Zhou YJ, Teng Y, Gong JB, Fu XY, Mao XL, Li SW.
In-Text Gene Mentions

…the knockdown ofOLFM4was able to…

Show Full Abstract

<b>Background:</b> Anoikis, a mechanism of programmed apoptosis, plays an important role in growth and metastasis of tumors. However, there are still few available comprehensive reports on the impact of anoikis on colorectal cancer. <b>Method:</b> A clustering analysis was done on 133 anoikis-related genes in GSE39582, and we compared clinical features between clusters, the tumor microenvironment was analyzed with algorithms such as "Cibersort" and "ssGSEA". We investigated risk scores of clinical feature groups and anoikis-associated gene mutations after creating a predictive model. We incorporated clinical traits to build a nomogram. Additionally, the quantitative real-time PCR was employed to investigate the mRNA expression of selected anoikis-associated genes. <b>Result:</b> We identified two anoikis-related clusters with distinct prognoses, clinical characteristics, and biological functions. One of the clusters was associated with anoikis resistance, which activated multiple pathways encouraging tumor metastasis. In our prognostic model, oxaliplatin may be a sensitive drug for low-risk patients. The nomogram showed good ability to predict survival time. And SIRT3, PIK3CA, ITGA3, DAPK1, and CASP3 increased in CRC group through the PCR assay. <b>Conclusion:</b> Our study identified two distinct modes of anoikis in colorectal cancer, with active metastasis-promoting pathways inducing an anti-anoikis subtype, which has a stronger propensity for metastasis and a worse prognosis than an anoikis-activated subtype. Massive immune cell infiltration may be an indicator of anoikis resistance. Anoikis' role in the colorectal cancer remains to be investigated.

TNFSF4
Also flagged:CDCA5TumorCell ProliferationColon Cancercell cyclecancer
Journal Article 2024-01-01 ✓ 1 Snippet Bao X, Leng X, Yu T, Zhu J, Zhao Y, Tenzindrogar, Yang Z, Wu S, Sun Q.
In-Text Gene Mentions

…CD244, CD28, CD40LG,TNFSF4, CD27, HHLA2, ICOS,…

Show Full Abstract

<b>Background</b>: CDCA5 has been reported as a gene involved in the cell cycle, however current research provides little details. Our goal was to figure out its functions and probable mechanisms in pan-cancer. <b>Methods</b>: Pan-cancer bulk sequencing data and web-based analysis tools were applied to analyze CDCA5's correlations with the gene expression, clinical prognosis, genetic alterations, promoter methylation, alternative splicing, immune checkpoints, tumor microenvironment and enrichment. Real‑time PCR, cell clone formation assay, CCK-8 assay, cell proliferation assay, migration assay, invasion assay and apoptosis assay were used to evaluate the effect of CDCA5 silencing on colon cancer cell lines. <b>Results</b>: CDCA5 is highly expressed in most tumors, which has been linked to a poor prognosis. Immune checkpoints analysis revealed that CDCA5 was associated with the immune gene CD276 in various tumors. Single-cell analysis showed that CDCA5 correlated with proliferating T cell infiltration in COAD. Enrichment analysis demonstrated that CDCA5 may modify cell cycle genes to influence p53 signaling. The examination of DLD1 cells revealed that CDCA5 increased the proliferation and blocked cell apoptosis. <b>Conclusion</b>: This study contributes to the knowledge of the role of CDCA5 in carcinogenesis, highlighting the prognostic potential and carcinogenic involvement of CDCA5 in pan-cancer.

TNFSF4
Also flagged:cancerlung adenocarcinomaLUADlung cancermalignant tumorstumor
Journal Article 2024-01-01 ✓ 1 Snippet Zhang J, Kuang T, Dong K, Yu J, Wang W.
In-Text Gene Mentions

…TNFRSF18, TNFRSF4, TNFRSF8,TNFSF4, CD276, CD70, and…

Show Full Abstract

<b>Background:</b> Immune cells play a critical role in the prognosis of cancer. However, the function of different immune cell types in lung adenocarcinoma (LUAD) and the development of a prognostic signature based on immune cell types have not been comprehensively investigated. <b>Methods:</b> We collected and included a total of 2499 LUAD patients and performed calculations to determine the penetration level of 24 immune cells. This examination was conducted using the macro-gene-based approach provided by ImmuCellAI. We performed a meta-analysis using Lasso-Cox analysis to establish the immune cell pair score (ICPS). We conducted a survival analysis to measure differences in survival across ICPS-risk groups. Wilcox test was used to measure the difference in expression level. Spearman correlation analysis was used for the relevance assessment. <b>Results:</b> We collected a total of 24 immune cell types to construct cell pairs. Utilizing 17 immune cell pairs, we constructed and validated the ICPS, which plays a critical role in stratifying survival and dynamically monitoring the effectiveness of immunotherapy. Additionally, we identified several candidate drugs that target ICPS. <b>Conclusions:</b> The ICPS shows promise as a valuable tool for identifying suitable candidates for immunotherapy among patients. Our comprehensive assessment of immune cell interactions in LUAD contributes to a deeper understanding of infiltration patterns and functions, thereby guiding the development of more efficacious immunotherapy strategies.

TNFSF4
Also flagged:non-small cell lung cancerNSCLCtumorLung cancercancerlung cancers
Journal Article 2024-01-01 ✓ 2 Snippets Zhu J, Yang J, Chen X, Wang Y, Wang X, Zhao M, Li G, Wang Y, Zhu Y, Yan F, Liu T, Jiang L.
In-Text Gene Mentions

…SIGLEC15, IL23A, ICOSLG,TNFSF4, HAVCR2, LDHB, LAMA3,…

…of IL23A, ICOSLG,TNFSF4, CD40, TNFRSF9, CD40LG…

Show Full Abstract

<b>Background</b>: Most of the current research on prognostic model construction for non-small cell lung cancer (NSCLC) only involves in bulk RNA-seq data without integration of single-cell RNA-seq (scRNA-seq) data. Besides, most of the prognostic models are constructed by predictive genes, ignoring other predictive variables such as clinical features. <b>Methods</b>: We obtained scRNA-seq data from GEO database and bulk RNA-seq data from TCGA database. We construct a prognostic model through the Least Absolute Shrinkage and Selection Operator (LASSO) and Cox regression. Furthermore, we performed ESTIMATE, CIBERSORT, immune checkpoint-related analyses and compared drug sensitivity using pRRophetic method judged by IC50 between different risk groups. <b>Results</b>: 14 tumor-related genes were extracted for model construction. The AUC for 1-, 3-, and 5 years overall survival prediction in TCGA and three validation cohorts were almost higher than 0.65, some of which were even higher than 0.7, even 0.8. Besides, calibration curves suggested no departure between model prediction and perfect fit. Additionally, immune-related and drug sensitivity results revealed potential targets and strategies for treatment, which can provide clinical guidance. <b>Conclusion</b>: We integrated traditional bulk RNA-seq and scRNA-seq data, along with predictive clinical features to develop a prognostic model for patients with NSCLC. According to the constructed model, patients in different groups can follow precise and individual therapeutic schedules based on immune characteristics as well as drug sensitivity.

HFE
Also flagged:irondextranlactationgene expressionClaudin 1Claudin 2
Journal Article 2024-01-01 ✓ 2 Snippets Pierce JL, Lyons JW, Chevalier TB, Lindemann MD.
In-Text Gene Mentions

…iron regulator gene (HFE) was downregulated (−1.33…

…authors reported thatHFEexpression increased by…

Show Full Abstract

Six female littermate piglets were used in an experiment to evaluate the mRNA expression in tissues from piglets given one or two 1 mL injections of iron dextran (200 mg Fe/mL). All piglets in the litter were administered the first 1 mL injection < 24 h after birth. On day 7, piglets were paired by weight (mean body weight = 1.72 ± 0.13 kg) and one piglet from each pair was randomly selected as control (CON) and the other received a second injection (+Fe). At weaning on day 22, each piglet was anesthetized, and samples of liver and duodenum were taken from the anesthetized piglets and preserved until mRNA extraction. differential gene expression data were analyzed with a fold change cutoff (FC) of |1.2| P < 0.05. Pathway analysis was conducted with Z-score cutoff of P < 0.05. In the duodenum 435 genes were significantly changed with a FC ≥ |1.2| P < 0.05. In the duodenum, Claudin 1 and Claudin 2 were inversely affected by + Fe. Claudin 1 (CLDN1) plays a key role in cell-to-cell adhesion in the epithelial cell sheets and was upregulated (FC = 4.48, P = 0.0423). Claudin 2 (CLDN2) is expressed in cation leaky epithelia, especially during disease or inflammation and was downregulated (FC = -1.41, P = 0.0097). In the liver, 362 genes were expressed with a FC ≥ |1.2| P < 0.05. The gene most affected by a second dose of 200 mg Fe was hepcidin antimicrobial peptide (HAMP) with a FC of 40.8. HAMP is a liver-produced hormone that is the main circulating regulator of Fe absorption and distribution across tissues. It also controls the major flows of Fe into plasma by promoting endocytosis and degradation of ferroportin (SLC4A1). This leads to the retention of Fe in Fe-exporting cells and decreased flow of Fe into plasma. Gene expression related to metabolic pathway changes in the duodenum and liver provides evidence for the improved feed conversion and growth rates in piglets given two iron injections preweaning with contemporary pigs in a companion study. In the duodenum, there is a downregulation of gene clusters associated with gluconeogenesis (P < 0.05). Concurrently, there was a decrease in the mRNA expression of genes for enzymes required for urea production in the liver (P < 0.05). These observations suggest that there may be less need for gluconeogenesis, and possibly less urea production from deaminated amino acids. The genomic and pathway analyses provided empirical evidence linking gene expression with phenotypic observations of piglet health and growth improvements.

RC3H1
Also flagged:Immune Responselung infectioninflammatory responseRNA-binding protein regnase-1Reg1MCPIP1
Journal Article 2024-01-01 ✓ 1 Snippet Lin B, Fan L, Jackson S, Matunis AR, Lou D, Chen K, Trevejo-Nuñez G.
In-Text Gene Mentions

…particularly Roquin 1/2 (RC3H1/2), which share the…

Show Full Abstract

Klebsiella pneumoniae (KP) presents a global health threat, leading to significant morbidity and mortality due to its multidrug-resistant profile and the limited availability of therapeutic options. To eliminate KP lung infection, the host initiates a robust inflammatory response. One of the host's mechanisms for mitigating excessive inflammation involves the RNA-binding protein regnase-1 (Reg1, MCPIP1, or ZC3H12A). Reg1 has an RNA binding domain that recognizes stem-loop structures in the 3' untranslated region of various proinflammatory transcripts, leading to mRNA decay. However, excessive suppression of inflammation by Reg1 results in suboptimal KP control. Reg1 deficiency within the nonhematopoietic compartment confers resistance to KP in the lung. Given that lung epithelium is crucial for KP resistance, we hypothesized that selective deletion of Reg1 in lung epithelial cells might enhance proinflammatory signals, leading to a better control of KP. Our transcriptomic analysis of epithelial cells in KP-infected wild-type mice revealed the presence of three distinct alveolar type 2 cell (AT2) subpopulations (conventional, inflammatory, and cycling) and enrichment of Reg1 in inflammatory AT2 cells. We conditionally deleted Reg1 in lung AT2 cells (ΔReg1), which amplified the local inflammatory response in the lung and increased macrophage cell numbers compared with controls. However, when ΔReg1 mice were subjected to KP infection, there were no significant differences in bacterial burden or survival compared with controls. These findings suggest that the local inflammatory response enhanced by Reg1 deletion in AT2 cells is insufficient to control KP infection.

TNFSF4
Also flagged:Zinc Transporterszinccancertransmembrane transportersSLC30ASLC39A
Journal Article 2024-01-01 ✓ 1 Snippet Liu Y, Wei L, Zhu Z, Ren S, Jiang H, Huang Y, Sun X, Sui X, Jin L, Sun X.
In-Text Gene Mentions

…such as TNFSF9,TNFSF4, TNFRSF4, CD276, VTCN1,…

Show Full Abstract

The disruption of zinc (Zn) homeostasis has been implicated in cancer development and progression through various signaling pathways. Maintaining intracellular zinc balance is crucial in the context of cancer. Human cells rely on two families of transmembrane transporters, SLC30A/ZNT and SLC39A/ZIP, to coordinate zinc homeostasis. While some ZNTs and ZIPs have been linked to cancer progression, limited information is available regarding the expression patterns of zinc homeostasis-related genes and their potential roles in predicting prognosis and developing therapeutic strategies for specific cancers. In this study, a systematic analysis was conducted to examine the expression of all genes from the SLC30A and SLC39A families at both mRNA and protein levels across different cancers. As a result, three SLC39A genes (<i>SLC39A1</i>, <i>SLC39A4</i>, and <i>SLC39A8</i>) were found to be significantly dysregulated in specific cancers, including cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), liver hepatocellular carcinoma (LIHC), pancreatic adenocarcinoma (PAAD), and kidney renal papillary cell carcinoma (KIRP). Moreover, the dysregulation of these genes was tightly associated with the prognosis of patients with those cancers. Furthermore, we found that the gene <i>SLC39A8</i> exhibited the lowest mutation frequency in KIRP, whereas mutations in <i>SLC39A4</i> were found to significantly impact overall survival (OS), disease-free (DF), and progress-free survival (PFS) in cancer patients, particularly in those with PAAD. Additionally, immune infiltration analysis revealed that <i>SLC39A1</i>, <i>SLC39A4</i>, and <i>SLC39A8</i> may function as immune regulators in cancers. This provides new insights into understanding the complex relationship between zinc homeostasis and cancer progression.

PEBP1
Also flagged:Alzheimer's DiseaseAgingADgene expressionsuppressor genessenescence inducible genes
Journal Article 2024-01-01 ✓ 4 Snippets Liu T, Hou K, Li J, Han T, Liu S, Wei J.
In-Text Gene Mentions

…CKB, PSMD14, SMARCA4,PEBP1, DDB2, ITPKB, ATF7IP,…

…were identified: PMSD14,PEBP1, ITPKB, and ATF7IP.…

…(AUCs) of PMSD14,PEBP1, ITPKB, and ATF7IP…

…PMSD14,PEBP1, ITPKB, and ATF7IP…

Show Full Abstract

<h4>Background</h4>Aging is considered a key risk factor for Alzheimer's disease (AD). This study aimed to identify and validate potential aging-related genes associated with AD using bioinformatics analysis.<h4>Methods</h4>Datasets GSE36980 and GSE5281 were selected to screen differentially expressed genes (DEGs), and the immune cell correlation analysis and GSEA analysis of DEGs were performed. The intersection with senescence genes was taken as differentially expressed senescence-related genes (DESRGs), and the GSE44770 dataset was used for further validation. The potential biological functions and signaling pathways were determined by GO and KEGG, and the hub genes were identified by 12 algorithms in Cytohubba. The expression of 10 hub genes in different brain regions was determined and single-cell sequencing analysis was performed, and diagnostic genes were further screened by gene expression and receiver operating characteristic (ROC) curve. Finally, a miRNA-gene network of diagnostic genes was constructed and targeted drug prediction was performed.<h4>Results</h4>A total of 2137 DEGs were screened from the GSE36980 and GSE5281 datasets, and 278 SRGs were identified from the CellAge database. The overlapping DEGs and SRGs constituted 29 DESRGs, including 14 senescence suppressor genes and 15 senescence inducible genes. The top 10 hub genes, including MDH1, CKB, PSMD14, SMARCA4, PEBP1, DDB2, ITPKB, ATF7IP, YAP1, and EWSR1 were screened. Furthermore, four diagnostic genes were identified: PMSD14, PEBP1, ITPKB, and ATF7IP. The ROC analysis showed that the respective area under the curves (AUCs) of PMSD14, PEBP1, ITPKB, and ATF7IP were 0.732, 0.701, 0.747, and 0.703 in the GSE36980 dataset and 0.870, 0.817, 0.902, and 0.834 in the GSE5281 dataset. In the GSE44770 dataset, PMSD14 (AUC, 0.838) and ITPKB (AUC, 0.952) had very high diagnostic values in the early stage of AD. Finally, based on these diagnostic genes, we found that the drug Abemaciclib is a targeted drug for the treatment of age-related AD. Flutamide can aggravate aging-related AD.<h4>Conclusion</h4>The results of this study suggest that cellular SRGs might play an important role in AD. PMSD14, PEBP1, ITPKB, and ATF7IP have the potential as specific biomarkers for the early diagnosis of AD.

TNFSF4
Also flagged:tumorscancertype I interferondeathtype I IFNprogrammed death-ligand 1
Journal Article 2024-01-01 ✓ 1 Snippet Sprooten J, Vanmeerbeek I, Datsi A, Govaerts J, Naulaerts S, Laureano RS, Borràs DM, Calvet A, Malviya V, Kuballa M, Felsberg J, Sabel MC, Rapp M, Knobbe-Thomsen C, Liu P, Zhao L, Kepp O, Boon L, Tejpar S, Borst J, Kroemer G, Schlenner S, De Vleeschouwer S, Sorg RV, Garg AD.
In-Text Gene Mentions

…, CD40 ,TNFSF4) ( Figures…

Show Full Abstract

Current immunotherapies provide limited benefits against T cell-depleted tumors, calling for therapeutic innovation. Using multi-omics integration of cancer patient data, we predict a type I interferon (IFN) response<sup>HIGH</sup> state of dendritic cell (DC) vaccines, with efficacious clinical impact. However, preclinical DC vaccines recapitulating this state by combining immunogenic cancer cell death with induction of type I IFN responses fail to regress mouse tumors lacking T cell infiltrates. Here, in lymph nodes (LNs), instead of activating CD4<sup>+</sup>/CD8<sup>+</sup> T cells, DCs stimulate immunosuppressive programmed death-ligand 1-positive (PD-L1<sup>+</sup>) LN-associated macrophages (LAMs). Moreover, DC vaccines also stimulate PD-L1<sup>+</sup> tumor-associated macrophages (TAMs). This creates two anatomically distinct niches of PD-L1<sup>+</sup> macrophages that suppress CD8<sup>+</sup> T cells. Accordingly, a combination of PD-L1 blockade with DC vaccines achieves significant tumor regression by depleting PD-L1<sup>+</sup> macrophages, suppressing myeloid inflammation, and de-inhibiting effector/stem-like memory T cells. Importantly, clinical DC vaccines also potentiate T cell-suppressive PD-L1<sup>+</sup> TAMs in glioblastoma patients. We propose that a multimodal immunotherapy and vaccination regimen is mandatory to overcome T cell-depleted tumors.

SOX6
Also flagged:rheumatoid arthritisRAjoint disorderpathogenesishistone deacetylaseHDAC
Journal Article 2024-01-01 ✓ 2 Snippets Li Z, Zhao W, Wang M, Hussain MZ, Mahjabeen I.
In-Text Gene Mentions

However, previous studies have indicated the expression dysregulation of miR-455-3p to suppress the genes associated with DNA methylation such as Smad3 and SOX6, and increased risk of bone/muscle disorder.[19,22] Kim et al[20] have reported that miR-455-3p expression dysregulation results in inhibiting DNMT3A expression.

…as Smad3 andSOX6, and increased risk…

Show Full Abstract

Rheumatoid arthritis (RA) is a joint disorder and is considered an important public health concern nowadays. So, identifying novel biomarkers and treatment modalities is urgently needed to improve the health standard of RA patients. Factors involved in RA pathogenesis are genetic/epigenetic modification, environment, and lifestyle. In the case of epigenetic modification, the expression deregulation of microRNAs and the role of histone deacetylase (HDAC) in RA is an important aspect that needs to be addressed. The present study is designed to evaluate the expression pattern of microRNAs related to the HDAC family. Five microRNAs, miR-92a-3p, miR-455-3p, miR-222, miR-140, and miR-146a related to the HDAC family were selected for the present study. Real-time polymerase chain reaction was used to estimate the level of expression of the above-mentioned microRNAs in 150 patients of RA versus 150 controls. Oxidative stress level and histone deacetylation status were measured using the enzyme-linked immunosorbent assay. Statistical analysis showed significant downregulation (P < .0001) of selected microRNAs in RA patients versus controls. Significantly raised level of HDAC (P < .0001) and 8-hydroxy-2'-deoxyguanosine (P < .0001) was observed in patients versus controls. A good diagnostic potential of selected microRNAs in RA was shown by the receiver operating curve analysis. The current study showed a significant role of deregulated expression of the above-mentioned microRNAs in RA initiation and can act as an excellent diagnostic marker for this disease.

Also flagged:GlioblastomaGBMtumortumorsbrain tumor glioblastomaglioblastoma multiforme
Journal Article 2024-01-01 No Snippets Mathur R, Wang Q, Schupp PG, Nikolic A, Hilz S, Hong C, Grishanina NR, Kwok D, Stevers NO, Jin Q, Youngblood MW, Stasiak LA, Hou Y, Wang J, Yamaguchi TN, Lafontaine M, Shai A, Smirnov IV, Solomon DA, Chang SM, Hervey-Jumper SL, Berger MS, Lupo JM, Okada H, Phillips JJ, Boutros PC, Gallo M, Oldham MC, Yue F, Costello JF.
Show Full Abstract

Treatment failure for the lethal brain tumor glioblastoma (GBM) is attributed to intratumoral heterogeneity and tumor evolution. We utilized 3D neuronavigation during surgical resection to acquire samples representing the whole tumor mapped by 3D spatial coordinates. Integrative tissue and single-cell analysis revealed sources of genomic, epigenomic, and microenvironmental intratumoral heterogeneity and their spatial patterning. By distinguishing tumor-wide molecular features from those with regional specificity, we inferred GBM evolutionary trajectories from neurodevelopmental lineage origins and initiating events such as chromothripsis to emergence of genetic subclones and spatially restricted activation of differential tumor and microenvironmental programs in the core, periphery, and contrast-enhancing regions. Our work depicts GBM evolution and heterogeneity from a 3D whole-tumor perspective, highlights potential therapeutic targets that might circumvent heterogeneity-related failures, and establishes an interactive platform enabling 360° visualization and analysis of 3D spatial patterns for user-selected genes, programs, and other features across whole GBM tumors.

Also flagged:collagencell migrationtissue formationtype I collagencalciumphosphorus
Journal Article 2024-01-01 No Snippets Cabrera Pereira A, Tovar N, Nayak VV, Mijares DQ, Smay JE, Torroni A, Flores RL, Witek L.
Show Full Abstract

Bone tissue has the capacity to regenerate under healthy conditions, but complex cases like critically sized defects hinder natural bone regeneration, necessitating surgery, and use of a grafting material for rehabilitation. The field of bone tissue engineering (BTE) has pioneered ways to address such issues utilizing different biomaterials to create a platform for cell migration and tissue formation, leading to improved bone reconstruction. One such approach involves 3D-printed patient-specific scaffolds designed to aid in regeneration of boney defects. This study aimed to develop and characterize 3D printed scaffolds composed of type I collagen augmented with β-tricalcium phosphate (COL/β-TCP). A custom-built direct inkjet write (DIW) printer was used to fabricate β-TCP, COL, and COL/β-TCP scaffolds using synthesized colloidal gels. After chemical crosslinking, the scaffolds were lyophilized and subjected to several characterization techniques, including light microscopy, scanning electron microscopy, and x-ray diffraction to evaluate morphological and chemical properties. In vitro evaluation was performed using human osteoprogenitor cells to assess cytotoxicity and proliferative capacity of the different scaffold types. Characterization results confirmed the presence of β-TCP in the 3D printed COL/β-TCP scaffolds, which exhibited crystals that were attributed to β-TCP due to the presence of calcium and phosphorus, detected through energy dispersive x-ray spectroscopy. In vitro studies showed that the COL/β-TCP scaffolds yielded more favorable results in terms of cell viability and proliferation compared to β-TCP and COL scaffolds. The novel COL/β-TCP scaffold constructs hold promise for improving BTE applications and may offer a superior environment for bone regeneration compared with conventional COL and β-TCP scaffolds.

Also flagged:esophageal adenocarcinomaepithelial-mesenchymal transitionGene expressiontranscription factorspathogenesisCDH11
Journal Article 2024-01-01 No Snippets Corlett R, Button C, Scheel S, Agrawal S, Rai V, Nandipati KC.
Show Full Abstract

Esophageal adenocarcinoma (EAC) occurs following a series of histological changes through epithelial-mesenchymal transition (EMT). A variable expression of normal and aberrant genes in the tissue can contribute to the development of EAC through the activation or inhibition of critical molecular signaling pathways. Gene expression is regulated by various regulatory factors, including transcription factors and microRNAs (miRs). The exact profile of miRs associated with the pathogenesis of EAC is largely unknown, though some candidate miRNAs have been reported in the literature. To identify the unique miR profile associated with EAC, we compared normal esophageal tissue to EAC tissue using bulk RNA sequencing. RNA sequence data was verified using qPCR of 18 selected genes. Fourteen were confirmed as being upregulated, which include CDH11, PCOLCE, SULF1, GJA4, LUM, CDH6, GNA12, F2RL2, CTSZ, TYROBP, and KDELR3 as well as the downregulation of UGT1A1. We then conducted Ingenuity Pathway Analysis (IPA) to analyze for novel miR-gene relationships through Causal Network Analysis and Upstream Regulator Analysis. We identified 46 miRs that were aberrantly expressed in EAC compared to control tissues. In EAC tissues, seven miRs were associated with activated networks, while 39 miRs were associated with inhibited networks. The miR-gene relationships identified provide novel insights into potentially oncogenic molecular pathways and genes associated with carcinogenesis in esophageal tissue. Our results revealed a distinct miR profile associated with dysregulated genes. The miRs and genes identified in this study may be used in the future as biomarkers and serve as potential therapeutic targets in EAC.

Also flagged:neurodegenerative disorderADchaperonecognitive declinepathogenesisgene expression
Journal Article 2024-01-01 No Snippets Takase H, Hamanaka G, Hoshino T, Ohtomo R, Guo S, Mandeville ET, Lo EH, Arai K.
Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is a widespread neurodegenerative disorder characterized by progressive cognitive decline, affecting a significant portion of the aging population. While the cerebral cortex and hippocampus have been the primary focus of AD research, accumulating evidence suggests that white matter lesions in the brain, particularly in the corpus callosum, play an important role in the pathogenesis of the disease.<h4>Objective</h4>This study aims to investigate the gene expression changes in the corpus callosum of 5xFAD transgenic mice, a widely used AD mouse model.<h4>Methods</h4>We conducted behavioral tests for spatial learning and memory in 5xFAD transgenic mice and performed RNA sequencing analyses on the corpus callosum to examine transcriptomic changes.<h4>Results</h4>Our results show cognitive decline and demyelination in the corpus callosum of 5xFAD transgenic mice. Transcriptomic analysis reveals a predominance of upregulated genes in AD mice, particularly those associated with immune cells, including microglia. Conversely, downregulation of genes related to chaperone function and clock genes such as Per1, Per2, and Cry1 is also observed.<h4>Conclusions</h4>This study suggests that activation of neuroinflammation, disruption of chaperone function, and circadian dysfunction are involved in the pathogenesis of white matter lesions in AD. The findings provide insights into potential therapeutic targets and highlight the importance of addressing white matter pathology and circadian dysfunction in AD treatment strategies.

Also flagged:thyroid nodulesNeuroendocrine Neoplasmsthyroid tumorthyroid cancerTERTTP53
Journal Article 2024-01-01 No Snippets Zhang M, Hu X, Liu L, Wang Y, Jiang J, Li H, Fei W, Zhong T, Jiang Z.
Show Full Abstract

<h4>Background</h4>The newly released 2022 WHO Classification of Neuroendocrine Neoplasms (version 5) and a recent update on thyroid tumor classifications have emphasized genetic testing to an unprecedented level. Fine needle aspiration (FNA) has been widely applied for the preoperative diagnosis of thyroid nodules. However, it is limited mainly to testing for a single gene-BRAFV600E, whereas multi-gene testing data are scarce, especially in the Asian population. This study aimed to explore the clinical value of multi-gene testing in the differential diagnosis of benign and malignant thyroid nodules based on the 2023 Bethesda System for Reporting Thyroid Cytopathology (BSRTC).<h4>Methods</h4>A total of 615 thyroid nodules underwent ultrasound-guided fine-needle aspiration cytology (FNAC) were collected from Sir Run Run Shaw Hospital, Zhejiang University School of Medicine. The next-generation sequencing platform was applied for multi-gene testing. A panel of well-recognized commonly mutated genes in thyroid cancer were analyzed, including BRAFV600E, KRAS, NRAS, HRAS, TERT, TP53, PAX8/PPARG, CCDC6/ RET and NCOA4/ RET.<h4>Results</h4>Gene mutations were identified in 324 nodules (52.7%), with BRAFV600E being the most prevalent driver gene alteration observed in this cohort (233/324; 79.1%), followed by RAS (77/324, 23.8%). The overall malignancy rate of gene mutations was 89.7% in our cohort, of which the lymph node metastasis rate was 45.3%. The combination of multi-gene testing and cytology resulted in 89.3% sensitivity, 95.2% specificity, 98.9% positive predictive value, 64.5% negative predictive value and 90.3% accuracy, which were significantly higher than those from mere cytology (sensitivity 68.6%, specificity 87.5%, positive predictive value 95.9%, negative predictive value 39.8%, accuracy 72.2%).<h4>Conclusions</h4>Multi-gene testing could substantially enhance the detection rate of malignant thyroid nodules and protect patients with benign nodules from unnecessary surgeries. Multi-gene testing provides a valuable reference for individualized preoperative decision-making, which may serve as a crucial method for postoperative treatment and prognosis assessment.

Also flagged:immune responseviral infectiontumor2infectionscancer
Journal Article 2024-01-01 No Snippets Niu M, Wang C, Chen Y, Zou Q, Xu L.
Show Full Abstract

Virus-encoded circular RNA (circRNA) participates in the immune response to viral infection, affects the human immune system, and can be used as a target for precision therapy and tumor biomarker. The coronaviruses SARS-CoV-1 and SARS-CoV-2 (SARS-CoV-1/2) that have emerged in recent years are highly contagious and have high mortality rates. In coronaviruses, little is known about the circRNA encoded by the SARS-CoV-1/2. Therefore, this study explores whether SARS-CoV-1/2 encodes circRNA and characteristics and functions of circRNA. Based on RNA-seq data of SARS-CoV-1 and SARS-CoV-2 infections, we used circRNA identification tools (circRNA_finder, find_circ and CIRI2) to identify circRNAs. The number of circRNAs encoded by SARS-CoV-1 and SARS-CoV-2 was identified as 151 and 470, respectively. It can be found that SARS-CoV-2 shows more prominent circRNA encoding ability than SARS-CoV-1. Expression analysis showed that only a few circRNAs encoded by SARS-CoV-1/2 showed high expression levels, and the positive strand produced more abundant circRNAs. Then, based on the identified SARS-CoV-1/2-encoded circRNAs, we performed circRNA identification and characterization using the previously developed CirRNAPL. Finally, target gene prediction and functional enrichment analysis were performed. It was found that viral circRNA is closely related to cancer and has a potential role in regulating host cell functions. This study studied the characteristics and functions of viral circRNA encoded by coronavirus SARS-CoV-1/2, providing a valuable resource for further research on the function and molecular mechanism of coronavirus circRNA.

VRK2
Also flagged:parturitionparturitionsreproductionautosomecordon-bleu WH2COBL
Journal Article 2024-01-01 ✓ 1 Snippet Munguía Vásquez MF, Gill CA, Riggs PK, Herring AD, Sanders JO, Riley DG.
In-Text Gene Mentions

VRK2

Show Full Abstract

Cow temperament at parturition may be mostly a measure of aggressiveness. The heritability of cow temperament at parturition in Bos taurus cows has been reported to be low. The objectives of this study were to estimate the heritability of cow temperament at parturition, conduct a genome-wide association analysis of cow temperament at the time of parturition, and estimate the correspondence of cow temperament at the time of parturition with cow productive performance and early-life temperament traits in Bos indicus crossbreds. Cow temperament was assessed from 1 to 5 indicating increasing levels of aggressiveness of cows (937 cows and 4,337 parturitions) from 2005 to 2022. Estimates of heritability and repeatability were 0.12 ± 0.024 and 0.24 ± 0.018. The estimates of proportion of phenotypic variance were 0.13 ± 0.019 and 0.02 ± 0.011 for permanent and maternal permanent environmental components, respectively. Estimates of heritability for maximum lifetime temperament score and proportions of temperament scores >1 were 0.18 ± 0.07 and 0.13 ± 0.072. Within cycles (generations), 2-yr-old cows had lower temperament score means than cows in most other age categories. There were low to moderate positive estimates of unadjusted correlation coefficients (r = 0.22 to 0.29; P < 0.05) of unadjusted temperament score with temperament measured on the same females when they were 8 mo old. There were low to moderate positive estimates of correlation coefficients (r = 0.09 to 0.37; P < 0.05) of unadjusted temperament score with calving rate, weaning rate, weaning weight per cow exposed, and weaning weight per 454 kg cow weight at weaning. Cows with the lowest temperament score had lower (P < 0.05) calving and weaning rate than cows in other temperament categories. Within 3 of 5 cycles, cows with the lowest temperament score (totally docile) had lower (P < 0.05) weaning weight per cow exposed than cows in other temperament categories. There were 2 SNP on BTA 4 associated with maximum lifetime temperament score (FDR < 0.05). The non-genetic influence of a cow's mother was documented in her own temperament measured at the time of calving; this may be a consequence of learned behavior. Less aggressiveness displayed by cows at the time of calving may be accompanied by lower reproductive and maternal performance.

OLFM4
Also flagged:chromosomeinfertilityInfertilizationinfertilechromosomes
Journal Article 2024-01-01 ✓ 1 Snippet Ou J, Sun J, Yang CC, Ni MX, Zou QY, Xing SY, Lin CH, Meng QX, Ding J, Zheng AY, Zhang Y, Kong LY, Liang B, Li H.
In-Text Gene Mentions

…detected, involving theOLFM4gene.…

Show Full Abstract

<h4>Background</h4>Cryptic translocations can be identified via genetic analysis of aborted tissues or malformed infants, but it is difficult to deduce the parental origins of the translocations. In the absence of such information, it is not easy to distinguish translocations from normal embryos during pre-implantation genetic testing, that seeks to block familial transmission of translocations.<h4>Methods</h4>Here, we present a new method that detects cryptic translocations and blocks familial transmission thereof. Whole-genome, low-coverage mate-pair sequencing (WGLMPS) revealed chromosome breakpoint sequences, and preimplantation genetic haplotyping (PGH) was then used to discard embryos with cryptic translocations.<h4>Results</h4>Cryptic translocations were found in all four families, and familial transmission was successfully blocked in one family.<h4>Conclusion</h4>Whole-genome, low-coverage mate-pair sequencing combined with preimplantation genetic haplotyping methods powerfully and practically identify cryptic translocations and block familial transmissions.

HTT
Also flagged:sleepcircadian rhythmHDautosomal dominant neurodegenerative disorderchromosomeSleep disorders
Journal Article 2024-01-01 ✓ 1 Snippet Chiem E, Zhao K, Stark G, Ghiani CA, Colwell CS, Paul KN.
In-Text Gene Mentions

…a human mutantHttgene encoding 97…

Show Full Abstract

Sleep and circadian rhythm disturbances are common features of Huntington's disease (HD). HD is an autosomal dominant neurodegenerative disorder that affects men and women in equal numbers, but some epidemiological studies as well as preclinical work indicate there may be sex differences in disease presentation and progression. Since sex differences in HD could provide important insights to understand cellular and molecular mechanism(s), we used the bacterial artificial chromosome transgenic mouse model of HD (BACHD) to examine whether sex differences in sleep/wake cycles are detectable in an animal model of the disease. Electroencephalography/electromyography (EEG/EMG) was used to measure sleep/wake states and polysomnographic patterns in young adult (12-week-old) male and female wild-type and BACHD mice. Our findings show that male, but not female, BACHD mice exhibited increased variation in phases of the rhythms as compared to age- and sex-matched wild-types. For both rapid-eye movement (REM) and non-rapid eye movement (NREM) sleep, genotypic and sex differences were detected. In particular, the BACHD males spent less time in NREM sleep and exhibited a more fragmented sleep than the other groups. Finally, in response to 6 h of sleep deprivation, both genotypes and sexes displayed the predicted homeostatic responses to sleep loss. These findings suggest that females are relatively protected early in disease progression in this HD model.

Also flagged:SND1Staphylococcal nuclease-containing structural domain 1transcriptional co-activatortumorlung adenocarcinomaLUAD
Journal Article 2024-01-01 No Snippets Zhang R, Huang H, Zhu G, Wu D, Chen C, Cao P, Ding C, Liu H, Chen J, Li Y.
Show Full Abstract

<h4>Background</h4>Transcription factor (TF) can bind specific sequences that either promotes or represses the transcription of target genes, and exerts important effects on tumorigenesis, migration, invasion. Staphylococcal nuclease-containing structural domain 1 (SND1), which is a transcriptional co-activator, is considered as a promising target for tumor therapy. However, its role in lung adenocarcinoma (LUAD) remains unclear. This study aims to explore the role of SND1 in LUAD.<h4>Methods</h4>Data from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), Clinical Proteomic Tumor Analysis Consortium (CPTAC), and Human Protein Atlas (HPA) database was obtained to explore the association between SND1 and the prognosis, as well as the immune cell infiltration, and subcellular localization in LUAD tissues. Furthermore, the functional role of SND1 in LUAD was verified in vitro. EdU assay, CCK-8 assay, flow cytometry, scratch assay, Transwell assay and Western blot were performed.<h4>Results</h4>SND1 was found to be upregulated and high expression of SND1 is correlated with poor prognosis of LUAD patients. In addition, SND1 was predominantly present in the cytoplasm of LUAD cells. Enrichment analysis showed that SND1 was closely associated with the cell cycle, as well as DNA replication, and chromosome segregation. Immune infiltration analysis showed that SND1 was closely associated with various immune cell populations, including T cells, B cells, cytotoxic cells and dendritic cells. In vitro studies demonstrated that silencing of SND1 inhibited cell proliferation, invasion and migration of LUAD cells. Besides, cell cycle was blocked at G1 phase by down-regulating SND1.<h4>Conclusions</h4>SND1 might be an important prognostic biomarker of LUAD and may promote LUAD cells proliferation and migration.

SLC2A14
Also flagged:StrokePathogenesisStroke-Induced Immunodepressionlymphopeniadeathdisulfide
Journal Article 2024-01-01 ✓ 2 Snippets Liu SP, Liu C, Xu B, Zhou H, Zhao H.
In-Text Gene Mentions

Weighted Gene Co-Expression Network Analysis (WGCNA) uncovered modules of co-expressed genes in stroke samples, and differentially expressed gene (DEG) analysis highlighted 1643 key genes.<h4>Results</h4>These analyses converged on four hub genes of DRGs (SLC2A3, SLC2A14, SLC7A11, NCKAP1) associated with stroke.

…of DRGs (SLC2A3,SLC2A14, SLC7A11, NCKAP1) associated…

Show Full Abstract

<h4>Background</h4>Stroke-Induced Immunodepression (SIID) is characterized by apoptosis in blood immune populations, such as T cells, B cells, NK cells, and monocytes, leading to the clinical presentation of lymphopenia. Disulfidptosis is a novel form of programmed cell death characterized by accumulating disulfide bonds in the cytoplasm, resulting in cellular dysfunction and eventual cell death.<h4>Objective</h4>In this study, we investigated the association between disulfidptosis and stroke by analyzing gene sequencing data from peripheral blood samples of stroke patients.<h4>Methods</h4>Differential gene expression analysis identified a set of disulfidptosis-related genes (DRGs) significantly associated with stroke. Initial exploration identified 32 DRGs and their interactions. Our study encompassed several analyses to understand the molecular mechanisms of DRGs in stroke. Weighted Gene Co-Expression Network Analysis (WGCNA) uncovered modules of co-expressed genes in stroke samples, and differentially expressed gene (DEG) analysis highlighted 1643 key genes.<h4>Results</h4>These analyses converged on four hub genes of DRGs (SLC2A3, SLC2A14, SLC7A11, NCKAP1) associated with stroke. Immune cell composition analysis indicated positive correlations between hub genes and macrophages M1, M2, and neutrophils and negative associations with CD4+ and CD8+ T cells, B cells, and NK cells. Sub-cluster analysis revealed two distinct clusters with different immune cell expression profiles. Gene Set Enrichment Analysis (GSEA) demonstrated enrichment of apoptosis-related pathways, neurotrophin signaling, and actin cytoskeleton regulation. Associations between hub genes and apoptosis, necroptosis, ferroptosis, and cuproptosis, were also identified.<h4>Conclusion</h4>These results suggest that the DRG hub genes are interconnected with various cell death pathways and immune processes, potentially contributing to stroke pathological development.

HFE
Also flagged:indole compoundsliver diseaseMetabolic dysfunction-associated steatotic liver diseasechronic liver diseaseindole-3-propionic acidindole-3-acetic acid
Journal Article 2024-01-01 ✓ 1 Snippet Min BH, Devi S, Kwon GH, Gupta H, Jeong JJ, Sharma SP, Won SM, Oh KK, Yoon SJ, Park HJ, Eom JA, Jeong MK, Hyun JY, Stalin N, Park TS, Choi J, Lee DY, Han SH, Kim DJ, Suk KT.
In-Text Gene Mentions

…use disorder, pancreatitis,hemochromatosis, viral liver disease,…

Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most common chronic liver disease, and its prevalence has increased worldwide in recent years. Additionally, there is a close relationship between MASLD and gut microbiota-derived metabolites. However, the mechanisms of MASLD and its metabolites are still unclear. We demonstrated decreased indole-3-propionic acid (IPA) and indole-3-acetic acid (IAA) in the feces of patients with hepatic steatosis compared to healthy controls. Here, IPA and IAA administration ameliorated hepatic steatosis and inflammation in an animal model of WD-induced MASLD by suppressing the NF-κB signaling pathway through a reduction in endotoxin levels and inactivation of macrophages. <i>Bifidobacterium bifidum</i> metabolizes tryptophan to produce IAA, and <i>B. bifidum</i> effectively prevents hepatic steatosis and inflammation through the production of IAA. Our study demonstrates that IPA and IAA derived from the gut microbiota have novel preventive or therapeutic potential for MASLD treatment.

Also flagged:peptidesnanofibrilsnanowirespeptideγ-aminobutyric acidamino acid
Journal Article 2024-01-01 No Snippets Samui S, Biswas S, Basak S, Ghosh S, Muniyappa K, Naskar J.
Show Full Abstract

Peptides are very interesting biomolecules that upon self-association form a variety of thermodynamically stable supramolecular structures of nanometric dimension <i>e.g.</i> nanotubes, nanorods, nanovesicles, nanofibrils, nanowires and many others. Herein, we report six peptide molecules having a general chemical structure, H-Gaba-X-X-OH (Gaba: γ-aminobutyric acid, X: amino acid). Out of these six peptides, three are aromatic and the others are aliphatic. Atomic force microscopic (AFM) studies reveal that except peptide 6 (H-Gaba-Trp-Trp-OH), all the reported peptides adopt nanofibrillar morphology upon aggregation in aqueous medium. These supramolecular assemblies can recognize amyloid-specific molecular probe congo red (CR) and thioflavine t (ThT) and exhibit all the characteristic properties of amyloids. The MTT cell viability assay reveals that the toxicity of both aliphatic and aromatic peptides increases with increasing concentration of the peptides to both cancer (HeLa) and non-cancer (HEK 293) cells. Of note, the aromatic peptides show a slightly higher cytotoxic effect compared to the aliphatic peptides. Overall, the studies highlight the self-assembling nature of the <i>de novo</i> designed aliphatic and aromatic peptides and pave the way towards elucidating the intricacies of pathogenic amyloid assemblies.

Also flagged:mitochondrial disordersmitochondrialphosphorylationmembranemitochondriacalcium
Journal Article 2024-01-01 No Snippets Alves CAPF, Whitehead MT.
Show Full Abstract

Mitochondrial diseases, a diverse and intricate group of disorders, result from both nuclear DNA and mitochondrial DNA malfunctions, leading to a decrease in cellular energy (ATP) production. The increasing understanding of molecular, biochemical, and genetic irregularities associated with mitochondrial dysfunction has led to a wider recognition of varying mitochondrial disease phenotypes. This broadening landscape has led to a diverse array of neuroimaging findings, posing a challenge to radiologists in identifying the extensive range of possible patterns. This review meticulously describes the central imaging features of mitochondrial diseases in children, as revealed by neuroimaging. It spans from traditional imaging findings to more recent and intricate diagnoses, offering insights and highlighting advancements in neuroimaging technology that can potentially guide a more efficient and accurate diagnostic approach.

Also flagged:hydroxyapatitecollagennanorodscalcium phosphatescationscalcium phosphate
Journal Article 2024-01-01 No Snippets Eknapakul T, Kuimalee S, Sailuam W, Daengsakul S, Tanapongpisit N, Laohana P, Saenrang W, Bootchanont A, Khamkongkaeo A, Yimnirun R.
Show Full Abstract

The comprehensive control of hydroxyapatite (HAp), involving morphological and structural variations, particle sizes, and defect formations, has garnered considerable attention for its versatile functionalities, rendering it applicable in diverse contexts. This work examined the shape, structure and optical characteristics, and defect formation in hydroxyapatite (HAp) extracted from Nile tilapia (<i>Oreochromis niloticus</i>) scales with various pre-treatments through experiments and density functional theory (DFT) calculations. Utilizing scanning electron microscopy, our findings revealed that dried fish scales (FS-D) exhibited a layered pattern of collagen fibers, while boiled fish scales (FS-B) had smoother surfaces and significantly reduced collagen content. After calcination, the FS-D sample produced nanorods with an average length of 150 ± 44 nm, whereas the FS-B samples yielded agglomerated spherical particles whose size increased with the rising calcining temperature. In-depth analysis through X-ray diffraction and Fourier-transform infrared spectroscopy confirmed the presence of biphasic calcium phosphates in the FS-B samples, while the FS-D sample presented a pure HAp phase. The boiled fish scale calcined at 800 °C (FS-B800) exhibited an optical band gap (<i>E</i><sub>g</sub>) of 5.50 eV, whereas the dried fish scale calcined at 800 °C (FS-D800) showed two <i>E</i><sub>g</sub> values of 2.87 and 3.97 eV, as determined by UV-visible spectroscopy. DFT calculations revealed that the band gap of 3.97 eV correlated with OH<sup>-</sup> vacancies, while that of 2.87 eV indicated Mn-substituted HAp, explaining the blue powder. The <i>E</i><sub>g</sub> value for the white powder resembled pure HAp, S<sup>-</sup> and Cl<sup>-</sup> substituted OH<sup>-</sup> vacancies, and various cations substituting Ca sites of HAp. Different pre-treatment procedures influence the characteristics of HAp, offering opportunities for applications in bone replacement and scaffolds for bone tissue engineering.

SERPINC1
Also flagged:Thrombophiliaperinatal arterial ischemic strokestrokemiddle cerebral artery infarctioncerebral palsyepilepsy
Journal Article 2024-01-01 ✓ 3 Snippets Bektaş Ö, Göktaş ÖA, Atasay B, Teber S.
In-Text Gene Mentions

…C, protein S,ATIII, homocysteine, factor V-Leide…

…protein S, andATIIIlevels are especially…

…C, homocysteine, andATIIIin the first…

Show Full Abstract

This study aimed to investigate the influence of prothrombotic risk factors on long-term outcomes of patients with perinatal arterial ischemic stroke. The study was conducted through an analysis of monitoring results that were regularly maintained for approximately 20 years at a tertiary stroke-monitoring center. The study assessed prothrombotic risk factors, radiological area of involvement, clinical presentation, treatments, clinical outcomes, and long-term outcomes of the 48 patients included in the study, with a mean monitoring time of 77.6 ± 45.7 months (range: 6-204). Our results showed that the presence of prothrombotic risk factors did not affect long-term outcomes. However, patients with middle cerebral artery infarction had the highest risk of developing cerebral palsy, whereas those with presumed stroke had the highest risk of developing epilepsy. This study suggests that prothrombotic risk factors should not be evaluated during the acute stage unless there is a strong suspicion of the patient's history, and prevention or early diagnosis of presumed stroke patients will positively impact their long-term prognosis.

SERPINC1
Also flagged:Cardiovascular diseaseischemic strokemyocardial infarctionvenous thromboembolismThrombustechnetium
Journal Article 2024-01-01 ✓ 1 Snippet Samridhi, Setia A, Mehata AK, Priya V, Pradhan A, Prasanna P, Mohan S, Muthu MS.
In-Text Gene Mentions

…S and AT-III (Antithrombin-III), which thwart the…

Show Full Abstract

Cardiovascular disease is one of the chief factors that cause ischemic stroke, myocardial infarction, and venous thromboembolism. The elements that speed up thrombosis include nutritional consumption, physical activity, and oxidative stress. Even though the precise etiology and pathophysiology remain difficult topics that primarily rely on traditional medicine. The diagnosis and management of thrombosis are being developed using discrete non-invasive and non-surgical approaches. One of the emerging promising approach is ultrasound and photoacoustic imaging. The advancement of nanomedicines offers concentrated therapy and diagnosis, imparting efficacy and fewer side effects which is more significant than conventional medicine. This study addresses the potential of nanomedicines as theranostic agents for the treatment of thrombosis. In this article, we describe the factors that lead to thrombosis and its consequences, as well as summarize the findings of studies on thrombus formation in preclinical and clinical models and also provide insights on nanoparticles for thrombus imaging and therapy.

Also flagged:segmentationguaninecytosinedeoxyribonucleic acidgenetic diseasegene expression
Journal Article 2024-01-01 No Snippets Zhang Y, Liu W, Duan J.
Show Full Abstract

Shotgun sequencing is a high-throughput method used to detect copy number variants (CNVs). Although there are numerous CNV detection tools based on shotgun sequencing, their quality varies significantly, leading to performance discrepancies. Therefore, we conducted a comprehensive analysis of next-generation sequencing-based CNV detection tools over the past decade. Our findings revealed that the majority of mainstream tools employ similar detection rationale: calculates the so-called read depth signal from aligned sequencing reads and then segments the signal by utilizing either circular binary segmentation (CBS) or hidden Markov model (HMM). Hence, we compared the performance of those two core segmentation algorithms in CNV detection, considering varying sequencing depths, segment lengths and complex types of CNVs. To ensure a fair comparison, we designed a parametrical model using mainstream statistical distributions, which allows for pre-excluding bias correction such as guanine-cytosine (GC) content during the preprocessing step. The results indicate the following key points: (1) Under ideal conditions, CBS demonstrates high precision, while HMM exhibits a high recall rate. (2) For practical conditions, HMM is advantageous at lower sequencing depths, while CBS is more competitive in detecting small variant segments compared to HMM. (3) In case involving complex CNVs resembling real sequencing, HMM demonstrates more robustness compared with CBS. (4) When facing large-scale sequencing data, HMM costs less time compared with the CBS, while their memory usage is approximately equal. This can provide an important guidance and reference for researchers to develop new tools for CNV detection.

PEBP1
Also flagged:adenosine triphosphatesynthesiselectron transport chainATP5MC2COX7A2UQCR
Journal Article 2024-01-01 ✓ 3 Snippets Jiang W, Mooney MH, Shirali M.
In-Text Gene Mentions

…only once, exceptPEBP1, which was reported…

PEBP1(Chr 17, 60…

…In bovine,PEBP1mRNA in Holstein…

Show Full Abstract

Improving the feeding efficiency of dairy cows is a key component to improve the utilization of land resources and meet the demand for high-quality protein. Advances in genomic methods and omics techniques have made it possible to breed more efficient dairy cows through genomic selection. The aim of this review is to obtain a comprehensive understanding of the biological background of feed efficiency (FE) complex traits in purebred Holstein dairy cows including heritability estimate, and genetic markers, genes, and pathways participating in FE regulation mechanism. Through a literature search, we systematically reviewed the heritability estimation, molecular genetic markers, genes, biomarkers, and pathways of traits related to feeding efficiency in Holstein dairy cows. A meta-analysis based on a random-effects model was performed to combine reported heritability estimates of FE complex. The heritability of residual feed intake, dry matter intake, and energy balance was 0.20, 0.34, and 0.22, respectively, which proved that it was reasonable to include the related traits in the selection breeding program. For molecular genetic markers, a total of 13 single-nucleotide polymorphisms and copy number variance loci, associated genes, and functions were reported to be significant across populations. A total of 169 reported candidate genes were summarized on a large scale, using a higher threshold (adjusted P value < 0.05). Then, the subsequent pathway enrichment of these genes was performed. The important genes reported in the articles were included in a gene list and the gene list was enriched by gene ontology (GO):biological process (BP), and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analysis. Three GO:BP terms and four KEGG terms were statistically significant, which mainly focused on adenosine triphosphate (ATP) synthesis, electron transport chain, and OXPHOS pathway. Among these pathways, involved genes such as ATP5MC2, NDUFA, COX7A2, UQCR, and MMP are particularly important as they were previously reported. Twenty-nine reported biological mechanisms along with involved genes were explained mainly by four biological pathways (insulin-like growth factor axis, lipid metabolism, oxidative phosphorylation pathways, tryptophan metabolism). The information from this study will be useful for future studies of genomic selection breeding and genetic structures influencing animal FE. A better understanding of the underlying biological mechanisms would be beneficial, particularly as it might address genetic antagonism.

HTT
Also flagged:trabecular tumor of the thyroid glandthyroid tumortrabecular tumorBRAF V600Etumorcytoplasm
Journal Article 2024-01-01 ✓ 1 Snippet Wang F, Liu Y.
In-Text Gene Mentions

<h4>Background</h4>The incidence of thyroid tumor is increasing, and preoperative diagnosis of hyalinizing trabecular tumor (HTT) is difficult.<h4>Aim</h4>To investigate the cytological features of HTT of the thyroid gland.<h4>Settings and design</h4>A retrospective observational study.<h4>Materials and methods</h4>Ultrasonography, preoperative needle aspiration cytology, postoperative histopathology, immunohistochemistry, and BRAF V600E gene test were performed in five patients with HTT to analyze the pathological characteristics of the patients and review the relevant literature.<h4>Results</h4>Four female and one male patients with HTT were recruited.

Show Full Abstract

<h4>Background</h4>The incidence of thyroid tumor is increasing, and preoperative diagnosis of hyalinizing trabecular tumor (HTT) is difficult.<h4>Aim</h4>To investigate the cytological features of HTT of the thyroid gland.<h4>Settings and design</h4>A retrospective observational study.<h4>Materials and methods</h4>Ultrasonography, preoperative needle aspiration cytology, postoperative histopathology, immunohistochemistry, and BRAF V600E gene test were performed in five patients with HTT to analyze the pathological characteristics of the patients and review the relevant literature.<h4>Results</h4>Four female and one male patients with HTT were recruited. Fine-needle aspiration cytology (FNAC) showed bloodstained background tumor cells with multiple morphologies. The tumor cells exhibited ovoid nuclei, abundant cytoplasm, fine chromatin, nuclear crowding and overlapping, and small nucleoli. Focal nuclear pseudoinclusions and grooves were present. No papillary structures or psammoma bodies were observed. In all cases, tumor cells were radially distributed around the eosinophilic extracellular matrix. In 40% (2 in 5) of cases, trabecular patterns of elongated tumor cells were present, with their nuclei staggered along the longitudinal axis of tumor cells in the trabeculae. FNAC suggested two cases of HTT and three cases of papillary thyroid cancer. Post-operational biopsy indicated they were HTT cases.<h4>Conclusion</h4>HTT is a rare thyroid tumor with non-specific clinical manifestations. It can be misinterpreted as papillary thyroid carcinoma by FNAC. However, its cytomorphological traits are helpful in the diagnosis. In combination with FNAC, immunohistochemistry, and molecular testing, HTT can be accurately diagnosed.

HFE
Also flagged:Melanosis CutisMelanomametastatic malignant melanomapigmentationmembranesmelanin
Journal Article 2024-01-01 ✓ 1 Snippet Burroni AG, Capurro N, Rongioletti F, Cozzani E, Pronzato P, Herzum A, Guadagno A, Molle MF, Oddenino GA, Parodi A.
In-Text Gene Mentions

…ts excluded hypoaldosteronism,hemochromatosis, lead, mercury, and…

Show Full Abstract

<h4>Introduction</h4>Diffuse Melanosis Cutis (DMC) is a rare and late complication of metastatic malignant melanoma (MM) characterized by progressive pigmentation of skin and sometimes mucous membranes. The distinctive feature is the widespread and progressive deposition of melanin precursors in the dermis.<h4>Objectives</h4>The purpose of this review is to define the clinical and demographic features of DMC and to promote a deeper insight into the clinical manifestation, histological findings, and pathophysiology behind DMC.<h4>Methods</h4>We have conducted a systematic review of the literature on published DMC in compliance with the Preferred Reporting Items for Systematic Reviews and Meta-Analysis. We also reported a case of DMC secondary to low-risk melanoma.<h4>Results</h4>Overall, including our case report, we reported 53 articles described 62 DMC patients. Breslow level of primary melanoma was reported having a mean value of 3.3 mm. The mean survival rate from onset of DMC resulted being 4.36 months.<h4>Conclusions</h4>Among the most widely accepted etiopathogenetic hypotheses are deposition of melanic precursors in the dermis following tumor lysis, melanocyte proliferation induced by neoplastic growth factors, and the presence of diffuse dermal micro-metastases of MM. However, unanimous consensus on the proposed etiopathogenetic models of DMC is still lacking.

NEGR1
Also flagged:breast cancercancerscancerdigestiontumorsBRCA
Journal Article 2024-01-01 ✓ 2 Snippets Whitham D, Bruno P, Haaker N, Arcaro KF, Pentecost BT, Darie CC.
In-Text Gene Mentions

neuronal growth regulator 1

NEGR1

Show Full Abstract

<h4>Introduction</h4>Breast cancer is one of the most prevalent cancers among women in the United States. Current research regarding breast milk has been focused on the composition and its role in infant growth and development. There is little information about the proteins, immune cells, and epithelial cells present in breast milk which can be indicative of the emergence of BC cells and tumors.<h4>Areas covered</h4>We summarize all breast milk studies previously done in our group using proteomics. These studies include 1D-PAGE and 2D-PAGE analysis of breast milk samples, which include within woman and across woman comparisons to identify dysregulated proteins in breast milk and the roles of these proteins in both the development of BC and its diagnosis. Our projected outlook for the use of milk for cancer detection is also discussed.<h4>Expert opinion</h4>Analyzing the samples by multiple methods allows one to interrogate a set of samples with various biochemical methods that complement each other, thus providing a more comprehensive proteome. Complementing methods like 1D-PAGE, 2D-PAGE, in-solution digestion and proteomics analysis with PTM-omics, peptidomics, degradomics, or interactomics will provide a better understanding of the dysregulated proteins, but also the modifications or interactions between these proteins.

Also flagged:colorectal cancerHubAURKACCNB1EXO1CCNA2
Journal Article 2024-01-01 No Snippets Li S, Li T, Shi YQ, Xu BJ, Deng YY, Sun XG.
Show Full Abstract

<h4>Background</h4>Our study aimed to investigate the Hub genes and their prognostic value in colorectal cancer (CRC) via bioinformatics analysis.<h4>Methods</h4>The data set of colorectal cancer was downloaded from the GEO database (GSE21510, GSE110224 and GSE74602) for differential expression analysis using the GEO2R tool. Hub genes were screened by protein-protein interaction (PPI) comprehensive analysis. GEPIA was used to verify the expression of Hub genes and evaluate its prognostic value. The protein expression of Hub gene in CRC was analyzed using the Human Protein Atlas database. The cBioPortal was used to analyze the type and frequency of Hub gene mutations, and the effects of mutation on the patients' prognosis. The TIMER database was used to study the correlation between Hub genes and immune infiltration in CRC. Gene set enrichment analysis (GSEA) was used to explore the biological function and signal pathway of the Hub genes and corresponding co-expressed genes.<h4>Results</h4>We identified 346 differentially expressed genes (DEGs), including 117 upregulated and 229 downregulated. Four Hub genes (AURKA, CCNB1, EXO1 and CCNA2) were selected by survival analysis and differential expression validation. The protein and mRNA expression levels of AURKA, CCNB1, EXO1 and CCNA2 were higher in CRC tissues than in adjacent tissues. There were varying degrees of immune cell infiltration and gene mutation of Hub genes, especially B cells and CD8+ T cells. The results of GSEA showed that Hub genes and their co-expressed genes mainly participated in chromosome segregation, DNA replication, translational elongation and cell cycle.<h4>Conclusion</h4>Overexpression of AURKA, CCNB1, CCNA2 and EXO1 had a better prognosis for CRC and this effect was correlation with gene mutation and infiltration of immune cells.

SERPINC1
Also flagged:von Willebrand factorvenous thromboembolismvWFCoagulationprothrombinthrombin
Journal Article 2024-01-01 ✓ 1 Snippet Yue J, Wan L, Wang G, Zhang R, Zhang X, Liu O, Yu X, Huang Q, Ren Z.
In-Text Gene Mentions

…D-dimer, antithrombin III (ATIII), etc.…

Show Full Abstract

<h4>Objective</h4>To analyze the predictive value of von Willebrand factor (vWF) for venous thromboembolism (VTE) of patients in intensive care unit (ICU) by using propensity score matching (PSM).<h4>Methods</h4>Patients admitted to ICU of the Second Affiliated Hospital of Kunming Medical University from December 2020 to June 2022 who stayed in ICU for ≥72 hours and underwent daily bedside vascular ultrasound screening were included. Baseline data such as age, gender, primary disease, and chronic comorbidities were collected. Coagulation indexes before admission to ICU and 24 hours and 48 hours after ICU admission were collected, including prothrombin time (PT), activated partial thromboplastin time (APTT), thrombin time (TT), international normalized ratio (INR), fibrinogen (Fib), fibrin monomer (FM), vWF, D-dimer, antithrombin III (ATIII), etc. Patients were divided into VTE group and non-VTE group according to whether they had VTE or not [diagnosis of VTE: patients underwent daily ultrasound screening of bedside blood vessels (both upper and lower limbs, visceral veins), and those suspected of having thrombosis were confirmed by ultrasonographer or pulmonary angiography]. Using PSM analysis method, the VTE group was used as the benchmark to conduct 1 : 1 matching of age, whether there was malignant tumor, whether there was infection, whether there was diabetes, and coagulation indicators before admission to ICU. Finally, the cases with balanced covariates between the two groups were obtained. The risk factors of VTE were analyzed by multivariate Logistic regression analysis. Receiver operator characteristic curve (ROC curve) was drawn to evaluate the predictive value of vWF in the occurrence of VTE in critically ill patients.<h4>Results</h4>A total of 120 patients were enrolled, of which 18 (15.0%) were diagnosed with VTE within 72 hours after admission to ICU, and 102 (85.0%) were not found to have thrombus in ICU. Before PSM, there were significant differences in age, gender, proportion of malignant tumor and infection, and coagulation indexes between VTE group and non-VTE group. After PSM, 14 pairs were successfully matched, and the unbalanced covariables between the two groups reached equilibrium. Multivariate Logistic regression analysis showed that vWF was an independent risk factor for VTE at 48 hours after ICU admission in critically ill patients [odds ratio (OR) = 1.165, 95% confidence interval (95%CI) was 1.000-1.025, P = 0.004]. ROC curve analysis showed that the area under the ROC curve (AUC) of vWF at 48 hours after ICU admission for predicting VTE was 0.782, 95%CI was 0.618-0.945, P = 0.007. When the optimal cut-off value was 312.12%, the sensitivity was 67.7% and the specificity was 93.0.<h4>Conclusions</h4>Dynamic monitoring of vWF is helpful to predict the occurrence of VTE in ICU patients, and vWF at 48 hours after ICU admission has certain value in predicting the occurrence of VTE.

Also flagged:Diabetesinsulinchronic diseasetype 2 diabetesGlucose-19
Journal Article 2024-01-01 No Snippets Ravi S, Meyerowitz-Katz G, Murugesan A, Ayre J, Jayaballa R, Rintoul D, Sarkis M, McCaffery K, Maberly G, Bonner C.
Show Full Abstract

<h4>Introduction</h4>Western Sydney Diabetes (WSD) established an innovative diabetes service in May 2020, using virtual and in-person care, linking primary care with the diabetes specialist team. This study evaluated the service's feasibility using qualitative and quantitative methods.<h4>Method</h4>Evaluation included: 1) thematic analysis of interviews and workshops with patients and health professionals (n = 28); 2) quantitative analysis of records of patients admitted July 2020-June 2021 (n = 110).<h4>Results</h4>Key themes related to 1) benefits: convenient location, access to integrated care, advantages of virtual care; 2) challenges: hard for patients to ask questions, technology issues; 3) confidence: shared care decision making, multidisciplinary team; and 4) future directions: additional multidisciplinary services, expanded insulin stabilisation service, promotion.Improvements between baseline and 3 months included 1.3% reduction in HbA<sub>1c</sub> (p < 0.05). Sulfonylurea dropped by 25% between initial appointment and follow-up, and GLP1RA/SGLT2i use increasing by 30% (p < 0.05). The clinic covered costs using Medicare billings and Nationally Weighted Activity Units.<h4>Discussion</h4>The findings suggest this integrated care model was feasible and perceived as beneficial by both patients and providers. The clinic offers a promising model of practice that could be developed further to roll out in other regions for rural delivery of care.

DCC
Also flagged:MDM2ARTM4SF3Androgen receptorprostate cancerDegradation
Journal Article 2024-01-01 ✓ 2 Snippets Khatiwada P, Rimal U, Han Z, Shemshedini L.
In-Text Gene Mentions

To maintain basal levels of AR/AR-V7 and TM4SF3, cells were grown in RPMI-1640 or DMEM medium (HEK-293T) without phenol red and l-glutamine, supplemented with 2% dextran charcoal extracted FBS (2% DCC) (Gibco), also referred as deprivation medium, for 48 h before MDM2 inhibitor (MDM2i) treatment or transfections.

…medium with 10%DCC-stripped serum.…

Show Full Abstract

Androgen receptor (AR) and its constitutively active splice variant, AR Variant 7 (AR-V7), regulate genes essential for the development and progression of prostate cancer. Degradation of AR and AR-V7 by the ubiquitination proteasomal pathway is important for the regulation of both their protein stability. Our published results demonstrate that the interaction of TM4SF3 with either AR or AR-V7 leads to mutual stabilization due to a reduction in their ubiquitination and proteasomal degradation. These results led us to search for a common E3 ligase for AR, AR-V7, and TM4SF3. Depletion by siRNA of several E3 ligases identified MDM2 as the common E3 ligase. MDM2 inhibition by siRNA depletion or using a pharmacological inhibitor (MDM2i) of its E3 ligase activity led to elevated levels of endogenous AR, AR-V7, and TM4SF3 in prostate cancer cells. MDM2 knockdown in PC-3 cells, which do not express AR, also increased TM4SF3, demonstrating that MDM2 affects the TM4SF3 protein independent of AR. We further demonstrate that MDM2i treatment reduced the ubiquitination of AR and TM4SF3, suggesting that MDM2 can induce the ubiquitination of these proteins. Increased AR and AR-V7 protein levels induced by MDM2i treatment resulted in the expected increased expression of AR-regulated genes and enhanced proliferation and migration of both LNCaP and Enzalutamide-resistant CWR-22Rv1 prostate cancer cells. Thus, our study expands the known roles of MDM2 in prostate cancer to include its potential involvement in the important mutual stabilization that TM4SF3 exhibits when interacting with either AR or AR-V7.

PEBP1
Also flagged:Phytolα-BisabololAutophagyNon-Small Cell Lung CancerNSCLCBcl-2
Journal Article 2024-01-01 ✓ 1 Snippet Kiruthiga C, Niharika K, Devi KP.
In-Text Gene Mentions

…CAPN2, TXN, ECHS1,PEBP1, PFN1, CDC42, TUBB1,…

Show Full Abstract

<h4>Background</h4>Non-Small Cell Lung Cancer (NSCLC) is a malignancy with a significant prevalence and aggressive nature, posing a considerable challenge in terms of therapeutic interventions. Autophagy and apoptosis, two intricate cellular processes, are integral to NSCLC pathophysiology, each affecting the other through shared signaling pathways. Phytol (Phy) and α-bisabolol (Bis) have shown promise as potential anticancer agents individually, but their combined effects in NSCLC have not been extensively investigated.<h4>Objective</h4>The present study was to examine the synergistic impact of Phy and Bis on NSCLC cells, particularly in the context of autophagy modulation, and to elucidate the resulting differential protein expression using LCMS/ MS analysis.<h4>Methods</h4>The A549 cell lines were subjected to the patented effective concentration of Phy and Bis, and subsequently, the viability of the cells was evaluated utilizing the MTT assay. The present study utilized real-time PCR analysis to assess the expression levels of crucial apoptotic genes, specifically Bcl-2, Bax, and Caspase-9, as well as autophagy-related genes, including Beclin-1, SQSTM1, Ulk1, and LC3B. The confirmation of autophagy marker expression (Beclin-1, LC3B) and the autophagy-regulating protein SQSTM1 was achieved through the utilization of Western blot analysis. Differentially expressed proteins were found using LC-MS/MS analysis.<h4>Results</h4>The combination of Phy and Bis demonstrated significant inhibition of NSCLC cell growth, indicating their synergistic effect. Real-time PCR analysis revealed a shift towards apoptosis, with downregulation of Bcl-2 and upregulation of Bax and Caspase-9, suggesting a shift towards apoptosis. Genes associated with autophagy regulation, including Beclin-1, SQSTM1 (p62), Ulk1, and LC3B, showed significant upregulation, indicating potential induction of autophagy. Western blot analysis confirmed increased expression of autophagy markers, such as Beclin-1 and LC3B, while the autophagy-regulating protein SQSTM1 exhibited a significant decrease. LC-MS/MS analysis revealed differential expression of 861 proteins, reflecting the modulation of cellular processes. Protein-protein interaction network analysis highlighted key proteins involved in apoptotic and autophagic pathways, including STOML2, YWHAB, POX2, B2M, CDA, CAPN2, TXN, ECHS1, PEBP1, PFN1, CDC42, TUBB1, HSPB1, PXN, FGF2, and BAG3, emphasizing their crucial roles. Additionally, PANTHER pathway analysis uncovered enriched pathways associated with the differentially expressed proteins, revealing their involvement in a diverse range of biological processes, encompassing cell signaling, metabolism, and cellular stress responses.<h4>Conclusion</h4>The combined treatment of Phy and Bis exerts a synergistic inhibitory effect on NSCLC cell growth, mediated through the interplay of apoptosis and autophagy. The differential protein expression observed, along with the identified proteins and enriched pathways, provides valuable insights into the underlying molecular mechanisms. These findings offer a foundation for further exploration of the therapeutic potential of Phy and Bis in the management of NSCLC.

HTT
Also flagged:Huntington's diseaseHDpathogenesisDsRed
Journal Article 2024-01-01 ✓ 2 Snippets Chanda K, Mukhopadhyay D.
In-Text Gene Mentions

…of Cytotoxic Huntingtin (HTT) Protein Aggregates Regulated…

…formed by mutantHTTprotein.…

Show Full Abstract

Huntington's disease (HD) pathogenesis involves deregulation of coding and noncoding RNA transcripts of which the involvement of long noncoding RNAs (lncRNA) has been realized recently. Of these, Meg3, Neat1, and Xist showed a consistent and significant increase in HD cell and animal models. In the present study, we formulate a methodology to visualize and quantify intracellular aggregates formed by mutant HTT protein. This method employs the use of both confocal laser scanning and super resolution (N-SIM) microscopy to accurately estimate aggregate numbers. Further, to determine the role of two lncRNAs Meg3 and Neat1 in the formation of aggregates of mutant HTT, we used commercially available siRNAs against Meg3 and Neat1 for transiently knocking them down in mouse Neuro2a and human SHSY5Y cells. Co-transfection of 83Q-DsRed and siRNA specific for Neat1 or Meg3 resulted in decreased intracellular aggregates of 83Q-DsRed in both the cell lines. We have established a quantitative method to estimate and directly or indirectly modulate the formation of mutant HTT aggregates.

HTT
Also flagged:Huntingtinneurodegenerative disorderHDDARPP32BDNFaxonal
Journal Article 2024-01-01 ✓ 5 Snippets Louessard M, Cailleret M, Jarrige M, Bigarreau J, Lenoir S, Dufour N, Rey M, Saudou F, Deglon N, Perrier AL.
In-Text Gene Mentions

Mutations in the Huntingtin (HTT) gene cause Huntington’s disease (HD), a neurodegenerative disorder.

Abnormal expansion of a CAG repeat tract in exon 1 of the HTT gene results in the elongation of a poly-glutamine (≥40Q) in the N-terminal of mutant HTT proteins (mut-HTT) and causes Huntington’s disease (HD) [4].

We created a novel collection of isogenic mono- or biallelic HTT knock-out iPSC clones to investigate the functions of the HTT gene and molecular determinants of HD.

In order to model the loss of wt-HTT, mut-HTT, or both isoforms during human neural and striatal development, we used CRISPR-Cas9 technology to inactivate the HTT gene in the human iPSC line (ND42222) generated from an HD patient carrying a mutant allele with 109 CAG repeats.

Characterizing neural and neuronal derivatives of human iPSCs of this collection, we show evidence that HTT loss or mutation has impacts on neuro-epithelial and striatal neurons maturation in line with the growing body of literature in support of a role for HTT protein in specific steps of human neurodevelopment and for a developmental component to HD.

Show Full Abstract

<h4>Background</h4>Mutations in the Huntingtin (HTT) gene cause Huntington's disease (HD), a neurodegenerative disorder. As a scaffold protein, HTT is involved in numerous cellular functions, but its normal and pathogenic functions during human forebrain development are poorly understood.<h4>Objective</h4>To investigate the developmental component of HD, with a specific emphasis on understanding the functions of wild-type and mutant HTT alleles during forebrain neuron development in individuals carrying HD mutations.<h4>Methods</h4>We used CRISPR/Cas9 gene-editing technology to disrupt the ATG region of the HTT gene via non-homologous end joining to produce mono- or biallelic HTT knock-out human induced pluripotent stem cell (iPSC) clones.<h4>Results</h4>We showed that the loss of wild-type, mutant, or both HTT isoforms does not affect the pluripotency of iPSCs or their transition into neural cells. However, we observed that HTT loss causes division impairments in forebrain neuro-epithelial cells and alters maturation of striatal projection neurons (SPNs) particularly in the acquisition of DARPP32 expression, a key functional marker of SPNs. Finally, young post-mitotic neurons derived from HTT-/- human iPSCs display cellular dysfunctions observed in adult HD neurons.<h4>Conclusions</h4>We described a novel collection of isogenic clones with mono- and biallelic HTT inactivation that complement existing HD-hiPSC isogenic series to explore HTT functions and test therapeutic strategies in particular HTT-lowering drugs. Characterizing neural and neuronal derivatives from human iPSCs of this collection, we show evidence that HTT loss or mutation has impacts on neuro-epithelial and striatal neurons maturation, and on basal DNA damage and BDNF axonal transport in post-mitotic neurons.

HFE
Also flagged:Hepatocellular carcinomanonneoplastic liver diseaseHepatic neoplasmsoxygenJaundiceicterus
Journal Article 2024-01-01 ✓ 4 Snippets Dai H, Klause H, Conran RM.
In-Text Gene Mentions

…lpha-1-antitrypsin deficiency,hemochromatosis, and especially MASLD,…

…32 , 33Hemochromatosis, an iron-overload disorder,…

…a-1-antitrypsin deficiency andhemochromatosis. •…

…obesity, metabolic syndrome,hemochromatosis, and alcohol consumption.…

Show Full Abstract

No abstract available.

Also flagged:neurological diseasescardiovascular diseasesdeathcardiovascular illnessstroke syndromecardiovascular disorders
Journal Article 2024-01-01 No Snippets Chib S, Devi S, Chalotra R, Mittal N, Singh TG, Kumar P, Singh R.
Show Full Abstract

Cardiovascular and neurological diseases cause substantial morbidity and mortality globally. Moreover, cardiovascular diseases are the leading cause of death globally. About 17.9 million people are affected by cardiovascular diseases and 6.8 million people die every year due to neurological diseases. The common neurologic manifestations of cardiovascular illness include stroke syndrome which is responsible for unconsciousness and several other morbidities significantly diminished the quality of life of patients. Therefore, it is prudent need to explore the mechanistic and molecular connection between cardiovascular disorders and neurological disorders. The present review emphasizes the association between cardiovascular and neurological diseases specifically Parkinson's disease, Alzheimer's disease, and Huntington's disease.

SERPINC1
Also flagged:ThrombophiliaVenous Thromboembolismcancerthrombosiscolorectal cancerbreast cancer
Journal Article 2024-01-01 ✓ 1 Snippet Costa J, Araújo A.
In-Text Gene Mentions

…the corresponding genesSERPINC1, PROC and…

Show Full Abstract

Although the relationship between venous thromboembolism (VTE) and cancer has been a subject of study, knowledge of the contribution of thrombophilia to thrombosis in patients with cancer is still very limited. The aim of this article is to collect present knowledge on the contribution of inherited thrombophilia to VTE in cancer patients. We performed a search in Google Scholar and PubMed and selected 21 from 76 returned articles. Then we made a narrative review of the selected articles. We describe 11 studies on the contribution of inherited thrombophilia to VTE in cancer patients in general and 10 on that contribution in specific types of cancer: 1 in colorectal cancer, 4 in breast cancer, 1 in gynecologic cancer and 4 in hematopoietic malignancies. All studies investigate the relation of factor V Leiden (FVL) to VTE, 13 that of the prothrombin G20210A mutation (PTG20210A) and 7 studies also investigate other inherited thrombophilias, such methylenetetrahydrofolate reductase gene mutations, although only 2 investigate the contribution of deficiencies of the natural anticoagulants. Studies are very heterogeneous, in design and sample size and conclusions differ considerably. There is no consensus on the contribution of inherited thrombophilia to VTE in cancer patients except for acute lymphoblastic leukemia in children. Probably, that contribution is not the same for all types of cancer and more studies are needed to bring more knowledge on this subject.

Also flagged:Gene ExpressionPancreatic Ductal AdenocarcinomatumorpolymerasenestinNES
Journal Article 2024-01-01 No Snippets Zhao S, Xue Z, Yao Wang J, Song P.
Show Full Abstract

<h4>Background/aims</h4>Pancreatic ductal adenocarcinoma is the tumor type with the highest incidence of perineural invasion. This study tries to identify the differentially expressed genes regulated between pancreatic ductal adenocarcinoma tissues with perineural invasion and without perineural invasion.<h4>Materials and methods</h4>The GSE102238 profile was downloaded. Gene function and pathway analysis were subsequently conducted. A protein-protein interaction network was constructed to search for hub genes. Both univariate Cox analysis and multivariate Cox analysis were calculated to identify prognostic factors. Quantitative real-time polymerase chain reaction (RT-PCR) and overall survival analysis of hub genes were used to verify.<h4>Results</h4>Our study identified 242 differentially expressed genes including 68 upregulated differentially expressed genes and 174 downregulated differentially expressed genes, which were involved in important functions and pathways. Nine relevant core genes using protein-protein interaction analysis as well as nestin (NES)/vascular endothlial growth factor (VEGF) signaling pathway which is highly related to the pathological process of perineural invasion in pancreatic ductal adenocarcinoma were also discovered. The differentiation was identified as an independent prognostic factor (P < .05) after multivariate Cox analysis. Three upregulated genes (JUP, CALM1, and NES) and 6 downregulated genes (EPHA2, ARF1, ORM2, TERT, IL18, and CXCL3) were validated by quantitative RT-PCR and they all had markedly worse overall survival (P < .05).<h4>Conclusion</h4>This analysis showed that 9 core genes including JUP, CALM1, NES, EPHA2, ARF1, ORM2, TERT, IL18, and CXCL3, as well as NES/VEGF signaling pathway, have a relationship with the development process of perineural invasion in pancreatic ductal adenocarcinoma. Cox analysis and overall survival analysis suggested differentiation as an independent prognostic factor and key roles for these 9 hub genes in perineural invasion prognosis in pancreatic ductal adenocarcinoma.

Also flagged:Colorectal CancerGene ExpressionpolymeraseGBA2ST3GAL5PLCE1
Journal Article 2024-01-01 No Snippets Niu C, Li X, Lei Luo X, Wan H, Jin W, Zhang Z, Zhang W, Li B.
Show Full Abstract

<h4>Background/aims</h4>Colorectal cancer (CRC) ranks third among malignancies in terms of global incidence and has a poor prognosis. The identification of effective diagnostic and prognostic biomarkers is critical for CRC treatment. This study intends to explore novel genes associated with CRC progression via bioinformatics analysis.<h4>Materials and methods</h4>Dataset GSE184093 was selected from the Gene Expression Omnibus database to identify differentially expressed genes (DEGs) between CRC and noncancerous specimens. Functional enrichment analyses were implemented for probing the biological functions of DEGs. Gene Expression Profiling Interactive Analysis and Kaplan-Meier plotter databases were employed for gene expression detection and survival analysis, respectively. Western blotting and real-time quantitative polymerase chain reaction were employed for detecting molecular protein and messenger RNA levels, respectively. Flow cytometry, Transwell, and CCK-8 assays were utilized for examining the effects of GBA2 and ST3GAL5 on CRC cell behaviors.<h4>Results</h4>There were 6464 DEGs identified, comprising 3005 downregulated DEGs (dDEGs) and 3459 upregulated DEGs (uDEGs). Six dDEGs were significantly associated with the prognoses of CRC patients, including PLCE1, PTGS1, AMT, ST8SIA1, ST3GAL5, and GBA2. Upregulating ST3GAL5 or GBA2 repressed the malignant behaviors of CRC cells.<h4>Conclusion</h4>We identified 6 genes related to CRC progression, which could improve the disease prognosis and treatment.

HTT
Also flagged:HDFAN1MLH1PTC
Journal Article 2024-01-01 ✓ 1 Snippet Estevez-Fraga C, Tabrizi SJ, Wild EJ.
In-Text Gene Mentions

N/S, not specified; HTT, Huntingtin; PD, Parkinson’s disease; SCA1, spinocerebellar ataxia 1; SCA3, spinocerebellar ataxia 3; VMAT2, Vesicular Monoamine Transporter 2.

Show Full Abstract

In this edition of the Huntington's Disease Clinical Trials Update, we expand on the ongoing program from VICO Therapeutics and on the recently terminated VIBRANT-HD clinical trials. We also discuss updates from uniQure's AMT-130 program and PTC therapeutics' trial of PTC518 and list all currently registered and ongoing clinical trials in Huntington's disease.

NEGR1
Also flagged:translationalmental healthMH) disorderspathogenesisMH disordersMH
Journal Article 2024-01-01 ✓ 1 Snippet Bhuvaneshwar K, Gusev Y.
In-Text Gene Mentions

Gene interaction networks in MDD Input gene list: SORCS3, NEGR1, NR3C2, NR3C1, MTRNRL8, SERPINH1, CCL4, SLC1A2, GABRD, HTR1A, HTR1B, HTR2A, HTR2C, PXMP2, EEF2, RPL26L1, RPLP0, PRPF8, LSM3, DHX9, RSRC1, AP2B1 Genes that are known to interact with each other are connected by cyan lines (information obtained from curated databases) or magenta lines (experimentally determined connections).

Show Full Abstract

Translational bioinformatics and data science play a crucial role in biomarker discovery as it enables translational research and helps to bridge the gap between the bench research and the bedside clinical applications. Thanks to newer and faster molecular profiling technologies and reducing costs, there are many opportunities for researchers to explore the molecular and physiological mechanisms of diseases. Biomarker discovery enables researchers to better characterize patients, enables early detection and intervention/prevention and predicts treatment responses. Due to increasing prevalence and rising treatment costs, mental health (MH) disorders have become an important venue for biomarker discovery with the goal of improved patient diagnostics, treatment and care. Exploration of underlying biological mechanisms is the key to the understanding of pathogenesis and pathophysiology of MH disorders. In an effort to better understand the underlying mechanisms of MH disorders, we reviewed the major accomplishments in the MH space from a bioinformatics and data science perspective, summarized existing knowledge derived from molecular and cellular data and described challenges and areas of opportunities in this space.

TAOK3
Also flagged:kinasesKinasecancercancerstranscription factorPLAU
Journal Article 2024-01-01 ✓ 1 Snippet Yang C, Kumar H, Kim P.
In-Text Gene Mentions

…are PAK1, MAP2K5,TAOK3, STK10, MAP3K5, STK24…

Show Full Abstract

Kinase fusion genes are the most active fusion gene group in human cancer fusion genes. To help choose the clinically significant kinase so that the cancer patients that have fusion genes can be better diagnosed, we need a metric to infer the assessment of kinases in pan-cancer fusion genes rather than relying on the sample frequency expressed fusion genes. Most of all, multiple studies assessed human kinases as the drug targets using multiple types of genomic and clinical information, but none used the kinase fusion genes in their study. The assessment studies of kinase without kinase fusion gene events can miss the effect of one of the mechanisms that enhance the kinase function in cancer. To fill this gap, in this study, we suggest a novel way of assessing genes using a network propagation approach to infer how likely individual kinases influence the kinase fusion gene network composed of ~5K kinase fusion gene pairs. To select a better seed of propagation, we chose the top genes via dimensionality reduction like a principal component or latent layer information of six features of individual genes in pan-cancer fusion genes. Our approach may provide a novel way to assess of human kinases in cancer.

Also flagged:polymeraseguaninecytosineBSAwaterchromosome
Journal Article 2024-01-01 No Snippets Ospino MC, Engel K, Ruiz-Navas S, Binns WJ, Doxey AC, Neufeld JD.
Show Full Abstract

Combining multiple displacement amplification (MDA) with metagenomics enables the analysis of samples with extremely low DNA concentrations, making them suitable for high-throughput sequencing. Although amplification bias and nonspecific amplification have been reported from MDA-amplified samples, the impact of MDA on metagenomic datasets is not well understood. We compared three MDA methods (i.e. bulk MDA, emulsion MDA, and primase MDA) for metagenomic analysis of two DNA template concentrations (approx. 1 and 100 pg) derived from a microbial community standard "mock community" and two low biomass environmental samples (i.e. borehole fluid and groundwater). We assessed the impact of MDA on metagenome-based community composition, assembly quality, functional profiles, and binning. We found amplification bias against high GC content genomes but relatively low nonspecific amplification such as chimeras, artifacts, or contamination for all MDA methods. We observed MDA-associated representational bias for microbial community profiles, especially for low-input DNA and with the primase MDA method. Nevertheless, similar taxa were represented in MDA-amplified libraries to those of unamplified samples. The MDA libraries were highly fragmented, but similar functional profiles to the unamplified libraries were obtained for bulk MDA and emulsion MDA at higher DNA input and across these MDA libraries for the groundwater sample. Medium to low-quality bins were possible for the high input bulk MDA metagenomes for the most simple microbial communities, borehole fluid, and mock community. Although MDA-based amplification should be avoided, it can still reveal meaningful taxonomic and functional information from samples with extremely low DNA concentration where direct metagenomics is otherwise impossible.

Also flagged:Metabotropic Glutamate Receptors Type 3GBMmGlu3 receptormetabotropic glutamate receptormGlu3mGlu5
Journal Article 2024-01-01 No Snippets Caridi M, Alborghetti M, Pellicelli V, Orlando R, Pontieri FE, Battaglia G, Arcella A.
Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) represents an aggressive and common tumor of the central nervous system. The prognosis of GBM is poor, and despite a refined genetic and molecular characterization, pharmacological treatment is largely suboptimal.<h4>Objective</h4>Contribute to defining a therapeutic line in GBM targeting the mGlu3 receptor in line with the principles of precision medicine.<h4>Methods</h4>Here, we performed a computational analysis focused on the expression of type 3 and 5 metabotropic glutamate receptor subtypes (mGlu3 and mGlu5, respectively) in high- and low-grade gliomas.<h4>Results</h4>The analysis allowed the identification of a particular high-grade glioma type, characterized by a high expression level of both receptor subtypes and by other markers of excitatory and inhibitory neurotransmission. This so-called neurotransmitter-GBM (NT-GBM) also shows a distinct immunological, metabolic, and vascularization gene signature.<h4>Conclusion</h4>Our findings might lay the groundwork for a targeted therapy to be specifically applied to this putative novel type of GBM.

SERPINC1
Also flagged:Cancerbreast cancersecretiontamoxifencisplatindoxorubicin
Journal Article 2024-01-01 ✓ 1 Snippet Kashyap D, Bhattacharya S, Irinike S, Khare S, Das A, Singh G, Bal A.
In-Text Gene Mentions

…Luminal B hadantithrombin-III, apolipoprotein C-III, and…

Show Full Abstract

<h4>Background</h4>Tumour microenvironment (TME) contributes to resistance to anti-cancer drugs through multiple mechanisms including secretion of pro-survival factors by cancer associated fibroblasts (CAFs). In this study, we determined the chemotherapy resistance producing potential of CAFs in molecular subtypes of breast cancer.<h4>Methods</h4>The CAFs were isolated from fresh lumpectomy/mastectomy specimens of different molecular subtypes of breast cancer. The CAFs were cultured and secretome was collected from each breast cancer subtype. Breast cancer cell lines MCF-7, SK-BR3, MDA-MB-231, and MDA-MB-468 were treated with different doses of tamoxifen, trastuzumab, cisplatin, and doxorubicin alone respectively and in combination with secretome of CAFs from respective subtypes. MTT assay was done to check cell death after drug treatment. Liquid chromatography-mass spectrometry (LCMS) analysis of CAF secretome was also done.<h4>Results</h4>MTT assay showed that anti-cancer drugs alone had growth inhibitory effect on the cancer cells however, presence of CAF secretome reduced the anti-cancer effect of the drugs. Resistant to drugs in the presence of secretome, was determined by increased cell viability i.e., MCF-7, 51.02% to 63.02%; SK-BR-3, 34.22% to 44.88%; MDA-MB-231, 52.59% to 78.63%; and MDA-MB-468, 48.92% to 55.08%. LCMS analysis of the secretome showed the differential abundance of CAFs secreted proteins across breast cancer subtypes.<h4>Conclusions</h4>The treatment of breast cancer cell lines with anti-cancer drugs in combination with secretome isolated from molecular subtype specific CAFs, reduced the cytotoxic effect of the drugs. In addition, LCMS data also highlighted different composition of secreted proteins from different breast cancer associated fibroblasts. Thus, TME has heterogenous population of CAFs across the breast cancer subtypes and in vitro experiments highlight their contribution to chemotherapy resistance which needs further validation.

NEGR1
Also flagged:endometriosismethylationhistonemodificationsPGR-BSF-1
Journal Article 2024-01-01 ✓ 1 Snippet Bedrick BS, Courtright L, Zhang J, Snow M, Amendola ILS, Nylander E, Cayton-Vaught K, Segars J, Singh B.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Objective</h4>To assess the current literature evaluating the epigenetics of endometriosis in humans.<h4>Evidence review</h4>A systematic review was conducted in accordance with the PRISMA guidelines within PubMed, EBSCOhost, Cochrane Library, Embase, Scopus, and Web of Science Core Collection. A comprehensive search strategy was developed by a data informationist. Observational and interventional studies assessing epigenetics in humans published in English up to January 15th, 2023, were included. Two reviewers independently screened studies evaluating the role of epigenetics in endometriosis. The risk of bias was assessed using Cochrane RoB 2.0 tool and the Newcastle-Ottawa scale. Extracted data were analyzed descriptively.<h4>Results</h4>We identified 18.639 studies, of which 57 were included, comprising 1.623 patients with endometriosis and 1.243 controls. Among the 57 studies included, 50 (88%) were case-control studies, and 7 (12%) were cross-sectional. Fifty-nine percent of the studies were Asian, 25% were from America, 14% were European, and 2% were from Africa. Acetylation and methylation were the two main key histone modifications that were centered in this review. Accordingly, we classified the studies as those focusing on genome-wide methylation and those on histone acetylation. Several studies identified an association between endometriosis and hypermethylated genes, including the PGR-B, SF-1, and RASSF1A. The genes HOXA10, COX-2, IL-12B, and GATA6 were found to be hypomethylated in endometriotic tissue by several studies. In regards to histone modification, multiple studies reported that the acetylation levels of histones H3 and H4 affect multiple genes associated with endometriosis. In addition, HDAC2 was found to be elevated in endometriosis patients in two studies.<h4>Conclusion</h4>Several studies reported a significant difference between specific genes' methylation levels in endometrial biopsies and normal tissue, which suggests that DNA methylation may play an important role in the modulation of the genotype in endometriotic tissue. Acetylation and methylation are the two key histone modifications leading to differential gene expression in endometriotic tissues. The alterations in gene expression reported by the 57 studies can have direct implications on cell cycle growth, cell cycle arrest, and apoptosis and, therefore, might play a key role in the pathogenesis of endometriosis. This review offers insight that histone modifications need further research to evaluate their role as potential biomarkers and treatment targets for endometriosis. Although several key similarities were reported, there were some disagreements among the results, which might be attributable to the heterogeneity between studies. Further research with a more robust standardization is needed to validate the epigenetic changes in endometriosis.

SERPINC1
Also flagged:PreeclampsiathrombinprothrombinfibrinogenD-dimerantithrombin III
Journal Article 2024-01-01 ✓ 4 Snippets Jin PP, Ding N, Dai J, Liu XY, Mao PM.
In-Text Gene Mentions

…(DD2), antithrombin III (ATIII), fibrin degradation products…

…(DD2), antithrombin III (ATIII), and fibrin degradation…

…immunoturbidimetry assay, andATIIIby the hair…

…FBG, TT, DD2,ATIII, FDP, and detecting…

Show Full Abstract

To investigate the effect of reduced early-pregnancy activated partial thrombin time (APTT), prothrombin time (PT), and international standardized ratio (INR) on the risk of preeclampsia. A total of 8549 pregnant women with singleton births were included. Early pregnancy APTT, PT, and INR levels, with age, birth, prepregnancy body mass index, fibrinogen (FBG), thrombin time (TT), D-dimer (DD2), antithrombin III (ATIII), fibrin degradation products (FDP) as confounders, generalized linear model of APTT, the relative risk of PT and INR when INR reduction. After adequate adjustment for confounders, the relative risk of preeclampsia was 0.703 for every 1 s increase in plasma PT results in early pregnancy, and for every 0.1 increase in plasma INR results, the relative risk of preeclampsia was 0.767. With a PT less than the P25 quantile (<11 s), the relative risk of preeclampsia was 1.328. The relative risk of preeclampsia at an INR less than the P25 quantile (<0.92) was 1.24. There was no statistical association between APTT on the risk of preeclampsia. The relative risk of preeclampsia is strongly associated with a decrease in PT and INR in early pregnancy. PT and INR in early pregnancy were a potential marker in the risk stratification of preeclampsia. Focusing on reduced PT and INR levels in early pregnancy can help to identify early pregnancies at risk for preeclampsia.

Also flagged:calcium phosphatedicalcium phosphateoctacalcium phosphatehydroxyapatitecataractscalcium
Journal Article 2024-01-01 No Snippets Gartaganis PS, Natsi PD, Gartaganis SP, Koutsoukos PG, Helbig H.
Show Full Abstract

We report an unusual, rare case of opacification of the hydrophilic acrylic intraocular lens (IOL) 23 years after the initial surgery with significant visual deterioration. Opacification of the hydrophilic acrylic IOL was primarily due to the formation of folds on the surface of the lens material, and less so due to calcium phosphate deposits. Calcification opacification can be attributed to recent events, as evidenced by deposits of dicalcium phosphate dihydrate (CaHPO<sub>4</sub>2H<sub>2</sub>O) and octacalcium phosphate (Ca<sub>8</sub>H<sub>2</sub>(PO<sub>4</sub>)<sub>6</sub>5H<sub>2</sub>O), both of which are transient calcium phosphate phases, converting hydrolytically to the thermodynamically most stable hydroxyapatite (Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>). To our knowledge, this case of hydrophilic acrylic IOL opacification is the only one that has been described so late, 23 years after cataract surgery.

Also flagged:Chronic Kidney Diseasebehavioraldiabeteshypertensionsaltalcohol
Journal Article 2024-01-01 No Snippets Theeranut A, Methakanjanasak N, Lertsinudom S, Surit P, Panyaek N, Leeladapattarakul S, Nilpetch P, Kessomboon P, Chalermwat C, Rintara W, Khongtong W, Paktipat P, Banchonhattakit P, Chunlertrith D, Sharma A, Cha'on U, Anutrakulchai S.
Show Full Abstract

<h4>Introduction</h4>Chronic kidney disease (CKD) is a major health problem in Thailand and health behaviors are central to its risk and progression. Because of the shortage of healthcare personnel, village health volunteers (VHVs) have been collaborating in the primary health care system. However, the contribution of VHVs to CKD reduction has not been evaluated yet. This study aimed to evaluate the efficacy of the VHV-integrated model in preventing and slowing down CKD and its risk factors.<h4>Methods</h4>The population-based cohort study was conducted in a rural community of Thailand between 2017 and 2019. Baseline clinical and behavioral characteristics including CKD, diabetes, hypertension, and other high-risk factors of the participants were collected. The integrated care model was initiated by the multidisciplinary care team that facilitated, empowered, and trained VHVs targeting risk factors of CKD, health literacy, and health promotion. Then the participants were educated and trained for lifestyle modification and were monitored continuously for 18 months by VHVs. Changes in the CKD risk factors, and kidney functions before and after the application of integrated care model were compared.<h4>Results</h4>A total of 831 subjects participated in the study with an average age of 57.5 years, and 69.5% were female. Among them, 222 participants (26.7%) were diagnosed as having CKD, the vast majority (95%) of which were in the early stages (G1-G3 and A1-A2). CKD risk factors such as high salt intake, smoking, alcohol consumption, self-NSAID (non-steroidal anti-inflammatory drugs) use were significantly decreased after application of the care model. Also, hemoglobin A<sub>1c</sub> was significantly reduced in diabetic patients, and blood pressure was controlled better than before in the hypertensive patients. Most importantly, a decline of estimated glomerular filtration rate of the CKD group was improved and lower than the non-CKD group.<h4>Conclusion</h4>The integrated care model through VHV significantly attenuated the risk factors associated with CKD in the general and high-risk population and effectively slowed down the progression of CKD.

Also flagged:sepsiscostunolidesesquiterpene lactoneinterleukin-1betaIL-1βIL-6
Journal Article 2024-01-01 No Snippets Güler MC, Tanyeli A, Eraslan E, Çelebi Ö, Çelebi D, Çomakli S, Yurdgülü EE, Bayir Y.
Show Full Abstract

<h4>Objectives</h4>Sepsis poses a significant threat to human life, rendering it a burdensome medical disease. Despite significant advancements, the current state of medical science still lacks a viable and efficacious cure. Costunolide (COST) is a multifaceted sesquiterpene lactone that exhibits a range of actions, including anti-inflammatory and antioxidant properties. We investigated the potential impacts of COST on a rat sepsis model caused by cecal ligation and puncture (CLP).<h4>Materials and methods</h4>We created an experimental rat model with the following groups: SHAM, CLP, CLP+low dose COST, and CLP+high dose COST. Blood, kidney, and lung samples were collected. Inflammatory mediators such as interleukin-1beta (IL-1β), IL-6, tumor necrosis factor-alpha (TNF- α), and nuclear factor kappa-B (NF-κB) were investigated. In addition, we assessed oxidative stress by measuring 8-Hydroxydeoxyguanosine (8-OHdG) immunopositivity, MDA levels, glutathione (GSH), and superoxide dismutase (SOD) activity. Histopathological and immunohistochemical examinations backed up our findings.<h4>Results</h4>Compared to the CLP group, the COST group showed a reduction in inflammatory and oxidative stress indicators. The expression of inflammatory mediators was suppressed by COST, and histological examinations revealed improvements in kidney and lung tissues in the treatment groups.<h4>Conclusion</h4>Our study highlights the preventive effects of COST against CLP-induced sepsis-related injury. Considering its beneficial effects against many diseases, COST is worthy as to be evaluated against sepsis.

HTT
Also flagged:neurodegenerative diseaseHDHuntington's DiseaseHuntington DiseaseNeurodegenerative diseasesneuroretina
Journal Article 2024-01-01 ✓ 2 Snippets Shah A, Fuller S, Criswell S, Apte RS.
In-Text Gene Mentions

…mutation in theHTTgene.…

…testing for theHTTgene.…

Show Full Abstract

<h4>Purpose</h4>Huntington's Disease (HD) is a fully penetrant neurodegenerative disease leading to cognitive and motor disturbances. The retina may serve as a structural and functional extension of the central nervous system to identify biomarkers of HD using noninvasive imaging technology such as optical coherence tomography angiography (OCTA) and dark adaptometry.<h4>Methods</h4>This case-control study included 12 HD participants (24 eyes) recruited from the Huntington's Disease Society of America Center of Excellence at Washington University in St. Louis along with 16 control participants (31 eyes). Disease-positive participants underwent imaging testing of retinal capillary density and foveal avascular zone utilizing OCTA along with dark adaptometry testing. Data were collected from November 2020 to February 2022.<h4>Results</h4>Individuals with HD had a lower mean age-adjusted superficial foveal capillary density and a higher mean deep foveal capillary density compared to control subjects. There was no significant difference in the mean foveal avascular zone or in dark adaptometry testing between the two groups.<h4>Conclusion</h4>This study suggests that changes in retinal biomarkers may exist in patients with HD and that additional investigations using multimodal techniques are warranted.

Also flagged:Insulin-Degrading EnzymePeptidesHuntingtinHuntington's diseaseautosomal dominant disorderdegradation
Journal Article 2024-01-01 No Snippets Geijtenbeek KW, Aranda AS, Sanz AS, Janzen J, Bury AE, Kors S, Al Amery N, Schmitz NCM, Reits EAJ, Schipper-Krom S.
Show Full Abstract

<h4>Background</h4>Huntington's disease is an inheritable autosomal dominant disorder caused by an expanded CAG trinucleotide repeat within the Huntingtin gene, leading to a polyglutamine (polyQ) expansion in the mutant protein.<h4>Objective</h4>A potential therapeutic approach for delaying or preventing the onset of the disease involves enhancing the degradation of the aggregation-prone polyQ-expanded N-terminal mutant huntingtin (mHTT) exon1 fragment. A few proteases and peptidases have been identified that are able to cleave polyQ fragments with low efficiency. This study aims to identify a potent polyQ-degrading endopeptidase.<h4>Methods</h4>Here we used quenched polyQ peptides to identify a polyQ-degrading endopeptidase. Next we investigated its role on HTT turnover, using purified polyQ-expanded HTT fragments and striatal cells expressing mHTT exon1 peptides.<h4>Results</h4>We identified insulin-degrading enzyme (IDE) as a novel endopeptidase for degrading polyQ peptides. IDE was, however, ineffective in reducing purified polyQ-expanded HTT fragments. Similarly, in striatal cells expressing mHTT exon1 peptides, IDE did not enhance mHTT turnover.<h4>Conclusions</h4>This study shows that despite IDE's efficiency in degrading polyQ peptides, it does not contribute to the direct degradation of polyQ-expanded mHTT fragments.

HTT
Also flagged:dystoniaCognitive declineautism spectrum disorderattention deficit hyperactivity disorderepilepsyataxia
Journal Article 2024-01-01 ✓ 1 Snippet Oosterloo M, Touze A, Byrne LM, Achenbach J, Aksoy H, Coleman A, Lammert D, Nance M, Nopoulos P, Reilmann R, Saft C, Santini H, Squitieri F, Tabrizi S, Burgunder JM, Quarrell O, Pediatric Huntington Disease Working Group of the European Huntington Disease Network.
In-Text Gene Mentions

…exon of theHTTgene such that…

Show Full Abstract

Juvenile Huntington's disease (JHD) is rare. In the first decade of life speech difficulties, rigidity, and dystonia are common clinical motor symptoms, whereas onset in the second decade motor symptoms may sometimes resemble adult-onset Huntington's disease (AOHD). Cognitive decline is mostly detected by declining school performances. Behavioral symptoms in general do not differ from AOHD but may be confused with autism spectrum disorder or attention deficit hyperactivity disorder and lead to misdiagnosis and/or diagnostic delay. JHD specific features are epilepsy, ataxia, spasticity, pain, itching, and possibly liver steatosis. Disease progression of JHD is faster compared to AOHD and the disease duration is shorter, particularly in case of higher CAG repeat lengths. The diagnosis is based on clinical judgement in combination with a positive family history and/or DNA analysis after careful consideration. Repeat length in JHD is usually > 55 and caused by anticipation, usually via paternal transmission. There are no pharmacological and multidisciplinary guidelines for JHD treatment. Future perspectives for earlier diagnosis are better diagnostic markers such as qualitative MRI and neurofilament light in serum.

STAU1
Also flagged:cancerdeathinvasive ductal carcinomabreast cancerTINCRmenopause
Journal Article 2024-01-01 ✓ 1 Snippet Shaghaghi Torkdari Z, Khalaj-Kondori M, Hosseinpour Feizi MA.
In-Text Gene Mentions

…its interaction withSTAU1protein 11 .…

Show Full Abstract

<b>Background:</b> Breast cancer is identified as the most common malignancy and cause of cancer-related death worldwide. Compared with healthy controls, this study evaluated the expression level and diagnostic power of lncRNA plasma <i>TINCR</i> in breast cancer patients. <b>Materials and Methods:</b> Fifty-eight women diagnosed with invasive ductal carcinoma and fifty healthy age- matched controls were included in the study. TRIzol<sup>®</sup> LS regent was used to isolate the total RNA from the whole plasma. Total RNA was converted to cDNA using Prime Script<sup>TM</sup> RT reagent kit and the expression levels of <i>TINCR</i> were quantified by qRT-PCR. <b>Results:</b> Low levels of <i>TINCR</i> lncRNA were observed in the plasma of breast cancer patients compared with control subjects. Plasma <i>TINCR</i> level was also positively correlated with the diagnostic age of breast cancer patients. <b>Conclusion:</b> A low level of plasma <i>TINCR</i> could discriminate breast cancer patients from healthy control subjects.

HTT
Also flagged:Post-Traumatic Stress DisorderPTSDmental disorderserotonin transporter5-HTTLPRSLC6A4
Journal Article 2024-01-01 ✓ 5 Snippets Hu XZ, Ursano RJ, Benedek D, Li X, Biomarker Study Group, Zhang L.
In-Text Gene Mentions

PTSD risk is influenced by environmental and genetic factors, as well as gene-environment interaction.4,5 The risk of PTSD varies with the type of trauma, including war-related experiences, physical violence, partner or sexual violence, accident,6 and natural disasters.7 Traumatic event experiences, pre-trauma personality, and their interplay further influence PTSD risk.6 Genetic factors, particularly the serotonin transporter (5-HTT) gene (SLC6A4)8 or mitochondria DNA copy number,9 have been a focus of research in PTSD.

These alleles impact 5-HTT expression and function12 and have been extensively studied in neuropsychiatric disorders, including PTSD.

The deletion (short, S) allele is associated with lower 5-HTT protein expression, potentially leading to serotonin dysfunction as seen in anxiety disorders and depression.10,11 This polymorphism is also tri-allelic due to the presence of an A > G single-nucleotide polymorphism within the L allele, resulting in Lg and La alleles.

The serotonin transporter (5-HTT) gene has been identified as a candidate for PTSD and a polymorphism of the serotonin transporter-linked promoter region (5-HTTLPR) is associated with the disorder in the general population.

…The serotonin transporter (5-HTT) gene has been…

Show Full Abstract

<h4>Objective</h4>Post-traumatic stress disorder (PTSD) is a mental disorder that manifests after exposure to a stressful traumatic event, such as combat experience. Accumulated evidence indicates an important genetic influence in the development of PTSD. The serotonin transporter (5-HTT) gene has been identified as a candidate for PTSD and a polymorphism of the serotonin transporter-linked promoter region (5-HTTLPR) is associated with the disorder in the general population. However, whether it is associated with PTSD in active military service members has not been investigated. This study aimed to investigate the relationship between 5-HTTLPR and PTSD in service members.<h4>Methods</h4>Leucocyte genomic DNA was extracted from service members, including those with PTSD (n = 134) or without PTSD (n = 639). The 5-HTTLPR polymorphism was detected by means of 2 stages of TaqMan fluorescent PCR assay. PTSD symptoms and symptom severity were assessed using the PTSD Checklist (PCL), a 17-item, DSM-based, self-report questionnaire with well-established validity and reliability. PTSD was determined based on endorsement of DSM-IV criteria and a PCL total score ≥ 44.<h4>Results</h4>Significant differences in biallele distribution were observed between PTSD and controls (χ2 = 7.497, <i>P</i> = .024). The frequency of SS, SL, and LL genotypes in the PTSD group was 0.17, 0.56, and 0.27 respectively, compared to the frequencies of 0.27, 0.43, and 0.29 in non-PTSD controls. Carriers of the L allele had higher scores for reexperiencing and arousal symptoms on the PCL, compared to SS homozygote carriers (<i>P</i> < .05). The triallele genotypes showed no significant differences in distribution between the PTSD and control groups (<i>P</i> > .05) and no relationship with PTSD symptom severity. The interaction of triallelic genotypes of 5-HTTLPR and traumatic life events was associated with re-experiencing, avoidance, and arousal (<i>P</i> < .05 for all). Multiple regression analysis revealed significant correlations between both biallelic and triallelic genotypes of 5-HTTLPR, the interaction of the number of stressful lifetime events, and 5-HTTLPR genotypes with PCL total score (<i>P</i> < .001).<h4>Conclusion</h4>Our findings suggested that 5-HTT might play a minor role in PTSD, and the interaction between 5-HTTLPR and the environment had effects on PCL score, complementing and emphasizing 5-HTT for PTSD, especially in the military population.

HTT
Also flagged:Gene ExpressiondegradationRNA-binding proteinscancersnonsense-mediated decayoligonucleotides
Journal Article 2024-01-01 ✓ 1 Snippet Zavileyskiy LG, Pervouchine DD.
In-Text Gene Mentions

Branaplam, similar in structure andmechanism of action to risdiplam, promotes the inclusion of the cryptic poisonexon in the HTT gene, which reduces its expression and slowsdown the progression of Huntington’s disease [122].

Show Full Abstract

Unproductive splicing is a mechanism of post-transcriptional gene expression control in which premature stop codons are inserted into protein-coding transcripts as a result of regulated alternative splicing, leading to their degradation via the nonsense-mediated decay pathway. This mechanism is especially characteristic of RNA-binding proteins, which regulate each other's expression levels and those of other genes in multiple auto- and cross-regulatory loops. Deregulation of unproductive splicing is a cause of serious human diseases, including cancers, and is increasingly being considered as a prominent therapeutic target. This review discusses the types of unproductive splicing events, the mechanisms of auto- and cross-regulation, nonsense-mediated decay escape, and problems in identifying unproductive splice isoforms. It also provides examples of deregulation of unproductive splicing in human diseases and discusses therapeutic strategies for its correction using antisense oligonucleotides and small molecules.

DCC
Also flagged:Colorectal cancercancerdeatheicosapentaenoic aciddocosahexaenoic acidfatty acids
Journal Article 2024-01-01 ✓ 1 Snippet Jayathilake AG, Luwor RB, Nurgali K, Su XQ.
In-Text Gene Mentions

…suppressor genes (DCC, APC, SMAD4 ,…

Show Full Abstract

Colorectal cancer (CRC) is the third leading cause of cancer-related death in the world. Multiple evidence suggests that there is an association between excess fat consumption and the risk of CRC. The long chain n-3 polyunsaturated fatty acids (LC n-3 PUFA), especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are essential for human health, and both <i>in vitro</i> and <i>in vivo</i> studies have shown that these fatty acids can prevent CRC development through various molecular mechanisms. These include the modulation of arachidonic acid (AA) derived prostaglandin synthesis, alteration of growth signaling pathways, arrest of the cell cycle, induction of cell apoptosis, suppression of angiogenesis and modulation of inflammatory response. Human clinical studies found that LC n-3 PUFA combined with chemotherapeutic agents can improve the efficacy of treatment and reduce the dosage of chemotherapy and associated side effects. In this review, we discuss comprehensively the anti-cancer effects of LC n-3 PUFA on CRC, with a main focus on the underlying molecular mechanisms.

Also flagged:fusobacterial infectioncolorectal adenocarcinomahost cellimmune responsesinfectionmucinous rectal cancer
Journal Article 2024-01-01 No Snippets Duggan WP, Kisakol B, Woods I, Azimi M, Dussmann H, Fay J, O'Grady T, Maguire B, Reynolds IS, Salvucci M, Slade DJ, McNamara DA, Burke JP, Prehn JHM.
Show Full Abstract

Mucinous colorectal cancer (CRC) is a common histological subtype of colorectal adenocarcinoma, associated with a poor response to chemoradiotherapy. The commensal facultative anaerobes fusobacteria, have been associated with poor prognosis specifically in mesenchymal CRC. Interestingly, fusobacterial infection is especially prevalent in mucinous CRC. The objective of this study was therefore to increase our understanding of beneficial and detrimental effects of fusobacterial infection, by contrasting host cell signaling and immune responses in areas of high vs. low infection, using mucinous rectal cancer as a clinically relevant example. We employed spatial transcriptomic profiling of 106 regions of interest from 8 mucinous rectal cancer samples to study gene expression in the epithelial and immune segments across regions of high versus low fusobacterial infection. Fusobacteria high regions were associated with increased oxidative stress, DNA damage, and P53 signaling. Meanwhile regions of low fusobacterial prevalence were characterized by elevated JAK-STAT, Il-17, Il-1, chemokine and TNF signaling. Immune masks within fusobacterial high regions were characterized by elevated proportions of cytotoxic (CD8+) T cells (<i>p</i> = 0.037), natural killer (NK) cells (<i>p</i> < 0.001), B-cells (<i>p</i> < 0.001), and gamma delta T cells (<i>p</i> = 0.003). Meanwhile, fusobacteria low regions were associated with significantly greater M2 macrophage (<i>p</i> < 0.001), fibroblast (<i>p</i> < 0.001), pericyte (<i>p</i> = 0.002), and endothelial (<i>p</i> < 0.001) counts.

Also flagged:Dihydroxypropanesulfonateorganosulfurphosphoruscatabolismdehydrogenasedehydrogenases
Journal Article 2024-01-01 No Snippets Liu L, Gao X, Dong C, Wang H, Chen X, Ma X, Liu S, Chen Q, Lin D, Jiao N, Tang K.
Show Full Abstract

Chirality, a fundamental property of matter, is often overlooked in the studies of marine organic matter cycles. Dihydroxypropanesulfonate (DHPS), a globally abundant organosulfur compound, serves as an ecologically important currency for nutrient and energy transfer from phytoplankton to bacteria in the ocean. However, the chirality of DHPS in nature and its transformation remain unclear. Here, we developed a novel approach using chiral phosphorus-reagent labeling to separate DHPS enantiomers. Our findings demonstrated that at least one enantiomer of DHPS is present in marine diatoms and coccolithophores, and that both enantiomers are widespread in marine environments. A novel chiral-selective DHPS catabolic pathway was identified in marine Roseobacteraceae strains, where HpsO and HpsP dehydrogenases at the gateway to DHPS catabolism act specifically on R-DHPS and S-DHPS, respectively. R-DHPS is also a substrate for the dehydrogenase HpsN. All three dehydrogenases generate stable hydrogen bonds between the chirality-center hydroxyls of DHPS and highly conserved residues, and HpsP also form coordinate-covalent bonds between the chirality-center hydroxyls and Zn2+, which determines the mechanistic basis of strict stereoselectivity. We further illustrated the role of enzymatic promiscuity in the evolution of DHPS metabolism in Roseobacteraceae and SAR11. This study provides the first evidence of chirality's involvement in phytoplankton-bacteria metabolic currencies, opening a new avenue for understanding the ocean organosulfur cycle.

HTT
Also flagged:Dentatorubral-pallidoluysian atrophyDRPLAneurodegenerative disorderataxiacognitive declinechorea
Journal Article 2024-01-01 ✓ 1 Snippet Prades S, Compton A, Carroll JB.
In-Text Gene Mentions

Preliminary studies suggested that it is possible to target expanded CAG repeats with RNA technology and a single compound could be used to treat multiple polyQ diseases, including DRPLA.25, –27 We have watched with great interest the rapid advancement of genome engineering approaches as potential therapeutic approach to genetic disease, including a recent approval of a CRISPR-Cas9 therapy (Casgevy) to treating sickle-cell disease and β-thalassaemia [ClinicalTrials.gov identifier: NCT03745287].28 And, indeed, similar genome engineering approaches have been shown protective in preclinical studies in, a Htt lowering approach in HD,29 and CAG expansion reduction approaches in SCA3.30 While exciting, several factors have caused CureDRPLA to take a cautious approach to supporting (epi-)genome engineering approaches.

Show Full Abstract

Dentatorubral-pallidoluysian atrophy (DRPLA) is an ultra-rare neurodegenerative disorder characterized by ataxia, cognitive decline, myoclonus, chorea, epilepsy, and psychiatric manifestations. This article delves into the multifaceted efforts of CureDRPLA, a family-driven non-profit organization, in advancing research, raising awareness, and developing therapeutic strategies for this complex condition. CureDRPLA's inception in 2019 led to the establishment of the DRPLA Research Program, and since then have funded research projects to advance the understanding of DRPLA including but not limited to human cellular and mouse models, a natural history and biomarkers study, and a patient registry. There are currently no disease-modifying treatments for DRPLA, motivating a concerted effort on behalf of CureDRPLA to hasten their development by funding and coordinating preclinical studies of therapies in multiple modalities. Of particular interest are therapies focused on lowering the expression (or downregulation) of <i>ATN1</i>, the mutant gene that causes DRPLA, in hopes of tackling the pathology at its root. As with many ultra-rare diseases, a key challenge in DRPLA remains the complexity of coordinating both basic and clinical research efforts across multiple sites around the world. Finally, despite the generous financial support provided by CureDRPLA, more funding and collective efforts are still required to advance research toward the clinic and develop effective treatments for individuals with DRPLA.

HTT
Also flagged:HDneurodegenerative disordersynapsescell proliferationbrainneurological disorders
Journal Article 2024-01-01 ✓ 5 Snippets Khoshnan A.
In-Text Gene Mentions

Huntingtin (HTT) protein is expressed in most cell lineages, and the toxicity of mutant HTT in multiple organs may contribute to the neurological and psychiatric symptoms observed in Huntington's disease (HD).

…1 of huntingtin (HTT) gene is the…

HTTis ubiquitously expressed,…

…biological properties ofHTTin the nervous…

…when WT humanHTTis expressed systemically…

Show Full Abstract

Huntingtin (HTT) protein is expressed in most cell lineages, and the toxicity of mutant HTT in multiple organs may contribute to the neurological and psychiatric symptoms observed in Huntington's disease (HD). The proteostasis and neurotoxicity of mutant HTT are influenced by the intracellular milieu and responses to environmental signals. Recent research has highlighted a prominent role of gut microbiota in brain and immune system development, aging, and the progression of neurological disorders. Several studies suggest that mutant HTT might disrupt the homeostasis of gut microbiota (known as dysbiosis) and impact the pathogenesis of HD. Dysbiosis has been observed in HD patients, and in animal models of the disease it coincides with mutant HTT aggregation, abnormal behaviors, and reduced lifespan. This review article aims to highlight the potential toxicity of mutant HTT in organs and pathways within the microbiota-gut-immune-central nervous system (CNS) axis. Understanding the functions of Wild-Type (WT) HTT and the toxicity of mutant HTT in these organs and the associated networks may elucidate novel pathogenic pathways, identify biomarkers and peripheral therapeutic targets for HD.

DCC
Also flagged:colorectal cancercancermethylationvimentinVIMSDC2
Journal Article 2024-01-01 ✓ 1 Snippet Rezkitha YAA, Panenggak NSR, Lusida MI, Rianda RV, Mahmudah I, Pradana AD, Uchida T, Miftahussurur M.
In-Text Gene Mentions

…in CRC, includingDCC, DPC4/SMAD4 , and…

Show Full Abstract

Colorectal cancer (CRC) is one of the most frequent types of cancer, with high incidence rates and mortality globally. The extended timeframe for developing CRC allows for the potential screening and early identification of the disease. Furthermore, studies have shown that survival rates for patients with cancer are increased when diagnoses are made at earlier stages. Recent research suggests that the development of CRC, including its precancerous lesion, is influenced not only by genetic factors but also by epigenetic variables. Studies suggest epigenetics plays a significant role in cancer development, particularly CRC. While this approach is still in its early stages and faces challenges due to the variability of CRC, it shows promise as a potential method for understanding and addressing the disease. This review examined the current evidence supporting genetic and epigenetic biomarkers for screening and diagnosis. In addition, we also discussed the feasibility of translating these methodologies into clinical settings. Several markers show promising potential, including the methylation of vimentin (<i>VIM</i>), syndecan-2 (<i>SDC2</i>), and septin 9 (<i>SEPT9</i>). However, their application as screening and diagnostic tools, particularly for early-stage CRC, has not been fully optimized, and their effectiveness needs validation in large, multi-center patient populations. Extensive trials and further investigation are required to translate genetic and epigenetic biomarkers into practical clinical use. biomarkers, diagnostic biomarkers.

OLFM4
Also flagged:metabolismpattern-recognition receptorslactateindolecarbohydratesminerals
Journal Article 2024-01-01 ✓ 3 Snippets Wu H, Mu C, Xu L, Yu K, Shen L, Zhu W.
In-Text Gene Mentions

Propionate supplementation reserves chemical injury-induced loss of aISC markers LGR5 and OLFM4 expression.96 Another research revealed that the supplementation of fucose increases the production of propionic acid by Akkermansia muciniphila, which further promotes the stemness of ISCs through a Gpr41/Gpr43-dependent mechanism.97

…makers LGR5 andOLFM4in the intestinal…

…s LGR5 andOLFM4expression.…

Show Full Abstract

Intestinal stem cells (ISCs) play a pivotal role in gut physiology by governing intestinal epithelium renewal through the precise regulation of proliferation and differentiation. The gut microbiota interacts closely with the epithelium through myriad of actions, including immune and metabolic interactions, which translate into tight connections between microbial activity and ISC function. Given the diverse functions of the gut microbiota in affecting the metabolism of macronutrients and micronutrients, dietary nutrients exert pronounced effects on host-microbiota interactions and, consequently, the ISC fate. Therefore, understanding the intricate host-microbiota interaction in regulating ISC homeostasis is imperative for improving gut health. Here, we review recent advances in understanding host-microbiota immune and metabolic interactions that shape ISC function, such as the role of pattern-recognition receptors and microbial metabolites, including lactate and indole metabolites. Additionally, the diverse regulatory effects of the microbiota on dietary nutrients, including proteins, carbohydrates, vitamins, and minerals (e.g. iron and zinc), are thoroughly explored in relation to their impact on ISCs. Thus, we highlight the multifaceted mechanisms governing host-microbiota interactions in ISC homeostasis. Insights gained from this review provide strategies for the development of dietary or microbiota-based interventions to foster gut health.

HFE
Also flagged:Hairy Cell Leukemianon-tuberculous mycobacterial infectionscladribinerituximabrifampinazithromycin
Journal Article 2024-01-01 ✓ 5 Snippets Stanton DJ, Quadri NZ, Tanabe MB.
In-Text Gene Mentions

He was also diagnosed with hemochromatosis via HFE gene mutation detection.

…also diagnosed withhemochromatosis, and this may…

…family history ofhemochromatosispresented to our…

…also diagnosed withhemochromatosisvia HFE gene…

…with hemochromatosis viaHFEgene mutation detection.…

Show Full Abstract

The association between Hairy Cell Leukemia (HCL) and non-tuberculous mycobacterial infections (NTMs) is well described, most notably <i>Mycobacterium kansasii</i>. The exact pathophysiology is not known. We report a case of a 31-year-old male with concomitantly diagnosed HCL and disseminated <i>M kansasii</i> infection who presented with rash, pancytopenia, and bulky axillary lymphadenopathy. The <i>M kansasii</i> was initially diagnosed through use of cell-free DNA detection and confirmed by bone marrow and lymph node cultures. Hairy Cell Leukemia was diagnosed with peripheral flow cytometry and confirmed via the same bone marrow sample. His HCL was put into remission with a single course of cladribine and rituximab chemotherapy; however, his <i>M kansasii</i> infection persisted for 6 months despite aggressive antimicrobial and surgical therapy. It was finally controlled using high-dose rifampin in combination with azithromycin and ethambutol. This case highlights the known link between HCL and <i>M kansasii.</i> Furthermore, it hints at potential causes beyond chemotherapy-induced immunocompromise. Notable possibilities include HCL cells acting as sanctuary sites for <i>M kansasii</i> to evade the immune system, and subclinical <i>M kansasii</i> infections causing NLRP3 inflammasome overactivation to trigger the oncogenic transformation to HCL. More research into the pathophysiologic link between HCL and <i>M kansasii</i> infections would allow for more effective prevention, diagnosis, and treatment of these severe atypical infections which are the major cause of morbidity in the cladribine era of HCL treatment.

Also flagged:Methylene blueheat hyperalgesiamechanical hyperalgesiaIL-1βFosIL-6
Journal Article 2024-01-01 No Snippets Banik RK, Sia T, Johns ME, Tran PV, Cheng AY, Setty S, Simone DA.
Show Full Abstract

Methylene blue (MB) has been shown to reduce mortality and morbidity in vasoplegic patients after cardiac surgery. Though MB is considered to be safe, extravasation of MB leading to cutaneous toxicity has been reported. In this study, we sought to characterize MB-induced cutaneous toxicity and investigate the underlying mechanisms. To induce MB-induced cutaneous toxicity, we injected 64 adult male Sprague-Dawley rates with 200 µL saline (vehicle) or 1%, 0.1%, or 0.01% MB in the plantar hind paws. Paw swelling, skin histologic changes, and heat and mechanical hyperalgesia were measured. Injection of 1%, but not 0.1% or 0.01% MB, produced significant paw swelling compared to saline. Injection of 1% MB produced heat hyperalgesia but not mechanical hyperalgesia. Pain behaviors were unchanged following injections of 0.1% or 0.01% MB. Global transcriptomic analysis by RNAseq identified 117 differentially expressed genes (111 upregulated, 6 downregulated). Ingenuity Pathway Analysis showed an increased quantity of leukocytes, increased lipids, and decreased apoptosis of myeloid cells and phagocytes with activation of IL-1β and Fos as the two major regulatory hubs. qPCR showed a 16-fold increase in IL-6 mRNA. Thus, using a novel rat model of MB-induced cutaneous toxicity, we show that infiltration of 1% MB into cutaneous tissue causes a dose-dependent pro-inflammatory response, highlighting potential roles of IL-6, IL-1β, and Fos. Thus, anesthesiologists should administer dilute MB intravenously through peripheral venous catheters. Higher concentrations of MB (1%) should be administered through a central venous catheter to minimize the risk of cutaneous toxicity.

Also flagged:Cancercell developmentgene expressiongenetic disordermethylationhistone
Journal Article 2024-01-01 No Snippets Akram F, Tanveer R, Andleeb S, Shah FI, Ahmad T, Shehzadi S, Akhtar AM, Syed G.
Show Full Abstract

Epigenetic machinery is a cornerstone in normal cell development, orchestrating tissue-specific gene expression in mammalian cells. Aberrations in this intricate landscape drive substantial changes in gene function, emerging as a linchpin in cancer etiology and progression. While cancer was conventionally perceived as solely a genetic disorder, its contemporary definition encompasses genetic alterations intertwined with disruptive epigenetic abnormalities. This review explores the profound impact of DNA methylation, histone modifications, and noncoding RNAs on fundamental cellular processes. When these pivotal epigenetic mechanisms undergo disruption, they intricately guide the acquisition of the 6 hallmark characteristics of cancer within seemingly normal cells. Leveraging the latest advancements in decoding these epigenetic intricacies holds immense promise, heralding a new era in developing targeted and more efficacious treatment modalities against cancers driven by aberrant epigenetic modifications.

OLFM4
Also flagged:5-fluorouracilmalignant tumorsinfectionlysozymedeathtumor
Journal Article 2024-01-01 ✓ 5 Snippets Tang D, Qiu R, Qiu X, Sun M, Su M, Tao Z, Zhang L, Tao S.
In-Text Gene Mentions

…of basal cryptOlfm4-positive cells and lysozyme-p…

…mmunohistochemical staining ofOlfm4, an intestinal stem…

…IHC staining forOlfm4was performed on…

…significant loss ofOlfm4-positive ISCs in the…

…the loss ofOlfm4+ ISCs was more…

Show Full Abstract

Chemotherapy remains a major treatment for malignant tumors, yet the application of standard dose intensity chemotherapy is limited due to the side effects of cytotoxic drugs, especially in old populations. The underlying mechanisms of cytotoxicity and strategies to increase the safety and tolerance of chemotherapy remain to be explored. Using 5-fluorouracil (5-FU), a cornerstone chemotherapeutic drug, we demonstrate that the main cause of death in <i>ad libitum</i> (AL) fed mice after 5-FU chemotherapy was infection caused by translocation of intestinal opportunistic pathogens. We show that these opportunistic pathogens greatly increase in the intestine after chemotherapy, which was closely related to loss of intestinal lysozyme. Of note, two weeks of dietary restriction (DR) prior to chemotherapy significantly protected the loss of lysozyme and increased the content of the beneficial <i>Lactobacillus</i> genera, resulting in a substantial inhibition of intestinal opportunistic pathogens and their translocation. The rescue effect of DR could be mimicked by Lysozyme or <i>Lactobacillus</i> gavage. Our study provides the first evidence that DR achieved a comprehensive protection of the intestinal physical, biological and chemical barriers, which significantly improved the overall survival of 5-FU-treated mice. Importantly, the above findings were more prominent in old mice. Furthermore, we show that patients over 65 years old have enriched opportunistic pathogens in their gut microbiota, especially after 5-FU based chemotherapy. Our study reveals important mechanisms for the poor chemotherapy tolerance of the elderly population, which can be significantly improved by short-term DR. This study generates new insights into methods for improving the chemotherapeutic prognosis by increasing the chemotherapy tolerance and safety of patients with malignant tumors.

HTT
Also flagged:HDpositronorganizationautosomal dominant neurodegenerative disorderadult-onset degenerative diseasecognitive decline
Journal Article 2024-01-01 ✓ 1 Snippet Hobbs NZ, Papoutsi M, Delva A, Kinnunen KM, Nakajima M, Van Laere K, Vandenberghe W, Herath P, Scahill RI.
In-Text Gene Mentions

…exon of theHTTgene, which encodes…

Show Full Abstract

Neuroimaging is increasingly being included in clinical trials of Huntington's disease (HD) for a wide range of purposes from participant selection and safety monitoring, through to demonstration of disease modification. Selection of the appropriate modality and associated analysis tools requires careful consideration. On behalf of the EHDN Imaging Working Group, we present current opinion on the utility and future prospects for inclusion of neuroimaging in HD trials. Covering the key imaging modalities of structural-, functional- and diffusion- MRI, perfusion imaging, positron emission tomography, magnetic resonance spectroscopy, and magnetoencephalography, we address how neuroimaging can be used in HD trials to: 1) Aid patient selection, enrichment, stratification, and safety monitoring; 2) Demonstrate biodistribution, target engagement, and pharmacodynamics; 3) Provide evidence for disease modification; and 4) Understand brain re-organization following therapy. We also present the challenges of translating research methodology into clinical trial settings, including equipment requirements and cost, standardization of acquisition and analysis, patient burden and invasiveness, and interpretation of results. We conclude, that with appropriate consideration of modality, study design and analysis, imaging has huge potential to facilitate effective clinical trials in HD.

TNFSF4
Also flagged:reproductionSNRPNSNURFUBE3AATP10Aautosome
Journal Article 2024-01-01 ✓ 2 Snippets Falchi L, Cesarani A, Criscione A, Hidalgo J, Garcia A, Mastrangelo S, Macciotta NPP.
In-Text Gene Mentions

Among the genes mapped in BTA16, 11 genes (SLC25A33, PIK3CD, CTNNBIP1, NMNAT1, MTHFR, MIIP, TNFRSF8, TNFRSF1B, DHRS3, TNFSF4, and TNFSF18) were previously found to be related to reproduction traits, such as early pregnancy, stillbirth, oocyte developmental potential, age at first calving, fertility, and embryo survival (details and references listed in Supplementary Table S2).

…, DHRS3 ,TNFSF4, and TNFSF18…

Show Full Abstract

Runs of homozygosity (ROHom) are contiguous stretches of homozygous regions of the genome. In contrast, runs of heterozygosity (ROHet) are heterozygosity-rich regions. The detection of these two types of genomic regions (ROHom and ROHet) is influenced by the parameters involved in their identification and the number of available single-nucleotide polymorphisms (SNPs). The present study aimed to test the effect of chip density in detecting ROHom and ROHet in the Italian Simmental cattle breed. A sample of 897 animals were genotyped at low density (50k SNP; 397 individuals), medium density (140k SNP; 348 individuals), or high density (800k SNP; 152 individuals). The number of ROHom and ROHet per animal (nROHom and nROHet, respectively) and their average length were calculated. ROHom or ROHet shared by more than one animal and the number of times a particular SNP was inside a run were also computed (SNPROHom and SNPROHet). As the chip density increased, the nROHom increased, whereas their average length decreased. In contrast, the nROHet decreased and the average length increased as the chip density increased. The most repeated ROHom harbored no genes, whereas in the most repeated ROHet four genes (SNRPN, SNURF, UBE3A, and ATP10A) previously associated with reproductive traits were found. Across the 3 datasets, 31 SNP, located on Bos taurus autosome (BTA) 6, and 37 SNP (located on BTA21) exceeded the 99th percentile in the distribution of the SNPROHom and SNPROHet, respectively. The genomic region on BTA6 mapped the SLIT2, PACRGL, and KCNIP4 genes, whereas 19 and 18 genes were mapped on BTA16 and BTA21, respectively. Interestingly, most of genes found through the ROHet analysis were previously reported to be related to health, reproduction, and fitness traits. The results of the present study confirm that the detection of ROHom is more reliable when the chip density increases, whereas the ROHet trend seems to be the opposite. Genes and quantitative trait loci (QTL) mapped in the highlighted regions confirm that ROHet can be due to balancing selection, thus related to fitness traits, health, and reproduction, whereas ROHom are mainly involved in production traits. The results of the present study strengthened the usefulness of these parameters in analyzing the genomes of livestock and their biological meaning.

RC3H1
Also flagged:RNA binding proteinsgene expressioncancerbindingresponse toARE-binding proteins
Journal Article 2024-01-01 ✓ 5 Snippets Podszywalow-Bartnicka P, Neugebauer KM.
In-Text Gene Mentions

…, 51 ]RC3H1Roquin-1 ROQ decay…

…51 ] RC3H1Roquin-1ROQ decay p-body…

Roquin-1, Regnase-1…

Roquin-1and Regnase-1 proteins…

…(ROQ) domain inRoquin-1( Figure 3(B)…

Show Full Abstract

Post-transcriptional regulation by RNA binding proteins can determine gene expression levels and drive changes in cancer cell proteomes. Identifying mechanisms of protein-RNA binding, including preferred sequence motifs bound <i>in vivo</i>, provides insights into protein-RNA networks and how they impact mRNA structure, function, and stability. In this review, we will focus on proteins that bind to AU-rich elements (AREs) in nascent or mature mRNA where they play roles in response to stresses encountered by cancer cells. ARE-binding proteins (ARE-BPs) specifically impact alternative splicing, stability, decay and translation, and formation of RNA-rich biomolecular condensates like cytoplasmic stress granules (SGs). For example, recent findings highlight the role of ARE-BPs - like TIAR and HUR - in chemotherapy resistance and in translational regulation of mRNAs encoding pro-inflammatory cytokines. We will discuss emerging evidence that different modes of ARE-BP activity impact leukaemia and lymphoma development, progression, adaptation to microenvironment and chemotherapy resistance.

TNFSF4
Also flagged:autophagycancerdeathCCGene ExpressionCXCR4
Journal Article 2024-01-01 ✓ 2 Snippets Li S, Gao K, Yao D.
In-Text Gene Mentions

…TNFRSF4, LAG3, CTLA4,TNFSF4, CD276, CD40, ICOS,…

…LGALS9, TIGIT, andTNFSF4.…

Show Full Abstract

<h4>Objectives</h4>Cervical cancer (CC) is the most common gynecological malignant tumor and the fourth leading cause of cancer-related death in women. The progression of CC is significantly affected by autophagy. Our objective was to use bioinformatics analysis to explore the expression, prognostic significance, and immune infiltration of autophagy-related genes in CC.<h4>Materials and methods</h4>We identified a set of autophagy-related differentially expressed genes (ARDEGs) from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. ARDEGs were further validated by The Human Protein Atlas (HPA), GSE52903, and GSE39001 dataset. Hub genes were found by the STRING network and Cytoscape. We performed Gene Set Enrichment Analysis (GSEA), Gene ontology analysis (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, and immune infiltration analysis to further understand the functions of the hub genes. Kaplan-Meier (K-M) and receiver operating characteristic (ROC) were used to check the hub genes.<h4>Results</h4>A total of 10 up-regulated (CXCR4, BAX, SPHK1, EIF2AK2, TBK1, TNFSF10, ITGB4, CDKN2A, IL24, and BIRC5) and 19 down-regulated (PINK1, ATG16L2, ATG4D, IKBKE, MLST8, MAPK3, ERBB2, ULK3, TP53INP2, MTMR14, BNIP3, FOS, CCL2, FAS, CAPNS1, HSPB8, PTK6, FKBP1B , and DNAJB1) ARDEGs were identified. The ARDEGs were enriched in cell growth, apoptosis, human papillomavirus infection, and cytokine-mediated. Then, we found that low expression of MAPK3 was associated with poor prognosis in CC patients and was significantly enriched in immune pathways. In addition, the expression of MAPK3 was significantly positively correlated with the infiltration levels of macrophages, B cells, mast cell activation, and cancer-associated fibroblasts. Furthermore, MAPK3 was positively correlated with LGALS9, and negatively correlated with CTLA4 and CD40.<h4>Conclusion</h4>Our results show that MAPK3 can be used as a new prognostic biomarker to predict the prognosis of patients with CC.

ZNFX1
Also flagged:Zfpm2As1gastric cancerGastritispeptic ulcershemorrhage
Journal Article 2024-01-01 ✓ 1 Snippet Liang H, Li H, Xia N, Chen J, Gao L, Liu H, Lyu P, Guo X, Yang Z.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

<h4>Background</h4>Long noncoding RNAs (lncRNAs) participate in diseases, especially tumorigenesis, including gastric cancer (GC). Although lncRNAs in GC tissues have been extensively studied in previous research, the possible significance of circulating lncRNAs in diagnosing GC is still unknown.<h4>Objective</h4>The present work investigated lncRNAs ZFPM2-AS1 and XIST with high expression in GC tissues proved as potential plasma biomarkers from 20 early GC cases, 100 GC cases, and 90 normal subjects.<h4>Methods</h4>The possible correlation between ZFPM2-AS1 and XIST expression levels was analyzed with general characteristics and clinicopathological features. The performance in diagnosis was assessed according to receiver operating characteristic (ROC) analysis.<h4>Results</h4>According to the results, XIST and ZFPM2-AS1 expression remarkably increased within GC plasma relative to normal subjects (P< 0.01); besides, lncRNA XIST expression after surgery had a tendency of downregulation compared with preoperative levels (P< 0.05). Moreover, the area under ROC curve (AUC) values were 0.62 for ZFPM2-AS1 and 0.68 for XIST, while the pooled AUC value of CA-724 and two lncRNAs was 0.751.<h4>Conclusion</h4>Circulating lncRNAs ZFPM2-AS1 and XIST can serve as the candidate plasma biomarkers used to diagnose GC.

HFE
Also flagged:Metabolic dysfunctionliver diseasecardiovascular diseasesteatotic liver diseaseLiver Diseasesnonalcoholic fatty liver disease
Journal Article 2024-01-01 ✓ 1 Snippet Laeeq T, Tun KM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

Also flagged:CisplatinGold Nanoparticlescarboxylatecomplexationsurfacecancer
Journal Article 2024-01-01 No Snippets Cho TJ, Reipa V, Gorham JM, Pettibone JM, Tona A, Johnston-Peck A, Liu J, Nelson BC, Hackley VA.
Show Full Abstract

Using dendron chemistry, we developed stability enhanced, carboxylate surface modified (negatively charged dendron) AuNPs (Au-NCD). Since the carboxylate surface of Au-NCD is optimal for complexation with cisplatin (Pt) moieties, we further synthesized Pt loaded Au-NCD (Au-NCD/Pt) to serve as potential therapeutic anticancer agents. The size distribution, zeta potential and surface plasmon resonance of both Au-NCDs and Au-NCD/Pt were characterized via dynamic light scattering, scanning transmission electron microscopy and ultraviolet-visible spectrophotometry. Surface chemistry, Pt uptake, and Pt release were evaluated using inductively coupled plasma-mass spectrometry and X-ray photoelectron spectroscopy. Colloidal stability in physiological media over a wide pH range (1 to 13) and shelf-life stability (up to 6 months) were also assessed. Finally, the cytotoxicity of both Au-NCD and Au-NCD/Pt to Chinese hamster ovary cells (CHO K1; as a normal cell line) and to human lung epithelial cells (A549; as a cancer cell line) were evaluated. The results of these physicochemical and functional cytotoxicity studies with Au-NCD/Pt demonstrated that the particles exhibited superlative colloidal stability, cisplatin uptake and in vitro anticancer activity despite low amounts of Pt release from the conjugate.

HFE
Also flagged:alcoholliver diseaseAlcohol-associated liver diseaseliver fibrosischronic liver diseasealcohol use disorder
Journal Article 2024-01-01 ✓ 1 Snippet Desalegn H, Diaz LA, Rehm J, Arab JP.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

OLFM4
Also flagged:cancercisplatin5-fluorouracildocetaxeldoxorubicinoxaliplatin
Journal Article 2024-01-01 ✓ 1 Snippet Jung T, Cheon C.
In-Text Gene Mentions

…Lgr5, ASCl2, andOlfm4.…

Show Full Abstract

<h4>Background</h4>Natural products are increasingly gaining interest as potential new drug candidates for cancer treatment. Herbal formula, which are combinations of several herbs, are primarily used in East Asia and have a long history of use that continues today. Recently, research exploring the combination of herbal formulas and chemotherapy for cancer treatment has been on the rise.<h4>Methods</h4>This study reviewed research on the co-administration of herbal formulas and chemotherapy for cancer treatment. The databases PubMed, Embase, and Cochrane Library were used for article searches. The following keywords were employed: "Antineoplastic agents," "Chemotherapy," "Phytotherapy," "Herbal medicine," "Drug synergism," and "Synergistic effect." The selection process focused on studies that investigated the synergistic interaction between herbal formulas and chemotherapeutic agents.<h4>Results</h4>Among the 30 studies included, 25 herbal formulas and 7 chemotherapies were used. The chemotherapy agents co-administered included cisplatin, 5-fluorouracil, docetaxel, doxorubicin, oxaliplatin, irinotecan, and gemcitabine. The types of cancer most frequently studied were lung, breast, and colon cancers. Most studies evaluating the anticancer efficacy of combined herbal formula and chemotherapy treatment were conducted in vitro or in vivo.<h4>Discussion</h4>Most studies reported synergistic effects on cytotoxicity, apoptosis, and tumor growth inhibition. These effects were found to be associated with cell cycle arrest, anti-angiogenesis, and gene expression regulation. Further studies leading to clinical trials are required. Clinical experiences in East Asian countries could provide insights for future research.

TNFSF4
Also flagged:Rho GTPase-activating protein 4Kidney Renal Clear Cell Carcinomamalignant tumorARHGAP4tumortumors
Journal Article 2024-01-01 ✓ 2 Snippets Xiao X, Lv X, Lin T, Li J, Wang R, Tian S, Liu X, Liu S, Jiang H, Yue D, Wang Y.
In-Text Gene Mentions

…), OX40 (TNFSF4), B7 homolog…

…, OX40 (TNFSF4), B7-H3 (…

Show Full Abstract

<h4>Background</h4>Kidney Renal Clear Cell Carcinoma (KIRC) is a malignant tumor that seriously threatens human health. Rho GTPase-activating protein 4 (ARHGAP4) plays an important role in the occurrence and development of tumors.<h4>Objective</h4>The purpose of this study was to explore the role of ARHGAP4 in the progression of KIRC and its diagnostic and prognostic value.<h4>Methods</h4>Multiple analytical methods and in vitro cell assays were used to explore the expression of ARHGAP4 and its value in the progression, diagnosis and prognosis of KIRC. The biological function of ARHGAP4 was studied by GO analysis and KEGG pathway analysis, and then the relationship between ARHGAP4 and immune infiltration was analyzed.<h4>Results</h4>The expression of ARHGAP4 was significantly up-regulated in KIRC. We found that the high expression of ARHGAP4 was related to the progression of KIRC and suggested a poor prognosis. Compared with normal tissues, ARHGAP4 had a better diagnostic value in KIRC. The biological function of ARHGAP4 was related to immunity, and its expression was also closely related to tumor immune infiltration and immune checkpoints.<h4>Conclusions</h4>Our study demonstrated that ARHGAP4 may be a biomarker, which is related to the progression, diagnosis and prognosis of KIRC. Its biological functions are related to tumor immune infiltration.

HTT
Also flagged:HDHuntingtinautosomalneurodegenerative disordercytosineadenine
Journal Article 2024-01-01 ✓ 2 Snippets Yin JH, Liu YO, Li HL, Burgunder JM, Huang Y.
In-Text Gene Mentions

…huntingtin gene (HTT).…

…repeats in theHTTgene.…

Show Full Abstract

<h4>Background</h4>Diffusion magnetic resonance imaging (dMRI) has revealed microstructural changes in white matter (WM) in Huntington's disease (HD).<h4>Objective</h4>To compare the validities of different dMRI, i.e., diffusion kurtosis imaging (DKI) and diffusion tensor imaging (DTI) in HD.<h4>Methods</h4>22 mutant huntingtin (mHTT) carriers and 14 controls were enrolled. Clinical assessments and dMRI were conducted. Based on CAG-Age Product (CAP) score, mHTT carriers were categorized into high CAP (hCAP) and medium and low CAP (m& lCAP) groups. Spearman analyses were used to explore correlations between imaging parameters in brain regions and clinical assessments. Receiver operating characteristic (ROC) was used to distinguish mHTT carriers from control, and define the HD patients at advanced stage.<h4>Results</h4>Compared to controls, mHTT carriers exhibited WM changes in DKI and DTI. There were 22 more regions showing significant differences in HD detected by MK than FA. Only MK in five brain regions showed significantly difference between any two group, and negatively correlated with the disease burden (r = -0.80 to -0.71). ROC analysis revealed that MK was more sensitive and FA was more specific, while Youden index showed that the integration of FA and MK gave rise to higher authenticities, in distinguishing m& lCAP from controls (Youden Index = 0.786), and discerning different phase of HD (Youden Index = 0.804).<h4>Conclusions</h4>Microstructural changes in WM occur at early stage of HD and deteriorate over the disease progression. Integrating DKI and DTI would provide the best accuracies for differentiating early HD from control and identifying advanced HD.

DCC
Also flagged:PDlevodopabenserazideParkinson DiseaseMetabolismdopamine
Journal Article 2024-01-01 ✓ 1 Snippet Figura M, Mrozowicz A, Milanowski Ł, Szlufik S, Raćkowska E, Lypkan H, Friedman A, Koziorowski D, Giebułtowicz J.
In-Text Gene Mentions

…polymorphism rs4680 andDCCgene polymorphisms rs921451…

Show Full Abstract

<h4>Background</h4>Levodopa is the gold standard of treatment in Parkinson's disease (PD). Its clinical effect changes as the disease progresses. Wearing off is a frequent first manifestation of motor fluctuations. Some patients with advanced PD report faster wearing off after physical exercise.<h4>Objective</h4>The aim was to assess if pharmacokinetics of levodopa is influenced by physical exercise in patients with different disease advancement.<h4>Methods</h4>22 patients with PD (12 untreated with levodopa and 10 with motor fluctuations) and 7 healthy controls (HC) were included. Plasma samples were collected at 9 fixed timepoints following administration of levodopa/benserazide 200/50 mg for two days: rest day and standardized physical exercise day. Clinical assessment with Unified Parkinson Disease Rating Scale part III (UPDRS III) was performed in fixed timepoints. Liquid chromatography-tandem mass spectrometry was used to measure levodopa concentrations.<h4>Results</h4>No differences between the HC, levodopa naïve and advanced PD groups were observed regarding selected pharmacokinetic parameters. In advanced PD and HC no differences in pharmacokinetic parameters of levodopa with and without effort were observed. In levodopa naïve PD group higher mean residence time after rest than after exercise (168.9±48.3 min vs. 145.5±50.8 min; p = 0.026) was observed. In advanced PD group higher UPDRS III score (14.45±5.5 versus 20.9±6.1 points, p = 0.04) was observed after exercise.<h4>Conclusions</h4>The deterioration of motor status of advanced PD patients after physical effort is not reflected by changes in pharmacokinetics but rather mediated by central mechanisms.

Also flagged:lipidcalcium phosphatecalciumlactosecholesterolasialoglycoprotein receptor
Journal Article 2024-01-01 No Snippets Khalifeh M, Badiee A, Ramezanian N, Sahebkar A, Farahpour A, Kazemi Oskuee R.
Show Full Abstract

<h4>Objectives</h4>For safe and effective gene therapy, the ability to deliver the therapeutic nucleic acid to the target sites is crucial. In this study, lactosylated lipid phosphate calcium nanoparticles (lac-LCP) were developed for targeted delivery of pDNA to the hepatocyte cells. The lac-LCP formulation contained lactose-modified cholesterol (CHL), a ligand that binds to the asialoglycoprotein receptor (ASGR) expressed on hepatocytes, and polyethyleneimine (PEI) in the core.<h4>Materials and methods</h4>Fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance (NMR) were used to monitor the chemical modification, and the physicochemical properties of NPs were studied using dynamic light scattering (DLS) and transmission electron microscopy (TEM). To evaluate transfection efficiency, cellular uptake and GFP expression were assessed using fluorescence microscopy and flow cytometry.<h4>Results</h4>The results revealed that lactose-targeted particles (lac-LCP) had a significant increase in cellular uptake by hepatocytes. The inclusion of a low molecular weight PEI (1.8 KDa) with a low PEI/pDNA ratio of 1 in the core of LCP, elicited high degrees of GFP protein expression (by 5 and 6-fold), which exhibited significantly higher efficiency than PEI 1.8 KDa and Lipofectamine.<h4>Conclusion</h4>The successful functionalization and nuclear delivery of LCP NPs described here indicate its promise as an efficient delivery vector to hepatocyte nuclei.

HFE
Also flagged:ironFerritinDmt1Dmt1 transporterdigestionshort-chain fatty acids
Journal Article 2024-01-01 ✓ 1 Snippet Noordine ML, Seyoum Y, Bruneau A, Baye K, Lefebvre T, Cherbuy C, Canonne-Hergaux F, Nicolas G, Humblot C, Thomas M.
In-Text Gene Mentions

…mouse model ofhemochromatosis, supplementation with DAP…

Show Full Abstract

The microbiota significantly impacts digestive epithelium functionality, especially in nutrient processing. Given the importance of iron for both the host and the microbiota, we hypothesized that host-microbiota interactions fluctuate with dietary iron levels. We compared germ-free (GF) and conventional mice (SPF) fed iron-containing (65 mg/Kg) or iron-depleted (<6 mg/Kg) diets. The efficacy of iron privation was validated by iron blood parameters. Ferritin and Dmt1, which represent cellular iron storage and transport respectively, were studied in tissues where they are abundant: the duodenum, liver and lung. When the mice were fed an iron-rich diet, the microbiota increased blood hemoglobin and hepcidin and the intestinal ferritin levels, suggesting that the microbiota helps iron storage. When iron was limiting, the microbiota inhibited the expression of the intestinal Dmt1 transporter, likely via the pathway triggered by Hif-2α. The microbiota assists the host in storing intestinal iron when it is abundant and competes with the host by inhibiting Dmt1 in conditions of iron scarcity. Comparison between duodenum, liver and lung indicates organ-specific responses to microbiota and iron availability. Iron depletion induced temporal changes in microbiota composition and activity, reduced α-diversity of microbiota, and led to <i>Lactobacillaceae</i> becoming particularly more abundant after 60 days of privation. By inoculating GF mice with a simplified bacterial mixture, we show that the iron-depleted host favors the gut fitness of <i>Bifidobacterium longum</i>.

Also flagged:TRIM26Ubiquitination-translationalproteasesTRIM
Journal Article 2024-01-01 No Snippets Zou J, Niu K, Lu T, Kan J, Cheng H, Xu L.
Show Full Abstract

Ubiquitination, a crucial post-translational modification, plays a role in nearly all physiological processes. Its functional execution depends on a series of catalytic reactions involving numerous proteases. TRIM26, a protein belonging to the TRIM family, exhibits E3 ubiquitin ligase activity because of its RING structural domain, and is present in diverse cell lineages. Over the last few decades, TRIM26 has been documented to engage in numerous physiological and pathological processes as a controller, demonstrating a diverse array of biological roles. Despite the growing research interest in TRIM26, there has been limited attention given to examining the protein's structure and function in existing reviews. This review begins with a concise overview of the composition and positioning of TRIM26 and then proceeds to examine its roles in immune response, viral invasion, and inflammatory processes. Simultaneously, we demonstrate the contribution of TRIM26 to the progression of various diseases, encompassing numerous malignancies and neurologic conditions. Finally, we have investigated the potential areas for future research on TRIM26.

HTT
Also flagged:HDHuntington ’ s DiseasepolyglutaminebehavioralHuntington diseasevariant huntingtin
Journal Article 2024-01-01 ✓ 5 Snippets DiFiglia M, Leavitt BR, Macdonald D, Thompson LM, Huntington’s Disease Nomenclature Working Group:.
In-Text Gene Mentions

…gene huntingtin (HTT), and this…

…encoded huntingtin protein (HTT).…

…residue in bothHTTproteins, or indeed…

…indeed in otherHTTvariants.…

…first exon ofHTT, when expressed…

Show Full Abstract

The field of Huntington's disease research covers many different scientific disciplines, from molecular biology all the way through to clinical practice, and as our understanding of the disease has progressed over the decades, a great deal of different terminology has accrued. The field is also renowned for its collaborative spirit and use of standardized reagents, assays, datasets, models, and clinical measures, so the use of standardized terms is especially important. We have set out to determine, through a consensus exercise involving basic and clinical scientists working in the field, the most appropriate language to use across disciplines. Nominally, this article will serve as the style guide for the Journal of Huntington's Disease (JHD), the only journal devoted exclusively to HD, and we lay out the preferred and standardized terminology and nomenclature for use in JHD publications. However, we hope that this article will also serve as a useful resource to the HD research community at large and that these recommended naming conventions will be adopted widely.

OLFM4
Also flagged:hematoxylinsynthesismucinsegmentationcell segmentationnucleus
Journal Article 2024-01-01 ✓ 1 Snippet Bao S, Lee HH, Yang Q, Remedios LW, Deng R, Cui C, Cai LY, Xu K, Yu X, Chiron S, Li Y, Patterson NH, Wang Y, Li J, Liu Q, Lau KS, Roland JT, Coburn LA, Wilson KT, Landman BA, Huo Y.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Multiplex immunofluorescence (MxIF) is an advanced molecular imaging technique that can simultaneously provide biologists with multiple (i.e., more than 20) molecular markers on a single histological tissue section. Unfortunately, due to imaging restrictions, the more routinely used hematoxylin and eosin (H&E) stain is typically unavailable with MxIF on the same tissue section. As biological H&E staining is not feasible, previous efforts have been made to obtain H&E whole slide image (WSI) from MxIF via deep learning empowered virtual staining. However, the tiling effect is a long-lasting problem in high-resolution WSI-wise synthesis. The MxIF to H&E synthesis is no exception. Limited by computational resources, the cross-stain image synthesis is typically performed at the patch-level. Thus, discontinuous intensities might be visually identified along with the patch boundaries assembling all individual patches back to a WSI. In this work, we propose a deep learning based unpaired high-resolution image synthesis method to obtain virtual H&E WSIs from MxIF WSIs (each with 27 markers/stains) with reduced tiling effects. Briefly, we first extend the CycleGAN framework by adding simultaneous nuclei and mucin segmentation supervision as spatial constraints. Then, we introduce a random walk sliding window shifting strategy during the optimized inference stage, to alleviate the tiling effects. The validation results show that our spatially constrained synthesis method achieves a 56% performance gain for the downstream cell segmentation task. The proposed inference method reduces the tiling effects by using 50% fewer computation resources without compromising performance. The proposed random sliding window inference method is a plug-and-play module, which can be generalized for other high-resolution WSI image synthesis applications. The source code with our proposed model are available at https://github.com/MASILab/RandomWalkSlidingWindow.git.

HFE
Also flagged:hepatocellular carcinomacirrhosiscarcinoma hepatocelularcarcinoma hepatocelularcarcinomamalignant neoplasm of the liver
Journal Article 2024-01-01 ✓ 1 Snippet Fontana PC, Coral GP, Horbe AF, Jotz RF, de Morais BG, de Mattos AA.
In-Text Gene Mentions

…steatotic liver disease,hemochromatosis, and ingestion of…

Show Full Abstract

<h4>Objective</h4>To compare conventional transarterial chemoembolization (cTACE) and drug-eluting bead TACE (DEB-TACE) in terms of efficacy, survival, and adverse effects in patients with hepatocellular carcinoma who are not candidates for curative therapy.<h4>Materials and methods</h4>This was a retrospective study of patients with hepatocellular carcinoma who underwent cTACE or DEB-TACE for palliative treatment between January 2009 and December 2021. The Kaplan-Meier method was used for survival analysis. Values of <i>p</i> < 0.05 were considered statistically significant.<h4>Results</h4>We evaluated 268 patients, of whom 70 underwent DEB-TACE and 198 underwent cTACE. There was no significant difference between the groups regarding sex, age, or etiology of cirrhosis. The proportion of patients achieving a complete response on imaging examinations was higher in the cTACE group (31.8% vs. 16.1%), whereas that of patients achieving a partial response was higher in the DEB-TACE group (33.9% vs.19.7%), and the differences were significant (<i>p</i> = 0.014). The mortality rate was similar between the groups. The survival rate in the DEB-TACE and cTACE groups, respectively, was 87.0% and 87.9% at one year, 35.1% and 32.9% at three years, and 20.5% and 18.1% at five years (<i>p</i> = 0.661). There was no significant difference between the DEB-TACE and cTACE groups in terms of the frequency of adverse events (7.1% vs. 17.8%; <i>p</i> = 0.052). The most common complication in both groups was post-embolization syndrome.<h4>Conclusion</h4>Although a complete response was more common among the patients who underwent cTACE, there was no difference in survival between the groups and the frequency of adverse events was similar.

HTT
Also flagged:neurodegenerative disordercognitive declinedeathHDproteolysisautophagy
Journal Article 2024-01-01 ✓ 5 Snippets Alshehabi Y, Martin DDO.
In-Text Gene Mentions

HD is caused by a polyglutamine expansion in the N-terminal region of the huntingtin (HTT) protein, which is linked to decreased HTT turnover, increased HTT proteolysis, increased HTT aggregation, and subsequent neuronal death.

…of the huntingtin (HTT) protein, which is…

…linked to decreasedHTTturnover, increased HTT…

…they demonstrated thatHTTperforms cellular functions…

…N-terminal region ofHTT, akin to Atg23,…

Show Full Abstract

 Huntington's disease (HD) is a devastating neurodegenerative disorder characterized by impaired motor function and cognitive decline, ultimately leading to death. HD is caused by a polyglutamine expansion in the N-terminal region of the huntingtin (HTT) protein, which is linked to decreased HTT turnover, increased HTT proteolysis, increased HTT aggregation, and subsequent neuronal death. In this review, we explore the mechanism of the protective effect of blocking HTT proteolysis at D586, which has been shown to rescue the HD phenotype in HD mouse models. Until recently, the mechanism remained unclear. Herein, we discuss how blocking HTT proteolysis at D586 promotes HTT turnover by correcting autophagy, and making HTT a better autophagy substrate, through post-translational myristoylation of HTT at G553.

Neuroepigenetic Editing.

HTT
Also flagged:neurological diseasechromatin-modifying enzymesresponse to externalgene expressionchromatinhistone
Journal Article 2024-01-01 ✓ 1 Snippet Hamilton PJ, Lim CJ, Nestler EJ, Heller EA.
In-Text Gene Mentions

HTT

Show Full Abstract

Epigenetic regulation is intrinsic to basic neurobiological function as well as neurological disease. Regulation of chromatin-modifying enzymes in the brain is critical during both development and adulthood and in response to external stimuli. Biochemical studies are complemented by numerous next-generation sequencing (NGS) studies that quantify global changes in gene expression, chromatin accessibility, histone and DNA modifications in neurons and glial cells. Neuroepigenetic editing tools are essential to distinguish between the mere presence and functional relevance of histone and DNA modifications to gene transcription in the brain and animal behavior. This review discusses current advances in neuroepigenetic editing, highlighting methodological considerations pertinent to neuroscience, such as delivery methods and the spatiotemporal specificity of editing and it demonstrates the enormous potential of epigenetic editing for basic neurobiological research and therapeutic application.

Also flagged:creatininecystatin-Cglomerular diseaseGlomerular FiltrationCureGlomerulonephropathy
Journal Article 2024-01-01 No Snippets Mondal A, Kobe C, Mariani LH, Zee J.
Show Full Abstract

<h4>Introduction</h4>Glomerular filtration rate (GFR) is typically estimated with equations that use biomarkers such as serum creatinine and/or cystatin-C. The impact of these different biomarkers on GFR estimates in glomerular disease patients is unclear. In this study, we compared the different GFR estimating equations in the Cure Glomerulonephropathy (CureGN) cohort of children and adults with glomerular disease.<h4>Methods</h4>All available cystatin-C measurements from CureGN study participants were matched to same-day serum creatinine measurements to estimate GFR. To explore the strength of agreement between eGFR values obtained from the "Under 25" (U25) and Chronic Kidney Disease Epidemiology Collaboration (CKD-Epi) equations, we used intraclass correlation coefficients. Multivariable linear mixed effects models were used to determine which factors were independently associated with differences in eGFR values.<h4>Results</h4>A total of 928 cystatin-C measurements were matched to same-day serum creatinine measurements from <i>N</i> = 332 CureGN study participants (58% male, 69% White/Caucasian, 20% Black/African American). Among 628 measurements collected while study participants were under 25 years old, there was moderate agreement (0.731) in serum creatinine versus cystatin-C U25 equations. Models showed that higher eGFR values were associated with larger differences between the two equations (<i>p</i> < 0.001). Among 253 measurements collected while study participants were at least 18 years old, there was excellent agreement (0.891-0.978) among CKD-Epi equations using serum creatinine alone, cystatin-C alone, or the combination of both. Younger age was associated with larger differences between CKD-Epi equations (<i>p</i> = 0.06 to <i>p</i> = 0.016).<h4>Conclusion</h4>Excellent agreement between CKD-Epi equations indicates continued use of serum creatinine alone for GFR estimation could be appropriate for adults. In contrast, only moderate agreement between U25 equations indicates a need for more frequent measurement of cystatin-C among children and young adults, especially as eGFR increases.

STAU1
Also flagged:dystrophia myotonica protein kinasemuscleblind-like splicing regulator 1MBNL1glycogen synthase kinase-3 betaAutophagyMyotonic Dystrophy Type 1
Journal Article 2024-01-01 ✓ 1 Snippet Roussel MP, Ravel-Chapuis A, Gobin J, Jasmin BJ, Leduc-Gaudet JP, Gagnon C, Duchesne E.
In-Text Gene Mentions

…upregulation of staufen-1 (Stau1), protein kinase C…

Show Full Abstract

<h4>Background</h4>Myotonic dystrophy type 1 (DM1) is a slowly progressive disease caused by abnormal CTG repetitions on the dystrophia myotonica protein kinase (DMPK) gene. Long mRNA from CTG repetitions stabilizes in nuclear foci and sequester muscleblind-like splicing regulator 1 (MBNL1). Cardinal signs of DM1 include muscle wasting and weakness. The impacts of DM1 progression on skeletal muscle are under-researched.<h4>Objective</h4>Identifying physiopathological markers related to maximal strength loss over time in DM1.<h4>Methods</h4>Twenty-two individuals with DM1 participated in two maximal isometric muscle strength (MIMS) evaluations of their knee extensors and two vastus lateralis muscle biopsies, 3 years apart. Muscle fiber typing, size (including minimal Feret's diameter [MFD] and atrophy/hypertrophy factors [AF/HF]), and nuclear foci and MBNL1 colocalization (foci/MBNL1+) were evaluated. Immunoblotting was used to measure glycogen synthase kinase-3 beta (GSK3β), p62, LC3BI, LC3BII, and oxidative phosphorylation proteins.<h4>Results</h4>There are significant correlations between the fold changes of MIMS with type 1 fiber MFD (ρ= 0.483) and AF (ρ= -0.514). Regression analysis shows that baseline percentage of foci/MBNL1+ nuclei and strength training explain 44.1% of foci/MBNL1+ nuclei percentage variation over time. There are fair to excellent correlations between the fold changes of MIMS and GSK3β (ρ= 0.327), p62 (ρ= 0.473), LC3BI (ρ= 0.518), LC3BII (ρ= -0.391) and LC3BII/LC3BI (ρ= -0.773).<h4>Conclusion</h4>Type 1 MFD decrease and AF increase are correlated with MIMS loss. There seems to be a plateau effect in foci/MBNL1+ nuclei accumulation and strength training helps decrease this accumulation. Autophagy marker LC3BII/LC3BI ratio has a good biomarker potential of MIMS loss, but more investigations are needed.

Also flagged:GlucopyranosideCOVID-19RBDACE2bindingprotease
Journal Article 2024-01-01 No Snippets Ezell J, Al-Horani RA.
Show Full Abstract

<h4>Background</h4>In the search for anti-COVID-19 therapy, 1,2,3,4,6-pentakis-O-galloyl-β- D-glucopyranoside, a natural polyphenolic compound isolated from many traditional medicinal herbs, has been reported as an RBD-ACE2 binding inhibitor and as a broad-spectrum anticoronaviral inhibitor targeting the main protease and RNA-dependent RNA polymerase of SARSCoV- 2. To facilitate the structure-activity relationship studies of 1,2,3,4,6-pentakis-O-galloyl-β-Dglucopyranoside, we describe its chemical synthesis and characterization, as well as its activity towards the SARS-CoV-2 spike interaction with host ACE2 receptor.<h4>Methods</h4>1,2,3,4,6-Pentakis-O-galloyl-β-D-glucopyranoside was synthesized in two quantitative steps from 3,4,5-tribenzyloxybenzoic acid and β-D-glucopyranoside: DCC-mediated esterification and palladium-catalyzed per-debenzylation. The synthesized molecule was evaluated using a SARS-CoV-2 spike trimer (S1 + S2) ACE2 inhibitor screening colorimetric assay kit, SARS-CoV- 2 spike S1 RBD ACE2 inhibitor screening assay kit, and a cellular neutralization assay using the Spike (SARS-CoV-2) Pseudotyped Lentivirus, ACE2-HEK293 recombinant cell line.<h4>Results</h4>The chemically synthesized product blocked the binding of the spike trimer of SARSCoV- 2 to the human ACE2 receptor with IC<sub>50</sub>=22±2 μM. It also blocked ACE2: spike RBD binding with IC<sub>50</sub>=27±3 μM. Importantly, it inhibited the infectivity of SARS2-CoV2-Spike pseudotyped lentivirus on the ACE2 HEK293 cell line with IC<sub>50</sub>=20±2 μM.<h4>Conclusion</h4>Overall, the chemically synthesized 1,2,3,4,6-pentakis-O-galloyl-β-D-glucopyranoside represents a lead molecule to develop anti-SARS-CoV-2 therapies that block the initial stage of the viral infection by blocking the virus entry to the host cell.

SERPINC1
Also flagged:Renal Failureimmunoglobulin A nephropathyIgANhypertensiontobacco use disorderchronic kidney disease
Journal Article 2024-01-01 ✓ 1 Snippet Yassin S, Athota S, Khan A, Patel V, Williams J, Dwived S.
In-Text Gene Mentions

…Leiden, antithrombin III [ATIII] deficiency, and anticardioli…

Show Full Abstract

Studies have highlighted a potential link between malignancies and immunoglobulin A nephropathy (IgAN). In such studies, the treatment of malignancy improved the symptoms of IgAN. Here, we report a patient case involving a history of hypertension, tobacco use disorder, and chronic kidney disease (CKD) presenting with hematuria with acute renal failure secondary to IgAN per renal biopsy. Prompted by this association, a malignancy workup was performed including computed tomography (CT) body imaging and biopsies of mediastinal and cervical lymph nodes which revealed a metastatic adenocarcinoma. Current knowledge includes a general mechanism behind the development of IgAN that points toward glomerular deposition of tumor-specific immunoglobulin A (IgA) immunoglobulins. However, the association of IgAN and malignancy has no definitive management guidelines. This clinical case serves as an important contribution in the hopes of future development of guidelines regarding the surveillance and management of IgAN in the setting of malignancy.

SOX6
Also flagged:DDX5dysfunctioncoronary heart diseaselipoproteintube formationbinding
Journal Article 2024-01-01 ✓ 5 Snippets Li S, Wang Y.
In-Text Gene Mentions

…injury through the miR-640/SOX6axis.…

…pre-miR-640, miR-640, andSOX6expressions were analyzed…

…between miR-640 andSOX6.<h4>Results</h4>DDX5 and miR-…

…highly expressed whileSOX6was poorly expressed…

…pri-miR-640, thereby reducingSOX6expression.…

Show Full Abstract

<h4>Background</h4>Endothelial dysfunction is an early and pre-clinical manifestation of coronary heart disease (CHD).<h4>Objective</h4>This study investigates the role of DDX5 in oxidized low-density lipoprotein (ox-LDL)-induced endothelial cell injury to confer novel targets for the treatment of CHD.<h4>Methods</h4>Endothelial cells were induced by ox-LDL. DDX5, pri-miR-640, pre-miR-640, miR-640, and SOX6 expressions were analyzed by RT-qPCR and Western blot. DDX5 expression was intervened by shRNA, followed by CCK-8 analysis of proliferation, flow cytometry detection of apoptosis, and tube formation assay analysis of angiogenic potential of cells. The binding between DDX5 and pri-miR-640 was determined by RIP, and the pri-miR-640 RNA stability was measured after actinomycin D treatment. Dual-luciferase assay verified the targeting relationship between miR-640 and SOX6.<h4>Results</h4>DDX5 and miR-640 were highly expressed while SOX6 was poorly expressed in ox-LDL-induced endothelial cells. Silence of DDX5 augmented cell proliferation, abated apoptosis, and facilitated angiogenesis. Mechanistically, RNA binding protein DDX5 elevated miR-640 expression by weakening the degradation of pri-miR-640, thereby reducing SOX6 expression. Combined experimental results indicated that overexpression of miR-640 or low expression of SOX6 offset the protective effect of DDX5 silencing on cell injury.<h4>Conclusion</h4>DDX5 elevates miR-640 expression by repressing the degradation of pri-miR-640 and then reduces SOX6 expression, thus exacerbating ox-LDL-induced endothelial cell injury.

ZNF644
Also flagged:colorectal canceralcoholcancersmismatch repairMLH1PMS2
Journal Article 2024-01-01 ✓ 1 Snippet Das A, Gkoutos GV, Acharjee A.
In-Text Gene Mentions

ZNF644is a TF…

Show Full Abstract

<h4>Introduction</h4>Adaptive mutagenesis observed in colorectal cancer (CRC) cells upon exposure to EGFR inhibitors contributes to the development of resistance and recurrence. Multiple investigations have indicated a parallel between cancer cells and bacteria in terms of exhibiting adaptive mutagenesis. This phenomenon entails a transient and coordinated escalation of error-prone translesion synthesis polymerases (TLS polymerases), resulting in mutagenesis of a magnitude sufficient to drive the selection of resistant phenotypes.<h4>Methods</h4>In this study, we conducted a comprehensive pan-transcriptome analysis of the regulatory framework within CRC cells, with the objective of identifying potential transcriptome modules encompassing certain translesion polymerases and the associated transcription factors (TFs) that govern them. Our sampling strategy involved the collection of transcriptomic data from tumors treated with cetuximab, an EGFR inhibitor, untreated CRC tumors, and colorectal-derived cell lines, resulting in a diverse dataset. Subsequently, we identified co-regulated modules using weighted correlation network analysis with a minKMEtostay threshold set at 0.5 to minimize false-positive module identifications and mapped the modules to STRING annotations. Furthermore, we explored the putative TFs influencing these modules using KBoost, a kernel PCA regression model.<h4>Results</h4>Our analysis did not reveal a distinct transcriptional profile specific to cetuximab treatment. Moreover, we elucidated co-expression modules housing genes, for example, POLK, POLI, POLQ, REV1, POLN, and POLM. Specifically, POLK, POLI, and POLQ were assigned to the "blue" module, which also encompassed critical DNA damage response enzymes, for example. BRCA1, BRCA2, MSH6, and MSH2. To delineate the transcriptional control of this module, we investigated associated TFs, highlighting the roles of prominent cancer-associated TFs, such as CENPA, HNF1A, and E2F7.<h4>Conclusion</h4>We found that translesion polymerases are co-regulated with DNA mismatch repair and cell cycle-associated factors. We did not, however, identified any networks specific to cetuximab treatment indicating that the response to EGFR inhibitors relates to a general stress response mechanism.

PRDX6
Also flagged:arsenicGene Expressionglutathione transferaseglutathionemetabolismresponse to
Journal Article 2024-01-01 ✓ 5 Snippets Yu Z, Wang R, Dai T, Guo Y, Tian Z, Zhu Y, Chen J, Yu Y.
In-Text Gene Mentions

…[ Os01g0644000 ,PRDX6( Os07g0638400 ),…

…including Os01g0644000 ,PRDX6( Os07g0638400 ),…

…related to peroxidase,PRDX6( Os07g0638400 )…

PRDX6has been reported…

…Presently,PRDX6expressions were up-regulated,…

Show Full Abstract

<h4>Background</h4>Arsenic is a toxic metalloid that can cause acute and chronic adverse health problems. Unfortunately, rice, the primary staple food for more than half of the world's population, is generally regarded as a typical arsenic-accumulating crop plant. Evidence indicates that arsenic stress can influence the growth and development of the rice plant, and lead to high concentrations of arsenic in rice grain. But the underlying mechanisms remain unclear.<h4>Methods</h4>In the present research, the possible molecules and pathways involved in rice roots in response to arsenic stress were explored using bioinformatics methods. Datasets that involving arsenic-treated rice root and the "study type" that was restricted to "Expression profiling by array" were selected and downloaded from Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) between the arsenic-treated group and the control group were obtained using the online web tool GEO2R. Gene Ontology (GO) function and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed to investigate the functions of DEGs. The protein-protein interactions (PPI) network and the molecular complex detection algorithm (MCODE) of DEGs were analyzed using STRING and Cystoscope, respectively. Important nodes and hub genes in the PPI network were predicted and explored using the Cytoscape-cytoHubba plug-in.<h4>Results</h4>Two datasets, GSE25206 and GSE71492, were downloaded from Gene Expression Omnibus (GEO) database. Eighty common DEGs from the two datasets, including sixty-three up-regulated and seventeen down-regulated genes, were then selected. After functional enrichment analysis, these common DEGs were enriched mainly in 10 GO items, including glutathione transferase activity, glutathione metabolic process, toxin catabolic process, and 7 KEGG pathways related to metabolism. After PPI network and MCODE analysis, 49 nodes from the DEGs PPI network were identified, filtering two significant modules. Next, the Cytoscape-cytoHubba plug-in was used to predict important nodes and hub genes. Finally, five genes [Os01g0644000, PRDX6 (Os07g0638400), PRX112 (Os07g0677300), ENO1(Os06g0136600), LOGL9 (Os09g0547500)] were verified and could serve as the best candidates associated with rice root in response to arsenic stress.<h4>Conclusions</h4>In summary, we elucidated the potential pathways and genes in rice root in response to arsenic stress through a comprehensive bioinformatics analysis.

STAU1
Also flagged:dsRNA-binding proteinsdsRNA-binding proteinbindingarmadillo/beta-catenin-binding proteinsRNA-binding proteins
Journal Article 2024-01-01 ✓ 3 Snippets Yang Z, Zhou J, Li Z, Guo J, Fang L, Xiao X, Xiao S.
In-Text Gene Mentions

…tibodies, namely, rabbit anti-STAU1(Proteintech), anti-DDX10 (Bet…

…RNA-protein complexes, bothSTAU1and LIN28A appeared…

…such as Exportin-5,STAU1/2, and NF90, have…

Show Full Abstract

Interactions between double-stranded RNA (dsRNA) and proteins play an important role in cellular homeostasis by regulating the editing, stability, and splicing of intracellular RNA. The identification of dsRNA-binding proteins (dsRBPs) is key; however, it has long been challenging to purify dsRBPs from cells. In this study, we developed a novel method, dsRBPC (dsRNA-binding protein capture), to purify cellular dsRBPs based on classic phase separation purification procedures. A global dsRNA-binding proteome of LLC-PK1 cells was obtained, and we identified 1326 dsRBPs, including 1303 putative novel dsRBPs. Functional analyses suggested that these enriched dsRBPs are mainly associated with rRNA processing, RNA splicing, transcriptional regulation, and nucleocytoplasmic transport. We also found that the ARM (armadillo/beta-catenin-like repeats) motif is a previously unknown dsRNA-binding domain, as demonstrated by biochemical experiments. Collectively, this study provides a useful approach for dsRBP identification and the discovery of a global dsRNA-binding proteome to comprehensively map the dsRNA - protein interaction network.

TNFSF4ECI2
Also flagged:Hepatocellular Carcinomatyrosine kinaseliver cancerprogrammed cell death 1 ligand 1tumortumors
Journal Article 2024-01-01 ✓ 5 Snippets Shi H, Liu Y, Liu Z, Ge X, Wu J, Tang H, Zhang Y, Lu S.
In-Text Gene Mentions

…the ASs inECI2and PRDX5 act…

…the ASs ofECI2and IL18BP and…

…the ASs inECI2and IL18BP genes…

…LAG3, CD276, CD80,TNFSF4, TNFSF9, TNFRSF4, TNFRSF14,…

…PSI levels ofECI2triggered the activation…

Show Full Abstract

<b>Background:</b> Integrating immune checkpoint inhibitors with multi-target tyrosine kinase inhibitors presents an innovative and hopeful strategy in liver cancer treatment. Nonetheless, a degree of resistance to this treatment is noticeable in certain patients. Alternative splicing (AS) represents a common biological process that controls the variety of life functions via isoforms. <b>Purpose:</b> Investigating how gene AS affects the effectiveness of combined immunotherapy in treating hepatocellular carcinoma (HCC). <b>Methods:</b> Our retrospective examination focused on AS's effect on immune therapy effectiveness, utilizing accessible tissue sequencing and clinical records for HCC. For corroborating our results, we gathered samples of drug-resistant HCC tissue, nearby tissues, HCC tissue with high drug responsiveness, and healthy liver tissue from clinical studies. <b>Results:</b> The study revealed a link between the frequency of AS occurrences, the expression levels of programmed cell death 1 ligand 1, and the resistance to tumor medications. Our study detailed the AS occurrences in HCC, leading to the creation of a risk-assessment function and a predictive model using AS data. The results of our study revealed that the risk score effectively distinguished between various immune subtypes and the effectiveness of immune therapy. Additional examination of the chosen AS occurrences uncovered their effects on both the immune microenvironment and cellular immunity. Our investigation also delved into the regulatory framework of AS, uncovering the role of stringently controlled splicing factors in the emergence of tumors and the modulation of the body's immune response. <b>Conclusions:</b> Increased AS in HCC diminishes the efficacy of immunotherapy; conversely, more AS in peritumoral tissue elevates the likelihood of tumor immune evasion.

Also flagged:synaptic proteinscognitive declinemild cognitive impairmentdementianeurofilament lightAD dementia
Journal Article 2024-01-01 No Snippets Duits FH, Nilsson J, Zetterberg H, Blennow K, van der Flier WM, Teunissen CE, Brinkmalm A.
Show Full Abstract

<h4>Background</h4>Synaptic dysfunction is closely associated with cognitive function in Alzheimer's disease (AD), and is present already in an early stage of the disease.<h4>Objective</h4>Using serial cerebrospinal fluid (CSF) sampling, we aimed to investigate slopes of CSF synaptic proteins, and their relation with cognition along the AD continuum.<h4>Methods</h4>We included subjects with subjective cognitive decline (SCD) or mild cognitive impairment (MCI) (n = 50 amyloid-β+ [A +], n = 50 A-) and 50 patients with AD dementia from the Amsterdam dementia cohort, with CSF at two time points (median[IQR] 2.1[1.4-2.7] years). We analyzed 17 synaptic proteins and neurofilament light (NfL). Using linear mixed models we assessed trajectories of protein levels, and associations with cognitive decline (repeated Mini-Mental State Examination). We used Cox regression models to assess predictive value of protein levels for progression to AD dementia.<h4>Results</h4>At baseline most proteins showed increased levels in AD dementia compared to the other groups. In contrast NPTX2 levels were lower in AD dementia. Higher baseline levels of SNAP25, β-syn, and 14-3-3 proteins were associated with faster cognitive decline (St.B[SE] -0.27[0.12] to -0.61[0.12]). Longitudinal analyses showed that SYT1 and NPTX levels decreased over time in AD dementia (st.B[SE] -0.10[0.04] to -0.15[0.05]) and SCD/MCI-A+ (St.B[SE] -0.07[0.03] to -0.12[0.03]), but not in SCD/MCI-A- (pinteraction < 0.05). Increase over time in NfL levels was associated with faster cognitive decline in AD dementia (St.B[SE] -1.75[0.58]), but not in the other groups (pinteraction < 0.05).<h4>Conclusions</h4>CSF synaptic proteins showed different slopes over time, suggesting complex synaptic dynamics. High levels of especially SNAP-25 may have value for prediction of cognitive decline in early AD stages, while increase in NfL over time correlates better with cognitive decline in later stages.

HTT
Also flagged:Pediatric HDHDHuntingtinadult-onset HDHuntington Diseaseaging
Journal Article 2024-01-01 ✓ 1 Snippet Bakels HS, Feleus S, Rodríguez-Girondo M, Losekoot M, Bijlsma EK, Roos RAC, de Bot ST.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene (≥36), explaining…

Show Full Abstract

<h4>Background</h4>Juvenile-onset Huntington's disease (JHD) represents 1-5% of Huntington's disease (HD) patients, with onset before the age of 21. Pediatric HD (PHD) relates to a proportion of JHD patients that is still under 18 years of age. So far, both populations have been excluded from interventional trials.<h4>Objective</h4>Describe the prevalence and incidence of JHD and PHD in the Netherlands and explore their ability to participate in interventional trials.<h4>Methods</h4>The prevalence and incidence of PHD and JHD patients in the Netherlands were analyzed. In addition, we explored proportions of JHD patients diagnosed at pediatric versus adult age, their diagnostic delay, and functional and modelled (CAP100) disease stage in JHD and adult-onset HD patients at diagnosis.<h4>Results</h4>The prevalence of JHD and PHD relative to the total manifest HD population in January 2024 was between 0.84-1.25% and 0.09-0.14% respectively. The mean incidence of JHD patients being diagnosed was between 0.85-1.28 per 1000 patient years and of PHD 0.14 per 1.000.000 under-aged person years. 55% of JHD cases received a clinical diagnosis on adult age. At diagnosis, the majority of JHD patients was functionally compromised and adolescent-onset JHD patients were significantly less independent compared to adult-onset HD patients.<h4>Conclusions</h4>In the Netherlands, the epidemiology of JHD and PHD is lower than previously suggested. More than half of JHD cases are not eligible for trials in the PHD population. Furthermore, higher functional dependency in JHD patients influences their ability to participate in trials. Lastly, certain UHDRS functional assessments and the CAP100 score do not seem appropriate for this particular group.

HFE
Also flagged:Non-Cirrhotic Portal Hypertensionnonalcoholic steatosissteatohepatitisviral hepatitisalcoholic hepatitisPortal hypertension
Journal Article 2024-01-01 ✓ 1 Snippet Jamali A, Ajumobi A.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis, alpha-1 antitrypsin deficien…

Show Full Abstract

<h4>Introduction</h4>Involvement of the gastrointestinal system is less common in Turner's syndrome. Hepatic derangements have been reported in individuals with Turner's syndrome due to nonalcoholic steatosis, steatohepatitis, and less commonly due to viral hepatitis and alcoholic hepatitis. Portal hypertension is typically associated with cirrhosis; however, in a minor fraction of individuals, it occurs in the absence of cirrhosis. Portal hypertension is rare in Turner's syndrome and is even more rarely observed in the absence of cirrhosis in individuals with Turner's syndrome.<h4>Case presentation</h4>Herein, we report a case of liver biopsy-proven non-cirrhotic portal hypertension due to portosinusoidal vascular disease.<h4>Conclusion</h4>High index of clinical suspicion can lead to early diagnosis and treatment of portal hypertension in individuals with Turner's syndrome, reducing the burden of complications of portal hypertension.

TNFSF4
Also flagged:Primary liver cancerhepatocellular carcinomaprimaryliver cancertumorCD8
Journal Article 2024-01-01 ✓ 2 Snippets Li X, Qu X, Li S, Lin K, Yao N, Wang N, Shi Y.
In-Text Gene Mentions

…CD80, CD44, VTCN1,TNFSF4, BTLA, and others…

…including CD44, VTCN1,TNFSF4, and NRP1, suggesting…

Show Full Abstract

<h4>Objective</h4>The aim of this study was to analyze the clinical significance and prognostic value of CD8<sup>+</sup> T cell-related regulatory genes in hepatocellular carcinoma (HCC).<h4>Methods</h4>This was a retrospective study. We combined TCGA-LIHC and single-cell RNA sequencing data for Lasso-Cox regression analysis to screen for CD8<sup>+</sup> T cell-associated genes to construct a novel signature. The expression of the signature genes was detected at cellular and tissue levels using qRT-PCR, immunohistochemistry, and tissue microarrays. The CIBERSORT algorithm was then used to assess the immune microenvironmental differences between the different risk groups and a drug sensitivity analysis was performed to screen for potential HCC therapeutic agents.<h4>Results</h4>An 8-gene CD8 + T cell-associated signature (FABP5, GZMH, ANXA2, KLRB1, CD7, IL7R, BATF, and RGS2) was constructed. Survival analysis showed that high-risk patients had a poorer prognosis in all cohorts. Tumor immune microenvironment analysis revealed 22 immune cell types that differed significantly between patients in different risk groups, with patients in the low-risk group having an immune system that was more active in terms of immune function. Patients in the high-risk group were more prone to immune escape and had a poorer response to immunotherapy, and AZD7762 was screened as the most sensitive drug in the high-risk group. Finally, preliminary experiments have shown that BATF has a promoting effect on the proliferation, migration and invasion of HuH-7 cells.<h4>Conclusions</h4>The CD8<sup>+</sup> T-cell-associated signature is expected to be a tool for optimizing individual patient decision-making and monitoring protocols, and to provide new ideas for treatment and prognostic assessment of HCC.

DDX27
Also flagged:ZAPRNA-binding Proteinszinc finger CCCH-type antiviral protein 1encephalitisinfectionsZC3HAV1
Journal Article 2024-01-01 ✓ 5 Snippets Sabir AJ, Le NPK, Singh PP, Karniychuk U.
In-Text Gene Mentions

…– DDX42, DDX56,DDX27, DDX50, DDX52, DDX23,…

…selected helicases (DDX23,DDX27, DDX42, and DDX50)…

…DDX42 andDDX27were chosen because…

…of DDX23 andDDX27was lower in…

…p = 0.0471;DDX27p < 0.0001;…

Show Full Abstract

One of the most recent advances in the analysis of viral RNA-cellular protein interactions is the Comprehensive Identification of RNA-binding Proteins by Mass Spectrometry (ChIRP-MS). Here, we used ChIRP-MS in mock-infected and Zika-infected wild-type cells and cells knockout for the zinc finger CCCH-type antiviral protein 1 (ZAP). We characterized 'ZAP-independent' and 'ZAP-dependent' cellular protein interactomes associated with flavivirus RNA and found that ZAP affects cellular proteins associated with Zika virus RNA. The ZAP-dependent interactome identified with ChIRP-MS provides potential ZAP co-factors for antiviral activity against Zika virus and possibly other viruses. Identifying the full spectrum of ZAP co-factors and mechanisms of how they act will be critical to understanding the ZAP antiviral system and may contribute to the development of antivirals.

HTT
Also flagged:cognitive impairmentHDneurodegenerative diseaseorganizationcognitionHuntington Disease
Journal Article 2024-01-01 ✓ 2 Snippets Petrillo J, Sawant R, Elliott E, Cleanthous S, Rogers R, Cano S, Baradaran S, Johannesen J.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, which results…

…production of mutantHTTprotein [ 1…

Show Full Abstract

<h4>Background</h4>The Huntington's Disease (HD) Everyday Functioning (Hi-DEF) is a new patient-reported outcome (PRO) instrument designed to measure the impact of cognitive impairment on daily functioning in the early stages of HD.<h4>Objective</h4>To assess the measurement properties and finalize item content of the Hi-DEF.<h4>Methods</h4>A cross-sectional, observational psychometric validation study was conducted among individuals with early stages of HD at 9 US centers of excellence. Rasch Measurement Theory (RMT) analysis of the initial draft version of the Hi-DEF (47 items) and subscales (i.e., 'Home', 'At work', 'Driving', and 'Communication') was conducted to examine measurement properties including sample-to-scale targeting, suitability of response scale (ordering of response thresholds), scale cohesiveness (item fit), local independence, and person fit.<h4>Results</h4>151 participants (mean age 47 years (SD 12), 59% female) were included. Seven items were removed based on dependency and item fit. The remaining 40-item version of the Hi-DEF demonstrated good measurement properties. Across the four subscales, targeting ranged from 49-70% (72% full scale), reliability ascertained by person separation index ranged from 0.53-0.87 (0.92 full scale), response scales were ordered for 25-100% of items (75% full scale), 0-12% items displayed misfit (2% full scale), and 0-1% (2% full scale) item pairs displayed dependency.<h4>Conclusions</h4>Our study supports the psychometric integrity of the Hi-DEF as a reliable and valid new PRO instrument designed to assess the impact of cognitive impairment on daily functioning in the early stages of HD. Future work will evaluate the external validity and utility in clinical trial applications.

HTT
Also flagged:neurodegenerative disordersHDcognitiveneurodegenerative disordercognitive impairmentsdeath
Journal Article 2024-01-01 ✓ 2 Snippets Hanrahan J, Locke DP, Cahill LS.
In-Text Gene Mentions

…the huntingtin gene (HTT).…

…literature suggests mutantHTThas an impact…

Show Full Abstract

Structural magnetic resonance imaging (MRI) is a powerful tool to visualize 3D neuroanatomy and assess pathology and disease progression in neurodegenerative disorders such as Huntington's disease (HD). The development of mouse models of HD that reproduce many of the psychiatric, motor and cognitive impairments observed in human HD has improved our understanding of the disease and provided opportunities for testing novel therapies. Similar to the clinical scenario, MRI of mouse models of HD demonstrates onset and progression of brain pathology. Here, we provided an overview of the articles that used structural MRI in mouse models of HD to date, highlighting the differences between studies and models and describing gaps in the current state of knowledge and recommendations for future studies.

SOX6
Also flagged:neuroblastomaNBFOXR2brain tumortranscription factortumors
Journal Article 2024-01-01 ✓ 2 Snippets Royston HN, Hampton AB, Bhagat D, Pinto EF, Emerson MD, Funato K.
In-Text Gene Mentions

…genes NKX2.1 ,SOX6, and SOX10…

…cluding synaptophysin, NKX2.1,SOX6, SOX10, and OLIG2,…

Show Full Abstract

<h4>Background</h4>FOXR2-activated central nervous system (CNS) neuroblastoma (CNS NB-FOXR2) is a recently identified subtype of brain tumor characterized by the elevated expression of the transcription factor FOXR2 mainly due to genomic rearrangements. However, the precise pathogenic mechanisms, including the cell type of origin, remain elusive.<h4>Methods</h4>A gene expression analysis of patient tumors was performed to identify putative cell types of origin. Based on this prediction, a new human embryonic stem cell-based model was developed to validate the origin and to examine the molecular and cellular mechanisms underlying the formation of CNS NB-FOXR2.<h4>Results</h4>Our data showed that CNS NB-FOXR2 tumors express a high level of lineage marker genes associated with the medial ganglionic eminence (MGE), a transient structure located in the developing ventral forebrain. Our model confirmed the cell-type-specific effect of FOXR2 on the proliferation and in vivo tumorigenicity. Additionally, we found that FOXR2 overexpression activated the MEK/ERK signaling pathway through a suppression of the endogenous RAS inhibitor DIRAS3. The MEK inhibitor trametinib suppressed the proliferation of FOXR2-expressing MGE progenitors more than nonexpressing cells.<h4>Conclusions</h4>Our study collectively demonstrates that MGE progenitors are the cell of origin of CNS NB-FOXR2 and that FOXR2 activates the MEK/ERK signaling pathway, providing a potential therapeutic target.

Also flagged:Macrophage migration inhibitory factorMIFcytokinecell proliferationCNS tumorspeptide
Journal Article 2024-01-01 No Snippets Jarmula J, Lee J, Lauko A, Rajappa P, Grabowski MM, Dhawan A, Chen P, Bucala R, Vogelbaum MA, Lathia JD.
Show Full Abstract

Primary central nervous system (CNS) tumors affect tens of thousands of patients each year, and there is a significant need for new treatments. Macrophage migration inhibitory factor (MIF) is a cytokine implicated in multiple tumorigenic processes such as cell proliferation, vascularization, and immune evasion and is therefore a promising therapeutic target in primary CNS tumors. There are several MIF-directed treatments available, including small-molecule inhibitors, peptide drugs, and monoclonal antibodies. However, only a small number of these drugs have been tested in preclinical models of primary CNS tumors, and even fewer have been studied in patients. Moreover, the brain has unique therapeutic requirements that further make effective targeting challenging. In this review, we summarize the latest functions of MIF in primary CNS tumor initiation and progression. We also discuss advances in MIF therapeutic development and ongoing preclinical studies and clinical trials. Finally, we discuss potential future MIF therapies and the strategies required for successful clinical translation.

POU3F2
Also flagged:GliomaConstitutional mismatch repair deficiencyCMMRDcancermismatch repaircancers
Journal Article 2024-01-01 ✓ 1 Snippet Guerrini-Rousseau L, Merlevede J, Denizeau P, Andreiuolo F, Varlet P, Puget S, Beccaria K, Blauwblomme T, Cabaret O, Hamzaoui N, Bourdeaut F, Faure-Conter C, Muleris M, Colas C, Adam de Beaumais T, Castel D, Rouleau E, Brugières L, Grill J, Debily MA.
In-Text Gene Mentions

…PHF3, SETD2, ZEB2,POU3F2.…

Show Full Abstract

<h4>Background</h4>Constitutional mismatch repair deficiency (CMMRD) is a cancer predisposition due to biallelic mutations in one of the mismatch repair (MMR) genes associated with early onset of cancers, especially high-grade gliomas. Our aim was to decipher the molecular specificities of these gliomas.<h4>Methods</h4>Clinical, histopathological, and whole exome sequencing data were analyzed in 12 children with genetically proven CMMRD and a high-grade glioma.<h4>Results</h4>PDL1 expression was present in immunohistochemistry in 50% of the samples. In 9 patients, the glioma harbored an ultra-hypermutated phenotype (104-635 coding single nucleotide variants (SNV) per Mb, median 204). Driver mutations in <i>POLE</i> and <i>POLD1</i> exonuclease domains were described for 8 and 1 patients respectively and were always present in the mutation burst with the highest variant allele frequency (VAF). The mutational signatures were dominated by MMR-related ones and similar in the different mutation bursts of a same patient without subsequent enrichment of the mutation signatures with POL-driven ones. Median number of coding SNV with VAF above one of the driving polymerase mutation per Mb was 57 (17-191). Our findings suggest that somatic polymerase alterations does not entirely explain the ultra-hypermutant phenotype. <i>SETD2</i>, <i>TP53</i>, <i>NF1</i>, <i>EPHB2</i>, <i>PRKDC,</i> and <i>DICER1</i> genes were frequently mutated with higher VAF than the deleterious somatic polymerase mutation.<h4>Conclusions</h4>CMMRD-associated gliomas have a specific oncogenesis that does not involve usual pathways and mutations seen in sporadic pediatric or adult glioblastomas. Frequent alterations in other pathways such as MAPK may suggest the use of other targeted therapies along with PD1 inhibitors.

Also flagged:GliomaGBMprimary tumorGlioblastomarecurrentcancers
Journal Article 2024-01-01 No Snippets Fei X, Wu J, Tian H, Jiang D, Chen H, Yan K, Wang Y, Zhao Y, Chen H, Xie X, Wang Z, Zhu W, Huang Q.
Show Full Abstract

Glioma is the most common primary tumor of the central nervous system (CNS). Glioblastoma (GBM) is incurable with current treatment strategies. Additionally, the treatment of recurrent GBM (rGBM) is often referred to as terminal treatment, necessitating hospice-level care and management. The presence of the blood-brain barrier (BBB) gives GBM a more challenging or "cold" tumor microenvironment (TME) than that of other cancers and gloma stem cells (GSCs) play an important role in the TME remodeling, occurrence, development and recurrence of giloma. In this review, our primary focus will be on discussing the following topics: niche-associated GSCs and macrophages, new theories regarding GSC and TME involving pyroptosis and ferroptosis in GBM, metabolic adaptations of GSCs, the influence of the cold environment in GBM on immunotherapy, potential strategies to transform the cold GBM TME into a hot one, and the advancement of GBM immunotherapy and GBM models.

HTT
Also flagged:antibodiesHuntingtinamino acidpolyglutamineHuntington's diseaseneurodegenerative disorder
Journal Article 2024-01-01 ✓ 5 Snippets Fanti R, Ayoubi R, Alende C, Fotouhi M, González Bolívar S, Chandrasekaran R, Southern K, Edwards AM, Harding RJ, Laflamme C, NeuroSGC/YCharOS/EDDU collaborative group, ABIF consortium.
In-Text Gene Mentions

…We generated anHTTKO line in…

…expresses the endogenousHTTtranscript at 6.1…

…A commercial HAP1HTTKO is also…

…available; HAP1 expressesHTTat 3.7 log…

…experiments, WT andHTTKO protein lysates…

Show Full Abstract

Huntingtin encodes a 3144 amino acid protein, with a polyglutamine repeat tract at the N-terminus. Expansion of this repeat tract above a pathogenic threshold of 36 repeats is the causative mutation of Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. Here we have characterized twenty Huntingtin commercial antibodies for western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. These studies are part of a larger, collaborative initiative seeking to address antibody reproducibility issues by characterizing commercially available antibodies for human proteins and publishing the results openly as a resource for the scientific community. While use of antibodies and protocols vary between laboratories, we encourage readers to use this report as a guide to select the most appropriate antibodies for their specific needs.

HTT
Also flagged:neuropsychiatric disordersanxietyMSdepressionamino acidsamino acid
Journal Article 2024-01-01 ✓ 1 Snippet Zhu J, Zhong Z, Shi L, Huang L, Lin C, He Y, Xia X, Zhang T, Ding W, Yang Y.
In-Text Gene Mentions

…, Pparg ,Htt, and Fos…

Show Full Abstract

Early life stress alters gut microbiota and increases the risk of neuropsychiatric disorders, including social deficits and anxiety, in the host. However, the role of gut commensal bacteria in early life stress-induced neurobehavioral abnormalities remains unclear. Using the maternally separated (MS) mice, our research has unveiled a novel aspect of this complex relationship. We discovered that the reduced levels of amino acid transporters in the intestine of MS mice led to low glutamine (Gln) levels in the blood and synaptic dysfunction in the medial prefrontal cortex (mPFC). Abnormally low blood Gln levels limit the brain's availability of Gln, which is required for presynaptic glutamate (Glu) and γ-aminobutyric acid (GABA) replenishment. Furthermore, MS resulted in gut microbiota dysbiosis characterized by a reduction in the relative abundance of <i>Lactobacillus reuteri</i> (<i>L. reuteri</i>). Notably, supplementation with <i>L. reuteri</i> ameliorates neurobehavioral abnormalities in MS mice by increasing intestinal amino acid transport and restoring synaptic transmission in the mPFC. In conclusion, our findings on the role of <i>L. reuteri</i> in regulating intestinal amino acid transport and buffering early life stress-induced behavioral abnormalities provide a novel insight into the microbiota-gut-brain signaling basis for emotional behaviors.

Also flagged:Gene ExpressionADPDdementiatauamyloid-β
Journal Article 2024-01-01 No Snippets Seligmann B, Camiolo S, Hernandez M, Yeakley JM, Sahagian G, McComb J.
Show Full Abstract

<h4>Background</h4>There is no molecular test for Alzheimer's disease (AD) using self-collected samples, nor is there a definitive molecular test for AD. We demonstrate an accurate and potentially definitive TempO-Seq® gene expression test for AD using fingerstick blood spotted and dried on filter paper, a sample that can be collected in any doctor's office or can be self-collected.<h4>Objective</h4>Demonstrate the feasibility of developing an accurate test for the classification of persons with AD from a minimally invasive sample of fingerstick blood spotted on filter paper which can be obtained in any doctor's office or self-collected to address health disparities.<h4>Methods</h4>Fingerstick blood samples from patients clinically diagnosed with AD, Parkinson's disease (PD), or asymptomatic controls were spotted onto filter paper in the doctor's office, dried, and shipped to BioSpyder for testing. Three independent patient cohorts were used for training/retraining and testing/retesting AD and PD classification algorithms.<h4>Results</h4>After initially identifying a 770 gene classification signature, a minimum set of 68 genes was identified providing classification test areas under the ROC curve of 0.9 for classifying patients as having AD, and 0.94 for classifying patients as having PD.<h4>Conclusions</h4>These data demonstrate the potential to develop a screening and/or definitive, minimally invasive, molecular diagnostic test for AD and PD using dried fingerstick blood spot samples that are collected in a doctor's office or clinic, or self-collected, and thus, can address health disparities. Whether the test can classify patients with AD earlier then possible with cognitive testing remains to be determined.

HTT
Also flagged:neurodegenerative diseasechoreadementiadepressioncognitive impairmentHD
Journal Article 2024-01-01 ✓ 4 Snippets Mian AM, Hamid H, Masaud F, Shah ZA, Fatima K, Salam A.
In-Text Gene Mentions

…the Huntingtin gene (HTT) on Chromosome 4.…

…HD involves theHTTgene located on…

…repeats on theHTTgene confirms the…

…allele of theHTTgene on chromosome…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disease characterized by neuropsychiatric symptoms including chorea, dementia, and depression. It is inherited in an autosomal dominant fashion and exhibits anticipation leading to earlier and more severe symptoms in the affected offspring of a patient. With a much lower prevalence in Asia than in Europe and other parts of the world, its diagnosis can be missed easily in the early stages due to mildness of the symptoms and significant overlap between its symptoms and those of other diseases. We present the case of a 38-year-old male of Pashtun ethnicity presenting with mild cognitive impairment and clumsiness who was eventually diagnosed with HD, but his mild clinical features, no documented history of HD in his parents, and his relatively young age coupled with the relatively low prevalence of HD in his geographical location presented a significant challenge in our diagnosis of his condition. This case underscores the importance of keeping a high clinical suspicion for HD in patients with chorea despite a negative parental history, especially in resource-limited areas where the parents may have gone undiagnosed and highlights the need for further research on HD's prevalence in different parts of the world as well as the barriers to its diagnosis.

SERPINC1
Also flagged:Dementiadementiasaginginfectious diseasesHIVAIDS
Journal Article 2024-01-01 ✓ 1 Snippet Babulal GM, Zha W, Trani JF, Guerra JL, Tee BL, Zhu Y, Chen Y, Chen L, Bubu M, Josephy-Hernandez S, Wandera S, Karanja W, Ellajosyula R, Caramelli P, Diversity and Disparity Professional Interest Area, Low-and-Middle-Income Working Group.
In-Text Gene Mentions

ACE-III

Show Full Abstract

<h4>Background</h4>The significant increase in Alzheimer's disease and related dementia prevalence is a global health crisis, acutely impacting low- and lower-middle and upper-middle-income countries (LLMICs/UMICs).<h4>Objective</h4>The objective of this study is to identify key barriers and gaps in dementia care and research in LLMICs and UMICs.<h4>Methods</h4>We conducted an international, cross-sectional survey among clinicians and healthcare professionals (n = 249 in 34 countries) across LLMICs and UMICs, exploring patient demographics, use of clinical diagnosis, dementia evaluation, screening/evaluation tools, and care and treatment.<h4>Results</h4>Significant disparities were found in diagnostic practices, access to assessments, and access to care. On average, clinicians in LLMICs saw more patients, had less time for evaluations, lower use of formal screening and tools, and less access to biomarkers. They were also under-resourced compared to UMICs.<h4>Conclusions</h4>The findings provide insights for policymakers, healthcare organizations, and researchers to address the complex challenges associated with dementia care in diverse settings. Addressing these challenges requires a multipronged approach involving local, national, and international stakeholders.

Also flagged:methylationcolorectal cancertumorcanceradenomaMYO1
Journal Article 2024-01-01 No Snippets Khabbazpour M, Tat M, Karbasi A, Abyazi MA, Khodadoustan G, Heidary Z, Zaki-Dizaji M.
Show Full Abstract

<h4>Aim</h4>A systematic review was conducted to summarize the methylated circulating tumor DNA (ctDNA) markers reported over the last decade for early detection of colorectal cancer (CRC) and to identify the main technical challenges that are impeding their clinical implementation.<h4>Background</h4>CRC is a major cause of cancer deaths worldwide, but early detection is key for successful treatment. Non-invasive methods such as methylated ctDNA testing show promise for improving detection and monitoring of CRC.<h4>Methods</h4>A comprehensive search was performed using Web of Science, PubMed, and Scopus up to December 30, 2023, limited to articles published in the last 10 years (after 2012), while including advanced adenoma/stage 0 or stage I/II samples in biomarker validation.<h4>Results</h4>After identifying 694 articles, removing duplicates and screening titles, abstracts, and full texts, a total of 62 articles were found to meet the inclusion criteria. Among the single biomarkers, MYO1-G, SEPT9, SDC2, and JAM3 revealed the highest sensitivity for polyps and stage I/II CRC. For multi-biomarkers with suitable sensitivity, combinations of SFRP1, SFRP2, SDC2, PRIMA1, or ALX4, BMP3, NPTX2, RARB, SDC2, SEPT9, VIM or ZFHX4, ZNF334, ELOVL2, UNC5C, LOC146880, SFMBT2, GFRA1 were identified for polyps and stage I/II CRC.<h4>Conclusion</h4>Enhancing sensitivity and specificity of molecular screening methods is crucial for improving CRC detection. Identifying a select few valuable biomarkers is key to reducing costs, despite challenges posed by low ctDNA levels in plasma, particularly in early-stage cancers.

OLFM4
Also flagged:osteoarthritisrheumatoid arthritisRAarthritisOAgene expression
Journal Article 2024-01-01 ✓ 2 Snippets Oveisee M, Gholipour A, Malakootian M.
In-Text Gene Mentions

…ITGB7 , andOLFM4) screened from…

…] concluded thatOLFM4played a significant…

Show Full Abstract

Osteoarthritis (OA) and rheumatoid arthritis (RA) treatment requires exact arthritis type diagnosis. We compared inflammatory molecular mechanisms between OA and RA to introduce reliable molecular biomarkers. The GSE55235 and GSE100786 microarray datasets were acquired from the GEO. Data preprocessing and differential expression analysis were conducted in OA and RA groups and their control groups applying GEO2R. Differentially expressed genes (DEGs) with a |LogFC|>1 and adj. <i>p</i><0.05 were determined. Gene ontology (GO) and signaling pathway analysis were done utilizing PANTHER and Enrichr. The suitability of gene expression alterations as biomarkers was tested using the receiver operating characteristic (ROC) curve analysis. We found 2129 DEGs between the OA and control groups and 2494 DEGs between the RA and control groups. GO on the DEGs showed enrichment in binding, cellular processes, and cellular anatomical entities in molecular functions, biological processes, and cellular components, respectively. Enrichr found the cell differentiation pathways of Th1 and Th2 only in RA. The ROC curve analysis indicated <i>HLA-DQA1</i> downregulation and <i>MAPK8IP3</i> upregulation as reliable biomarkers to discriminate RA from OA in peripheral blood and bone marrow samples, respectively. We found more DEGs in patients with OA than those with RA and determined inflammatory pathways and genes unique to RA as reliable biomarkers to discriminate RA from OA. Gene expression alterations associated with Th1 and Th2 cell differentiation pathways, including <i>HLA-DQA1</i> downregulation and <i>MAPK8IP3</i> upregulation, could be novel molecular biomarkers to diagnose RA.

MRPL39
Also flagged:Neuropathic painNPdiabetescancercalcium channelssodium channels
Journal Article 2024-01-01 ✓ 5 Snippets Ge H, Zhou H, Song L, Tao Y, Hu L.
In-Text Gene Mentions

…highlighting TOMM5, PDHB,MRPL39, SIRT3, MRPS15, and…

…genes (TOMM5, PDHB,MRPL39, SIRT3, MRPS15 and…

…SLC2A8, TOMM5, PDHB,MRPL39, SIRT3, and MRPS15…

…SLC2A8, TOMM5, PDHB,MRPL39, SIRT3, MRPS15, and…

…genes (TOMM5, PDHB,MRPL39, SIRT3 and MRPS15)…

Show Full Abstract

Neuropathic pain (NP) affects approximately 6.9-10% of the world's population and necessitates the development of novel treatments. Mitochondria are essential in the regulation of cell death. Neuroimmune mechanisms are implicated in various forms of cell death associated with NP. However, the specific involvement of mitochondrial dysfunction and disulfidptosis in NP remains uncertain. Further research is required to gain a better understanding of their combined contribution. Our comprehensive study employs a variety of bioinformatic analysis methods, including differential gene analysis, weighted gene co-expression network analysis, machine learning, functional enrichment analysis, immune infiltration, sub-cluster analysis, single-cell dimensionality reduction and cell-cell communication to gain insight into the molecular mechanisms behind these processes. Our study rationally defines a list of key gene sets for mitochondrial dysfunction and disulfidptosis. 6 hub mitochondrial genes and 3 disulfidptosis-related genes (DRGs) were found to be associated with NP. The key genes were predominantly expressed in neurons and were lowly expressed in the NP group compared to SHAM. In addition, our macrophages used the APP (Amyloid precursor protein)-CD74 (MHC class II invariant chain) pathway to interact with neurons. These results suggest that NP is interconnected with the mechanistic processes of mitochondrial dysfunction and disulfidptosis, which may contribute to clinically targeted therapies.

HTT
Also flagged:Huntington's diseasemetabolismstriatal atrophyHD
Journal Article 2024-01-01 ✓ 1 Snippet Binda CS, Lelos MJ, Rosser AE, Massey TH.
In-Text Gene Mentions

…exon of theHTTgene, leading to…

Show Full Abstract

Huntington's disease is caused by a CAG repeat expansion in the first exon of the HTT gene, leading to the production of gain-of-toxic-function mutant huntingtin protein species and consequent transcriptional dysregulation and disrupted cell metabolism. The brunt of the disease process is borne by the striatum from the earliest disease stages, with striatal atrophy beginning approximately a decade prior to the onset of neurologic signs. Although the expanded CAG repeat in the HTT gene is necessary and sufficient to cause HD, other genes can influence the age at onset of symptoms and how they progress. Many of these modifier genes have roles in DNA repair and are likely to modulate the stability of the CAG repeat in somatic cells. Currently, there are no disease-modifying treatments for HD that can be prescribed to patients and few symptomatic treatments, but there is a lot of interest in therapeutics that can target the pathogenic pathways at the DNA and RNA levels, some of which have reached the stage of human studies. In contrast, cell therapies aim to replace key neural cells lost to the disease process and/or to support the host vulnerable striatum by direct delivery of cells to the brain. Ultimately it may be possible to combine gene and cell therapies to both slow disease processes and provide some level of neural repair. In this chapter we consider the current status of these therapeutic strategies along with their prospects and challenges.

Also flagged:major histocompatibility complexchemokinescytotoxic responsescancertumorMHC
Journal Article 2024-01-01 No Snippets Li Y, Mo XP, Yao H, Xiong QX.
Show Full Abstract

<b>Background:</b> γδT cells are special innate lymphoid cells, which are not restricted by major histocompatibility complex (MHC). γδT cells mainly exist in human epidermis and mucosal epithelium. They can secrete a variety of cytokines and chemokines involved in immune regulation, and produce effective cytotoxic responses to cancer cells. <b>Purpose: </b> To investigate the role of γδT cells in tumor immunotherapy, to understand its anti-tumor mechanism, and to explore the synergistic effect with other treatment modalities. This therapy is expected to become an important means of cancer treatment. <b>Research Design:</b> In this review presents a comprehensive analysis of the existing literature, focusing on the efficacy of γδT cells in a variety of tumor types. <b>Results:</b> The mechanism of γδT cells recognizing tumor antigens and killing tumor was clarified. The tumor immunotherapy based on γδT cells and its application in clinical practice were summarized. <b>Conclusions:</b> γδT cells have shown promising potential in tumor immunotherapy, but the therapeutic effect varies according to the type of tumor, and some patients have poor response. There are still some challenges in the treatment of this disease, such as non-standard expansion regimens and different responses of patients, indicating that the existing treatment methods are not complete. Future research should focus on perfecting γδT cell expansion protocols, gaining a deeper understanding of its anti-tumor mechanisms, and exploring synergies with other treatment modalities. This multifaceted study will promote the development of γδT cells in the field of cancer immunotherapy.

Also flagged:psilocybinfunctional neurological disordermovement disordersinteroceptionneuropsychiatric disordersneurological diseases
Journal Article 2024-01-01 No Snippets Butler M, Bird C, Maggio C, Durden A, Modlin N, Campbell-Coker K, Edwards M, Pick S, Millman LSM, Lowery E, Bhagavan C, Kanaan R, Golder D, Mildon B, Mehta M, Rucker J, Nicholson TR.
Show Full Abstract

<h4>Background</h4>Functional neurological disorder (FND) is a common cause of neurological symptoms including seizures and movement disorders. It can be debilitating, is associated with high health and social care costs, and can have a poor prognosis. Functional magnetic resonance imaging (fMRI) has suggested FND is a multi-network disorder. Converging evidence suggests that other mechanisms including dissociation, interoception, and motor agency may be abnormal in people with FND. Psychedelics are currently under investigation for numerous neuropsychiatric disorders and have been shown to disrupt functional brain networks. Administering psychedelics to people with FND will help us to probe mechanistic theories of the disorder.<h4>Protocol</h4>In this open-label neuroimaging study, we will administer 25mg oral psilocybin with psychological support to people with chronic FND (target n = 24). Participants will undergo resting-state and task-based (Libet's clock, a measure of motor agency) fMRI sequences which will be compared in a pre-post manner. Additional mechanistic outcomes including measures of interoception (heartbeat tracking task), somatisation, illness perceptions, suggestibility, and dissociation will be collected. Data on expectancy, preparedness, and subjective experience of the psychedelic experience will also be gathered. Participants will be followed up for three months following psilocybin administration. fMRI changes in networks will be analysed using seed-based approaches, and additional exploratory analysis of resting-state imaging will take place.<h4>Discussion</h4>The study will help us to probe the mechanisms thought to potentially underpin FND. As the first modern study of psychedelics in FND, it will also help us to understand whether psychedelic administration alongside psychological support might be safe and feasible in this patient population.

Also flagged:collagenfibrilhydroxyapatitetricalciummineralproteoglycans
Journal Article 2024-01-01 No Snippets Hu L, Cheng D, Yuan X, Gao Z, Yi Q, Zhao B, Wei F, Xu J, Fan Z, Liu Y, Wang X, Cui F, Zhang C, Wang J, Wang S.
Show Full Abstract

Stem cell-mediated bio-root regeneration is an alternative tooth replacement strategy; however, physiologically functional bio-root regeneration with distinctive dentin structure remains challenging. In this study, the distinct arrangements of collagen fibril bundles were identified that account for hierarchical structural differences between dentin, cementum, and alveolar bone. Thus, an "engineered pre-dentin" was fabricated, which was a dentin hierarchical structure mimicking collagen (MC) scaffold, with well-aligned hierarchical mineralized collagen fibril bundles. The results revealed that it has a stronger effect on promoting biological root regeneration in nude mice and miniature pigs with dental pulp stem cell (DPSC) and periodontal ligament stem cell (PDLSC) sheets compared to hydroxyapatite tricalcium phosphate (HA/TCP). The success rate in the MC group was also higher than that in the HA/TCP group (67% and 33%, respectively). In conclusion, the hierarchical dentin-mimicking scaffold can enhance the regeneration of bio-roots, which provides a promising strategy for tooth regeneration.

Also flagged:retrotransposonsageinginnate immunitybindingdegradationautoimmune diseases
Journal Article 2024-01-01 No Snippets Luqman-Fatah A, Nishimori K, Amano S, Fumoto Y, Miyoshi T.
Show Full Abstract

Approximately 45% of the human genome is comprised of transposable elements (TEs), also known as mobile genetic elements. However, their biological function remains largely unknown. Among them, retrotransposons are particularly abundant, and some of the copies are still capable of mobilization within the genome through RNA intermediates. This review focuses on the life cycle of human retrotransposons and summarizes their regulatory mechanisms and impacts on cellular processes. Retrotransposons are generally epigenetically silenced in somatic cells, but are transcriptionally reactivated under certain conditions, such as tumorigenesis, development, stress, and ageing, potentially leading to genetic instability. We explored the dual nature of retrotransposons as genomic parasites and regulatory elements, focusing on their roles in genetic diversity and innate immunity. Furthermore, we discuss how host factors regulate retrotransposon RNA and cDNA intermediates through their binding, modification, and degradation. The interplay between retrotransposons and the host machinery provides insight into the complex regulation of retrotransposons and the potential for retrotransposon dysregulation to cause aberrant responses leading to inflammation and autoimmune diseases.

Also flagged:Fmr1Mecp2Ube3aneurodevelopmental conditionsintellectual disabilityID
Journal Article 2024-01-01 No Snippets Wilson E, Currie G, Macleod M, Kind P, Sena ES.
Show Full Abstract

Using genetically modified animals to model neurodevelopmental conditions helps better our understanding of biology underlying these conditions. Animal research has unique characteristics not shared with clinical research, meaning systematic review methods must be adapted to this context. We aim to evaluate the quantity, characteristics, and reporting quality of systematic reviews which synthesise research using genetically modified animals to model neurodevelopmental conditions. On 23 January 2023, we searched PubMed, Embase, and the Web of Science Core Collection to identify systematic reviews of genetic neurodevelopmental condition animal research where the modified gene was one in a list of 102 genes associated with neurodevelopmental conditions identified through large-scale exome sequencing or <i>Fmr1</i>, <i>Mecp2</i>, or <i>Ube3a</i>. Two independent reviewers screened studies based on full text and assessed the reporting quality of relevant reviews using an adapted version of the PRISMA checklist (PRISMA-Pre). Twelve review publications met our criteria. We found mixed levels of reporting: items such as identifying the publication as a systematic review in the title, search strategies, and funding sources being well reported, and others such as protocol registration and data sharing less well reported. We also identified 19 review registrations via PROSPERO, most of which remain unpublished after their anticipated end dates. Systematic reviews are limited by lack of reporting. Increased awareness of reporting guidelines may help authors increase the transparency and reproducibility, and therefore the reliability, of their systematic reviews.

TNFSF4
Also flagged:Pancreatic CancertumorimmunosuppressionPLAUSLC2A1CA9
Journal Article 2024-01-01 ✓ 1 Snippet Wu Y, Zhou J, Kou Q, Sun L, Ma Y, Yang T, Hu X.
In-Text Gene Mentions

…our model, CD276,TNFSF4, CD70, TNFSF9, CD44,…

Show Full Abstract

<h4>Objectives</h4>Pancreatic cancer presents a formidable challenge with its aggressive nature and dismal prognosis, often hampered by elusive early symptoms. The tumor microenvironment (TME) emerges as a pivotal player in pancreatic cancer progression and treatment responses, characterized notably by hypoxia and immunosuppression. In this study, we aimed to identify hypoxia-related genes and develop a prognostic model for pancreatic cancer leveraging these genes.<h4>Methods</h4>Through analysis of gene expression data from The Cancer Genome Atlas (TCGA) and subsequent GO/KEGG enrichment analysis, hypoxia-related pathways were identified. We constructed a prognostic model using lasso regression and validated it using an independent dataset.<h4>Results</h4>Our results showed that expression levels of PLAU, SLC2A1, and CA9 exhibited significant associations with prognosis in pancreatic cancer. The prognostic model, built upon these genes, displayed robust predictive accuracy and was validated in an independent dataset. Furthermore, we found a correlation between the risk score of the prognostic model and clinical parameters of pancreatic cancer patients. At the same time, we also explored the relationship between the established hypoxia-related prognostic model and the immune microenvironment at the single-cell level. RT-qPCR results showed notable differences in the expression of hypoxia pathway-related genes between normal PANC-1 and hypoxic-treated PANC-1 cells.<h4>Conclusion</h4>Our study provides insights into the role of the hypoxic microenvironment in pancreatic cancer and offers a promising prognostic tool for clinical application.

Also flagged:nucleoside triphosphateRNA helicasescancersRNA helicasehelicasenucleoside triphosphates
Journal Article 2024-01-01 No Snippets Lang N, Jagtap PKA, Hennig J.
Show Full Abstract

RNA helicases are an evolutionary conserved class of nucleoside triphosphate dependent enzymes found in all kingdoms of life. Their cellular functions range from transcription regulation up to maintaining genomic stability and viral defence. As dysregulation of RNA helicases has been shown to be involved in several cancers and various diseases, RNA helicases are potential therapeutic targets. However, for selective targeting of a specific RNA helicase, it is crucial to develop a detailed understanding about its dynamics and regulation on a molecular and structural level. Deciphering unique features of specific RNA helicases is of fundamental importance not only for future drug development but also to deepen our understanding of RNA helicase regulation and function in cellular processes. In this review, we discuss recent insights into regulation mechanisms of RNA helicases and highlight models which demonstrate the interplay between helicase structure and their functions.

Also flagged:Geriatricdementiageriatric syndromesalcoholdepressionAlzheimer disease
Journal Article 2024-01-01 No Snippets Tran LV, Nguyen TX, Nguyen TTH, Nguyen HTT, Nguyen TN, Nguyen AL, Naganathan V, Thillainadesan J, Nguyen HTT, Nguyen AT, Vu HTT.
Show Full Abstract

<h4>Introduction</h4>The identification of geriatric syndromes in people with dementia is important. The aim of the study was to assess the prevalence of geriatric syndromes among dementia outpatients.<h4>Methods</h4>A cross-sectional study was conducted enrolling outpatients with dementia aged ≥60 years old. Dementia was diagnosed by neuropsychiatrists following DSM-5 criteria. The geriatric syndromes assessed included nutritional status (Mini Nutritional Assessment Scale-Short Form), polypharmacy, comorbidities, alcohol use, depression (quality of life in Alzheimer disease), functional status (Barthel Index, Instrumental Activities of Daily Living); lower body strength (30 s stand chair test), and frailty (Timed Up and Go test ≥14 s).<h4>Results</h4>A total of 87 participants was recruited in the study (mean age: 76.8 ± 1.2 years; female: 65.5%). The median number of geriatric syndromes per participant was 5 (IQR = 2); all participants had two or more geriatric syndromes. The most common geriatric syndromes were loss of independence (96.6% impairment in >1 IADL task score and 74.7% dependency in physical function at based on Barthel Index), reduced lower body strength (86.2%), malnutrition and risk of malnutrition (78.2%), and frailty (67.8%). Current and history of smoking, drinking alcohol, using memantine therapy, malnourishment and risk of malnourishment were significantly associated with increasing severity of dementia.<h4>Conclusion</h4>The presence and coincidence of geriatric syndromes is common among outpatients with dementia. These findings have important clinical implications in terms of the assessment and service delivery for older adults in Vietnam. We are exploring ways to enhance our services to provide comprehensive, multidisciplinary approaches to screening, recognition, and treatment of geriatric syndromes in older adults with dementia.

SERPINC1
Also flagged:ThrombocytopeniaTrastuzumabPertuzumabHER2colorectal cancerantibody
Journal Article 2024-01-01 ✓ 1 Snippet Okemoto D, Yamaguchi T, Yamaguchi M, Kadono T, Yukami H, Fakhrejahani E, Nishikawa H.
In-Text Gene Mentions

…PT, APTT, andATIIIlevels were within…

Show Full Abstract

<h4>Introduction</h4>In recent years, trastuzumab and pertuzumab have been used in treatment protocols for patients with HER2-positive colorectal cancer. Although severe thrombocytopenia is an uncommon side effect of anti-HER2 antibody therapy, we present the first patient with HER2-positive metastatic rectal cancer who developed significant thrombocytopenia after trastuzumab and pertuzumab administration.<h4>Case presentation</h4>The condition was identified as drug-induced immune thrombocytopenia associated with trastuzumab and pertuzumab. Despite the discontinuation of anti-HER2 treatment and administration of corticosteroids, and in addition to frequent platelet transfusions, a low platelet count persisted. Consequently, we determined that the patient presented with a condition similar to immune thrombocytopenic purpura (ITP) and selected a treatment approach consisting of eltrombopag, a thrombopoietin receptor agonist. Subsequently, the patient's platelet count did not decrease further but rather improved.<h4>Conclusion</h4>Although uncommon, anti-HER2 antibodies can cause severe thrombocytopenia. Furthermore, if thrombocytopenia persists after treatment discontinuation and the administration of corticosteroids, exploring treatment options aligned with managing ITP is essential.

SERPINC1
Also flagged:purpura fulminansrituximabtacrolimuszoonotic infectionsbacteremiaInfection
Journal Article 2024-01-01 ✓ 1 Snippet Varadarajan I, Pham N, Ballen K.
In-Text Gene Mentions

…C activity andATIIIwere reduced at…

Show Full Abstract

<h4>Introduction</h4>Purpura fulminans is a rare but fatal manifestation of <i>Capnocytophaga canimorsus</i> bacteremia that can present in immunocompromised hosts. This can have a profound impact on patients, including recipients of allogeneic hematopoietic stem cell transplant. Despite aggressive therapy, mortality can be as high as 60% and most patients require amputation of multiple extremities.<h4>Case presentation</h4>We present a 31-year-old woman s/p myeloablative allogeneic transplant, presenting with purpura fulminans and septic shock. She had been on Immunosuppressive therapy with rituximab and tacrolimus. Despite aggressive antibiotic coverage and supportive therapy, although her shock was resuscitated, she had to undergo bilateral below-knee amputations.<h4>Discussion</h4>We attempt to highlight the clinical presentation, pathophysiology and potential therapeutic options for immunocompromised patients presenting with septic shock from <i>C. canimorsus</i>. The importance of pre-transplant counselling on handling and adoption of new pets to prevent zoonotic infections is also discussed. Early recognition and initiation of antibiotics play a crucial role to reduce mortality in patients receiving HSCT.

Also flagged:sleepanxietydepressionDisorders offunctional dyspepsiaFD
Journal Article 2024-01-01 No Snippets Shah A, Lee YY, Suzuki H, Tan-Loh J, Siah KTH, Gwee KA, Fairlie T, Talley NJ, Ghoshal UC, Wang YP, Kim YS, Holtmann G.
Show Full Abstract

The International Rome Committee defines Disorders of Gut-Brain Interactions (DGBI) based upon distinct combinations of chronic and/or recurrent unexplained gastrointestinal symptoms. Yet patients often experience overlapping DGBI. Patients with DGBI frequently also suffer from extraintestinal symptoms, including fatigue, sleep disturbances, anxiety, and depression. Patients with overlapping DGBI typically experience more severe GI symptoms and increased psychosocial burden. Concerning the pathophysiology, DGBI are associated with disruptions in gut motility, function of the brain and enteric neurons, immune function, and genetic markers, with recent findings revealing gut microbiome alterations linked to these mechanisms of DGBI. Emerging evidence summarized in this review suggests that the microbiome influences various established disease mechanisms of different DGBI groups. Overall, changes in the gastrointestinal microbiome do not seem to be linked to a specific DGBI subgroup but may play a key role in the manifestation of different DGBI and, subsequently, overlap of DGBI. Understanding these shared mechanisms and the role of the gastrointestinal microbiome, particularly for overlapping DGBI, might aid in developing more precise diagnostic criteria and treatment strategies while developing personalized interventions that target specific mechanisms to improve patient outcomes.

Also flagged:Coronary artery diseasesCoronary Artery Diseasedeathcardiovascular diseasegene expressioncell division
Journal Article 2024-01-01 No Snippets Azar Bahadori R, Shabani D, Arjmandrad E, Kazerani M, Rohani M, Ramazani Karim Z, Ali-Kheyl M, Nosratabadi R, Pourghadamyari H, Zaemi MA.
Show Full Abstract

Coronary artery diseases (CAD) represent a significant global health concern and are recognized as a primary contributor to mortality on a worldwide scale. Early diagnosis of CAD is one of promising goal to manage this disorder. Recent investigations have highlighted the pivotal involvement of microRNAs (miRNAs) in diverse health conditions, notably CAD. The principal objective of this investigation was to identify appropriate miRNAs that could be employed for the early detection of CAD<b>.</b> In the present study, we analyzed dataset of CAD (GSE113079) and 100 differentially expressed mRNAs (DEmRNAs) were detected. The miRNAs that have a significant interaction with DEmRNAs were chosen. By computational prediction method, 5 miRNAs (miR-106b-5p, miR-20a-3p, miR-17-3p, miR-146a-5p, and miR-155-3p) were selected. Finally, we assessed the anticipated expression levels of microRNAs in CAD patients and healthy control groups. Our findings revealed a statistically significant elevation solely in the expression level of miR-106b-5p within the CAD group when compared to the control group (p>0.001). Our study demonstrated an elevation in the expression of miR-106b-5p in individuals diagnosed with CAD. This microRNA may be used as a diagnostic biomarker in patients with CAD. However, further investigations are needed to confirm these results.

Also flagged:melanomacancerskin cancermetastatic diseaseCutaneous melanomaBRAFV600E
Journal Article 2024-01-01 No Snippets Beatriz Cristina Biz T, Carolina de Sousa CS, Frank John S, Miriam Galvonas J.
Show Full Abstract

Long non-coding RNAs (lncRNAs) have received growing attention due to their diverse regulatory roles in cancer, including in melanoma, an aggressive type of skin cancer. The plasticity and phenotypic adaptability of melanoma cells are crucial factors contributing to therapeutic resistance. The identification of molecules playing key roles in melanoma cell plasticity could unravel novel and more effective therapeutic targets. This review presents current concepts of melanoma cell plasticity, illustrating its fluidity and dismissing the outdated notion of epithelial-mesenchymal-like transition as a simplistic binary process. Emphasis is placed on the pivotal role of lncRNAs in orchestrating cell plasticity, employing various mechanisms recently elucidated and unveiling their potential as promising targets for novel therapeutic strategies. Insights into the molecular mechanisms coordinated by lncRNAs in melanoma pave the way for the development of RNA-based therapies, holding great promise for enhancing treatment outcomes and offering a glimpse into a more effective approach to melanoma treatment.

Also flagged:type III secretion16S ribosomal ribonucleic acidAMRvirulencefimHprophages
Journal Article 2024-01-01 No Snippets Binsker U, Deneke C, Hamid HM, Gadicherla AK, Göhler A, Käsbohrer A, Hammerl JA.
Show Full Abstract

Anthropogenic activities enhance the interconnection of human, animal, and environmental habitats and drive the evolution and inter-niche transmission of bacteria. Clear identification of emerging bacteria and pathogen control is therefore a public health priority. In 2015, the novel <i>Escherichia</i> species <i>Escherichia marmotae</i> was assigned, but due to the lack of appropriate detection and typing technologies, the One Health impact of this species is still being unraveled. <i>E. marmotae</i> represents a missing link in the impact of <i>Escherichia</i> spp. Here, we report 25 <i>E. marmotae</i> identified by next-generation sequencing that were previously phenotypically characterized as <i>Escherichia coli</i> during national zoonosis monitoring of food-producing animals. Applying fastANI to 153 738 published <i>Escherichia</i> spp. genome assemblies, we identified further 124 <i>E. marmotae</i>, originally classified as <i>E. coli</i>. Phylogenomics of all 149 isolates reveals an undefined population structure that is independent of the ecological niche. We highlight the phenotypic, genomic, and plasmid diversity of <i>E. marmotae</i> and provide evidence for gene flow across the species. The latter is illustrated by the acquisition of antibiotic resistance plasmids and pathogenicity islands, such as the type III secretion system. Thus, our comprehensive genomic overview of an emerging potential opportunistic pathogen underlines the importance of improved detection and characterization.

HTT
Also flagged:Isorhamnetinpulmonary vascular diseaseflavonoidsphosphorylationc-Src tyrosine kinasemonocrotaline
Journal Article 2024-01-01 ✓ 1 Snippet Chen Y, Ma P, Bo L, Lv Y, Zhou W, Zhou R.
In-Text Gene Mentions

…ydroxytryptamine transporter (5-HTT) antibody (1:1000), Prolifera…

Show Full Abstract

<h4>Objectives</h4>Pulmonary arterial hypertension (PAH) is a malignant pulmonary vascular disease with high mortality. Isorhamnetin (ISO), one of the main natural flavonoids extracted from sea buckthorn, has pharmacological effects such as anti-inflammatory, anti-proliferative and antioxidant. This study aimed to investigate the protective effect of ISO on PAH and its relationship with the phosphorylation of the c-Src tyrosine kinase (p-c-src)/NOX1 signaling pathway.<h4>Materials and methods</h4>Ninety-five rats were randomly divided into five groups. The normal group received only a subcutaneous injection of saline, while the other groups received a subcutaneous injection of monocrotaline(MCT) (60 mg/kg) to establish a PAH model. The treatment group received ISO (50, 100, 150 mg/kg/d) treatment for 21 days, and after 21 days, all rat lung tissues were separated.<h4>Results</h4>The results showed that ISO could significantly improve the hemodynamics of MCT-induced PAH rats, such as mean pulmonary artery pressure (mPAP) and right ventricular systolic pressure (RVSP), and had inhibitory effects on right ventricular hypertrophy in PAH rats, and on pulmonary vascular remodeling in PAH rats. In addition, ISO can reduce the content of 5-hydroxytryptamine (5-HT) in PAH rats, increase the expression of Nrf2 protein in the lung tissue of PAH rats, activate the antioxidant system, enhance the activity of SOD in lung tissue of PAH rats, and inhibit NOX1, 5-HTT, p-c-src and Proliferating Cell Nuclear Antigen(PCNA) protein expression, and decrease MDA content.<h4>Conclusion</h4>Our research confirmed the therapeutic effect of ISO on MCT-induced PAH rats, which may be related to regulating the p-c-src/NOX1 signaling pathway.

MLLT10ARFGEF2
Also flagged:canceradenocarcinomacancerstumourproto-oncogenesALK
Journal Article 2024-01-01 ✓ 4 Snippets Zong L, Zhu Y, Jiang Y, Xia Y, Liu Q, Wang J, Gao S, Luo B, Yuan Y, Zhou J, Jiang S.
In-Text Gene Mentions

…the positive targets, PICALM-MLLT10, would be…

…tools, GAS6-RASA3 andARFGEF2-SULF2 , the fusion…

…additional isoform forARFGEF2-SULF2 , and the…

…not only identifiedARFGEF2-SULF2 but also rectified…

Show Full Abstract

Next-generation sequencing has revolutionized cancer genomics by enabling high-throughput mutation screening yet detecting fusion genes reliably remains challenging. Long-read sequencing offers potential for accurate fusion transcript identification, though challenges persist. In this study, we present an optimized workflow using nanopore sequencing technology to precisely identify fusion transcripts. Our approach encompasses a tailored library preparation protocol, data processing, and fusion gene analysis pipeline. We evaluated the performance using Universal Human Reference RNA and human adenocarcinoma cell lines. Our optimized nanopore sequencing workflow generated high-quality full-length transcriptome data characterized by an extended length distribution and comprehensive transcript coverage. Validation experiments confirmed novel fusion events with potential clinical relevance. Our protocol aims to mitigate biases and enhance accuracy, facilitating increased adoption in clinical diagnostics. Continued advancements in long-read sequencing promise deeper insights into fusion gene biology and improved cancer diagnostics.

Also flagged:Sickle Cell DiseaseMalariahuman immunodeficiency virusHIV) infectionsickle-cell anaemiasalmonellosis
Journal Article 2024-01-01 No Snippets Kavai SM, Mbae C, Wairimu C, Ngetich R, Wakio Z, Onsaŕe R, Kariuki S.
Show Full Abstract

<h4>Background</h4>Invasive non-typhoidal <i>Salmonella</i> (iNTS) disease continues to be a major public health problem, especially in sub-Saharan Africa (SSA), where incidence rates are 227 cases [range 152-341] per 100,000 populations. Populations at risk of iNTS include adults with human immunodeficiency virus (HIV) infection, malnourished children, and those with recent malaria or sickle-cell anaemia (SCA). In Kenya, iNTS disease is particularly a major challenge in poor informal settlements, with infants and young children less than 5 years of age being the most affected. Our study aimed to investigate the association between sickle cell disease, malaria, and HIV in multi-drug-resistant invasive non-typhoidal <i>Salmonella</i> from outpatient and hospitalised children ≤16 years in informal settlements in Nairobi County, Kenya.<h4>Methods</h4>This study recruited 16,679 children aged ≤16 years who presented with salmonellosis symptoms for a period of 6 years (2013-2018). The patients were age-matched with controls (asymptomatic individuals). The study was conducted at 3 outpatient sites and 1 inpatient site; the outpatient sites were all located within the Mukuru informal settlement. The inpatient site was Mbagathi district hospital, which serves patients residing in Kibera informal settlement. Blood and stool samples from children with fever ≥38°C and/or diarrhea and stool samples alone from controls were collected for processing for the presence of iNTS using basic microbiology procedures including culture, serology, and Kirby Bauer disc diffusion for sensitivity testing. Dry blood spots were also taken and processed for sickle cell protein markers using high-performance liquid chromatography (HPLC). HIV and malaria tests were also conducted using rapid tests, respectively.<h4>Results</h4>From the total of 22,246 blood and stool samples tested, 741 (3.3%) tested positive for <i>Salmonella</i> species. A total of 338 (45.6%) iNTS were isolated across all 4 sites; these consisted of 158 (21.3%) <i>Salmonella</i> Enteritidis and 180 (24.3%) <i>Salmonella</i> Typhimurium. The most common resistance phenotype was against ampicillin, chloramphenicol, and sulfamethoxazole trimethoprim. A total of 118 (34.9%) isolates were multidrug-resistant (MDR). Out of 2,684 dry blood samples subjected to HPLC for investigation of sickle cell disease traits, 1820 (67.8%) had normal haemoglobin (Hb AA/Hb AF); 162/2684 (6%) tested positive for sickle cell traits (Hb AS/Hb AFS). Some patients positive for iNTS were also found to have other co-morbidities; 4 (0.1%) tested positive for sickle cell disease (Hb FS), malaria, and HIV 8 (2.4%) and 5 (1.5%), respectively.<h4>Conclusion</h4>The high prevalence of MDR iNTS isolates and emerging resistance to third-generation cephalosporins is of great concern, as they are the recommended drugs for the management of iNTS in our settings. Sickle cell disease, malaria, and HIV were all not major factors associated with iNTS disease among children in Mukuru and Kibera informal settlements.

Also flagged:neurodevelopmental disordersMED13L syndromeneurodevelopmental syndromemultisystem disorderdevelopmental delayintellectual disability
Journal Article 2024-01-01 No Snippets Heilmann R, Pfalzer A, Bichell TJ, Terala A, Campbell A, Taatjes D, Ghoumid J, Grueter C, Bain J, Strich R, Dias V, Sokorai K, Seaver N, Sexton K, Boychuck K.
Show Full Abstract

A strategic research plan (SRP) serves as a compass for the patient advocacy organizations driving the therapeutic options for their rare disorder. The MED13L Foundation commissioned the SRP in 2022 through COMBINEDBrain, a consortium of patient advocacy organizations of rare neurodevelopmental disorders, working toward clinical trial readiness. The MED13L Foundation SRP is an objective evaluation of MED13L literature including clinical and basic science knowledge interwoven with an assessment of preclinical trial readiness tools necessary for achieving therapeutic interventions. Clinical evaluation is conducted through a review of the literature documenting symptoms and variant information for each individual with MED13L syndrome. Data is collated and presented as a summary, providing any unique genotype-phenotype, as applicable. Scientific literature is reviewed in the same manner, identifying areas of opportunity to expand knowledge of MED13L syndrome. Researchers and clinicians responsible for growing the understanding of MED13L syndrome are interviewed and information is shared to create an open and collaborative network. Preclinical trial readiness tools are largely framed through Food and Drug Administration guidelines for the development of therapeutics from bench to bedside. Finally, the Foundation infrastructure and community engagement are assessed providing areas of strengths and opportunities to elevate the bond formed to drive patient-centered research forward. Completed, this SRP becomes a living resource for the MED13L Foundation to set priorities, share with researchers and clinicians, and provide direction to reach their organizational goals, including therapies for their community affected by MED13L syndrome.

SERPINC1
Also flagged:agingextracellularvesiclescollagensfibronectinYWHAE
Journal Article 2024-01-01 ✓ 3 Snippets Schmidt JR, Adamowicz K, Arend L, Lehmann J, List M, Poh PS, Baumbach J, Kalkhof S, Laske T.
In-Text Gene Mentions

…HTRA1, SERPINA1, andSERPINC1), but also apoptotic…

…inhibitor activity (SERPINA1,SERPINC1, and SERPINH1) were…

…AHSG, KNG, andSERPINC1are vital to…

Show Full Abstract

Non-healing bone defects are a pressing public health concern accounting for one main cause for decreased life expectancy and quality. An aging population accompanied with increasing incidence of comorbidities, foreshadows a worsening of this socio-economic problem. Conventional treatments for non-healing bone defects prove ineffective for 5%-10% of fractures. Those challenges not only increase the patient's burden but also complicate medical intervention, underscoring the need for more effective treatment strategies and identification of patients at risk before treatment selection. To address this, our proteomic meta-analysis aims to identify universally affected proteins and functions in the context of bone regeneration that can be utilized as novel bioactive biomaterial functionalizations, drug targets or therapeutics as well as analytical endpoints, or biomarkers in implant design and testing, respectively. We compiled 29 proteomic studies covering cellular models, extracellular vesicles, extracellular matrix, bone tissue, and liquid-biopsies to address different tissue hierarchies and species. An innovative, integrated framework consisting of data harmonization, candidate protein selection, network construction, and functional enrichment as well as drug repurposing and protein scoring metrics was developed. To make this framework widely applicable to other research questions, we have published a detailed tutorial of our meta-analysis process. We identified 51 proteins that are potentially important for bone healing. This includes well-known ECM components such as collagens, fibronectin and periostin, and proteins less explored in bone biology like YWHAE, HSPG2, CCN1, HTRA1, IGFBP7, LGALS1, TGFBI, C3, SERPINA1, and ANXA1 that might be utilized in future bone biomaterial development. Furthermore, we discovered the compounds trifluoperazine, phenethyl isothiocyanate, quercetin, and artenimol, which target key proteins such as S100A4, YWHAZ, MMP2, and TPM4 providing the option to manipulate undesired processes in bone regeneration. This may open new ways for treatment options to face the increasing socio-economic pressure of non-healing bone defects.

CACNA1E
Also flagged:CalciumEpilepsyVoltage-gated calcium channelsneurological disordershigh-voltage-activated calcium channelsCACNA1C
Journal Article 2024-01-01 ✓ 1 Snippet Rossignol E.
In-Text Gene Mentions

…(CACNA1A), and CaV2.3 (CACNA1E)-associated disorders.…

Show Full Abstract

Voltage-gated calcium channels support an array of fundamental biological processes in various systems. In the brain, they determine neuronal responses to stimulation, dendritic properties, neuronal firing mode, and synaptic release. They also regulate multiple critical developmental processes, including neuronal proliferation, migration, connectivity, and structural activity-dependent plasticity. For these reasons, mutations in voltage-gated calcium channels result in a variety of neurological disorders displaying epilepsy as a core feature. This chapter summarizes the molecular, cellular, and network mechanisms by which mutations in high-voltage-activated calcium channels result in epilepsy, with a particular focus on CaV1.2 (CACNA1C), CaV1.3 (CACNA1D), CaV2.1 (CACNA1A), and CaV2.3 (CACNA1E)-associated disorders.

Also flagged:Venous Thromboembolismpathogenesisobesitystatincanceracute infections
Journal Article 2024-01-01 No Snippets He C, Chu J, Li Y, Dang Y, Xue K, Cai C.
Show Full Abstract

This research aims to reassess women's risk of venous thromboembolism (VTE) events. We conducted an in-depth analysis of the environmental risk factors associated with VTE and their interactions with gender while also exploring the genetic underpinnings of the disease. VTE is identified as a multifactorial condition influenced by a combination of genetic, non-predisposing, and predisposing environmental factors. We further investigated the genetic basis of VTE, focusing on the identification and analysis of risk loci, as well as gene interaction networks and genetic analyses, which offer significant insights into the pathogenesis of VTE. Recognizing the critical role of gender in assessing VTE risk and developing prevention strategies, this research underscores the necessity of adopting an integrated perspective that accounts for individual vulnerabilities at both genetic and environmental levels to formulate effective preventive measures.

Also flagged:kidney failurediabetesepigeneticextracellulartransforming growth factor-βDiabetic Kidney Disease
Journal Article 2024-01-01 No Snippets Liebisch M, Wolf G.
Show Full Abstract

<h4>Background</h4>Diabetic kidney disease (DKD) is a global health issue. Epigenetic changes play an important role in the pathogenesis of this disease.<h4>Summary</h4>DKD is currently the leading cause of kidney failure worldwide. Although much is known about the pathophysiology of DKD, the research field of epigenetics is relatively new. Several recent studies have demonstrated that diabetes-induced dysregulation of epigenetic mechanisms alters the expression of pathological genes in kidney cells. If these changes persist for a long time, the so-called "metabolic memory" could be established. In this review, we highlight diabetes-induced epigenetic modifications associated with DKD. While there is a substantial amount of literature on epigenetic changes, only a few studies describe the underlying molecular mechanisms. Detailed analyses have shown that epigenetic changes play an important role in known pathological features of DKD, such as podocyte injury, fibrosis, accumulation of extracellular matrix, or oxidative injury, all of which contribute to the pathophysiology of disease. The transforming growth factor-β plays a key role as it is involved in all-mentioned epigenetic types of regulation.<h4>Key messages</h4>Epigenetic is crucial for the development and progression of DKD, but the detailed molecular mechanisms have to be further analyzed more in detail.

Also flagged:isoflavoneAktmTORestrogentriacylglycerolsfatty acids
Journal Article 2024-01-01 No Snippets Shao Y, Huang J, Wei M, Fan L, Shi H, Shi H.
Show Full Abstract

Soybean isoflavone (SIF) in soybeans are natural phytoestrogens, which is functioned as an estrogen agonistic or antagonistic. SIF regulates the capacity of animals to synthesize triacylglycerols by directly utilizing long-chain fatty acids. However, few studies have focused on its regulatory lipid metabolism in lactating dairy goats. The objective of this study was to investigate the influence of SIF on milk yield and composition using Saanen dairy goats as a model, employing both in vivo and in vitro approaches. In the in vivo phase, a total of 20 goats were randomly divided into 2 groups: the control group fed a basal diet, and the experimental group fed a basal diet supplemented with SIF at a dosage of 100 mg/d. The results underscored a significant elevation in serum estrogen and prolactin levels in the SIF-supplemented group (P < 0.05). Notably, SIF supplementation also displayed a higher milk fat percentage (P = 0.03). Transitioning to in vitro experimentation, the addition of SIF (75 µM) to goat mammary epithelial cells exhibited a pronounced effect on cell proliferation. It spurred cell proliferation and led to an increase in triacylglycerol levels (P < 0.05). Consistently, SIF showcased an enhancement in the expression of key genes associated with milk fat de novo synthesis. SIF demonstrated a rescuing effect on the suppressive impact of MK2206 on Akt protein phosphorylation. Importantly, the study observed that the knockdown of estrogen receptor alpha (ERα) expression completely counteracted the effect of SIF on lipid droplet accumulation. Collectively, the current study establishes the critical role of SIF in process of fatty acid de novo in the goat mammary gland. This regulation is notably mediated through the ERα-Akt axis, thus enriching our understanding of this intricate biological process. This research sheds light on the potential benefits of SIF supplementation in dairy goat farming, ultimately contributing to improved milk production and quality.

PRDX6
Also flagged:diarrheal diseasePolyaminesspermidinedeoxyhypusine synthaseDHPSconjugation
Journal Article 2024-01-01 ✓ 2 Snippets Gobert AP, Hawkins CV, Williams KJ, Snyder LA, Barry DP, Asim M, Allaman MM, McNamara KM, Delgado AG, Wang Y, Zhao S, Rose KL, Piazuelo MB, Wilson KT.
In-Text Gene Mentions

…the peroxiredoxins 6 (PRDX6), which are involved…

…of peroxides (THIO,PRDX6) and reactive aldehydes…

Show Full Abstract

Enteropathogenic <i>Escherichia coli</i> (EPEC) is a bacterium that causes attaching/effacing (A/E) lesions and serious diarrheal disease, a major health issue in developing countries. EPEC pathogenicity results from the effect of virulence factors and dysregulation of host responses. Polyamines, including spermidine, play a major role in intestinal homeostasis. Spermidine is the substrate for deoxyhypusine synthase (DHPS), which catalyzes the conjugation of the amino acid hypusine to eukaryotic translation initiation factor 5A (EIF5A); hypusinated EIF5A (EIF5A<sup>Hyp</sup>) binds specific mRNAs and initiates translation. Our aim was to determine the role of hypusination during infection with A/E pathogens. We found that DHPS and EIF5A<sup>Hyp</sup> levels are induced in i) a colonic epithelial cell line and human-derived colon organoids infected with EPEC, and ii) the colon of mice infected with <i>Citrobacter rodentium</i>, the rodent equivalent of EPEC. Specific deletion of <i>Dhps</i> in intestinal epithelial cells worsened clinical, histological, and pro-inflammatory parameters in <i>C. rodentium</i>-infected mice. These animals also exhibited an exacerbated pathogenic transcriptome in their colon. Furthermore, infected mice with specific <i>Dhps</i> deletion exhibited reduced levels of proteins involved in detoxification of tissue-damaging reactive aldehydes and consequently increased electrophile adducts in the colon. Thus, hypusination in intestinal epithelial cells protects from infectious colitis mediated by A/E pathogens.

HFE
Also flagged:Hepatocellular Carcinomahepatitis Bhepatitis CalcoholNASHalcoholism
Journal Article 2024-01-01 ✓ 1 Snippet Long J, Cui K, Wang D, Qin S, Li Z.
In-Text Gene Mentions

…aflatoxin, parasites, orhemochromatosis.…

Show Full Abstract

<h4>Purpose</h4>The incidence and mortality of hepatocellular carcinoma (HCC) and its underlying etiologies in China are still unclear. Therefore, this study used the Global Burden of Disease (GBD) 2021 to evaluate the incidence and mortality of HCC and its underlying etiologies in China.<h4>Methods</h4>We extracted the incident cases, incidence rate, deaths, and mortality rate of HCC and its underlying etiologies in China in 1990 and 2021 from the GBD database. In addition, we used joinpoint regression analysis to assess the trend of the incidence rate and mortality rate of HCC and its underlying etiologies in China from 1990 to 2021.<h4>Results</h4>The incidence of HCC in China climbed from 96,434.35 in 1990 to 196,636.59 in 2021, while the number of deaths rose from 94,937.12 in 1990 to 172,068.40 in 2021. From 1990 to 2021, the age-standardized incidence rate (ASIR) and age-standardized mortality rate (ASMR) of HCC in China decreased by 0.31 (95% CI: 0.23, 0.39) and 0.79 (95% CI: 0.28, 1.30), respectively. ASIR demonstrated a decreasing trend in HCC caused by different etiologies, such as HCC due to hepatitis B (HCCDHB), HCC due to hepatitis C (HCCDHC), and HCC due to other causes (HCCDOC), but an increasing trend in HCC due to alcohol use (HCCDAU) and HCC due to NASH (HCCDNASH). Between 1990 and 2021, ASMR showed a downward trend in HCCDHB, HCCDHC, and HCCDOC, while the trend in HCCDAU and HCCDNASH was not significant.<h4>Conclusions</h4>In the past 30 years, although the overall incidence rate and mortality of HCC in China have declined, the proportion of HCCDAU and HCCDNASH has increased due to the increasingly serious problems of alcoholism and obesity. Therefore, interventions are needed to address the issues of alcohol consumption and obesity in order to control the incidence of HCCDAU and HCCDNASH.

Also flagged:PRMT1cGASSTINGtumorinnate immunitymethylation
Journal Article 2024-01-01 No Snippets Huang D, Rezaeian AH, Wang J, Qi Y, Chen H, Inuzuka H, Wei W.
Show Full Abstract

Activating innate immune signaling in tumor cells to enhance anti-tumor immunity and increase T cell-mediated killing is the core objective of tumor immunotherapy. PRMT1, one of the most crucial PRMTs, plays a critical role in tumor progression and innate immunity. Recent research revealed that PRMT1 can inhibit the enzymatic activity of cGAS in part through PRMT1-mediated Arg methylation, thereby suppressing the anti-tumor immune response of cells. As such, inhibiting or knocking down PRMT1 can synergistically enhance the efficacy of anti-PD-1 immunotherapy by activating the cGAS-STING signaling pathway. Here, we provide a comprehensive description of the two key signaling components, PRMT1 and cGAS, in the PRMT1-cGAS-STING signaling pathway for therapeutic intervention to augment anti-tumor immunity. By understanding the specific physiological functions and regulatory mechanisms of PRMT1, as well as the extensive post-translational modifications (PTMs) of cGAS, we have identified several compounds and drugs that can directly target PRMT1 or cGAS, and/or indirectly target PRMT1 upstream regulators or cGAS-post-translational modifying enzymes as potential means to activate the cGAS-STING signaling pathway. However, further investigation is needed on the efficacy of combining this pathway activation with anti-PD1 therapy. This review suggests that targeting the PRMT1-cGAS-STING pathway with immune checkpoint inhibitors is likely a promising approach in tumor immunotherapy.

Also flagged:tumorsestrogen receptorERprogesterone receptorPRhuman epidermal growth factor receptor 2
Journal Article 2024-01-01 No Snippets Sankaranarayanan P, G DJD, Pa A, Manikandan M, Ghosh A.
Show Full Abstract

<h4>Background</h4>Triple-negative breast cancers (TNBC) are defined as tumors that lack the expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2). It exhibits unique clinical and pathological features, demonstrates high aggressiveness, and has a relatively poor prognosis and clinical outcome.<h4>Objective</h4>To identify a novel drug target protein against TNBC and potential phytochemical lead molecules against the identified target.<h4>Methods</h4>In this study, we retrieved TNBC samples from NGS and microarray datasets in the Gene Expression Omnibus database. We employed a combination of differential gene expression studies, protein-protein interaction analysis, and network topology investigation to identify the target protein. Additionally, the molecular docking and molecular dynamics (MD) simulation studies followed by Molecular Mechanics with Generalised Born Surface Area salvation was used to identify potential lead molecule.<h4>Result</h4>The upregulated genes with LogFC > 1.25 and P-value < 0.05 from the TNBC gene expression dataset were identified. Androgen receptor (AR) was found to be an appropriate hub target in the protein-protein interaction network. Phytochemicals that inhibit breast cancer target were retrieved from the PubChem database and virtual screening was performed using PyRx against the AR protein. Thereby, the AR was found to be the target protein and 2-hydroxynaringenin was discovered to be a possible phytochemical lead molecule for combating TNBC. Moreover, the AR and the 2-hydroxynaringenin complex showed structural stability and higher binding affinity through molecular dynamics and MM-GBSA studies.<h4>Conclusion</h4>AR was identified as a hub protein that is highly expressed in breast cancer and 2-hydroxynaringenin efficacy of counter TNBC requires further investigation both in vitro and in vivo.

Also flagged:HepcidinIronObesitymetabolismSTAT3IL-6
Journal Article 2024-01-01 No Snippets Siemonsma M, Cerami C, Darboe B, Verhoef H, Prentice AM, Jobe M.
Show Full Abstract

<h4>Aims</h4>Obesity, type 2 diabetes (T2D), and chronic inflammation are associated with disturbances in iron metabolism. Hepcidin is hypothesized to play a role in these alterations owing to its strong association with inflammation via the JAK-STAT3 pathway. The current study investigated the differences between inflammatory markers and iron indices and their association with hepcidin in lean women, women with obesity, and women with obesity and T2D (obesity-T2D) in The Gambia.<h4>Materials and methods</h4>In a cross-sectional study design, fasted blood samples were collected from three groups of women: lean women (n=42, geometric mean (GM) body mass index (BMI)=20.9 kg/m <sup>2</sup>), women with obesity (n=48, GM BMI=33.1 kg/m <sup>2</sup>) and women with obesity-T2D (n=30, GM BMI=34.5 kg/m <sup>2</sup>). Markers of inflammation (IL-6 and CRP) and iron metabolism [hepcidin, iron, ferritin, soluble transferrin receptor (sTfR), transferrin, transferrin saturation, and unsaturated iron-binding capacity (UIBC)] were compared using linear regression models. Simple regression analyses were performed to assess the association between hepcidin levels and respective markers.<h4>Results</h4>Women with obesity and obesity-T2D showed elevated levels of inflammatory markers. There was no evidence that markers of iron metabolism differed between lean women and obese women, but women with obesity-T2D had higher transferrin saturation, higher serum iron concentration, and lower UIBC. Serum hepcidin concentrations were similar in all the groups. Hepcidin was not associated with markers of inflammation but was strongly associated with all other iron indices (all P<0.002).<h4>Conclusion</h4>Contrary to our original hypothesis, hepcidin was not associated with markers of inflammation in the three groups of Gambian women, despite the presence of chronic inflammation in women with obesity and obesity-T2D.

HFE
Also flagged:liver diseasecirrhosishepatocellular carcinomaliverdiseasesynthesis
Journal Article 2024-01-01 ✓ 1 Snippet Yeoman AD, Ahmed H, Akbari A, Cullen K, Davies A, Fitzsimmons D, Gao J, Hood K, Nollett C, Vincent A, Williams W, Pembroke T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>The incidence and severity of liver disease in the United Kingdom have increased over the last 20 years. Many patients present with advanced disease with limited treatment options and subsequently high morbidity and mortality. There was also a significant correlation with deprivation. Strategies that support the earlier detection of liver disease are paramount to reverse this trend. Despite significant progress in terms of novel pathways, the optimal strategy for early detection of liver disease remains unknown. Novel ways to tackle the deprivation gradient and reduce health inequalities are urgently required.<h4>Methods</h4>Clinical research has an enormous role to play both in terms of identifying the true scale of this challenge, where current gaps exist, and to identify the optimal early detection strategies and their implementation. We therefore established Liver Research Cymru (LRC) a multi-disciplinary collaboration that seeks to maximise the benefits from our existing data sources and clinical networks and increase the output of hepatology research in Wales.<h4>Results</h4>LRC has developed the first Wales wide research collaborative. We have successfully collaborated with the Secure Anonymised Information Linkage (SAIL) data resource to develop a greater understanding of liver disease burdens through comprehensive analysis of primary and secondary care data. We are now using this information to evaluate the effectiveness of local early detection pathways and to identify the scale of delays in diagnosis with a view to addressing this important care gap.<h4>Conclusion</h4>LRC has successfully brought together patients. Hepatologists and population/primary care academics to better understand current discrepancies in the early diagnosis of liver disease in Wales. In addition, it has laid a foundation for future research work based both on our preliminary findings and allowed us to collaborate with other more established liver disease research groups.

Also flagged:depressionanxietysleepruminationneuroticismeating disorders
Journal Article 2024-01-01 No Snippets Tariq A, Gray E, M Gregory A, W Y Chan S.
Show Full Abstract

<h4>Background</h4>Adolescent depression and anxiety are highly prevalent, recurrent, and disabling mental health conditions. Current treatment outcomes are suboptimal, often leaving young people with residual symptoms and high relapse rates. To inform future development of more effective preventative strategies, the Emotional Vulnerability in Adolescents (EVA) study aimed to identify vulnerability markers for adolescent depression and anxiety. Specifically, it examined the associations between mental health outcomes and potentially modifiable biopsychosocial factors. The present report provides an overview of the study design and methodology, summarised the demographic, clinical, and mechanistic characteristics of the sample, and examined individual differences by age, gender, and personal and familial history of mental health at baseline.<h4>Methods</h4>Data collection was conducted across three-time points (baseline, 6-months and a 60-month follow-up). A total of 425 adolescents (60.5% female) aged 12 -18 years (Mean = 15.06, SD = 1.75) were recruited at baseline. A comprehensive battery of measures to assess a range of bio-psycho-social factors was employed.<h4>Results</h4>We replicated previous findings in suggesting that females and those with a personal or familial history of mental health difficulties have higher levels of depression and anxiety and lower levels of well-being. These vulnerable sub-groups were also found to differ from their counterparts in a number of biopsychosocial factors; specifically they showed poorer sleep quality, lower levels of resilience, and higher levels of rumination, stress, neuroticism, external shame, bullying experiences, neural-cognitive biases, and dysfunctional attitudes. Furthermore, symptoms of depression and anxiety increased with age and peaked around age 15; age was also associated with an increased risk for eating disorders.<h4>Conclusions</h4>The present findings highlight the importance of considering individual differences in developing future preventative and intervention strategies by targeting underlying mechanisms that are more specifically prominent in each individual subgroup of the population.

HFE
Also flagged:Hepatic Fibrosistype 2 diabetesMetabolic dysfunction-associated liver diseasenon-alcoholic fatty liver diseaseNAFLDsteatosis
Journal Article 2024-01-01 ✓ 1 Snippet Yang Q, Sharma A, Calin D, de Crecy C, Inampudi R, Yin R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Hepatic fibrosis poses a significant health risk for young adults with type 2 diabetes (T2D). We propose FCFNets, a novel factual and counterfactual learning framework to predict hepatic fibrosis in young adults with T2D that can address class imbalance issue and increase interpretability leveraging electronic health records (EHRs). We designed a hybrid UNDO oversampling strategy, combining random and dissimilar oversampling that improves dataset diversity and model robustness. FCFNets also integrates SHAP-based global and instance-level explanations, alongside feature interaction analysis, providing insights into critical risk factors associated with hepatic fibrosis. The results show our proposed model outperforms various baseline methods with high sensitivity (0.846) and accuracy (0.768), while delivering counterfactual explanations. Hyperparameter tuning and dropout analysis further refine the model, ensuring optimal performance. This study demonstrates FCFNets's potential for early detection and personalized management of hepatic fibrosis, paving the way for interpretable AI applications in precision medicine.

HTTHFE
Also flagged:Malformation/Anomalies SyndromesPAX3PBX1KIF1AFOXC1CYP19A1
Journal Article 2024-01-01 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

HFE

HTT

Show Full Abstract

No abstract available.

Also flagged:DCAF15Cornelia de Lange syndromeSMC3ReproductionCdLSdevelopmental disorder
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Multiple Malformation/Anomalies SyndromesMandibulofacial dysostosisintellectual disabilityIDcleft lipcleft
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:ADneurodegenerative disorderpathogenesisLOADagingdementia
Journal Article 2024-01-01 No Snippets Zhang Z, Liu X, Zhang S, Song Z, Lu K, Yang W.
Show Full Abstract

No abstract available.

DCC
Also flagged:EZH2FMR1fragile X syndromeneurological disorderhistone methyltransferaseoligonucleotide
Journal Article 2024-01-01 ✓ 4 Snippets Fang M, Deibler S, Krishnamurthy P, Wang F, Rodriguez P, Banday S, Virbasius C, Sena-Esteves M, Watts J, Green M.
In-Text Gene Mentions

…axonal guidance genesDCC, ROBO3 ,…

…increased expression ofDCC, ROBO3 ,…

…of REST ,DCC, ROBO3 ,…

…increased expression ofDCC, ROBO3 and…

Show Full Abstract

No abstract available.

CA10
Also flagged:CurcuminPiperineCandidiasisinvasive candidiasispolyenesazoles
Journal Article 2024-01-01 ✓ 1 Snippet Tsopmene U, Tokam Kuaté C, Kayoka-Kabongo P, Bisso B, Metopa A, Mofor C, Dzoyem J.
In-Text Gene Mentions

…, Ca09 ,Ca10, Ca11 ,…

Show Full Abstract

No abstract available.

Also flagged:gestationiodinealbuminIntrauterine asphyxiafoetal asphyxiaoxygen
Journal Article 2024-01-01 No Snippets Malviya M, Kapoor V, Torgalkar R, Fiander M, Shah P.
Show Full Abstract

No abstract available.

PEBP1
Also flagged:cancerFerroptosisdeathironlipidmembrane
Journal Article 2024-01-01 ✓ 1 Snippet Diao J, Jia Y, Dai E, Liu J, Kang R, Tang D, Han L, Zhong Y, Meng L.
In-Text Gene Mentions

…binding protein 1 (PEBP1), specifically recognizing st…

Show Full Abstract

No abstract available.

PLCL1
Also flagged:ethanololigodendrocyte developmentmyelinationAlcoholmyelinmethylation
Journal Article 2024-01-01 ✓ 1 Snippet Brocato E, Easter R, Morgan A, Kakani M, Lee G, Wolstenholme J.
In-Text Gene Mentions

…7 genes (Plcl1, Gnpda2, Tnc, Luzp2,…

Show Full Abstract

No abstract available.

Also flagged:Ali1HLATP53Huntington diseasesickle cell anaemiainfertility
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Nickelalkenehydrocarbonshydrogen atomcarbonalkenes
Journal Article 2024-01-01 No Snippets Hu X, Cheng-Sánchez I, Kong W, Molander G, Nevado C.
Show Full Abstract

No abstract available.

Also flagged:breast cancermalignant tumorpathogenesisAPAcancerdeath
Journal Article 2024-01-01 No Snippets Qiao P, Zhang C, Shi Y, Du H.
Show Full Abstract

No abstract available.

DARS2
Also flagged:Mitochondrial DiseaseMitochondrial MyopathyIntrauterine growth restrictionidiopathic placental insufficiencymitochondrialmetabolism
Journal Article 2024-01-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…aspartyl-tRNA synthetase (DARS2) knockdown worms,…

Show Full Abstract

No abstract available.

Also flagged:AntibodyHerpes MyeloencephalopathyantibodiesinfectionAlprazolambenzodiazepine
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Graphenefertilizationgestationdicasreproductionfertilizations
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:EstrogenPerfluorooctanoic AcidEstrogen ReceptorBRCA1Breast CancerZanib
Journal Article 2024-01-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Research Square 2024-01-01 Preprint (No Snippets API) Kharel Z, Kharel H, Phatak PD.
Show Full Abstract

<title>Abstract</title> <p>A 58-year-old female was found to have hyperferritinemia (Serum ferritin:1683 ng/mL) during work-up for mild normocytic anemia. Transferrin saturation was low normal. Genetic analysis for hereditary hemochromatosis(HH) related <italic>HFE</italic> mutations showed absence of the common mutations (C282Y, H63D and S65C). Magnetic resonance imaging (MRI) abdomen showed evidence of hepatic iron deposition. Liver biopsy showed 4 + hepatic iron deposition without any evidence of steatosis or fibrosis. Quantitative liver iron was elevated at 348.3 µmol/g dry liver weight [Reference range(RR): 3–33 µmol/g dry liver weight]. She was presumptively diagnosed with tissue iron overload, cause uncertain. A diagnosis of ferroportin disease(FD) was entertained but the distribution of iron in the liver was largely parenchymal making this atypical. She was treated with intermittent phlebotomy for over a decade with poor tolerance due to worsening microcytic anemia. During the course of treatment, her ferritin level decreased. Over the past 1.5 years, she developed progressively worsening neurocognitive decline. MRI brain showed areas of susceptibility involving basal ganglia, midbrain and cerebellum raising suspicion for metabolic deposition disease. Neuroimaging findings led to testing for serum copper and ceruloplasmin levels which were both found to be severely low. The diagnosis of aceruloplasminemia was ultimately made. The biochemical triad of hyperferritinemia, low/normal transferrin saturation and microcytic anemia should raise the possibility of aceruloplasminemia. Since neurological manifestations are rare in most inherited iron overload syndromes, neurological symptoms in a patient with tissue iron overload should prompt consideration of aceruloplasminemia as a differential diagnosis.</p>