Gene Literature Dashboard

Viewing September 2025 — 785 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← August 2025 October 2025 →
ZNFX1
Also flagged:IL12RB1Mendelian susceptibility to mycobacterial diseaseMSMDdisseminated infectionIL-12Rβ1IFN-γ
Journal Article 2025-09-30 ✓ 1 Snippet Qian M, Zhou J, Chen P, Jiang N, Wang T, Chen X, Xu H, Zhou F, Yang Y, Lin X, Yang Q, Shao L, Ruan Q, Zhang W.
In-Text Gene Mentions

…, USP18 andZNFX1[ 6 ,…

Show Full Abstract

Mendelian susceptibility to mycobacterial disease (MSMD) is a rare clinical syndrome that is characterized by selective vulnerability to intracellular pathogens. Deficiency in IL12RB1 is the most common type of MSMD but the heterogeneity of its clinical Manifestation Makes precise diagnosis difficult. Here, we report a previously healthy 29 year-old woman who had suffered from disseminated infection with Mycobacterium tilburgii, which is a rare, unculturable environmental mycobacteria, for over 2 years. We used whole exome sequencing to detect a novel compound heterozygous variant in the IL12RB1 gene. Immunological analysis of the patient's peripheral lymphocytes showed a barely detectable level of IL-12Rβ1, a reduced population of follicular helper T (Tfh) cells and impaired production of IFN-γ in response to IL-12/IL-23 stimulation. Metagenomic next-generation sequencing was used to identify the causative pathogen and to analyze drug susceptibility. The infection was contained by a combination of anti-mycobacterial drugs and IFN-γ supplementary treatment. An RNA-seq analysis, using follow-up blood samples, revealed the limited success of these treatments over 6 months. Our findings support the screening for inherited immunological problems in patients with difficult-to-treat mycobacterial infections. The suboptimal response to prolonged anti-mycobacterial drugs and IFN-γ supplementation warrants the development of novel therapeutic strategies for MSMD patients.

Also flagged:cirrhosisvitamin and sugarmetabolismimmune responsescytochromeobesity
Journal Article 2025-09-30 No Snippets Pérez-González AP, Aguilar-Ordoñez I, Caballero NA, Morett E.
Show Full Abstract

The Comcáac (also known as Seri) are an indigenous community from the central coast of the Sonoran Desert in Mexico. Genetic studies conducted on this population since the late 1990s have revealed marked genetic differentiation resulting from pronounced genetic drift caused by a historical bottleneck, which is consistent with anthropological and linguistic records. Research has examined allele frequencies and genetic variants associated with cirrhosis risk, pathogen adaptation, forensic markers, vitamin and sugar metabolism, body mass index, immune responses, cytochrome genes, genetic distances with other groups, and migration patterns. While early investigations relied on classical genetic approaches, more recent studies have employed omics technologies, including whole-genome sequencing. Analyses of the Comcáac genome provide valuable insights into the phenotypic traits and medical predispositions of this community.

DARS2
Also flagged:malignant tumormalignant tumorsbladder tumorsbladder cancertumorbladder tumor
Journal Article 2025-09-30 ✓ 1 Snippet Wang Y, Zhou T, Hu C, Chen H, Chen M.
In-Text Gene Mentions

…OAS1, APOBEC3H, TRIM71,DARS2, YTHDC1, and RBMS3…

Show Full Abstract

<h4>Background</h4>Bladder cancer is a prevalent malignant tumor in the urinary system, ranking tenth among malignant tumors globally. Currently, the primary treatment methods include surgery, chemotherapy, immunotherapy, and emerging neoadjuvant therapies. These treatments have effectively reduced the mortality rate associated with bladder tumors. However, the prognosis for bladder cancer patients remains poor due to the high rates of recurrence, metastasis, and drug resistance. Therefore, identifying the pathological features and tumor immune environment of each patient to develop optimal treatment strategies is an urgent health issue.<h4>Methods</h4>We analyzed a single-cell dataset of bladder cancer to identify key signaling pathways and chromosomal mutations among different subgroups of bladder tumors. Additionally, we sought to identify ligand-receptor pairs between malignant bladder tumor epithelial cells and other cell subgroups. Using the TCGA-BLCA database and COX regression analysis, we screened key ligand-receptor pairs closely related to patient prognosis. We then used LASSO regression analysis to construct a bladder cancer risk prediction model based on these key ligand-receptor pairs (LR.Riskscore). To evaluate the impact of different LR.Riskscores on prognosis and clinical benefits for bladder cancer patients, we used Kaplan-Meier survival curves, risk forest plots, nomograms, and decision curve analysis. We also conducted cellular experiments, including clone formation, CCK8 assays, Transwell migration assays, and scratch assays, to elucidate the important cellular role of the key receptor CXCR4 in bladder tumor cells. Finally, we utilized the IMvigor210 bladder cancer immunotherapy dataset to reveal the correlation between the LR.Riskscore risk equation and bladder cancer immunotherapy.<h4>Results</h4>We constructed a bladder cancer risk prediction model based on key ligand-receptor pairs, including CXCL12_CXCR4, VEGFA_FLT1, PDGFRA_PDGFC, WNT2_SFRP4, and HLA-E_KLRC1. This model effectively predicted the prognosis and immunotherapy responsiveness of bladder cancer patients, significantly enhancing clinical benefits compared to conventional clinical features. Additionally, our cellular experiments confirmed the oncogenic role of the key receptor CXCR4 in bladder cancer.<h4>Conclusion</h4>Our risk prediction model significantly improves the evaluation of prognosis and the prediction of immunotherapy responsiveness in bladder cancer patients. This advancement promotes the development of precise, individualized treatment strategies for bladder cancer.

Also flagged:Acetyl-CoA carboxylase 1metabolismgraft-versus-host diseaseinflammatory disordersphosphorylationFatty acid
Journal Article 2025-09-30 No Snippets McDonald-Hyman C, Aguilar EG, Compeer EB, Zaiken MC, Rhee SY, Mohamed FA, Larson JH, Loschi ML, Lees C, Thangavelu G, Sleeth ML, Smith KD, Whangbo JS, Ritz J, Sparwasser TD, O'Connor RS, Crawford PA, Rathmell JC, Kean LS, Zeiser R, Hippen KL, Dustin ML, Blazar BR.
Show Full Abstract

Tregs are critical for maintaining immune homeostasis, and their adoptive transfer can treat murine inflammatory disorders. In patients, Treg therapies have been variably efficacious. Therefore, new strategies to enhance Treg therapeutic efficacy are needed. Tregs predominantly depend on oxidative phosphorylation (OXPHOS) for energy and suppressive function. Fatty acid oxidation (FAO) contributes to Treg OXPHOS and can be important for Treg "effector" differentiation, but FAO activity is inhibited by coordinated activity of the isoenzymes acetyl-CoA carboxylase-1 and -2 (ACC1 and ACC2). Here, we show that small-molecule inhibition or Treg-specific genetic deletion of ACC1 significantly increases Treg suppressive function in vitro and in mice with established chronic graft-versus-host disease. ACC1 inhibition skewed Tregs toward an "effector" phenotype and enhanced FAO-mediated OXPHOS, mitochondrial function, and mitochondrial fusion. Inhibiting mitochondrial fusion diminished the effect of ACC1 inhibition. Reciprocally, promoting mitochondrial fusion, even in the absence of ACC1 modulation, resulted in a Treg functional and metabolic phenotype similar to that seen with ACC1 inhibition, indicating a key role for mitochondrial fusion in Treg-suppressive potency. Ex vivo-expanded, ACC1 inhibitor-treated human Tregs similarly augmented suppressor function, as observed with murine Tregs. Together, these data suggest that ACC1 manipulation may be exploited to modulate Treg function in patients.

SLC9C2HTTHFESLC2A14
Also flagged:membraneMembrane transportersmembranessolute carriersSLCmembrane transport proteins
Journal Article 2025-09-30 ✓ 5 Snippets Gyimesi G, Tweedie S, Bruford E, Hediger MA.
In-Text Gene Mentions

SLC2A14

5-HTT

SLC9C2

SLC9C2 - Orphan transporter : NHE11

hemochromatosis

Show Full Abstract

Membrane transporters are essential for human health, mediating the movement of nutrients, electrolytes, metabolites and other molecules across cellular and organellar membranes. Genes encoding these proteins account for approximately 5.2% of the human protein coding genome. Nearly half of these belong to the solute carriers (SLC) supergroup, the largest class of membrane transport proteins, collectively termed the "SLC-ome." The current SLC-ome comprises 464 SLCs organized into 76 SLC families, of which 24% (111 SLCs) remain orphan transporters with unknown or incompletely characterized function. An additional 52 SLC-like proteins bring the total to 516 membrane transport proteins. SLCs function as molecular gatekeepers, and their dysfunction contributes to a wide spectrum of human diseases, including cancer, diabetes, and immunological, cardiovascular and neurodegenerative disorders. Pathological consequences of SLC defects include hypertension, hyperglycemia, hypercholesterolemia, nutritional deficiencies, metal ion imbalance, oxidative stress, and dysfunction of mitochondria, lysosomes, endoplasmic reticulum and Golgi apparatus. In addition, genetic defects in SLCs are the cause of many rare diseases. Several SLCs require additional subunits to form functional heteromeric complexes, while others exhibit additional or alternative roles, such as acting as transceptors. In this review, we provide updated physiological, structural, mechanistic, and pharmacological insights for each of the 516 human SLC and SLC-like proteins. We also summarize their classification, structural architecture, transport mechanisms and pharmaceutical relevance, and present the most recent SLC gene nomenclature assignments approved by the HUGO Gene Nomenclature Committee (HGNC).

PCDH17DCC
Also flagged:down syndromeTrisomy 21intellectual disabilitycorticogenesisnucleusgene expression
Journal Article 2025-09-30 ✓ 3 Snippets Feng MY, Cao W, Tahmasian N, Kukreja B, Li G, Rusu B, Youn JY, Kalish BT, Kalish BT.
In-Text Gene Mentions

…markers UNC5D andDCC19 , 26…

…(e.g. ROBO2, SLIT1,DCC) in the…

…LRRTM2, CNTNAP4, CBLN1,PCDH17, NRCAM) (Fig. 4c…

Show Full Abstract

Down syndrome (DS, or Trisomy 21) is one of the most common genetic causes of intellectual disability. DS results in both abnormal neurodevelopment and accelerated neurodegeneration, but the molecular mechanisms underlying abnormal corticogenesis are incompletely understood. To gain molecular insight into the prenatal neurobiology of DS, we performed single-nucleus sequencing, spatial transcriptomics, and proteomics on mid-gestational prenatal human cortex. We captured altered expression dynamics of lineage commitment genes and de-repression of transposable elements in DS neural progenitor cells, which suggest changes to the fate and functionality of neuronal and glial cells. Given the importance of linking human and model system pathobiology, we also performed highly multiplexed RNA in situ spatial transcriptomics on a well-established trisomic mouse model (Ts65Dn) to study the cellular landscape of the trisomic brain during early development and maturation. We profiled the spatial transcriptome of > 240,000 cells in the mouse brain and identified trisomy-associated gene expression patterns in the molecular control of neurogenesis and gliogenesis. Together, our study provides an extensive resource for understanding of the complex multicellular processes underlying DS neurodevelopment.

MLLT10
Also flagged:acute lymphoblastic leukemiaALLtoleukemiaIKZF1PAX5
Journal Article 2025-09-30 ✓ 1 Snippet Gil JV, Avetisyan G, Miralles A, de Las Heras S, Díaz-González Á, López-Benet C, Del Cañizo M, Vicente A, Andreu R, Fuentes C, Fernández JM, Barragán E, Such E, Llop M.
In-Text Gene Mentions

…two cases harboured PICALM::MLLT10(2/18, 11.1%) and,…

Show Full Abstract

<h4>Background</h4>The molecular characterisation of pediatric acute lymphoblastic leukemia (pALL) is essential for accurate diagnosis and risk stratification. However, standard-of-care (SoC) methods have limited sensitivity and resolution.<h4>Methods</h4>This study evaluates the clinical utility of emerging genomic technologies-including optical genome mapping (OGM), digital multiplex ligation-dependent probe amplification (dMLPA), RNA sequencing (RNA-seq), and targeted next-generation sequencing (t-NGS)-in the largest cohort of pALL patients analysed to date, with 60 cases using OGM.<h4>Results</h4>Considering clinically relevant alterations identified with at least two different methods, OGM as a standalone test demonstrated superior resolution, detecting chromosomal gains and losses (51.7% vs. 35%, p = 0.0973) and gene fusions (56.7% vs. 30%, p = 0.0057), while resolving 15% of non-informative cases. Combining dMLPA and RNA-seq was the most effective approach, achieving precise classification of complex subtypes and uniquely identifying IGH rearrangements undetected by other techniques. OGM identified clinically relevant alterations in 90% of cases, and the dMLPA-RNAseq combination reached 95%, compared to 46.7% with SoC techniques.<h4>Conclusions</h4>Integrating these technologies into diagnostic workflows overcomes SoC limitations. OGM and the dMLPA-RNAseq combination emerge as front-line strategies, addressing pALL heterogeneity, streamlining molecular testing, and informing treatment decisions to improve outcomes.

DNAJC1
Also flagged:rRNAELK3BMP25 S-rRNATitinDNAJC11
Journal Article 2025-09-30 ✓ 1 Snippet Nanaie HA, Tian J, Sun G, Wang X, Zhao M, Li H, Dalai B, Li Y, Wang T, Chen L, Sai Y, Guo W, Wang G, Che L, Wu J, Tian R.
In-Text Gene Mentions

…For example, we identified DNAJC11 andDnaJC1genes, which are related to heat resistance traits in local cattle 58 , 59 .…

Show Full Abstract

Meat quality and carcass traits are the most economically important traits affecting the value and the quality characteristics of the animal at slaughter. In this study, we analyzed the genomes of 295 domestic cattle from 20 global breeds using next-generation sequencing to identify signatures of positive selection associated with meat production and quality traits. The results of population genetic analysis revealed genetic differentiation among worldwide cattle groups. We observed clustering of samples in agreement with their geographic origins and production characteristics. We further observed noticeable genetic variety between cattle groups from different geographical regions. Generally, the lowest genetic diversity was determined for commercial cattle breeds, while the highest genetic diversity was found in African local cattle breeds. Our search for putative selective genomic regions in beef cattle populations revealed several candidate genes such as BMP2, EGR1, MAGEL2, U6, TMEM201, ELK3 and 5S_rRNA that were previously explored to be associated with carcass traits and meat quality in beef cattle. The enriched pathways and candidate genes discovered in this study could supply a basis for future improvement through the use of whole-genome technologies and selective breeding.

Also flagged:migraineneurological disorderauradepressiongastrointestinal disordersTMA7
Journal Article 2025-09-30 No Snippets Hong Y, Mi Y, Chen F, Wang Y, Li J, Shu Z.
Show Full Abstract

<h4>Background</h4>Migraine is a highly prevalent neurological disorder with complex pathophysiology and limited treatment efficacy. Emerging evidence suggests immune cell involvement in migraine, but the specific regulatory mechanisms remain unclear. This study aimed to identify immune cell-type-specific genetic drivers of migraine and prioritize potential therapeutic targets.<h4>Methods</h4>We conducted a Mendelian randomization (MR) analysis integrating single-cell expression quantitative trait loci (sc-eQTL) data from 14 immune cell types with large-scale genome-wide association studies (GWAS) of migraine. Colocalization analysis, protein-protein interaction (PPI) networks, linkage disequilibrium score regression (LDSC), phenome-wide association studies (PheWAS), and drug repurposing databases were utilized to validate findings and assess therapeutic potential and safety.<h4>Results</h4>We identified 25 immune cell-specific eGenes causally associated with migraine, including CDC42, NELFCD, HOXB3, HAX1, and FHL3. Several genes, such as CDC42 and HAX1, were implicated across multiple immune cell types. Subtype-specific analyses revealed differential gene effects in migraine with aura (MA) and without aura (MO). Genetic correlation and pleiotropy analyses linked eGenes to comorbid traits such as depression, gastrointestinal disorders, and blood pressure. PheWAS suggested minimal adverse associations for prioritized genes like GINM1 and TMA7. Drug repurposing identified FDA-approved agents, including hydroxychloroquine sulfate (NELFCD) and bazedoxifene (CDC42), as potential migraine therapies.<h4>Conclusion</h4>This study reveals immune cell-specific genetic contributors to migraine and highlights druggable targets for therapeutic development. Integrating sc-eQTL with multi-omics and pharmacological data provides a novel framework for precision medicine in migraine.

Also flagged:acetylcholinetumorbindingmuscarinic receptorscell proliferationangiogenesis
Journal Article 2025-09-30 No Snippets Zhang C, Guo X, Wang Y, Zhang S, Wang Z.
Show Full Abstract

Acetylcholine (ACh) is an essential neurotransmitter that has recently gained attention for its multifunctional role in tumor immune regulation. By binding neuronal loss to nicotinic and muscarinic receptors, ACh directly promotes tumor cell proliferation and migration while modulating immune cell functions, thereby influencing the tumor microenvironment. Additionally, ACh plays a crucial role in tumor angiogenesis and stromal remodeling. Recent studies suggest that combining ACh modulators with immune checkpoint inhibitors and other therapies may improve treatment efficacy and overcome resistance. This review highlights current research developments regarding ACh in tumor immune regulation, explores its underlying mechanisms and clinical potential, and provides a theoretical basis for developing personalized therapeutic strategies.

PCDH17
Also flagged:methylationVimentinPOU4F2malignant tumorPOU class 4 homeobox 2urinary diseases
Journal Article 2025-09-30 ✓ 2 Snippets Zhang J, Cheng X, Huang C, Xu Y, He J, Xu H, Tai S, Wei Y.
In-Text Gene Mentions

…methylation biomarkers HOXA9,PCDH17, POU4F2, and ONECUT2…

…combining POU4F2 andPCDH17methylation assays achieved…

Show Full Abstract

BACKGROUND: Bladder carcinoma (BC) is a malignant tumor that originates from the epithelial cells of the urinary system. Currently, the main diagnostic methods suffer from disadvantages including being invasive, having high costs, and low sensitivity and specificity. Therefore, there is an urgent need to develop a non-invasive, high-performance method for diagnosing BC. MATERIALS AND METHODS: We developed a urine DNA detection panel utilizing two methylation biomarkers for the diagnosis of BC. A total of 467 urine samples were collected from the First Affiliated Hospital of Anhui Medical University for DNA methylation analysis. The methylation levels of Vimentin and POU class 4 homeobox 2 gene (POU4F2) were analyzed in a training set of 306 urine samples (92 cases and 214 controls), and in an independent validation set of 161 urine samples (59 cases and 102 controls) using Real-Time PCR (RT-PCR). RESULTS: The Vimentin/POU4F2 combined methylation panel achieved an AUC of 0.935 (95% CI: 0.889–0.981), with sensitivity, specificity, and accuracy of 86.44% (95% CI: 0.772–0.957), 96.08% (95% CI: 0.923–0.998), and 92.55% (95% CI: 0.886–0.965) for diagnosing BC. Notably, for patients with stage I and low-grade BC, the sensitivity was 90.00% for both. Additionally, it demonstrated specificities of 96.30% and 95.83% for patients with other urinary diseases and malignancies in other systems. CONCLUSIONS: Our study provides evidence that the two-gene methylation panel based on urine DNA detection demonstrates strong performance in diagnosing BC with high sensitivity and accuracy, offering a promising strategy for early screening and adjunctive diagnosis of BC.

Also flagged:Phosphatephosphorusbromophenol blueorthophosphatecalciumiron
Journal Article 2025-09-30 No Snippets Quijia-Pillajo J, Nordstedt NP, Chapin LJ, Owen JS, Altland JE, Jones ML.
Show Full Abstract

<h4>Background</h4>Phosphate solubilizing bacteria (PSB) can break down insoluble forms of phosphorus such as Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>. In several soil grown crops, PSB inoculation improved phosphorus nutrition. However, positive results are inconsistent and there is comparably little information about PSB efficacy in soilless culture systems. This study aimed to identify phosphate solubilizing bacteria (PSB) from a greenhouse rhizobacteria collection that could be used to improve floriculture crop growth and health under phosphorus limiting conditions.<h4>Results</h4>A bromophenol blue (pH indicator) based colorimetric assay was used to identify bacterial isolates that acidified the culture media. From the collection of 1044 bacteria, 35 isolates that reduced media pH were identified, and their phosphate solubilization capacity was quantified. The top 14 PSB were selected for whole-genome sequencing. The isolates belonged to genera Enterobacter (8), Pantoea (5), and Raoultella (1). In planta effects of strains C2B11 and C8D10 were evaluated in French marigolds (Tagetes patula) grown in a peat-based substrate (pH = 7). Phosphorus was supplemented weekly as insoluble Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>. C2B11 and C8D10 inoculated marigolds were greener than non-inoculated controls. Only C2B11 increased shoot digital biomass and bloom area.<h4>Conclusions</h4>Bromophenol blue proved useful to identify bacteria that reduced culture media pH, but not all identified isolates showed high phosphate solubilization. Pantoea formicae C8D10 and Pantoea trifolii C2B11 strains improved growth or health of marigolds grown in soilless substrate under phosphate limiting conditions. We showed the applicability of bromophenol blue for high-throughput PSB identification. C8D10 and C2B11 are phosphate solubilizing bacteria native to soilless substrate systems, and both strains have potential for use as biostimulants to support phosphorus management in ornamental greenhouse production.

PTGIS
Also flagged:PD-1ovarian cancerOCfolate receptor alphatumorCD8
Journal Article 2025-09-30 ✓ 1 Snippet Chiello JL, Shaikh N, Jacobi J, Gaulin N, Santos G, Keck C, Hess SM, Lichty B, Singh PK, Rosario SR, Abrams SI, Zsiros E, Long MD, McGray AJR.
In-Text Gene Mentions

…( Ptgds ,Ptgis, Ptges2 )…

Show Full Abstract

Despite some clinical success, ovarian cancer (OC) patients rarely achieve durable benefit from current immunotherapies, suggesting a need for strategies that improve OC immune recognition. We previously reported that engineered T cells secreting folate receptor alpha (FRα)-targeted bispecific T cell engagers (FR-B T cells) elicit robust antitumor responses in OC, in part by engaging endogenous T cells. Here, we use clinical OC specimens and preclinical OC to evaluate FR-B T cells combined with PD-1 blockade. Assessing the tumor microenvironment during acute and prolonged FR-B T cell + anti-PD-1 responses revealed broad immune cell engagement/reorganization. Early CD8+ T cell-driven responses and myeloid cell influx were followed by accumulation of CXCL13-producing macrophages, activated B cells, and effector memory CD4+ T cells with durable response, hallmarks that were diminished with progressive disease. Resistant OC (characterized by FRα loss and metabolic reprogramming) emerged at disease relapse, suggesting a need to target additional vulnerabilities to extend responses. As FR-B T cells promoted epitope spreading beyond FRα, we employed a booster vaccine to enhance antitumor immunity, improving OC control. Our findings point to rationally combining FR-B T cells with PD-1 blockade in OC and an opportunity to apply personalized cancer vaccines to limit OC relapse.

SUDS3
Also flagged:Histonepost-translational modificationsgene expressioncancerlysinemethylation
Journal Article 2025-09-30 ✓ 4 Snippets Vai A, Noberini R, Graziadei A, Polasky DA, Yu F, Nesvizhskii AI, Bonaldi T.
In-Text Gene Mentions

…and 13 onlinker histoneshistones, HiP-Frag enables…

…the analysis oflinker histoneshistones, which were…

…seven for thelinker histoneshistones.…

…cell lines andlinker histoneshistones from breast…

Show Full Abstract

Histone post-translational modifications (PTMs) play a crucial role in regulating gene expression and maintaining DNA integrity, and their aberrations are linked to various diseases, including cancer. While lysine acetylation and methylation have been extensively studied, recent research has uncovered additional PTMs that significantly contribute to chromatin structure and function. Mass spectrometry is the most effective analytical method for studying histone PTMs; however, computational limitations often restrict the analysis to common modifications. Unrestrictive search strategies have the potential to enable a more comprehensive characterization of the histone modification landscape. In this work, we systematically assess the application of unrestrictive search approaches to histone data. After evaluating the limitations of these methods, we develop a novel bioinformatics workflow, named HiP-Frag (histone PTM analysis with FragPipe), which enables the identification of 96 sites decorated with uncommon PTMs on core histones-60 of which were previously unreported-as well as 55 histone marks on linker histones, including 13 novel ones, purified from human cell lines and primary samples. The expanded histone PTM analysis enabled by this strategy is among the first to extract previously unexplored epigenetic information from mass spectrometry raw data. This approach paves the way for a facilitated and more streamlined identification of uncommon and yet unannotated histone modifications, supporting a deeper dissection of the histone code and the understanding of the potential biological role of the novel epigenetic marks.

TNFSF4
Also flagged:cuproptosisC1QBPPFKPlung adenocarcinomacopperdeath
Journal Article 2025-09-30 ✓ 1 Snippet Lv Y, Duan X, Yuan X.
In-Text Gene Mentions

…except for CD276,TNFSF4, and CD274 (…

Show Full Abstract

Excessive intracellular copper accumulation triggers cuproptosis, a novel regulated cell death process with therapeutic potential. Analyzing 566 The Cancer Genome Atlas samples alongside lung adenocarcinoma (LUAD)-specific microarray and single-cell sequencing data, we identified 109 cuproptosis-associated genes, of which <i>C1QBP</i> and <i>PFKP</i> emerged as key prognostic markers. Four-gene risk model stratified patients into high- and low-risk groups with distinct survival outcomes, where high-risk scores correlated with advanced TNM stages. Clinical validation confirmed that elevated <i>C1QBP</i>/<i>PFKP</i> expression in LUAD tissues predicted shorter progression-free survival. Functional assays demonstrated that silencing <i>C1QBP</i> or <i>PFKP</i> increased intracellular copper concentration, suppressed proliferation, and inhibited invasion, mechanistically linking these genes to cuproptosis dysregulation. Our findings nominate <i>C1QBP</i>/<i>PFKP</i> as actionable targets for LUAD therapy, offering both prognostic biomarkers and copper-metabolism-directed treatment strategies.

DCC
Also flagged:reproductionEPHA6MLLT3ROBO1KIAA0753MED31
Journal Article 2025-09-30 ✓ 1 Snippet Krivoruchko A, Yatsyk O, Skokova A, Safaryan E, Usai L, Kanibolotskaya A.
In-Text Gene Mentions

…, NCAPG ,DCC, IBSP ,…

Show Full Abstract

Analysis of selection signatures in the genomes of farm animals enables the detection of genomic regions affected by selection and contributes to the identification of genes underlying adaptive and productive traits. This research aimed to identify loci under selection pressure and to detect candidate genes in Dzhalgin Merino sheep by performing a comparative genomic analysis with the related Australian Merino and Rambouillet breeds. A total of 293 animals were included in the analysis, comprising Dzhalgin Merino (n = 53), Australian Merino (n = 50), Australian Industry Merino (n = 88), and Rambouillet (n = 102). Whole-genome SNP genotyping data for Dzhalgin Merino were generated within this study, while data for Australian Merino, Australian Industry Merino, and Rambouillet were obtained from the SheepHapMap project. For the purposes of analysis, Australian Merino and Australian Industry Merino were combined into a single group (n = 138). To enhance the reliability of the results, three independent methods were employed to detect selection signatures: the fixation index (FST), analysis of linkage disequilibrium variation (varLD), and the cross-population number of segregating sites by length (xp-nSL). The study showed that Dzhalgin Merino have unique genetic signatures potentially associated with adaptation and productivity, which opens up new opportunities for their selection. The identified genes can become the basis for developing new breeding programs aimed at improving both the productive qualities and the adaptive abilities of the breed. Further research should be aimed at a detailed investigation of gene structure within loci under selection pressure and at clarifying the mechanisms by which these genes influence animal phenotypes. A total of 185 genes were identified within genomic regions exhibiting selection signatures. Among these, particular attention was given to <i>EPHA6</i>, <i>MLLT3</i>, <i>ROBO1</i>, <i>KIAA0753</i>, <i>MED31</i>, <i>SLC13A5</i>, and <i>ELAVL4</i>, which are involved in biological processes such as growth, development, and reproduction. The identified genes represent potential targets for breeding programs aimed at increasing productivity and adaptive capacity of the breed.

Also flagged:TuberculosisTBnon-communicable diseasesinfectious diseaseTYK2infectious diseases
Journal Article 2025-09-30 No Snippets Dashian MA, Shipulin GA, Deviatkin AA.
Show Full Abstract

Tuberculosis (TB) is one of the leading infectious causes of mortality worldwide. Although a significant proportion of the population (up to 36%, depending on the region) is infected with the latent form of TB, only about one in ten of these people will develop an active form of the disease in their lifetime. This is due to a complex interaction between the host's genetic predisposition and environment. However, the genetic determinants of TB are not well established and have been insufficiently explored in previous genome-wide association studies (GWAS) with sparse and incongruent results. We reviewed recent evidence on host genetic susceptibility to TB, highlighting population-specific characteristics, host-pathogen coevolution, and the limitations of conventional GWAS approaches in terms of clinical and genetic heterogeneity. While rare variants with high penetrance, such as <i>TYK2</i> P1104A, lead to monogenic susceptibility, most heritable risk results from the cumulative effect of numerous common variants. This cumulative effect may be summarized using polygenic risk scores (PRSs). Although their use has been proven for non-communicable diseases, PRSs are not applied to infectious disease susceptibility. To date, no PRS model for susceptibility to tuberculosis has been consistently validated. The development of PRSs for TB susceptibility is limited by phenotypic heterogeneity, population structure, and co-adaptation between host and pathogen. Another major challenge is to take into account the considerable influence of environmental factors. This difficulty in modeling environmental influences probably explains the current lack of a clinically applicable PRS for TB susceptibility. However, taking these caveats into account, polygenic models could improve risk stratification at the individual level compared to single-variant association and allow for earlier targeted treatment and prophylaxis.

NEGR1BTN2A1
Also flagged:Major Depressive Disordermetabolismphospholipidglycanchromatingene expression
Journal Article 2025-09-30 ✓ 5 Snippets Ivanov SM, Sukhachev VS, Tarasova OA, Lagunin AA, Poroikov VV.
In-Text Gene Mentions

…receptor 3 (SORCS3),neuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1), transcription factor 4…

…94 genes, includingNEGR1, CTC-467M3.3, TMEM106B, LRFN5…

…2 member A1 (BTN2A1), and rs34788973 and…

⭐ same-sentence co-mention

…); butyrophilins BTN1A1,BTN2A1, BTN2A2, and BTN3A2…

Show Full Abstract

Major depressive disorder (MDD) is one of the most common diseases, affecting millions of people worldwide. Existing antidepressants do not allow sustainable remission to be achieved in many cases, probably due to insufficient understanding of the etiopathogenesis of MDD. The aim of this study was to identify the key genes, pathways, and master regulators associated with MDD based on a combination of genomic and transcriptomic data analyses. We performed a transcriptome-wide association study (TWAS) to identify the increase and decrease in transcription of particular genes that can be associated with MDD risk, the results of which were used to perform a pathway enrichment analysis that elucidated the pathways and processes associated with MDD. Besides changes in the metabolism of neurotransmitters, the association of some other processes with MDD was revealed, including changes in phospholipid and glycan metabolism, chromatin remodeling, RNA processing and splicing, and cell-extracellular matrix interaction. The transcriptomic analysis performed for brain regions mostly confirmed genome-level findings. The gene expression changes in the brain related to MDD were mostly sex-specific, and the transcription of many genes was changed in the opposite direction in males and females. Finally, master regulators were found, which are the proteins responsible for the transcriptional regulation of the revealed genes and represent the most important proteins contributing to MDD development.

Also flagged:Synthesisglycolipidlipid ATLR4shocklipid As
Journal Article 2025-09-30 No Snippets Kenneth D, Santi CM, Tanda F, Izzo A, Civera M, D'Orazio G, Lay L.
Show Full Abstract

<i>Bacteroides fragilis</i>, a prominent commensal of the human gut microbiota, plays a vital role in immune system regulation through its capsular polysaccharide A (PSA), which requires a glycolipid anchor structurally reminiscent of lipid A. While canonical <i>Escherichia coli</i> lipid A acts as a potent TLR4 agonist contributing to septic shock and inflammatory disorders, certain <i>B. fragilis</i>-derived glycolipids demonstrate antagonistic effects, offering potential as anti-inflammatory agents. In this study, we report the synthesis and preliminary computational evaluation of a library of glycolipids inspired by <i>B. fragilis</i> lipid A. Three lipid As, including a tetra-acylated 1-phosphoryl lipid A analog (Tetra C-1), were synthesized and assessed using molecular docking simulations targeting the human TLR4/MD-2 complex. Docking results reveal that Tetra C-1 exhibits more favorable antagonist binding characteristics compared to the well-studied TLR4 antagonist Eritoran. This work highlights a microbiota-informed strategy for the development of novel TLR4 antagonists, potentially enabling targeted modulation of innate immunity for therapeutic applications in inflammatory diseases and as vaccine adjuvants.

Also flagged:cancertumortranslationaltumorsextracellularsynthesis
Journal Article 2025-09-30 No Snippets Singh H, Mijakovic I, Singh P.
Show Full Abstract

Despite major advances in oncology, cancer therapy continues to face persistent challenges due to intratumoral heterogeneity, drug resistance, and the poor clinical translation of experimental therapeutics. Conventional preclinical models such as 2D cultures and animal systems often fail to accurately recapitulate the tumor microenvironment immune contexture, and patient-specific variability limiting their predictive power. While nanomedicine and advanced drug delivery platforms offer promising solutions, their translational success is hindered by insufficient integration with physiologically relevant tumor models. In this review, we critically examine how patient-derived organoids derived from patient tumors serve as next-generation platforms for modeling cancer heterogeneity, therapeutic response, and biomarker discovery. We further explore how the integration of PDOs with functional biomaterials, extracellular matrix mimetics, and organ-on-chip systems enables dynamic co-culture environments that capture tumor-stroma-immune interactions with high fidelity. By linking the biological underpinnings of resistance, such as genetic mutations, altered signaling, metabolic rewiring, and immune evasion, with smart biomaterial design and drug screening workflows, we propose a unified roadmap for precision oncology. Additionally, we highlight the emergence of PDO biobanks, co-culture innovations, and high-throughput phenotypic screening as essential tools for improving clinical translation. This interdisciplinary synthesis underscores the transformative potential of PDO-based platforms in accelerating personalized cancer therapy.

SERPINC1
Also flagged:gene expressionmetabolismcatecholaminemitochondrialphosphorylationsteroid
Journal Article 2025-09-30 ✓ 1 Snippet Janovska P, Kobets T, Steiner Mrazova L, Svobodova M, Tesarova M, Kopecky P, Zouhar P, Rossmeisl M, Stranecky V, Kmoch S, Kopecky J.
In-Text Gene Mentions

…blood coagulation (SERPINC1, KNG1 ,…

Show Full Abstract

<h4>Background</h4>Newborns undergo rapid metabolic and organ adaptations after birth, which are compromised in premature newborns, leading to adverse health outcomes. Molecular mechanisms underlying these transitions remain poorly understood due to limited tissue availability. To address this gap, we characterized tissue transcriptomes using autopsy samples from a unique newborn cohort.<h4>Methods</h4>We analyzed liver (LI), heart (HM), and skeletal muscle (SM) transcriptomes using RNA sequencing in 41 predominantly premature newborns who died shortly after birth. Nearly 14,000 protein-coding gene transcripts per tissue were detected.<h4>Results</h4>Tissues exhibited distinct expression profiles, with LI showed the highest number of tissue-specific genes. SM gene expression correlated strongly with gestational age at birth (i.e., the prenatal development), while LI was influenced by the duration of postnatal survival (i.e., the postnatal development). HM displayed minimal changes, suggesting stable myocardial metabolism during the perinatal transition. Weighted Gene Co-expression Network Analysis (WGCNA) identified tissue-specific gene co-expression modules linked to clinical traits such as gestational age, birth weight, survival duration, nutrition, and exposure to catecholamine treatment. The key functional annotations, validated by differential expression analysis, revealed that LI and SM modules were enriched for mitochondrial metabolism and oxidative phosphorylation genes, with more pronounced prenatal development in SM, and a postnatal increase in both tissues. Data suggests that energy metabolism in SM matures first, followed by the development of muscle functions. Hepatic modules were associated with a postnatal increase in the steroid hormone/xenobiotic metabolism, and a decline in hematopoietic activity. Robust annotations to ribosome activity suggested tissue-specific changes in protein synthesis, which declined prenatally in SM, postnatally in HM. Notably, the supply of exogenous glucose and nutrition type were strongly associated with hepatic gene expression, highlighting the central role of the liver in postnatal metabolic adaptation.<h4>Conclusion</h4>Overall, our study highlights tissue-specific perinatal gene regulation, with mitochondrial maturation emerging as a crucial driver of postnatal adaptation, explaining vulnerabilities in preterm infants. We provide a unique resource for characterizing developmental changes in tissue transcriptomes during the fetal-to-neonatal transition in human newborns.

TNFSF4
Also flagged:systemic lupus erythematosusSLEGene ExpressionC3C4CLEC4E
Journal Article 2025-09-30 ✓ 1 Snippet Ma X, Zhang H, Li J.
In-Text Gene Mentions

…STAT4 , andTNFSF4, the disease’s…

Show Full Abstract

<h4>Objective</h4>This study explores the prognostic value of the <i>CLEC4E</i> gene in systemic lupus erythematosus (SLE) through bioinformatics analysis and evaluates its role in disease diagnosis and progression.<h4>Methods</h4>Gene expression datasets related to SLE (GSE17755, GSE50772, and GSE61635) were obtained from the GEO (Gene Expression Omnibus) database. Intersection analysis was performed using the Jvenn tool with a screening threshold of |log2FC| > 1 and P< 0.05 to identify differentially expressed genes (DEGs). The resulting DEGs were then cross-referenced with immune-related genes in the GeneCards database (relevance score > 8) to further prioritize candidates with immunological relevance. Peripheral blood from 360 SLE patients and 360 healthy controls was collected for <i>CLEC4E</i> expression analysis via RT-qPCR. Disease activity was evaluated using the SLEDAI score, and patients were grouped accordingly. Pearson and Spearman correlation analysis to investigate the relationship between <i>CLEC4E</i> and immune indicators. Logistic regression and <i>ROC</i> analyses were conducted to assess diagnostic and prognostic value. Kaplan-Meier analysis evaluated survival outcomes.<h4>Results</h4>Bioinformatics analysis identified six SLE-related DEGs, namely <i>ISG15</i>, <i>HERC5</i>, <i>TNFAIP6</i>, <i>IFIT3</i>, <i>OASL</i>, and <i>CLEC4E.</i> Further intersection with immune-related genes from the GeneCards database (relevance score > 8) ultimately highlighted <i>CLEC4E</i> as the key gene for clinical validation. The expression level of <i>CLEC4E</i> was significantly higher in SLE patients compared with healthy controls. <i>ROC</i> analysis showed good diagnostic performance (AUC = 0.7744). <i>CLEC4E</i> expression was higher in active SLE, and multivariate analysis identified <i>CLEC4E</i>, C3, C4, ANA, and anti-dsDNA as independent predictors of disease activity. <i>CLEC4E</i> demonstrated moderate diagnostic value for distinguishing active from inactive disease (AUC = 0.6360). Higher <i>CLEC4E</i> expression was associated with worse prognosis (<i>P</i> = 0.0002). The combined diagnostic performance with other biomarkers (C3, C4, ANA, anti-dsDNA) showed a remarkable AUC of 0.9407.<h4>Conclusion</h4><i>CLEC4E</i> is a potential biomarker for SLE diagnosis, disease activity assessment, and prognosis evaluation.

Also flagged:Lipopolysaccharidesinflammatory responseswatercoagulationFactor Cinfection
Journal Article 2025-09-30 No Snippets Colombelli A, Lospinoso D, Arima V, Guarino V, Zizzari A, Bianco M, Perrone E, Carbone L, Rella R, Manera MG.
Show Full Abstract

Lipopolysaccharides (LPS) from Gram-negative bacteria represent a significant challenge across various industries due to their prevalence and pathogenicity and the limitations of existing detection methods. Traditional approaches, such as the rabbit pyrogen test (RPT) and the Limulus Amebocyte Lysate (LAL) assay, have served as gold standards for endotoxin detection. However, these methods are constrained by high costs, lengthy processing times, environmental concerns, and the need for significant reagent volumes, which limit their scalability and application in resource-limited settings. In this study, we introduce an innovative microfluidic platform that integrates the LAL assay within microdroplets, addressing the critical limitations of traditional techniques. By leveraging the precise fluid control and reaction isolation offered by microdroplet technology, the system reduces reagent consumption, enhances sensitivity, and enables high-throughput analysis. Calibration tests were performed to validate the platform's ability to detect LPS, using colorimetric measurements. Results demonstrated comparable or improved performance relative to traditional systems, achieving lower detection limits and greater accuracy. This work demonstrates a proof-of-concept miniaturisation of the pharmacopoeial LAL assay. The method yielded low intra-assay variability (σ ≈ 0.002 OD; CV ≈ 0.9% over n = 50 droplets per point) and a LOD estimated from calibration statistics after path-length normalisation. Broader adoption will require additional comparative validation and standardisation. This scalable, cost-effective, and environmentally sustainable approach offers a practical solution for endotoxin detection in clinical diagnostics, biopharmaceutical production, and environmental monitoring. The proposed technology paves the way for advanced LPS detection methods that meet stringent safety standards while improving efficiency, affordability, and adaptability for diverse applications.

DCC
Also flagged:Lactatemetabolismmembranesmonocarboxylate transportersMCT1ACC
Journal Article 2025-09-30 ✓ 5 Snippets Maculewicz E, Mastalerz A, Mróz A, Johne M, Krawczak-Wójcik K, Pabin A, Garbacz A, Komar K, Massidda M, Stastny P, Bojarczuk A.
In-Text Gene Mentions

…was associated withDCCin the overall…

…carriers showed higherDCCcompared with AA…

…ForDCC, calculated as the…

…ForDCC, the variant was…

…TG showed higherDCCthan GG (8.14…

Show Full Abstract

<h4>Background/objectives</h4>Lactate (LA) is a key metabolite in exercise metabolism, transported across cell membranes by monocarboxylate transporters (MCTs). Although genetic variation in <i>MCT</i> genes has been linked to LA kinetics, evidence in athletic populations remains limited. This study investigated nine MCT1 polymorphisms (rs4301628, rs12028967, rs10857983, rs3789592, rs10776763, rs1049434, rs6537765, rs7556664, rs7169) in relation to LA metabolism.<h4>Methods</h4>337 Polish and Czech males (elite athletes, sub-elite competitors, physically active controls) performed two maximal Wingate tests. Buccal swabs were collected for DNA extraction and single nucleotide polymorphism (SNP) genotyping. LA was assessed before and after the tests.<h4>Results</h4>Five variants (rs3789592, rs7556664, rs7169, rs1049434, rs6537765) remained significantly associated with LA measured 30 min after the second Wingate (LA30') and delta clearance capacity (DCC) in elites (codominant and recessive models: <i>p</i> = 0.01-0.03; false discovery rate (FDR)-adjusted <i>p</i> = 0.02-0.04). Rs10776763 showed the broadest associations, surviving FDR for LA30' in all models (<i>p</i> = 0.003-0.03; FDR-adjusted <i>p</i> = 0.01-0.03) and for LA accumulation capacity (ACC) in the recessive model (<i>p</i> = 0.01; FDR-adjusted <i>p</i> = 0.03). Rs12028967 also supported a clearance role, with LA30' significant in elites (<i>p</i> = 0.004; FDR-adjusted <i>p</i> = 0.01) and DCC in the overall cohort (<i>p</i> = 0.02; FDR-adjusted <i>p</i> = 0.03). In contrast, rs4301628 and rs10857983 demonstrated isolated LA30' effects in elites (<i>p</i> = 0.004-0.01; FDR-adjusted <i>p</i> = 0.01), and no production-phase endpoint other than rs10776763 survived FDR; ACC remained significant in the recessive model (<i>p</i> = 0.01; FDR-adjusted <i>p</i> = 0.03).<h4>Conclusions</h4>The results suggest that <i>MCT1</i> polymorphisms contribute to differences in LA metabolism and warrant replication in larger, more diverse cohorts.

Also flagged:oxygenmitochondrialsodiumazideComplex IVcarbonyl cyanide
Journal Article 2025-09-30 No Snippets Dennis N, Gourlay CW, Ezcurra M.
Show Full Abstract

Measurement of the oxygen consumption rate, or respirometry, is a powerful and comprehensive method for assessing mitochondrial function both <i>in vitro</i> and <i>in vivo</i>. Respirometry at the whole-organism level has been repeatedly performed in the model organism <i>Caenorhabditis elegans</i>, typically using high-throughput microplate-based systems over traditional Clark-type respirometers. However, these systems are highly specialized, costly to purchase and operate, and inaccessible to many researchers. Here, we develop a respirometry assay using low-cost commercially available optical oxygen sensors (PreSens OxoPlates<sup>®</sup>) and fluorescence plate readers (the BMG FLUOstar), as an alternative to more costly standard respirometry systems. This assay uses standard BMG FLUOstar protocols and a set of custom scripts to perform repeated measurements of the <i>C. elegans</i> oxygen consumption rate, with the optional use of respiratory inhibitors or other interventions. We validate this assay by demonstrating the linearity of basal oxygen consumption rates in samples with variable numbers of animals, and by examining the impact of respiratory inhibitors with previously demonstrated efficacy in <i>C. elegans</i>: carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (a mitochondrial uncoupler) and sodium azide (a Complex IV inhibitor). Using this assay, we demonstrate that the sequential use of FCCP and sodium azide leads to an increase in the sodium azide-treated (non-mitochondrial) oxygen consumption rate, indicating that the sequential use of respiratory inhibitors, as standard in intact cell respirometry, may produce erroneous estimates of non-mitochondrial respiration in <i>C. elegans</i> and thus should be avoided.

HFE
Also flagged:bile acidsliver cirrhosisbile acidillnessfailurechronic liver diseases
Journal Article 2025-09-30 ✓ 1 Snippet Doshi S, Sonawane P, Agrawal U, Munshi AA.
In-Text Gene Mentions

…inherited diseases likehemochromatosis[ 1 ].…

Show Full Abstract

The association of serum bile acid levels with liver cirrhosis severity is of interest. Hence, 100 patients were admitted, among them 50 patients had variable severity of liver cirrhosis and 50 patients were controls. Serum bile acid levels were measured and their association was also analyzed with clinical parameters like Child-Pugh score, MELD score and liver function tests. The results indicate that serum bile acid concentrations are strongly associated with the severity of liver cirrhosis and potentially as a disease progression biomarker. Thus, the clinical value of bile acids as a marker for the severity of liver cirrhosis is shown.

Also flagged:deathnecroptosisferroptosispyroptosisneurodegenerative disorderscaspase
Journal Article 2025-09-29 No Snippets Mathew NC, Park KK.
Show Full Abstract

Long non-coding RNAs have emerged as pivotal regulators of diverse biological processes, particularly in the modulation of regulated neuronal cell death pathways. This review highlights the roles of long non-coding RNAs in programmed neuronal cell death, focusing on apoptosis, necroptosis, ferroptosis, and pyroptosis. Dysregulation of these processes contributes to neurodegenerative disorders and neurological injuries, emphasizing the importance of understanding how long non-coding RNAs influence these pathways. Apoptosis, essential for neuronal development, can lead to pathology when misregulated. Necroptosis, a caspase-independent inflammatory process, involves the modulation of necrosome components. Pyroptosis, mediated by inflammasomes, affects inflammasome assembly and cytokine release. Ferroptosis, driven by iron accumulation and lipid peroxidation, is influenced by changes in antioxidant defenses. By detailing the roles of long non-coding RNAs in these mechanisms, this review underscores their therapeutic potential for mitigating neuronal loss.

Also flagged:neurodegenerative diseasesmitochondrialphosphorylationaginghistonepathogenesis
Journal Article 2025-09-29 No Snippets Fu T, Chen X, Zhang S, Fu Y, Huang L, Xiong W.
Show Full Abstract

The mitochondrial genomic homeostasis is essential for the function of the oxidative phosphorylation system and cellular homeostasis. Mitochondrial DNA is particularly susceptible to aging-related oxidative stress due to the lack of a histone coat. Disturbances in mitochondrial DNA may contribute to functional decline during the aging process and in neurodegenerative diseases, leading to further impairment of mitochondrial DNA and initiating a vicious cycle. To date, it remains unclear how disturbed mitochondrial DNA is involved in the etiology of pathological aging and neurodegenerative diseases. The purpose of this review is to clarify the crucial roles of mitochondrial DNA homeostasis in the pathogenesis of neurodegenerative diseases. Mitochondrial DNA is distributed within nucleoids and is then transcribed into polycistronic mitochondrial DNA molecules within the mitochondrial granule region. Within the ultrastructure of the mitochondrial nucleoid and granule, a group of essential mitochondrial proteins involved in DNA replication, DNA transcription, RNA translation, RNA surveillance, and RNA degradation plays a crucial role in maintaining mitochondrial structure, genome integrity, and mitochondrial DNA processing. The uniparentally inherited mitochondrial DNA undergoes heritable polyploid variations, which include homoplasmy and heteroplasmy. Accumulating mitochondrial DNA alterations, such as deletions, point mutations, and methylations, occur during the pathogenic processes of neurodegenerative diseases. The increased mitochondrial DNA alterations can be propagated by the rise of deleterious heteroplasmy in neurodegenerative diseases, ultimately resulting in impairment to the oxidative phosphorylation system, biogenesis defects, and cellular metabolic dysfunction. Therefore, developing appropriate gene editing tools to rectify aberrant alterations in mitochondrial DNA and targeting the key proteins involved in maintaining mitochondrial DNA homeostasis can be considered promising therapeutic strategies for neurodegenerative diseases. Although therapeutic strategies targeting mitochondrial DNA in diseases show great potential, challenges related to efficacy and safety require a better understanding of the mechanisms underlying mitochondrial DNA alterations in aging and neurodegenerative diseases.

Also flagged:α-synucleinmitochondrialParkinson's diseasemethylphenyl2
Journal Article 2025-09-29 No Snippets Tang X, He Y, Liang M, Ning P, Zhao J, Zhang Y, Yan X, Sun R, Wei G, Shen R, Huang F, Yu M.
Show Full Abstract

No abstract available.

Also flagged:Hedgehogferroptosisgestationto hypoxiamechanistic target of rapamycin complex 1fatty acid
Journal Article 2025-09-29 No Snippets Yi S, Huang M, Xian C, Kong X, Yin S, Peng J, Li H, Jiang Y, Xie B, Xie H.
Show Full Abstract

No abstract available.

Also flagged:signal transductionneurological diseasesmucinnerve injurycord injuryshort-chain
Journal Article 2025-09-29 No Snippets Yuan H, Shi J, Gu C, Yuan J, Huang C, Li X, Zhou K, Zhou K, Qi J.
Show Full Abstract

The brain-gut axis is a bidirectional signal transduction system between the gastrointestinal tract and the central nervous system that integrates neural, endocrine, and immune functions. In recent years, the role of the intestinal flora in regulating neural function and affecting the progression of different neurological diseases has received increasing attention. Akkermansia muciniphila is a mucin-degrading bacterium of the intestinal flora present in the intestinal mucus layer that can regulate host immunity, the intestinal barrier and neuroimmune homeostasis. In recent years, a growing body of literature has suggested that Akkermansia muciniphila may play beneficial roles in nerve injury and regeneration by regulating brain-gut axis signalling. This review comprehensively summarizes the latest research results on the role of Akkermansia muciniphila in neurological diseases such as spinal cord injury, multiple sclerosis, Parkinson's disease, and Alzheimer's disease. The mechanisms by which Akkermansia muciniphila regulates inflammatory cytokines, neurotransmitters, and short-chain fatty acids are also highlighted. Various Akkermansia muciniphila -based interventions, such as those involving outer membrane proteins, extracellular vesicles, and pasteurized Akkermansia muciniphila , are discussed, and their therapeutic potential in restoring intestinal homeostasis, alleviating neuroinflammation, and supporting neuronal repair is explored. Although promising results from animal models have been reported, significant challenges remain in translating these findings into clinical practice and therapeutic applications. The differences in Akkermansia muciniphila colonization efficiency, host responses, and intervention strategies in different disease states limit the results of these studies. In addition, Akkermansia muciniphila may exhibit different mechanisms of action in acute and chronic neurodegenerative diseases, and thus more targeted mechanistic studies are needed. Despite these limitations, Akkermansia muciniphila represents a novel and potent pathway for the modulation of the brain-gut axis to support neural repair and functional recovery. By enhancing intestinal barrier integrity and regulating neuroimmunity, Akkermansia muciniphila has broad prospects as a microbial candidate for the treatment of central nervous system diseases. Future research should focus on optimizing the administration method and clinical trials to verify its efficacy, ultimately providing new treatment options in the field of neural regeneration and microbial therapy.

PTGIS
Also flagged:polyunsaturated fatty acidmetabolismlaryngeal cancerfatty acidADH1BADH1A
Journal Article 2025-09-29 ✓ 5 Snippets Peng L, Ma H, Qin L, Zhao Q, Ren X, Wang Z, Hu J, Han H.
In-Text Gene Mentions

…ADH1A, ALDH7A1, CYP2J2,PTGIS) was linked with…

…ulations, particularly showingPTGISpositively correlated with…

…ALOXE3, HPGD, PTGDS,PTGIS) as candidate genes…

…EPHX2, HPGD, andPTGIS), 44 molecular drugs,…

…mRNAs (FADS1, ADH1B,PTGIS, CYP2J2, and ALDH7A1),…

Show Full Abstract

<h4>Objective</h4>This study aimed to explore potential associations between polyunsaturated fatty acid (PUFA) metabolism and laryngeal cancer (LC) using a combination of Mendelian randomization (MR) and integrative bioinformatics, while investigating its potential immunogenic implications.<h4>Methods</h4>Transcriptomic data from the GEO database were integrated to identify differentially expressed genes (DEGs) in LC. Gene Set Enrichment Analysis (GSEA) was performed in addition to Gene Ontology and KEGG enrichment analyses to characterize biological functions. MR analysis was employed to assess the potential causal link between PUFA metabolism and LC risk. PUFA-associated genes were screened for druggability using the DGIdb database. Furthermore, an lncRNA-miRNA-mRNA (ceRNA) regulatory network was constructed, and immune cell infiltration in LC was profiled using CIBERSORT with LM22 signature matrix to uncover immunoregulatory associations with PUFA pathway genes.<h4>Results</h4>A total of 730 DEGs were identified from a combined cohort of 30 LC and 31 normal samples. GSEA and enrichment analysis revealed significant involvement in fatty acid metabolism and immune-related pathways. MR analysis demonstrated a statistically significant but modest association between PUFA metabolism and LC risk (OR = 0.9996, 95% CI = 0.9992-0.9999, p = 0.020). A network of key PUFA pathway genes (e.g., ADH1B, ADH1A, ALDH7A1, CYP2J2, PTGIS) was linked with multiple drug targets. A focused sub-network of regulatory interactions among lncRNAs, miRNAs, and mRNAs was elucidated. Immune infiltration analysis revealed distinct correlations between pathway gene expression and immune cell populations, particularly showing PTGIS positively correlated with activated mast cells and negatively with naive B cells.<h4>Conclusions</h4>Our findings suggest a potential mechanistic link between PUFA metabolism and LC susceptibility, generating hypotheses that PUFA-associated pathways may modulate immune microenvironment characteristics. This computational study provides preliminary insights into potential immunometabolic therapeutic strategies in laryngeal cancer that warrant experimental validation.

MLLT10
Also flagged:Lymphoblastic LymphomaLeukemiaacute lymphoblastic leukemiaALLserous effusionsSE
Journal Article 2025-09-29 ✓ 1 Snippet Cui W, Ding X, Liu J, Hu P, Ma S, Yang C, Xu H.
In-Text Gene Mentions

…gene MLL::ENL and PLCALM::MLLT10, as well as…

Show Full Abstract

<h4>Introduction</h4>This study aimed to elucidate the spectrum of clinical manifestations, cytomorphology, immunophenotype, and the molecular genetic features of lymphoblastic lymphoma/acute lymphoblastic leukemia (LBL/ALL) in the context of serous effusions (SE).<h4>Methods</h4>A retrospective analysis evaluated the cytomorphological features, immunophenotype, and the cyto-histological correlations of twenty-one LBL/ALL associated with SE. Concurrently, bone marrow (BM) aspiration samples were analyzed using an integrated approach, including flow cytometry, reverse transcription PCR (RT-PCR), next-generation sequencing (NGS), or whole transcriptome sequencing (WTS).<h4>Results</h4>Of the 21 cases of SE LBL/ALL, 16 cases were T-LBL/ALL and 5 cases were B-LBL/ALL. The cases included 17 pleural, 2 peritoneal, and 2 pericardial fluid samples. Both T-LBL/ALL and B-LBL/ALL in SE exhibit a blast-like morphology, characterized by small to medium size, irregular nuclear membranes, and inconspicuous nucleoli, alongside frequent nuclear fragmentation and apoptotic bodies. LBL/ALL express immaturity markers such as terminal deoxynucleotidyl transferase (7/17, 41.2%), CD10 (6/12, 50%), CD43 (8/8, 100%), and CD99 (6/6, 100%). T-LBL/ALL and B-LBL/ALL specifically express T-cell markers (CD2 [3/6, 50%], CD3 [10/12, 83.3%], CD5 [2/11, 18.2%], CD7 [10/10, 100%]) or B-cell markers (CD20 [3/5, 60%], CD79a [4/4, 100%], PAX5 [5/5, 100%]), respectively. A high proportion of primitive and immature lymphocytes exceeding 25% in BM was observed in T-LBL/ALL (5/7) and in one case of B-LBL/ALL. No BCR/ABL gene rearrangements were detected in any cases. Furthermore, fusion gene MLL::ENL and PLCALM::MLLT10, as well as mutations in genes including WT1, NOTCH1, PAX5, IKZF, ARID1A, BCOR, SETD2, ARID2, TET2, JAK3, NF1, and CEBPA, were identified in LBL/ALL through RT-PCR, NGS, or WTS analyses.<h4>Conclusion</h4>The integration of clinical manifestations, cytological evaluation, and gene expression profiles is instrumental in achieving accurate diagnosis, subclassification, and prognosis of LBL/ALL within the context of SE.

Also flagged:WaterAdsorptionHydroxyapatiteMinocyclinedoxycyclinetetracycline
Journal Article 2025-09-29 No Snippets Soria-Martínez R, Rossi AM.
Show Full Abstract

Hydroxyapatite (HA) functionalized nanoparticles are particularly important in bone and tooth regeneration. This study continues previous work aimed at understanding the interaction of cycline antibiotics with different HA surfaces, now incorporating the effect of hydration on adsorption energies as calculated using density functional theory. The strength of these interactions was analyzed through the quantum theory of atoms in molecules (QTAIM). The adsorption isotherm of nearly stoichiometric HA followed Langmuir-Freundlich kinetics. Minocycline exhibited higher adsorption energy than doxycycline and tetracycline. The nonhydrated adsorption behavior of minocycline is compared to earlier results for doxycycline and tetracycline, while this study also evaluates adsorption on hydrated HA surfaces for all three molecules. Minocycline displays more stable adsorption than the others, in agreement with experimental findings. Our results reveal that the influence of water cannot be neglected: although it does not prevent cycline-HA interactions, it can stabilize previously unstable configurations through hydrogen bonding between cyclines and water molecules. QTAIM analysis indicates that a combination of electrostatic interactions and medium-to-strong covalent character governs the adsorption mechanism.

SUDS3
Also flagged:head and neck cancerUchl5head and neck squamous cell carcinomaHNSCCubiquitin C-terminal hydrolase 5extracellular
Journal Article 2025-09-29 ✓ 1 Snippet Fu C, Saddawi-Konefka R, Chinai JM, Kim SY, Kammula AV, Perera JJ, Jiang A, Tiwari P, Kistler EN, Tang S, Luna SM, Colvin KJ, Dubrot J, Anderson S, Fetterman RA, Chuong CL, Lane-Reticker SK, Cheruiyot CK, Muscato AJ, Alipour Z, Adkins DR, Griffin GK, Griffin GK, Bernstein BE, Egloff AM, Yates KB, Chernock RD, Gutkind JS, Uppaluri R, Manguso RT.
In-Text Gene Mentions

…Arid4a , andSuds3), EP300 (…

Show Full Abstract

Recurrent/metastatic head and neck squamous cell carcinoma (HNSCC) is an aggressive malignancy with a significant unmet need for enhancing immunotherapy response given current modest efficacy. Here, we perform an in vivo CRISPR screen in an HNSCC mouse model to identify immune evasion genes. We identify several regulators of immune checkpoint blockade (ICB) response, including the ubiquitin C-terminal hydrolase 5 (UCHL5). Loss of Uchl5 in tumors increases CD8<sup>+</sup> T cell infiltration and improved ICB responses. Uchl5 deficiency attenuates extracellular matrix (ECM) production and epithelial-mesenchymal-transition (EMT) transcriptional programs, which contribute to stromal desmoplasia, a histologic finding we describe as associated with reduced anti-PD1 response in human HNSCCs. COL17A1, a collagen highly and specifically expressed in HNSCC, mediates in part Uchl5-mediated immune evasion. Our findings suggest an unappreciated role for UCHL5 in promoting EMT in HNSCC and highlight ECM modulation as a strategy to improve immunotherapy responses.

Also flagged:atrial fibrillationAFcoronary artery diseaseheart failurecardiovascular diseasesheart diseases
Journal Article 2025-09-29 No Snippets Jordà P, Lai Y, Jeuken A, Lemieux Perreault LP, Goulet E, Lahrouchi N, Nozza A, Tanck MW, Guerra P, Cadrin-Tourigny J, de Denus S, Bezzina CR, Lettre G, Busseuil D, Dubé MP, Tardif JC, Tadros R.
Show Full Abstract

Common genetic variation detected by genome-wide association studies (GWAS) partially explains variability in the spectrum of cardiac phenotypes. In this work, we explore genetic correlations among 58 cardiac-related traits/diseases, detecting novel ones. We subsequently employ multi-trait analysis of GWAS (MTAG), which meta-analyzes genetically correlated traits, to improve genomic loci discovery and prediction in atrial fibrillation (AF), coronary artery disease (CAD), and heart failure (HF). We identify 19 novel loci specific for AF, 131 for CAD, and 141 for HF. Polygenic scores (PGS) in 15,177 Canadian individuals show similar results when PGS are derived from conventional GWAS versus MTAG summary statistics, although MTAG-PGS improve prediction and discrimination of CAD in females [∆R<sup>2</sup> 1.735% (95% Confidence Interval (CI): 0.609-2.856); Net reclassification index 0.208 (95%CI: 0.139-0.277)]. This work describes new relevant genetic correlations among cardiac-related traits/diseases and supports MTAG to improve loci discovery in common cardiovascular diseases and potentially improve the prediction of CAD in females.

HTT
Also flagged:amideALSagingamino aciddeathneurodegenerative diseases
Journal Article 2025-09-29 ✓ 5 Snippets Sun R, Zhuang Y, Lin Y, Hu F.
In-Text Gene Mentions

…The EGFP-Htt-Q74 plasmid was purchased…

…TheHtt-Q74 plasmid was obtained…

…sequence from the EGFP-Htt-Q74 plasmid.…

…fluorescence imaging ofHttproteins in live…

…and 500 ng EGFP-Htt-Q74 or Htt-Q74 plasmids…

Show Full Abstract

Biomolecular condensates enable the coordination of cellular activities with high spatiotemporal selectivity. Many techniques have been developed to characterize protein condensate. However, direct visualization of protein structure in phase-separated condensate remains underexplored. Here we develop in situ quantitative imaging of secondary structure in protein condensates by stimulated Raman scattering (SRS) microscopy. Characteristic spectra of four secondary structures are obtained from protein amide I vibration analysis. Hyperspectral SRS imaging reveals significant enrichments and disordered to ordered structural changes during phase separation of ALS-related proteins. Time-lapse imaging of protein aging process directly visualizes heterogeneous β-sheet formation on the condensate surface. And secondary structures of mutant proteins are imaged to correlate amino acid sequence to phase separation property. Live-cell label-free imaging of protein structure is further demonstrated to exhibit pronounced heterogeneity in subcellular aggregates. Therefore, our technique provides crucial molecular-level information to investigate protein phase separation and its transition in pathological aggregation.

HFE
Also flagged:Metabolic dysfunctionSteatotic Liver Diseasemetabolic syndromebile acidmetabolismMetabolic dysfunction-Associated Steatotic Liver Disease
Journal Article 2025-09-29 ✓ 1 Snippet Bahri MH, Navabian S, Akbari H, Bagherpour JZ, Bozorgmehr R, Mohammaditabar M.
In-Text Gene Mentions

…including those withhemochromatosisor kidney problems,…

Show Full Abstract

<h4>Background</h4>Cholecystectomy, a common surgery, may cause metabolic changes linked to bile acid metabolism. Early studies suggest a possible link between cholecystectomy and Metabolic dysfunction-Associated Steatotic Liver Disease (MASLD) and metabolic syndrome, but findings are inconclusive. This 6-month study aimed to assess how elective cholecystectomy affects metabolic syndrome development and MASLD progression in a Middle Eastern population.<h4>Methods</h4>Participants included 51 patients undergoing elective cholecystectomy and 49 matched controls. MASLD grade and metabolic syndrome status were assessed at baseline and six months post-intervention using ultrasonography and standard clinical criteria.<h4>Results</h4>A total of 100 patients were included in the present study, with 51 assigned to the cholecystectomy group and 49 to the control group. Over a six-month follow-up period, individuals in the cholecystectomy group experienced a significant decrease in body mass index (BMI) (p < 0.05) and fasting blood sugar (FBS) levels (p < 0.05). However, this group also exhibited a significant increase in systolic blood pressure (SBP) and diastolic blood pressure (DBP) (p < 0.05). In contrast, the control group showed significant improvements in FBS (p < 0.05) and HDL cholesterol levels (p < 0.05). Logistic regression analysis revealed that undergoing cholecystectomy was linked to a higher likelihood of developing metabolic syndrome (OR = 9.63, p < 0.05).<h4>Conclusions</h4>Our findings highlight the potential metabolic implications of cholecystectomy. Cholecystectomy was associated with reduced BMI and improved fasting glucose but significantly increased blood pressure over 6 months. Highlighting the need for careful metabolic monitoring post-surgery.

SUDS3
Also flagged:methylationmethylmercurySLC5A7L-type amino acid transporter 1LAT1transcription factor
Journal Article 2025-09-29 ✓ 1 Snippet Weinhouse C, Perez L, Ryde I, Goodrich JM, Miranda JJ, Hsu-Kim H, Murphy SK, Meyer JN, Pan WK.
In-Text Gene Mentions

…histone modifications (e.g.,polycomb repressiverepressive complex components…

Show Full Abstract

<h4>Background</h4>Epigenome-wide association studies (EWAS) are a highly promising approach that can inform precision environmental health. However, current EWAS are underpowered and increasing sample sizes will require substantial resources. Therefore, alternative approaches for identifying candidate biomarkers through EWAS are critical. Here, we provide proof of principle that maximizing exposure variance in EWAS enables effective candidate biomarker detection, even in small sample sizes.<h4>Methods</h4>We profiled genome-wide DNA methylation in whole blood from individuals from Madre de Dios, Peru, with either high methylmercury (MeHg) exposure (> 10 µg/g total hair mercury; N = 16) or low MeHg exposure (< 1 µg/g total hair mercury; N = 16).<h4>Results</h4>We identified nine differentially methylated CpG sites (FDR < 0.05), which is comparable to the number identified by much larger EWAS. The most significantly different CpG site was in an intronic enhancer of the SLC5A7 gene, which encodes the L-type amino acid transporter 1 (LAT1) that facilitates MeHg transport. Our Gene Ontology and transcription factor motif enrichment analyses identified genes involved in outcomes linked to MeHg toxicity, including immune response, neurotoxicity, and type 2 diabetes (T2D).<h4>Conclusions</h4>Similar EWAS in global populations with known high exposure variance can be leveraged to develop targeted, custom sequencing panels and microarrays limited to replicated, validated biomarkers of a given exposure.

LRRC7
Also flagged:meningitissepticaemiadeathsecretionCT3pore-forming
Journal Article 2025-09-29 ✓ 2 Snippets Wu H, Wu Y, Bai Q, Liang Z, Zhu X, Pan X, Liu M, Yao H, Ma J, Wu Z.
In-Text Gene Mentions

…the DUF3130-DUF3958 pair (Lap1–Lap2), the DUF5344-DUF5082 pa…

…WXG100-like protein pairsLap1–Lap2, as well as…

Show Full Abstract

<h4>Background</h4>Streptococcus suis poses a significant threat to both humans and pigs, causing severe disease such as meningitis, septicaemia, and sudden death. The type VII secretion system (T7SS) plays a crucial role in exporting effectors that mediate bacterial competition and colonization in polymicrobial environments. Although Leu-x-Gly (LXG) polymorphic toxins are among the main effectors secreted by the T7SS, the mechanism underlying their secretion remains to be fully elucidated.<h4>Results</h4>Here, we identified a complex repertoire of LXG effectors in S. suis, comprising at least five distinct LXG-domain groups and 14 C-terminal toxin types. We focused on one LXG effector, LXG1-CT3, from the virulent strain WUSS351, demonstrating its pore-forming activity and essential role in S. suis competition and virulence. Additionally, we discovered that a small protein family, DUF4176, partners with each cognate C-terminal toxin, stabilizing the corresponding LXG effector prior to secretion, thereby enhancing bacterial competitiveness.<h4>Conclusions</h4>These findings deepen our understanding of S. suis competition and pathogenesis, while offering new insights into the T7SS-mediated secretion of LXG effectors.

TNFSF4
Also flagged:propionatemetabolismcancersovarian cancerGene ExpressionOC
Journal Article 2025-09-29 ✓ 1 Snippet Ni J, Qiu J, Ma Y.
In-Text Gene Mentions

…checkpoints, including TGFB1,TNFSF4, VEGFB, TNFRSF14 and…

Show Full Abstract

<h4>Background</h4>Related studies have shown that propionate metabolism-related genes (PMRGs) were associated with the progress of cancers. However, the roles of PMRGs in ovarian cancer (OC) were unclear.<h4>Methods</h4>In this study, OC-related transcriptome data and clinical information were extracted from The Cancer Genome Atlas (TCGA),Genotype-Tissue Expression (GTEx) and Gene Expression Omnibus (GEO) databases. Firstly, the differentially expressed genes (DEGs) between OC and healthy control (HC) samples were screened by differential expression analysis. Then, the differentially expressed PMRGs (DE-PMRGs) were obtained by intersecting the DEGs with PMRGs. Next, the enrichment analyses of DEGs and DE-PMRGs were conducted to investigate the functions. Moreover, the biomarkers of OC were screened and the risk score was calculated. Then, the nomogram predicting the survival of OC was constructed. Furthermore, the tumor microenvironment analyses and drug sensitivity analysis were proceeded. In addition, the transcription factor (TF)-mRNA regulatory network was constructed to reveal the potential molecular-level regulation of biomarkers. Additionally, the expression levels of biomarkers in IOSE-80, OVCA429, hey and OVCAR-8 were detected through the Quantitative Real-time Polymerase Chain Reaction (qRT-PCR). Immunohistochemistry (IHC) was performed to validate the protein expression of key biomarkers (CETP, ALDH5A1, and PTH) in ovarian cancer tissue microarrays.<h4>Results</h4>Totals of 280 DE-PMRGs were obtained by intersecting the 9,466 DEGs and 531 PMRGs, and these genes were associated with steroid and fatty acid metabolic process. Five biomarkers (ALDH5A1, CETP, GRIA1, PTH, and TPMT) were identified, and the nomogram was constructed with risk score, age and TMB. Among them, GRIA1 was a negative factor, while age and risk score were negatively associated with patients' survival. Noticeable, the tumor purity was low and the level of immune escape was high in OC groups. Besides, AKT.inhibitor.VIII,A.443654,LFM.A13,BMS.509744 and BMS.536924 were positively associated with the risk score. Furthermore, the TF-mRNA regulatory network of OC was constructed, among them, EGR1 was the key TF which could regulate ALDH5A1 and TPMT simultaneously. The qRT-PCR proved the up-regulated expression levels of ALDH5A1, CETP, PTH and TPMT in OVCA429, hey and OVCAR-8. IHC results confirmed significantly higher protein expression of CETP, ALDH5A1, and PTH in ovarian cancer tissues compared to normal controls (p < 0.05), further validating their roles as potential prognostic biomarkers.<h4>Conclusion</h4>This study identified 5 biomarkers associated with the prognosis of OC, which might be helpful in understanding the roles of PMRGs in the development of OC in depth. The IHC validation provided additional evidence at the protein level, reinforcing the clinical relevance of these findings.

HFE
Also flagged:genetic disordersRNF43kidney diseaseadult diseasesdiabetesdyslipidemia
Journal Article 2025-09-29 ✓ 5 Snippets Bakur K, Hamid H, Alhaddad B, Alfadhel M, Alhashem A, Eyaid W, Alanzi T, Al Mutairi F, Alswaid A, Ababneh F, Al Ghamdi M, Mohamed S, Alaskar A, Alqahtani F, Alzaidan H, Al-Owain M, Faqeih EA, Mushiba AM, Alanazi R, Almoallem B, Alsaleh NS, Al Tala S, Alshammari M, Turkistani A, Gosadi G, Hakami F, Alobaid F, Al Rukban H, Alfaidi A, Ba-Abbad R, Almuqbil MA, Al-Boukai A, Alamri AS, Alshehri A, Sulaiman RA, Almontasheri A, Danish E, AlSagheir A, Aljeaid D, Al-Awam BS, Shawli A, Al-Otaibi M, Majdali WS, Azher ZA, Almannai M, Baalawi W, Saudi Adult Genomics Group, AlAbdi L, Benoukraf T, Alkuraya FS.
In-Text Gene Mentions

…novel RNF43 -relatedhemochromatosis, NFXL1 -related syndrome…

…novel link tohemochromatosis.…

…tested negative forHFEas a potential…

…of their unexplainedhemochromatosis.…

…important cause ofhemochromatosisin our local…

Show Full Abstract

<h4>Background</h4>Clinical exome and genome sequencing has transformed the diagnostic workup of patients with genetic disorders. The extensive body of evidence supporting the application of this clinical genomics approach in pediatric patients stands in stark contrast to the relative paucity of evidence for its use in the adult population. Here, we describe the largest cohort to date of adult patients who underwent clinical exome and genome sequencing for suspected genetic diagnoses.<h4>Methods</h4>A total of 2763 adult patients (2529 families) from all regions of Saudi Arabia are included in this cohort (2202 exomes, and 561 genomes).<h4>Results</h4>The diagnostic rate is 38.9% spanning 535 Mendelian genes and revealing clinical diagnostic errors in 38% of patients with positive reports. Structured feedback using C-GUIDE demonstrates clinical utility in 90% of positive cases. Consistent with the highly consanguineous nature of the local population, the majority (61%) of diagnosed phenotypes are recessive (94.6% homozygous) and founder variants account for 85% (414/487) of these variants. The same population characteristic has also led to the encounter of extremely rare, even novel recessive disorders including a highly penetrant novel RNF43-related hemochromatosis, NFXL1-related syndrome of hyperlaxity, short stature, and kidney disease, as well as autosomal recessive forms of typically dominant disorders. Multilocus phenotypes are observed in 5% of cases although only 26.7% of these are caused by two recessive variants. That 70% of molecular diagnoses encountered in our cohort are typically described in pediatric patients allowed us to observe highly unusual clinical presentations in the adult population. This delayed diagnosis also represents a missed opportunity for effective treatment in many instances and we note the availability of treatment for 26% of diagnosed conditions. Of particular interest are patients with monogenic disorders that could be overlooked as common multifactorial adult diseases (e.g., diabetes, dyslipidemia, stroke, chronic kidney disease, and dementia). Finally, we note the opportunities of deploying adult clinical genomics in an underrepresented population where 45.5% (373/819) of encountered variants are completely absent in gnomAD.<h4>Conclusions</h4>Our results illustrate numerous benefits of a clinical genomics approach in adult medicine and argue for a broader implementation than currently practiced.

HTT
Also flagged:pathogenesisagingneurodegenerative disordersAlzheimer's diseaseParkinson's diseaseMultiple Sclerosis
Journal Article 2025-09-29 ✓ 1 Snippet Su Y, Su Z.
In-Text Gene Mentions

…in the huntingtin (HTT) gene located on…

Show Full Abstract

Neuroinflammation plays a critical role in the pathogenesis of aging-related neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, and Multiple Sclerosis. It involves the activation of glial cells and the release of pro-inflammatory mediators and reactive oxygen and nitrogen species, which, when chronically sustained, contribute to neuronal damage and cognitive decline. Recent evidence suggests that regular physical exercise exerts neuroprotective effects by modulating neuroinflammatory pathways and enhancing brain health. Exercise has been shown to regulate the activity of microglia and astrocytes, strengthen the blood-brain barrier, and reduce systemic and gut-derived inflammation-all of which are implicated in the progression of neurodegeneration. Additionally, exercise influences inflammasome signaling, a key component in the innate immune response, further mitigating inflammation-induced neuronal injury. This review summarizes current findings on the impact of physical activity on inflammation and inflammasome pathways in aging-related neurodegenerative diseases, highlighting the therapeutic potential of exercise as a non-pharmacological intervention. Further research is warranted to optimize exercise protocols for maximal neuroprotective benefits.

Also flagged:Mild traumatic brain injuryposttraumatic amnesiafamilial hemiplegic migraineFHM) type 1migrainecalcium channel
Journal Article 2025-09-29 No Snippets Sun C, Ma D, Hansen J, Tonniges JR, Hu H, Zhang L, Gu C.
Show Full Abstract

All cells in the central nervous system (CNS) are considered mechanosensitive, but how they collectively respond to a concussive head impact and contribute to the transition from the primary to secondary injury remains unknown. Using a mouse model for mild traumatic brain injury (mTBI) or concussion, we report that blocking the activity of TRPV4 transient receptor potential channels inhibits mTBI-induced sequential changes of neurons and glial cells, as well as behavioral disturbances. A concussive head impact immediately induces axonal varicosities, preceding NMDA-receptor-mediated microglial activation and cortical demyelination. Afterward, these changes differentially and partially recover. Blocking TRPV4 channels before or after head impact markedly suppresses axon-glial and behavioral changes or enhances their recovery, respectively. Using knockout mice and AAV-Cre-mediated acute and cell-type-specific deletion, we further show that neuronal TRPV4 channels, as an mTBI target, regulate the homeostasis of axon mechanosensation and their hyperactivation causes axonal varicosity formation followed by axon-to-glia mechanotransduction.

Also flagged:deatherrors ofmetabolismneurodegenerative diseaseslysosomal diseasesvCJD
Journal Article 2025-09-29 No Snippets Verity CM, Maunder PJ, Winstone AM, Pal S.
Show Full Abstract

<h4>Aim</h4>To study the neurodegenerative diseases that cause progressive intellectual and neurological deterioration (PIND) in children in the UK.<h4>Method</h4>This active prospective epidemiological study asked UK paediatricians to notify all childhood cases of PIND via the British Paediatric Surveillance Unit. Clinical data were obtained using a questionnaire or via a site visit. An independent PIND study Expert Group classified the cases.<h4>Results</h4>Between May 1997 and April 2024 (27 years), 2373 children with PIND were identified who had an underlying diagnosis to explain their deterioration. There were six cases of variant Creutzfeldt-Jakob disease plus 2367 children (1265 males, 1102 females) with other diseases. The lifetime risk of having a diagnosed disease causing PIND was 0.1 in 1000 live births. Asian British children made up 28.6% of the 2183 cases with known ethnicity. Excluding variant Creutzfeldt-Jakob disease, diagnosed children had 259 diseases, identified before death in 99% of children (only 39 were known to have had postmortems). Increasingly, diagnosis was made using genetic studies. Sixty-one per cent (157 of 259) of the diseases were inborn errors of metabolism, affecting 78% of diagnosed children. There were 43 lysosomal diseases.<h4>Interpretation</h4>This unique epidemiological study of many rare childhood neurodegenerative diseases provides valuable practical information about the presentation, clinical features, and inheritance of these complex disorders.

CCPG1DDX27
Also flagged:colorectal cancerP53tumorsferroptosisTGF-βWNT
Journal Article 2025-09-29 ✓ 2 Snippets Wu J, Liu L, Chang Y, Duan X, Chen X, Li H, Wang Z, Guo L, Yin J.
In-Text Gene Mentions

…rRNA processing (UTP25,DDX27, UTP23, RRP1, DDX21,…

…CHTF18, ARPP19, CHAF1B,CCPG1, PSME3, MCM3, MCM4,…

Show Full Abstract

<h4>Background</h4>Colorectal cancer metastasis, especially liver metastasis, is characterized by significant intricate diversity and remains a major contributor to patient mortality. Despite its clinical importance, the precise molecular mechanisms driving metastasis remain poorly understood.<h4>Methods</h4>To investigate the molecular drivers of metastasis heterogeneity, we performed a comprehensive proteomic analysis of non-metastatic (NM) colorectal cancer tissues, as well as metachronous (MM) and synchronous (SM) metastatic tissues.<h4>Results</h4>Our analysis revealed distinct biological features associated with colorectal cancer liver metastasis. Notably, we identified P53-mediated hyperproliferation as a common initiating factor in the occurrence of CRC. Additionally, metabolic dysregulation emerged as a key hallmark of CRC liver metastasis. Importantly, MM tumors exhibited suppressed ferroptosis and activation of the TGF-β signaling pathway, while SM tumors displayed inhibited anoikis and activation of the WNT signaling pathway, accompanied by activated angiogenesis. Most strikingly, CEACAM6 was identified as the only protein exhibiting a stepwise decrease in expression from NM to MM and further to SM, underscoring its unique role in metastatic progression.<h4>Conclusions</h4>These findings provide new insights into the molecular complexities underpinning colorectal cancer liver metastasis. Our identification of CEACAM6 as a differential marker highlights its potential as a diagnosis marker and therapeutic target, offering new avenues for the treatment of metastatic CRC.

Also flagged:ThioldoxorubicinmembraneHKendocytosisphosphorothioate
Journal Article 2025-09-29 No Snippets Bouffard J, Bayard F, Sakai N, Matile S.
Show Full Abstract

Liposomes made from phosphorothioate lipids are shown to penetrate cells better and differently than conventional phosphodiester liposomes. DSP<sub>S</sub>C phosphorothioate liposomes are synthesized, characterized and labeled with either internal doxorubicin or membrane-bound flippers. Inhibition experiments reveal that their penetration of HK cells is independent of endocytosis and occurs by thiol-mediated uptake (TMU). Dynamic covalent exchange with phosphorothioate sulfurs as pseudo-thiolates is confirmed and explored to modify liposomes and activate TMU. Mechanosensitive flipper probes and colocalization experiments reveal that phosphorothioate liposomes cross the plasma membrane in intact form with negligible endocytosis and little fusion. In the cytosol, fast-emitting flipper probes and non-released doxorubicin in punctate objects that partially co-localize with lipid droplets but not lysosomes suggest that the liposomes apparently stay at least partially intact and incorporate disorganizing lipid components from lipid droplets. In clear contrast, conventional DSPC liposomes bind to the cell surface in intact form and neither fuse nor cross the plasma membrane. These results support and translate recent insights from cell-penetrating oligonucleotides to phosphorothioate lipids, highlight the importance of understanding the dynamic covalent chemistry of phosphorothioates, and identify flipper dendrons as promising tools to elucidate liposomal delivery.

OLFM4
Also flagged:infectiondegranulationoxygenextracellularinflammatory responsesmembrane receptors
Journal Article 2025-09-29 ✓ 5 Snippets Hua Y, Zhou Z, Zhang C, Fang H, Wu M, Chen Z, Ku X, Yan W.
In-Text Gene Mentions

…FCGR3B, QPCT, andOLFM4( Fig. 4…

…TCN1, LRG1, andOLFM4), gelatinase granule markers…

…LCN2, LTF, andOLFM4), and gelatinase granules…

…FCN1, QPCT, andOLFM4) commonly showed an…

…as MMP9, MMP8,OLFM4, and LCN2, Supplemental…

Show Full Abstract

Neutrophils respond rapidly to inflammation and infection via defense mechanisms, including degranulation, reactive oxygen species production, and neutrophil extracellular trap formation (known as "NETosis"). As the most abundant neutrophil components, granule proteins constitute the major mediators of neutrophil effector functions and likely orchestrate their functional diversity. However, a systematic profile of these proteins, particularly their temporal release dynamics during inflammatory responses, remains uncharacterized. Here, we performed a "multistate" proteomic study to explore circulating neutrophils' dynamic responses to diverse infectious and inflammatory signals over time. Circulating neutrophils exhibited both conserved and stimulus-specific protein expression programs. Through integrated characterization of the cellular and secretory proteome landscapes, we delineated the release patterns of canonical granule proteins and identified inflammatory mediators, including soluble membrane receptors. Notably, granule membrane receptors were translocated to the cell surface and shed via proteolytic cleavage, highlighting their dynamic regulation and diversity. These findings revealed the complexity of the neutrophil degranulation program, demonstrating its stimulus-dependent and temporally layered nature. Our study provides a functional atlas of neutrophil degranulation upon inflammation, which would strengthen our understanding of neutrophil activation in inflammation and facilitate the exploration of inflammation management therapies.

OLFM4
Also flagged:MetabolismGene expressionvitamin Acarotenoidvitamin B12fatty acid
Journal Article 2025-09-29 ✓ 1 Snippet Tang Y, Lu P, Chowanadisai W, Smith BJ, Salak-Johnson JL, Lucas EA, Clarke SL, Conway T, Tang M, Lin D.
In-Text Gene Mentions

Olfm4

Show Full Abstract

<h4>Background</h4>The ileum integrates nutrient absorption with mucosal immunity, yet its cell-type-specific functions remain poorly defined. Disruption of epithelial or immune pathways contributes to nutrient deficiency, Crohn's disease, and impaired barrier integrity. Single-cell RNA sequencing (scRNA-seq) provides the resolution needed to uncover epithelial differentiation and immune crosstalk that bulk approaches cannot resolve.<h4>Objectives</h4>This study aimed to map ileal cellular heterogeneity and define epithelial differentiation, nutrient metabolism programs, and epithelial-immune interactions relevant to health and disease.<h4>Methods</h4>scRNA-seq was performed on ileal cells from 8-wk-old male C57BL/6J mice. Gene expression and clustering were analyzed using Seurat, with pseudotime trajectory, cell-cell communication, and pathway enrichment analyses applied to characterize intestinal dynamics.<h4>Results</h4>A total of 32,076 ileal cells were identified, including 6 epithelial types and multiple immune populations. Enterocyte subclusters showed distinct nutrient-related functions: Ent_C1, C4, C7, and C8 were enriched for vitamin A absorption; Ent_C0, C1, C2 and C7 for carotenoid metabolism; and Ent_C1, C4, C7, C8, and C9 for vitamin B12 absorption. Coexpression of β-carotene oxygenase 2 (Bco2) and IL 18 (Il18) occurred across enterocytes, stem cells, and goblet cells, whereas noncanonical goblet cells exhibited high Bco2-Il18 expression together with signatures of fatty acid metabolism and stress responses. Plasmacytoid dendritic cells were identified as central regulators of immune-epithelial interactions.<h4>Conclusions</h4>This study provides the first integrated single-cell atlas of the mouse ileum, profiling both epithelial and immune cells and revealing nutrient metabolism programs and epithelial-immune crosstalk relevant to intestinal health and disease.

SOX6
Also flagged:-determination
Journal Article 2025-09-29 ✓ 1 Snippet Zhuang X, Wen B, Chen Z.
In-Text Gene Mentions

…four core genes (sox6, wnt7ba, gnrhr4, and…

Show Full Abstract

The recent resolution of the koi carp (Cyprinus carpio) genome framework through high-throughput sequencing has enabled novel insights into sex determination mechanisms. Whole-genome resequencing (WGS) was performed on koi carp, yielding 1,341,975 high-quality SNPs. Integrated analyses, including gene annotation, GO functional classification, and KEGG pathway enrichment, identified four core genes (sox6, wnt7ba, gnrhr4, and mrps30) significantly associated with vertebrate sex-determination pathways. Validation through PCR-RFLP and Sanger sequencing confirmed that SNP3, a sexually dimorphic locus within the exon region of gnrhr4, demonstrated a sex identification accuracy of 100 % (n = 20).This study not only provides a practical molecular marker for sex-controlled breeding but also advances the theoretical understanding of epigenetic regulatory networks underlying sex determination in teleost fishes.

HFE
Also flagged:bloodstream infectionsadhesion factorscheWmotAflgCprotein secretion
Journal Article 2025-09-29 ✓ 1 Snippet Chen H, Fang Q, Zheng L, Wu Y, Liang W.
In-Text Gene Mentions

…with liver diseases,hemochromatosis, or Mediterranean anemia…

Show Full Abstract

<h4>Objective</h4>This study analyzes the characteristics and clonal dynamics of <i>Vibrio vulnificus</i> isolated from a Chinese hospital between 2021 and 2024.<h4>Methods</h4>We performed whole genome sequencing (WGS) on the six collected <i>Vibrio vulnificus</i> isolates. Antibiotic susceptibility testing was conducted using the bioMérieux automated antimicrobial susceptibility testing system. The clonal dynamics were studied through phylogenetic analysis, and the clinical diagnostic value indicators for bloodstream infections (BSI) were evaluated using the receiver operating characteristic (ROC) curve.<h4>Results</h4>The six <i>Vibrio vulnificus</i> strains collected in this study were phylogenetically closely related, including two of sequence type ST678 and one each of ST696, ST675, ST607, and ST367. All strains tested positive for the <i>vcgC</i> gene; five were positive for 16S rRNA type A, and one showed type AB. Virulence gene profiling revealed that the strains universally carried exotoxins (VvhA, RTX), adhesion factors (TadZ/CpaE, IlpA, VWA), and motility-associated genes (cheW/R, motA, flgC). Notably, one strain harbored a broader array of virulence factors, including effector protein secretion systems (ompA, vipA/tssB, sciN/tssJ), biofilm formation-related genes (mrkA/B/C), and siderophores (fepA/B, entE/F, iucA/B), which may significantly enhance its pathogenicity. According to CLSI guidelines for <i>Vibrio</i> spp. all isolates were resistant to ampicillin but susceptible to third-generation cephalosporins, carbapenems, tetracyclines, quinolones, and folate pathway inhibitors. ROC curve analysis showed that high-sensitivity C-reactive protein (HS-CRP), lactate (Lac), procalcitonin (PCT), and other indicators were of good clinical value for the early diagnosis of bloodstream infection caused by <i>Vibrio vulnificus</i>.<h4>Conclusion</h4>This study represents the inaugural whole-genome sequencing research conducted on <i>Vibrio vulnificus</i> isolates from eastern China. It comprehensively examines the current species, antibiotic resistance, virulence genes, and clinical characteristics of infected individuals, elucidating the pathogenic mechanisms and epidemiological features of <i>Vibrio vulnificus</i>. The findings offer essential references for clinical diagnosis and treatment.

SERPINC1
Also flagged:Interleukin-1 ReceptorPsoriasisNon-Alcoholic Fatty Liver DiseaseNAFLD-imiquimod
Journal Article 2025-09-29 ✓ 1 Snippet Shuai C, Cheung S, Zhang L, Cao H, Yuan Y, Ge Q, Wang Y, Li X, Zheng J, Xue F.
In-Text Gene Mentions

…p = 0.037),Antithrombin-III(OR IVW =…

Show Full Abstract

<h4>Background</h4>Epidemiological studies have revealed a close association between psoriasis and non-alcoholic fatty liver disease (NAFLD), but the causal relationship and underlying mechanisms remain unclear.<h4>Materials and methods</h4>In this study, we used genome-wide association study (GWAS) data from the MRC Integrative Epidemiology Unit (MRC-IEU) to investigate the causal relationship between psoriasis and NAFLD, as well as potential mediators. Two-sample and two-step MR analyses were conducted, followed by bulk and single-cell transcriptomic analyses to validate our MR findings. In vivo validation was performed using Enzyme-Linked Immunosorbent Assay (Sample of patients (n=10)), immunohistochemistry, and liver bulk transcriptomic analysis.<h4>Results</h4>The two-sample MR analysis revealed that genetically predicted psoriasis significantly increased the risk of NAFLD (OR = 1.07, 95% CI = 1.03-1.12, <i>p</i> = 0.001). Mediation analysis suggested that psoriasis was associated with elevated plasma Interleukin-1 receptor antagonist protein (IL-1RA) levels (OR = 1.02, 95% CI = 1.00-1.05, <i>p</i> = 0.031), which in turn raised the risk of NAFLD (OR = 1.15, 95% CI = 1.04-1.27, <i>p</i> = 0.006). In vivo experiments demonstrated elevated IL-1RA levels in the skin and plasma of psoriasis patients. Similarly, imiquimod (IMQ)-induced psoriasis mouse models exhibited increased IL-1RA levels in plasma and liver, accompanied by liver inflammation. MR and colocalization analysis indicated a positive correlation between IL-1RA, apolipoprotein B, and cholesterol.<h4>Conclusion</h4>Our study demonstrates that genetically predicted psoriasis increases the risk of NAFLD, and plasma IL-1RA may serve as a potential mediator between psoriasis and NAFLD.

PRDX6
Also flagged:FerroptosiscancerirondeathlipidGlutathione Peroxidase 4
Journal Article 2025-09-29 ✓ 4 Snippets Kalishwaralal K, Patil P, Mali A.
In-Text Gene Mentions

…and Peroxiredoxin 6 (PRDX6), as critical modulators…

…GPX4, TXNRD1 andPRDX6constitute a complementary…

…or disruption ofPRDX6-mediated selenium trafficking…

…GPX4, TXNRD1, andPRDX6, suggesting their potential…

Show Full Abstract

<h4>Objective</h4>Ferroptosis is an iron-dependent, non-apoptotic form of metabolic cell death driven by lipid peroxidation. While Glutathione Peroxidase 4 (GPX4) is the canonical ferroptosis suppressor, recent evidence highlights additional selenoproteins, including Thioredoxin Reductase 1 (TXNRD1) and Peroxiredoxin 6 (PRDX6), as critical modulators of ferroptotic sensitivity. We compared three mechanistically distinct ferroptosis inducers, RSL3 (a covalent GPX4 inhibitor), auranofin (a TXNRD1 inhibitor), and artesunate (ART; a pro-oxidant derivative of artemisinin), in MDA-MB231, A549 and HepG2 cell lines.<h4>Method</h4>Cell viability (MTT) and wound-healing assays quantified cytotoxic and anti-migratory effects. Our inhibitor study using Ferrostatin-1(Ferro) and Liproxstatin-1(Lipo), in combination with ferroptosis inducers, confirmed the specificity of ferroptosis. Beyond GPX4, TXNRD1 and PRDX6 constitute a complementary selenium-dependent axis safeguarding cancer cells from ferroptosis. Dual targeting of GPX4 and TXNRD1, or disruption of PRDX6-mediated selenium trafficking, potentiates ferroptosis death and impedes metastatic traits.<h4>Results</h4>Using in silico methods, we confirmed the interaction between drug and protein molecules. Among the tested compounds, RSL3 and auranofin exhibited strong binding affinity towards all the targeted proteins, including GPX4, TXNRD1, and PRDX6, suggesting their potential as effective ferroptosis pathway inhibitors.<h4>Conclusions</h4>These findings nominate multi-selenoproteins inhibition as a promising strategy to overcome ferroptosis resistance.

Also flagged:SynthesisGlycosphingolipidssphingolipidcancertumorinfections
Journal Article 2025-09-29 No Snippets Dong L, Cao Z, Han W, Wu Z.
Show Full Abstract

Glycosphingolipids (GSLs) constitute the most structurally diverse subgroup of the sphingolipid family and play crucial roles in a wide variety of cellular functions. The expression of GSLs is tightly controlled during development, with each GSL series exhibiting distinct functional roles in adhesion or signaling, depending on cell type. Genetic defects in lysosomal GSL-degrading enzymes result in GSL storage disorders. However, aberrant and increased expression of GSLs has also been observed in various cancer cells, promoting tumor survival and impairing anti-tumor immunity. Additionally, viruses, pathogens, and bacterial toxins have been found to bind to host GSLs. Therefore, inhibiting GSL synthesis could be a potential therapeutic strategy for such infections or cancers. Here, we discuss the synthesis and classification of GSLs and review their role in disease and treatment.

Also flagged:mucusendocytosislactic acidethylene glycolpaclitaxelester
Journal Article 2025-09-29 No Snippets Liu K, Zhao P, Chen Y, Zhang Y, Jin J, Wan T.
Show Full Abstract

The primary challenge in developing oral nanocarriers lies in achieving a balance between mucus penetration and cellular endocytosis. Overcoming this dilemma tends to require multiple surface properties on design of nanocarriers, but it is not favorable to clinical translation due to the complex preparation procedure and availability of commercial material. Herein, we innovatively constructed a hydrophilic-lipophilic balanced micelles only composed of poly (lactic acid)-b-poly (ethylene glycol) (PLA-PEG) or poly (lactic acid)-b-poly (carboxybetaine) (PLA-PCB) for oral delivery. The hydrophobic core of micelles was reasonably exposed by adjusting the size and the molar mass ratio of hydrophilic to hydrophobic segment of polymer, and significantly enhanced cellular internalization were observed in both micelles. In addition, the hydrophobic force driven by the core of micelles was multiply confirmed as the primary factor in enhancing cellular uptake, while time-dependent endocytosis of micelles was also verified. Although the hydrophilic segment of micelles exhibited limited functionality during the adsorption-endocytosis process of micelles, their construction could significantly mediate the intracellular trafficking process. Both <i>in vivo</i> and <i>ex vivo</i> imaging suggest that micelles exhibited good retention abilities in small intestine as well as colon after gavage administration. Remarkably, the oral bioavailability of paclitaxel (PTX) in both PTX-loaded micelles exceeded 29 % and exhibited significant oral antitumor efficacy, indicating excellent potential for oral delivery via micelles. Furthermore, poly (butyric ester)-based micelles were much capable of relieving symptoms in colitis mice induced with dextran sulfate sodium salt (DSS). These results reveal that the micelles with hydrophilic-lipophilic balance possess a broad-spectrum oral therapeutic potential and are available in potential clinical practice.

Also flagged:apatitehydroxyapatitefluoridefluorapatitecalcium-1,3-glucan
Journal Article 2025-09-29 No Snippets Borkowski L, Palka K, Pajchel L.
Show Full Abstract

In recent years, apatite-based materials have garnered significant interest, particularly for applications in tissue engineering. Apatite is most commonly employed as a coating for metallic implants, as a component in composite materials, and as scaffolds for bone and dental tissue regeneration. Among its various forms, hydroxyapatite (HAP) is the most widely used, owing to its natural occurrence in human and animal hard tissues. An emerging area of research involves the use of fluoride-substituted apatite, particularly fluorapatite (FAP), which can serve as a direct fluoride source at the implant site, potentially offering several biological and therapeutic advantages. However, substituting HAP with FAP may lead to unforeseen changes in material behavior due to the differing physicochemical properties of these two calcium phosphate phases. This study investigates the effects of replacing hydroxyapatite with fluorapatite in ceramic-polymer composite materials incorporating β-1,3-glucan as a bioactive polymeric binder. The β-1,3-glucan polysaccharide was selected for its proven biocompatibility, biodegradability, and ability to form stable hydrogels that promote cellular interactions. Nitrogen adsorption analysis revealed that FAP/glucan composites had a significantly lower specific surface area (0.5 m<sup>2</sup>/g) and total pore volume (0.002 cm<sup>3</sup>/g) compared to HAP/glucan composites (14.15 m<sup>2</sup>/g and 0.03 cm<sup>3</sup>/g, respectively), indicating enhanced ceramic-polymer interactions in fluoride-containing systems. Optical profilometry measurements showed statistically significant differences in profile parameters (e.g., Rp: 134 μm for HAP/glucan vs. 352 μm for FAP/glucan), although average roughness (Ra) remained similar (34.1 vs. 27.6 μm, respectively). Microscopic evaluation showed that FAP/glucan composites had smaller particle sizes (1 μm) than their HAP counterparts (2 μm), despite larger primary crystal sizes in FAP, as confirmed by TEM. XRD analysis indicated structural differences between the apatites, with FAP exhibiting a reduced unit cell volume (524.6 Å<sup>3</sup>) compared to HAP (528.2 Å<sup>3</sup>), due to substitution of hydroxyl groups with fluoride ions. Spectroscopic analyses (FTIR, Raman, <sup>31</sup>P NMR) confirmed chemical shifts associated with fluorine incorporation and revealed distinct ceramic-polymer interfacial behaviors, including an upfield shift of PO<sub>4</sub><sup>3-</sup> bands (964 cm<sup>-1</sup> in FAP vs. 961 cm<sup>-1</sup> in HAP) and OH vibration shifts (3537 cm<sup>-1</sup> in FAP vs. 3573 cm<sup>-1</sup> in HAP). The glucan polymer showed different hydrogen bonding patterns when combined with FAP versus HAP, as evidenced by shifts in polymer-specific bands at 888 cm<sup>-1</sup> and 1157 cm<sup>-1</sup>, demonstrating that fluoride substitution significantly influences ceramic-polymer interactions in these bioactive composite systems.

Also flagged:ChromiumHydroxyapatitechitosanwatercell proliferationcalcium phosphate
Journal Article 2025-09-29 No Snippets Predoi D, Ciobanu CS, Iconaru SL, Petre RA, Rokosz K, Raaen S, Predoi MV.
Show Full Abstract

Chromium-doped hydroxyapatite (7CrHAp) and chromium-doped hydroxyapatite in chitosan matrix (7CrHAp-CH) coatings were synthesized in order to address the need for biomaterials with improved physico-chemical and biological properties for biomedical applications. Both chromium-doped hydroxyapatite (7CrHAp) and chromium-doped hydroxyapatite in chitosan matrix (7CrHAp-CH) coatings could represent promising materials for biomedical applications due to their superior properties. This study aims to evaluate the physico-chemical and in vitro biological properties of 7CrHAp and 7CrHAp-CH coatings to determine the impact of chitosan incorporation on the physico-chemical and biological features. The results reported in this study indicate that addition of chitosan improves surface uniformity and biological properties, highlighting their potential for uses in biomedical applications. In this study, coatings of chromium-doped hydroxyapatite (7CrHAp, with x<sub>Cr</sub> = 0.07) and its composite variant embedded in a chitosan matrix (7CrHAp-CH) were systematically analyzed using a suite of characterization techniques: X-ray diffraction (XRD), scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDX), Fourier-transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM), and metallographic microscopy (MM). The results of the XRD analysis revealed that the average crystal size was 19.63 nm for 7CrHAp and 16.29 nm for 7CrHAp-CH, indicating a decrease in crystallite size upon CH incorporation. The films were synthesized via the dip coating method using stable suspensions, whose stability was assessed through ultrasonic measurements (double-distilled water serving as the reference medium). The values obtained for the stability parameter were 2.59·10<sup>-6</sup> s<sup>-1</sup> for 7CrHAp, 8.64·10<sup>-7</sup> s<sup>-1</sup> for 7CrHAp-CH, and 3.14·10<sup>-7</sup> s<sup>-1</sup> for chitosan (CH). These data underline that all samples are stable: CH is extremely stable, followed by 7CrHAp-CH (very stable) and 7CrHAp (stable). The in vitro biocompatibility of the 7CrHAp and 7CrHAp-CH coatings was evaluated with the aid of the MG63 cell line. The cytotoxic potential of these coatings towards MG63 cells was quantified using the MTT assay after 24 and 48 h of incubation. Our results highlight that both 7CrHAp and 7CrHAp-CH coatings exhibit high biocompatibility with MG63 cells, maintaining cell viability above 90% at both incubation times, thus supporting osteoblast-like cell proliferation. Furthermore, the antimicrobial efficacy of both 7CrHAp and 7CrHAp-CH samples was evaluated in vitro against the <i>Pseudomonas aeruginosa</i> 27853 ATCC (<i>P. aeruginosa</i>) reference strain. The in vitro antibacterial activity of the 7CrHAp and 7CrHAp-CH coatings was further evaluated against <i>Pseudomonas aeruginosa</i> 27853 ATCC (<i>P. aeruginosa</i>), <i>Escherichia coli</i> ATCC 25922 (<i>E. coli</i>) and <i>Staphylococcus aureus</i> ATCC 25923 (<i>S. aureus</i>) reference strains. In addition, atomic force microscopy (AFM) analysis was also used to investigate the ability of <i>P. aeruginosa</i>, <i>E. coli</i> and <i>S. aureus</i> cells to adhere and to develop colonies on the surfaces of the 7CrHAp and 7CrHAp-CH coatings. The results from the biological assays indicate that both coatings exhibit promising antibacterial properties, highlighting their potential for being used in biomedical applications, particularly in the development of novel antimicrobial devices.

DARS2
Also flagged:FGF21Fibroblast growth factor 21energy homeostasismitochondrial aminoacyl-tRNA synthetasemt-aARSsmitochondrial
Journal Article 2025-09-29 ✓ 3 Snippets Tekin Neijmann S, Gunes D, Karaca M, Karaman V, Balci MC, Gokcay GF, Gedikbasi A.
In-Text Gene Mentions

…, EARS2 ,DARS2, SARS2 ,…

…amino acid, andDARS2, EARS2 ,…

…patients with theDARS2pathogenic variant.…

Show Full Abstract

Fibroblast growth factor 21 (FGF21), a pleiotropic hormone, is a significant modulator of energy homeostasis. We evaluated serum FGF21 levels in patients with a deficiency of mitochondrial aminoacyl-tRNA synthetase (mt-aARSs). Six patients with mitochondrial aminoacyl tRNA synthetase deficiency and twelve healthy volunteers were included in this study. Whole-exome sequencing was used for molecular diagnosis. Serum FGF21 levels in the case group and healthy volunteers were analyzed using the enzyme-linked immunosorbent assay. Exome sequencing test revealed nine different pathogenic variants in the <i>AARS2</i>, <i>EARS2</i>, <i>DARS2</i>, <i>SARS2</i>, and <i>WARS2</i> genes. A statistically significant difference was found between the serum FGF21 levels of the case and control groups: case group (n = 6), 882.49 ± 923.60 pg/mL; control group (n = 12), 20.89 ± 2.63 pg/mL (<i>p</i> < 0.001). The area under the ROC curve for FGF21 in the differential diagnosis of mitochondrial aminoacyl-tRNA synthetase deficiency was 1.000 (0.813-1.000). Sensitivity and specificity were 100%, and positive and negative predictive values were also 100% for an FGF21 cut-off value > 27.4 pg/mL. Assessment of FGF 21 levels as an indicator of mitochondrial damage in mt-aARSs deficiency may provide insight into the level of damage. Investigation of the biochemical mechanisms underlying the different levels of damage caused by different aminoacyl tRNA synthetases will be important in terms of elucidating clinical heterogeneity.

BTN3A3
Also flagged:Acute Strokestrokecerebral ischemiaaspirincytoskeletondeath
Journal Article 2025-09-29 ✓ 5 Snippets Gendosz de Carrillo D, Kocikowska O, Krzan A, Student S, Rak M, Nowak-Andraka M, Mi J, Burek M, Lasek-Bal A, Jędrzejowska-Szypułka H.
In-Text Gene Mentions

…, ATXN7L3B ,BTN3A3, BZW1 ,…

…, SOC5 ,BTN3A3, RFK ,…

…targets: ABHD2, BTG2,BTN3A3, CNOT4, CSNK1A1, DCBLD2,…

…Anti-Proliferation Factor 2BTN3A3Butyrophilin Subfamily 3…

…Factor 2 BTN3A3Butyrophilin Subfamily 3 Member A3Subfamily 3 Member…

Show Full Abstract

Reperfusion therapy uses thrombolysis and clot removal to restore blood flow in the brain after stroke; however, three months after reperfusion therapy, roughly 46% of stroke patients become independent again. MiRNAs (micro RNA) regulate cerebral ischemia/reperfusion injury, and their transfer between cells via exosomes may differentially affect recipient cells. We examined serum exosomal miRNA levels, stroke treatments, and functional outcomes in stroke patients, and we explored the potential role of estimated differentially expressed miRNA (DEmiRNA) target genes in the brain's reaction to reperfusion after ischemia. The patients in the study received aspirin or reperfusion therapy with either intravenous thrombolysis (rt-PA), mechanical thrombectomy (MT), or a combination of both (rt-PA/MT). Serum samples were collected from stroke patients on days 1 and 10 post-stroke. Serum exosomes' miRNA was analyzed using qRT-PCR. We identified DEmiRNAs, estimated their targets, and performed enrichment analysis. Functional outcomes were assessed using the modified Rankin Scale (mRS) on days 10 and 90 post-stroke. Among studied treatments, only rt-PA/MT lowered DEmiRNA by day 10 vs. other groups. Specifically, patients with unfavorable mRS score exhibited decreased levels of miR-17, miR-20, miR-186 and miR-222 after combined stroke therapy. Functional analysis identified target genes and pathways associated with cytoskeleton remodeling, cell death, autophagy, inflammation, and dementia. In conclusion, unfavorable stroke outcomes following poor rt-PA/MT response could result from lower miRNA expression levels, thus activating cell death and neurodegenerative processes in brain.

Also flagged:SynthesisSRPK1Serine/arginine protein kinase 1phosphorylationSR/RS domain-containing proteinscancer
Journal Article 2025-09-29 No Snippets Leonidis G, Sigala I, Spathakis M, Kolios G, Giannakouros T, Nikolakaki E, Sarli V.
Show Full Abstract

Serine/arginine protein kinase 1 (SRPK1) plays a pivotal role in the phosphorylation of SR/RS domain-containing proteins, which are involved in various cellular processes. Its overexpression has been associated with the progression of various malignancies, positioning SRPK1 as a promising target for cancer treatment. In this study, we report the design, synthesis, and preliminary biological evaluation of two hybrid molecules, geo15 and geo140, which combine known SRPK1 inhibitors with the antimetabolites gemcitabine and 5-fluorouracil (5-FU), respectively. These conjugates were synthesized to assess whether hybridization enhances potency compared to the parent compounds, and to investigate potential novel mechanisms of action. <i>In vitro</i> assays were performed to evaluate SRPK1 inhibition and antiproliferative activity in selected cancer cell lines. Among the tested compounds, the JH-VII-139-1-based hybrid geo140 exhibited notable SRPK1 inhibitory potency and cytotoxic effects, demonstrating a favorable profile for further optimization. Interestingly, treatment with geo140 did not appear to alter the overall SRPK1 distribution in interphase cells but resulted in a notable increase of mitotic cells that displayed a substantial accumulation of SRPK1, thus suggesting that the hybrid compound may have an impact on cell cycle progression. This work supports the potential of molecular hybridization as a strategy for the development of novel SRPK1-targeting anticancer agents.

DNAJC1
Also flagged:Colorectal cancercancertumor-apoptosis5-fluorouracilgene silencing
Journal Article 2025-09-29 ✓ 1 Snippet Ahn CH, Park JE, Sim DY, Park SY, Cha HJ, Shim BS, Kim B, Kim SH.
In-Text Gene Mentions

…PTPN13, HSPB8, EIF3A,DNAJC1, PDPK1, HINFP, GSK3B…

Show Full Abstract

Emerging evidence implicates serine/threonine kinase 32C (STK32C) overexpressed in bladder cancer and brain tissues acts as a molecular target for doxorubicin resistance, yet its role in colorectal cancer (CRC) remains unclear. Thus. this study investigates the oncogenic mechanism of STK32C in CRC and its interplay with HSP90 and the PI3K/AKT/mTOR signaling axis. STK32C was markedly upregulated in CRC cell lines (HCT116, HT29, SW480, SW620) compared to normal fibroblasts (CCD-18Co) with poor prognosis. STK32C depletion suppressed proliferation, migration, and invasion, while promoting apoptosis-as evidenced by increased Bax, Annexin V, TUNEL-positive, and sub-G1 populations, alongside reduced Bcl-2, pro-Caspase-3, and pro-PARP. Mechanistically, STK32C directly bound the N-terminal domain of HSP90, as shown by immunoprecipitation, immunofluorescence, and GST pulldown assays. Consistently, STK32C depletion or HSP90 N-terminal inhibitor Ganetespib reduced STK32C and p-AKT1, while the HSP90 C-terminal inhibitor, epigallocatechin gallate (EGCG) or AKT inhibitor LY294002 did not affect STK32C, implying that STK32C acts as an upstream of AKT. Furthermore, STK32C depletion enhanced 5-fluorouracil (5-FU) efficacy, with synergistic effects confirmed by CompuSyn and SynergyFinder analysis. <i>In vivo</i>, STK32C depletion reduced the growth of HCT116 cells in BALB/c mice with decreased expression of STK32C, HSP90, PCNA, and AKT and activated caspase 3. Overall, these findings suggest STK32C as a novel oncogenic driver in CRC that modulates HSP90 and PI3K/AKT/mTOR signaling and highlights its potential as a therapeutic target alone or in combination with 5-FU.

HFE
Also flagged:Alcoholic Cirrhosischronic diseasesalcoholic liver cirrhosiscirrhosisesophageal varicesacute liver failure
Journal Article 2025-09-29 ✓ 1 Snippet Dhruv S, Atodaria KP, Rockey DC, Goyal A, Boger J, Batheja M, Fonkam A.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

<h4>Background</h4>The Hispanic population is the fastest-growing ethnic group in the USA and is projected to comprise 30% of the US population by 2050. Despite socioeconomic disadvantages and often presenting with more severe disease phenotypes, previous studies in chronic diseases have shown that Hispanics experience lower overall inpatient mortality compared with other ethnic groups - a phenomenon known as the "<i>Hispanic Paradox</i>". In alcoholic liver cirrhosis (ALC), this paradox is particularly evident: Hispanics frequently develop more advanced forms of alcoholic liver cirrhosis, yet survival outcomes are often similar or even superior to those of non-Hispanic populations. This study aims to assess the risk and burden of alcoholic liver cirrhosis in the Hispanic population and to compare the clinical phenotype of ALC with that observed in non-Hispanic populations.<h4>Methods</h4>This retrospective analysis used the Nationwide Inpatient Sample (NIS) database (2016 - 2019) to examine adults hospitalized with ALC. Patients with other causes of cirrhosis were excluded. Patients were stratified into Hispanic and non-Hispanic groups. Diagnoses, complications, and comorbidities were captured using the International Classification of Disease, 10th Revision (ICD-10) codes. The primary outcome was inpatient mortality; secondary outcomes included length of stay (LOS) and total hospitalization charges (TOTCHG). Statistical analyses were performed using Chi-square, <i>t</i>-tests, and Mann-Whitney U tests.<h4>Results</h4>Among patients hospitalized with alcoholic cirrhosis (n = 1,002,115), 17% were Hispanic. Hispanic patients were younger (mean age 54 vs. 57 years, P < 0.001), more often male (81% vs. 67%, P < 0.001), and had similar Charlson Comorbidity Index (CCI) scores. Despite slightly lower inpatient mortality (5.9% vs. 6.8%, P < 0.001), Hispanics experienced higher rates of complications, including esophageal varices (28% vs. 23%), variceal bleeding (10% vs. 7%), acute liver failure (27% vs. 25%), and hepatocellular carcinoma (4% vs. 2%) (P < 0.001 for all). Median TOTCHG was significantly higher ($46,494 vs. $38,881, P < 0.001) in Hispanic patients.<h4>Conclusions</h4>Hispanic patients with alcoholic cirrhosis (ALC) experience a higher burden of cirrhosis-related complications and increased healthcare utilization compared to other ethnic groups yet exhibit lower observed inpatient mortality. These disparities highlight the need for earlier detection, culturally tailored public health interventions, and improved access to preventive and specialty liver care to improve outcomes in this vulnerable population.

ZNFX1
Also flagged:mycobacterial diseaseinborn errors of immunityMSMDinterferon-gammaMycobacterium tuberculosis diseaseerrors of immunity
Journal Article 2025-09-29 ✓ 1 Snippet Almarzooqi F, Bousfiha AA.
In-Text Gene Mentions

…, ISG15 ,ZNFX1, IRF8 ,…

Show Full Abstract

Advances in genomic technologies, including whole exome and genome sequencing, have transformed diagnosis of monogenic disorders such as inborn errors of immunity (IEIs). In high-consanguinity populations like the United Arab Emirates (UAE), where autosomal recessive disorders are prevalent, early genomic screening shifts care from reactive diagnosis to personalized care. UAE national programs remain limited to premarital or neonatal panels, missing disorders with variable onset or incomplete penetrance. We advocate universal genomic screening to integrate disease-causing alleles into clinical care. As proof of concept, we highlight Mendelian susceptibility to mycobacterial disease (MSMD), an IEI defined by impaired interferon-gamma signaling and severe complications following <i>Bacillus Calmette-Guérin</i> (BCG) vaccination and <i>Mycobacterium tuberculosis</i> disease. We propose a tiered approach using MSMD-related genes within exome or genome platforms, enabling scalable, cost-effective implementation and periodic reanalysis as evidence evolves. In the UAE, high consanguinity, genomic infrastructure, and regulatory frameworks position MSMD as an entry point for population genomic screening, advancing precision medicine and prevention.

DCC
Also flagged:neurodegenerative disordersdementiaAlzheimer's diseasesynapticaginggene expression
Journal Article 2025-09-28 ✓ 1 Snippet Bilgic M, Obata R, Panfil VI, Zhu Z, Saeki M, Gotoh Y, Kishi Y.
In-Text Gene Mentions

…, Ank3 ,Dcc, and Dusp10…

Show Full Abstract

Aging represents a major risk for human neurodegenerative disorders, such as dementia and Alzheimer's disease, and is associated with a functional decline in neurons and impaired synaptic plasticity, leading to a gradual decline in memory. Previous research has identified molecular and functional changes associated with aging through transcriptomic studies and neuronal excitability measurements, while the role of chromatin-level regulation in vulnerability to aging-related diseases is not well understood. Moreover, the causal relationship between molecular alterations and aging-associated decline in functions of different cell types remains poorly understood. Here, we systematically characterized gene regulatory networks in a cell type-specific manner in the aging mouse hippocampus, a central brain region involved in learning and memory formation, by simultaneously profiling gene expression and chromatin accessibility at a single-nucleus level. The analysis of multiome (RNA and ATAC) sequencing recapitulated the diversity of glial and neuronal cell types in the hippocampus and revealed transcriptomic and chromatin accessibility level changes in different cell types, among which oligodendrocytes and dentate gyrus (DG) neurons exhibited the most drastic changes. We found pronounced aging-dependent chromatin-level changes among neurons, especially for genes related to synaptic plasticity. Our data suggest that BACH2, a candidate transcription factor implicated in aging-mediated functional decline of DG neurons, potentially regulates genes associated with synaptic plasticity, cell death, and inflammation during aging. Taken together, our single-nucleus multiome analysis reveals potential cell type-specific regulators involved in the aging of neurons and glial cells.

MLLT10
Also flagged:leukemiasKMT2Aacute myeloid leukemiasmixed-lineage leukemia-10mixed-lineage leukemia-4MLLT4
Journal Article 2025-09-28 ✓ 1 Snippet Mahdavi L, Alikarami F, Goodrow H, Lenard A, Riedel SS, Libbrecht C, Bowser I, Tasian SK, Falkenstein CD, Manning B, Skuli S, Carroll MP, Wertheim G, Cai SF, McGeehan G, Yu S, Shi J, Xie HM, Bernt KM.
In-Text Gene Mentions

…s (mixed-lineage leukemia-10 [MLLT10] and mixed-lineage leukemia-4…

Show Full Abstract

Inhibitors of the menin-KMT2A interaction are promising agents for the treatment of KMT2A-rearranged leukemias. We evaluated menin inhibition in patient-derived xenografts of KMT2A-rearranged leukemias with high-risk features. Three acute myeloid leukemias with high-risk fusion partners (mixed-lineage leukemia-10 [MLLT10] and mixed-lineage leukemia-4 [MLLT4]) and two infant acute lymphocytic leukemia (ALL) samples were sensitive to menin inhibition. We also evaluated serial samples from two patients with multiply relapsed ALL. We found that highly pretreated KMT2A::AFF1 ALL samples were much less sensitive compared with cells obtained earlier in the same patients' disease course. Because none of the patients had been treated with a menin inhibitor, resistance in these highly pretreated samples was acquired in the absence of menin-inhibitor exposure. Transcriptomic analysis documented sustained on-target efficacy toward the canonical targets of the menin inhibitor in resistant cells. Targeted genomic analysis documented the emergence of multiple comutations, including RAS pathway and TP53 mutations, although neither was sufficient to induce menin-inhibitor resistance in vitro. Downregulation of KMT3D may account for resistance in one patient; inactivation of KMT2C/D has been reported to result in menin-inhibitor resistance, and KMT2C-edited cells from this patient were selected for in menin-inhibitor-containing growth conditions. Future studies will need to clarify more broadly which genomic/epigenomic alterations drive upfront resistance. Regardless of mechanism, our data support using menin inhibitors upfront or in early lines of therapy before substantial genomic or epigenomic evolution has occurred.

HTT
Also flagged:Huntingtincentral nervous system (CNS) disordersgenetic diseasesHDgenetic disease
Journal Article 2025-09-28 ✓ 5 Snippets Gavgani PM, García-Domínguez M.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene, leading to…

…form of theHTTprotein.…

…the Huntingtin (HTT) gene, located…

…form of theHTTprotein (known as…

HTTis a widely…

Show Full Abstract

Huntington's Disease (HD) is an inherited neurodegenerative condition caused by an expansion of CAG repeats in the Huntingtin (HTT) gene, leading to a toxic form of the HTT protein. Despite advances in understanding the disease and developing symptomatic treatments, effective therapies for modifying its progression remain limited. Among emerging and novel treatments for central nervous system (CNS) disorders, gene therapy (GT), particularly using adeno-associated virus (AAV)-mediated gene delivery, holds great promise. Numerous preclinical and clinical trials are exploring the benefits of AAVs for treating neurodegenerative and genetic diseases. However, while widely used and investigated in rare and genetic disease treatment, AAVs' potential for HD treatment remains underexplored. The absence of a comprehensive collection of previous reports, advancements, and methodologies regarding exclusively AAV-mediated GT for HD is notable and prompted us to address this gap. The current review compiles the available and emerging information regarding the application of AAVs in HD therapy, outlines the promise of this approach, and highlights the necessity of conducting further studies to achieve efficient HD treatment. The authors hope that the current review will guide further research to unlock the full potential of AAVs in treating HD.

Also flagged:transcriptional regulatorsmetabolismorganogenesistissue formationPI3KAKT
Journal Article 2025-09-28 No Snippets Bhargava D, Bhargava AN, Katz JP.
Show Full Abstract

The <i>Krüppel</i>-like factors (KLFs) are a family of transcriptional regulators that play crucial roles in regulating diverse cellular processes including development, proliferation, differentiation, metabolism, and carcinogenesis across various tissues. KLFs play pivotal roles in gastrointestinal pathologies, and exhibit tissue- and cell-type-specific expression patterns throughout the gastrointestinal tract. During gastrointestinal (GI) development, KLFs orchestrate the transition from embryonic to adult gene programming, with specific family members being essential for proper organogenesis and tissue formation. KLFs also function as context-dependent modulators of GI homeostasis, inflammation, and carcinogenesis in adult tissues and interact with major signaling pathways such as PI3K/AKT, NF-κB, Wnt, Notch, MAPK, and TGF-β. This review comprehensively examines the roles of KLFs in GI health and disease, focusing on their expression patterns, regulatory mechanisms, function in normal homeostasis, and therapeutic implications for gastrointestinal disorders.

NEGR1
Also flagged:Pathogenesisγ-aminobutyric acidcognitionneurodevelopmental disordersschizophreniaautism spectrum disorder
Journal Article 2025-09-28 ✓ 2 Snippets Marilovtseva EV, Abdurazakov A, Kurishev AO, Mikhailova VA, Golimbet VE.
In-Text Gene Mentions

…presynaptic membrane byNeuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1) and further removed…

Show Full Abstract

γ-aminobutyric acid (GABA), the primary inhibitory neurotransmitter in the central nervous system (CNS), regulates neuronal excitability, synaptic plasticity, and oscillatory activity essential for cognition, emotion, and behavior. Disruptions in GABAergic signaling are increasingly recognized as key contributors to a range of neurodevelopmental disorders (NDDs), including schizophrenia (SZ), autism spectrum disorder (ASD), major depressive disorder (MDD), bipolar disorder (BD), and intellectual disability (ID). In this review, we analyze the data available from the literature concerning the components of the GABA pathway. We describe the main steps of GABA metabolism, including GABA synthesis and release, GABA receptors neurotransmission, GABA reuptake and catabolism, and evaluate their involvement in the pathogenesis of neurodevelopmental disorders. We suggest the possibility of existence of so far undescribed mechanisms which maintain the concentrations of GABA at a relatively physiological level when the function of glutamic acid decarboxylases is compromised by mutations. Searching for these mechanisms could be important for better understanding neurodevelopment and could give a clue for future searches for new therapeutic approaches for treating or alleviating the symptoms of BD and SZ. We also argue that the metabolic stage of the GABA pathway has only a minor direct effect on GABA signaling and rather causes clinical effects due to accumulation of neurotoxic byproducts.

Also flagged:inflammatory bowel diseasescolitiscolorectal cancerneoplasiapro-inflammatory cytokinesTNF-α
Journal Article 2025-09-28 No Snippets Triantaphyllopoulos KA, Ragia ND, Panagiotopoulou ME, Sourlingas TG.
Show Full Abstract

The rising global prevalence of inflammatory bowel diseases, including Crohn's disease and ulcerative colitis, is paralleled by an increased risk of colitis-associated colorectal cancer. Persistent intestinal inflammation promotes genetic instability and epigenetic reprogramming within epithelial and immune cells, driving the multistep transition from inflammation to neoplasia. This review integrates human and preclinical model evidence with literature mining and bioinformatic analyses of genetic, epigenetic, and ncRNA data to dissect molecular mechanisms driving colitis-associated colorectal cancer from chronic inflammation. We highlight how pro-inflammatory cytokines (e.g., TNF-α, IL-6), oxidative stress, and microbial dysbiosis converge on key transcriptional regulators such as NF-κB and STAT3, inducing DNA methylation and histone modifications (e.g., H3K27me3); altering chromatin dynamics, gene expression, and non-coding RNA networks (e.g., <i>miR-21</i>, <i>MALAT1</i>, <i>CRNDE</i>); ultimately reshaping pathways involved in proliferation, apoptosis, and immune evasion. This review updates new potential associations of entities with these diseases, in their networks of interaction, summarizing major aspects of genetic and chromatin-level regulatory mechanisms in inflammatory bowel disease and colorectal cancer, and emphasizing how these interactions drive the inflammatory-to-neoplastic transition. By underscoring the reversibility of epigenetic changes, we explore their translational potential in early detection, surveillance, and precision epigenetic therapy. Understanding the interplay between genetic mutations and chromatin remodeling provides a roadmap for improving diagnostics and personalized treatments in inflammatory bowel disease-associated colorectal carcinogenesis.

Also flagged:synthesispolyazoaromaticheterocycleshydrogenbindingpolyazo heterocycles
Journal Article 2025-09-28 No Snippets Titova YY, Gyrgenova EA, Ivanov AV.
Show Full Abstract

This review summarizes and compares literature data on the main strategies for the synthesis of saturated and/or partially saturated analogs of six-membered polyazoaromatic heterocycles. With a few exceptions, this data was published within the last 15-20 years. These strategies include, first of all, hydrogenation, which can be carried out in a classical manner (i.e., in the presence of a catalyst and molecular hydrogen) or via hydrogen transfer techniques. Other approaches comprise saturation of aromatic frameworks, which can be achieved using compounds other than hydrogen, such as hydroboration and dearomatic binding, or the creation of saturated or partially saturated polyazo heterocycles through the coupling of two or more molecules. Each of the above strategies has certain advantages and serious shortcomings and limitations. Despite the apparent methodological difficulties, it is demonstrated that the described approaches can sometimes give impressive results, including the production of optically pure products under relatively mild conditions.

HFE
Also flagged:portal hypertensionacute-on-chronic liver failure-Stage Liver DiseaseSodiumgastric varicescirrhosis
Journal Article 2025-09-28 ✓ 1 Snippet Abu Zar N, Chey C.
In-Text Gene Mentions

…alpha-1 antitrypsin, negativehemochromatosisgene analysis).…

Show Full Abstract

Extensive portosystemic shunting in portal hypertension creates a paradox: effective decompression protects against variceal bleeding but complicates liver transplantation through portal steal. We report a 31-year-old man with cryptogenic acute-on-chronic liver failure grade 3 (Model for End-Stage Liver Disease-Sodium (MELD-Na) 31, United Kingdom Model for End-Stage Liver Disease (UKELD) 63). Despite severe portal hypertension on Doppler ultrasound, endoscopy revealed complete absence of oesophageal and gastric varices. CT explained this paradox, demonstrating a large tortuous splenorenal shunt providing highly effective decompression. At transplantation, this protective adaptation caused portal steal, with immediate right posterior sector graft demarcation. Restoration of perfusion required emergent left renal vein ligation. This case highlights how extensive splenorenal shunting can fully mask varices yet create critical intraoperative challenges. The absence of varices in established portal hypertension should prompt investigation for alternative drainage pathways. Even in young patients, comprehensive vascular assessment is essential, as protective anatomical adaptations can precipitate life-threatening operative emergencies requiring specialized surgical intervention.

HTT
Also flagged:Temporomandibular DisordersTemporomandibular disorderTMDsmyalgiaheadachejoint disorders
Journal Article 2025-09-28 ✓ 1 Snippet Achuthan Pk M, K S, Vallikat Velath A, Varma Nk S.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT), which is found…

Show Full Abstract

Temporomandibular disorder (TMD) refers to musculoskeletal conditions that affect the temporomandibular joint (TMJ) and surrounding tissues, often leading to pain, impaired function, and a diminished quality of life. Despite its clinical relevance, diagnosing and managing TMD remains complex due to its multifactorial etiology. Biomarkers, which are quantifiable indicators of biological processes, have gained attention as valuable tools for enhancing TMD diagnosis, prognosis, and treatment monitoring. Various categories of biomarkers, such as molecular, genetic, sensory, and neuroimaging markers, have been investigated in TMD studies. Biomarker assessment typically employs non-invasive methods, including analysis of saliva, serum, or synovial fluid, and advanced imaging techniques. The incorporation of these biomarkers into clinical practice offers the potential for earlier diagnosis, more accurate prediction of treatment responses, and the development of individualized therapeutic strategies.

HFE
Also flagged:PiperacillinTazobactamDrug-induced liver injuryDILIPiperacillin/tazobactamTZP
Journal Article 2025-09-28 ✓ 1 Snippet Maheshwari PK, Maddox A, Yoo J, Harrison A, Fahim P.
In-Text Gene Mentions

…Wilson's disease andhemochromatosis; however, all tests…

Show Full Abstract

Drug-induced liver injury (DILI) is a diagnosis of exclusion, but one that requires high clinical suspicion because prompt withdrawal of the offending agent is imperative to improve prognosis. Piperacillin/tazobactam (TZP) is a rare cause of clinically apparent liver injury. This case is an example of DILI caused by TZP that was identified when a hospitalized patient's liver enzymes greatly increased, and hepatic steatosis was subsequently seen on a computed tomography scan. The Roussel Uclaf Causality Assessment Method (RUCAM) score is a tool used to indicate the likelihood of DILI. In this case, the RUCAM score was 7, indicating that the causality assessment of the TZP as the cause of liver injury was probable. This case underscores the importance of maintaining a high index of suspicion for DILI, particularly in patients receiving extended courses of antibiotics, and highlights the need for routine liver function monitoring during therapy with agents known to carry hepatotoxic potential.

SERPINC1
Also flagged:neurocognitive dysfunctionDepressionGlucoseHemoglobinB-Type Natriuretic Peptideacute coronary syndrome
Journal Article 2025-09-28 ✓ 1 Snippet Moreira I, Peixoto M, Sousa D, Rocha A, Peixoto B.
In-Text Gene Mentions

…obtained in theACE-IIIand HADS are…

Show Full Abstract

<h4>Introduction</h4>The interplay between coronary disease and neurocognitive dysfunction remains unclear with several underlying factors likely contributing to this complex relationship. This study develops a predictive model using a machine learning approach to determine a predictive model of neurocognitive functioning in patients with acute coronary syndrome (ACS).<h4>Methods</h4>Sixty-three patients, enrolled in the phase III cardiac rehabilitation program, underwent a neurocognitive assessment. To predict neurocognitive functioning a cross validated random forest model was used (RF_cv) due to its robustness to non-linear relationships and overfitting, and its successful application in prior disease prediction studies.<h4>Results</h4>The RF_cv model showed an r-squared of 0.978, an RMSE of 0.6309 and a MAE value of 0.479. The top-ten predictors in the model were: HDL, Depression, Glucose, Glycated Hemoglobin, B-Type Natriuretic Peptide, BMI (Kg/m2), Waist-to-Hip Ratio, Cholesterol, Anxiety and Age.<h4>Conclusion</h4>The variance in neurocognitive functioning is explained by a combination of biochemical indicators and body composition, reflecting classical cardiovascular risk factors and depression. The obtained RF-cv predictive model supports early identification of patients for tailored interventions.

medRxiv 2025-09-28 Preprint (No Snippets API) Kumar R, Beric A, Western D, Yang Z, Lin W, Timsina J, Cruchaga C, Ibanez L.
Show Full Abstract

<h4>Background</h4> High throughput proteomics has enabled hypothesis free biomarker discovery. However, differences in sample sizes, biological fluid, and quantification technologies have limited replication and validation of the results, and studies on the cross-platform variability are lacking. Here, we present the first orthogonal validation across three platforms in Parkinson’s disease (PD) to understand the technical and biological challenges of proteomic studies. <h4>Methods</h4> We have leveraged publicly available proteomic data from cerebrospinal fluid (CSF), plasma, and urine within the Parkinson’s Progression Markers Initiative (PPMI) cohort, generated using SomaScan5K (CSF), mass spectrometry (MS; CSF, plasma, and urine), and Olink Explore (CSF and plasma). Across platforms, we compared 375 proteins that were consistently quantified. We performed differential abundance analysis comparing PD versus healthy controls followed by sensitivity analyses (mutation carriers, at-risk participants, longitudinal analyses) to further understand the findings. <h4>Results</h4> In CSF, we found significant correlations between effect sizes from the 375 proteins quantified by SomaScan5K and MS (ρ=0.42, p=2.60×10 □ □), as well as SomaScan5K and Olink Explore (ρ=0.15, p=3.15×10□ 3 ) while MS and Olink Explore showed no significant correlations in CSF or plasma. Orthogonal validation identified two proteins (DLK1, GSTA3) replicated between SomaScan5K and Olink Explore and seven proteins (ALCAM, CHL1, CNDP1, NCAM2, PEBP1, PTPRS, SCG2) replicated between MS and SomaScan5K. No proteins replicated between MS and Olink Explore in CSF or plasma. DDC showed consistent dysregulation across analyses. In CSF (Olink Explore), it was dysregulated in PD participants (beta=0.79, p=8.49×10 −16 ), and in at-risk individuals (beta=0.64, p=1.41×10 −7 ) including those with hyposmia (beta=0.70, p=2.13×10 −5 ) and REM Sleep Behavior Disorder (beta=0.52, p=1.00×10 −3 ). In urine, DDC was higher in at-risk individuals (beta=0.43, p=7.28×10 −5 ), driven by LRRK2 + at-risk participants (beta=0.59, p=1.74×10 −6 ), as well as in symptomatic mutation carriers, LRRK2 + (beta=0.68, p=9.08×10 −8 ), and GBA + (beta=0.28, p=0.04). <h4>Conclusions</h4> Biologically, these findings add further evidence that DDC has strong potential as a biomarker. Methodologically, our findings emphasize that platform selection can introduce more variance than that originating from disease status, which limits the reproducibility across technologies. This highlights the challenges and importance of cross-platform validation in proteomic biomarker research, and the translation of those discoveries to the clinic.

LRRIQ3
Also flagged:geriatric syndromesmethylationtelomeressarcopeniaCLIC5GHITM
Journal Article 2025-09-27 ✓ 1 Snippet Ginevičienė V, Pranckevičienė E, Urnikytė A, Jurkūnaitė L, Gutauskaitė K, Dadelienė R, Kilaitė J, Jamontaitė IE, Mastavičiūtė A, Ahmetov II, Alekna V.
In-Text Gene Mentions

…( FPGT ,LRRIQ3, TNFSF9 ,…

Show Full Abstract

Sarcopenia and frailty are complex geriatric syndromes influenced by a combination of genetic and environmental factors. Recent studies suggest that specific genetic variants, DNA methylation patterns and shortened telomeres are associated with age-related diseases and might contribute to the development of both sarcopenia and frailty. In this study, we investigated the contribution of multi-omics data to sarcopenia, frailty, lean mass index (LMI) and handgrip strength in an elderly Lithuanian population. A total of 204 participants (age 82.2 ± 7.6 years) were included, comprising 122 individuals diagnosed with sarcopenia and/or frailty and 82 healthy, community-dwelling older adults. The results showed that LMI was associated with various health and lifestyle factors. Two genetic variants, CLIC5 rs75652203 and GHITM rs17102732, were found to be significantly associated with handgrip strength at the genome-wide level. Additionally, 12 polymorphisms previously linked to sarcopenia were replicated in relationship to LMI: BOK rs76993203, VAMP5 rs1374370, TMEM18 rs12714414, SFMBT1 rs36033494, BANK1 rs13136118, TET2 rs2647239, FOXO3 rs9384679, L3MBTL3 rs13209574, ZFAT rs13267329, CEP57 rs35793328, PCGF2 rs1985352 and MC4R rs66922415. Furthermore, several genes, many of which are involved in immune system processes, were significantly enriched with differentially methylated sites associated with LMI. Shorter telomeres were also associated with both sarcopenia and frailty. Notably, a significant relationship was observed between telomere length and methylation levels in genes related to lifestyle traits and the risk of developing these conditions. These findings provide new insights into the biological mechanisms underlying sarcopenia and frailty, underscoring the important roles of genetic and epigenetic factors in their pathogenesis among older adults.

Also flagged:glutaminaseMajor depressive disorderGLS1glutamineglutamateSocial Defeat Stress
Journal Article 2025-09-27 No Snippets Huang M, Li Y, Thomas AG, Sharma A, Liyanage W, Tichý T, Tenora L, Su Y, Ha J, Hin N, Obayashi M, Majer P, Kannan RM, Tsukamoto T, Ursini G, Rais R, Slusher BS, Zhu X.
Show Full Abstract

Major depressive disorder (MDD) is a prevalent and debilitating psychiatric condition with significant societal and economic impacts. Many patients are resistant to current antidepressant therapies, underscoring the need for novel treatments targeting underlying mechanisms. We previously discovered that glutaminase (GLS1), an enzyme converting glutamine to glutamate, is upregulated specifically in activated microglia in mice exposed to Chronic Social Defeat Stress (CSDS). Importantly, GLS1 mRNA was also upregulated in microglia within postmortem brain tissue of MDD patients, highlighting a potential role for microglial GLS1 in MDD pathophysiology. However, existing GLS1 inhibitors lack brain penetrance and/or cause gastrointestinal toxicities, limiting their translational potential. To address this, we utilized a hydroxyl-terminated poly(amidoamine) dendrimer nanoparticle system to selectively target microglial GLS1. Using structurally distinct GLS1 inhibitors, we synthesized two hydroxyl-dendrimer-GLS1 inhibitor conjugates: dendrimer-TTM020 (D-TTM020) and dendrimer-JHU29 (D-JHU29). In the murine CSDS model, we evaluated their microglial target engagement, safety, and efficacy using immunofluorescence, GLS1 activity assays, gastrointestinal histopathology, and a battery of behavioral tests. Using a Cy5 fluorescently labeled hydroxyl-dendrimer (D-Cy5), we confirmed that systemically administered D-Cy5 crossed the blood-brain barrier and was selectively engulfed by activated microglia in mice after CSDS. D-TTM020 and D-JHU29 attenuated CSDS-induced microglial GLS1 activity elevation without affecting non-microglial cells. Furthermore, D-TTM020 and D-JHU29 both alleviated CSDS-induced social avoidance, and D-TTM020 additionally reduced anxiety-like behavior and improved recognition memory. Both conjugates were well tolerated, with no overt or gastrointestinal toxicities. Collectively, these findings suggest that microglia-targeted GLS1 inhibition is a promising therapeutic approach for chronic stress-associated depression.

DCC
Also flagged:Solid Tumorscancermetastatic diseasetumorMicrometastatic Diseaseimmune response
Journal Article 2025-09-27 ✓ 2 Snippets Nicolini A, Ferrari P, Silvestri R, Bini DA.
In-Text Gene Mentions

…the kinetics ofDCCproliferation, as inferred…

…kinetic analysis ofDCCgrowth, we estimated…

Show Full Abstract

The era of targeted therapies has significantly advanced our understanding of cancer growth and metastasis. Intrinsic or acquired drug resistance remains a major challenge, rendering clinically overt metastatic disease incurable in most patients. This review first examines key clinical trials and their primary outcomes involving targeted therapies in the most common advanced solid tumors, along with the main mechanisms underlying drug resistance. Recently, micrometastatic disease has emerged as a novel focus of investigation aimed at definitively curing advanced solid tumors. Accordingly, this review explores the biology of micrometastases, current challenges in their detection and monitoring, and the main strategies proposed to prevent their progression. The potential roles of nanotechnology and artificial intelligence-driven predictive models are also discussed. Furthermore, we highlight specific characteristics of micrometastatic disease that favor immune modulation, and we evaluate the effectiveness of an immunotherapy regimen that inhibits immune suppression. The lead time provided by serum tumor markers, used experimentally to better track the progression of otherwise undetectable micrometastatic disease, also forms the mechanistic basis for a novel protocol we propose to prevent relapse in high-risk cancer patients. This innovative protocol holds scientific relevance being supported by an appropriate mathematical model and ready for immediate application in clinical practice.

Also flagged:wound healingbiopolymersagingdermatological diseasestissueskin diseases
Journal Article 2025-09-27 No Snippets Anitua E, Tierno R, Orive G, Alkhraisat MH.
Show Full Abstract

<h4>Background</h4>The treatment of dermatological diseases has evolved significantly with the advent of advanced therapeutic strategies involving platelet-rich products. These products are rich in morphogens, growth factors, and proteins that play a crucial role in tissue regeneration and wound healing. Their combination with different biomaterials has been engineered to enhance the biomaterials' safety and performance in the context of tissue healing.<h4>Objective</h4>This narrative review aims to explore the current evidence on the biological mechanisms, efficacy, and clinical applications of these combined therapies. Furthermore, we examine the potential advantages of synergistic effects and the challenges associated with optimizing treatment protocols.<h4>Methods</h4>Relevant literature was retrieved through a structured search strategy implemented across PubMed, Scopus, and Google Scholar databases. Studies included investigated co-administration of platelet-rich products with other agents in topical, injectable, or composite formulations for dermatological conditions with no restriction regarding publication date.<h4>Results</h4>The review summarizes in vitro and in vivo biological effects of various biopolymers and active substances combined with platelet-rich products, highlighting diverse application strategies and their effectiveness across dermatological contexts.<h4>Conclusion</h4>Adding platelet-rich products has shown promising results in enhancing therapeutic outcomes for various dermatological conditions, including chronic wounds, burns, scars, and skin aging. Although promising results have been reported, the need for critical thinking regarding the selection of the biomaterial and the platelet-rich products, standardized methodologies, large-scale randomized controlled trials, and long-term follow-up studies is emphasized to fully establish the clinical benefits of these combined treatments in dermatology.

Also flagged:Glioblastomabrain tumorsgene expressiontumorscell proliferationcell cycle
Journal Article 2025-09-27 No Snippets Tremante E, Díaz Méndez AB, Rizzo MG.
Show Full Abstract

Malignant brain tumors remain highly challenging to treat due to intrinsic and acquired therapy resistance and limited therapeutic options, consequently contributing to poor prognosis. Advancing the understanding of resistance mechanisms alongside novel treatment strategies is essential to improve clinical outcomes. Altered gene expression is common in tumors, and a specific class of non-coding RNAs, particularly long non-coding RNAs (lncRNAs), is frequently deregulated. LncRNAs play critical roles in processes such as cell proliferation, cell cycle arrest, and metastasis in brain cancer, functioning either as tumor promoters or suppressors. They exert their effects through transcriptional and post-transcriptional regulatory mechanisms. Understanding the functional roles of lncRNAs in malignant brain tumors has become a priority, as they are differentially expressed in tumors compared to healthy tissue. These molecules are studied for their potential as therapeutic targets and biomarkers in oncology. This review provides an overview of current research on brain cancer and lncRNAs, emphasizing the need for further investigation into their specific roles in therapy resistance and their involvement in various pathways. A better understanding of lncRNAs and their role in brain cancer could offer valuable insights into their prognostic and therapeutic potential, with the promise of improving early diagnosis and treatment outcomes.

Also flagged:nanomaterialsdiabetesoxygenbone formationtumorinfection
Journal Article 2025-09-27 No Snippets He W, Xu T, Wang M, Ni N, Su Y, Fan X.
Show Full Abstract

Bone defects, characterized by a loss of skeletal structure integrity, represent a prevalent clinical challenge affecting millions of patients. While bone autografts and allografts offer potential solutions, limitations, including donor scarcity, immune rejection, anatomical constraints, and complications arising from host comorbidities such as diabetes, often lead to unsatisfactory outcomes. This necessitates the need for alternative treatments. Researchers have identified that reactive oxygen species (ROS) play a crucial role in bone regeneration. Although physiological ROS levels are essential for normal healing, excessive ROS accumulation disrupts the balance between bone formation and resorption, hindering regeneration. Antioxidants can mitigate oxidative stress by scavenging ROS or inhibiting their formation, thereby restoring the equilibrium between bone formation and resorption. Advances in nanotechnology have enabled the development of various ROS-scavenging nanomaterials with enhanced therapeutic efficacy. These nanomaterials either function as delivery platforms for conventional antioxidants or as direct ROS-neutralizing agents through intrinsic redox or enzyme-mimicking properties. This review comprehensively summarizes ROS-scavenging nanomaterials for bone tissue regeneration, focusing on their design strategies, underlying mechanisms, applications, and potential for clinical translation.

medRxiv 2025-09-27 Preprint (No Snippets API) Singh A, Posner J.
Show Full Abstract

The putamen plays a key role in motor control, learning, and cognition, with abnormal putamen volumes associated with neuropsychiatric disorders. Using data from the ABCD study, we performed a genome wide association study (GWAS) of putamen volumes, followed by replication and pathway enrichment analyses. We next evaluated the shared genetic architecture of putamen volume and neuropsychiatric disorders—including depression, schizophrenia, Parkinson’s, ADHD, bipolar, and OCD— using SNP associations from this and prior GWASs. We identified 199 genome-wide significant SNP associations in White participants. Most identified SNPs were in gene regulatory regions and in the neuronal growth-linked genes, DCC and DSCAM . Sixteen of the most significant associations observed in Whites were replicated in non-White participants. Twenty-one SNPs from prior GWASs of putamen volumes were also replicated in our ABCD GWAS analysis, including five of the top eight SNPs. There was considerable genetic heterogeneity between White and non-White participants in putamen-linked SNPs with significant differences between the minor allele frequencies across the two groups (Wilcoxon rank-sum test Exact prob < 0.0001). We identified a key pathway ( REACTOME_DSCAM_INTERACTIONS) associated with putamen volume that involves DSCAM gene, netrin-1 protein and/or DCC gene. In addition, 28 unique SNPs from prior GWASs of neuropsychiatric disorders were strongly associated with putamen volume at Bonferroni-corrected significance, while 40 SNPs shared by at least three disorders were associated with putamen volume at a 0.05 threshold. Our findings provide deeper insights into the shared genetic architecture and cross-population differences in genetic associations of putamen volume.

bioRxiv 2025-09-27 Preprint (No Snippets API) Tang TT, Zangari F, Yu CW, Stowell JA, Roeselová A, Freund SM, Gingras A, Passmore LA.
Show Full Abstract

Cytoplasmic shortening of mRNA poly(A) tails represses eukaryotic gene expression by inhibiting efficient translation and committing an mRNA to decay. The CCR4–NOT deadenylase machinery interacts with sequence-specific RNA-binding proteins (RBPs), termed RNA adaptors, to target specific transcripts for deadenylation. In contrast, the PAN2–PAN3 deadenylation complex is thought to be predominantly recruited to mRNAs via interaction with the poly(A) binding protein, raising the question of whether it acts in a transcript-specific manner. Here, using biochemical reconstitution, we show that PAN2–PAN3 can also be recruited to specific RNAs via RNA adaptors, including MEX3, YTHDF and ZFP36 proteins. In cells, we find that a diverse range of RNA adaptors interact with both major deadenylation complexes. Thus, our data suggest that, in addition to CCR4-NOT, PAN2-PAN3 also contributes to the specificity of mRNA degradation and the robustness of post-transcriptional regulation of gene expression.

PRDX6
Also flagged:AtractylodinsepsisTOM20mitochondrialmembraneSIRT3
Journal Article 2025-09-26 ✓ 1 Snippet Hu YX, Chen MQ, Wang JL, Wu T, Zhang HD, Li TT, Gao H, Bai Y.
In-Text Gene Mentions

…PRDX1, PRDX2 andPRDX6are localized in…

Show Full Abstract

Gastrointestinal injury (GI) is a significant concern in various medical contexts, particularly in patients undergoing antiplatelet therapy, experiencing trauma, or dealing with the effects of medications. The present study investigated the effect of atractylodin, a bioactive compound derived from <i>Atractylodes lancea</i> (Thunb.) DC., traditionally used in medicinal applications. A sepsis animal model was established through cecal ligation and perforation. Mice were treated with atractylodin, with or without silencing of NAD‑dependent protein deacetylase sirtuin‑3 (SIRT3), via transfection with adeno‑associated virus (AAV) vectors. Atractylodin markedly improved mitochondrial function <i>in vivo</i>, as evidenced by increased mitochondrial‑related proteins via western blot analysis (TOM20) and increased mitochondrial membrane potential, as observed via JC‑1 staining. In addition, atractylodin treatment inhibited apoptosis. Together, these changes regulated mitochondrial dysfunction. Moreover, atractylodin improved the prognosis of sepsis‑induced ferroptosis in the stomach and colon tissues. Atractylodin markedly activated SIRT3 while suppressing the expression of ac‑peroxiredoxin‑3 (PRDX3). Notably, the knockdown of SIRT3 diminishes the inhibitory effect of atractylodin on ferroptosis, when AAV‑short hairpinSIRT3 was injected into the stomach and colon tissues of C57 BL/6 mice. Further, atractylodin may have attenuated GI development by preventing mitochondrial dysfunction through the SIRT3/PRDX3 pathway. Hence, protection against mitochondrial dysfunction using atractylodin may be a promising therapeutic strategy against sepsis‑induced acute GI.

SOX6
Also flagged:FBXO2E3proteasomedeubiquitinating enzymedegradationubiquitin
Journal Article 2025-09-26 ✓ 1 Snippet Zhang J, Yang J, Zhang X, Yuan Y, Sun S, Zhang S, He J.
In-Text Gene Mentions

…the transcription factorSOX6promotes the expression…

Show Full Abstract

The ubiquitin‑proteasome system (UPS) acts as a central regulator for a range of protein components, including ubiquitin, ubiquitin‑activating enzyme (E1), ubiquitin‑conjugating enzyme (E2), ubiquitin ligase (E3), the 26S proteasome and deubiquitinating enzyme. These components function in a coordinated manner to facilitate the repair and degradation of proteins. Among the ubiquitinating enzymes, in conjunction with E1‑activating enzymes and E2‑binding enzymes, it attaches to substrates and promotes the transfer of ubiquitin molecules to target proteins. The S‑phase kinase‑associated protein 1 (SKP1)‑Cullin‑F‑box (SCF) complex is one of the E3 ligases involved in cancer progression, and consists of four primary components: i) SKP1; ii) Cullin 1/coiled‑coil domain containing 53; iii) ring box protein 1/RING‑box 1/RING‑box protein HRT1; and iv) F‑box protein (FBP). Each FBP can recognize and bind to a different set of substrates, which determines the specificity of the targets of the SCF complex. In addition to being components of the SCF complex, FBPs participate in processes such as DNA replication, transcription, cell differentiation and cell death. F‑box protein 2 (FBXO2), a member of the human FBP family, functions as a subunit of FBP ubiquitin ligases and is highly expressed in the cytoplasm of eukaryotic cells. FBXO2 is highly expressed in various malignant tumors, and is closely associated with tumor cell proliferation, migration and invasion. The present review presents the composition of the UPS and FBP families and their roles in malignant tumors, with a focus on advancements in research into the relationships between FBXO2 and various malignant tumors, aiming to acquire a more profound understanding of their potential mechanisms in the development of malignant tumors and to offer novel ideas for tumor therapy.

Also flagged:ProenkephalinPENKbrain atrophyneurofilament lightMovement DisordersMovement Disorder
Journal Article 2025-09-26 No Snippets Farag M, Murphy MJ, Hobbs NZ, Leocadi M, Fayer K, Thackeray O, Gobom J, Ciosi M, Heslegrave A, Zetterberg H, Langbehn DR, Monckton DG, Wild EJ, Tabrizi SJ, Tabrizi SJ, Scahill RI.
Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is characterized by early, selective, progressive vulnerability of striatal medium spiny neurons (MSNs). Proenkephalin (PENK), a precursor of opioid peptides abundantly expressed in MSNs, is a promising biomarker of striatal integrity, but region-specific associations and its potential for early-stage discrimination have not been characterized.<h4>Objectives</h4>We investigated cross-sectional and longitudinal associations between baseline cerebrospinal fluid (CSF) PENK concentration and regional brain atrophy, compared identified patterns with CSF neurofilament light (NfL), and evaluated PENK and NfL for discriminating between HD Integrated Staging System (HD-ISS) stage 0 versus 1 in a far-from-onset HD gene-expanded (HDGE) cohort.<h4>Methods</h4>Whole-brain voxel-based morphometry was performed in 149 participants (72 HDGE, 77 controls) cross-sectionally and 88 participants (54 HDGE, 34 controls) longitudinally over a mean interval of 4.8 years. Voxel-wise linear regression tested associations between baseline biofluid biomarkers and gray/white matter volume, adjusting for age, sex and CAG-Age Product score, with false discovery rate correction. Logistic regression and receiver operating characteristic analyses assessed stage discrimination.<h4>Results</h4>Lower baseline CSF PENK predicted longitudinal gray and white matter loss, predominantly in the striatum bilaterally. Higher baseline CSF NfL predicted widespread longitudinal white matter loss. For stage discrimination, PENK (area under curve [AUC], 0.706; P = 0.0002) outperformed NfL (AUC, 0.661; P = 0.1596) with minimal gain from combining both (AUC, 0.714; joint P = 0.0007).<h4>Conclusions</h4>Lower baseline CSF PENK concentration predicted longitudinal striatal atrophy and CSF PENK outperformed CSF NfL in distinguishing HD-ISS stages 0 and 1, supporting its role as a striatum-specific biomarker with potential to enrich early-stage HD trial cohorts. © 2025 The Author(s). Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

SERPINC1CCDC92
Also flagged:Amino Acidamino acidsCAAPasparaginethreoninePrestin
Journal Article 2025-09-26 ✓ 2 Snippets Chen S, Zou Z.
In-Text Gene Mentions

…12 genes (CCDC92, CDH19 ,…

…the 12 genes,SERPINC1has been reported…

Show Full Abstract

Many studies have proposed various comparative genomic methods to probe the molecular basis for adaptive functional convergence between species, conventionally by detecting the convergence of amino acid states between orthologous protein sequences of these species or lineages. However, different amino acids with similar physicochemical properties at a site may contribute to the functional similarity of the protein. Hence, could the convergence of amino acid physicochemical properties, in addition to state convergence, also contribute to adaptive convergence of organismal functions? Here we grouped amino acids into physicochemically similar classes, and developed computational pipelines to detect the Convergence of Amino Acid Properties (CAAP, https://github.com/shanschen33/CAAP) by modifying previous state convergence detection methods. Investigating three organismal convergence cases including echolocating mammals, marine mammals and woody mangroves, we found genes with CAAP that likely contribute to the respective functional adaptation, supported by orthogonal evidence such as functional enrichment and positive selection analyses. Our findings in multiple cases corroborate the hypothesis that CAAP may underlie adaptive convergent evolution of organismal functions, emphasising the importance of considering sequence features more complex than amino acid states when studying adaptive sequence convergence.

TNFSF4
Also flagged:MATN3hepatocellular carcinomacancerα-PinenemonoterpeneMatrilin-3
Journal Article 2025-09-26 ✓ 1 Snippet Zhao B, Qiu W, Xu W, Wu L, Zhao J, Zhao H, Wei F, Qiu B.
In-Text Gene Mentions

…Notably,TNFSF4and ENTPD1 are…

Show Full Abstract

In the search for novel therapeutic strategies against cancer, natural compounds such as α-Pinene, a bioactive monoterpene predominantly found in coniferous trees, have emerged as potential modulators of oncogenic processes. The primary objective of this study was to investigate whether α-Pinene can regulate the expression of MATN3 (Matrilin-3), a gene previously associated with poor prognosis in various cancers. Our central hypothesis is that α-Pinene exerts its anticancer effects, at least in part, by downregulating MATN3, thereby impacting oncogenic signaling. The rationale for selecting MATN3 as a target lies in its demonstrated overexpression in multiple cancer types and its established role as both a prognostic marker and a contributor to tumor progression. Extending our research through a comprehensive pan-cancer analysis, we confirmed the association between high MATN3 expression and poor prognosis across multiple cancer types. Further exploration revealed a strong correlation between MATN3 expression and immune infiltration, as well as significant associations with key immunomodulatory genes, suggesting an intricate role of MATN3 in the tumor immune environment. Enrichment analysis pointed to the involvement of MATN3 in the PI3K-AKT signaling pathway. Additionally, we identified connections between MATN3 and extracellular matrix (ECM)-related mechanisms.The downregulation of MATN3 by α-Pinene in HepG2 cells suggests a novel mechanism by which α-Pinene may exert anticancer effects, potentially through the disruption of key oncogenic and immune-related pathways. This study not only underscores the anticancer potential of α-Pinene but also establishes MATN3 as a critical target and biomarker across a spectrum of cancers. Our findings advocate for further clinical investigations into α-Pinene's therapeutic potential, particularly focusing on its impact on MATN3 and related pathways in diverse cancer contexts.

LRRC7
Also flagged:Lysosomesmembraneorganelles-bound receptor proteinsautophagosomevesicles
Journal Article 2025-09-26 ✓ 1 Snippet Kumar A, Zhao Y, Xie L, Chadda R, Tranter JD, Mikami RT, Abraham N, Hong J, Feng E, Rawnsley DR, Liu H, Henry KM, Meyer G, Hu M, Xu H, Hinton A, Grueter CE, Abel ED, Norris AW, Diwan A, Sah R.
In-Text Gene Mentions

…Theleucine-rich repeat-containing 8repeat-containing 8 (LRRC8)…

Show Full Abstract

The lysosome integrates anabolic signaling and nutrient sensing to regulate intracellular growth pathways. The leucine-rich repeat-containing 8 (LRRC8) channel complex forms a lysosomal anion channel and regulates PI3K-AKT-mTOR signaling, skeletal muscle differentiation, growth, and systemic glucose metabolism. Here, we define the endogenous LRRC8 subunits localized to a subset of lysosomes in differentiated myotubes. We show that LRRC8A affects leucine-stimulated mTOR; lysosome size; number; pH; expression of lysosomal proteins LAMP2, P62, and LC3B; and lysosomal function. Mutating an LRRC8A lysosomal targeting dileucine motif sequence (LRRC8A-L706A;L707A) in myotubes recapitulates the abnormal AKT signaling and altered lysosomal morphology and pH observed in LRRC8A knockout cells. In vivo, LRRC8A-L706A;L707A knock-in mice exhibit increased adiposity, impaired glucose tolerance and insulin resistance associated with reduced skeletal muscle PI3K-AKT-mTOR signaling, glucose uptake, and impaired incorporation of glucose into glycogen. These data reveal a lysosomal LRRC8-mediated metabolic signaling function regulating lysosomal function, systemic glucose homeostasis, and insulin sensitivity.

Also flagged:reproductionresponse tolipidCyp6g1toeclosion
Journal Article 2025-09-26 No Snippets Chen J, Liu C, Li W, Clark AG, Wang Z, Lu J.
Show Full Abstract

Genetic variants can have sex-specific, sex-biased, or sexually antagonistic fitness effects, yet their roles in fitness-related traits remain unclear. Using pooled phenotype sorting and sequencing of male <i>Drosophila melanogaster</i> from natural populations, we identified starvation resistance-associated variants, many in regulatory regions or altering protein sequences. RNA interference experiments showed that 85.7% (66 of 77) of the candidate genes with nonlethal knockdown effects influenced starvation resistance. Of these, 49 had sex-dependent effects, including 12 with sexually antagonistic effects-all increasing resistance in females but decreasing it in males. These patterns were not explained by sex-biased expression or knockdown efficiency. Analysis of the <i>Lnk</i> gene revealed that both nonsynonymous mutations and expression changes had sex-dependent effects. Our findings indicate that polygenic architecture, sex-dependent effects, and pleiotropy jointly shape evolutionary outcomes and that some variants maintained by these forces may enable rapid responses to environmental change.

SERPINC1
Also flagged:Neonatal SeizuresstrokeinfectionsSeizureHIEacute metabolic disorders
Journal Article 2025-09-26 ✓ 1 Snippet Kraus V, Schatz U, Krüger M, Krampe-Heni F.
In-Text Gene Mentions

…genetic variant wasSERPINC1, which leads…

Show Full Abstract

Prevalence of seizures is 1 to 5/1,000 neonates. The most common causes of neonatal seizures are hypoxic-ischemic encephalopathy (HIE), vascular events (hemorrhages, stroke), and infections. We assessed prevalence and etiology of seizures defined according to the recent Brighton and International League of Epilepsy (ILAE) criteria in a neonatology monocenter cohort.In a retrospective cross-sectional cohort study of all 12,154 neonates born in our three maternities from January 1, 2022 to December 31, 2023 seizures were categorized by frequency, etiology, risk profile, semiology, and EEG. A total of 19 neonates (male: <i>n</i> = 11 [57.9%]; full-term: <i>n</i> = 11 [57.9%]; preterm very low birth weight [VLBW]: <i>n</i> = 6 [31.6%]; preterm >1,500 g birth weight: <i>n</i> = 2 [10.5%]) were identified.In 19/12,154 neonates, seizures were confirmed by application of the ILAE criteria. Preterm VLBW was found in 174 neonates with birth weight <1,500 g. Seizure incidence was 1.6/1,000 in all neonates and 3.4% in VLBW infants. HIE was the most frequent etiology in term infants (30.8%), followed by vascular events in preterm >1,500 g and term infants (30.8%). Vascular events were the most common cause in preterm VLBW infants (83.3%). Whole exome sequencing (WES) was performed in four cases (21.1% of neonates with seizures).Incidence of neonatal seizures in our center is in the lower range and leading seizure etiologies are comparable to the literature. Early recognition of neonatal seizures including the detection of electrographic-only seizures and early WES to identify rare genetic defects possibly offering tailored treatment options have the potential to further raise the standard of neonatal care and improve neurodevelopmental outcome.

SOX6
Also flagged:joint diseasesOsteoarthritisOAdegenerative joint disorderMsi2pathogenesis
Journal Article 2025-09-26 ✓ 1 Snippet Suo J, Li L, Tan W, Yin X, Wang J, Shao R, Sun S, Guo SK, Feng J, Gao BQ, Wang Y, Wei MY, Wang L, Feng H, Gao X, Hu P, Zheng X, Chen LL, Lei G, Huang Y, Zou W.
In-Text Gene Mentions

…region of SOX11,SOX6and SOX5 is…

Show Full Abstract

In vitro-transcribed and circularized RNAs (ivcRNAs) represent a robust platform for sustained protein translation, offering promising potential for localized therapeutic delivery in joint diseases. Osteoarthritis (OA), the most prevalent degenerative joint disorder, remains a major clinical challenge due to its progressive nature and the lack of disease-modifying treatments. In this study, we identify Musashi2 (Msi2) deficiency in articular chondrocytes as a key contributor to OA pathogenesis. To evaluate the efficacy of ivcRNA-mediated protein replacement therapy, we developed a localized delivery strategy that enables high-yield and prolonged protein expression in chondrocytes. Using a destabilization of the medial meniscus (DMM) mouse model, we demonstrate that intra-articular delivery of ivcRNA encoding MSI2 effectively mitigates OA progression in male mice. Furthermore, therapeutic supplementation of SOX5, a downstream effector of MSI2, via ivcRNA delivery further validates this approach. Our findings establish ivcRNA-based protein replacement as a potential RNA therapeutic strategy for osteoarthritis.

TNFSF4
Also flagged:tumorlung adenocarcinomapleural mesotheliomahematoxylinsegmentationsolid tumors
Journal Article 2025-09-26 ✓ 1 Snippet Ozirmak Lermi N, Molina Ayala M, Hernandez S, Lu W, Khan K, Serrano A, Lubo I, Hamana L, Tomczak K, Barnes S, Dou J, Liang Q, RTI Team, Raso MG, Tang X, Jiang M, Sanchez-Espiridion B, Weissferdt A, Heymach J, Zhang J, Sepesi B, Cascone T, Tsao A, Altan M, Mehran R, Gibbons D, Wistuba I, Haymaker C, Chen K, Solis Soto LM.
In-Text Gene Mentions

…, TNFRSF9 ,TNFSF4, TNFSF9 ,…

Show Full Abstract

Imaging-based spatial transcriptomics (ST) is evolving as a pivotal technology in studying tumor biology and associated microenvironments. However, the strengths of the commercially available ST platforms in studying spatial biology have not been systematically evaluated using rigorously controlled experiments. We use serial 5 μm sections of formalin-fixed, paraffin-embedded surgically resected lung adenocarcinoma and pleural mesothelioma samples in tissue microarrays to compare the performance of the ST platforms (CosMx, MERFISH, and Xenium (uni/multi-modal)) in reference to bulk RNA sequencing, multiplex immunofluorescence, GeoMx, and hematoxylin and eosin staining data. In addition to an objective assessment of automatic cell segmentation and phenotyping, we perform a manual phenotyping evaluation to assess pathologically meaningful comparisons between ST platforms. Here, we show the intricate differences between the ST platforms, reveal the importance of parameters such as probe design in determining the data quality, and suggest reliable workflows for accurate spatial profiling and molecular discovery.

HFE
Also flagged:fatty liver diseaseMetabolic dysfunction-associated fatty liver diseaseKurdica gumfattylipidnon-alcoholic fatty liver disease
Journal Article 2025-09-26 ✓ 1 Snippet Mostafaei R, Nachvak SM, Saber A, Jalilian N, Mahaki B, Salehi MG, Behbood L, Ghorbani Z, Rahimi S.
In-Text Gene Mentions

…virus, autoimmune hepatitis,hemochromatosis, celiac disease, pituitary…

Show Full Abstract

Metabolic dysfunction-associated fatty liver disease (MAFLD) is a problem worldwide. Oxidative stress is important factor in beginning and progress of MAFLD. This study is the first clinical trial with the aim of determining the effect of Pistacia atlantica Sub. Kurdica gum on oxidative status in patients with metabolic dysfunction-associated fatty liver disease. In this double-blind randomized clinical trial 50 patients with metabolic dysfunction-associated fatty liver disease were randomized into two groups: those given syrup containing Pistacia atlantica sub. Kurdica gum (Group A), those on placebo (Group B). Over a two-month period, Group A given syrup containing 500 mg of P. atlantica sub. Kurdica gum per each tablespoon and Group B given syrup without P. atlantica sub. Kurdica gum. Anthropometric measures, serum oxidative markers and physical activity were evaluated at the beginning and end of the intervention. We observed a significant decrease in fatty liver grade in group A (P = 0.03). In the end of intervention had not been show significant change in serum total antioxidant capacity (TOS) in group A (P = 0.91) and group B (0.70). Serum total oxidant status (TAC) had been show increase in group A and decrease in group B but this changes not significant as within group (P = 0.36, P = 0.53, respectively) and between group (P = 0.66). The mean of Malondialdehid (MDA) had significant decrease from baseline in group A (P = 0.002) and had non-significant increase in group B (P = 0.65). The between-group comparison of changes of MDA had been show a significant difference (P = 0.025). As well as, after adjusting for baseline characteristics (Age, Gender, Physical activity, BMI), there were not significant differences between A and B groups in the changes comparison of TOS and TAC except for MDA (p < 0.032). Weight had significant decrease in group A (P = 0 < 001). Pistacia atlantica sub. Kurdica gum can improve some oxidative status indices, particularly lipid peroxidation and subsequently MAFLD in patient with metabolic dysfunction-associated fatty liver disease, but further studies with larger samples, longer duration and dose-response assessment will be needed.Trial registration: IRCT20231219060466N1, 2024-01-05 (https//irct.behdasht.gov.ir/).

CACNA1E
Also flagged:α-synucleinsecretionpresynaptic terminalscalciumvoltage gated calcium channelsω-conotoxin GVIA
Journal Article 2025-09-26 ✓ 1 Snippet Leandrou E, Chalatsa I, Vekrellis K, Emmanouilidou E.
In-Text Gene Mentions

…rse; TATCATGAGAGCAGCATAGACCTT,Cacna1e(Cav2.3) forward; AAGGTAAAGAAA…

Show Full Abstract

The secretion of α-synuclein from presynaptic terminals is controlled by neuronal activity through a calcium-dependent mechanism. To address the role of voltage gated calcium channels in this process, we used reverse brain microdialysis to monitor α-synuclein release in vivo in the presence of selective channel inhibitors. Our results revealed that the ω-conotoxin GVIA-sensitive N-type calcium channels are the major mediators of stimulated α-synuclein secretion in mouse striatum.

Also flagged:cancernanoparticlepolyvinyl alcoholchitosansilver nanoparticlesilver nanoparticles
Journal Article 2025-09-26 No Snippets Budiarto R, Sholikin MM, Adli DN, Wahyono T, Ahmed T, Ujilestari T, Ali HM.
Show Full Abstract

This study aims to explore and analyse the potential antioxidant and anticancer potential of various citrus-mediated nanoformulations (CMNs), focusing on their effectiveness in scavenging free radicals and inducing cytotoxicity in cancer cells. This research employs a meta-analysis approach to assess data from multiple studies on CMNs. This study is the first meta-analysis to evaluate the antioxidant and anticancer properties of CMNs concurrently. This study offers a novel perspective by examining citrus species, plant parts utilised, nanoparticle types, particle sizes, and coating materials. The analysis employs the Population, Intervention, Comparison, and Outcome (PICO) framework and complies with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. The analysis utilizes Hedges' effect size and includes validation through fail-safe N. The IC<sub>50</sub> evaluation (µg/mL) revealed a significant effect of CMNs on antioxidant activity (d<sub>++</sub> = 3.49; P < 0.05). The IC50 value of 3.49 in the CMN indicates that a lower concentration is sufficient to inhibit 50% of the free radical activity, reflecting a stronger antioxidant potential than that of the control group. However, the overall antioxidant assay results (d<sub>++</sub> = 0.2; P = 0.309) and radical inhibition (%) for CMNs (d<sub>++</sub> = 0.1; P = 0.602) did not significantly differ. Subgroup analysis provided further insights, showing that both citrus peel and polyvinyl alcohol significantly reduced IC<sub>50</sub> values (d<sub>++</sub> >1; P < 0.05). In addition, radical inhibition significantly increased in CMNs derived from Citrus paradisi (d<sub>++</sub> = 3.05; P = 0.015), followed by those derived from Citrus limon (d<sub>++</sub> = 2.25; P < 0.01) and Citrus reticulata (d<sub>++</sub> = 1.03; P = 0.025). Various types of nanoformulations, such as Ag chitosan-NP (silver nanoparticle with chitosan), Ag-NP (silver nanoparticles), cerium dioxide nanoparticle (CeO₂-NPs), hydrogel-based nanocomposite (Hydrogel-NPCs), pectin-based nanoemulsion (Pectin-NPEs), titanium dioxide nanoparticle (TiO₂-NP), and whey-based nanoemulsion (Whey-NPEs), also significantly enhanced free radical scavenging activity (d<sub>++</sub> >1; P < 0.01). In terms of anticancer activity, CMN has a strong effect size (|d<sub>++</sub>| >1; P < 0.05), with species such as Citrus macroptera and plant parts such as juice showing highly positive effects (d<sub>++</sub> = 2.25; P < 0.001). Additionally, nanoparticles with sizes between 101 and 500 nm exhibited significant effectiveness (d<sub>++</sub> = 2.26; P < 0.001). These findings indicate that citrus-derived compounds have potential as anticancer agents by actively enhancing the antioxidant capacity of healthy cells. The significant antiproliferative activity observed across multiple cancer cell lines, supported by robust statistical analyses, demonstrates the potential of CMNs as a natural therapeutic approach for cancer prevention and treatment.

Also flagged:glycoproteinsgalactose-type C-type lectinsugarlectin receptorslectinsmacrophage galactose-type lectin
Journal Article 2025-09-26 No Snippets Szczykutowicz J, Zimmer M, Orczyk-Pawiłowicz M.
Show Full Abstract

Immunity during pregnancy must be precisely balanced, because the mother's body needs to effectively fight pathogens while maintaining tolerance of the semi-allogeneic fetus. Factors that participate in achieving the proper immune balance during pregnancy include glycoproteins that expose sugar residues recognized by specific lectin receptors. Several types of lectins and their ligands have been detected at the maternal-fetal interface, and changes in their expression levels have been correlated with pregnancy complications. Although the presence of potential sugar ligands for human macrophage galactose-type lectin (MGL), including LacdiNAc and (sialo)Tn antigen, has been detected in amniotic fluid, placenta and fetal tissues, the interaction between them and its possible role have not been elucidated so far. The aims of the present study were to evaluate reactivity of MGL with amniotic fluid proteins and to identify and characterize the amniotic ligands of MGL. The analysis proved the ability of MGL to interact with amniotic glycoproteins and revealed the potential protein carriers of glycans recognized by MGL, including mucins, mucin-like proteins, and uromodulin. Bioinformatics analysis assigned the identified glycoproteins as being involved in immune processes such as regulation of signaling pathways activated in the response to Toll-like receptor (TLR) agonist stimulation or modulation of antimicrobial responses. Our research suggests that MGL-mediated interactions may be involved in maintaining the delicate immune balance during pregnancy. Our results may be helpful in future implementation of modern therapies based on the glycan ligands of MGL in the context of avoiding miscarriages and preterm birth.

HFE
Also flagged:liver diseaseLiver cirrhosischronic liver diseasesliver infectionsviral hepatitis Balcohol-related liver disease
Journal Article 2025-09-26 ✓ 1 Snippet Nastasa R, Stanciu C, Stratina E, Zenovia S, Stafie R, Rotaru A, Sfarti C, Girleanu I, Minea H, Singeap AM, Huiban L, Trifan A.
In-Text Gene Mentions

…hepatitis, Wilson disease,hemochromatosis, HIV co-infection, alcoholic…

Show Full Abstract

Liver cirrhosis is the primary contributor to global mortality associated with chronic liver diseases (CLD). Certain liver infections, including viral hepatitis B (VHB) and C (VHC), alcohol-related liver disease (ALD), and metabolic dysfunction-associated steatotic liver disease (MASLD) are significant contributors to the development of liver cirrhosis. This study aimed to evaluate the prevalence of liver steatosis and fibrosis in individuals with vulnerable conditions. Subjects residing in a rural Romanian county or having lower educational attainment were selected for this study. Following the acquisition of informed consent, a demographic, clinical, and physiological characterization was conducted for each participant. The AUDIT-C questionnaire was obtained from every participant. Transient Elastography (TE) measured liver fibrosis, while blood tests screened for the presence of hepatitis viruses B and C. Among the 571 screened vulnerable subjects, 52.7% were males, and 17.3% were identified as heavy drinkers. Metabolic syndrome was identified in 37.3% of patients and 70% of subjects exhibited a body mass index of ≥ 25 kg/m<sup>2</sup>. Furthermore, 8.5% of participants tested positive for HBs antigen, while 6.1% had HCV antibodies. Additionally, 35.7% of the participants in our study had MASLD, and 7.1% had metabolic dysfunction and alcohol-related liver disease (MetALD) according to the AUDIT-C questionnaire. On TE exams, we found that 9.9% of the participants had advanced fibrosis, 16.1% had cirrhosis, and 24.5% had severe steatosis. Hence, the prevalence of advanced fibrosis and cirrhosis is elevated in asymptomatic healthy individuals from vulnerable conditions in Northeastern Romania, particularly among those with various risk factors. Most of the subjects were identified with MetALD and ALD demonstrating the efficacy of the new nomenclature in identifying the etiology of liver fibrosis.

BTN2A1
Also flagged:BTN3A2nephrolithiasisglomerular filtrationdigitoxigeninbindingtract obstruction
Journal Article 2025-09-26 ✓ 5 Snippets Sun S, Wang Y, Dong Q, Bi J, Fu Y.
In-Text Gene Mentions

…2 member A1 (BTN2A1), receptor tyrosine-protein k…

…to the GFR (BTN2A1, BTN3A2, ERBB4/UMOD, HLA-E…

…were 5.549% forBTN2A1, 21.495% for BTN3A2,…

…safety evaluation, andBTN2A1, FKBPL, and HLA-E…

…PPRTs and nephrolithiasis (BTN2A1, BTN3A2, ERBB4/UMOD, FKBPL,…

Show Full Abstract

Nephrolithiasis has a high recurrence rate and imposes a heavy burden on patients and society. Therefore, there is an urgent need to explore new effective targets for nephrolithiasis prevention and treatment. Protein quantitative trait loci (pQTL) data of plasma proteins and plasma protein-protein ratios were used as plasma protein related targets (PPRTs), and genome-wide association studies (GWASs) of nephrolithiasis were used as outcomes. Bidirectional Mendelian randomization analyses were then conducted. The mediating factors between PPRTs and nephrolithiasis were identified. After colocalization analyses, the safety of targeted PPRTs for nephrolithiasis were evaluated. Subsequently, multi-omics data were used to further validate the effects of candidate PPRTs on nephrolithiasis. Finally, molecular docking operations were performed. Six PPRTs were confirmed to be causally associated with nephrolithiasis. The glomerular filtration rate (GFR) was identified as a mediating factor between five PPRTs and nephrolithiasis. There were strong evidences of colocalization of three PPRTs. After safety assessments and multi-omics analyses, BTN3A2 was considered as a potential therapeutic target. Molecular docking analyses indicated that digitoxigenin had the strongest binding ability with BTN3A2. These comprehensive analyses suggested causal relationships between PPRTs and nephrolithiasis, and BTN3A2 might be an advantageous drug target for nephrolithiasis.

DARS2TNFSF4
Also flagged:Bladder cancerBLCAmalignant tumor of theMitophagyautophagymitochondria
Journal Article 2025-09-26 ✓ 2 Snippets Huang X, Meng Y, Song J, Zhu Y, Li J, Xi Y, Peng X, Xiong Y.
In-Text Gene Mentions

…reported in studiesDARS2promotes BLCA progression…

…ICOS, TMIGD2, PDCD1,TNFSF4, TIGIT, TNFSF9, CTLA4,…

Show Full Abstract

Bladder cancer (BLCA) is the most prevalent malignant tumor of the urinary system. Mitophagy is a selective form of autophagy that occurs within the mitochondria. The goal of this study was to determine mitophagy-related biomarkers associated with BLCA and to explore their underlying molecular mechanisms. CTSK, MTERF3, SRC, and CSNK2B were identified as biomarkers. A risk model classified BLCA patients into high-risk group (HRG) and low-risk group (LRG), with HRG patients exhibiting lower survival probabilities. The "chemical carcinogenesis-DNA adducts" and "cytokine-cytokine receptor interaction" signaling pathway were closely associated with HRG and LRG. TP53 had the highest mutation frequencies in the HRG and LRG, respectively. The two groups exhibited significant differences in 14 immune cells, including M2 macrophages. CTSK exhibited the strongest correlation with the naive B cells. A total of 135 drugs differed in sensitivity between HRG and LRG, including KU.55933. The identified regulatory network included ADAMTSL4-AS1-hsa-miR-149-5p-SRC. Expression analysis showed that CTSK was significantly downregulated in the BLCA group, while MTERF3, SRC, and CSNK2B were significantly upregulated. In conclusion, CTSK, MTERF3, SRC, and CSNK2B laid the foundation for targeted therapy in the treatment of BLCA.

POU3F2
Also flagged:Frontotemporal dementiadementiapathogenesisC9orf72C9dipeptide repeat proteins
Journal Article 2025-09-26 ✓ 1 Snippet Huber N, Hietanen T, Heikkinen S, Shakirzyanova A, Hoffmann D, Rostalski H, Dhingra A, Rodriguez-Nieto S, Kärkkäinen S, Koskuvi M, Korhonen E, Hartikainen P, Pylkäs K, Krüger J, Malm T, Takalo M, Hiltunen M, Koistinaho J, Portaankorva AM, Solje E, Haapasalo A.
In-Text Gene Mentions

…upper layer neurons,POU3F2is found in…

Show Full Abstract

Frontotemporal dementia (FTD) is the second most common cause of dementia in patients under 65 years, characterized by diverse clinical symptoms, neuropathologies, and genetic background. Synaptic dysfunction is suggested to play a major role in FTD pathogenesis. Disturbances in the synaptic function can also be associated with the C9orf72 repeat expansion (C9-HRE), the most common genetic mutation causing FTD. C9-HRE leads to distinct pathological hallmarks, such as C9orf72 haploinsufficiency and development of toxic RNA foci and dipeptide repeat proteins (DPRs). FTD patient brains, including those carrying the C9-HRE, are also characterized by neuropathologies involving accumulation of TDP-43 and p62/SQSTM1 proteins. This study utilized induced pluripotent stem cell (iPSC)-derived cortical neurons from C9-HRE-carrying or sporadic FTD patients and healthy control individuals. We report that the iPSC neurons derived from C9-HRE carriers developed typical C9-HRE-associated hallmarks, including RNA foci and DPR accumulation. All FTD neurons demonstrated increased cytosolic accumulation of TDP-43 and p62/SQSTM1 and changes in nuclear size and morphology. In addition, the FTD neurons displayed reduced number and altered morphologies of dendritic spines and significantly altered synaptic function indicated by a decreased response to stimulation with GABA. These structural and functional synaptic disturbances were accompanied by upregulated gene expression in the FTD neurons related to synaptic function, including synaptic signaling, glutamatergic transmission, and pre- and postsynaptic membrane, as compared to control neurons. Pathways involved in DNA repair were significantly downregulated in FTD neurons. Only one gene, NUPR2, potentially involved in DNA damage response, was differentially expressed between the sporadic and C9-HRE-carrying FTD neurons. Our results show that the iPSC neurons from FTD patients recapitulate pathological changes of the FTD brain and strongly support the hypothesis of synaptic dysfunction as a crucial contributor to disease pathogenesis in FTD.

MLLT10SOX6
Also flagged:Cardiac myxomaheart tumornucleus-to-mesenchymal transitionmyxomaMAPK
Journal Article 2025-09-26 ✓ 2 Snippets Liu S, Zhang W, Sun H, Zheng C, Huang K, Fan C, Lai R, Yin M, Lan J, Wu X, Ran L, Li X.
In-Text Gene Mentions

…Among these, SOX5,SOX6, GATA4, and CDH11…

…oncogenic drivers—PVT1, CCND3,MLLT10, SETBP1, and BCAS3…

Show Full Abstract

Cardiac myxoma, the most common primary heart tumor, remains poorly understood at the molecular level. Here, we combined single-nucleus RNA sequencing, third-generation transcriptomics, and untargeted metabolomics to dissect its origin and pathology. Single-cell analyses demonstrate an endothelial origin driven by aberrant endothelial-to-mesenchymal transition (EndMT), with pseudotime and RNA-velocity tracing a continuum from endothelial-like to mesenchymal-like and metabolically active states. We identify two distinct myxoma subtypes: Subtype 1, marked by MAPK/WNT/EGFR pathway activation, and Subtype 2, characterized by ribosomal and oxidative phosphorylation signatures alongside immune-evasive programs. Third-generation data highlight extracellular matrix remodeling and endothelial signaling, while metabolomics reveal dysregulated purine, nicotinic acid, and nicotinamide metabolism. Notably, MET-PTK2 signaling emerges as a potential driver of tumor initiation and progression. These integrated findings define the cellular architecture and metabolic adaptations of cardiac myxoma and lay the foundation for future interventions.

CCPG1
Also flagged:Droshagene expressionnucleotidespairingviral genomesRNases
Journal Article 2025-09-26 ✓ 1 Snippet Chang T, Hancks DC.
In-Text Gene Mentions

…( hsa-mir-628 / DNAAF4-CCPG1/ NR_037923.1 ).…

Show Full Abstract

<h4>Background</h4>Small RNAs regulate gene expression in species across the tree of life. miRNAs, which impact a variety of cellular and physiological processes ranging from development and stress adaptation to host defense, are one of the best characterized classes of small RNA. Many miRNAs are produced from longer non-coding transcripts generated from host genes via a series of RNA cleavage reactions. The location of a small RNA within a host gene can shape the processing of the mature small RNA. For example, a type of miRNAs derived from host gene intronic sequence, referred to as miRtrons, are Drosha-independent and reliant on splicing for biogenesis. Relatedly, processing of a small RNA from an exon of a protein-coding mRNA, in principle, may destabilize it and compromise translation of the host gene. Prior to extensive transcriptome analysis, informatics analyses identified six human miRNAs embedded in exons of protein-coding genes and experimental studies have characterized additional anecdotal examples. Still, whether protein-coding mRNAs encoding small RNAs represent an appreciable class of host genes given the now recognized complexity of the transcriptome is unclear.<h4>Results</h4>Our analysis finds 201 small RNAs (118 human and 83 mouse) encoded by expressed exons of protein-coding genes (5'-UTR, CDS, 3'-UTR). Forty-six of these cases (29 human and 17 mouse) are also present in MirGeneDB which includes the most up-to-date miRNA classifications. Many of these small RNAs are poorly characterized with 96% of the protein-coding host gene relationships identified here not previously known. Furthermore, the identification of nearly fifty human and mouse small RNAs embedded within coding exons of canonical ORFs suggests that overlapping hybrid genes might be more common than previously appreciated in higher organisms. Expression analysis for a subset of these small RNAs indicates that many display differential expression across human tissues with the pattern correlating significantly with the expression of the candidate protein-coding host gene.<h4>Significance</h4>Overall, our analysis suggests that the number of protein-coding transcripts serving as host genes is greater than previously recognized. Our small RNA host gene classifications may serve as a resource to shed new light on small RNA biology, specific host genes, and gene regulation.

CACNA1E
Also flagged:voltage gated calcium channelamino acidion channelVoltage-gated calcium channelscalciumpore-forming
Journal Article 2025-09-26 ✓ 5 Snippets Bhuiyan SA, Tyson JR, Belmadani M, Sicherman J, Snutch TP, Pavlidis P.
In-Text Gene Mentions

…functional diversity ofCacna1esplice variants using…

…to catalog ratCacna1e(Cav2.3) splice variants,…

…structure of 2,110Cacna1esplice variants.…

…long-read sequencing ofCacna1eand the first…

…computational evaluation ofCacna1esplice variants for…

Show Full Abstract

<h4>Background</h4>The degree to which alternative RNA splicing influences the function and structure of voltage gated calcium channel (VGCC) splice variants is poorly understood. Here we used long-read RNA-sequencing to catalog rat Cacna1e (Cav2.3) splice variants, and computationally prioritize which are likely to impact channel function.<h4>Result</h4>We sequenced Cacna1e transcripts from rat thalamus using Oxford Nanopore sequencing yielding the structure of 2,110 Cacna1e splice variants. Of these, up to 154 had the potential encode for a functional channel based on predicted amino acid sequences. Our analysis revealed a total of 31 cassette splicing events (in various combinations) potentially affecting channel function, with three cassette exons appreciably expressed and conserved.<h4>Conclusion</h4>Our work both provides the first long-read sequencing of Cacna1e and the first computational evaluation of Cacna1e splice variants for future follow-up. This overall strategy to provide the field with prioritized transcripts will improve our understanding of Cacna1e function, its role in disease pathophysiology, and serve as a general approach to evaluate splice variant function across multiple ion channel types.

PRDX6
Also flagged:nicotineNotchoxygen transportermethylationcell adhesionnon-alcoholic fatty liver disease
Journal Article 2025-09-26 ✓ 1 Snippet Dali O, Heitz-Marchaland C, Kernanec PY, Carrion-Padilla J, Godin B, Tevosian S, Zubcevic J, Hayward LF, Smagulova F.
In-Text Gene Mentions

…Tigar, Mvk, Mmab,Prdx6, Acaca, Ggta1, Mtmr7,…

Show Full Abstract

BACKGROUND: Prenatal nicotine exposure (PNE) has been shown to significantly impact fetal development, leading to various pathologies in adulthood. OBJECTIVES: In this study, we analyzed the epigenetic effects of PNE on the proximal colon. RESULTS: We show here that PNE decreases the length of the colon crypts and induces a higher Ki-67 index. The genes related to metabolic pathways, tight junctions, and neurodegenerative processes were downregulated in PNE colons, and genes related to inflammation and oxygen transporter activity were upregulated. We observed a decrease in acetylated H4Ac and H3K9Ac marks. Genome-wide DNA methylation analysis demonstrated reduced DNA methylation of genes related to cell adhesion and metabolic pathways and increased methylation levels at thermogenesis, GABAergic synapsing, and non-alcoholic fatty liver disease-related genes. The Notch signaling pathway was deregulated in PNE rats. CONCLUSION: PNE leads to perturbation of proximal colon functioning, plausibly through nicotine-induced epigenetic alterations.

POU3F2
Also flagged:maturationWntlipidmetabolismribosomegene expression
Journal Article 2025-09-26 ✓ 2 Snippets Huang XD, Frapin M, Ahi EP, Primmer CR, Verta JP.
In-Text Gene Mentions

…as gh1 ,pou3f2, and ier5…

…characterized genes including,pou3f2, foxq1 mc1r…

Show Full Abstract

BACKGROUND: Sexual maturation is a key developmental process important for reproductive success. Understanding the molecular mechanisms behind variation in sexual maturation can provide insights into reproductive biology and how life history variation is encoded in the genome. Atlantic salmon (Salmo salar) has become an excellent sexual maturation research model due to its diversity of life history strategies and its ecological and economic importance. A major challenge has been the lack of a comprehensive transcriptional investigation of reproductive tissues that captures the dynamic transcriptional changes across individuals, tissues, and developmental stages. Long non-coding RNAs (lncRNAs) also play crucial roles in maturation, yet their functions in salmon maturation remain underexplored. RESULTS: In this study, we sequenced 98 transcriptomes and found substantial transcriptomic complexity in the gonad and pituitary tissues of Atlantic salmon. We identified transcripts corresponding to 2,364 putative newly characterized protein-coding genes and 4,421 putative long intergenic non-coding RNAs (lincRNAs), many with tissue-specific expression. Gene co-expression network analysis (WGCNA) revealed tissue-specific gene network modules, linked to GO terms including Wnt signaling in immature testis, lipid metabolism, and cilia assembly in mature testis, ribosome biogenesis and DNA repair in the ovary, and hormone activity in pituitary. We identified new copies of known genes, such as gh1, pou3f2, and ier5 associated with the regulation of gonadal and pituitary functions. Some lncRNAs and their nearest genes showed correlated expression within modules, suggesting potential regulatory roles. Candidate lincRNAs indicated cis-acting regulatory potential on genes like tnfrsf11b and fgl1, which are implicated in immune privilege during gonadal development and sperm quality control. CONCLUSIONS: Our study provides a comprehensive transcriptomic analysis of Atlantic salmon gonad and pituitary tissues, significantly improving the functional annotation of the Atlantic salmon genome. These findings reveal key regulatory pathways and novel molecular players involved in sexual maturation, particularly in the testis. Importantly, our study highlights the regulatory potential of lncRNAs in reproductive biology and maturation age variation, advancing our understanding of the molecular mechanisms governing sexual maturation. They further unlock future gene expression analyses and regulatory network reconstruction for dissecting the roles of lncRNAs in Atlantic salmon life history variation.

VRK2
Also flagged:psychiatric disordersneuropsychiatric disordersMSRAmethionineSLC6A9glycine transporter
Journal Article 2025-09-26 ✓ 5 Snippets Cornelis MC, Caldwell JA, Vu THT, Hennigar SR, Berryman CE, Lieberman HR.
In-Text Gene Mentions

…biological evidence includeVRK2(2p16.1) (previously associate…

…−8 , nearVRK2, TNKS/MSRA and RAB36…

…10 −6 ):VRK2, FANCL, ZNF396, PCDH9,…

…−6 ) genes:VRK2and ZNF396 (Additional…

…Candidate genesVRK2and TNKS at…

Show Full Abstract

<h4>Background</h4>Some individuals exposed to traumatic stressors develop psychiatric disorders while others remain resilient. The Brief Resilience Scale (BRS) assesses the ability to "bounce back" from stress and is a widely used measure of trait resilience. We performed the first genome-wide association study of BRS in the UK Biobank (UKB).<h4>Methods</h4>Beginning 2022, a subset of UKB participants completed an on-line mental-health questionnaire that included the six-item BRS. BRS data and genome-wide typing and imputation were available for 124,774 participants of European ancestry. Genome-wide linear tests of BRS were performed, followed by SNP-based heritability and cross-trait genetic correlation analyses. Nominally significant loci (P < 5 × 10<sup>-6</sup>) were followed up for candidate gene mapping.<h4>Results</h4>SNP-based heritability of BRS was 7.3% and strong genetic correlations (r<sub>g</sub>) were observed with neuroticism (r<sub>g</sub>, - 0.70 to - 0.44), depression (r<sub>g</sub>, - 0.63 to - 0.37) and anxiety (r<sub>g</sub>, - 0.81 to - 0.46). Three loci met genome-wide significance (P < 5 × 10<sup>-8</sup>, near VRK2, TNKS/MSRA and RAB36) and 29 loci met nominal significance (P < 5 × 10<sup>-6</sup>). None of these were replicated in prior GWAS using different measures of resilience. The strongest candidate genes prioritized on the basis of both functional and biological evidence include VRK2 (2p16.1) (previously associated with neuropsychiatric disorders) and MSRA (8p23.1) (reduces methionine sulfoxide to methionine). Others at nominally significant loci include SLC6A9 (1p34.1) (encodes a glycine transporter), NPY (7p15.2) (involved in stress response), CADPS2 (7q31.32) (involved in synaptic vesicle exocytosis), and PCDH9 (13q21.32) (involved in neural tissue cell adhesion).  CONCLUSIONS: Our findings provide further support for a genetic basis to trait resilience and one shared with psychiatric disorders and personality traits including depression, anxiety, and neuroticism. Our promising loci warrant replication but offer new biological insight to resilience.

BTN3A3
Also flagged:IRF1PAQR5IFITM3PSMB8Inflammatory bowel diseaseinflammatory disorders
Journal Article 2025-09-26 ✓ 1 Snippet Wu X, Yan F, Yang Y, Li Y.
In-Text Gene Mentions

…ANXA1, ANXA2, BTN3A1,BTN3A3, CAPN3, CASP1, CAV3,…

Show Full Abstract

<h4>Background</h4>Super-enhancers (SEs) are implicated in the regulation of the onset and progression of Crohn's disease (CD). However, the precise mechanisms remain unclear. This study aims to investigate the diagnostic potential and molecular mechanisms of SE-related genes (SERGs) as biomarkers for CD from a transcriptomics perspective.<h4>Methods</h4>Data on CD and SERGs were retrieved from public databases. Differential expression analysis, the Maximal Clique Centrality algorithm, and two machine learning methods were applied, complemented by receiver operating characteristic analysis and expression level assessment to identify biomarkers and construct a nomogram for evaluating their diagnostic value. Enrichment and immune infiltration analyses were performed subsequently. Unsupervised clustering categorized CD samples into distinct subtypes based on the biomarkers, and functional and immune microenvironmental differences among these subtypes were examined. Immunohistochemical experiments confirmed the elevated protein expression of hub genes in colonic tissues from patients with CD relative to healthy controls (P < 0.05).<h4>Results</h4>PAQR5, IFITM3, PSMB8, and IRF1, were identified as biomarkers for CD, demonstrating robust diagnostic performance, with area under curve (AUC) values of 0.988, 0.973, 0.959, and 0.940, respectively. When integrated into a nomogram, the AUC reached 0.991. Except for PAQR5, the other three genes showed significantly higher expression in CD samples, a trend confirmed clinically by immunohistochemical experiments. These biomarkers were involved in areas such as immune regulation, cell biology, and sensory perception. Immunoassays further elucidated the specific infiltration patterns of different immune cells in CD and highlighted the importance of these biomarkers in regulating immune cell functions. Additionally, we classified the CD samples into two subtypes, with the biomarkers exhibiting significant expression differences between the subtypes. These two subtypes possessed distinct immune microenvironments, with the biomarkers showing moderate correlation with the differential immune cells between the subtypes.<h4>Conclusion</h4>PAQR5, IFITM3, PSMB8, and IRF1 serve as biomarkers for CD, offering substantial diagnostic and immune regulatory value. These biomarkers differentiate CD into two subtypes, providing insights for personalized therapeutic strategies.

HFE
Also flagged:cardiovascular diseaseironiodinecadmiumglucosenicotine
Journal Article 2025-09-26 ✓ 2 Snippets Yang L, Shi J, Shen X, Tang J, Kasimujiang A, Dejite T, Deng Z, Yang T, Zheng Y, Liu C, Ma S, Shan X.
In-Text Gene Mentions

…associated disorders includehemochromatosis, a hereditary systemic…

Hemochromatosisis characterized by…

Show Full Abstract

<h4>Backgrounds</h4>Adolescence is a critical stage in the development of cardiovascular disease. The American Heart Association has introduced a state-of-the-art algorithm called "Life Essential 8" (LE8) designed to quantify cardiovascular health (CVH). Research on the association of trace metal elements with cardiovascular disease in adolescents is inconsistent. This study aims to examine the association between trace metal elements and ideal CVH in adolescents.<h4>Methods</h4>This cross-sectional study included 5724 adolescents who participated in the National Health and Nutrition Examination Survey (NHANES) from 2005 to 2018. CVH was assessed using Life's Essential 8 (LE8) developed by the American Heart Association (AHA). Exposure factors were trace metal elements (iron, iodine, cadmium, lead, mercury, selenium, and manganese).<h4>Results</h4>More than half of the adolescents had non-ideal CVH and only 40.8% achieved ideal CVH scores. Of the CVH measures, high blood glucose (96.1%), body mass index (81.3%), blood pressure (77.4%), and physical activity (65.0%) had high proportions of "ideal" values. However, diet, lipids and nicotine intake had lower rates of achieving the ideal CVH criteria (26.9%, 42.6% and 47.6%, respectively). The results of regression logistic showed that iron and mercury were negatively associated with the occurrence of non-ideal CVH (adjusted ORs of 0.997 [95% CI 0.995,0.999] and 0.913 [95% CI 0.840,0.991], and that urinary iodine, blood cadmium, lead, and selenium were positively associated with the occurrence of non-ideal CVH (adjusted ORs of 1.432 [95% CI 1.054,1.945], 3.845 [95% CI 2.278,6.491], and 1.010 [95% CI 1.003,1.017], respectively). No correlation between manganese and CVH was observed.<h4>Conclusions</h4>There is an urgent need to intervene in the CVH of children and adolescents. It is important to emphasize the need to maintain adequate iron intake while reducing iodine, cadmium, lead, and selenium intake.

Also flagged:Nucleustooth developmentgene expressiontranscription factorsSPP1integrin receptor
Journal Article 2025-09-26 No Snippets Chen X, Li G, Zhang J, He F, Yang Z, Wei G, Hu L, Wu B, Wei F, Xiong F.
Show Full Abstract

<h4>Introduction and aims</h4>Understanding the identity of odontogenic cells is fundamental to advancing research in tooth development and regeneration. We aim to explore the cellular composition, differentiation pathways, and regulatory networks in human embryonic teeth during the transition from the cap stage to the early bell stage.<h4>Methods</h4>The spatial RNA sequencing and single-nucleus RNA sequencing to human embryonic tooth germs were obtained from four healthy aborted specimens and integrated with public database. The spatial and temporal gene expression patterns, cell distributions, and interactions in tooth germ and surrounding periodontal tissues spanning postconception weeks 12 to 18 were examined and validated by immunohistochemistry.<h4>Results</h4>Our analysis identified diverse cell types, including 10 epithelial and nine mesenchymal subpopulations, alongside smooth muscle cells, endothelial cells, macrophages, and Schwann cells. We characterized epithelial and mesenchymal lineages by defining their signature genes, regulatory transcription factors, spatial distributions, and differentiation trajectories, while revealing conserved and distinct features between oral and odontogenic cells. Developmental stage-specific intercellular communications were delineated for epithelial and mesenchymal compartments. Notably, SPP1+ macrophages mediated crosstalk with odontoblasts via SPP1-integrin receptor interactions, whereas Schwann cells contributed to the signalling landscape via SEMA3C/MDK/PDGFC ligands.<h4>Conclusions</h4>This study reveals the cellular heterogeneity present in human embryonic teeth during early development, identifies key genes governing the differentiation of epithelial and mesenchymal cells, and provides valuable transcriptomic resources for investigating human embryonic tooth development.<h4>Clinical relevance</h4>Characterizing cells into more precise subgroups will enhance the potential to select optimal cell types for regenerative applications. The characteristic genes in differentiated cells could serve as potential inducers to guide the directed differentiation of stem cells.

Also flagged:Coronavirus Diseasebronchopulmonary dysplasiaretinopathy of prematuritynecrotizing enterocolitisNECdeath
Journal Article 2025-09-26 No Snippets Messick EA, Saha S, Slaughter JL, Kielt MJ, Benninger KL, Bell EF, Stoll BJ, Puopolo KM, Mukhopadhyay S, Flannery DD, Wyckoff MH, Cotten CM, Patel RM, Laptook AR, Grisby C, Das A, Walsh MC, Sánchez PJ, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To describe the neonatal intensive care unit outcomes of infants born extremely preterm to mothers who test positive for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) during pregnancy.<h4>Study design</h4>Prospective study (March 1, 2020-April 30, 2023) at 16 Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network centers of inborn infants (birth weight 401-1000 g and/or gestational age <29 weeks) born to mothers tested for SARS-CoV-2 during pregnancy. Frequency of maternal SARS-CoV-2 detection, vertical transmission rate, and association of maternal SARS-CoV-2 positivity during pregnancy with infant outcomes were determined.<h4>Results</h4>During the 38-month study, 4548 extremely preterm infants were born to 4072 mothers tested for SARS-CoV-2 during pregnancy. Overall, 7% (297/4072) of mothers had a positive SARS-CoV-2 test; 1% (2/181) of tested infants were positive at age <72 hours. The majority of outcomes (eg, bronchopulmonary dysplasia and retinopathy of prematurity) did not differ between infants of test-positive vs test-negative mothers. Infants of test-positive mothers were more likely to be diagnosed with necrotizing enterocolitis (NEC) than those of test-negative mothers (14% vs 11%; P = .03). In adjusted analyses, infants born to test-positive mothers were more likely to develop NEC (risk ratio [RR] 1.40; 95% CI, 1.03-1.89; P = .03) or the combined outcome of death within 12 hours of age or NEC (RR 1.33; 95% CI, 1.09-1.62; P < .01) but not death within 12 hours of age (RR 1.22, 95% CI, 0.92-1.62; P = .16) or before discharge (RR 0.83, 95% CI, 0.55-1.26; P = .38).<h4>Conclusions</h4>Among infants <29 weeks' gestation, vertical transmission of SARS-CoV-2 was infrequent. Maternal SARS-CoV-2 positivity was associated with NEC but not with other infant outcomes or mortality.<h4>Trial registration</h4>ClinicalTrials.gov ID. Generic Database: NCT00063063. https://clinicaltrials.gov/study/NCT00063063.

Also flagged:Protein Kinase ARaf Kinase InhibitoryPKAphosphorylationPKA-Cpeptide
Journal Article 2025-09-26 No Snippets Olivieri C, Biancaniello C, Manu VS, Walters MS, Masterson L, Rosner MR, De Simone A, Veglia G.
Show Full Abstract

Protein kinase A (PKA) is found in all mammalian tissues and plays a critical role in mediating many signaling processes. The structure and phosphorylation mechanism of the catalytic subunit of PKA (PKA-C) have been extensively studied in interaction with linear pseudosubstrate inhibitors, peptide substrates, or protein fragments. To date, however, there have been only a few studies examining how PKA recognizes full-length, folded proteins. Here, we utilized solution NMR spectroscopy in combination with replica-averaged restrained molecular dynamics (RARMD) calculations to investigate the interactions between PKA-C and Raf Kinase Inhibitory Protein (RKIP). RKIP is a member of the phosphatidylethanolamine binding protein (PEBP) family, which regulates important kinase pathways such as the Raf/MAPK pathway and the β-adrenergic receptor/cAMP-dependent PKA signaling cascade. The X-ray structure of RKIP reveals a compact fold, with the phosphorylation consensus sequence well-structured and essentially inaccessible to the kinase. Using Carr-Purcell-Meiboom-Gill (CPMG) and chemical exchange saturation transfer (CEST) experiments, we discovered that RKIP undergoes a conformational equilibrium between a compact fold and a more open conformation, where the C-terminal helix splays away from the RKIP core and exposes its phosphorylation sequence, allowing the kinase to bind and phosphorylate this substrate. The dynamic interplay between the kinase and the substrate may represent a common mechanism for kinases to recognizes well-folded substrates.

PCDH17
Also flagged:NFKB2MIFCD44Endometrioid Endometrial CancertumorSOX9
Journal Article 2025-09-26 ✓ 1 Snippet Zhang L, Yang M, Zhang Q, Zhang Y, Li Q, Chen Q.
In-Text Gene Mentions

…(marked by PECAM1,PCDH17, VWF, ADGRL4), ciliated…

Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) is a complex network driving endometrioid endometrial cancer (EC) progression. Previous analyses of the EC TME were often limited by a lack of detailed cellular annotations. Integrating single-cell RNA sequencing (scRNA-seq) data offers a comprehensive approach to reconstruct the TME, aiming to uncover novel mechanisms and therapeutic targets.<h4>Methods</h4>We integrated public scRNA-seq data from 15 EC and 5 normal endometrium samples. Through detailed cell annotation, we performed comprehensive bioinformatic analyses, including pseudotime trajectories, copy number variation, and cell communication, to investigate mechanisms of EC development.<h4>Results</h4>We identified nine cell types and characterized subpopulations of epithelial, macrophage, lymphocyte, and stromal fibroblast cells. The SOX9+LGR5- epithelial subtype showed elevated malignancy and NFKB pathway enrichment. The M2_like2 macrophage subtype played a critical role, engaging in robust MIF-(CD74+CD44) mediated communication with SOX9+LGR5- cells. Experimental validation confirmed MIF co-expression with E-cadherin in EC tissues. Furthermore, the transcription factor NFKB2 was found to mediate MIF's effect on the CD44 receptor in malignant epithelial cells. A pericyte-to-fibroblast transition in stromal cells may also support tumor growth, while an increase in CD8 exhausted/Treg cells and a decrease in cytotoxic CD8 cells suggest potential immune evasion.<h4>Conclusion</h4>Our single-cell analysis details the EC TME landscape, revealing robust communication between M2_like2 macrophages and SOX9+LGR5- epithelial cells. We highlight a key mechanism where NFKB2 mediates MIF's pro-tumorigenic effects via the CD44 receptor, offering new insights into EC progression and potential therapeutic targets.

TNFSF4
Also flagged:CYP19A1Cell Proliferationgastric cancerstomach adenocarcinomaSTADmalignant tumor
Journal Article 2025-09-26 ✓ 1 Snippet Jin Y, Shan Z, Yang F, Fan X, Lin J, Huang Z, Zhu X.
In-Text Gene Mentions

…CD276, PD-L2, andTNFSF4, showed higher expression…

Show Full Abstract

<h4>Background</h4>As a major histopathological subtype of gastric cancer (GC), stomach adenocarcinoma (STAD) is an important malignant tumor in the digestive system. Increasing evidence also indicates that endoplasmic reticulum (ER) stress plays a pivotal role in the pathogenesis and progression of GC. Therefore, this study aims to screen and identify vital ER stress-related genes that could contribute to the malignant development and poor prognosis for STAD.<h4>Methods</h4>A novel ER stress-related risk score signature was developed employing machine learning techniques. Then, a prognostic prediction nomogram was also built based on the clinicopathological characteristics and the risk score signature. The tumor immune microenvironment characteristics and pathway enrichment analysis in different risk groups were also explored. Furthermore, through the single-cell RNA sequencing (scRNA-seq) analysis, the study highlighted Cytochrome P450 Family 19 Subfamily A Member 1 (CYP19A1) as the pivotal research target and detected its effect on cell proliferation by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and the expression of ER stress-related genes by RT-qPCR in STAD.<h4>Results</h4>Based on the evaluation of five screened key ER stress-related genes (<i>AKR1B1</i>, <i>SERPINE1</i>, <i>ADCYAP1</i>, <i>MATN3</i>, <i>CYP19A1</i>), our ER stress-related risk score signature offers a novel approach for assessing STAD prognosis hazards. The novel prognostic prediction nomogram based on the signature also accurately predicted the survival outcomes of patients with STAD. Furthermore, the expression of <i>CYP19A1</i> is significantly higher in STAD tissues than in normal tissues. High expression of <i>CYP19A1</i> was related to a poor survival outcome for patients with STAD. Besides, compared to normal gastric epithelial cells, the expression of <i>CYP19A1</i> was significantly higher in STAD cell lines. Silencing the expression of <i>CYP19A1</i> significantly inhibited the cell proliferation ability and decreased the expression of ER stress-related genes, including <i>ATF4</i>, <i>DDIT3</i> and <i>XBP1</i> in STAD.<h4>Conclusions</h4>In conclusion, our study developed a novel prognosis prediction signature and identified the novel diagnostic and therapeutic target CYP19A1 for patients with STAD.

Also flagged:bacterial wiltapple fire blightfire blightcopperazomycinCF
Journal Article 2025-09-26 No Snippets Nguyen LTT, Park AR, Im HW, Le VV, Nguyen HTT, Le Dang Q, Hoa TTN, Yeo YJ, Le HH, Nguyen VT, Hwang I, Kim JC.
Show Full Abstract

Tomato bacterial wilt and apple fire blight, caused by <i>Ralstonia solanacearum</i> and <i>Erwinia amylovora</i>, respectively, are highly destructive diseases that threaten global agriculture productivity. Increasing resistance of these pathogens to conventional antibiotics and copper-based pesticides highlights the urgent need for sustainable, eco-friendly biocontrol alternatives. This study aimed to evaluate the biocontrol potential of the azomycin-producing <i>Streptomyces</i> sp. JCK-8368 (hereafter JCK-8368) against tomato bacterial wilt and apple fire blight, and to investigate its possible resistance-inducing mechanism. The culture filtrate (CF) of JCK-8368, containing azomycin, was applied to the plant at 1,000-fold (100 ng/mL), 500-fold (200 ng/mL), and 250-fold (400 ng/mL) dilutions via foliar spraying or soil drenching. Purified azomycin was tested at concentrations from 1 ng/mL to 1000 ng/mL. Disease severity and control efficacy were assessed, and expression of defense-related genes (<i>PR1</i>, <i>PR2</i>, <i>PR3</i>, and <i>PR5</i>) was also analyzed. Foliar spraying and soil drenching with JCK-8368 CF significantly reduced tomato bacterial wilt severity, with control efficacies of 52.22% (1000-fold), 11.11% (500-fold), and 35.55% (250-fold) in foliar application, 90.00%, 77.78%, and 52.22% in soil drenching, respectively. The reversed dose-response pattern in soil drenching indicated higher efficacy at lower concentrations. In apple fire blight control, soil drenching with CF at a 1,000-fold dilution achieved foliar spraying (78.38%) efficacy, exceeding soil drenching (50.88%). In particular, purified azomycin most effectively reduced tomato bacterial wilt at 100 ng/mL (57.14% efficacy) and showed a clear dose-dependent effect from 1 to 100 ng/mL. The plants treated with JCK-8368 CF and azomycin upregulated defense-related genes such as <i>PR1</i>, <i>PR2</i>, <i>PR3</i>, and <i>PR5</i>, suggesting systemically acquired resistance and pathogenesis-related defense pathways. This is the first report demonstrating the application of azomycin against plant bacterial diseases, showing that low concentrations of JCK-8368 and purified azomycin can effectively control tomato bacterial wilt and apple fire blight through induced resistance. Azomycin-producing <i>Streptomyces</i> sp. JCK-8368 offers a promising, sustainable alternative to chemical pesticides, warranting further field validation and formulation development for agricultural use.

HFE
Also flagged:depressionchronic liver diseasesagingliver diseaseliver diseaseschronic diseases
Journal Article 2025-09-26 ✓ 1 Snippet Wang H, Zhao S, Wang X, Liu X.
In-Text Gene Mentions

…disease (NAFLD), andhemochromatosis, but except tumors…

Show Full Abstract

<h4>Background</h4>Chronic liver diseases and depression are both major public health concerns worldwide, particularly among aging populations. However, evidence on the prospective association between depressive symptoms and the risk of developing chronic liver diseases remains limited. The aim of this study is to explore the potential association in middle-aged and older Chinese adults.<h4>Methods</h4>Data for this study were obtained from the China Health and Retirement Longitudinal Study (CHARLS), and 11,272 participants without prior liver disease were finally included in this study. Depression was assessed using the CESD-10, with scores analyzed as continuous variables and chronic liver diseases were self-reported based on physician diagnosis. By adjusting for multiple covariates, Cox proportional hazards regression models were used to estimate hazard ratios and restricted cubic spline models were applied to assess the potential non-linear relationships.<h4>Findings</h4>Over a mean follow-up period of 6.85 years, a total of 570 participants were finally diagnosed with chronic liver diseases. Multivariate regression analyses revealed a significant association between CESD scores and the risk of liver diseases among study participants even accounting for all potential covariates (HR: 1.020, 95% CI: 1.006-1.033, <i>p</i> = 0.004).<h4>Conclusion</h4>We identified a significant association between depressive symptoms and subsequent development of chronic liver diseases. Based on observational findings, depressive symptoms may represent a potential early marker of liver disease risk. These findings highlight the importance of integrating mental health assessments into early routine clinical care.

HFE
Also flagged:Metabolic SyndromeMethotrexatemetabolic dysfunction-associated steatotic liver diseasehyperbilirubinemia-induced liver injuryDILI
Journal Article 2025-09-26 ✓ 1 Snippet Kilani Y, Mosquera DAG, Fennell K, Qureshi K.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, Wilson disease, hepatic…

Show Full Abstract

<b>Background/Objectives</b>: Methotrexate (MTX) is associated with hepatotoxicity, but distinguishing MTX-induced liver injury from hepatic dysfunction due to metabolic syndrome (MetS) is challenging. This study investigates the incidence of hepatic outcomes in long-term MTX users with and without MetS and metabolic dysfunction-associated steatotic liver disease (MASLD) using real-world data. <b>Methods</b>: This cohort study used the TriNetX research network to identify U.S. adults (≥18 years) on MTX, excluding those with pre-existing liver injury. Patients were grouped by MetS status (MTX-MetS vs. controls) and further sub-stratified based on MASLD status. Propensity score matching (1:1) was adjusted for demographics, comorbidities, and treatment. The primary outcomes included hepatic-enzyme elevations, hyperbilirubinemia, prolonged INR, and clinically significant drug-induced liver injury (DILI) at 3-, 5-, and 10-year follow-up. <b>Results</b>: Among 324,219 MTX users, 59,733 MTX-MetS patients were propensity matched with 59,733 controls. MTX-MetS patients demonstrated increased 10-year odds of hepatic-enzyme elevations (aOR = 1.41; 95%CI: 1.38-1.46), hyperbilirubinemia (aOR = 1.40; 95%CI: 1.32-1.49), prolonged INR (aOR = 1.58; 95%CI: 1.49-1.67), clinically significant DILI (aOR = 1.49; 95%CI: 1.41-1.57), and liver cirrhosis (aOR = 1.48; 95%CI: 1.35-1.63) compared to the controls. Patients with and without MASLD showed similar hepatic-enzyme, bilirubin, and INR elevations, with higher odds of DILI with MASLD (aOR = 1.56; 95%CI: 1.28-1.89). <b>Conclusions</b>: This study highlights the increased liver injury risk in MTX users with MetS and MASLD. Further studies are needed to distinguish the effects of MTX and metabolic dysfunction on liver outcomes.

Also flagged:gene expressiondegradationpathogenesisheart defectsacquired diseaseshypoplastic left heart syndrome
Journal Article 2025-09-26 No Snippets Kozik A, Piotrowski M, Karpierz JI, Kowalewski M, Batko J.
Show Full Abstract

The development and function of the heart are governed by a highly coordinated network of regulatory mechanisms, among which miRNAs play a central role. These small, non-coding molecules modulate gene expression predominantly through mRNA degradation. This narrative review aims to summarize current knowledge about biogenesis, its impact on heart development and function, and its clinical implications in pediatric cardiology. We discuss how specific miRNAs contribute to shaping the normal heart and influencing the pathogenesis of congenital malformations. Furthermore, we review disease-specific miRNA signatures identified in the most common congenital heart defects and some acquired diseases, including hypoplastic left heart syndrome (HLHS), tetralogy of Fallot (TOF), bicuspid aortic valve (BAV), septation defects, cardiomyopathies, arrhythmias, and myocarditis. Many studies indicate that circulating and tissue miRNAs can become non-invasive biomarkers for early diagnosis and disease monitoring. Experimental data suggest their potential use in treatment despite many delivery and safety challenges. However, further research is necessary to fully exploit the potential of miRNAs and effectively translate these findings into clinical practice in pediatric cardiology.

SOX6
Also flagged:chromatingene expressiontranscription factorbindingmetabolismRB1
Journal Article 2025-09-26 ✓ 2 Snippets Dou D, Chen H, Ge Y, Zhou J, Chang C, Zhang F, Yang S, Cao Z, Luan P, Li Y, Zhang H.
In-Text Gene Mentions

…This hypothesis is supported by prior studies; for instance, Santiago et al. [ 78 ] found that promoters can preferentially recruit STAT1/2 and IRF to regulate distal gene expression, Zhu et al. [ 87 ] reported that rs1440702 affects distalSOX6expression by modifying TCF4 binding to enhancers, and Yu et al. [ 88 ] showed that rs7198799 regulates ZFP90 expression via NFATC2 binding.…

…rs1440702 affects distalSOX6expression by modifying…

Show Full Abstract

Excessive abdominal fat deposition accompanying rapid growth in broiler chickens seriously affects production efficiency. Using divergently selected broiler lines from Northeast Agricultural University, we integrated transcriptome sequencing, whole-genome resequencing, and three-dimensional genomic data to identify key SNPs affecting abdominal fat deposition. From 3,850,758 initial SNPs, 22,721 high-quality SNPs were selected (|ΔAF| ≥ 0.9) and validated to obtain 7341 reliable SNPs. GWAS identified 16 SNPs significantly associated with abdominal fat weight, while LD analysis revealed 22 highly linked SNPs, finally determining 2302 candidate SNPs. Transcriptome analysis identified 825 differentially expressed genes (<i>p</i> ≤ 0.05, |FC| ≥ 1.5). Functional annotation revealed 201 SNPs located in differentially expressed gene regions, including 8 coding SNPs and 193 non-coding SNPs, with an additional 15 SNPs potentially regulating through long-range chromatin interactions. Mechanistic analysis showed that coding SNPs regulate gene expression by altering codon translation rates or mRNA stability, while non-coding SNPs regulate transcription by affecting transcription factor binding. Phenotypic association analysis demonstrated that all 213 SNPs can cause ≥2-fold differences in abdominal fat weight, with 182 SNPs causing ≥3-fold differences. This study successfully identified 213 functional SNPs affecting abdominal fat deposition in broilers and revealed their molecular basis for regulating fat metabolism through multiple mechanisms, providing important genetic markers for low-fat breeding in broilers.

Also flagged:CRISPRextracellularclustered regularly interspaced short palindromic repeatsCas9Cas12 nucleasesCas13
Journal Article 2025-09-26 No Snippets Șerban M, Toader C, Covache-Busuioc RA.
Show Full Abstract

Repairing the central nervous system (CNS) remains one of the most difficult obstacles to overcome in translational neurosciences. This is due to intrinsic growth inhibitors, extracellular matrix issues, the glial scar-form barrier, chronic neuroinflammation, and epigenetic silencing. The purpose of this review is to bring together findings from recent developments in genome editing and computational approaches, which center around the possible convergence of clustered regularly interspaced short palindromic repeats (CRISPR) platforms and artificial intelligence (AI), towards precision neuroregeneration. We wished to outline possible ways in which CRISPR-based systems, including but not limited to Cas9 and Cas12 nucleases, RNA-targeting Cas13, base and prime editors, and transcriptional regulators such as CRISPRa/i, can be applied to potentially reactivate axon-growth programs, alter inhibitory extracellular signaling, reprogram or lineage transform glia to functional neurons, and block oncogenic pathways in glioblastoma. In addition, we wanted to highlight how AI approaches, such as single-cell multi-omics, radiogenomic prediction, development of digital twins, and design of adaptive clinical trials, will increasingly be positioned to act as system-level architects that allow translation of complex datasets into predictive and actionable therapeutic approaches. We examine convergence consumers in spinal cord injury and adaptive neuro-oncology and discuss expanse consumers in ischemic stroke, Alzheimer's disease, Parkinson's disease, and rare neurogenetic syndromes. Finally, we discuss the ethical and regulatory landscape around beyond off-target editing and genomic stability of CRISPR, algorithmic bias, explainability, and equitable access to advanced neurotherapies. Our intent was not to provide a comprehensive inventory of possibilities but rather to provide a conceptual tool where CRISPR acts as a molecular manipulator and AI as a computational integrator, converging to create pathways towards precision neuroregeneration, personalized medicine, and adaptive neurotherapeutics that are ethically sound.

Also flagged:replication-defectiveproviruspeptidelipidamino acidmembrane
Journal Article 2025-09-26 No Snippets He J, Shi N, Yao H, Li J, Wang Y, Zhang J.
Show Full Abstract

Avian genome editing has historically lagged behind mammalian research. This disparity is primarily due to a unique reproductive biology that precludes standard techniques like pronuclear injection. A pivotal breakthrough, however, came from the development of efficient in vitro culture systems for primordial germ cells (PGCs). This has established the chicken as a tractable and powerful model for genetic engineering. Our review chronicles the technological evolution this has enabled, from early untargeted methods to the precision of modern CRISPR-based systems. We then analyze the broad applications of these tools, which are now used to engineer disease resistance, enhance agricultural traits, and develop novel platforms such as surrogate hosts and oviduct bioreactors. Collectively, these advances have established PGC-based genome editing as a robust and versatile platform. Looking forward, emerging precision editors and the expansion of these techniques to other avian species are poised to drive the next wave of innovation in poultry science and biotechnology.

Also flagged:bladder cancertumorepithelial-mesenchymal transitionGALNT16polypeptideN-acetylgalactosaminyltransferase 16
Journal Article 2025-09-26 No Snippets Ben L, Wang J, Wu P.
Show Full Abstract

<h4>Background</h4>Bladder cancer is highly malignant, but specific biomarkers and molecular targets are lacking. The aim of this study was to screen bladder cancer progression-related differential genes based on those associated with tumor-node-metastasis (TNM) staging, and to validate them by <i>in vitro</i> and <i>in vivo</i> experiments.<h4>Methods</h4>Common genes were screened and prognostically analyzed by cross-analyzing differential genes in The Cancer Genome Atlas (TCGA) database for bladder cancer stages T1-2 and T3-4, N1 and N2, and M0 and M1. The functions were further identified by enrichment analysis, and the biological functions of the differential genes in bladder cancer were verified using <i>in vivo</i> and <i>in vitro</i> experiments.<h4>Results</h4>The shared gene polypeptide N-acetylgalactosaminyltransferase 16 (<i>GALNT16</i>) was identified by cross-analysis of differential genes between T1-2 and T3-4 stages, N1 and N2 stages, and M0 and M1 stages. Further analysis showed that <i>GALNT16</i> was involved in a variety of signaling pathways and biological functions, especially related to tumor metastasis, and correlated with immune cell infiltration status. In addition, <i>ex vivo</i> and <i>in vivo</i> functional experiments demonstrated that <i>GALNT16</i> was able to influence the expression of epithelial-mesenchymal transition (EMT) pathway-related proteins, thereby promoting the proliferation, migration and invasive ability of bladder cancer.<h4>Conclusions</h4><i>GALNT16</i> can promote malignant progression of bladder cancer and may be a valuable diagnostic and prognostic marker and potential therapeutic target for bladder cancer.

TNFSF4
Also flagged:stem cell proliferationcancertumorcancersthymomaneoantigen
Journal Article 2025-09-26 ✓ 1 Snippet Chu A, Wang Y.
In-Text Gene Mentions

…checkpoints like HMGB1,TNFSF4, ICAM1, and CXCL10…

Show Full Abstract

<b>Background/Objectives:</b><i>FAM72B</i> (Family with sequence similarity 72 member B) is a gene whose function is not yet fully elucidated and which belongs to the <i>FAM72</i> gene family. Recent studies have indicated that it is involved in the regulation of stem cell proliferation and DNA repair and serves as a valuable prognostic biomarker for a few types of cancer. This study aimed to systematically investigate the expression profile of <i>FAM72B</i> in pan-cancer, its role in the tumor immune microenvironment, and its potential as a prognostic and immunotherapeutic biomarker. <b>Methods:</b> Using bioinformatics tools such as SangerBox3.0, GEPIA2.0, Kaplan-Meier Plotter, and cBioPortal, we systematically analyzed the correlation of <i>FAM72B</i> expression levels with various cancer types, clinical pathological parameters, prognostic value, genetic mutations, genomic heterogeneity, immune checkpoint genes, immune cell infiltration levels, and single-cell-level characteristics. <b>Results:</b><i>FAM72B</i> was found to be overexpressed in most cancers and significantly associated with poor prognosis, although it may exert a protective effect in some cancers like thymoma (THYM). Its expression level was positively correlated with tumor mutation burden (TMB), microsatellite instability (MSI), neoantigen (NEO) levels, and expression of immune checkpoint genes in most cancers, suggesting that patients with high <i>FAM72B</i> expression may respond better to immune checkpoint inhibitors. Moreover, <i>FAM72B</i> expression was significantly correlated with the infiltration levels of various immune cells in the tumor immune microenvironment across pan-cancer. Single-cell sequencing results also demonstrated a significant correlation between <i>FAM72B</i> and the biological functional states of multiple cancers. <b>Conclusions:</b><i>FAM72B</i> holds promise as a potential pan-cancer prognostic biomarker and therapeutic target, providing a novel basis for the development of personalized treatment strategies.

SERPINC1
Also flagged:Cdk5Cyclin-Dependent KinaseProtein kinasesADMild Cognitive ImpairmentMcl1
Journal Article 2025-09-26 ✓ 1 Snippet Kumari S, Singh AK, Kumar M, Pradhan R, Rao AR, Yadav Y, Kumar P, Haldar P, Kaur P, Dey S.
In-Text Gene Mentions

…and HMSE orACE-IIIscores) were evaluated…

Show Full Abstract

Protein kinases are important molecules of Alzheimer's Disease (AD), driving neuronal demise and the emergence of the disease's destructive hallmarks. Cdk5 has recently been highlighted as a key therapeutic target for AD. This study evaluated the expression levels of Cdk5 and Mcl1 (Cdk5's substrate) in blood samples of 61 AD, 55 Mild Cognitive Impairment (MCI), and 57 Geriatric Controls (GC), and explored the in vitro inhibition of Cdk5. The serum levels of Cdk5 and Mcl1 were measured by Surface Plasmon Resonance (SPR) and verified by Western blot and RT-PCR. Molecular modeling and simulation studies were used to identify a potent hit targeting Cdk5 and validated by binding studies using SPR. The peptide rescue effect was analyzed by MTT assay in the AD cellular model. SPR analysis revealed a significant change in Cdk5 and Mcl1 levels in the serum samples of AD and MCI compared to GC. Results were validated by Western blot and RT-PCR. Binary logistic regression analysis revealed that the concentration of both Cdk5 and Mcl1 was independently associated with disease after adjusting for certain parameters. ROC analysis established an optimum diagnostic cutoff value for Cdk5 [24.97 ng/µL (AUC-0.90)] and Mcl1 [23.08 ng/µL (AUC-0.94)] with high sensitivity and specificity. The peptide YCWS strongly binds to Cdk5's ATP binding site, confirmed by molecular modeling and SPR. In the AD cellular model, peptide YCWS rescued neurotoxicity, increased Mcl1 levels, and reduced destructive hallmarks by inhibiting Cdk5. It can be concluded that Cdk5 is a promising molecule as a circulatory biomarker for the diagnosis of the early stages of AD, and its peptide inhibitor YCWS is a potential therapeutic agent.

Also flagged:Protoporphyrin5-Aminolevulinic acidhemebiosynthesisskin lesionsbrain tumors
Journal Article 2025-09-26 No Snippets Ruhi MK.
Show Full Abstract

5-Aminolevulinic acid (5-ALA) is used clinically for photodynamic therapy and fluorescence-guided diagnosis and surgery due to its selective accumulation in malignant cells, where it is converted into photoactive protoporphyrin IX (PpIX) via the heme biosynthesis pathway. The resulting buildup allows for selective visualization or destruction of the tissue under specific light exposure, particularly in pre-malignant and malignant skin lesions, brain tumors, and bladder cancer. More recently, 5-ALA and 5-ALA-induced PpIX have attracted interest for emerging diagnostic and therapeutic approaches. For instance, PpIX is being investigated as a potential marker for liquid biopsy. PpIX-mediated photodynamic therapy also shows promise for targeting specific cancer cell populations, including dormant cancer cells and cancer stem cells. In addition, the benefits of 5-ALA in neurological and mental health are under investigation, as disruptions in heme biosynthesis are increasingly linked to neurodegenerative diseases, chronic fatigue, and mood and sleep disorders. This review highlights these expanding research directions, discusses current challenges, and explores potential opportunities for 5-ALA-based applications.

HFE
Also flagged:IronMetabolismLiver FibrosisChronic Hepatitis CbindingSLC40A1
Journal Article 2025-09-26 ✓ 5 Snippets Ferreira J, Bicho M, Faustino P, Serejo F.
In-Text Gene Mentions

…TheHFEprotein is a…

…codified by theHFEgene located on…

…domains of theHFEprotein (signal peptide,…

…mutations in theHFEgene.…

…homozygosity for theHFEC282Y mutation or…

Show Full Abstract

Chronic hepatitis C (CHC) is linked to iron overload, which significantly correlates with liver fibrosis. This study aimed to assess whether genetic polymorphisms related to iron metabolism are associated with fibrosis severity, predict improvement in fibrosis after HCV clearance with direct-acting antivirals (DAAs) and influence iron-related metabolic markers before treatment. A total of 329 CHC patients were included, 134 of whom received DAAs therapy. Liver fibrosis was assessed using transient elastography (FibroScan), and biochemical parameters were measured using standard methods. Eighteen genetic polymorphisms within five iron metabolism-related genes were analyzed using PCR-RFLP, endpoint genotyping, or next-generation sequencing (NGS). Before DAA treatment, patients with severe fibrosis showed higher levels of serum iron (Fe), total iron-binding capacity (TIBC), and ferritin (Ft). SLC40A1 rs1439816_GG was associated with an increased risk of severe fibrosis compared with GC or CC genotypes. SLC40A1 rs11568351_GC genotype was linked to a higher likelihood of remaining cirrhotic after HCV clearance. Elevated iron parameters were observed in carriers HFE C282Y_CY, TF IVS 11 G>A, and BMP2 570 A>T. Overall, polymorphisms in iron metabolism genes may influence both the severity of liver fibrosis prior to treatment, its regression after DAA therapy and the regulation of iron metabolism in CHC patients.

Also flagged:coronavirus disease 2019COVID-19viral infectionspolyaminestumorpolyamine
Journal Article 2025-09-26 No Snippets Ignatenko NA, Trinh HT, Wagner AM, Gerner EW, Bime C, Hsu CH, Besselsen DG.
Show Full Abstract

Despite numerous research efforts and several effective vaccines and therapies developed against coronavirus disease 2019 (COVID-19), drug repurposing remains an attractive alternative approach for treatment of SARS-CoV-2 variants and other viral infections that may emerge in the future. Cellular polyamines support viral propagation and tumor growth. Here we tested the antiviral activity of two polyamine metabolism-targeting drugs, an irreversible inhibitor of polyamine biosynthesis, α-difluoromethylornithine (DFMO), and a non-steroidal anti-inflammatory drug (NSAID), Sulindac, which have been previously evaluated for colon cancer chemoprevention. The drugs were tested as single agents and in combination in the human Calu-3 lung adenocarcinoma and Caco-2 colon adenocarcinoma cell lines and the <i>K18-hACE2</i> transgenic mouse model of severe COVID-19. In the infected human cell lines, the DFMO/Sulindac combination significantly suppressed SARS-CoV-2 N1 Nucleocapsid mRNA by interacting synergistically when cells were pretreated with drugs and additively when treatment was applied to the infected cells. The Sulindac alone and DFMO/Sulindac combination treatments also suppressed the expression of the viral Spike protein and the host angiotensin-converting enzyme 2 (ACE2). In <i>K18-hACE2</i> mice, the antiviral activity of DFMO and Sulindac as single agents and in combination was tested as prophylaxis (drug supplementation started 7 days before infection) or as treatment (drug supplementation started 24 h post-infection) at the doses equivalent to patient chemoprevention trials (835 ppm DFMO and 167 ppm Sulindac). The drugs' antiviral activity in vivo was evaluated by measuring the clinical (survival rates and clinical scores), viral (viral load and virus infectivity), and biochemical (plasma polyamine, Sulindac, and Sulindac metabolite levels) endpoints. Prophylaxis with DFMO and Sulindac as single agents significantly increased survival rates in the young male mice (<i>p</i> = 0.01 and <i>p</i> = 0.027, respectively), and the combination was effective in the aged male mice (<i>p</i> = 0.042). Young female mice benefited the most from the prophylaxis with Sulindac alone (<i>p</i> = 0.001) and the DFMO/Sulindac combination (<i>p</i> = 0.018), while aged female mice did not benefit significantly from any intervention. Treatment of SARS-CoV-2-infected animals with DFMO or/and Sulindac did not significantly improve their survival rates. Overall, our studies demonstrated that DFMO and Sulindac administration as the prophylaxis regimen provided strong protection against the lethal outcome of SARS-CoV-2 infection and that male mice benefited more from the polyamine-targeted antiviral treatment than female mice. Our findings underscore the importance of evaluation of the antiviral activity of the drugs in the context of sex and age.

Also flagged:lung adenocarcinomanon-small cell lung cancerNSCLCpost-translational modificationscancerLUAD
Journal Article 2025-09-26 No Snippets Wang Y, Xu M, Wei X, Huang H, Chen Q, Chen B, Bao X, Li J.
Show Full Abstract

<h4>Background and objective</h4>Lung adenocarcinoma (LUAD), as the main subtype of non-small cell lung cancer (NSCLC), faces clinical challenges including molecular heterogeneity, late diagnosis, and aggressive growth, leading to a low 5-year survival rate. Biomarkers are critical for early detection, accurate differentiation of benign/malignant lesions, and guiding personalized treatment strategies. Proteomic technologies using liquid biopsy show potential by analyzing protein changes and post-translational modifications (PTMs) to identify novel biomarkers and unravel cancer mechanisms. This review examines proteomic advances in LUAD, compares platform strengths, lists validated protein markers, and discusses challenges like specificity and regulations. It aims to develop a precision medicine framework by integrating multi-omics data for improved diagnosis and treatment.<h4>Methods</h4>This study conducted a literature review by searching the PubMed and Web of Science databases for original articles written in English from 2002 to 2025, using the keywords "lung adenocarcinoma" OR "LUAD" AND "biomarkers" AND "proteomics" OR "SomaScan" OR "spatial proteomics" to identify the latest research findings in the field of proteomics technology and LUAD biomarkers. The included studies mainly focused on the current landscape of biomarkers in the diagnosis, treatment, and prognosis of LUAD.<h4>Key content and findings</h4>This review discusses high-throughput methods for comprehensive protein profiling in accessible biospecimens (tissues, blood, urine) to identify biomarkers for LUAD. We systematically evaluate emerging proteomic strategies, including mass spectrometry (MS), proximity extension assays (PEAs), spatial proteomics techniques, and SomaScan platforms-coupled with innovative computational frameworks have revolutionized biomarkers discovery and their translational potential in developing precision diagnostics and targeted therapies. Additionally, the review addresses challenges in integrating proteomics with genomics, transcriptomics, and metabolomics, offering new methodologies and expanding research in life sciences. As technological advancements continue, it is anticipated that more potential biomarkers will be conducted to validate the broader application in LUAD treatment, addressing early-stage disease complexities and aiding in selecting more effective treatment strategies.<h4>Conclusions</h4>By synthesizing cutting-edge evidence on proteome-driven LUAD biomarkers, this review elucidates actionable strategies to refine early detection protocols and mechanism-informed personalized treatment frameworks, directly advancing precision oncology initiatives for this prevalent malignancy through biomarker-guided clinical decision-making and multi-omics integration.

PRDX6
Also flagged:GPX4lipidferroptosismembraneglutathione peroxidase 4iron
Journal Article 2025-09-26 ✓ 1 Snippet Stephenson D, Keele GR, Hay A, Dzieciatkowska M, Reisz JA, Haiman ZB, Moore AL, Nemkov T, Deng X, Stone M, Hansen KC, Kleinman S, Norris PJ, Busch MP, Churchill GA, Stockwell BR, Roubinian N, Zimring JC, Page GP, D'Alessandro A.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Red blood cell (RBC) membrane lipid peroxidation during blood bank storage profoundly impacts transfusion efficacy; however, the genetic determinants underlying RBC resilience remain incompletely defined. Here, we identify a critical role for glutathione peroxidase 4 (GPX4) - a pivotal enzyme protecting against iron-dependent lipid peroxidation (ferroptosis) - in regulating RBC storage quality and post-transfusion survival. Conditional erythroid-specific deletion of <i>Gpx4</i> in mice exacerbated lipid hydroperoxide accumulation, oxidation and ubiquitination of membrane proteins, and reduced RBC recovery after transfusion. Multi-omics analyses in 13,091 human blood donors from the REDS RBC Omics cohort identified regulatory intergenic (rs8178962), intronic and missense genetic variants in GPX4 (rs73507255, rs8178967), particularly prevalent among donors of African descent, that were linked to increased lipid peroxidation and compromised post-transfusion hemoglobin increments. Single protein- and metabolome-wide association studies (pQTL/mQTL) highlighted genetic variants associated with enhanced (rs8178962) or impaired GPX4 expression, disrupted glutathione homeostasis, lipid hydroperoxide accumulation, accelerated membrane damage, and activation of ferroptotic signatures during RBC storage. These effects were exacerbated by genetic traits impairing redox homeostasis, including glucose 6-phosphate dehydrogenase (G6PD) deficiency (African variant rs1050828 V68M/N126D). Storage of murine RBCs in presence of the ferroptosis inhibitor ferrostatin-1 prevented storage-induced lipid peroxidation and boosted post-transfusion recovery, a beneficial effect in part phenocopied by supplementation of lipophilic antioxidants vitamin E and Lands cycle fueling via L-carnitine, and in part ablated by GPX4 inhibition via the covalent inhibitor ML210. This study offers mechanistic insights into RBC ferroptosis and positions GPX4 genetic status as a promising biomarker for precision transfusion medicine.

medRxiv 2025-09-26 Preprint (No Snippets API) Grimes PZ, Mitchell BL, Thompson KN, Deng Q, Shen X, Wolfe JC, Thomas JT, Wootton RE, Adkins DE, Arirangan S, Assary E, Chatzinakos C, Dennison CA, Gangaraju SH, Jangmo A, Jeong Y, Kurvits S, Li QS, Motazedi E, Naamanka J, Nguyen T, Nolte IM, Ota VK, Pasman JA, Shahisavandi M, Shakeshaft A, Shorter JR, Slaney C, Tesli M, Wang CA, Zubizarreta-Arruti U, PGC MDD Working Group, GLAD+, NIHR BioResource, Alemany S, Andreassen OA, Ask H, Belangero SI, Bosch R, Breen G, Bressan RA, Buil A, Byrne EM, Casas M, Copeland WE, Eley TC, Hannigan LJ, Hartman CA, Havdahl A, Hickie IB, Khandaker GM, Lehto K, Maes H, Martin NG, Neumann A, Oldehinkel AJ, Pan PM, Pan H, Pennell CE, Peterson RE, Rodriguez A, Salum GA, Vrijkotte TG, Wedow R, Whitehouse AJ, Thapar A, Larsson H, Middeldorp CM, McIntosh A, Adams MJ, Lu Y, Whalley HC, Kwong AS.
Show Full Abstract

Adolescent depression is a heritable psychiatric condition with rising global prevalence and severe long-term outcomes, yet its biological underpinnings remain poorly understood. We conducted the first genome-wide association study of adolescent-onset depression, comprising 102,428 cases (diagnosis or clinical symptom thresholds) and 286,911 controls, including diverse ancestries. Cross-ancestry meta-analysis identified 52 independent variants across 17 loci; European-only analysis found 61 variants at 29 loci, with a SNP-based heritability of 9.8%. Comparative analyses revealed two genes unique to adolescent-onset versus lifetime depression, enriched in neuronal subtypes, and two genes as potential drug repurposing targets. Polygenic scores were associated with adolescent-onset depression across ancestries, persistent depression trajectories, more severe outcomes, as well as reduced cortical volume, surface area and white matter integrity. Genetic correlation and Mendelian randomisation analyses support shared genetic liability and causal links with early puberty and modifiable health and behavioural risk factors. These findings uncover novel genetic loci and refine biological pathways underlying adolescent-onset depression, revealing age-specific mechanisms and early intervention opportunities.

DCC
Also flagged:MBD2tumorsmall intestinal neuroendocrine tumorsneoplasms of thechromosomemethyl-CpG binding domain protein 2
Journal Article 2025-09-25 ✓ 1 Snippet Barazeghi E, Backman S, Hellman P, Norlén O, Stålberg P.
In-Text Gene Mentions

…of tumor suppressorsDCCand SMAD4 has…

Show Full Abstract

Small intestinal neuroendocrine tumors (SI-NETs) represent the most frequent neoplasms of the small intestine, with loss of chromosome 18 as the most common genetic aberration. To date, no highly frequently mutated genes have been identified on chromosome 18 or elsewhere. This study aimed to explore the potential role of methyl-CpG binding domain protein 2 (MBD2), located at 18q21.2, as a tumor suppressor gene in SI-NETs. By immunohistochemistry, we found undetectable or very low levels of MBD2 expression in 64% of the analyzed SI-NETs, and overall, very low levels of mRNA and protein expression were observed. Overexpression of MBD2 in the SI-NET cell line, GOT1, reduced cell growth and induced apoptosis, though cell migration remained unaffected. In addition, MBD2 expression decreased cell proliferation and migration capacity of the neuroendocrine cells NCI-H727 but showed no effect on apoptosis. Furthermore, MBD2 expression in both cell lines was found to upregulate E-cadherin but downregulate the levels of N-cadherin and vimentin in GOT1 and NCI-H72, respectively, as determined by western blot analysis. These results suggest that MBD2 plays a role in inhibiting the epithelial-mesenchymal transition process and may function as a potential tumor suppressor gene in SI-NETs. Future studies to elucidate the underlying mechanisms are warranted.

STAU1
Also flagged:nucleocapsidribosomal proteinsnucleolar proteinsribosomesplicing factorsRNA helicases
Journal Article 2025-09-25 ✓ 1 Snippet Kovanich D, Ketsuwan K, Hengphasatporn K, Thepparit C, Sittipaisankul P, Wongkongkathep P, Sirisereewan C, Techakriengkrai N, Nedumpun T, Shigeta Y, Pisitkun T, Suradhat S.
In-Text Gene Mentions

…Staufen homologue 1 (STAU1) were also widely…

Show Full Abstract

Porcine reproductive and respiratory syndrome virus (PRRSV) is a major swine pathogen that causes significant economic losses worldwide. The nucleocapsid (N) protein, the most abundant viral protein in infected cells, plays roles beyond its structural function, influencing various host cellular processes. Here, we report the identification of 301 cellular protein candidates interacting with PRRSV N using EGFP immunoprecipitation combined with label-free quantitative mass spectrometry. The analysis underscores the versatile nature of the N protein in targeting a wide range of cellular proteins and processes across multiple subcellular compartments. We observed strong enrichment of ribosomal proteins, nucleolar proteins involved in ribosome biogenesis, splicing factors, RNA helicases, and DNA-binding proteins involved in chromatin remodeling and DNA damage response. Additionally, we identified proteins involved in viral RNA sensing and intrinsic antiviral mechanisms that may contribute to the immunosuppressive properties of the viral protein. Several interactions were validated and further characterized for RNA dependence, including MYBBP1A, NCL, IGF2BP1, UPF3B, G3BP1, EIF2S1, RFC4, ABCF1, PPM1G, NSUN2, and NOP2. Notably, RTCB and MYBBP1A were identified as host dependency factors for PRRSV infection. Our findings expand the current understanding of PRRSV-host interactions and reveal novel N-interacting proteins that may contribute to viral pathogenesis and immune evasion.

BTN2A2TRIM38ABT1
Also flagged:depressionmajor depressionbipolar disorderbroadchromosomeNCAM1
Journal Article 2025-09-25 ✓ 5 Snippets Zhang M, Chen X, Zhou W, Zhou N, Zhang C, Yang Y, Li Q, Ming X, Wu Y, Qi H, Zhou W.
In-Text Gene Mentions

…superfamily clusters (e.g.BTN2A2), and other…

…, 2023 ),ABT1(Oda et al.…

…innate immunity [e.g.TRIM38(Xue et al.…

…, 2012 ),BTN2A2(Sarter et al.…

…( SCGN ,ABT1) (Liu et…

Show Full Abstract

<h4>Background</h4>Little is known regarding the shared genetic architecture underlying the phenotypic associations between depression and preterm birth (PTB). We aim to investigate the genetic overlap and causality of depression with PTB.<h4>Methods</h4>Leveraging summary statistics from the largest genome-wide association studies for broad depression (N<sub>total</sub> = 807,533), major depression (N<sub>total</sub> = 173,005), bipolar disorder (N<sub>total</sub> = 414,466), and PTB (N<sub>total</sub> = 226,330), we conducted a large-scale genome-wide cross-trait analysis to assess global and local genetic correlations, identify pleiotropic loci, and infer potential causal relationships.<h4>Results</h4>Positive genetic correlations were observed between PTB and broad depression (<i>r<sub>g</sub></i> = 0.242), major depression (<i>r<sub>g</sub></i> = 0.236), and bipolar disorder (<i>r<sub>g</sub></i> = 0.133) using the linkage disequilibrium score regression, which were further verified by the genetic covariance analyzer. Local genetic correlation was identified at chromosome 11q22.3 (harbors <i>NCAM1-TTC12-ANKK1-DRD2</i>) for PTB with depression. Cross-trait meta-analysis identified two loci shared between PTB and broad depression, two loci shared with major depression, and five loci shared with bipolar disorder, among which three were novel (rs7813444, rs3132948 and rs9273363). Mendelian randomization demonstrated a significantly increased risk of PTB for genetic liability to broad depression (odds ratio [OR]=1.30; 95% confidence interval [CI]: 1.11-1.52) and major depression (OR=1.27; 95%CI: 1.08-1.49), and the estimates remained significant across the sensitivity analyses.<h4>Conclusions</h4>Our findings demonstrate an intrinsic link underlying depression and PTB and shed novel light on the biological mechanisms, highlighting an important role of early screening and effective intervention of depression in PTB prevention, and may provide novel treatment strategies for both diseases.

Also flagged:obesitytype 2 diabetesmetabolismenzyme activitybindinghost cells
Journal Article 2025-09-25 No Snippets Zhai C, Liu X, Liu Z, Ma H, Li H, Gong Y, Li X, Wang Y, Zhang N, Zhang H, Luo G, Wang Y, Gao X.
Show Full Abstract

The intestinal environment determines the biochemical activity of individual microbial strains. The functions of microbial strains in their native environments often cannot be accurately predicted based solely on genomic information or the biochemical properties of cultivated isolates. In some cases, even the activity of intracellular enzymes does not correlate with the functional activity of bacteria. To address this challenge, we developed an enzymatic activity visualization platform that uses active intracellular enzymes as molecular baits to capture specific substrate probes. This platform links enzyme-mediated biochemical activity to their <i>in situ</i> localization, isolation, phylogenetic identification, and functional validation. This platform uses substrate-based probes designed to target isozymes, namely enzymes with different sequences but capable of catalyzing the same chemical reactions on a given substrate. Combined with a highly specific alkyne-azide cycloaddition reaction, these probes enable fluorescent visualization of strains harboring isozymes in human gut microbiota under anaerobic conditions. In addition, the platform can be integrated with fluorescence-activated cell sorting and 16S rRNA amplicon sequencing to isolate and taxonomically identify functional guilds containing isozymes physically. By performing metabolic capacity tests, fluorescence imaging, and proteomic analyses on four positive and three negative reference strains, we validated that our probes exhibit selectivity at the bacterial cell level. Using the platform, we successfully identified functional guilds involved in the reduction of sennoside A, a widely used laxative prodrug activated by gut bacteria. Importantly, we found that phylogenetically distinct bacteria perform similar metabolic activities toward sennoside A and discovered a novel sennoside A-reducing enzyme, StNfrA, from these functional guilds. The mechanistic study on StNfrA proved that our platform distinguished sennoside A-reducing bacteria species from microbiota by the enzymatic activity. Overall, these findings demonstrate that this enzymatic activity visualization platform is a powerful tool for the reliable localization, isolation, and identification of functional guilds in complex microbial communities.

POU3F2
Also flagged:-estradiolnucleusestradiolaging17α-estradiolmetabolism
Journal Article 2025-09-25 ✓ 1 Snippet Li L, Wu G, Xu X, Yang J, Yi L, Yang Z, Mo Z, Xing L, Shan Y, Yu Z, Li Y.
In-Text Gene Mentions

…, Preb ,Pou3f2, and Hoxb5…

Show Full Abstract

This study investigated 17α-estradiol's effects on aged hypothalamic physiological activity via long-term administration. Single-nucleus transcriptomic sequencing (snRNA-seq) was performed on pooled hypothalami from each group: aged male Norway brown rats treated with 17α-estradiol (O.T), aged controls (O), and young controls (Y). Supervised clustering of neurons (based on neuropeptides/receptors) evaluated subtype responses to aging and 17α-estradiol. Aging-induced elevation of neuronal cellular metabolism, stress, and reduced synapse formation-related pathways were significantly attenuated by 17α-estradiol. Neuron population analysis showed that subtypes regulating food intake, reproduction, blood pressure, stress response, and electrolyte balance were sensitive to 17α-estradiol. 17α-estradiol increased serum oxytocin (Oxt) and hypothalamic-pituitary-gonadal (HPG) axis activity (elevated plasma Gnrh, total testosterone; reduced estradiol). Gnrh1 upregulation mediated its effects on energy homeostasis, neural synapse, and stress response. Notably, <i>Crh</i> neurons in O.T showed prominent stress phenotypes, distinct from <i>Agrp/Ghrl</i> neurons. Thus, HPG axis and energy metabolism may be key 17α-estradiol targets in male hypothalamus. Additionally, our results demonstrate that supervised clustering (based on neuropeptides/receptors) effectively assesses the responses of hypothalamic neuron subtypes to aging and 17α-estradiol treatment.

HTT
Also flagged:c-Met Receptorgene expressionMET receptor tyrosine kinasesynapseHgfaxon growth
Journal Article 2025-09-25 ✓ 1 Snippet Ali Marandi Ghoddousi R, Levitt P, Rady Z, Eagleson KL.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Introduction</h4>Single-cell transcriptomic analyses in adult mice show that cortical projection neuron subclasses exhibit heterogenous gene expression profiles that reflect their projection targets and laminar and areal positions. Further analyses revealed that projection neurons within the same subclass also exhibit transcriptomic heterogeneity. Recent evidence suggests that differences in maturation state reflect one source of this heterogeneity. The MET receptor tyrosine kinase, a regulator of synapse maturation, is expressed in a subpopulation within cortical projection neuron subclasses, providing an experimental model to address transcriptomic heterogeneity within developing projection neuron subclasses.<h4>Methods</h4>Single-cell RNA sequencing and smFISH were used to identify transcriptomic differences between Met+ and Met- projection neuron populations in the mouse visual and frontal cortices during the early phase of synapse formation and dendritic growth.<h4>Results</h4>Analyses confirmed enrichment of Met in select projection neuron subclasses and further identified astrocytes as the major source of its ligand, Hgf. No genes were expressed uniquely in Met+ or Met- projection neurons within a subclass; rather, there were graded differences in gene expression between the populations. While the identity of differentially expressed genes varied between subclass and cortical area, there was a consistent overrepresentation of genes associated with axon growth, as well as synapse structure, development, and function, with a subset associated with the MET interactome. Further, compared to Met- projection neurons, expression differences in genes associated with maturation indicate less mature excitatory synapses and spines in the Met+ population at this age.<h4>Conclusion</h4>The current findings provide support for the hypothesis that Met+ projection neurons are in a less mature state than Met- projection neurons within the same subclass. Further, the data are consistent with converging lines of biochemical and electrophysiological evidence that MET contributes to asynchronous maturation of developing cortical circuits.

SOX6
Also flagged:sleepmetabolismcancerdiabetesheart diseasetranslational
Journal Article 2025-09-25 ✓ 1 Snippet Liu X, Cai YD, Hou C, Liu X, Luo Y, Mendiola AJP, Xu X, Luo Y, Zheng H, Zhao C, Chen CH, Zhang Y, Xiang YK, Ma J, Chiu JC.
In-Text Gene Mentions

…transcription factors (NFIL3,SOX6DBP, RBL2, etc.),…

Show Full Abstract

The liver circadian clock and hepatic transcriptome are highly responsive to metabolic signals generated from feeding-fasting rhythm. Previous studies have identified a number of nutrient-sensitive signaling pathways that could interpret metabolic input to regulate rhythmic hepatic biology. Here, we investigated the role of O-GlcNAcylation, a nutrient-sensitive post-translational modification (PTM) in mediating metabolic regulation of rhythmic biology in the liver. We observe daily oscillation of global nuclear protein O-GlcNAcylation in the liver of mice subjected to night-restricted feeding (NRF) using label-free global O-GlcNAc proteomics. Additional site-specific O-GlcNAc analysis by tandem mass tag mass spectrometry further supports temporal differences in O-GlcNAcylation by revealing day-night differences. Proteins involved in gene expression are enriched among rhythmically O-GlcNAcylated proteins, suggesting rhythmic O-GlcNAcylation may directly regulate the hepatic transcriptome. We show that rhythmic O-GlcNAcylation can also indirectly modulate nuclear proteins by interacting with phosphorylation. Several proteins harboring O-GlcNAcylation-phosphorylation interplay motif exhibit rhythmic O-GlcNAcylation and phosphorylation. Specifically, we show that O-GlcNAcylation occurs at a phospho-degron of a key circadian transcriptional activator, circadian locomotor output cycles kaput (CLOCK), thus regulating its stability and transcriptional output. Finally, we report that day-restricted feeding (DRF) in the nocturnal mouse significantly alters O-GlcNAcylation pattern. Whereas global O-GlcNAcylation analysis indicates dampening of global O-GlcNAcylation rhythm in mice fed under DRF, site-specific analysis reveals differential responses of O-GlcNAc sites when timing of food intake is altered. Notably, a substantial number of O-GlcNAcylation sites exhibit inverted day-night profiles when mice are subjected to DRF. This suggests the dysregulation of daily nuclear protein O-GlcNAcylation rhythm may contribute to the disruption in liver transcriptome previously observed in DRF condition. In summary, our results provide new mechanistic insights into metabolic regulation of hepatic transcriptional regulators via interplay between O-GlcNAcylation and phosphorylation and shed light on the deleterious effects of improper mealtimes.

Lupus nephritis.

Also flagged:Lupus nephritisglomerulonephritissystemic lupus erythematosusSLEkidney failureglomerular filtration
Journal Article 2025-09-25 No Snippets Parodis I, Rovin BH, Tektonidou MG, Anders HJ, Malvar A, Mok CC, Mohan C.
Show Full Abstract

Lupus nephritis (LN) is a type of glomerulonephritis and one of the most serious complications of systemic lupus erythematosus (SLE). LN affects 25-60% of patients with SLE, with incidence and prevalence varying by age, sex, ethnicity and socioeconomic factors. LN predominantly develops within 5 years of an SLE diagnosis and, for many patients, it is the initial manifestation that leads to the recognition of SLE. In some patients, LN may develop late in the disease course, highlighting the importance of persistent awareness of its symptoms and signs. Despite an increasing understanding of disease biology and more effective treatment options, LN remains a substantial cause of morbidity and mortality as it can lead to irreversible kidney failure and associated complications. Risk factors for progression to kidney failure include persistent proteinuria, low glomerular filtration rate, hypertension at diagnosis and frequent disease flares. LN pathogenesis involves complex immune dysregulation, with key pathways including type I interferon signalling, calcineurin activation, and B and T cell dysfunction. Several immunomodulatory drugs are used for the management of LN, and treatment paradigms are increasingly shifting towards multi-agent regimens. Along with appropriate pharmacotherapy, multidisciplinary care tailored to the patient's individual needs, involving rheumatologists, nephrologists, social workers and other health professionals, is crucial for holistically addressing both the immune and non-immune risk factors for progressive kidney function loss and for maximizing kidney lifespan in LN.

Also flagged:brain tumorsGlioblastomaGBMneoplasmbrain tumormalignant glioma
Journal Article 2025-09-25 No Snippets Suhail H, Rahman MA, Yadab MK, Gonawala S, deCarvalho A, Ewing JR, Snyder J, Ali MM.
Show Full Abstract

The uniform lethality of glioblastoma (GBM) with a survival of less than 2 years despite best available therapy is attributed to treatment resistance due to DNA repair mechanisms that drive disease relapse and tumor heterogeneity. One prognostic factor identified as a reliable biomarker for GBM sensitivity to temozolomide (TMZ) and radiotherapy (RT) is the overexpression of O<sup>6</sup>-methylguanine-methyl-transferase (MGMT) enzyme. Patients with active MGMT were found to receive little benefit from TMZ and RT. They represent a group of great unmet need with no treatment options that significantly improve survival. Recently, several preclinical and clinical studies suggest that the alcohol aversion drug, disulfiram (DSF), inhibited MGMT and improved the efficacy of TMZ in GBM when combined with copper (Cu). However, phase II trial showed that there was no significant survival benefit from oral Cu/DSF. Nevertheless, the major limitation of oral Cu/DSF has been delivery of fragile DSF to the in vivo system. To address this limitation, we developed a novel delivery system using 2-hydroxypropyl beta cyclodextrin (HPβCD) encapsulating the Cu complex of DSF's active metabolite, diethyldithiocarbamic acid (DDC). It was determined that HPβCD stabilized Cu(DDC)<sub>2</sub>. In vitro cell culture study revealed that HPβCD-Cu(DDC)<sub>2</sub> inhibited MGMT through the ubiquitin-proteasome pathway. Inhibition of MGMT activity in cell cultures vastly increased the alkylation-induced DNA double-strand breaks, cytotoxicity, and the levels of apoptotic markers like histone family member X (γ-H2AX), JNK-P and cleavage of Poly [ADP-ribose] polymerase 1 (PARP-1). Preliminary intravenous delivery of HPβCD-Cu(DDC)<sub>2</sub> in combination with TMZ in an MGMT-positive patient derived orthotopic xenograft (PDOX) model demonstrated tumor size regression. HPβCD-Cu(DDC)<sub>2</sub> targets MGMT-145-cysteine and its unique cytotoxic mechanism circumvents MGMT-mediated TMZ resistance. This novel delivery system shows promise for overcoming MGMT-mediated resistance in GBM, offering a potential new therapeutic strategy.

Also flagged:synthesishydroxyapatitecalciumhydroxylcarbonateapatite
Journal Article 2025-09-25 No Snippets Abdulhussein HJ, Mohsin MH, Jabir MS, Sulaiman GM, Mohammed HA, Ismail RA, Ramizy A, Eisa MH, Ibrahim NA, Badher NS.
Show Full Abstract

Hydroxyapatite (HA) nanoparticles synthesized from bio-waste sources like eggshells offer a sustainable and biocompatible alternative for bone regeneration. This study successfully synthesized nano-hydroxyapatite from chicken eggshell-derived calcium precursors and comprehensively characterized it. X-ray diffraction (XRD) confirmed the formation of a highly crystalline, phase-pure HA structure, while Fourier-transform infrared spectroscopy (FTIR) revealed characteristic phosphate, hydroxyl, and carbonate bands, resembling biological apatite. Scanning electron microscopy (SEM) showed spherical nanoparticles (~ 11.2 nm) with uniform distribution, enhancing bioactivity. Hemocompatibility assays demonstrated concentration-dependent hemolysis, with minimal RBC disruption (< 7%) at 12.5 mg/ml, mitigated further by protein corona formation. In vitro studies revealed excellent osteoblast (MC3T3-E1) adhesion and spreading on HA surfaces, indicating osteoconductivity. Additionally, HA nanoparticles exhibited dose-dependent free radical scavenging activity (up to 84.7% at 200 µg/ml) and significantly suppressed pro-inflammatory cytokines (IL-1β and IL-18) in LPS (Lipopolysaccharide)/ATP (Adenosine triphosphate)-stimulated macrophages, highlighting anti-inflammatory potential. These findings collectively underscore the suitability of eggshell-derived nano-HA for bone tissue engineering, combining eco-friendly synthesis, structural biomimicry, and multifunctional bioactivity to promote osteogenesis and mitigate inflammation.

PRDX6
Also flagged:Peroxiredoxinsmultiple myelomaperoxiredoxinPRDX2cell proliferationferroptosis
Journal Article 2025-09-25 ✓ 5 Snippets Chen Y, Peng X, Feng Z, Zhang L, Bai J, Li Y, Li L, Zhang L.
In-Text Gene Mentions

PRDX6plays a key…

…In contrast,PRDX6expression did not…

…of PRDX2 andPRDX6were significantly increased…

…and MM groups,PRDX6expression exhibited a…

…patients with lowPRDX6expression exhibited lower…

Show Full Abstract

We investigate the clinical significance of the peroxiredoxin (PRDX) family in multiple myeloma (MM) patients, focusing on its diagnostic and prognostic value, biological role and impact on the immune system. Using bioinformatics tools, such as CCLE, GEO, TCGA-MMRF, Kaplan-Meier plotter, enrichment and CIBERSORT analyses, we systematically characterized the expression levels, impact on survival and biological significance of PRDXs in MM. Bone marrow aspiration and clinical data were subsequently collected from MM patients to validate the findings related to PRDX2 from the databases. Finally, PRDX2 silencing in vitro modulated cell proliferation, immune infiltration and ferroptosis susceptibility. Compared with those in normal plasma cells, the expression levels of PRDX2/4/5/6 were significantly increased in myeloma cells. Furthermore, in relapsed MM cells, PRDX1/2/3/6 expression was significantly upregulated compared with that at baseline. Notably, PRDX2 was found to be highly expressed and associated with poor tumor characteristics, potentially contributing to disease progression and correlating with unfavourable prognosis. PRDX-related genes participate in various biological functions, influence metabolic pathways and may regulate ferroptosis and immune-related pathways in myeloma cells. This study is the first comprehensive analysis of the potential diagnostic and prognostic impact of the PRDXs family in MM, highlighting their significant associations with ferroptosis and the immune microenvironment. These findings provide a strong experimental and theoretical foundation for developing novel therapeutic strategies targeting ferroptosis and immunotherapy in MM.

Also flagged:Obstructive sleep apneaDiabetes Mellitussleep disordersdiabetesType 2 Diabetesmetabolic diseases
Journal Article 2025-09-25 No Snippets Hrytsenko Y, Spitzer BW, Wang H, Bertisch SM, Taylor KD, Garcia-Bedoya O, Ramos AR, Daviglus ML, Gallo LC, Isasi CR, Cai J, Qi Q, Alcántara C, Redline S, Sofer T.
Show Full Abstract

<h4>Background</h4>Obstructive sleep apnea (OSA), and other sleep disorders, are associated with increased risk of developing diabetes mellitus (DM). We examined whether sleep disorders influence the genetic risk of developing diabetes in Hispanic/Latino individuals.<h4>Methods</h4>We developed Type 2 Diabetes (T2D) polygenic risk score (T2D-PRS) useful in admixed Hispanic/Latino individuals. We estimated the association of the T2D-PRS with cross-sectional (n = 12,342) and incident (n = 6965) DM in the Hispanic Community Health Study/Study of Latinos (ages 18-76, 50.9% female). We conducted a mediation analysis with T2D-PRS as an exposure, incident DM as an outcome, and OSA as a mediator. Additionally, we performed Mendelian randomization (MR) analysis to assess the causal relationship between T2D and OSA.<h4>Results</h4>Here, we show that a 1 standard deviation increase in T2D-PRS has DM adjusted odds ratio (OR) = 2.67, 95% CI [2.40; 2.97] and a higher incident DM rate (incident rate ratio (IRR) = 2.02, 95% CI [1.75; 2.33]). In a stratified analysis based on OSA severity categories the associations are stronger in individuals with mild OSA compared to those with moderate to severe OSA. Mediation analysis suggests that OSA mediates the T2D-PRS association with DM. In two-sample MR analysis, T2D has a causal effect on OSA, OR = 1.03, 95% CI [1.01; 1.05], and OSA has a causal effect on T2D, with OR = 2.34, 95% CI [1.59; 3.44].<h4>Conclusions</h4>These results support a causal association between OSA and DM, with OSA mediating up to 4.7% of the genetic risk for DM. OSA treatment may reduce DM prevalence.

Also flagged:titaniumchitosannanohydroxyapatitesilvercalciumethanol
Journal Article 2025-09-25 No Snippets Pawłowski Ł, Kowalczyk K, Szczepańska K, Galer-Tatarowicz K, Mielewczyk-Gryń A.
Show Full Abstract

Titanium implants possess bioinert surfaces that limit osseointegration and are prone to bacterial colonization, necessitating functional coatings. This study investigated the electrophoretic deposition (EPD) of composite coatings composed of chitosan (CS), nanohydroxyapatite (nanoHAp), and silver nanoparticles (AgNPs) on grade 2 titanium using an ethanol-acetic acid suspension. The influence of deposition parameters (10-30 V; 3-5 min) on coating microstructure, adhesion, corrosion resistance, wettability, bioactivity, and silver release was systematically examined. The coatings reached a maximum thickness of ~ 7 μm at 30 V/5 min, while the most uniform and adherent coating (class 1, EN ISO 2409) was obtained at 10 V/3 min. Increasing voltage and time produced rougher (Sa up to 1.3 μm) and more porous surfaces, but decreased adhesion. Corrosion resistance improved with coating thickness, with open circuit potentials shifting positively up to + 0.15 V versus the reference electrode. Wettability tests revealed hydrophilic behavior with contact angles of ~ 80°. Bioactivity in simulated body fluid was confirmed by calcium phosphate precipitation on all coated samples, particularly thicker ones. Silver ion release was controlled by deposition parameters, ranging from 0.9 mg/L (10 V/3 min) to 1.8 mg/L (30 V/5 min) after 7 days, indicating a balance between antibacterial functionality and coating integrity. These results demonstrate that ethanol-based EPD can fabricate bioactive, corrosion-resistant CS/nanoHAp/AgNPs coatings with tunable properties. Optimized coatings show potential for biomedical applications, particularly in reducing implant-associated infections while supporting bone integration.

SERPINC1
Also flagged:bindingantibodiespeptidespeptidepost-translational modificationssodium
Journal Article 2025-09-25 ✓ 1 Snippet Kirsher DY, Chand S, Phong A, Nguyen B, Szoke BG, Ahadi S.
In-Text Gene Mentions

…P01008 (SERPINC1), on the other…

Show Full Abstract

Plasma is a rich source of biomolecules, including proteins, that reflect both health and disease. Due to their key roles in biological processes, proteins hold significant potential as biomarkers, fueling the rise of plasma proteome profiling in recent years. However, comprehensive comparisons of the performance of different plasma proteomics platforms are limited. Our study addresses this gap by conducting a direct comparison of eight platforms, representing both affinity-based and diverse mass spectrometry approaches, and covering over 13,000 proteins. By applying these platforms to the same cohort, we systematically assess their performance, identifying key differences and complementary strengths. Our findings offer valuable insights for researchers, highlighting trade-offs in coverage and their implications for biomarker discovery and clinical applications. This study serves as an essential resource, offering both technical evaluation and biological insights to support the development of novel diagnostics and therapeutics through plasma proteomics.

ZNF644
Also flagged:bicalutamideprostate cancerbenign prostatic hyperplasiagene expressiontranscription factorbinding
Journal Article 2025-09-25 ✓ 4 Snippets Peng G, Liang Z, Zuo F, Li J, Han F, Zhang B, Shen H.
In-Text Gene Mentions

…For example,ZNF644targeted both HMGCR…

…NQO1 , whileZNF644contributes to lipotoxicity…

…miR-128-3p, and TFsZNF644and MAZ may…

…like hsa-miR-216a-3p andZNF644in gene suppression.…

Show Full Abstract

Existing research indicates that bicalutamide and zoladex show significant potential in treating prostate cancer. However, in the clinical application of treating benign prostatic hyperplasia (BPH), it is limited due to relatively severe side effects, and the specific mechanism of action has not been fully studied. This research aimed to identify and validate key genes linked to the effects of bicalutamide and zoladex in BPH, potentially guiding the development of targeted therapeutic strategies. BPH-related datasets were retrieved from publicly available databases (|log2FC| > 0.5, p value < 0.05). Initially, intersection genes were identified by overlapping results from differential expression analysis (comparing BPH and control groups) with the target genes of bicalutamide and zoladex, which were sourced from database searches. Key genes were then pinpointed using protein-protein interaction (PPI) networks, machine learning algorithms (SVM-RFE and Random Forest), and gene expression analyses (IHC, immunohistochemical). To explore the biological mechanisms underlying these genes, functional enrichment (GO, KEGG and GSEA) molecular docking analyses were performed, construction of lncRNA miRNA mRNA molecular regulatory network, transcription factor (TFs) regulatory network, SNPs analysis, and disease prediction. Validation of gene expression levels was conducted through IHC analysis of clinical samples. The study identified NQO1, CLPP, HMGCR, and SORD as critical genes associated with BPH, all showing significantly reduced expression in BPH samples. These genes were notably co-enriched in the "oxidative phosphorylation" pathway. Moreover, CLPP, HMGCR, and NQO1 exhibited strong binding affinities with bicalutamide and zoladex. Specifically, the NQO1-bicalutamide interaction had a binding energy of -10.8 kcal/mol, while the NQO1-zoladex interaction demonstrated a binding energy of -38.05 kcal/mol. IHC analysis revealed significantly higher expression levels of NQO1, CLPP, HMGCR, and SORD in the treated group compared to the untreated group. This study underscores NQO1, CLPP, HMGCR, and SORD as potential therapeutic targets for BPH, offers mechanistic insights into the efficacy of bicalutamide and zoladex and provides novel insights into potential therapeutic strategies for patients with BPH. However, attention should still be paid to the control of side effects in their clinical application.

HFE
Also flagged:skeletal disordersgeneticGenetic disordersMendelian lethal disordersMendelian disorderstranslational
Journal Article 2025-09-25 ✓ 1 Snippet Jacinto J, Letko A, Gentile A, Otter A, Floyd T, Collins R, Richey M, Carty H, Scholes S, Jones A, Fuller H, Häfliger IM, Strugnell B, Studer E, Benazzi C, Bolcato M, Starič J, Diana A, Weber J, Freick M, Lühken G, Tammen I, Kraft DCE, Lindgren CM, Sickinger M, Soto S, O'Rourke BA, Agerholm JS, Drögemüller C.
In-Text Gene Mentions

…not compatible withhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Genetic skeletal disorders are a heterogeneous group of syndromic or non-syndromic diseases characterized by abnormal bone, joint or cartilage development. These disorders generally occur sporadically in ruminants. Although a genetic etiology is often suspected, only a limited number of causal variants have been identified and no comprehensive genetic analyses of a cohort of bovine and ovine skeletal developmental defects have been published. The aims of our study were (1) to propose a nosology of genetic skeletal disorders in cattle and sheep and (2) to contribute to the nosology with a number of novel genomically characterized cases.<h4>Results</h4>Based on a literature review, the proposed nosology of skeletal disorders in cattle and sheep with a confirmed molecular cause was found to comprise 43 different disorders associated with 45 different genes. In addition, horn traits were also included. The disorders were grouped into 21 categories based on the human medical nosology. Thirty novel bovine and nine ovine cases of congenital skeletal disorders were investigated. These represented 19 different disorders, which were grouped into 9 categories. Whole-genome sequencing (WGS) data were generated based on sample availability for either complete trios, affected paternal halfsiblings or isolated single cases. We identified 21 SNVs or small indels for 12 skeletal disorders. Of these, 17 were considered candidate variants affecting 16 different genes, including 11 that were classified as pathogenic and six as likely pathogenic. Additionally, the remaining 4 SNVs were of uncertain significance. Two aneuploidies (trisomy and partial monosomy) were the cause of two different disorders. For eight cases affected by six disorders no variant could be identified. Different modes of inheritance were detected, including spontaneous dominant de novo mutations, autosomal recessive alleles, an X-linked dominant allele, as well as aneuploidies. The overall molecular genetic diagnostic rate was 64%.<h4>Conclusions</h4>Genomic analysis revealed considerable heterogeneity of the described phenotypes in terms of mode of inheritance, affected genes, and variant type. We propose, for the first time in veterinary medicine, a nosology of genetic skeletal disorders in ruminants that may be useful for more precise differential clinicopathological diagnosis. We emphasize the potential of WGS to enhance genetic disease diagnosis and the importance of adopting a nosology for disease categorization.

NEGR1
Also flagged:TJP1GABRG3CDH2transcription factorbindingluciferase
Journal Article 2025-09-25 ✓ 5 Snippets Wang J, Zhang Y, Yang C, Ju Z, Xiao Y, Jiang Q, Liu W, Wang X, Wei X, Gao Y, Zhao X, Wang L, Gao Y, Li J, Huang J.
In-Text Gene Mentions

…such as GABRG3,NEGR1, and CDH2 were…

…other genes (NEGR1, MORF4L1 ,…

…intron of theNEGR1gene, which is…

…SNP rs11587434 inNEGR1was associated with…

…genes, including GABRG3,NEGR1, MORF4L1, CTSH, RASGRF1,…

Show Full Abstract

<h4>Background</h4>The genomic diversity of Chinese Holstein cattle remains insufficiently characterized, and the identification of genes associated with body conformation traits is still limited. In this study, we aimed to explore the genome-wide diversity and population structure, and to identify candidate genes associated with 20 body conformation traits in Chinese Holstein cattle from six farms using the GGP Bovine 50 K single nucleotide polymorphism (SNP) chip.<h4>Results</h4>We analyzed runs of homozygosity and population admixture across farms and observed genetic diversity differences among herds. A genome-wide association study identified 21 significant SNPs linked to five body conformation traits. Notably, a missense mutation in TJP1 (BovineHD2100008355) was associated with foot heel depth. Ten SNPs within intronic regions of genes such as GABRG3, NEGR1, and CDH2 were associated with various udder and leg traits. The remaining ten SNPs were located in intergenic regions and influenced transcription factor binding sites. Among them, BovineHD2100013266, BovineHD0500004109, and BTB-00042676 were shown to regulate transcriptional activity through dual-luciferase reporter assays.<h4>Conclusions</h4>Our findings offer valuable insights for managing genetic inbreeding in cattle farms, enhancing the understanding of the genetic architecture underlying body conformation traits in Holstein cattle, and accelerating the genomic selection process in Chinese Holsteins.

RC3H1
Also flagged:infectious pancreatic necrosischromosomesdsRNA-dependent serine/threonine-protein kinasePKRpancreatic necrosischromosome
Journal Article 2025-09-25 ✓ 5 Snippets D'Ambrosio J, François Y, Morin T, Courant S, Desgranges A, Haffray P, Collet B, Boudinot P, Phocas F.
In-Text Gene Mentions

…( uts2d ,rc3h1, ga45b )…

…( uts2d andrc3h1on chr 1;…

…Q1.6, the generc3h1(also named roquin-1…

…rc3h1 (also namedroquin-1) encodes for…

…located in therc3h1gene (Q1.6) and…

Show Full Abstract

<h4>Background</h4>This study focuses on genetic resistance to infectious pancreatic necrosis (IPN), a highly contagious disease caused by an aquatic birnavirus (IPNV) which especially affects salmonids worldwide. The objectives were to estimate the heritability of IPN resistance and to fine map quantitative trait loci (QTL) using a Bayesian Sparse Linear Mixed Model to identify candidate genes possibly linked to IPN resistance in two successive generations from a French commercial strain of rainbow trout. For each generation, 2000 fish were experimentally exposed by bath to IPNV and mortalities were monitored daily during 5 weeks. All fish were genotyped using a medium-density 57 K single nucleotide polymorphism (SNP) chip and imputed to high-density genotypes (665 K SNPs).<h4>Results</h4>The mean survival rate was 70% after 37 days, with a higher survival rate in the second generation compared to the first one (78% versus 61%). Heritability was moderate (~ 0.20). Approximately 74% of the genetic variance of IPN resistance was explained by several tens of SNPs. In total, 25 QTL were mapped on 10 chromosomes, of which 7 were detected with very strong evidence, on chromosomes 1, 14, 16 and 28. The most interesting QTL were associated to top SNPs with mean survival rate differences over 20% between the beneficial and detrimental homozygous genotypes. Those SNPs were all located within promising functional candidate genes on chromosome 1 (uts2d, rc3h1, ga45b) and chromosome 16 (irf2bp, eif2ak2), which were all associated with regulation of inflammatory pathways. A key factor for the genetic differences in susceptibility to IPNV among fish is the dsRNA-dependent serine/threonine-protein kinase (PKR) encoded by the eif2ak2 gene.<h4>Conclusions</h4>All genes associated with the most significant QTL on chromosomes 1 and 16 are involved in the regulation of inflammatory pathways, strongly suggesting a central role of inflammation in IPN resistance in rainbow trout. These findings offer the possibility of marker-assisted selection for rapid dissemination of genetic improvement for IPN resistance.

Also flagged:secretionangiogenesisalkaloidsberberinerhynchophyllineephedrine
Journal Article 2025-09-25 No Snippets Bi Z, Tang H, Wang E, Wang Y, Meng Y, Yuan J, Liu Z.
Show Full Abstract

This review article explores the possible role of Chinese medicine (CM) in modulating stem cells for regenerative medicine, synthesizing evidence from animal experiments and human trials. The article focuses on how CM modulates the stem cell environment, specifically their roles in delaying cellular senescence and promoting stem cell survival, enhancing proliferation and differentiation, as well as stimulating exosome secretion. It also conducts a critical analysis of methodological rigor and clinical transparency within the included studies to enable a more objective assessment of their reliability and reproducibility. To guarantee the responsible integration of CM and stem cells in future clinical application, it also discussed the safety, efficacy, and heterogeneity of stem cells, as well as delivery methods, alongside the dose-response relationship of CM. The current evidence for CM in stem cell therapy remains constrained by the absence of standardized comparative baselines in animal studies and clinical outcome assessment. This methodological gap not only compromises the evidentiary weight of herbal effects but also introduces confounding variables in studies. The elucidation of CM mechanistic role in stem cell therapeutics necessitates robust interdisciplinary collaboration, this is an imperative and critically urgent thing within peer-reviewed research framework.

Also flagged:NCAPHYAP1breast cancermalignant tumortumorgene expression
Journal Article 2025-09-25 No Snippets Qiu C, Wei Y, Li J.
Show Full Abstract

<h4>Rationale</h4>Breast cancer (BC) is the most prevalent malignant tumor in women globally. Despite improved cure rates and survival for early- to mid-stage patients, around 30% still progress to metastatic BC due to cancer stem cells (CSCs), which drive tumor recurrence, progression, metastasis, and drug resistance.<h4>Methods</h4>This study used bioinformatics to analyze BC datasets from gene expression omnibus (GEO), cBioportal, and The Cancer Genome Atlas (TCGA), identifying NCAPH as a gene associated with breast cancer stem cells (BCSCs) characteristics. The mRNA stemness index algorithm was used to calculate tumor stemness scores. WGCNA, Lasso regression, and Kaplan-Meier analyses validated the link between NCAPH and BC prognosis. In vitro and in vivo experiments explored NCAPH's effects on BC cells. Transcriptomic sequencing and Gene set enrichment analysis (GSEA) analysis revealed Hippo-YAP1 pathways regulated by NCAPH. Co-immunoprecipitation and immunofluorescence co-localization experiments confirmed the interaction between NCAPH and YAP1, with functional rescue experiments using the YAP1 inhibitor Verteporfin.<h4>Results</h4>Results showed NCAPH was overexpressed in BC, linked to advanced tumor stages and poor prognosis. It enhanced CSCs properties, accelerated cell cycle progression, and promoted proliferation, migration, and invasion in vitro and in vivo. GSEA analysis suggested NCAPH regulates YAP1 in the Hippo signaling pathway. NCAPH promotes LATS1 and YAP1 expression, dephosphorylation, and nuclear translocation, enhancing BCSC traits and malignant phenotypes. Notably, Verteporfin reversed NCAPH-driven BCSC traits and malignant phenotypes.<h4>Conclusion</h4>This study identifies NCAPH as a novel oncogenic factor in BC. NCAPH interacts with YAP1, promoting its nuclear translocation and enhancing BCSC traits and malignancy. Critically, YAP1 inhibition reverses NCAPH-driven effects, validating the NCAPH as a promising therapeutic target.

PRDX6
Also flagged:dementiaADpathogenesisAHNAKβ-amyloid peptides
Journal Article 2025-09-25 ✓ 5 Snippets Wang E, Yu K, Cao J, Wang M, Katsel P, Song WM, Wang Z, Li Y, Wang X, Wang Q, Xu P, Yu G, Zhu L, Geng J, Habibi P, Qian L, Tuck T, Li A, Tcw J, Roussos P, Brennand KJ, Haroutunian V, Johnson ECB, Seyfried NT, Levey AI, Bennett DA, Peng J, Cai D, Zhang B.
In-Text Gene Mentions

…for MSN (ab151542),PRDX6(ab133348, both from…

…(VIM, GFAP, PLEC,PRDX6, EZR, AHNAK, and…

…protein (MSN) andPRDX6are the top…

…23 For example,PRDX6was shown to…

…its ranking order),PRDX6(#2), VIM (#3),…

Show Full Abstract

The molecular mechanisms underlying the pathogenesis of Alzheimer's disease (AD), the most common form of dementia, remain poorly understood. Proteomics offers a crucial approach to elucidating AD pathogenesis, as alterations in protein expression are more directly linked to phenotypic outcomes than changes at the genetic or transcriptomic level. In this study, we develop multiscale proteomic network models for AD by integrating large-scale matched proteomic and genetic data from brain regions vulnerable to the disease. These models reveal detailed protein interaction structures and identify putative key driver proteins (KDPs) involved in AD progression. Notably, the network analysis uncovers an AD-associated subnetwork that captures glia-neuron interactions. AHNAK, a top KDP in this glia-neuron network, is experimentally validated in human induced pluripotent stem cell (iPSC)-based models of AD. This systematic identification of dysregulated protein regulatory networks and KDPs lays down a foundation for developing innovative therapeutic strategies for AD.

SUDS3
Also flagged:methylationhistonenucleosomechromatinorganizationH3K4 methyltransferase
Journal Article 2025-09-25 ✓ 1 Snippet Gong Y, Wang Q, Wei L, Wang L, Lv N, Du X, Shen C, Xin Y, Sun L, Xu J.
In-Text Gene Mentions

…mediated by thepolycomb repressiverepressive complexes PRC1…

Show Full Abstract

Despite their ecological and biotechnological importance, the extent to which microalgae are regulated by epigenetic mechanisms has remained poorly understood. In the model industrial microalga Nannochloropsis oceanica, by comprehensive, multi-dimensional epigenomic analyses, this study uncovers an epigenetic regulatory network responsive to CO<sub>2</sub> levels. This network involves intricate interactions among DNA methylation, histone modifications, dynamic nucleosome positioning, and three-dimensional chromatin organization during adaptation to low-CO<sub>2</sub> conditions. Although DNA methylation is minimal, histone modifications-such as lysine acetylation, crotonylation, and methylation-are associated with active chromatin states and linked to 43.1% of differentially expressed genes. Notably, histone H3K4 di-methylation (H3K4me2) displays a distinct dual-peak profile around the transcription start site and is correlated with chromatin compartment dynamics. Knockout of NO24G02310, a putative H3K4 methyltransferase gene, caused genome-wide shifts in H3K4me2 peaks and decreased H3K4me1 levels, accompanied by direct or indirect downregulation of NoHINT and NoPMA2 expression, slower algal growth, and reduced photosynthetic efficiency (indicated by Fv/Fm), specifically under low-CO<sub>2</sub> conditions. Deletion and overexpression of genes encoding the histidine triad nucleotide-binding protein NoHINT and the plasma membrane H⁺-ATPase NoPMA2 confirmed their roles in growth and photosynthetic efficiency under low CO<sub>2</sub>; NoHINT influences growth and NoPMA2 affects photosynthesis. As a previously unrecognized low-CO<sub>2</sub> adaptation mechanism, NO24G02310 likely coordinates the regulation of NoHINT and NoPMA2 through H3K4 modifications. These findings provide a foundation for enhancing microalgal productivity through targeted epigenetic engineering.

CACNA1ESHISA6
Also flagged:KCNQ2potassium channelneonatalepileptic encephalopathyintellectual disabilityautism
Journal Article 2025-09-25 ✓ 2 Snippets Sundberg M, Shum C, Norabuena EM, Makhortova NR, Chen C, Yu L, Wightman EV, Kim K, Han SY, Howe J, Poduri A, Buttermore ED, Scherer SW, Sahin M.
In-Text Gene Mentions

…nonsynonymous variant inCACNA1E( Shum et…

…finger protein 562),SHISA6(shisa family member…

Show Full Abstract

Pathogenic variants in the KCNQ2 gene, which encodes a potassium channel subunit, are associated with neonatal seizures, epileptic encephalopathy, intellectual disability, and autism. Although the consequences of disrupted KCNQ2 channel function have been studied in the past, the detailed molecular mechanisms underlying the development of neurological phenotypes remain unclear, and neuronal models of specific patient variants are lacking. We generated patient-specific induced pluripotent stem cells (iPSCs) from fibroblasts from three individuals with distinct KCNQ2 pathogenic variants. We corrected the KCNQ2 variants using CRISPR-Cas9 editing to create isogenic controls and differentiated these iPSCs into glutamatergic neurons to study the effects of each variant on neuronal function. The three KCNQ2 variants were: 1) KCNQ2 c.875_877delTCCinsCCT, L292_L293delinsPF, 2) KCNQ2 c.766G > T, G256W, and 3) KCNQ2 c.821C > T, T274M. Our data revealed longer neurite outgrowth in two patient lines (T274M and G256W). Transcriptional profiling showed that all three KCNQ2 lines co-expressed genes enriched in synaptic transmission/signaling, cell adhesion, and GTPase signal transduction. Functional analyses of neuronal networks revealed increased burst duration in all three KCNQ2 lines compared with their isogenic controls. Furthermore, neurons from the L292_L293delinsPF and T274M lines displayed increased network connectivity associated with increased density of synaptic markers. Finally, we detected hyperexcitable neuronal networks in the G256W line with electrical stimulation of the neural networks on a high-density microelectrode array, and this phenotype was rescued with retigabine. These disease-related phenotypes for each of the KCNQ2 pathogenic variants can be used for drug screening to identify treatment options for the patients.

Also flagged:Psoriasisnucleotidegene expressionalanineleucinevaline
Journal Article 2025-09-25 No Snippets Jiang S, Chen L, Li J, Gao F, Yan X, Zhao Y.
Show Full Abstract

<h4>Introduction</h4>Psoriasis is a chronic autoimmune skin disorder with a complex genetic basis. However, the codon usage patterns and nucleotide features of psoriasis-related genes remain unexplored, despite their potential to influence gene expression and disease progression.<h4>Methods</h4>We analyzed 79 psoriasis-associated genes to investigate codon usage bias (CUB) and nucleotide composition. Metrics included GC content, effective number of codons (ENC), and relative synonymous codon usage (RSCU). Evolutionary influences were assessed using correspondence analysis, parity rule 2 (PR2) plots, and neutrality plots.<h4>Results</h4>Functional enrichment analysis identified pathway involvement. Comparative genomic analysis evaluated differences in coding sequence and UTR lengths and GC content relative to the genome-wide background. Psoriasis-related genes showed high GC content (mean = 53.3 ± 9.3%) with a strong preference for GC-ending codons, especially at the third codon position (GC3 = 60.6 ± 16.1%). RSCU analysis revealed frequent use of GCC (alanine), CTG (leucine), and GTG (valine). While the mean ENC (46.2 ± 9.9) suggested moderate codon bias, several genes displayed strong bias (ENC < 30). Selection pressure accounted for 71% of codon usage variation, with mutation pressure contributing 29%. Functional enrichment showed significant involvement in IL-17 (FDR = 3.4×10<sup>-3</sup>), JAK-STAT (FDR = 3.4×10<sup>-3</sup>), and TNF (FDR = 8.0×10<sup>-</sup>³) signaling pathways. These genes also tended to have shorter coding sequences and 5'UTRs and higher GC content compared to genome-wide averages.<h4>Conclusion</h4>In conclusion, this study reveals that psoriasis-related genes are under strong selective pressure, enriched in key inflammatory pathways, and exhibit codon and nucleotide features that may optimize expression in inflamed tissues. These insights have translational relevance for designing codon-optimized mRNAs, gene therapies, and diagnostic tools tailored to autoimmune diseases like psoriasis.

POU3F2
Also flagged:breast cancerautoimmune diseasescancerBRCAGene ExpressionSEZ6
Journal Article 2025-09-25 ✓ 1 Snippet He W, Fan S, Luo Y, Yi X, Liu Y, He G, Li Z, Li Y.
In-Text Gene Mentions

…Conversely, genes B4GALNT2,POU3F2, SPIB, and XKR7…

Show Full Abstract

Citrullination, a process linked to autoimmune diseases, has been implicated in cancer, but its role in breast cancer (BRCA) remains unclear. This study aimed to identify citrullination-related genes (CRGs) associated with prognosis in BRCA. We utilized datasets from The Cancer Genome Atlas (TCGA-BRCA) and Gene Expression Omnibus (GEO), pinpointing candidate genes by intersecting differentially expressed genes (DEGs) from TCGA-BRCA with known CRGs. Prognostic CRGs were selected using univariate Cox regression and Lasso regression analyses, and a predictive nomogram was created based on independent prognostic factors identified through multivariate Cox regression. Our findings revealed that SEZ6, S100B, SPIB, and TFF1 were key CRGs used to construct a risk model. High-risk BRCA patients exhibited immune-suppressive tumor microenvironments (TMEs) with low CD8<sup>+</sup> T cell mutation and enrichment in C1/C4 immune subtypes. In contrast, low-risk patients displayed high immune infiltration and enrichment in C2/C3/C6 subtypes. High expression of S100B, SPIB, and TFF1 was associated with increased immune infiltration by NK cells and T cells, while high SEZ6 expression was linked to neutrophil mutations, PD-L1 upregulation, and low CD8<sup>+</sup> T cell infiltration. Molecular docking studies explored the interactions of these CRGs with entinostat. In conclusion, SEZ6, S100B, SPIB, and TFF1 were identified as significant prognostic genes in BRCA, providing insights into BRCA pathogenesis and potential personalized treatment strategies.

OLFM4
Also flagged:coagulationgene expressionPI3KAktCCR6CD
Journal Article 2025-09-25 ✓ 5 Snippets Wu F, Wu F, Yang H, Xie W, Zhang S, Zhou L, Xie F, Bai L, Huang M, Liu S.
In-Text Gene Mentions

…novel CCR6 +OLFM4+ intestinal stem…

…novel CCR6 +OLFM4+ stem cell…

…in CCR6 +OLFM4+ cells in…

…nominate CCR6 +OLFM4+ stem cells…

…Four distinctOLFM4+ stem cell…

Show Full Abstract

<h4>Background</h4>The mechanisms linking hypercoagulability to disease severity in Crohn's disease (CD) remain poorly understood. Through integrated transcriptomic and single-cell analyses of ileal tissues, we identified a novel CCR6<sup>+</sup>OLFM4<sup>+</sup> intestinal stem cell subpopulation that bridges coagulation and inflammation in CD.<h4>Methods</h4>A cohort of 78 CD patients was established, utilizing transcriptomic data from three independent ileal samples obtained from the GEO database as discovery and validation datasets. Coagulation-related DEGs (CRGs) were determined via AmiGO 2 and KEGG databases. Based on these CRGs, CD patients were subclustered, coagulation scores were calculated, and gene expression changes were evaluated. Public single-cell RNA sequencing data from CD patient ileal epithelial cells were analyzed to identify key target cells influenced by coagulation. Immune infiltration was evaluated based on coagulation scores across subgroups. Ileal tissues from CD patients with different coagulation statuses were examined using Immunofluorescence Staining.<h4>Results</h4>Single-cell analysis of ileal epithelium revealed a novel CCR6<sup>+</sup>OLFM4<sup>+</sup> stem cell subpopulation that was significantly expanded in CD patients with hypercoagulability (<i>P</i><0.05). These cells showed marked upregulation of PI3K-Akt signaling and correlated strongly with disease severity. Immunofluorescence validation confirmed a 2.3-fold increase in CCR6<sup>+</sup>OLFM4<sup>+</sup> cells in the epithelial layer of hypercoagulable CD patients compared to normocoagulable controls. The concurrent activation of coagulation pathways and immune cell infiltration in CD ileum suggests this stem cell subpopulation may serve as a critical link between hypercoagulability and disease progression.<h4>Conclusion</h4>Our findings nominate CCR6<sup>+</sup>OLFM4<sup>+</sup> stem cells as cellular mediators of coagulation-associated CD progression, suggesting the CCR6-PI3K-Akt axis as a potential therapeutic target requiring validation in larger cohorts.

HFE
Also flagged:erythropoietic protoporphyriaFECHprotoporphyrinautoimmune hepatitisferrochelatase deficiencyPorphyrias
Journal Article 2025-09-25 ✓ 2 Snippets Yang T, Chen C, Li C, Wang J.
In-Text Gene Mentions

…glycogen, further excludinghemochromatosis( 12 ),…

…storage diseases, andhemochromatosis, should also be…

Show Full Abstract

<h4>Background</h4>Erythropoietic protoporphyria (EPP) is a rare autosomal recessive disorder caused by mutations in the FECH gene, leading to ferrochelatase deficiency and the accumulation of protoporphyrin in various organs. EPP patients with liver damage have atypical histopathological manifestations, which pose challenges for pathological diagnosis.<h4>Content</h4>We report a 29-year-old male with recurrent abdominal pain and scleral jaundice. Initial liver dysfunction suggested autoimmune hepatitis, but liver biopsy revealed dense brownish granular deposits with red birefringence under polarized light, characteristic of EPP. Genetic testing identified a new mutation site (c.804 + 1del), which may be related to the disease. Additionally, the patient also has Gilbert's syndrome.<h4>Conclusion</h4>This case highlights the diagnostic challenges of EPP and the importance of integrating clinical history, histopathology, and genetic testing. Polarized light microscopy is crucial for identifying the characteristic features of EPP. Early genetic testing can guide timely diagnosis and treatment, contributing to the understanding of this rare condition.

HTT
Also flagged:neurodegenerative disordernucleotidegene expressionHDpathogenesisneurological diseases
Journal Article 2025-09-25 ✓ 5 Snippets Salemi M, Schillaci FA, Salluzzo MG, Marchese G, Ventola GM, Perrotta CS, Di Stefano V, Lanza G, Ferri R.
In-Text Gene Mentions

…the Huntingtin (HTT) gene.…

…the huntingtin (HTT) gene was…

…interaction between mutantHTTand the Repressor…

…nder physiological conditions,HTTsequesters REST, but…

…MutantHTTis ubiquitously expressed,…

Show Full Abstract

<b>Background/Objectives</b>: Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by a CAG nucleotide repeat expansion in the Huntingtin (<i>HTT</i>) gene. Dysregulation of microRNAs (miRNAs), key post-transcriptional regulators of gene expression, has been implicated in HD pathogenesis, although their specific roles remain incompletely understood. <b>Methods</b>: Peripheral blood mononuclear cells from Sicilian HD patients and matched healthy controls were subjected to small RNA sequencing. Differential expression analysis was conducted using DESeq2 (version 1.44.0), with significance defined as |fold change| ≥ 1.5 and adjusted <i>p</i> ≤ 0.05. Ingenuity Pathway Analysis (IPA) was applied to assess functional enrichment, focusing on neurological diseases, inflammatory processes, and miRNA-RNA messenger (mRNA) interaction networks. <b>Results</b>: A total of 790 differentially expressed miRNAs were identified in HD patients (270 upregulated and 520 downregulated). IPA revealed enrichment in pathways related to organismal injury, neurological disease, and inflammatory responses. Four major regulatory networks linked differentially expressed miRNAs to neurodegenerative processes, with target genes involved in neuroinflammation, cellular stress responses, and metabolic dysfunction. Cross-referencing with previous RNA-seq data identified 5721 high-confidence miRNA-mRNA interactions, implicating 721 target genes across 54 key canonical pathways. <b>Conclusions</b>: HD patients exhibit a distinct and reproducible peripheral blood miRNA expression signature. These dysregulated miRNAs may represent accessible biomarkers and provide mechanistic insights into HD pathogenesis, with potential applications for diagnosis, prognosis, and therapeutic development.

DARS2POU3F2
Also flagged:CancerClpPserine proteasemitochondrialtumortumors
Journal Article 2025-09-25 ✓ 3 Snippets Armenise D, Baldelli OM, Liturri A, Cavallaro G, Fortuna CG, Ferorelli S, Miciaccia M, Perrone MG, Scilimati A.
In-Text Gene Mentions

…of SOX2 andPOU3F2in LNCaP and…

…InDars2-deficient mouse models of…

…transcription factor 2POU3F2POU class 3…

Show Full Abstract

<b>Background</b>: The human mitochondrial ClpP is a serine protease located in the mitochondrial matrix responsible for degrading short lived regulatory proteins as well as misfolded or damaged proteins, thereby maintaining cellular homeostasis. Proteastasis dysregulation is linked to tumor progression. <b>Methods</b>: We conducted a literature review (2020-2025) using PubMed and Scopus, focusing on studies addressing ClpP structure, function, activity modulation, and cancer relevance. Keywords included "ClpP", "ClpP activators", "ClpP inhibitors", and "mitochondrial protease". <b>Results</b>: ClpP is upregulated in many tumors compared to normal tissues. Cancer cells depend on ClpP for mitochondrial proteostasis, metabolic adaptation, and survival. ClpP proteolytic activity modulation-via activators or inhibitors-disrupts these processes showing efficacy even in clinical setting. <b>Conclusions</b>: ClpP is emerging as a key player in cancer pathophysiology and holds potential as a therapeutic target. Its selective overexpression in tumors, along with its involvement in mitochondrial homeostasis, makes it a compelling candidate for precision oncology.

Also flagged:Peptide Nucleic Acidlactic-co-glycolic acidHBBOligonucleotidesgene expressioncell adhesion
Journal Article 2025-09-25 No Snippets Eltaweel N, Elkamah G, Elaraby N, Hassan I, Wassel A, Abdel-Aziz N, Amr K.
Show Full Abstract

PNAs have emerged as a powerful tool in gene editing, particularly for correcting monogenic disorders by enhancing targeted recombination and genomic modifications. This study aimed to establish a gene editing technique using Peptide Nucleic Acid (PNA)/donor DNA-loaded poly lactic-co-glycolic acid (PLGA) nanoparticles at our genomic facilities, with the ultimate goal of correcting disease-causing mutations. Methods involved culturing skin fibroblasts from a healthy Egyptian volunteer without HBB gene mutations in two separate 12-well plates. Oligonucleotides were designed, and nanoparticles were formulated and characterized before being used to treat the cultured fibroblasts. DNA and RNA were extracted from treated cells, followed by molecular analyses to confirm the edits. Results indicated successful encapsulation of nanoparticles and modest, sustained introduction of the desired mutation, accompanied by functional impairment in HBB gene expression. The study successfully established PNA gene editing technology, potentially paving the way for future treatment studies of single-gene disorders.

Also flagged:agingproteostasisHERV-KNF-κBIgGbetaine
Journal Article 2025-09-25 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

PEBP1
Also flagged:Ferroptosislung diseasesirondeathlipidglutathione
Journal Article 2025-09-24 ✓ 2 Snippets Yin X, Hou X, Feng J.
In-Text Gene Mentions

…oxidative stress andPEBP1-15-LO-mediated lipid peroxida…

…autophagy, modulated byPEBP1[ 90 ,…

Show Full Abstract

Lung epithelial cells, including bronchial and alveolar epithelial cells, serve as the frontline barrier of the respiratory tract and play essential roles in maintaining pulmonary homeostasis and immune defense. Dysfunction of these epithelial cells contributes significantly to the development and progression of various lung diseases. Ferroptosis, an iron-dependent form of regulated cell death characterized by lipid peroxidation and glutathione depletion, has emerged as a key mechanism in pulmonary pathology. It plays distinct roles in benign and malignant lung conditions. In chronic obstructive pulmonary disease and asthma, ferroptosis promotes bronchial epithelial damage, oxidative stress, and persistent inflammation. Pathogens, such as Pseudomonas aeruginosa and SARS-CoV-2, induce ferroptosis to exacerbate epithelial injury. In pulmonary fibrosis, ferroptosis of alveolar epithelial cells contributes to tissue remodeling through oxidative stress and epithelial-mesenchymal transition. In lung cancer, ferroptosis affects carcinogenesis, therapy resistance, and response to radiotherapy. Emerging therapeutic strategies target ferroptosis using inhibitors, such as ferrostatin-1 and deferoxamine, or inducers, such as erastin and sulfasalazine, to modulate cell fate in a disease-specific manner. Natural compounds, such as curcumin, resveratrol, and nanomaterials, further enhance ferroptosis-based treatment potential. Ferroptosis thus offers a novel perspective on lung disease mechanisms and treatment. This article aims to review the role of epithelial cell ferroptosis in benign and malignant lung diseases.

DCC
Also flagged:Parkinson's DiseaseAlzheimer's diseaseADtauPDcognitive decline
Journal Article 2025-09-24 ✓ 1 Snippet Sturchio A, Paslawski W, Khosousi S, Markaki I, Nalls MA, Singleton AB, Iwaki H, Svenningsson P.
In-Text Gene Mentions

…direct influence ofDCCincrease in the…

Show Full Abstract

<h4>Background</h4>DOPA decarboxylase (DDC) in cerebrospinal fluid (CSF) is an emerging Parkinson's disease (PD) biomarker, but its association with nonmotor symptoms is unclear.<h4>Objectives</h4>We aimed to determine if baseline DDC was associated with future cognitive decline in PD.<h4>Methods</h4>We correlated baseline CSF DDC, detected using the proximity extension assay, with Montreal Cognitive Assessment (MoCA) score using longitudinal data from 3 cohorts: Biopark, PPMI, and PDBP.<h4>Results</h4>DDC was significantly associated with cognitive decline in both the Biopark cohort (P-value < 0.0001) and the PDBP/PPMI cohorts (P-value < 0.0001). The results were still significant after correcting for levodopa-equivalent daily dose in the Biopark cohort (P-value < 0.0001) and when the analysis was restricted to the de novo subjects, both in Biopark (P-value: 0.0065) and PPMI (P-value<0.0001) cohorts.<h4>Conclusions</h4>CSF DDC is a potential biomarker for the prediction of cognitive decline in PD patients.

Also flagged:gold nanorodsion channelsRUNX2osteogenesisYes‐associated proteinRunt‐related transcription factor 2
Journal Article 2025-09-24 No Snippets Wang C, İyisan N, Harder P, Fell VHK, Kozina V, Dietz H, Merkel OM, Özkale B.
Show Full Abstract

Exogenous forces significantly influence mammalian cell behavior, yet current strategies fail to resolve signaling processes between individual cells under conditions that accurately mimic the native microenvironment. This work presents a new cell culture technology capable of applying spatially patterned exogenous forces on individual cells within multicellular clusters encased in three-dimensional (3D) hydrogel matrices. Photothermally powered 3D microgels containing stem cells and integrated force generators are engineered to investigate intercellular communication under anisotropic forces with excellent spatial resolution (≈1 µm). Varying force patterns, such as uniform compression versus spatially heterogeneous tension, are achieved in 3D by relying on the synergistic effect of plasmonic gold nanorods and thermally responsive co-polymers under light actuation. The microgels generate 17-34 nN force locally, which activates mechanically sensitive ion channels in encapsulated cells stimulated with isotropically applied compression and spatially heterogeneous tension in 3D in a selective manner. Spatially patterned exogenous forces trigger F-actin remodeling, nuclear translocation of Yes-associated protein (YAP) and Runt-related transcription factor 2 (RUNX2) in encapsulated cells following cyclic stimulation. Sustained application of exogenous forces over three days is sufficient to regulate stem cell fate toward osteogenesis. This technology allows combinatorial studies of biomolecular and biophysical cues in 3D, making it suitable for applications in mechanobiology and bioengineering.

Also flagged:2,4-Dichlorophenoxyacetic acidphenoxyacidwater2,4-dichlorophenolbehavioralmetabolism
Journal Article 2025-09-24 No Snippets Papade SE, Suhail M, Bagwe OK, Phale PS.
Show Full Abstract

Repeated application of herbicides like 2,4-dichlorophenoxyacetic acid (2,4-D) in agriculture poses a significant environmental threat and health risk to non-target biota. <i>Cupriavidus</i> sp. strain DSPFs, isolated from Indian agricultural soil, utilizes 2,4-D and various other aromatics as the sole source of carbon and energy. It efficiently degrades high concentrations of 2,4-D (up to 0.3% wt/vol, i.e., 3,000 ppm) within 24 h with a maximum degradation rate of 105 mg L<sup>-1</sup> h<sup>-1</sup>. Based on enzyme activity, whole-cell oxygen uptake, high-performance liquid chromatography (HPLC), and liquid chromatography-mass spectroscopy (LC-MS/MS) analyses, the strain was proposed to metabolize 2,4-D via 2,4-dichlorophenol (2,4-DCP) and 3,5-dichlorocatechol <i>ortho</i> ring-cleavage pathway. The key enzyme, 2,4-DCP monooxygenase (24DCPM), was purified to homogeneity and found to be homotetrameric with a native molecular mass of ~255 kDa with ~3.9 mol of FAD per mol of native protein. The enzyme exhibited high catalytic efficiency (<i>K</i><sub>cat</sub>/<i>K</i><sub>m</sub>) of 4.5 and 6.6 µM<sup>-1</sup> s<sup>-1</sup> with NADH and NADPH, respectively. Strain also displayed various plant growth-promoting traits like production of indoleacetic acid, ammonia, siderophores and mineral solubilization. Priming of <i>Vigna radiata</i> (mung bean) seeds with strain enhanced (30-47%) growth of seedlings in non-contaminated soil microcosms, indicating plant growth-promoting potential of the strain. Seed priming with strain significantly reduced 2,4-D toxicity to mung bean seedlings, suggesting the phytoprotective abilities of the strain. Bio-augmentation of 2,4-D-contaminated soil with strain DSPFs could remove >95% of 2,4-D (100 ppm) in 4 days with a degradation rate of 91 mg kg<sup>-1</sup> day<sup>-1</sup>. <i>Cupriavidus</i> sp. DSPFs is a promising candidate for the eco-friendly clean-up of agricultural fields and enhancing crop productivity.<h4>Importance</h4>An agricultural soil isolate, <i>Cupriavidus</i> sp. strain DSPFs, is capable of degrading 2,4-dichlorophenoxyacetic acid (2,4-D), a widely used herbicide having deleterious effects on non-target crop plants and other biota. Strain DSPFs efficiently degrade relatively high concentrations of 2,4-D in minimal growth medium as well as in contaminated soil. This efficient degradation by strain can be attributed to the enhanced catalytic efficiency (low <i>K</i><sub>m</sub> and high <i>V</i><sub>max</sub>) of key enzyme 2,4-dichlorophenol-6-monooxygenase (2,4-DCPM). Strain DSPFs mitigate the toxicity caused by 2,4-D to crops and also promote plant growth. This tri-functional (bioremediator-phytoprotecting-plant growth promoting) bacterium has significant potential in the eco-friendly remediation of 2,4-D in agricultural fields to prevent groundwater contamination, reduce phytotoxicity of herbicides, and enhance crop productivity.

TRIM38
Also flagged:lysosomessignal transductionubiquitintranscription factorsgene expressionlysophagy
Journal Article 2025-09-24 ✓ 1 Snippet Endo A, Takahashi C, Ishibashi N, Nishito Y, Yamano K, Tanaka K, Yoshida Y.
In-Text Gene Mentions

…and TAB2 undergoesTRIM38-mediated lysosomal degradatio…

Show Full Abstract

The lysosomal damage response is important for the maintenance of cellular homeostasis in human cells. Although the mechanisms underlying the repair and autophagic elimination of damaged lysosomes have been elucidated, the early signal transduction pathways and genes induced in response to lysosomal damage remain elusive. We performed transcriptome and proteome analyses and found that the TAB-TAK1-IKK-NF-κB axis is activated by K63-linked ubiquitin chains that accumulate on damaged lysosomes. This activates the expression of various transcription factors and cytokines that promote anti-apoptosis and intercellular signaling. The findings highlight the crucial role of ubiquitin-regulated signal transduction and gene expression in cell survival and cell-cell communication in response to lysosomal damage. The results suggest that the ubiquitin system is not only involved in the removal of damaged lysosomes by lysophagy, but also functions in the activation of cellular signaling for cell survival.

POU3F2
Also flagged:GlioblastomaGBMbrain tumorgliomalactateVRK1
Journal Article 2025-09-24 ✓ 4 Snippets Li J, Tang C, Zhang X, Xing R, Guo Q.
In-Text Gene Mentions

…such as SOX2,POU3F2, and OLIG2 can…

…CD133, NES, andPOU3F2.…

…CD133, NES, andPOU3F2(Figure S1A–E ,…

…NES , andPOU3F2in the CGGA…

Show Full Abstract

Glioblastoma (GBM) is the most malignant primary brain tumor in adults, with glioma stem cells (GSCs) as a subpopulation contributing to treatment resistance and recurrence. This study investigates the role of lactate and its regulatory gene, vaccinia-related kinase 1 (VRK1), in the regulation of GSC stemness. Utilizing multiple glioma-related databases and patient-derived GSCs, it is discovered that lactate enhances the stemness and proliferation of GSCs via VRK1. Mechanistically, lactate promotes histone lactylation (H3K18la) at the VRK1 promoter in GSCs, thereby upregulating VRK1 expression. VRK1 enhances Y-box binding protein 1 (YBX1) protein stability by inhibiting its ubiquitination and degradation, and phosphorylates YBX1 to promote its nuclear translocation, thereby regulating GSC stemness and proliferation via the YBX1/SOX2 pathway. Additionally, the VRK1-targeted nanoliposome A/TMZ-siVRK1 effectively suppresses the stemness and proliferation of GSCs, demonstrating its therapeutic potential. In conclusion, lactate regulates the stemness and proliferation of GSCs via the H3K18la/VRK1/YBX1/SOX2 pathway. This study elucidates the role of histone lactylation in stem cell regulation and suggests that VRK1 is a potential therapeutic target for GBM.

NEGR1
Also flagged:polyunsaturated fatty acidagingvisionpolyunsaturated fatty acidsmembranesmembrane
Journal Article 2025-09-24 ✓ 1 Snippet Gao F, Tom E, Rydz C, Cho W, Kolesnikov AV, Sha Y, Papadam A, Jafari S, Joseph A, Ahanchi A, Balalaei Someh Saraei N, Lyon DC, Foik A, Nie Q, Grassmann F, Kefalov VJ, Skowronska-Krawczyk D.
In-Text Gene Mentions

Negr1

Show Full Abstract

The retina is uniquely enriched in polyunsaturated fatty acids (PUFAs), primarily localized in cell membranes, where they govern membrane biophysical properties. During aging, alterations in lipid metabolism lead to reduced content of very long-chain PUFAs (VLC-PUFAs) in the retina, which is associated with normal age-related reductions in contrast sensitivity, diminished photoreceptor function and delayed rod-mediated dark adaptation recovery, and pathological age-related macular degeneration (AMD). <i>ELOVL2</i> (<i>elongation of very long chain fatty acids-like 2</i>) encodes a transmembrane protein that produces precursors to docosahexaenoic acid (DHA) and VLC-PUFAs. The methylation status of the <i>ELOVL2</i> promoter is currently one of the best predictors of chronological age. Here, we show that lower VLC-PUFA abundance in the aged mouse retina is accompanied by a reduction in visual function. Similarly, mice lacking ELOVL2-specific enzymatic activity (<i>Elovl2<sup>C234W</sup></i>) demonstrate reduced contrast sensitivity and slower rod-mediated dark adaptation. Intravitreal supplementation with the direct product of ELOVL2, 24:5n-3, in aged animals improved visual function for up to 4 weeks and reduced accumulation of APOE- and C3d-positive sub-RPE deposits. The gene expression pattern observed in supplemented retinas exhibited a partial rejuvenation profile, including decreased expression of aging-related genes and a transcriptomic signature resembling younger retinas. Last, human genetic data from the IAMDGC and UK Biobank linked two variants in the <i>ELOVL2</i> locus with the onset of intermediate AMD, underlining the translational importance of our findings. Our work highlights VLC-PUFA supplementation as a potential therapeutic opportunity and defines ELOVL2 as a promising target for interventions to prevent age-related vision loss.

TRIM38
Also flagged:apolipoprotein A-IAPOA1ribosomal proteinsliver X receptorretinoid X receptorLXR
Journal Article 2025-09-24 ✓ 1 Snippet Cho YJ, Jeong HD, Jeon YJ, Choi S, Back JH, Wi JH, Park YE, Gwak SH, Ji MJ, Park HM, Jeong H, Kim SY, Lee JE.
In-Text Gene Mentions

…in LF-S, whileTRIM38marginally decreased (Table…

Show Full Abstract

This study investigated the effects of diesel particulate matter (DPM) on multiple human organs using 3D spheroids derived from eight human primary cell types. To assess the impact of DPM, we exposed these spheroids to varying concentrations of standardized DPM (Standard Reference Material, SRM 2975) and measured their viability, followed by proteomic analysis using tandem mass tag (TMT) labeling with liquid chromatography-tandem mass spectrometry (LC-MS/MS). A total of 9,707 proteins were identified, with 128 proteins exhibiting statistically significant changes (P-value < 0.05) in response to DPM exposure, as determined by two-way analysis of variance (ANOVA). Among these, five proteins, including apolipoprotein A-I (APOA1), significantly increased at higher DPM concentrations, while 36 proteins, primarily ribosomal proteins, showed notable decreases even at lower DPM levels. Canonical pathway analysis revealed activation of acute phase response signaling, liver X receptor/retinoid X receptor (LXR/RXR), and farnesoid X receptor (FXR)/RXR pathways across all spheroid types. APOA1 was identified as a potential biomarker for DPM exposure, with increased expression potentially linked to disruption in protein degradation pathways. This study provides valuable insights into the systemic toxicity of DPM, highlighting key proteomic changes across different tissue types and identifying potential biomarkers that could be used to assess exposure levels and health risks related to particulate matter.

ECI2
Also flagged:Fatty aciddegradationSarcoidosisgranulomaschronic inflammatory diseasegranulomatous uveitis
Journal Article 2025-09-24 ✓ 1 Snippet Wu Z, Gao Y, Tan K, Yao X, Peng Q, Li W.
In-Text Gene Mentions

…ACADL, ACSL1, ACSS3,ECI2, HADH, ALDH3A2 in…

Show Full Abstract

Sarcoidosis is characterized by the proliferation of noncaseating granulomas and presents as a complex chronic inflammatory disease. It extensively affects multiple organ systems, with 30-60% of patients experiencing ocular complications, predominantly bilateral granulomatous uveitis. Fatty acid degradation, a fundamental metabolic process, is crucial for cellular energy homeostasis, involving the breakdown of fatty acids to produce acetyl-CoA, NADH, and FADH2, which then enter the citric acid cycle and electron transport chain to generate ATP. Despite its importance, the role of fatty acid degradation genes (FADGs) in the pathophysiology of Ocular sarcoidosis (OS) remains unclear. To identify candidates potentially involved in OS, we intersected differentially expressed genes (DEGs) with a curated list of 177 FADGs. Advanced methodologies, including Gene Set Enrichment Analysis (GSEA) and Gene Set Variation Analysis (GSVA), were employed to explore biological functions. Further refinement using Lasso regression and Support Vector Machine-Recursive Feature Elimination (SVM-RFE) allowed for the identification of key hub genes and assessment of their diagnostic potential for OS. Our investigation identified two FADGs, ADH1B and ECI1, closely associated with OS. Functional analyses revealed their involvement in processes such as fatty acid metabolic processes, small molecule catabolic processes, and fatty acid oxidation. Importantly, the diagnostic capabilities of these FADGs demonstrated significant efficacy in distinguishing OS from unaffected states. Through rigorous bioinformatics analyses, this study identifies ADH1B and ECI1 as novel biomarker candidates for OS, elucidating their potential roles in the disease's pathogenesis. These findings offer new insights into the molecular mechanisms underlying OS and highlight the diagnostic potential of FADGs in differentiating OS from unaffected conditions.

Also flagged:argonhydroxyapatitecrystallitebone formationelectronsblood circulation
Journal Article 2025-09-24 No Snippets Abdel Reheem AM, Desouky OS, Selim NS, Abdel-Hamid HM, El-Marakby SM.
Show Full Abstract

In this study, bovine cortical bone was investigated under plasma treatment process to investigate the potential for improvements in their structural characteristics. The bone specimens were treatment with low pressure argon cold plasma at different treatment times; 15, 30, and 45 min. Various techniques such as X-ray diffraction, scanning electron microscopy, surface roughness testing and automatic LCR Bridge were utilized to study the plasma-induced modifications on the structural and dielectric properties of the bone. SEM images revealed the elimination of some outer atoms from the bone surface during the 30-minute plasma ablation process, leading to more noticeable grain size of hydroxyapatite. XRD measurements confirmed the obtained results as mentoring the changes in crystallite size and strain parameters. As the treatment time approached 45 min, crystallite size increased, along with surface roughness parameters and relaxation time. These findings contribute to a better understanding of the microstructural and morphological changes occurring on the bone surface during cold argon plasma treatment.

RC3H1
Also flagged:multiple myelomaRASA2SOCS1CDKN1BmyelomaChimeric antigen receptor
Journal Article 2025-09-24 ✓ 2 Snippets Knudsen NH, Escobar G, Korell F, Kienka T, Nobrega C, Anderson S, Cheng AY, Zschummel M, Armstrong A, Bouffard A, Kann MC, Goncalves S, Pope HW, Pezeshki M, Rojas A, Suermondt JSMT, Phillips M, Berger TR, Park S, Salas-Benito D, Darnell EP, Birocchi F, Leick MB, Larson RC, Doench JG, Sen D, Yates KB, Manguso RT, Maus MV.
In-Text Gene Mentions

…ZC3H12A , andRC3H1conferred early growth…

RC3H1

Show Full Abstract

Chimeric antigen receptor (CAR) T cells are highly effective in haematological malignancies<sup>1</sup>. However, progressive loss of CAR T cells contributes to relapse in many patients<sup>2-4</sup>. Here we performed in vivo loss-of-function CRISPR screens in CAR T cells targeting B cell maturation antigen to investigate genes that influence CAR T cell persistence and function in a human multiple myeloma model. We tracked the expansion and persistence of CRISPR library-edited T cells in vitro and at early and late time points in vivo to track the performance of gene-modified CAR T cells from manufacturing to survival in tumours. The screens revealed context-specific regulators of CAR T cell expansion and persistence. Ablation of RASA2 and SOCS1 enhanced T cell expansion in vitro, whereas loss of PTPN2, ZC3H12A and RC3H1 conferred early growth advantages to CAR T cells in vivo. Notably, we identified cyclin-dependent kinase inhibitor 1B (encoded by CDKN1B), a cell cycle regulator, as the most important factor limiting CAR T cell fitness at late time points in vivo. CDKN1B ablation increased CAR T cell proliferation and effector function, significantly enhancing tumour clearance and overall survival. Our findings reveal differing effects of gene perturbation on CAR T cells over time and in different environments, highlight CDKN1B as a promising target to generate highly effective CAR T cells for multiple myeloma and underscore the potential of in vivo screening for identifying genes to enhance CAR T cell efficacy.

Also flagged:Parkinson diseaseMultiple System AtrophyPDribosomalmitochondrialautophagy
Journal Article 2025-09-24 No Snippets Shin JH, Ruhno KE, Shin C, Kim HJ, Nam SJ, Chung SJ, Moon JH, Kim HJ.
Show Full Abstract

To investigate transcriptomic signatures of Parkinson's disease (PD) and the Parkinsonian subtype of Multiple System Atrophy (MSA-P) in substantia nigra pars compacta (SNpc), we conducted transcriptome analysis using in-situ hybridization on paraffin-embedded SNpc tissues from post-mortem brains. The study included 2 MSA-P patients, 2 PD patients, and 2 healthy controls (HC), with 12 regions of interest (ROIs) selected from the dorsal to ventral and medial to lateral aspects of the SNpc. A total of 72 ROIs from 6 participants were analyzed, and differentially expressed genes (DEGs) were identified by comparing MSA-P, PD and HC groups. The MSA-P group showed 88 upregulated DEGs and 326 downregulated DEGs (adjusted 𝑝<0.05) compared to HC. The downregulated DEGs were significantly enriched in pathways related to ribosomal translation, immune processes, mitochondrial function, and autophagy. Notably, the dorsomedial quadrant was uniquely linked to antigen presentation, while other quadrants showed downregulation of protein synthesis. The PD group exhibited 165 upregulated DEGs and 350 downregulated DEGs (adjusted 𝑝<0.05) compared to HC, with downregulated DEGs associated with ribosomal translation, mitochondrial function, and the ubiquitin-proteasome system. In both MSA-P and PD, the upregulated DEGs were not associated with any pathways or biological process in gene enrichment analysis. In network propagation analysis, amyloid precursor protein was the most significant network hub among DEGs in both MSA-P and PD. Comparing the transcriptomic signatures of SNpc between MSA-P and PD, we found immune/inflammation, mitochondrial function and neural signaling related genes were significantly downregulated in MSA-P compared to PD. Overall, the transcriptomic signature of the SNpc in MSA-P and PD revealed overlapping but distinct features, including alterations in protein synthesis, immune processes, mitochondrial function, and protein degradation systems. Future studies with larger cohorts and functional validation are needed to further elucidate these findings.

Also flagged:synaptic vesicle protein 2Aextracellularvesiclestausynaptic proteins
Journal Article 2025-09-24 No Snippets Nussbaumer J, Barve A, Zufferey V, Espourteille J, Kirabali T, Konietzko U, Razansky D, Rominger A, Nordberg A, Buée L, Colin M, Nitsch RM, Hock C, Richetin K, Ni R.
Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is characterized by accumulation of amyloid-β (Aβ) plaques, tau neurofibrillary Tangles and synaptic dysfunction. The aim of this study was to map the distributions of synaptic vesicle protein 2A (SV2A) and other synaptic proteins in the brain and the brain-derived extracellular vesicles (BDEVs) of AD patients, analyze their associations with Aβ, tau, and the apolipoprotein E (APOE) ε4 allele, and investigate the biological role of SV2A.<h4>Methods</h4>Mass spectrometry-based proteomics of BDEVs and immunohistochemistry staining were conducted on postmortem brain samples from 57 AD patients and 48 nondemented controls. The levels of SV2A, synaptophysin (SYP), and other synaptic proteins in the brain tissues and the BDEVs, and their associations with Aβ, tau (phospho-tau and Braak stages), other proteins and the APOE ε4 allele, were analyzed.<h4>Results</h4>SV2A levels were significantly lower in AD patients than in nondemented controls, particularly in the hippocampus and entorhinal cortex. APOE ε4 carriers presented further reductions in SV2A levels compared with noncarriers. The SV2A levels in BDEVs and brain tissues were positively correlated with SYP levels and negatively correlated with Aβ and phospho-tau levels. Reductions in SV2A were associated with decreased levels of other synaptic proteins, such as synaptotagmins, GAP43, and SNAP25. SV2A emerged as a central hub with interactions with proteins from subnetworks related to synaptic vesicle formation and fusion.<h4>Conclusion</h4>SV2A levels in brain tissues and BDEVs are reduced in AD patients, particularly in those carrying the APOE ε4 allele, and are correlated with Aβ and tau pathologies. SV2A may serve as a valuable biomarker for monitoring synaptic dysfunction and progression in AD.

SERPINC1
Also flagged:Hbhemesickle cell disease pulmonary hypertensionPHHpHpx
Journal Article 2025-09-24 ✓ 1 Snippet Lucero MJ, Lisk C, Swindle D, Cendali F, Setua S, Thangaraju K, Khan A, Pak DI, O'Boyle Q, Lu S, Tolson R, Zaeske S, Khan S, Rana N, Westover N, Davizon-Castillio P, George G, Hassell K, Nuss R, Brinkman N, Gentinetta T, Niemeyer C, Cabrales P, Palmer A, D'Alessandro A, Buehler PW, Irwin DC.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

Hemolysis and the downstream consequences of cell-free hemoglobin (Hb) and heme contribute to the development of sickle cell disease pulmonary hypertension (SCD-PH). The plasma concentrations of Hb and heme scavenger proteins haptoglobin (Hp) and hemopexin (Hpx) in sickle cell patients are observed to be significantly lower than healthy donors. The unchecked exposure to Hb and heme contribute to vasculopathy and aberrant cardiac function. This is consistent with vascular remodeling co-localized within iron rich macrophages. Based on these observations in patients, we hypothesize that a joint Hb and heme scavenger approach, combining Hp + Hpx as a therapeutic will attenuate hemolysis driven SCD-PH progression in a SCD mouse model. To test the hypothesis, we utilized our validated Berk-SS mouse model of SCD-PH driven by a 10-week moderate hypoxia exposure and weekly subcutaneous administration of Hp + Hpx. At study termination, we analyzed changes in cardiopulmonary iron deposition, right ventricular and pulmonary functional parameters, and multi-omic indices associated with SCD-PH. Our data demonstrates that Hp+Hpx improves pulmonary vascular resistance and right ventricular function including stiffness, afterload, cardiac output, ventricular to vascular coupling ratio, pulmonary vascular resistance and medial hypertrophy. Histological evaluation of lung and right ventricular tissue demonstrates attenuation of cardiopulmonary pathology. Finally, a multi-omic analysis of whole lung and heart tissue demonstrates a rebalancing of proteins related to PH, iron, inflammation, and oxidative stress. This data provides strong pre-clinical evidence for the clinical study of combined Hb and heme scavenger proteins in the treatment of PH-associated SCD.

LRRC7
Also flagged:condensin Ihistonechromosomehistoneshistone chaperonechromatin
Journal Article 2025-09-24 ✓ 1 Snippet Yamamoto T, Shintomi K, Hirano T.
In-Text Gene Mentions

Condensin-mediated loop extrusion is…

Show Full Abstract

Condensin-mediated loop extrusion is thought to be one of the primary mechanisms underlying mitotic chromosome assembly. However, how this process is affected by other chromosomal proteins, such as histones, is not well understood. Our previous study showed that in Xenopus egg extracts codepleted of topoisomerase IIα and the histone chaperone Asf1, a highly characteristic chromatin structure called the "sparkler" is assembled. The sparkler is a compact structure assembled on nucleosome-free, entangled DNA in which multiple protrusions radiate from a core. Interestingly, condensin I is concentrated at the tips of the protrusions, whereas the linker histone H1.8 is enriched in the remaining regions of the structure. To understand the biophysical mechanisms underlying sparkler assembly, we construct a model predicting that DNA loops extruded from the entangled DNA undergo phase separation into two domains: loops enriched in condensin I remain as protrusions, whereas those enriched in H1.8 are reeled into the central region. We propose that H1.8 competes with condensin I for DNA binding, thereby reorganizing DNA loops formed by condensin I under this specialized condition.

RC3H1
Also flagged:VHLerythrocytosisvon Hippel-Lindau diseaseRNA-binding proteinsvon Hippel-Lindaupathogenesis
Journal Article 2025-09-24 ✓ 1 Snippet Karaghiannis V, Schmitt L, Chesnel F, Gautier EF, Leduc M, Le Gall M, Idriss S, Couvé S, Barlier A, Sarrabay G, Maaziz N, Cassinat B, Legros L, Thibaud V, Richard S, Girodon F, Miro J, Tuffery-Giraud S, Arlot Y, Gardie B.
In-Text Gene Mentions

RC3H1

Show Full Abstract

This study explores the impact of mutations in the exon 2 of the von Hippel-Lindau (VHL) gene, associated with erythrocytosis or von Hippel-Lindau disease. We analyzed 15 missense and synonymous genetic variants to assess their effects on splicing and VHL protein stability. Using in silico predictions and functional assays, we found that some specific mutations impact splicing and reduce protein stability, allowing their clinical classification as pathogenic. This study revealed exonic-splicing regulatory regions. Notably, by performing RNA-protein pull-down, we identified two RNA-binding proteins, hnRNPF and hnRNPAB, as key regulators of VHL splicing. Our findings reveal the limitations of current splicing-prediction tools in recognizing exonic-splicing enhancer (ESE) or silencer (ESS) sequences and suggest that mutations can differentially affect disease phenotypes by influencing both splicing and protein stability. These insights enhance our understanding of the molecular mechanisms underlying VHL-associated disorders and expand the landscape of regulatory elements and protein factors involved in VHL splicing regulation.

RABGAP1LSOX6
Also flagged:aginghematopoiesislipidmetabolism16Sv3-v4
Journal Article 2025-09-24 ✓ 2 Snippets Santos-Pujol E, Noguera-Castells A, Casado-Pelaez M, García-Prieto CA, Vasallo C, Campillo-Marcos I, Quero-Dotor C, Crespo-García E, Bueno-Costa A, Setién F, Ferrer G, Davalos V, Mereu E, Pluvinet R, Arribas C, Torre C, Villavicencio F, Sumoy L, Granada I, Coles NS, Acha P, Solé F, Mallo M, Mata C, Peregrina S, Gabaldón T, Llirós M, Pujolassos M, Carreras-Torres R, Lluansí A, García-Gil LJ, Aldeguer X, Samino S, Torné P, Ribalta J, Guardiola M, Amigó N, Yanes O, Martínez P, Sánchez-Vázquez R, Blasco MA, Oviedo J, Lemos B, Rius-Bonet J, Torrubiano M, Massip-Salcedo M, Khidir KA, Cao TH, Quinn PA, Jones DJL, Macip S, Brigos-Barril E, Moldes M, Barteri F, Muntané G, Laayouni H, Navarro A, Esteller M.
In-Text Gene Mentions

…for the genesRABGAP1L, TMEM43 ,…

…LSM3 , andSOX6( Table S6…

Show Full Abstract

Extreme human lifespan, exemplified by supercentenarians, presents a paradox in understanding aging: despite advanced age, they maintain relatively good health. To investigate this duality, we have performed a high-throughput multiomics study of the world's oldest living person, interrogating her genome, transcriptome, metabolome, proteome, microbiome, and epigenome, comparing the results with larger matched cohorts. The emerging picture highlights different pathways attributed to each process: the record-breaking advanced age is manifested by telomere attrition, abnormal B cell population, and clonal hematopoiesis, whereas absence of typical age-associated diseases is associated with rare European-population genetic variants, low inflammation levels, a rejuvenated bacteriome, and a younger epigenome. These findings provide a fresh look at human aging biology, suggesting biomarkers for healthy aging, and potential strategies to increase life expectancy. The extrapolation of our results to the general population will require larger cohorts and longitudinal prospective studies to design potential anti-aging interventions.

B4GALT5
Also flagged:multiple sclerosisMSparvalbuminglutamateglialfibrillary acidic protein
Journal Article 2025-09-24 ✓ 1 Snippet Anderson AM, Ajayi M, Jonak CR, Desfor S, Soto J, Akhuetie A, Deshpande D, Lapato A, Binder DK, Tiwari-Woodruff SK.
In-Text Gene Mentions

…myelin formation genes,B4galt5( p =…

Show Full Abstract

Chronic demyelination is a hallmark of multiple sclerosis (MS) and is associated with increased seizure susceptibility. In this study, we used the cuprizone (CPZ) diet induced demyelination model to investigate the progression of hippocampal demyelination and its impact on seizure activity and neurotransmitter dysregulation. Using EEG recordings, immunohistochemistry, Western blotting, ELISA, Golgi staining, and NanoString transcriptomics, we found progressive hippocampal demyelination accompanied by a striking increase in seizure incidence, from 38 % at 6 weeks to 88 % by 12 weeks. Structural degeneration of the CA1 pyramidal layer was marked by reduced dendritic arborization and loss of parvalbumin interneurons. Hippocampal glutamate levels increased as early as 3 weeks and remained elevated, with values (∼2.2 μM) reaching excitotoxic thresholds, along with astrocyte reactivity (glial fibrillary acidic protein) and downregulation of astrocytic glutamate transporter-1, and glutamate aspartate Transporter-1 and modification of aquaporin-4 in CA1. Stratum pyramidal and stratum radiatum region-specific alterations in glutamate transporters and related enzymes (glutamine synthetase, glutamic acid decarboxylase 67, vesicular glutamate transporter 1), further supported neurotransmitter imbalance. Transcriptomic profiling revealed widespread downregulation of myelin, neuronal, astrocytic, glutamatergic, and GABAergic genes at 6 weeks, with partial recovery by 12 weeks. Together, these findings establish a mechanistic link between chronic hippocampal demyelination, glutamate dysregulation, and epileptogenesis offering potential molecular targets for therapeutic intervention in MS-associated epilepsy.

Also flagged:acute kidney injurycreatinineAcute Diseaserenal anginafurosemidechronic kidney disease
Journal Article 2025-09-24 No Snippets Stanski NL, Oh J, Basu RK.
Show Full Abstract

Acute kidney injury (AKI) is common in critically ill children and neonates and imparts an increased risk for morbidity and mortality. Despite a growing recognition of the untoward consequences of AKI, its management continues to rely on supportive care alone, after numerous clinical trials have failed to identify effective disease-modifying therapies. This failure to advance the field is likely due in large part to the heterogeneity of AKI, which demands a precision approach to diagnosis and management. Despite the emergence of several novel AKI biomarkers with the ability to refine the AKI diagnosis beyond what is afforded by changes in serum creatinine and/or urine output alone, widespread translation of these biomarkers to practice has been limited. In this review, we outline a roadmap for AKI risk-stratification, diagnosis, management, and follow-up that is rooted in precision medicine principles and feasible with the tools currently available in pediatric ICUs. This roadmap highlights the importance of dynamic (as opposed to static) assessment of the critically ill child with, at-risk for, and recovering from AKI, and introduces the concept of theragnostic biomarkers that are both the target of and change with treatment, thus helping guide the therapeutic approach. Finally, we highlight the need for re-defining appropriate endpoints in AKI clinical trials testing the interventions proposed here (and others) to ensure we are identifying treatments that will meaningfully improve outcomes for critically ill children with AKI.

Also flagged:Anthracenemethacrylateoxygennanomaterialsethyl methacrylate2-cyanoethyl methacrylate
Journal Article 2025-09-24 No Snippets Bonardd S, Maiz J, Maisueche J, Verde-Sesto E, Pomposo JA.
Show Full Abstract

Dipolar glass copolymers (DGCs) incorporating 9-anthrylmethyl methacrylate (ANMA) with dipolar monomers 2-(methylsulfonyl)ethyl methacrylate (SO<sub>2</sub>MA) and 2-cyanoethyl methacrylate (CNMA) were synthesized <i>via</i> RAFT polymerization to develop high-performance dielectric materials with photo-responsive capabilities. Structural and spectroscopic analyses confirmed successful copolymer formation and anthracene incorporation, enabling ultraviolet (UV)-triggered functionalities. Thermal characterization revealed a significant increase in glass transition temperature (Δ<i>T</i> <sub>g</sub> ≈ +28 °C) compared to their homopolymer counterparts, despite a moderate reduction in thermal stability. Dielectric measurements demonstrated high permittivity and low loss factors across a broad temperature range, with distinct γ, β, and α relaxation processes identified. Upon UV irradiation, anthracene photodimerization enabled efficient intramolecular cross-linking under dilute, oxygen-free conditions, leading to the formation of discrete single-chain nanoparticles (SCNPs) as confirmed by combined UV-visible spectroscopy, size-exclusion chromatography, and dynamic light scattering analyses. We explore, for the first time, the use of programmable nanoscale architectures to develop a new generation of single-chain high-dielectric nanomaterials. These materials exhibit high permittivity, relatively low dielectric losses, and suitable thermal properties in terms of glass transition temperature. Our results show that the localized environment and the reduction of long-range entanglements, arising from the collapse of linear DGC precursors into single-chain nanoparticles, do not significantly alter the dielectric response of these entities. As a result, they provide efficient dielectric materials with potential applications in energy storage, flexible electronics, sensors, and smart materials.

HTT
Also flagged:ADHDAttention deficit hyperactivity disorderbehavioralneurodevelopmental disordersubstance abusesleep
Journal Article 2025-09-24 ✓ 1 Snippet Baby M, Priya V, Pallavi J, Karthik Chand B, Srinivasan LV, Rana SS, Tawil S, Haque S, Ghosh P, Bhattacharya P, Khan MO, Perwez SK, Ahmad F.
In-Text Gene Mentions

…receptor 1 B; 5-HTT, serotonin/5-hydroxytryptamin…

Show Full Abstract

Attention deficit hyperactivity disorder (ADHD) is a prevalent neurodevelopmental condition that persists into late adolescence and even adulthood. While a lot of research has addressed the issues of childhood ADHD, manifestation of the condition in adults, particularly females, remains largely obscure. The aim of the present narrative review is to address the sex-specific subtleties of ADHD in adolescent and adult female populations and critically analyze the various intricately complex facets of the associated comorbidities and outcomes, based upon data extracted from scholarly works indexed in online databases (eg, PubMed, Google Scholar, etc). We provide evidences refuting the presumption that ADHD primarily affects men, highlighting the complexity of clinical outcomes and comorbidities, and the consequent misdiagnosis of women as a possible reason. Comprehensive critical assessment of the multiple aspects of psycho-socio-behavioral, cognitive, and other clinical outcomes and comorbidities associated with ADHD in women indicated widespread dysfunctions and atypical characteristics. Furthermore, we also propose the probable utilities of art-based and other unconventional behavioral therapeutic regimens as alternatives and/or additives for the therapy of female ADHD cases to address case- and gender-specific needs and induce an overall improvement in their functioning. While this is not an exhaustive review of the literature, we hope that our points of discussion will generate further interest among scientists, clinicians, and caregivers to address the age and gender specificity of the condition to advance our perspectives of the condition and eventually establish novel therapeutic measures for the same.

HTT
Also flagged:neurodegenerative diseasesaquaporin 4AQP4ADPDmultiple sclerosis
Journal Article 2025-09-24 ✓ 1 Snippet Wang Y, Liu Q, Wu J, Meng K, Zhou L, Ye F.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, driving progressive…

Show Full Abstract

<h4>Background</h4>The glymphatic system is a crucial factor in the development of neurodegenerative diseases (NDs) and holds substantial promise for therapeutic strategies. However, despite its growing significance, detailed bibliometric investigations specifically targeting the interplay between the glymphatic system and NDs are still sparse. This study pioneers a comprehensive bibliometric analysis to delineate the intellectual framework and emerging trajectories in glymphatic system research associated with NDs.<h4>Materials and methods</h4>We conducted an exhaustive search of the literature on the glymphatic system and NDs using the Web of Science Core Collection (WoSCC), Scopus, and Pubmed Central (PMC) databases. VOSviewer was applied for bibliometric analysis and visualization to scrutinize geographical distribution, institutional distribution, inter-journal connections, and keyword prevalence. Additionally, CiteSpace was utilized to intuitively explore and analyze journal interactions and citation dynamics. The bibliometrix R package was employed to construct visualized networks of international collaborations, as well as the relationships among authors, keywords, and journals. Data visualization was further enhanced with the aid of the WPS Office.<h4>Results</h4>A total of 865 relevant publications were retrieved, covering 92 countries, 1,471 research institutions, and 367 academic journals. Over the past thirteen years, both the number of publications and citations related to the glymphatic system in NDs have shown a significant upward trend, with neuroscience being the primary research field. Chinese authors over the world published the largest number of articles, while China and United States rank the highest in terms of publication and citation counts, also both demonstrate extensive international collaboration. And the <i>Frontiers series journal</i> publishes the most papers in this field, while <i>Brain</i> is the most frequently cited journal. The University of Rochester is the top-producing institution with an internally well-known Chinese research group. Keyword analysis highlights the glymphatic system, Alzheimer's disease (AD), cerebrospinal fluid, and aquaporin 4 (AQP4) as core topics, with AQP4 polarization identified as a key regulatory factor for metabolic waste clearance. The main NDs under investigation are AD and Parkinson's disease (PD).<h4>Conclusion</h4>This study offers a comprehensive preliminary dissection of the research landscape, identifying current focal points and potential future directions in glymphatic system research related to NDs. By leveraging multiple bibliometric approaches, this study provides valuable insights into this burgeoning field.

OLFM4
Also flagged:zinczinc transportersinflammatory bowel diseasesSLC39ZIPSLC30
Journal Article 2025-09-24 ✓ 1 Snippet Mitchell SB, Aydemir TB.
In-Text Gene Mentions

…a decrease inOlfm4+ stem cells…

Show Full Abstract

The inflammatory bowel diseases (IBD), including Crohn's Disease and Ulcerative Colitis, are chronic, incurable disorders of the gastrointestinal tract. These multifactorial diseases pose an enormous burden on patients, clinicians, and public health systems worldwide. Zinc (Zn) is an essential micronutrient that is required for a wide variety of functions critical to maintaining gastrointestinal health. Zn homeostasis is facilitated by the SLC39/ZIP and SLC30/ZnT families of solute carrier proteins, which collectively distribute Zn with subcellular specificity. Disruptions in Zn homeostasis can have substantial impacts on health, as recent years have seen Zn transporters become increasingly recognized for their importance in health and disease. Although dietary Zn deficiency is rare in the United States, Zn deficiency is common among IBD patients. Disruptions in Zn homeostasis have also been shown to play a role in the progression of IBD. Despite these links, Zn supplementation trials in IBD have shown inconsistent results. This review focuses on the role of Zn and Zn transporters in the development, progression, and treatment of IBD, as well as discussing the challenges and potentially promising future of the study of Zn and Zn transporters in precision health.

HFE
Also flagged:restrictive cardiomyopathyheart muscle diseaseTransthyretintafamidistransthyretin amyloid cardiomyopathyATTR
Journal Article 2025-09-24 ✓ 1 Snippet Deng B, Liu W.
In-Text Gene Mentions

…amyloidosis, sarcoidosis, orhemochromatosis( 3 ).…

Show Full Abstract

Restrictive cardiomyopathy (RCM) is a rare form of heart muscle disease characterized predominantly by diastolic dysfunction and restrictive filling, for which no guideline-supported pharmacological treatment currently exists. We reviewed the clinical trial landscape for RCM to identify emerging therapeutic strategies and trends. Using the TrialTrove database, we identified 63 RCM-related clinical trials (2007-2024) after excluding studies of standard therapies or unrelated conditions. Our analysis shows that research interest in RCM has remained modest but steady, with many trials in early (Phase I) and late (Phase III/IV) stages. Transthyretin stabilizers, particularly tafamidis, accounted for a significant portion of these trials and have demonstrated improved cardiac function and outcomes in transthyretin amyloid cardiomyopathy (ATTR-CM). In addition, novel disease-modifying approaches - including antisense oligonucleotides, RNA interference therapies, and gene-editing strategies - are being explored in clinical trials, reflecting a shift towards targeted treatment of underlying causes. Approximately half of the identified trials have been completed, though a few were terminated early due to insufficient efficacy. These findings highlight a dynamic and evolving therapeutic landscape in RCM. While tafamidis has substantially advanced ATTR-CM management, emerging RNA-silencing and gene therapy techniques hold promise to address the unmet needs in RCM, warranting further large-scale studies to validate their safety and efficacy.

Also flagged:diabetic cardiomyopathyheart diseasediabetesmyocardial fibrosisdeathmetabolic disorders
Journal Article 2025-09-24 No Snippets Guan Y, Han Q, Wang M, Xu J, Liu X.
Show Full Abstract

Diabetic cardiomyopathy (DCM) is a specific form of heart disease induced by diabetes, characterized by myocardial fibrosis, oxidative stress, metabolic dysregulation, and cardiomyocyte death. In recent years, circular RNAs (circRNAs), a novel class of non-coding RNAs, have gained increasing attention due to their unique covalently closed structure, high stability, and critical regulatory roles in various diseases. While extensive studies have been conducted on microRNAs (miRNAs) and long non-coding RNAs (lncRNAs) in the context of DCM, research on circRNAs remains relatively limited and fragmented. Existing reviews often focus on specific aspects without providing a systematic and comprehensive overview. This review aims to summarize the current progress in circRNA research related to DCM, with a particular focus on the molecular mechanisms and regulatory networks through which circRNAs influence metabolic disorders, oxidative stress, myocardial fibrosis, and programmed cell death. In addition, the potential of circRNAs as diagnostic biomarkers and therapeutic targets is evaluated, along with an in-depth discussion of current challenges and future research directions. This work is intended to offer theoretical insights and reference value for both fundamental and translational studies of circRNAs in DCM.

Also flagged:Isoliquiritigeninangiogenesiswound healingdiabeteschitosananthocyanin
Journal Article 2025-09-24 No Snippets Xue H, Zhang C, Lin D, Gu Q, Sun C, Lin X, Zhang C, Lei L, Liu L.
Show Full Abstract

Chronic inflammation, oxidative stress, and insufficient angiogenesis hinder wound healing in patients with diabetes, necessitating long-term management strategies. In this study, we developed pH-responsive hydrogel microneedles (LSI-GCA) based on <i>Lycium barbarum</i> polysaccharide stearate micelles that could achieve real-time pH monitoring and intelligent drug release for effective wound management. LSI-GCA was prepared through hydrophobic modification and isoliquiritigenin (ISO) loading, followed by its combination with a chitosan/anthocyanin backing layer. LSI-GCA exhibited excellent biocompatibility and antibacterial and antioxidant properties by activating the NRF2 pathway and inhibiting pro-inflammatory factors. Animal experiments confirmed that LSI-GCA significantly accelerated wound healing in a diabetic model and promoted angiogenesis, collagen deposition, and M2 macrophage polarization. Genomic and network pharmacological analyses revealed a multi-target synergistic mechanism involving the modulation of EGFR/VEGF signaling to promote proliferation, inhibition of inflammatory pathway (NF-κB), and repair of DNA damage through upregulation of BRCA1/2. This study provides an integrated "monitoring-treatment" strategy for diabetic wounds, offering great potential for clinical transformation and personalized treatment.

HTT
Also flagged:Neurodegenerative Diseasesamyotrophic lateral sclerosissynthesistranslationaltriggering receptor expressed on myeloid cells 2TREM2
Journal Article 2025-09-24 ✓ 5 Snippets Vishnumukkala T, Che Mohd Nassir CMN, Hein ZM, Kalerammana Gopalakrishna P, Karikalan B, Alkatiri A, Jagadeesan S, Naik VR, Thomas W, Mohd Moklas MA, Kamaruzzaman MA.
In-Text Gene Mentions

…the Huntingtin (HTT) gene results…

…stretch in theHTTprotein.…

…The mutantHTT(mHTT) protein is…

…expansion in theHTTgene leads to…

…tract in theHTTprotein, which undergoes…

Show Full Abstract

Neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease, multiple sclerosis, and amyotrophic lateral sclerosis share converging mechanisms of neuronal dysfunction, including protein aggregation, oxidative stress, and chronic neuroinflammation. Glial cells, once considered passive supporters, are now recognized as central drivers of these processes, offering both pathogenic triggers and therapeutic opportunities. Yet, despite compelling preclinical evidence, the translation of glial-targeted therapies into clinical success has been limited. This review provides a critical synthesis of current knowledge by examining therapeutic strategies through the lens of their translational challenges and failures. This narrative review highlights how interspecies variability of glial phenotypes, shifting neuroprotective versus neurotoxic states, limited biomarker stratification, and delivery barriers have constrained trials, such as anti-triggering receptor expressed on myeloid cells 2 (anti-TREM2) antibodies in AD and glial cell line-derived neurotrophic factor (GDNF) in PD. By analyzing these obstacles across major neurodegenerative disorders, this review argue that the next stage of glial medicine requires precision approaches that integrate stage-specific phenotyping, biomarker-guided patient selection, and innovative delivery platforms. Understanding not only what has been tried but why translation has stalled is essential to chart a roadmap for effective, disease-modifying glial therapies in the aging brain.

Also flagged:Peripheral nerve injuriesautonomic dysfunctionautonomic disordersdiseases of the nervous systemdiabetesperipheral neuropathy
Journal Article 2025-09-24 No Snippets Piotrzkowska D, Siwak M, Adamkiewicz J, Dziki L, Majsterek I.
Show Full Abstract

Peripheral nerve injuries (PNIs) present significant clinical challenges, often leading to severe motor, sensory, and autonomic dysfunction, with profound impacts on patient quality of life and considerable healthcare costs. This review synthesizes current knowledge on the therapeutic potential of Pulsed Electromagnetic Fields (PEMF) and Low-Intensity Pulsed Ultrasound (LIPUS) as non-invasive modalities for promoting peripheral nerve regeneration. We explore their cellular and molecular mechanisms of action, discuss optimal treatment parameters, and present evidence from preclinical and clinical studies, including their synergistic effects with other therapies and emerging applications beyond neurological repair. Clinical studies have shown that PEMF therapy can significantly reduce neuropathic pain and improve functions, whereas LIPUS demonstrates the ability to enhance nerve conduction.

NEGR1
Also flagged:agingTERTmatrix proteinssecretionproteasesinnervation
Journal Article 2025-09-24 ✓ 2 Snippets Karagyaur M, Primak A, Basalova N, Monakova A, Tolstoluzhinskaya A, Kulebyakina M, Chechekhina E, Skryabina M, Grigorieva O, Chechekhin V, Yakovleva T, Turilova V, Shagimardanova E, Gazizova G, Vigovskiy M, Kulebyakin K, Sysoeva V, Dyachkova U, Dzhauari S, Bozov K, Popov V, Akopyan Z, Efimenko A, Kalinina N, Tkachuk V.
In-Text Gene Mentions

…SDF-1, neuregulins, TCN2,NEGR1, HDGF, CTGF, PEDF,…

…on-Derived Neurotrophic FactorNEGR1Neuronal Growth Regulator…

Show Full Abstract

The secretome of mesenchymal stromal cells (MSCs) can efficiently stimulate regeneration and therefore is a tempting remedy for "cell-free cellular therapy". However, the usage of primary MSC cultures as secretome producers for translation studies has obvious obstacles, including the rapid aging of MSC cultures, the need for a large number of verified donors, and donor-to-donor variability of secretome content. MSCs immortalization makes it possible to overcome those limitations and to obtain secretome-producing cultures with a prolonged lifetime. However, the efficacy and safety of such secretomes are critical issues that limit their usage as therapeutic agents. In this study, we tested in large detail how the immortalization of MSC cultures affects the content, biological activity and safety of their secretome. MSCs immortalization via the overexpression of human <i>TERT</i> gene does not significantly alter the qualitative and quantitative composition of their secretome or its activity according to the results of proteomic analysis, ELISA, qPCR and functional tests in vitro. Moreover, we have demonstrated that the secretome of immortalized MSCs does not contain detectable amounts of telomerase and does not possess any transforming activity. Altogether, our data suggest that immortalized MSC cultures may become a reliable source for obtaining standardized active secretome in large-scale quantities for clinical use.

HTT
Also flagged:Bisphenol ABisphenol SLactationcognitive deficitsmood disordersbisphenol
Journal Article 2025-09-24 ✓ 5 Snippets Semeão KA, Dutra-Tavares AC, Ribeiro-Carvalho A, Isnardo-Fernandes J, Lopes LD, Souza GSM, Nunes-Freitas AL, Silva BS, Filgueiras CC, Manhães AC, Lisboa PC, Abreu-Villaça Y.
In-Text Gene Mentions

…presynaptic 5-HT transporter (5-HTT)] were assessed.…

…with the presynaptic5-HTT[ 93 ],…

…[3H]paroxetine binding to5-HTT, and for membrane…

…to the presynaptic5-HTTwas evaluated with…

…to the presynaptic5-HTT, incubations lasted for…

Show Full Abstract

Considering the increased risk of cognitive deficits and mood disorders programming associated with bisphenol exposure, we used a preclinical model to identify short- and long-term effects of early exposure to Bisphenol A (BPA) and its replacement, Bisphenol S (BPS), on the central cholinergic and serotonergic systems. Wistar female and male rats born to dams exposed to BPA or BPS (both at 10 μg/kg/day or 50 μg/kg/day) during pregnancy and lactation were euthanized at weaning or adulthood. Cholinergic and serotonergic biomarkers were assessed in the frontal cortex and pons + medulla oblongata. BPA and BPS disrupted these systems, with outcomes depending on the specific bisphenol, biomarker, and time point. Effects also varied across brain regions and between sexes. The nicotinic cholinergic receptor showed more pronounced alterations than the presynaptic choline transporter. Both serotonergic receptors-5-HT1AR and 5-HT2R-were affected; however, the serotonergic transporter remained unchanged. Increased binding was the predominant effect for both systems. Maternal exposure to BPA, even at low doses, induces sex-dependent short- and long-term changes in the cholinergic and serotonergic systems of the progeny. BPS affects these same neurotransmitter systems, although leading to compound-specific outcomes. These results pose both BPA and BPS as neurotoxicants that compromise neurodevelopment and program disorders later in life.

Also flagged:TumorOsteosarcomaOSbone-basedcancersarcoma
Journal Article 2025-09-24 No Snippets Schmidt AA, Prasad A, Huisman AR, Wakefield MR, Fang Y.
Show Full Abstract

Osteosarcoma (OS) is the most common bone-based cancer in both the US and the world in children, teenagers, and young adults. It is an aggressive form of sarcoma which forms mainly in the long bones of the legs and arms, often metastasizing prior to diagnosis. Every year across the globe, there are approximately 28,000 new cases, yet this sarcoma remains difficult to manage with standard treatments, partly due to its solid and immune resistant tumor microenvironment (TME). The quantity of research conducted on OS because of these difficulties has greatly increased over the past decade, meaning a comprehensive review of new findings on the TME may prove beneficial. This article aims to give a broad overview of the components of the TME of osteosarcoma, discuss its resistances and detrimental effects, and illustrate current and future immune therapy treatments which effectively target the microenvironment. Additionally, it will seek to highlight any knowledge gaps in the current literature and propose further studies to improve clinical outcomes. These studies could be beneficial in increasing drug and treatment efficacy for OS.

Also flagged:immunoglobulin Eatopic dermatitisADantibodiespathogenesisatopic diseases
Journal Article 2025-09-24 No Snippets Do HTT, Luong TTM, Ziersch A, Doanh LH.
Show Full Abstract

Background In atopic dermatitis (AD), allergen-specific IgE (sIgE) antibodies is considered to play an important role in the disease's pathogenesis and could be used to identify triggers. However, the association between sIgE and clinical and sub-clinical characteristics of AD varies according to different allergens and different countries. Aim This study aims to assess sIgE antibodies and their association with clinical and sub-clinical characteristics of Vietnamese children with AD. Methods This descriptive cross-sectional study was conducted among 160 children aged 2 to 12 years old, diagnosed with AD based on Hanifin and Rajka's criteria. sIgE antibodies were measured by the EUROLINE Immunoblot test. Results sIgE positivity to at least one allergen was detected in 119 out of 160 (74.4%) children. The top two positive allergens were food allergens (88/160, 55%), and house dust mite allergens (64/160, 40%). sIgE antibodies were more often positive in children with a high tIgE level (p=<0.001), children with a family history of atopic diseases (p=<0.001), and children with moderate and severe AD (p=0.037). sIgE positivity to food allergens was more common in children in the younger age group than children in the middle and oldest age groups (p=<0.001), while sIgE positivity to house dust mite allergens was more common in children in the older age group (p=0.025). Food allergens were more often positive with moderate and severe AD (p=0.01). Limitations The participants did not represent all children with AD attending the National Hospital of Dermatology and Venereology, as we used a convenience sample and excluded those whose parents/guardians declined to participate. In addition, some information, such as medical history, was only obtained from the parent/guardian report. This information may lack reliability. Conclusions Given the high incidence of sIgE antibody positivity and its association with family history of atopic diseases, age, disease severity, and tIgE in Vietnamese children with AD, it would be worthwhile to assess allergen-specific IgE antibodies when there is clinical suspicion of an allergen trigger to advise on allergen avoidance for preventing the exacerbation of AD.

HFE
Also flagged:Gastrointestinal Stromal Tumorsmesenchymal neoplasmstumorGISTtumorstyrosine kinase
Journal Article 2025-09-24 ✓ 1 Snippet Ramkumar S.
In-Text Gene Mentions

…breast carcinoma (pT1),hemochromatosis, hypothyroidism, and sleep…

Show Full Abstract

Gastrointestinal stromal tumors (GISTs) are very common mesenchymal neoplasms involving the gastrointestinal tract. Despite having a uniform nuclear morphology, they can show varied histological subtypes. The prognosis is based on tumor size, mitotic rate and location of the tumor. Some cases of GIST can however show marked nuclear pleomorphism. Here we report a case of GIST with marked nuclear pleomorphism without other high-grade features. This case highlights the importance of nuclear pleomorphism and its implications in the perspective of existing prognostic criteria.

Also flagged:ciprofloxacintetracyclinecampylobacteriosisinfectionCampylobacter infectionbacterial diseases
Journal Article 2025-09-24 No Snippets Bulgan E, Byambajav Z, Naranchimeg B, Chantsal B, Bolormaa T, Sandagdorj B, Nyam-Osor P, Kikuchi E, Suzuki A, Toyting-Hiraishi J, Sato T, Horiuchi M.
Show Full Abstract

Poultry and cattle are the major reservoirs of <i>Campylobacter</i> infection in humans. However, no information is available on <i>Campylobacter</i> spp. in cattle in Mongolia. Thus, this study aimed to assess their prevalence and antimicrobial resistance. Between 2019 and 2023, rectal swabs were collected from cattle on dairy farms around Ulaanbaatar city and in total, 35 <i>Campylobacter</i> spp., including 23 <i>C. jejuni</i>, 7 <i>C. hyointestinalis</i>, 4 <i>C. fetus</i>, and 1 <i>C. lari</i>, were isolated. Multilocus sequence typing of <i>C. jejuni</i> cattle isolates revealed substantial genetic diversity and identified 7 sequence types (STs) including ST61, which is known to be associated with cattle and sheep. Interestingly, the antimicrobial resistance patterns of the <i>C. jejuni</i> cattle isolates completely differed from those of previously reported chicken isolates. Excluding one ciprofloxacin-resistant isolate, all isolates were susceptible to tetracycline and ciprofloxacin. This is the first report on the characterization of <i>Campylobacter</i> spp. in cattle in Mongolia. Although no official statistics of human campylobacteriosis are currently available in Mongolia, data on <i>Campylobacter</i> spp. in food-producing animals represent valuable information for investigating potential sources and infection routes to humans.

PRDX6
Also flagged:Lipidoxygencystineglucosemitochondriaendoplasmic reticulum
Journal Article 2025-09-24 ✓ 1 Snippet Kanner J, Shpaizer A, Tirosh O.
In-Text Gene Mentions

…2-related factor 2,PRDX6: peroxiredoxin 6, PDSS:…

Show Full Abstract

Animal slaughtering causes the cessation of oxygen delivery and that of nutrients such as cystine, glucose and others to muscle cells. In muscle cells, the changes in oxygen level and pH cause mitochondria, the endoplasmic reticulum, xanthine oxidase and uncoupled NOS to increase the level of O<sub>2</sub><sup>•-</sup>, affecting the generation of H<sub>2</sub>O<sub>2</sub> and the release of iron ions from ferritin. The activation of enzymes that remove and dislocate fatty acids from the membrane affects the sensitivity of muscle cells to peroxidation and ferroptosis. Increasing PUFAs in membrane phospholipids, by feeding animals a diet high in w-3 fatty acids, is a driving factor that increases lipid peroxidation and possible muscle ferroptosis. The activation of lipoxygenases by ROS to Fe<sup>3+</sup>-lipoxygenase increases hydroperoxide levels in cells. The labile iron pool generated by a "redox cycle" catalyzes phospholipid hydroperoxides to generate lipid electrophiles, proximate executioners of ferroptosis. Ferroptosis in food muscle cells is protected by high concentrations of vitamin E and selenium. In fresh muscle cells, glutathione peroxidase (GSH-PX) and other endogenous antioxidant enzymes are active and prevent lipid peroxidation; however, muscle heating eliminates enzymatic activities, making cells prone to high non-enzymatic lipid peroxidation. In muscle cells, coupled myoglobin and vitamin E act as a hydroperoxidase, preventing the generation of lipid electrophiles. Free iron ion chelators or effectors such as deferoxamine, EDTA, or ceruloplasmin are strong inhibitors of muscle cell lipid peroxidation, proving that muscle ferroptosis is mostly dependent on and catalyzed by the labile iron redox cycle.

Also flagged:obesitymetabolismPathogenesisNeurodegenerative Diseasesdopaminebrain development
Journal Article 2025-09-24 No Snippets Srokowska M, Żwierełło W, Wszołek A, Gutowska I.
Show Full Abstract

The global rise in high-fat diet (HFD) consumption and obesity has raised concerns about their long-term effects on brain health. This review addresses how HFDs, including ketogenic diets (KDs), influence the central nervous system (CNS) and may contribute to neurodegenerative processes. The findings show that prolonged HFD exposure is associated with altered brain metabolism, increased oxidative stress, neuroinflammation, and impaired synaptic plasticity, particularly in regions like the hippocampus and hypothalamus. These changes may affect cognitive function and accelerate neurodegenerative mechanisms linked to disorders such as Alzheimer's and Parkinson's disease. While certain types of KD appear to exert neuroprotective effects-such as improved motor outcomes in experimental Parkinson's disease models-evidence remains inconsistent, and concerns about their long-term safety persist. This review emphasizes that the impact of high-fat nutrition on the CNS depends on fat type, exposure duration, and individual factors such as age and sex. Overall, further research is needed to distinguish between harmful and potentially therapeutic dietary fat patterns and to better understand their influence on brain health across the lifespan.

HFE
Also flagged:APOC3ESR2MMP1lipodystrophypathogenesispolymerase
Journal Article 2025-09-23 ✓ 3 Snippets Soares da Silva A, Do Socorro de Mendonça Cavalcanti M, Furtado de Mendonça Belmont T, de Alencar Ximenes RA, da Nóbrega DN, Dos Santos Souza R, Farias ICC, Do Ó KP, Silva Vasconcelos LR, Diniz GTN, de Barros Miranda Filho D.
In-Text Gene Mentions

…(rs2854116), ESR2 (rs3020450),HFE(rs1799945), and MMP1…

…OC3-rs2854116, ESR2-rs3020450,HFE-rs1799945 and MMP1-rs1799750 …

…association between APOC3,HFE, and MMP1 polymorphisms…

Show Full Abstract

<h4>Background</h4>The pathogenesis of lipodystrophy in people living with HIV (PLWHIV) receiving antiretrovirals appears to be multifactorial and may involve genetic factors; however, it is not yet fully understood. We verified the association between single nucleotide polymorphisms in the APOC3-rs2854116, ESR2-rs3020450, HFE-rs1799945 and MMP1-rs1799750 genes and lipodystrophy and its subtypes in PLWHIV receiving antiretroviral.<h4>Methods</h4>Design: cross-sectional study. Lipodystrophy definition was based on self-report. Genotyping of the polymorphisms was performed using real-time polymerase chain reaction.<h4>Results</h4>Lipodystrophy was reported in 204/404 participants (51%), being 89/204 with mixed lipodystrophy, 72/204 with lipohypertrophy, and 43/204 with lipoatrophy. There was no association between APOC3, HFE, and MMP1 polymorphisms and lipodystrophy. The frequency of AA genotype (<i>p</i>=0.004/OR=3.33/CI=1.52-7.29) and of A allele (<i>p</i>=0.031/OR=1.72/CI=1.08-2.75) of the ESR2 polymorphism was higher in individuals with lipoatrophy compared to those without lipodystrophy. In the multivariate analysis, viral load >40copies/mL (<i>p</i>=0.037/OR=2.52/CI=1.03-6.91) and current use of zidovudine (<i>p</i>=0.007/OR=2.97/CI=1.32-6.54) were associated with lipoatrophy.<h4>Conclusion</h4>Participants with lipoatrophy had higher frequency of the AA genotype and the A allele of the ESR2-rs3020450 polymorphism. In addition, viral load >40 copies/mL and current use of zidovudine were associated with lipoatrophy, suggesting a potential involvement of this genetic variant in the pathogenesis of lipoatrophy in PLWHIV receiving antiretroviral.

Also flagged:Pulmonary Fibrosischronic diseasesfibrosisCD47tissue remodelingpirfenidone
Journal Article 2025-09-23 No Snippets Cho IS, Yaghmour A, Joshi A, Gupta P, Sanborn MA, Zappia MP, Wong SW, Cheng G, Frolov MV, Rehman J, Shin JW.
Show Full Abstract

The innate immune system plays a dual role in both mediating pathogenic processes following tissue damage and acting as a barrier to effective therapeutic delivery. Strategies that evade immune clearance while modulating host immune components offer promising solutions for treating complex chronic diseases, such as fibrosis. Here, an innate immune checkpoint material-based strategy is presented in which mesenchymal stromal cells, coated with a soft conformal microgel and functionalized with the CD47 self-marker agonist, effectively evade clearance by tissue resident macrophages. These engineered cells reverse persistent fibrotic damage in the lungs through a paracrine mechanism. Single-cell RNA sequencing identifies a transitional antigen-presenting macrophage subpopulation that mediates these reparative effects. By combining immune cloaking with the presentation of local signals encoded in the gel coatings, this strategy can be used to design secretory cells for long-term tissue remodeling, enabling a living pharmacy for chronic tissue damage.

Also flagged:Huntington's Diseaseneurodegenerative disorderHDcognitive declineMovement DisordersMovement Disorder
Journal Article 2025-09-23 No Snippets Yao J, Feng G, Shao G, Wang Z, Mendizabal A, Telesca D, Fang K, Ibragimova L, Shoaib J, Morrison MA, Lupo JM.
Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a cytosine-adenine-guanine (CAG) repeat expansion in the huntingtin gene. The disease exhibits sex-related differences in symptomatology and disease progression, but the effect on brain structural biomarkers and the interaction between sex and CAG-age product score (CAPS), a widely used index combining the effect of CAG expansion and age, remains underexplored.<h4>Objective</h4>The aim of this study was to investigate the interplay between sex and CAPS on clinical measures and neuroimaging biomarkers in HD.<h4>Methods</h4>We retrospectively analyzed data from Enroll-HD, TRACK-HD/ON, PREDICT-HD, and IMAGE-HD studies, including a combined dataset of 19,738 participants with CAG ≥ 40. Linear mixed models were employed to evaluate the influence of sex and the sex-CAPS interaction on clinical evaluations, including Unified HD Rating Scale (UHDRS) UHDRS and Problem Behaviors Assessment, and neuroimaging biomarkers (striatal volumes and cortical thickness), while controlling for covariates.<h4>Results</h4>Female participants exhibited less pronounced striatal atrophy and cortical thinning with increasing CAPS (caudate: βmale/female = -3.449/-2.931, P = 0.05; putamen: βmale/female = -4.770/-3.902, P < 0.01). Regarding clinical measures, females experience greater motor decline with increasing CAPS (total motor score: βmale/female = 3.008/3.230, P < 0.0001), greater cognitive decline (symbol digit modalities test: βmale/female = -34.52/-38.57, P < 0.0001), and greater functional decline (total functional capacity: βmale/female = -6.413/-6.783, p < 0.05; Independence Scale: βmale/female = -32.26/-34.85, P < 0.001).<h4>Conclusions</h4>The sex-CAPS interaction significantly impacts both clinical and neuroimaging biomarkers of HD, underscoring the importance of incorporating sex-specific considerations into the clinical staging and management of HD. © 2025 The Author(s). Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

DCC
Also flagged:Colorectal CancercancersplatinumoxaliplatinagingCIPN
Journal Article 2025-09-23 ✓ 1 Snippet Kee JX, Yau JNN, Kumar Muthuramalingam RP, Wang X, Chng WH, Lopez-Sanchez A, Tay KKW, Deng LW, Gibson D, Bertrand HC, Adriani G, Ang WH, Pastorin G.
In-Text Gene Mentions

…suppressor genes likeDCC, MDD, p53 ,…

Show Full Abstract

Colorectal cancer (CRC) remains a significant global health challenge, ranking third in incidence and second in mortality among cancers worldwide. This review addresses the complex landscape of CRC, focusing on incidence, mortality trends, preventive strategies, and the evolving therapeutic approaches, particularly highlighting the role of platinum-based drugs like oxaliplatin (OXP). It also underscores the increasing burden of CRC, with factors such as westernized diets, aging populations, and genetic predispositions contributing to its prevalence. Therapeutically, early detection greatly enhances survival rates, emphasizing the importance of regular colonoscopies and stool tests. For advanced CRC, chemotherapy remains pivotal, with OXP as a cornerstone treatment despite its associated chemotherapy-induced peripheral neurotoxicity (CIPN). The review explores innovative strategies to overcome challenges related to chemotherapy, such as drug resistance and side effects, highlighting recent developments in the field, such as Pt(IV) prodrugs and immunotherapeutic approaches to enhance efficacy while minimizing toxicity. Additionally, this manuscript examines experimental models for drug screening, emphasizing the role of murine models and advanced 3D <i>in vitro</i> systems in CRC research. Overall, the review advocates for a comprehensive approach, integrating prevention, early detection, and personalized treatments to alleviate the global burden of CRC.

HTT
Also flagged:Huntingtinneurodegenerative diseasesAlzheimer'sADParkinson'sPD
Journal Article 2025-09-23 ✓ 5 Snippets Ezeigbo E, Keith K, Ellis ZL, Pebley K, Girman T, Adewoye A, Stonebraker AR, Biswas PK, Legleiter J.
In-Text Gene Mentions

…populations of huntingtin (htt) aggregates <i>in vitro.</i>…

Httoligomers were identified…

…Nonaggregatedhttand fibrils did…

…methods to manipulatehttoligomers were then…

…Chemically cross-linkinghttoligomers reduced their…

Show Full Abstract

Many neurodegenerative diseases, including Alzheimer's (AD), Parkinson's (PD), and Huntington's disease (HD), are associated with proteinaceous deposits in the brain comprising amyloid. The aggregation process leading to these deposits proceeds through a variety of intermediates, i.e., oligomers and fibrils. The heterogeneity of aggregates produced complicates the assignment of specific toxic functions to distinct aggregate species. Here, a simple centrifugation strategy was employed to produce well-characterized and relatively homogeneous populations of huntingtin (htt) aggregates <i>in vitro.</i> After characterization of the resulting aggregate populations, <i>C. elegans</i> were exogenously exposed to these different aggregates species to assess their impact on worm viability. Htt oligomers were identified as the most acutely toxic aggregate form. Nonaggregated htt and fibrils did not significantly reduce <i>C. elegans</i> viability. A variety of methods to manipulate htt oligomers were then tested to demonstrate the ability to modify oligomer toxicity in this model system. Chemically cross-linking htt oligomers reduced their toxicity, suggesting that structural flexibility is important in oligomer toxicity. Stabilizing oligomers with truncated peptides based on the first 17 N-terminal amino acids (Nt17) impacted toxicity when specific acetylation-mimicking point mutations were introduced. Nt17-derived peptides without any mutations did not alter toxicity; however, the addition of acetylation-mimicking mutations toward the C-terminus of the peptide reduces toxicity. Finally, two small molecules that modify htt aggregation, EGCG and riluzole, were tested for their impact on oligomer toxicity. In general, this approach provides a simple method to investigate and manipulate the toxicity of aggregate subpopulation in a quasi-controlled manner.

TNFSF4
Also flagged:chronic inflammatory skin diseasepustular psoriasispsoriasisIL-17pathogenesisantibodies
Journal Article 2025-09-23 ✓ 3 Snippets Do TH, Bogle R, Zhang H, Xing X, Gharaee-Kermani M, Raducu M, Fox J, Jiang R, Plazyo O, Harms PW, Nakamura M, Xing E, Gilliet M, Billi AC, Kahlenberg JM, Modlin RL, Uluckan O, Tsoi LC, Gudjonsson JE.
In-Text Gene Mentions

…primary antibodies againstTNFSF4(Thermo Fisher Scientific,…

…its ligand OX40L (TNFSF4) is well documented…

…icance of OX40/OX40L (TNFRSF4/TNFSF4) and GITR/GITRL (TNFRSF18/TNF…

Show Full Abstract

Palmoplantar pustulosis (PPP) is a chronic inflammatory skin disorder marked by erythematous pustules and desquamation on the palms and soles. While IL-17 pathways are implicated in PPP, IL-17 blockers have shown modest efficacy, underscoring the need for a deeper understanding of IL-17 involvement. To dissect the cellular and spatial architecture of PPP, we performed single-cell RNA-Seq (scRNA-Seq) on lesional, nonlesional, and healthy acral skin to examine cellular composition, transcriptomic profiles, and cell-cell interactions. Unbiased clustering revealed 9 major cell types, including an inflammatory keratinocyte subset enriched in IL-17A/TNF signatures and marked by high IL-36G expression. Within the lymphocyte compartment, we identified a hybrid "regTh17" population coexpressing regulatory markers (FOXP3, CTLA4, TIGIT), IL17F, and IL26. This regTh17 subset was distinguished by elevated IL1R1 and CD39, suggesting an IL-1β-driven differentiation. Spatial analyses demonstrated significant neighborhood enrichment of regTh17 cells with IL-36G+ supraspinous keratinocytes. RegTh17 cells were the predominant source of IL-17F and IL-26 signals, whereas keratinocytes were predicted as their main receivers. We further observed regTh17 coexpressing TNFRSF4 (OX40) and TNFRSF18 (GITR) specifically at sites of IL36G+ keratinocyte interactions, implicating these pathways in amplification of the IL-17/IL-36 inflammatory loop. Together, our integrated single-cell and spatial profiling uncovers Th17 plasticity in PPP, identifies a regTh17-keratinocyte interaction, and highlights IL-17F, IL-26, OX40/OX40L, and GITR/GITRL as candidate targets for precision therapies in this challenging disease.

HTT
Also flagged:Serotonin transportermethylationcortisolstress-related disordersMental disorderspathogenesis
Journal Article 2025-09-23 ✓ 1 Snippet Czernin NS, Seuling PD, Zillich L, Hummel E, Salvador ÓC, Pauli P, Reif A, Deckert J, Domschke K, Schiele MA.
In-Text Gene Mentions

…transporter gene (SLC6A4,5-HTT) are associated with…

Show Full Abstract

Mental disorders arise through the interaction of genetic predisposition and environmental influences such as stress. Epigenetic processes, like DNA methylation, could represent a mechanism mediating this interplay in the pathogenesis and maintenance of stress-related mental disorders. Changes in methylation of the serotonin transporter gene (SLC6A4, 5-HTT) are associated with both stress and mental disorders. The present study for the first time longitudinally examines the relationship between the acute stress response and SLC6A4 methylation. For this purpose, 122 healthy adults participated in a standardized acute stress induction paradigm (Maastricht Acute Stress Test; MAST). The stress response was assessed via salivary cortisol collected at seven time points before and after stress induction. SLC6A4 promoter methylation was determined using pyrosequencing of bisulfite-converted DNA from peripheral blood before and 45 min after stress induction. A relative increase in SLC6A4 methylation from before to after the stress test was associated with increased salivary cortisol stress reactivity. Increased SLC6A4 methylation has previously been reported as a potential pathogenetic marker for stress-related mental disorders such as depression and posttraumatic stress disorder (PTSD), and to predict clinical response to both pharmacotherapy and psychotherapy. The present results therefore suggest that acute stress induction may serve as a model paradigm for investigating the potential pathogenetic and treatment mechanisms of stress-related mental disorders.

Also flagged:brain atrophymitochondrial diseasecortical atrophystroke-likeatrophymitochondrial diseases
Journal Article 2025-09-23 No Snippets Mickelsson N, Hirvonen J, Martikainen MH.
Show Full Abstract

<h4>Background</h4>Primary mitochondrial diseases comprise a group of inherited disorders that frequently affect the central nervous system. Previous studies have reported brain imaging findings commonly associated with mitochondrial disease. However, longitudinal data on volumetric brain abnormalities, their progression in time, and associations with clinical features of the disease remain limited.<h4>Methods</h4>We conducted a retrospective observational study of 36 patients with genetically confirmed mitochondrial disease at Turku University Hospital (Turku, Finland). A total of 73 brain magnetic resonance scans (1-8 per patient) were analysed using the cNeuro® image quantification tool to assess lobar and regional cortical atrophy. Associations with clinical features, including stroke-like episodes (SLEs), sex, and genetic subtype, were investigated.<h4>Results</h4>Cerebral atrophy was present in all patients and was most pronounced in the temporal and occipital lobes. Patients with a history of SLEs exhibited significantly greater atrophy in both temporal lobes and the right occipital and parietal lobes. Follow-up imaging (available for 15 patients) revealed progressive atrophy, particularly in the occipital lobes, in patients with SLEs. No significant differences in atrophy severity or progression were found between patients with the m.3243A > G variant and those with other genetic causes.<h4>Conclusions</h4>Cerebral atrophy is a common and often progressive feature of mitochondrial disease, even in patients without clinical brain symptoms. Atrophy predominantly affects posterior brain regions, and its progression is particularly evident in patients with SLEs. These findings underline the neurodegenerative nature of mitochondrial disease and highlight the need to develop neuroprotective therapies.

LRRIQ3HFE
Also flagged:OsteoporosisOsteoarthritisMusculoskeletal Diseaseschronic kidney diseasemineralbone disorder
Journal Article 2025-09-23 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…loci overlapping FPGT,LRRIQ3, TNFSF9, ZDHHC14, LINC00240,…

…transfusions complicated byhemochromatosiswith primary amenorrhea,…

Show Full Abstract

No abstract available.

Also flagged:anxietylinaloolbenzaldehydegelatinaggressionbehavioral
Journal Article 2025-09-23 No Snippets Atiratana T, Goldson AR, Samosorn S, Rajput N, Praphairaksit N, Kenney JW.
Show Full Abstract

Jasminum sambac (L.) Aiton, commonly known as Arabian jasmine, is widely used in Thai traditional medicine for mental health ailments. While most studies in humans and animals find that Arabian jasmine reduces stress and anxiety, there are a handful of reports that it can oppose relaxation by increasing autonomic arousal. Using adult zebrafish, we sought to determine whether factors like strain, sex, and personality might contribute to the variable effects of J. sambac on anxiety-related behavior. We extracted the flowers of J. sambac by ultrasonic-assisted extraction with optimal air pressure. Headspace solid-phase microextraction with gas chromatography-mass spectrometry (HS-SPME-GC-MS) identified the main components in the Arabian jasmine flower extract, including linalool (an anxiolytic compound) and benzaldehyde (a potentially anxiogenic compound). We fed three strains of zebrafish (AB, TL, and WIK) a gelatin pellet containing different concentrations of J. sambac (5-20 mg kg-1) and assessed 3-dimensional swim behavior in the novel tank and mirror biting tests. We found that in female AB fish, J. sambac resulted in a decrease in both bottom distance and percent explored during the novel tank test, consistent with an anxiogenic effect; there was no effect in WIK or TL fish. We also found that behavior/personality type influenced the effects of J. sambac where shy AB females increased their percent explored and low activity males increased their bottom distance, consistent with anxiolytic effects. Thus, we find that sex, genetics, and personality interact to influence the anxiety-related effects of Arabian jasmine. This suggests that these factors may contribute to the opposing effects of jasmine previously reported in the literature.

SUDS3
Also flagged:histoneschromatingene expressionhistonephosphorylationH1
Journal Article 2025-09-23 ✓ 1 Snippet Alam MS, Fuller CN, Jeanne Dit Fouque K, Valadares Tose L, Carter MA, Searfoss RM, de Luna Vitorino FN, Kosmopoulou M, Suckau D, Ridgeway ME, Van Orden SL, Garcia BA, Fernandez-Lima F.
In-Text Gene Mentions

linker histones

Show Full Abstract

Linker H1 histones are highly susceptible to a variety of post-translational modifications (PTMs) that play a critical role in chromatin dynamics and gene expression. In the present work, trapped ion mobility spectrometry in tandem with ultraviolet photodissociation followed by ultrahigh resolution mass measurements, provided by a Fourier transform ion cyclotron mass spectrometer (TIMS-q-UVPD-FT-ICR MS/MS), enabled direct characterization of the linker H1 histone proteoforms. The proposed method takes advantage of the mobility and mass preseparation of core and linker histones proteoforms prior to UVPD fragmentation and consequent high mass accuracy detection in the FT-ICR MS of the fragment ions for efficient PTM assignment. The application to a bovine histone extraction resulted in the annotation of four H1 variants (H1.2, H1.3, H1.5, and H1.4V), together with their PTM distribution with high sequence coverages (up to 60%); in particular, the H1.4V variant sequence was identified via <i>de novo</i> sequencing. All reported H1 proteoforms and their PTMs (e.g., mono/dimethylation, acetylation, and phosphorylation) were confirmed with complementary top-down liquid chromatography coupled to tandem MS/MS using electron-activated dissociation (LC-q-EAD-ToF MS/MS) and bottom-up analysis. This direct approach shows great promise for global H1 proteoform analysis due minimal sample preparation and large number of proteoform PTM observed.

LRRC7
Also flagged:chromosomesmetaphasechromatinphosphorylationkinasesbinding
Journal Article 2025-09-23 ✓ 2 Snippets Dimond A, Gim DH, Ing-Simmons E, Whilding C, Kramer HB, Djeghloul D, Montoya A, Patel B, Cheriyamkunnel S, Brown KE, Shliaha PV, Vaquerizas JM, Merkenschlager M, Fisher AG.
In-Text Gene Mentions

…Pbk –/– );Condensin= GOCC name…

…= GOCC name ‘Condensincomplex’ or protein…

Show Full Abstract

PBK/TOPK is a mitotic kinase implicated in haematological and non-haematological cancers. Here we show that the key haemopoietic regulators Ikaros and Aiolos require PBK-mediated phosphorylation to dissociate from chromosomes in mitosis. Eviction of Ikaros is rapidly reversed by addition of the PBK-inhibitor OTS514, revealing dynamic regulation by kinase and phosphatase activities. To identify more PBK targets, we analysed loss of mitotic phosphorylation events in Pbk<sup>-/-</sup> preB cells and performed proteomic comparisons on isolated mitotic chromosomes. Among a large pool of C2H2-zinc finger targets, PBK is essential for evicting the CCCTC-binding protein CTCF and zinc finger proteins encoded by Ikzf1, Ikzf3, Znf131 and Zbtb11. PBK-deficient cells were able to divide but showed altered chromatin accessibility and nucleosome positioning consistent with CTCF retention. Our studies reveal that PBK controls the dissociation of selected factors from condensing mitotic chromosomes and contributes to their compaction.

Also flagged:patent ductus arteriosusdeathductus arteriosusneurodevelopmental impairmentgestationneurodevelopmental
Journal Article 2025-09-23 No Snippets Kaluarachchi DC, Chock VY, Do BT, Rysavy MA, Sankar MN, Laughon MM, Backes CH, Colaizy TT, Bell EF, McNamara PJ, Hintz SR, Natarajan G.
Show Full Abstract

<h4>Background</h4>There is a paucity of data on neurodevelopmental outcomes in preterm infants who undergo transcatheter patent ductus arteriosus (PDA) closure (TCPC).<h4>Objective</h4>To evaluate neurodevelopmental impairment (NDI) or death at 2 years among preterm infants treated with TCPC compared to surgical ligation.<h4>Methods</h4>Retrospective cohort study of infants born at <27 weeks' gestation at NICHD NRN sites. Comparisons were made between infants who underwent TCPC and PDA ligation.<h4>Results</h4>TCPC and surgical ligation were performed on 99 and 279 infants, respectively. Death or severe NDI occurred in 49% of infants with TCPC and 40% with surgical ligation. There was no difference in odds of death or severe NDI between the two groups [aOR 1.12 95% CI: 0.55-2.26)].<h4>Conclusion</h4>TCPC had similar odds of death or severe NDI compared to surgical ligation. These findings need to be evaluated in large prospective studies as the management practice around the TCPC evolves.<h4>Clinical trial registration</h4>ClinicalTrials.gov ID: Generic Database: NCT00063063.

LRRC7
Also flagged:chromosomechromosomescell divisionsprophasechromatinMitotic
Journal Article 2025-09-23 ✓ 1 Snippet Kakui Y, Kusano Y, Clarence T, Lopez M, Fallesen T, Hirota T, Khatri BS, Uhlmann F.
In-Text Gene Mentions

Condensinintroduces a layer…

Show Full Abstract

Mitotic chromosomes give genome portions the required compaction and mechanical stability for faithful inheritance during cell divisions. They are shaped by the chromosomal condensin complex. Here, we record human chromosome dimensions from their appearance in prophase over successive times in a mitotic arrest. Chromosomes first appear long and uniformly thin. Then, individual chromosome arms become discernible, which continuously shorten and thicken-the longer a chromosome arm, the thicker it becomes. In the search for a molecular explanation of this behavior, given uniform condensin density, the popular loop extrusion model provides no obvious means by which longer chromosome arms become thicker. Instead, we find that simulations of an alternative loop capture model recapitulate key features of our observations, with re-arranging chromatin rosettes underpinning the gradually developing arm length-to-width relationship. Our analyses portray chromosomes as out-of-equilibrium structures in the process of transitioning towards, but on biologically relevant time scales not typically reaching, steady state.

SOX6
Also flagged:TAF15sarcomasleukemiasmyxoid liposarcomaEwing sarcomaoncoproteins
Journal Article 2025-09-23 ✓ 3 Snippets Lindén M, Andersson L, Albatrok H, Canfjorden V, Jonasson E, Grönqvist K, Sjövall D, Jaako P, Crescitelli R, Fagman H, Åman P, Ståhlberg A.
In-Text Gene Mentions

…EWS, including HOXD11,SOX6, POU3F1, FOXP1, and…

…(POU3F1, MEIS1, SOX8,SOX6, L3MBTL3, and E2F6)…

…transcription factors HOXD11,SOX6, MEIS1, and E2F6…

Show Full Abstract

<h4>Background</h4>FET (FUS, EWSR1, and TAF15) fusion oncoproteins are characteristic for several sarcomas and leukemias, including myxoid liposarcoma and Ewing sarcoma. FET oncoproteins interact with the SWI/SNF chromatin remodeling complex subtypes cBAF, PBAF, and GBAF, but their impact on SWI/SNF compositions, interactions, and downstream epigenetic effects remains elusive.<h4>Methods</h4>We employ a comprehensive immunoprecipitation and quantitative mass spectrometry approach to determine the impact of FET oncoproteins on SWI/SNF composition and their interactomes. Validation of complex composition and interaction partners is performed by glycerol gradient sedimentation assays and co-immunofluorescence analysis. Furthermore, we determine the differential chromatin accessibility and gene regulation in FET sarcomas using assay for transposase-accessible chromatin sequencing and RNA sequencing, respectively.<h4>Results</h4>Our data show that FET sarcomas have distinct SWI/SNF complex compositions, with different subunit paralogs and subtype-specific components that utilize distinct sets of interaction partners, including specific transcription factors. We show that FET oncoproteins cause no major disruption of the SWI/SNF complex composition. Instead, FUS::DDIT3-bound SWI/SNF complexes in myxoid liposarcoma cells are enriched in PBAF and GBAF components as well as most interaction partners.<h4>Conclusions</h4>These data suggest that FET oncoproteins act together with fully assembled and functional SWI/SNF complexes and recruited interaction partners. Finally, our data reveal that the SWI/SNF compositions, interactomes, and epigenetic background contribute to the tumor type in FET sarcoma. Trial registration Clinical trial number: not applicable.

NEGR1DCC
Also flagged:neuropsychiatric disorderATG13GATAD2AITIH4neuropsychiatric disordersschizophrenia
Journal Article 2025-09-23 ✓ 5 Snippets De Paoli-Iseppi R, Joshi SS, Gleeson J, Prawer YDJ, You Y, Agarwal R, Li A, Hull A, Whitehead EM, Seo Y, Kujawa R, Chang R, Dutt M, McLean C, Parker BL, Clark MB.
In-Text Gene Mentions

NEGR1splice isoforms and…

…ForDCC, we identified…

…ASD risk geneneuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1).…

…to the canonicalNEGR1isoform (ENST00000357731, 354…

Show Full Abstract

<h4>Background</h4>Neuropsychiatric disorders are highly complex conditions and the risk of developing a disorder has been tied to hundreds of genomic variants that alter the expression and/or RNA isoforms made by risk genes. However, how these genes contribute to disease risk and onset through altered expression and RNA splicing is not well understood.<h4>Results</h4>Combining our new bioinformatic pipeline IsoLamp with nanopore long-read amplicon sequencing, we deeply profile the RNA isoform repertoire of 31 high-confidence neuropsychiatric disorder risk genes in Human brain. We show most risk genes are more complex than previously reported, identifying 363 novel isoforms and 28 novel exons, including isoforms which alter protein domains, and genes such as ATG13 and GATAD2A where most expression was from previously undiscovered isoforms. The greatest isoform diversity is detected in the schizophrenia risk gene ITIH4. Mass spectrometry of brain protein isolates confirms translation of a novel exon skipping event in ITIH4, suggesting a new regulatory mechanism for this gene in the brain.<h4>Conclusions</h4>Our results emphasize the widespread presence of previously undetected RNA and protein isoforms in the human brain and provide an effective approach to address this knowledge gap. Uncovering the isoform repertoire of candidate neuropsychiatric risk genes will underpin future analyses of the functional impact these isoforms have on neuropsychiatric disorders, enabling the translation of genomic findings into a pathophysiological understanding of disease.

Also flagged:bioluminescencetranslational infectionmethicillinbiofilm infectionsinfectioninfections
Journal Article 2025-09-23 No Snippets Demidov VV, Jackson OP, Demidova N, Gunn JR, Gitajn IL, Elliott JT.
Show Full Abstract

<h4>Significance</h4>Methicillin-resistant <i>Staphylococcus aureus</i> (MRSA) biofilm infections present a critical challenge in orthopedic trauma surgery and are notoriously resistant to systemic antibiotic therapy. Noninvasive, quantitative imaging methods are urgently needed to assess biofilm burden and therapeutic efficacy, especially for emerging photodynamic therapy (PDT) strategies.<h4>Aim</h4>We aim to establish a quantitative framework using a combined bioluminescence and optical coherence tomography (OCT) imaging approach to correlate bioluminescent signal with viable MRSA burden in both planktonic and biofilm states and to determine how biofilm density and structure influence this relationship.<h4>Approach</h4>Bioluminescent MRSA (SAP231-luxCDABE) was cultured in planktonic and biofilm forms using <i>in vitro</i> growth models in 24-well plates and custom macrofluidic devices, respectively. Bacteria bioluminescence intensity (BLI), counted colony-forming units (CFU), and OCT-based biofilm thickness measurements were collected to construct linear regression models to evaluate how well BLI alone, or combined with biofilm density (CFU/volume), predicts bacterial counts across culture conditions.<h4>Results</h4>Bioluminescence strongly correlated with CFU in planktonic cultures ( R2=0.98 ). In biofilms, BLI per CFU decreased with density, indicating metabolic downregulation, and BLI alone was less reliable ( R2=0.59 ). Incorporating biofilm density (CFU/volume) improved prediction ( R2=0.84 ). A joint model for both states showed excellent fit ( R2=0.985 ), but the biofilm versus planktonic group remained a significant factor ( p=0.002 ), revealing systematic differences. This highlights the need for a mixed-model approach that segments subvolumes by morphological features to improve accurate, generalizable CFU estimation across both growth states.<h4>Conclusions</h4>Bioluminescence alone underestimates bacterial burden in dense, metabolically suppressed MRSA biofilms. The combination of BLI with OCT-derived structural metrics enables accurate, nondestructive quantification of viable bacterial load. This approach provides a robust toolset for preclinical evaluation of antimicrobial therapies, particularly for optimizing PDT dosimetry and assessing biofilm response in translational infection models.

Also flagged:ExtracellularVesicleObesityvesiclesphosphorylationinterferon gamma
Journal Article 2025-09-23 No Snippets Warnier G, van Doorslaer de Ten Ryen S, Lannoy C, Mahy T, Antoine N, Boyer E, Kienlen-Campard P, Verboven K, Copine S, Francaux M, Deldicque L.
Show Full Abstract

Systemic inflammatory state found in obesity increases the risk of developing numerous diseases. While endurance training seems effective to reduce this inflammation, the underlying mechanisms are not fully understood. Among those, extracellular vesicles (EVs) have been proposed to be actors in the anti-inflammatory intercellular crosstalk induced by exercise training. This study aimed to investigate how endurance training modulates the EV proteome in the context of an inflammatory state in adults with obesity. Thirteen lean sedentary adults and 10 sedentary adults with obesity participated in a 12-week endurance training programme. Skeletal muscle, abdominal subcutaneous adipose tissue and venous blood samples were taken prior to and after the training period. The systemic and adipose tissue inflammatory states were assessed, and plasma EVs were isolated by size exclusion chromatography. EV content was analysed by mass spectrometry. EVs isolated from the medium of myotubes stimulated by electrical pulse stimulation in vitro were quantified, and their content was analysed by western blot. After the endurance training, C-reactive protein (CRP) levels decreased in participants with obesity. In abdominal subcutaneous adipose tissue, the phosphorylation state of nuclear factor-kappa B (NF-κB) was not affected by training, but interleukin (IL)-6 and IL-1β protein levels were reduced after the 12 weeks in both groups. Conversely, interferon gamma (IFNγ) level reduction was exclusively found in the obesity group. Despite no changes in EV abundance, EV proteome was modified by training. Among the modified proteins in participants with obesity, the antioxidant enzyme peroxiredoxin (PRDX) 1 abundance was increased after training. Additionally, the PRDX1 content of EVs isolated from stimulated myotubes was increased compared to control conditions. In conclusion, our results suggest that the anti-inflammatory effects of exercise training are not directly mediated by EV anti-inflammatory proteome changes. However, exercise training increases circulating EV antioxidant content, possibly through contractile activity of skeletal muscle during repeated exercise.

Also flagged:StressNF-κBNrf2homoisoflavonoidToll-like receptorTLR
Journal Article 2025-09-23 No Snippets Do HTT, Lee C, Rhee I.
Show Full Abstract

SHR02, a derivative of homoisoflavonoid, exhibits potent anti-inflammatory activity in innate immune cells. In this study, we investigated the immunomodulatory effects of SHR02 in dendritic cells (DC2.4) and macrophages (RAW 264.7) under Toll-like receptor (TLR) stimulation. SHR02 significantly suppressed the secretion of pro-inflammatory cytokines (TNF-α and IL-6), reduced nitric oxide (NO) and reactive oxygen species (ROS) production, and downregulated the expression of iNOS and COX-2. Mechanistically, SHR02 inhibited NF-κB phosphorylation in dendritic cells while enhancing Nrf2 nuclear translocation in both cell types. These findings suggest that SHR02 modulates inflammatory and oxidative responses through both NF-κB and Nrf2 signaling pathways and may serve as a promising candidate for the treatment of inflammatory disorders.

SERPINC1DDX27
Also flagged:nisinurolithin Bvincristinelymphomamembraneellagitannins
Journal Article 2025-09-23 ✓ 5 Snippets Al-Khazaleh AK, Alsherbiny MA, Chang D, Münch G, Bhuyan DJ.
In-Text Gene Mentions

…proteins DDX21 andDDX27, both of which…

…ribosome assembly (DDX21,DDX27), translation initiation (DDX…

…proteins such asSERPINC1(Log 2 FC…

…RNA helicases (DDX21,DDX27, DDX3X, and DDX6),…

…of immune effectors (SERPINC1, LTF, GSN) and…

Show Full Abstract

Lymphoma remains a significant global health burden, necessitating innovative, targeted therapeutic strategies. Nisin (N), a bacteriocin produced by <i>Lactococcus lactis</i>, has demonstrated antimicrobial and anticancer properties through membrane disruption and apoptotic induction. Urolithin B (UB), a gut microbiota-derived metabolite of ellagitannins, has shown anti-inflammatory and antiproliferative activities in various cancer models. Vincristine (Vinc), a common anti-lymphoma drug, disrupts microtubule formation, leading to cell cycle arrest and apoptosis in cancer cells. This study explored the antiproliferative and pro-apoptotic effects of a triple combination therapy comprising N, UB, and Vinc against human lymphoma cell lines (HKB-11 and Hs 313.T). This study systematically evaluated the synergistic efficacy of both monotherapy and dual and triple combinations and molecular mechanisms using Alamar Blue viability assays, combination index (CI) modelling, reactive oxygen species (ROS) quantification, annexin V/7-AAD flow cytometry, and bottom-up label-free proteomics. The potential cytotoxicity of the combination on normal stromal HS-5 cells was also assessed using the Alamar Blue assay. The N: UB: Vinc combination at 2240: 210: 0.94 µM demonstrated potent synergy (CI values 0.31-0.50 at IC<sub>90</sub> - IC<sub>95</sub>) and induced near-complete growth inhibition (> 99%) in both lymphoma cell lines with reduced toxicity (42.09 ± 1.21% viability) toward normal stromal HS-5 cells. ROS analysis revealed significant oxidative stress, while flow cytometry confirmed enhanced apoptosis (p < 0.0001) in the combination groups. Proteomic profiling of the combination N: UB: Vinc at 2450.94 µM uncovered distinct molecular responses, including upregulation of MAP1LC3B2 (Log<sub>2</sub>FC = 1.4), GMNN (Log<sub>2</sub>FC = 1.3), and SLC38A2 (Log<sub>2</sub>FC = 1.5), promoting apoptosis, cell cycle regulation, and mTOR signaling inhibition. Concurrently, key oncogenic and metabolic proteins were downregulated, including NNMT (Log<sub>2</sub>FC = -2.9), PLTP (Log<sub>2</sub>FC = -2.5), and CYP4X1 (Log<sub>2</sub>FC = -2.0), which implicated the suppression of MAPK-Akt signaling, ferroptosis activation, and lipid metabolism disruption. These results established a mechanistic rationale for combining postbiotics such as N and UB with standard chemotherapy, highlighting a promising avenue for safer and more effective lymphoma management in the future.

Also flagged:myeloid cell differentiationprostate cancerPCaNR3C1BMP2RACGAP1
Journal Article 2025-09-23 No Snippets Chen J, Qiu J, Zhang W, Nie Z, Gao X, Xu G, Kang L, Zhang Z.
Show Full Abstract

<h4>Background</h4>Myeloid cell differentiation (MCD) has an important correlation with prostate cancer (PCa), but the mechanism of action of the former in the latter is still under investigation. This study designed to investigate the prognostic genes related to MCD in PCa and the associated mechanisms.<h4>Methods</h4>The related data were downloaded from public databases. Differentially expressed genes (DEGs) were intersected with MCD related genes (MCDRGs) to acquire candidate genes. Candidate prognostic genes with a causal relationship to PCa were further obtained through Mendelian randomization (MR). Prognostic genes were acquired by univariate Cox regression analysis and Least Absolute Shrinkage and Selection Operator (LASSO) analysis. Then, the risk model was built based on prognostic genes. Immune infiltration, nomogram model, and drug sensitivity were employed to investigate the roles of prognostic genes in PCa. The manifestation of prognostic genes in key cells was also investigated by single-cell sequencing (scRNA-seq) analysis. Finally, the manifestation of prognostic genes were authenticated by <i>in vitro</i> experiments.<h4>Results</h4>The 23 candidate prognostic genes had a causal relationship with PCa. The 5 prognostic genes (NR3C1, BMP2, RACGAP1, TLR3, FASN) were identified. The risk models suggested that high risk group (HRG)'s survival rate was inferior to that of low risk group (LRG). The nomogram indicated that prognostic genes could effectively predict the survival status of PCa patients. There were 18 immune cells that suggested notable differences between the HRG and the LRG. The HRG and LRG suggested notable differences in sensitivity to 86 drugs such as AZD8186. Epithelial cells were considered as key cells. Only FASN was consistently active during critical cell differentiation. The <i>in vitro</i> results were consistent with the results of bioinformatics analysis, indicating that the analysis results were reliable.<h4>Conclusion</h4>This study identified 5 prognostic genes and a risk model, suggesting a fresh thought on the subsequent development of PCa related drugs.

Also flagged:ferroptosisinflammatory bowel diseasechronic intestinal inflammatory diseaseironlipidperoxide
Journal Article 2025-09-23 No Snippets Chen S, Ma J, Tang J, Yang Y, Zhou S, Feng P.
Show Full Abstract

The pathophysiology of inflammatory bowel disease (IBD), a chronic intestinal inflammatory disease, is tightly associated with immunological dysregulation, intestinal flora abnormalities, and intestinal epithelial cell destruction. Ferroptosis-a non-apoptotic cell death form that differs from the standard apoptotic mode-plays a significant regulatory role in the development of IBD through iron-dependent lipid peroxide accumulation. Iron serves as a critical component for maintaining the normal function of macrophages. Macrophages have been demonstrated to play multifaceted roles in the pathogenesis and progression of inflammatory bowel disease. The iron metabolism within macrophages may potentially influence the development of IBD and colitis-associated cancer. This paper summarizes the present research on ferroptosis and macrophages and their related molecular mechanisms. It also discusses the interactive function of macrophage ferroptosis in the development of IBD and inflammatory-cancer transformation. The development of new theoretical foundations and intervention techniques for the prevention and treatment of IBD and colitis-associated colorectal cancer will be facilitated by the growth of this research area.

HTT
Also flagged:serotonin transportermental disorderstoserotonin (5-hydroxytryptamine, 5-HT) transportergestationbehavioural
Journal Article 2025-09-23 ✓ 5 Snippets Weidner MT, Zöller JEM, Hamann CS, Schraut KG, Ali M, Lardenoije R, Eijssen L, Foerstner KU, Gorbunov N, Strekalova T, Domschke K, Schmitt-Böhrer AG, Lesch KP, Leibold NK, van den Hove DLA.
In-Text Gene Mentions

…were mated with 5-Htt+/- C57BL6/J males, after…

…ryptamine, 5-HT) transporter (5-HTT).…

…Dependent on the 5-Httgenotype, PS offspring…

…PS exposure displayed 5-Httgenotype-dependent behavioural…

…the serotonin transporter (5-HTT, Slc6a4) linked polymorphic…

Show Full Abstract

<h4>Introduction</h4>Early-life stress exposure has been linked to an increased risk for the onset of mental disorders. As another factor, an individual's genetic make-up may also tip the scale towards health or disease, with certain genetic variants mediating differential susceptibility towards the effects of early-life stress or other experiences. The current study investigated the molecular foundation of individual variation in the response to prenatal stress (PS) exposure in wildtype mice as well as in mice deficient for the serotonin (5-hydroxytryptamine, 5-HT) transporter (5-HTT).<h4>Methods</h4>To meet this end, wildtype C57BL6/J dams were mated with 5-Htt+/- C57BL6/J males, after which they were exposed to restraint stress during the last part of gestation. In adulthood, female 5-HTT-deficient PS offspring and their wildtype littermates as well as age-matched control groups completed a behavioural test-battery, after which gene expression and histone 3 lysine 4 tri-methylation (H3K4me3) enrichment, as a marker of epigenetic programming, were measured in hippocampal tissue.<h4>Results</h4>Dependent on the 5-Htt genotype, PS offspring showed decreased social behaviour in the 3-chamber sociability test. Notably, we observed a considerable degree of behavioural variation in the observed effect of PS in this social test, which allowed segregation into socially affected (SA) and socially unaffected (SU) mice. Genome-wide mRNA expression profiling of hippocampal tissue revealed a core set of 23 genes to be associated with genotype-specific variation in social behaviour following PS exposure. Whereas H3K4me3 levels did not show profound global changes in relation to the variable effects of PS exposure on social behaviour, the kinesin family member 14 (Kif14) gene, which displayed increased expression in socially unaffected wildtype mice, did show lower levels of H3K4me3 in those same mice, but not in any of the other groups.<h4>Discussion</h4>All in all, differential susceptibility linked to PS exposure displayed 5-Htt genotype-dependent behavioural and transcriptomic profiles, supporting the notion of 5-HT-dependent developmental programming.

Also flagged:Mineralstrace elementsmicronutrientsneurological disordersmetabolismneurotransmitter
Journal Article 2025-09-23 No Snippets Das S, Banerjee P, Jana S, Mondal H.
Show Full Abstract

Minerals, vitamins, and trace elements are examples of micronutrients essential for psychological wellbeing and brain function. Severe disorders may result from their deficiency or, conversely, from an excess of them. Recent studies have indicated that the etiopathogenesis of certain neurological disorders may involve chronically elevated micronutrient levels. Physiological functions, such as energy metabolism, neurotransmitter synthesis, and antioxidant defence, are regulated by these vital nutrients and are essential for optimal neuronal activity. According to new research, micronutrient enrichment, whether through diet or supplements, can have a significant impact on cognitive function, neuroplasticity, and brain development. Cognitive decline, memory loss, and attention problems are linked to deficiencies in essential micronutrients, including vitamin B12, iron, zinc, and omega-3 fatty acids. Tailored micronutrient therapies have shown promise in reducing age-related cognitive decline and enhancing mental function in both healthy individuals and those at greater risk. This manuscript emphasizes the growing research linking micronutrient status to cognitive health. It also highlights the importance of maintaining a balanced diet and following appropriate supplementation practices to optimize brain function throughout life.

DARS2
Also flagged:Amyotrophic Lateral SclerosisALSmultisystem diseaseSETX Class-4SETXPOINTS
Journal Article 2025-09-23 ✓ 1 Snippet Posa A, Kornhuber M.
In-Text Gene Mentions

…, DAO ,DARS2, DCAF8 ,…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is a severe neurodegenerative multisystem disease with loss of spinal, bulbar and cortical upper and lower motor neurons resulting in progressive and generalised paralysis. Unfortunately, many aspects of this disease remain unclear. In the age of next generation sequencing, numerous gene variants have been discovered that are associated with ALS. In this article, a 72-year-old male underwent a medical history interview, clinical neurological examinations, neuropsychological tests, electrophysiological examinations (electromyography, electroneurography, somatosensory evoked potentials), computed tomography scan of the head and the cervical spine, blood and cerebrospinal fluid tests and a genetic analysis. The results of these examinations provided the definitive diagnosis of ALS. Whole-exome sequencing revealed the very rare genetic finding of the <i>SETX</i> Class-4 variant c.2750T>C (p.Met917Thr). The case presented here discusses the role of the <i>SETX</i> gene as a possible pathogenetic variant of adult-onset ALS. It demonstrates the relevance of genetic screening for gene variants of ALS in routine diagnostics. The precise classification of disease-related gene variants is of great relevance for clinical practice.<h4>Learning points</h4>Amyotrophic lateral sclerosis (ALS) is a severe neurodegenerative multisystem disease with loss of spinal, bulbar and cortical upper and lower motor neurons resulting in progressive and generalised paralysis.The case presented here describes a very rare variant in the <i>SETX</i> gene (heterozygous Class-4 variant c.2750T>C, p.Met917Thr) in an adult man with sporadic rapidly progressive ALS, with an unremarkable family history.This case demonstrates the relevance of genetic screening for gene variants of ALS in routine diagnostics, both in sporadic and familial cases. This may add to the accuracy of diagnosis and may improve genetic counselling for rare diseases.

Also flagged:membranemembranestumorneurological disordersinfectious diseasescancer
Journal Article 2025-09-23 No Snippets Feng J, He D, Chen J, Li M, Luo J, Han Y, Wei X, Ren S, Wang Z, Wu Y, Wang H, Zhang Y, Zhou Y.
Show Full Abstract

Cell membrane biomimetic nanoplatforms represent an innovative approach to addressing key challenges in nanodrug delivery systems by encapsulating natural cell membranes onto nanomaterials. This strategy confers unique biological properties that overcome immune clearance, extend in vivo circulation time, and enhance targeting specificity. This review systematically examines the construction strategies of these nanoplatforms and provides an in-depth analysis of immune escape mechanisms across different membrane sources-including erythrocyte, leukocyte, platelet, and tumor cell membranes-and their applications in precision-targeted therapies. We comprehensively explore cell membrane extraction and purification methods, nanocarrier selection, functionalization strategies, and membrane-nanocarrier integration techniques. The therapeutic applications of these platforms are examined across tumor treatment, inflammatory conditions, neurological disorders, and infectious diseases. Despite their significant clinical potential, challenges remain in large-scale production, standardized preparation protocols, and long-term safety assessment. This review also discusses future directions, including smart-responsive nanoplatform development, novel membrane source exploration, and multifunctionalization strategies, providing a theoretical foundation and technical reference for clinical translation of cell membrane biomimetic nanoplatforms.

Also flagged:AMLALLhematopoiesisleukemiatrisomy 21inherited predisposition syndromes
Journal Article 2025-09-23 No Snippets Leśniak M, Sekunda A, Kamizela E, Deleszkiewicz P, Ozygała A, Zawitkowska J, Lejman M.
Show Full Abstract

Acute myeloid leukemia (AML), the second most common type of leukemia in children, is a heterogeneous disease known to be caused by genetic, epigenetic, and transcriptional changes, predominantly somatic and germline abnormalities. Despite significant improvement of overall survival rates, the prognosis of pediatric AML remains unfavorable in comparison with acute lymphoblastic leukemia (ALL), especially in relapsed or refractory settings. The current status and future directions are focused on establishing an accurate diagnosis and treatment strategies based on the genomic background. Next-generation sequencing (NGS) technologies enable a broader understanding of the basis of the disease for the purpose of determining pathology-associated mutations and additional prognostic biomarkers in pediatric AML. This review focuses on providing an overview of the known and possible prognostic factors, as well as genetic landscape of pediatric AML patients and how it can be used to accurately differentiate and risk stratify patients. It also presents potential candidate modifications for risk adjustment and targeted therapy. Furthermore, we describe in this article a case of a 22-month-old male patient with relapsed M5 high-risk group (HRG) AML with complex karyotype. Due to belonging to the HRG, as well as unsatisfactory chemotherapy response, the patient underwent matched unrelated donor (MUD) stem cell transplantation (SCT).

PRDX6
Also flagged:oxygenangiogenesisHypoxia-inducible factorsHIFsHIFmitochondrial
Journal Article 2025-09-23 ✓ 1 Snippet Vásquez Vélez IC, Charris Domínguez CM, Fernández Sánchez MJ, Garavito-Aguilar ZV.
In-Text Gene Mentions

…ctivated Receptor Alpha PRDX1/PRDX6Peroxiredoxin-1, -6 RAAS…

Show Full Abstract

Reduced oxygen availability, or hypoxia, is an environmental stress factor that modulates cellular and systemic functions. It plays a significant role in both physiological and pathological conditions, including tissue regeneration, where it influences angiogenesis, metabolic adaptation, inflammation, and stem cell activity. Hypoxia-inducible factors (HIFs) orchestrate these responses by activating genes that promote survival and repair, although HIF-independent mechanisms, particularly those related to mitochondrial function, are also involved. Depending on its duration and severity, hypoxia may exert either beneficial or harmful effects, ranging from enhanced regeneration to fibrosis or maladaptive remodeling. This review explores the systemic and cellular effects of acute, chronic, intermittent, and preconditioning hypoxia in the context of tissue regeneration. Hypoxia-driven responses are examined across tissues, organs, and complex structures, including the heart, muscle, bone, vascular structures, nervous tissue, and appendages such as tails. We analyze findings from animal models and in vitro studies, followed by biomedical and pharmacological strategies designed to modulate hypoxia and their initial exploration in clinical settings. These strategies involve regulatory molecules, signaling pathways, and microRNA activity, which are investigated across species with diverse regenerative capacities to identify mechanisms that may be conserved or divergent among taxa. Lastly, we emphasize the need to standardize hypoxic conditions to improve reproducibility and highlight their therapeutic potential when precisely controlled.

SUDS3
Also flagged:Carbon Ion Beamcarbonchromosomeschromosomeflavonoidbiosynthesis
Journal Article 2025-09-23 ✓ 1 Snippet Liu X, Zhao K, Wang X, Zhang C, Zhang F, Yuan R, Lamlom SF, Zhang B, Ren H.
In-Text Gene Mentions

…modification (GO:0016570) andhistone deacetylase complexdeacetylase complex (GO:000011…

Show Full Abstract

Understanding the genetic architecture of complex traits is crucial for crop improvement and molecular breeding. We developed a mutagenized soybean population using carbon ion beam irradiation and conducted genome-wide association studies (GWAS) to identify variants controlling key agronomic traits. Whole-genome resequencing of 199 M4 lines revealed 1.48 million SNPs, predominantly C→T transitions, with population structure analysis identifying three distinct genetic groups. GWAS across five traits revealed striking differences in genetic architecture: the podding habit showed extreme polygenic control with 87,029 significant associations of small effect, while pubescence color exhibited oligogenic inheritance with only 122 variants. Hundred-seed weight displayed moderate complexity (4637 associations) with the largest effect sizes (-3.74 to 5.03) and major QTLs on chromosomes 4, 7, and 15-20. Growth habit involved 12,136 SNPs, including a strong chromosome 3 association (-log<sub>10</sub>(<i>p</i>-value) > 50). Flower color showed 2662 associations clustered on chromosome 15. Functional analysis of 18,542 candidate genes revealed trait-specific pathway enrichments: flavonoid biosynthesis for flower color, phloem transport for seed weight, auxin signaling for growth habit, and amino acid transport for podding habit. This study demonstrates how mutagenesis-induced variation, combined with association mapping, reveals evolutionary constraints that shape genetic architectures, providing insights for genetics-assisted breeding strategies.

HFE
Also flagged:Carboxy-MaltoseIron Sucroseironcarboxymaltosesucrose
Journal Article 2025-09-23 ✓ 1 Snippet Sharma C, Sharma M, Kapoor V, Verma T, Soni A, Verma S.
In-Text Gene Mentions

…known case ofhemochromatosisor hepatitis (A,…

Show Full Abstract

<h4>Objective</h4>To determine the efficacy of parenteral iron carboxy-maltose (FCM) versus iron sucrose complex (ISC) for the treatment of postpartum iron-deficiency anemia (IDA).<h4>Methods</h4>A randomized controlled trial was conducted among postpartum women with IDA. Primary outcome was to compare the efficacy of FCM versus ISC in the improvement of hemoglobin (Hb), RBC indices (mean corpuscular Hb (MCH), mean corpuscular volume (MCV), mean corpuscular Hb concentration (MCHC)), and iron stores (serum iron, serum ferritin, percentage saturation of iron, and total iron binding capacity). Secondary outcomes were side-effect profile and maternal complications. At enrolment, 500 women were randomized to two groups. Demographic and clinical data were collected at enrolment and four weeks later.<h4>Results</h4>Women receiving FCM had statistically significantly higher Hb levels (g/dl) (11.4 (10.3-12.5) vs. 11 (9.1-12.9), p<0.001), better RBC indices (MCV (fl); 96.5 (87.5-105) vs. 92 (77-107), p<0.001, MCH (pg/cell); 32 (27-37) vs. 30 (25-35), p<0.001, MCHC (g/dl); 36 (31-41) vs. 34 (30-38), p=0.001) and better iron stores (serum ferritin (µg/l); 290 (273-307) vs. 229 (213-245), p<0.001, and percentage saturation of iron (%); 24.5 (16.5-32.5) vs. 21 (16-26), p<0.001). However, there was no difference regarding serum iron (p=0.513) and total iron binding capacity (p=0.298). ISC had poor compliance as 23 (9.2%) women did not come for repeated doses. Secondary outcomes (side-effect profile (p=0.797) and maternal complications (p=0.176)) were comparable among women.<h4>Conclusion</h4>Ferric carboxymaltose has better efficacy and compliance for the treatment of postpartum iron-deficiency anemia as compared to iron-sucrose complex, with a similar side effect profile. We recommend that women with postpartum iron deficiency anemia (Hb 7-11 g%) receive at least a single parenteral FCM (1000 mg) before discharge from the hospital as a standard policy, especially in low- and middle-income countries.

Also flagged:PhosphorusCalciumPhosphateIndiscriminatewatercarbon
Journal Article 2025-09-23 No Snippets Qin Y, Yuan R, Li H, Huang H.
Show Full Abstract

Phosphorus, a crucial yet nonrenewable resource, is essential for agriculture, life processes, and various industries. In this study, we employed co-pyrolysis of eggshells and peanut shells to prepare calcium-based biochar (EPB) with a high adsorption capacity and ecological non-toxicity, enabling effective phosphorus recovery from wastewater. EPB was characterized via X-ray diffraction, scanning electron microscopy, electron probe microanalysis, and Brunauer-Emmett-Teller analysis. Additionally, its phosphate adsorption characteristics were investigated under varying temperature, pH, and coexisting ion conditions. Phosphate adsorption followed the Langmuir isotherm with a maximum adsorption capacity of 178.08 mg/g, and the kinetics aligned with those of the quasi-second-order kinetic model. Phosphate adsorption by EPB was driven by electrostatic attraction and chemical precipitation. Moreover, we investigated the effects of phosphorus-enriched biochar on the growth and development of tobacco and soil microbial communities. Phosphorus-enriched biochar increased organic and inorganic phosphorus levels and promoted tobacco growth compared with conventional fertilizers. Phosphorus-enriched biochar reshaped tobacco rhizosphere microbial communities, promoting beneficial taxa, such as <i>Nitrospira</i>. Structural equation analysis showed that EPB enhanced microbial alpha diversity and key microbial communities, improving phosphorus availability and tobacco growth and development. Conclusively, this study provides a theoretical reference for phosphorus-containing wastewater treatment and reuse.

SERPINC1
Also flagged:Platelet AdhesionMembranePlatelet activationantibodyPAC-1fibrinogen
Journal Article 2025-09-23 ✓ 4 Snippets Thaus C, Lubnow M, Krenkel L, Lehle K.
In-Text Gene Mentions

…albumin and theantithrombin-III(ATIII)-mediated inactivation …

…and the antithrombin-III (ATIII)-mediated inactivation of Fac…

…by binding toATIIIin a heparin-like…

…of heparin toATIIIto catalyze AT-mediated…

Show Full Abstract

<b>Background:</b> Contact between blood and the large artificial surfaces within membrane lungs (MLs) is one reason for device-induced thrombus formation during extracorporeal membrane oxygenation (ECMO). <b>Methods:</b> Hemocompatibility testing of gas-exchange fibers (GFs) and heat-exchange fibers (HEs) from commercially available/non-used MLs (ML-type, coating: PLS, Bioline<sup>®</sup>; Hilite7000LT, X.ELLENCE<sup>®</sup>; Nautilus, Balance<sup>®</sup>; EOS, PH.I.S.I.O<sup>®</sup>) included static hemolysis and platelet adhesion/activation assays. Platelet activation of non-adherent platelets was identified after antibody (CD62P, PAC-1, CD61) and fibrinogen staining (flow cytometry). The surface coverage (%) of adherent platelets was quantified after F-actin filament-staining. <b>Results:</b> All materials were non-hemolytic and did not induce platelet activation. However, platelet adhesion (median (IQR)) depended on the type of surface coating of GFs made entirely of polymethylpentene. Both uncoated GFs (12 (7-19)%) and X.ELLENCE-coated GFs (Hilite-ML, 13 (8-19)%) showed a significantly higher surface coverage compared to Balance-coated GFs (Nautilus-ML, 3 (1-6)%), PH.I.S.I.O-coated GFs (EOS-ML, 2 (2-5)%) and Bioline-coated GFs (PLS-ML, 4 (1-8)%) (<i>p</i> < 0.001). HEs made of polyethyleneterephthalate (Hilite-ML, Nautilus-ML) that were coated with X.ELLENCE were covered with more platelets (5 (3-7)%) compared to Balance-coated HEs (3 (1-6)%), respectively (<i>p</i> = 0.029). <b>Conclusions:</b> In vitro testing disclosed fourfold higher platelet adhesion on X.ELLENCE-coated GFs (and HEs) from the Hilite-ML compared to other ECMO-materials. Additional hemocompatibility tests are necessary to assess the increased platelet adhesion on the materials from the Hilite-ML.

Also flagged:Spinal Cord Tumorstumorspinal cord tumortumorsneoplasmscentral nervous system tumors
Journal Article 2025-09-23 No Snippets Motiei-Langroudi R.
Show Full Abstract

Primary spinal cord tumors are rare neoplasms representing 2-4% of central nervous system tumors. Despite their low incidence, their impact on neurological function is profound. Historically, tumor classification and management have relied primarily on histopathology. However, advances in molecular diagnostics have highlighted the critical role of genetic alterations in tumor behavior, prognosis, and treatment response. This narrative review summarizes current evidence on genetic mutations in primary intramedullary spinal cord tumors, focusing on their prognostic value and implications for clinical management. Emphasis is placed on the integration of genetic features into diagnostic criteria and clinical practice, as distinct molecular profiles define many spinal cord tumor subtypes. Integration of molecular diagnostics into spinal cord tumor management represents a paradigm shift from morphology-based to biology-driven practice. Genetic alterations inform prognosis, refine risk stratification, and increasingly guide therapeutic decision-making, including the use of targeted therapies and adjuvant radiation. Despite progress, challenges remain due to the rarity of these tumors, small sample sizes, and limited access to molecular testing. Ultimately, molecular precision promises to enhance survival and quality of life for patients with these rare but impactful tumors.

Research Square 2025-09-23 Preprint (No Snippets API) Scoles D, Paul S, Nguyen H, Gandelman M, Dansithong W, Figueroa K, Bonini N, Pulst S.
Show Full Abstract

<title>Abstract</title> <p> RNA-binding proteins (RBPs) play an essential role in development, normal functioning and human disease. Staufen1 (STAU1) is an RBP that regulates mRNA degradation and subcellular localization, and is part of the ATXN2 protein complex. Previously, we showed that STAU1 is overabundant in patient fibroblasts and in mouse models of Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), and spinocerebellar ataxia type 2 (SCA2), where it is associated with impaired autophagic flux due to STAU1-mediated upregulation of mTOR translation. STAU1 overabundance and impaired autophagy cause accumulation of biomolecular condensates and abnormal unfolded protein response (UPR). We generated a mouse model expressing the entire human <italic>STAU1</italic> gene (h <italic>STAU1</italic> ) in a bacterial artificial chromosome (BAC) construct. hSTAU1 in these mice was expressed in cerebral hemispheres, cerebellum and spinal cord, as well as cultured cortical neurons and cortical and spinal cord astrocytes and microglia. Expression of hSTAU1 caused dysregulated gene expression, abnormal autophagy, glial activation, and changes in neuronal marker proteins. All of these were significantly improved by reducing STAU1 abundance by RNAi, but exacerbated in BAC-STAU1 mice crossed with Prp-TDP-43(Q331K) transgenic mice. Similar results were also obtained in eye phenotypes in ALS- and SCA2-relevant fly models upon changing staufen-1 dosage. Despite the molecular changes, we observed no overt behavioral changes in mice up to 55 weeks of age, suggesting that STAU1 may function as an epistatic modifier of neuronal degeneration. The BAC-hSTAU1 mouse will be useful for developing therapies targeting the human STAU1 gene. </p>

HTT
Also flagged:fatty acidscysteinelipidmembranethioestertrypsin
Journal Article 2025-09-22 ✓ 1 Snippet Sardana S, Trezza A, Ianiski FR, Nederstigt AE, Baggelaar MP.
In-Text Gene Mentions

…-acylated proteins (CDC42,HTT, ZDHHC6 and FYN)…

Show Full Abstract

Long-chain <i>S</i>-acylation is the addition of long-chain fatty acids to cysteine residues on proteins. This lipid modification is essential for protein membrane association and signalling but presents analytical challenges due to both its hydrophobicity and the labile nature of thioester bonds. We developed and optimised a bottom-up mass spectrometry workflow tailored for the detection of long-chain <i>S</i>-acylated peptides. Following liquid chromatography optimisation for improved separation and elution of long-chain <i>S</i>-acylated peptides from a C<sub>18</sub> stationary phase, we investigated thioester stability under typical proteomics sample preparation conditions, including variations in pH, reducing agents, and trypsin digestion. Stability analyses revealed that long-chain <i>S</i>-acylated peptides were generally resistant to pH variations and reducing agents, while extended digestion times resulted in a loss of signal from some peptides. For MS/MS analysis, CID, HCD and ETD were applied to analyse long-chain <i>S</i>-acylated peptides. Neutral losses of the modification were observed with all these fragmentation methods. However, HCD proved to be the most effective, as the fragment ions resulting from the neutral losses provided sequence information, unlike those from CID and ETD. Applying this workflow to HEK293T cells overexpressing the long-chain <i>S</i>-acylated proteins GNA13 and RhoB, we detected dual acylation states of GNA13 and observed both long-chain <i>S</i>-acylation and prenylation on RhoB. Our optimised analytical strategy facilitates the identification and analysis of long-chain <i>S</i>-acylation on proteins without the need for chemical derivatization by alkyne-tagged probes or acyl-biotin exchange. Although recombinant overexpression of the long-chain <i>S</i>-acylated proteins was still required for long-chain <i>S</i>-acylation detection, this direct analysis strategy for protein long-chain <i>S</i>-acylation enables the study of lipid modifications with lipid-specific resolution, laying a foundation for deeper insights into the regulatory roles of these hydrophobic modifications in protein function and cellular signalling.

SUDS3
Also flagged:agingcancerprostate cancergene expressioncell growthmetabolism
Journal Article 2025-09-22 ✓ 1 Snippet Zhang S, Lee E, Bopardikar S, Goldstein AS.
In-Text Gene Mentions

containing histone demethylases

Show Full Abstract

Age is a major risk factor for a range of diseases, including prostate cancer. Understanding how age influences the susceptibility of normal prostate epithelial cells to cancer initiation is complicated by the fact that aging affects all tissues in the body. Assessing how various aging mechanisms influence the prostate epithelium is a necessary step to determine the critical factors associated with aging that increase prostate cancer risk. Here, we take a broad view of both prostate epithelial cell-intrinsic and cell-extrinsic factors that change with age and are likely to contribute to age-related risk of prostate tumorigenesis. For each factor, we discuss the impact of these age-related changes on cancer risk. We highlight important areas where additional research is required to help decipher the specific age-associated changes that contribute to prostate cancer initiation. Finally, we address the potential impact of various therapeutic interventions on aging phenotypes and cancer risk.

OLFM4
Also flagged:Gastric cancercancerchronic gastritisatrophic gastritisintestinal metaplasiadysplasia
Journal Article 2025-09-22 ✓ 1 Snippet Gao P, Zuo C, Yuan W, Cai J, Chai X, Gong R, Yu J, Yao L, Su W, Liu Z, Lin S, Wang Y, Cai M, Ma L, Li Q, Zhou P.
In-Text Gene Mentions

…(MSC, defined byOLFM4, and GAL…

Show Full Abstract

Understanding the cellular origins and early evolutionary dynamics that drive the initiation of carcinogenesis is critical to advancing early detection and prevention strategies. By characterizing key molecular, cellular and niche events at the precancerous tipping point of early gastric cancer (EGC), we aimed to develop more precise screening tools and design targeted interventions to prevent malignant transformation at this stage. We utilized our AI models to integrate spatial multimodal data from nine EGC endoscopic submucosal dissection (ESD) samples (covering sequential stages from normal to cancer), construct a spatial-temporal profile of disease progression, and identify a critical tipping point (PMC_P) characterized by an immune-suppressive microenvironment during early cancer development. At this stage, inflammatory pit mucous cells with stemness (PMC_2) interact with fibroblasts via NAMPT ⟶ ITGA5/ITGB1 and with macrophages via AREG ⟶ EGFR/ERBB2 signaling, fostering cancer initiation. We established gastric precancerous cell lines and organoids to demonstrate that NAMPT and AREG promote cellular proliferation in vitro. Furthermore, in the transgenic CEA-SV40 mouse model, targeting AREG and/or NAMPT disrupted key cell interactions, inhibited the JAK-STAT, MAPK, and NFκB pathways, and reduced PD-L1 expression, which was also confirmed by western blot in vitro. These interventions delayed disease progression, reversed the immunosuppressive microenvironment, and prevented malignant transformation. Clinical validation was conducted using endoscopically resected EGC specimens. Our study provides a precise spatiotemporal depiction of EGC development and identifies novel diagnostic markers and therapeutic targets for early intervention.

BTN2A1
Also flagged:BTN3A1cytokinehydroxymethylpyrophosphatesuperantigen
Journal Article 2025-09-22 ✓ 2 Snippets Eberl M, Mata Forsberg M, McLaren JE, Sverremark-Ekström E.
In-Text Gene Mentions

…butyrophilin family membersBTN2A1and BTN3A1.…

…the role ofBTN2A1/BTN3A1 and related molecules,…

Show Full Abstract

Vγ9/Vδ2 T cells represent the largest γδ T-cell population in human blood and possess a unique responsiveness towards microbial organisms by sensing the metabolite (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP) in the context of the butyrophilin family members BTN2A1 and BTN3A1. Curiously, the bacterium Staphylococcus aureus does not produce HMB-PP but appears to be capable of inducing activation, cytokine expression and proliferation of Vγ9/Vδ2 T cells regardless, through a largely unknown mechanism. We here provide a comprehensive review of the existing literature around Vγ9/Vδ2 T-cell responses to S. aureus and discuss potential pathways, ligands and biological functions.

MLLT10
Also flagged:EZH2acute myeloid leukemiaAMLPICALMmyelosarcomaCD7
Journal Article 2025-09-22 ✓ 5 Snippets Rausch C, Bacher U, Tchinda J, Hoffmann M, Seipel K, Pabst T.
In-Text Gene Mentions

…Observation of PICALM::MLLT10-rearrangement and coincidenta…

…(AML) with rearranged PICALM::MLLT10is a rare…

…feration advantage in PICALM::MLLT10positive cells.…

…The PICALM::MLLT10(also known as…

MLLT10-rearranged acute myeloid…

Show Full Abstract

Acute Myeloid Leukemia (AML) with rearranged PICALM::MLLT10 is a rare and poorly characterized entity. Here, we describe a patient with this rearrangement, and compare this case to the literature. We observed a trend towards young age, male sex, extramedullary involvement (particularly mediastinal myelosarcoma), trisomy 4, trisomy 19 and aberrant CD7-expression. It was suggested that upregulation of DOT1l or BMI1 is a key effector for subsequent leukemogenesis. However, molecular data are not available for most published cases. Interestingly, two different EZH2-mutations were detected in our case, while generally being rare in AML, which is concordant with recent reports on the occurrence of EZH2mut in this AML subtype. As a synergistic effect of BMI1 and EZH2 has already been demonstrated in other neoplasms, we hypothesize that acquiring an EZH2 mutation might be a crucial proliferation advantage in PICALM::MLLT10 positive cells. This may explain the high percentage of EZH2 mutated cases in this entity, but also supports the hypothesis of BMI1-mediated leukemogenesis.

Also flagged:neurological diseasesdepressionestradioltestosteronesex hormone-degrading enzyme17b-hydroxysteroid dehydrogenase
Journal Article 2025-09-22 No Snippets Xiang G, Wang Y, Ni K, Luo H, Liu Q, Song Y, Miao P, He L, Jian Y, Yang Z, Chen T, Xu K, Sun X, Shen Z, Ji C, Zhao N, He M, Pan Y, Luo Y, Hu J, Otto M, Li M.
Show Full Abstract

The human microbiome has a pronounced impact on human physiology and behaviour. Despite its unique anatomical connection to the brain, the role of the nasal microbiome in neurological diseases is understudied. Here, using human data and experiments in mice, we show that nasal Staphylococcus aureus is linked to depression. Nasal microbiome analyses revealed a positive correlation between depression scores and S. aureus abundance among patients with depression and healthy controls. Metabolomics of the nasal cavity showed decreased sex hormones, estradiol and testosterone in patients with depression versus controls. Nasal microbiota transplants from patients reproduced depression-like behaviour in mice with differential abundance of S. aureus. Further homology and mutational analysis uncovered an S. aureus sex hormone-degrading enzyme, 17b-hydroxysteroid dehydrogenase (Hsd12), which degraded testosterone and estradiol in mice, leading to lower levels of dopamine and serotonin in the murine brain. These findings reveal a nasal commensal that influences depressive behaviour and provides insights into the nose-brain axis.

MLLT10
Also flagged:Acute leukemiamethylationeukemia5-methylcytosineAMLUBTF
Journal Article 2025-09-22 ✓ 4 Snippets Steinicke TL, Benfatto S, Capilla-Guerra MR, Monteleone AB, Young JH, Shankar S, Michaels PD, Tsai HK, Good JD, Kreso A, van Galen P, Schliemann C, Chen EC, Griffin GK, Griffin GK, Hovestadt V.
In-Text Gene Mentions

…KMT2A -r withMLLT10and MLLT3 ,…

…-ALL (associated with PICALM::MLLT10, n =…

…in BCL11B , PICALM::MLLT10and ZNF384 -r…

…out of 11 PICALM::MLLT10T-ALL and 23…

Show Full Abstract

Acute leukemia requires precise molecular classification and urgent treatment. However, standard-of-care diagnostic tests are time-intensive and do not capture the full spectrum of acute leukemia heterogeneity. Here, we developed a framework to classify acute leukemia using genome-wide DNA methylation profiling. We first assembled a comprehensive reference cohort (n = 2,540 samples) and defined 38 methylation classes. Methylation-based classification matched standard-pathology lineage classification in most cases and revealed heterogeneity in addition to that captured by genetic categories. Using this reference, we developed a neural network (MARLIN; methylation- and AI-guided rapid leukemia subtype inference) for acute leukemia classification from sparse DNA methylation profiles. In retrospective cohorts profiled by nanopore sequencing, high-confidence predictions were concordant with conventional diagnoses in 25 out of 26 cases. Real-time MARLIN classification in patients with suspected acute leukemia provided accurate predictions in five out of five cases, which were typically generated within 2 h of sample receipt. In summary, we present a framework for rapid acute leukemia classification that complements and enhances standard-of-care diagnostics.

Also flagged:sarcomassolid tumourspaediatriccancerssarcomasoft tissue sarcomas
Journal Article 2025-09-22 No Snippets Young E, Kelly B, Cain JE.
Show Full Abstract

Childhood sarcomas are an aggressive and diverse group of mesenchymal-origin malignancies that collectively account for over a third of paediatric solid tumours. There has been little progress made in the treatment of childhood sarcomas in recent decades, and survival outcomes are poor compared to most other common paediatric cancers. Furthermore, long-term survivors of childhood sarcomas face disproportionately high morbidity from treatment. A unique feature of paediatric and adolescent sarcomas, compared to adult-type sarcomas, is that they arise from developing tissues and often share features with tissue-specific progenitors suggesting that they originate from cells that are arrested in a primitive developmental window. The developmental origins of paediatric sarcomas are also reflected in the incidence of different sarcoma types which correlate with age-specific tissue expansion and growth. In this review, we discuss the molecular mechanisms underpinning paediatric sarcomagenesis, focusing on how distortion of normal developmental programming, such as epigenetic regulation, embryonic signalling pathways, and aberrant growth pathways, contributes to childhood sarcoma development and progression. Finally, we will review the new and emerging therapeutic strategies seeking to target these developmental vulnerabilities.

PRDX6SERPINC1
Also flagged:Extracellular vesiclesendometrial cancerextracellularvesiclessynthesisextracellular vesicle
Journal Article 2025-09-22 ✓ 2 Snippets Baxter E, Nair S, West Z, Salomon C, Obermair A.
In-Text Gene Mentions

SERPINC1(serpin family C…

…basic protein) andPRDX6(peroxiredoxin 6) were…

Show Full Abstract

<h4>Background</h4>The current method for diagnosing endometrial cancer and monitoring treatment response is invasive and fraught with both interobserver and intraobserver variability. Less invasive and more reproducible methods are desirable. This systematic review examines the evidence for extracellular vesicles as minimally invasive biomarkers for endometrial cancer.<h4>Methods</h4>PubMed, Embase and Web of Science were searched for studies reporting extracellular vesicles as biomarkers in females with endometrial cancer. Risk of bias was assessed using the QUADAS-2 tool. A descriptive synthesis of biomarkers reported in the included studies was conducted.<h4>Results</h4>Of the 680 unique records reviewed, 23 studies were included. All 23 studies investigated extracellular vesicles as diagnostic biomarkers. Ten extracellular vesicle-associated biomarkers were consistently reported to be differentially abundant between endometrial cancer cases and controls in multiple independent studies and hence may be putative diagnostic biomarkers. Levels of extracellular vesicles, LGALS3BP (galectin 3 binding protein), miR-15a-5p, and miR-21-3p were elevated, while levels of miR-26a-5p, miR-130a-3p, miR-139, miR-219a-5p, miR-222-3p, and miR-885 were decreased in endometrial cancer cases versus controls. Seven studies also investigated extracellular vesicles as prognostic biomarkers, but no biomarker was reported as prognostic in more than one study.<h4>Conclusion</h4>Of the ten putative diagnostic biomarkers, extracellular vesicle-associated miR-21-3p, miR-26a-5p, miR-130a-3p, miR-139 and miR-219a-5p are the most promising as their expression in extracellular vesicle preparations appears to reflect that in endometrial tissue. However, there are significant concerns regarding study quality, limited adherence to consensus recommendations on extracellular vesicle research and lack of evidence supporting biomarkers being encapsulated within extracellular vesicles.

SERPINC1
Also flagged:liver cancerposthepatectomy liver failuredeathcell cyclewatertumor
Journal Article 2025-09-22 ✓ 1 Snippet Guerra S, Birrer DL, Ungethüm U, Jang JH, Clavien PA, Humar B.
In-Text Gene Mentions

…F7, F10, F13,Serpinc1, Supplemental Digital Content…

Show Full Abstract

<h4>Background</h4>Hepatic surgery rests on the unique, however limited regenerative capacity of the liver. Metabolic duties may be a key factor regulating proliferative abilities of hepatocytes. During regeneration, division of labor leads to spatial separation of proliferation from metabolic tasks, suggesting these opposing activities compete for space. Here, we exploited two-stage-hepatectomy mouse models to explore whether metabolic needs constrain the regenerative capacity of the liver.<h4>Materials and methods</h4>Mice were subjected to sham or associating liver partition and portal vein ligation for staged hepatectomy (ALPPS) surgery (a two-stage-hepatectomy renowned for accelerated regeneration), which leaves one fast-regenerating lobe (FLR) plus portally ligated lobes (LLs) that do not grow but have an intact arteriocentral flow. FLR and LLs were analyzed by omics approaches. Functional surgery was applied to create ALPPS variants with differing metabolic capacity.<h4>Results</h4>The FLR and the adjacent LL displayed a similar metabolite profile which however completely diverged during the major FLR growth phase. Combined transcriptomics-metabolomics and histology assigned proliferative activities explicitly to the FLR, while LLs were enriched with metabolic tasks, establishing macroscopic division of labor. In ALPPS variants differing in ligated volume, FLR growth was increased or reduced with gain or loss of metabolic capacity, respectively, revealing control of regeneration through metabolic duties. Notably, FLRs of slow-growing variants had upregulated metabolic activities, reflecting plastic adaptation to the increased metabolic pressure coming with little ligated volume. Transcriptomics disclosed macroscopic division of labor also in human ALPPS regeneration.<h4>Conclusion</h4>LLs act as auxiliary livers after ALPPS, enabling the FLR to focus on growth. Our findings demonstrate the functional requirement for division of labor during regeneration. This transient division roots on plastic behavior of the different lobes during ALPPS regeneration and reveals how metabolic needs define the liver's regenerative capacity.

PTGIS
Also flagged:arteriovenousextracellularcell proliferationfibroblast growth factorsangiopoietin-like proteinschemokines
Journal Article 2025-09-22 ✓ 1 Snippet Martinez L, Stoyell-Conti FF, Tabbara M, Rojas MG, Pereira-Simon S, Santos Falcon N, Hernandez Lopez R, Galtes D, Kosanovic C, Griswold AJ, Yang X, Shiu YT, Lee T, Duque JC, Ladino MA, Salman LH, Long X, Vazquez-Padron RI.
In-Text Gene Mentions

PTGIS

Show Full Abstract

<h4>Introduction</h4>The biological mechanisms underlying arteriovenous fistula (AVF) maturation in patients receiving hemodialysis remain poorly understood despite decades of research.<h4>Methods</h4>To address this gap, we first investigated the cellular changes in the venous wall after fistula creation in histological biopsies of longitudinal veins and AVF samples (23 patients). Using single-cell RNA sequencing of 70,281 cells from independent pre-access veins, early resections, mature, and failed AVFs (20 patients), we then created a complementary transcriptomic atlas of the human vein before and after anastomosis.<h4>Results</h4>AVFs had increased wall area and cell number but reduced cell density in histological sections, suggesting that postoperative wall thickening occurs predominantly through extracellular matrix (ECM) deposition. The early remodeling of the AVF was characterized by a loss of smooth muscle cells, increased monocyte infiltration, and the reprograming of myofibroblasts and fibroblasts toward reparative phenotypes. In contrast, later stages of remodeling were dominated by ECM-producing myofibroblasts and fibroblasts, occurring in the context of low cell proliferation. Failed AVFs displayed persistent inflammation and exaggerated healing responses as defining features. Specifically, these AVFs contained abundant proinflammatory and adhesive macrophages with upregulation of the Myddosome signaling complex, proinflammatory vasa vasorum endothelial cells, and hyperactivated fibroblasts and myofibroblasts. Macrophage-derived osteopontin emerged as a key paracrine signal driving vascular cell activation in failed AVFs. Additional signals derived from fibroblasts, myofibroblasts, and endothelial cells, including chemokines, semaphorins, fibroblast growth factors, angiopoietin-like proteins, periostin, and transforming growth factor-β, were also enriched within the inflammatory microenvironment sustaining AVF failure.<h4>Conclusions</h4>Our findings uncover previously unrecognized cellular and molecular patterns in human veins following AVF creation, providing novel insights and potential therapeutic targets to improve AVF maturation outcomes.

CCPG1
Also flagged:SCA2polyglutamineataxin-2ATXN2spinocerebellar ataxia type 2frontotemporal dementia
Journal Article 2025-09-22 ✓ 1 Snippet Almaguer-Mederos LE, Kandi AR, Sen NE, Canet-Pons J, Berger LM, Stokes MP, Abell K, Key J, Gispert S, Auburger G.
In-Text Gene Mentions

…FAM134B, RTN3L, SEC62,CCPG1, ATL3, TEX264, NIPSNAP1/2)…

Show Full Abstract

Toxic polyglutamine (polyQ) expansions in ataxin-2 (ATXN2) trigger neurodegenerative processes, causing spinocerebellar ataxia type 2, and enhancing TAR DNA-binding protein 43-dependent pathology in amyotrophic lateral sclerosis/frontotemporal dementia. Primary disease events can be compensated transiently, delaying disease manifestation. To define potential therapy targets, here we studied how cells modify phosphoprotein signals, using preferentially affected nervous tissue from end-stage Atxn2-CAG100-Knockin mice. The spinal cord phosphoproteome revealed massive hyperphosphorylations flanking the polyQ expansion in ATXN2 and for SQSTM1 and moderate hyperphosphorylations also for amyotrophic lateral sclerosis proteins, OPTN (optineurin), UBQLN2 (ubiquilin-2), TNIP1 (TNFAIP3 interacting protein 1), and TBK1-targeted TAX1BP1. Conversely, strong hypophosphorylations of WNK1 (protein kinase with no lysine 1), SPARCL1 (secreted protein acidic and cysteine rich-like 1), and PSMD9 (proteasome 19S regulator non-ATPase assembly chaperone P27) were found. Significant enrichments of SRC-homology domain type 3-containing proteins, autophagy/endocytosis factors, and actin modulators could be explained by N-terminal, polyQ-adjacent, proline-rich motifs in ATXN2, suggesting that spinocerebellar ataxia type 2 pathogenesis is highly similar to Huntington's disease, where neurotoxicity is mediated by abnormal polyQ-proline-rich motif-SRC-homology domain type 3 interactions. Validation of protein and mRNA levels was done in mouse spinal cord and embryonic fibroblasts or patient fibroblasts after bafilomycin or arsenite treatment, observing polyQ-dependent OPTN deficiency and SQSTM1 induction impairment. Overall, this phosphoproteome profile identified and quantified the main cellular efforts in adapting autophagy pathways to the aggregation propensity of the ATXN2-N-term.

Also flagged:cancerYin Yang 1YY1Raf kinase inhibitorRKIPgene expression
Journal Article 2025-09-22 No Snippets Dommalapati L, Guenter R, Golivi Y, Ganji SP, Sandhya T, Nagaraju GP, Saddala MS.
Show Full Abstract

Spatial transcriptomics (ST) plays a pivotal role in cancer research, offering a unique perspective on gene expression within the cancer microenvironment, further revolutionizing our current understanding of the subject. From addressing the limitations of traditional bulk RNA sequencing by preserving spatial context, this review discusses the importance of integrating machine learning (ML), artificial intelligence (AI), and statistical methods for interpreting ST data within oncology. Herein, we use examples from studies involving Raf kinase inhibitor protein (RKIP) and Ying Yang 1 (YY1) to illustrate applications for some of the ST techniques discussed. We explore how applying supervised learning techniques, such as Support Vector Machines (SVMs) and Random Forests (RFs), can significantly help further cancer classification and prediction of clinical outcomes and advance personalized medicine. Additionally, exploring unsupervised learning approaches like clustering and dimensionality reduction methods (PCA, t-SNE, UMAP) allows us to see hidden structures in ST data that may be overlooked. This review discusses recent tools and techniques that have been introduced within the last few years, underlining the transformation brought into ST by ML, AI, and statistical methods that provide new insight into oncogenic drivers such as YY1 and RKIP, cancer heterogeneity, and avenues for personalized medicine approaches in cancer treatment.

DARS2PRDX6
Also flagged:Polycystic Ovary Syndromemetabolic disorderpathogenesisPCOSFGF23SH2B3
Journal Article 2025-09-22 ✓ 4 Snippets Yu T, Zeng P, Zhou H.
In-Text Gene Mentions

…SPOCK2, SERPINA10, RALB,PRDX6, PKP2, JUND, GNPNAT1,…

…OSTN, PARK7, PIK3IP1,PRDX6, RALB, and SIGLEC5…

…like PRSS22, ERLEC1,DARS2, CRABP2, COLEC12, APOA4,…

…for 6 targets:PRDX6, FGF23, PKP2, SERPINA10,…

Show Full Abstract

<h4>Background and aims</h4>Polycystic ovary syndrome (PCOS) is a prevalent endocrine and metabolic disorder with complex pathogenesis and limited targeted therapeutic options. This study presents a proteomics-informed approach to identify potential plasma protein targets for PCOS intervention using causal inference methods.<h4>Methods</h4>We conducted a comprehensive proteome-wide Mendelian randomization analysis by integrating 1 Mb plasma cis-acting protein quantitative trait loci datasets with PCOS genome-wide association study summary statistics. To enhance robustness, we applied complementary approaches including summary-data-based MR, the Heterogeneity in Dependent Instruments test, and colocalization analysis. Identified targets were further assessed for druggability using curated drug databases.<h4>Results</h4>The MR analysis revealed 33 plasma proteins significantly associated with PCOS risk. Among these, FGF23 and SH2B3 showed the strongest evidence of a causal role, supported by SMR, HEIDI, and colocalization analyses. FGF23 was positively associated with PCOS risk and implicated in inflammatory and metabolic pathways, while SH2B3 was inversely associated and linked to anti-inflammatory signalling.<h4>Conclusions</h4>This study establishes a causal link between specific plasma proteins and PCOS and identifies FGF23 and SH2B3 as promising candidates for targeted drug development. These findings demonstrate the value of proteomics-integrated genetic analyses in uncovering novel therapeutic avenues for complex diseases like PCOS.

HFE
Also flagged:agingneurological diseasesAtherosclerosisironatrophydiabetes
Journal Article 2025-09-22 ✓ 3 Snippets Heckbert SR, Jensen PN, Rashid T, Wang DH, Sitlani CM, Franklin CG, Mojtabai M, Navas-Acien A, Charisis S, Bertoni A, Longstreth WT, Bryan RN, Nasrallah IM, Habes M.
In-Text Gene Mentions

…elevated risk forhemochromatosiswith Homeostatic Iron…

…Iron Regulator (HFE) mutations were…

…Four participants hadHFEmutations and 7…

Show Full Abstract

<h4>Background and objectives</h4>In neuropathologic studies, iron accumulation in gray matter (GM) is associated with aging and specific neurological diseases, but less is known about its correlates in community-based populations.<h4>Methods</h4>In the Multi-Ethnic Study of Atherosclerosis, brain MRI was conducted in 2018-2019. To estimate iron content, we derived the median quantitative susceptibility mapping (QSM) signal from four regions: the basal ganglia and cortical GM of the frontal, temporal, and parietal lobes. We examined cross-sectional associations with demographic and clinical characteristics, cognitive test performance, gait speed, and brain MRI measures of atrophy and small vessel disease.<h4>Results</h4>We studied 943 participants (14 % Chinese, 25 % Black, 20 % Hispanic, 41 % White; mean age 74 years; 48 % men). In multivariable models, higher left basal ganglia QSM signal was associated with older age (7.2 ppb per 10 years; 95 %CI 4.6,9.9), smoking (7.1; 3.4,10.9), and diabetes (7.4; 2.5,12.3). Lower QSM signal was associated with Black race (-15.3; -20.6,-10, relative to White) and higher high-density lipoprotein cholesterol (-3.4 per 20 mg/dL; -5.8,-0.9). In cortical GM, QSM signal was associated with greater waist circumference, lifetime alcohol use, and log-transformed white matter hyperintensity (WMH) volume (0.08-0.12 SD units per SD, all p ≤ 0.002), but not with cognitive test performance or gait speed.<h4>Discussion</h4>In cross-sectional analyses in a community-based cohort, older age, White race, smoking, diabetes, and greater WMH volume were associated with higher QSM signal in basal ganglia and/or cortical GM. Longitudinal studies are needed to further explore GM QSM signal in relation to cognition and gait in older individuals.

DARS2
Also flagged:Breast Cancercancercancersinvasive breast cancerdeathductal carcinoma in situ
Journal Article 2025-09-22 ✓ 1 Snippet Khalili-Tanha G, Shoari A.
In-Text Gene Mentions

…Genes such asDARS2, ESRP1, TH, and…

Show Full Abstract

Breast cancer is the most prevalent cancer among women and is challenging to diagnose and treat due to its diverse subtypes and stages. Precision medicine aims to improve early detection, prognosis, and treatment planning by identifying new clinical biomarkers. The review emphasizes the importance of using cutting-edge technology and artificial intelligence (AI) to identify new biomarkers associated with epithelial-mesenchymal transition (EMT). During EMT, epithelial cells transform into a mesenchymal state, a process driven by genetic and epigenetic alterations that facilitate cancer progression. The review discusses how statistical analysis and machine learning methods applied to multi-omics data facilitate the discovery of novel EMT-related biomarkers, thereby advancing therapeutic strategies. This conclusion is supported by numerous clinical and preclinical studies on breast cancer.

HTT
Also flagged:HDautosomal dominant neurodegenerative disordercognitionchromosomeChoreaVMAT2
Journal Article 2025-09-22 ✓ 1 Snippet Floridia Rietmann LM, Romano C, Beltrán Covarrubias SA, Gomez Miranda JA, Briceño Cardeña OE, Shenod S, Marrero Peralta AV, Ferrer Zavala GM, Hanumanthu P, Borges Sosa O, Calderon Martinez E.
In-Text Gene Mentions

…TheHTTgene mutation leads…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) causes progressive motor dysfunction, with chorea as its hallmark symptom. Vesicular monoamine transporter 2 (VMAT 2) inhibitors (tetrabenazine, deutetrabenazine, valbenazine) are established symptomatic therapies, while dopamine stabilizers (pridopidine, ordopidine) are emerging therapies, but their net benefit and safety remain uncertain.<h4>Methods</h4>Seven databases were searched through May 2025 following PRISMA guidelines. Random effects meta-analyses calculated mean differences (MDs) for the Unified Huntington Disease Rating Scale total motor score (UHDRS TMS) and total maximal chorea score (TMC), plus risk ratios (RRs) for adverse events (AEs). Trial Sequential Analysis (TSA) applied a Lan DeMets O'Brien Fleming α spending function with 80% power.<h4>Results</h4>Seven randomized trials (1431 participants) met inclusion criteria. VMAT 2 inhibitors significantly improved motor outcomes versus placebo (UHDRS TMS: MD -3.80, 95% CI -5.76 to -1.83; TMC: MD -3.05, 95% CI -3.84 to -2.26; both I<sup>2</sup> = 0%). Dopamine stabilizers produced no meaningful change (UHDRS TMS: MD -0.98, 95% CI -2.48 to 0.51; I<sup>2</sup> = 32%). Neither class increased total AEs (VMAT 2: RR 1.21, 95% CI 0.99 to 1.48; dopamine stabilizers: RR 1.05, 95% CI 0.92 to 1.20; both I<sup>2</sup> = 0%). TSA confirmed robust evidence for VMAT 2 benefits on TMC but indicated additional data are required to verify dopamine stabilizer effects on UHDRS TMS. Trial sequential analysis confirmed the reliability of VMAT2 for TMC; however, the sample size was insufficient to draw conclusions about the effects of dopamine stabilizers on UHDRS TMS or their safety outcomes, indicating that additional data are needed.<h4>Conclusions</h4>VMAT-2 inhibitors may suggest potential improvements in motor symptoms in Huntington's disease, while current evidence does not demonstrate a significant benefit of dopamine stabilizers. The safety profiles of both treatments appear generally comparable to placebo. Further rigorous and long-term studies are required to better establish their efficacy and safety.

HFE
Also flagged:steatotic liver diseasehepatic steatosisobesityhypertensionhypercholesterolemiahypertriglyceridemia
Journal Article 2025-09-22 ✓ 1 Snippet Egresi A, Kozma B, Karácsony M, Rónaszéki A, Werling K, Csongrády B, Novák PK, Folhoffer A, Szijártó A, Hagymási K.
In-Text Gene Mentions

…disorders (Wilson’s disease,hemochromatosis) or use of…

Show Full Abstract

<b>Background/Objectives:</b> Hepatic steatosis, a hallmark of metabolic dysfunction-associated steatotic liver disease (MASLD), is closely associated with systemic metabolic dysfunction. However, the cumulative impact of metabolic risk factors on liver fat content remains underexplored. To evaluate the association between metabolic risk factors and hepatic steatosis severity using magnetic resonance imaging proton density fat fraction (MR-PDFF) measurement, and to assess the cumulative effect of multiple metabolic abnormalities. <b>Methods</b>: In this cross-sectional study, MASLD patients (<i>n</i> = 132, aged ≥ 18 years, age: 61.3 ± 10.3, male: 54, female: 78) underwent metabolic risk assessment and MR-PDFF liver fat content measurement. The association between certain metabolic risk scores (obesity/overweight, hypertension, hypercholesterolemia, hypertriglyceridemia, impaired fasting glucose or type 2 diabetes mellitus) both continuous and categorized, as well as liver fat content was analyzed using linear regression models. The cumulative effect of increasing metabolic risk was further explored with subgroup comparisons. <b>Results</b>: A significant positive association was observed between continuous metabolic risk scores and MR-PDFF values (β = 0.021, <i>p</i> < 0.001). Participants with higher cumulative metabolic risk (4 and 5 risk factors group) showed significantly higher liver fat content compared to the reference group (<i>p</i> < 0.01) (MetfO0 = 5.7 ± 5.9%; MetfO1 = 11.6 ± 9.5%; MetfO2 = 7.9 ± 5.6%; MetfO3 = 10.2 ± 7.9%; MetfO4 = 16.4 ± 11.0%; MetfO5 = 17.8 ± 9.5%). Intermediate metabolic risk categories showed a trend toward increased steatosis but did not reach statistical significance. <b>Conclusions</b>: Cumulative metabolic risk is strongly associated with increased hepatic fat accumulation. These findings underscore the need for early identification and management of metabolic risk factors to prevent the development and progression of hepatic steatosis.

DCC
Also flagged:Tumorcancerinnervationneurotrophic factorssolid tumorsnerve formation
Journal Article 2025-09-22 ✓ 1 Snippet Ji ZZ, Chan MK, Tang PC, Ng CS, Li C, Zhang D, Nikolic-Paterson DJ, To KF, Jiang X, Tang PM.
In-Text Gene Mentions

…peptide DCX DoublecortinDCCDeleted in colorectal…

Show Full Abstract

Innervation is ubiquitous in diseased tissues, including cancer. Increasing evidence suggests that innervation not only plays a direct role in cancer pain, but is also closely related to disease progression, including cancer growth, metastasis, and drug resistance. At the molecular level, tumor-associated nerves can interact with cancer cells and the tumor microenvironment through neurotrophic factors, thereby promoting tumor occurrence and development, and represent a potential intervention for solid tumors with nerve enrichment. By dissecting the transcriptome dynamics of cancer-associated neurons with single cell resolution, numbers of novel therapeutic targets for tumor denervation have been uncovered, including a novel phenomenon-Macrophage to Neuron-like cell Transition (MNT). This review systematically summarizes the latest research findings of tumor denervation, from molecular mechanisms to the innovative denervation strategies, paving the way for novel, safe, and effective cancer treatments in the clinic.

Also flagged:autoimmune diseaselymphocyte proliferationStimulator of Interferon GenesSTINGtype I interferonpathogenesis
Journal Article 2025-09-22 No Snippets Ka Y, Tan T, Fan Y, Liu W, Wang A, Wang W, Yuzhen G, Zhang J, Yao X, Lin X, Wu Y.
Show Full Abstract

Sjögren's syndrome (SS) is an autoimmune disease characterized by abnormal lymphocyte proliferation and progressive exocrine gland dysfunction. The Stimulator of Interferon Genes (STING) pathways, as an important intracellular immune hub, overactivation can drive abnormally high expression of type I interferon and induce inflammatory cell infiltration, which is considered an important mechanism in the pathogenesis of SS. However, currently there is limited clinical evidence for direct activation of STING in human SS, and its tissue-specific regulatory mechanisms in target organs also need to be further elucidated. Based on this, STING pathway inhibitors have shown potential value in treating SS. This article systematically reviews the molecular mechanisms of the STING pathways in the pathogenesis of SS, explores its feasibility as a therapeutic target, and provides new evidence and ideas for precision treatment of SS.

Also flagged:AP-1transcription factorgene expressionFRA1cancercell cycle
Journal Article 2025-09-22 No Snippets Al-Khayyat W, Laframboise T, Dougherty J, Mendonca MS, Boreham DR, Tai TC, Thome C, Tharmalingam S.
Show Full Abstract

<h4>Purpose</h4>FOS-like antigen 1 (FRA1), encoded by <i>FOSL1</i>, is an inducible subunit of the AP-1 transcription factor complex and regulates gene expression in response to proliferative and environmental cues. Although FRA1 has been linked to cancer progression, its role in early transformation and radiation responses remains unclear.<h4>Methods</h4>CRISPR-engineered human CGL1 cells-a hybrid of HeLa and normal fibroblasts-were used to evaluate the impact of FRA1 overexpression and knockout on neoplastic transformation. Transformation frequency, clonogenic survival, DNA damage recognition and repair, and cell cycle distribution were assessed following irradiation. Transcriptomic profiling was performed under baseline and serum-stimulated conditions.<h4>Results</h4>FRA1 loss markedly increased both spontaneous and radiation-induced transformation frequency, while overexpression suppressed transformation under both conditions. FRA1-deficient cells were sensitized to radiation-induced cell killing, despite intact DNA damage recognition and repair. In contrast, FRA1 overexpression promoted G2/M accumulation post-irradiation, suggesting enhanced checkpoint activation. Transcriptomic profiling revealed that FRA1 remodels AP-1 complex composition and functions as a transcriptional repressor of mitogen- and stress-responsive genes. FRA1-mediated repression was observed across gene networks involved in extracellular matrix remodeling, hypoxia signaling, inflammation, and proliferation, under both baseline and serum-stimulated conditions.<h4>Conclusion</h4>These findings establish FRA1 as a key modulator of neoplastic transformation and radiation response, acting primarily through transcriptional repression of pro-tumorigenic signaling pathways.

Also flagged:spermatogenesisMale infertilityinfertilityPIWIinteractingsynthesis
Journal Article 2025-09-22 No Snippets Hong Z, Huang S, Li L, Gao Y, Ma B, Fan Q, Zhang Y, Wang M.
Show Full Abstract

Male infertility, accounting for approximately 50% of global infertility cases, is a growing concern in reproductive medicine. A fundamental cause lies in disrupted spermatogenesis-a complex, highly regulated process involving mitotic proliferation, meiotic division, and spermiogenic remodeling. Among the key regulatory pathways, PIWI-interacting RNAs (piRNAs) and their associated PIWI proteins have emerged as essential players in maintaining germline genome integrity and ensuring successful sperm development. However, their clinical relevance remain underexplored. This review provides a comprehensive synthesis of the piRNA pathway's multifaceted roles across the full spectrum of spermatogenesis. We describe how piRNAs, together with PIWI proteins, silence transposable elements (TEs), guide chromatin remodeling, regulate mRNA translation, and protect sperm from environmental insults. We detail the stage-specific functions of piRNA machinery during spermatocytogenesis, spermatidogenesis, and spermiogenesis, supported by evidence from gene knockout models and cross-species studies. Particular emphasis is placed on piRNA biogenesis, including the primary processing pathway, the ping-pong amplification cycle, and terminal modifications mediated by enzymes such as PNLDC1 and TDRKH. Genetic disruptions in key piRNA pathway genes-including <i>MOV10L1</i>, <i>PNLDC1</i>, <i>SPOCD1</i>, and <i>TDRKH</i>-have been linked to clinical phenotypes such as non-obstructive azoospermia and severe oligozoospermia. We explore how these mutations impair piRNA maturation, compromise TE silencing, and trigger germ cell arrest, highlighting their diagnostic and therapeutic relevance. In addition, we discuss emerging applications of piRNAs as non-invasive biomarkers in seminal plasma, with altered piRNA profiles correlating with reduced sperm count and motility. Beyond pathogenesis, the piRNA pathway presents a promising frontier for reproductive interventions. We examine translational strategies targeting piRNA-associated proteins (e.g., RNF8-MIWI interaction modulators) and the potential for piRNA-guided gene silencing in germ cells. Moreover, we consider the impact of environmental toxins and epigenetic stressors on piRNA dynamics, suggesting new angles for fertility preservation. In summary, this review positions the piRNA pathway as a central regulator of male reproductive health. By integrating molecular biology with clinical genetics, we provide a roadmap for leveraging piRNA biology in the diagnosis, management, and treatment of male infertility.

SERPINC1
Also flagged:portal vein thrombosisfibrinogenprotein Cplasminogencoagulopathycoagulation
Journal Article 2025-09-22 ✓ 2 Snippets Turgunboev EK, Haybullina ZR, Babadjanov AK, Sultonova RD.
In-Text Gene Mentions

…of 0.896 (P<0.05),antithrombin-IIIlevels below 15%,…

…following LT includeantithrombin-IIIlevels below 15%,…

Show Full Abstract

<h4>Background</h4>Bleeding and thrombosis are major perioperative complications in liver transplantation (LT), with mortality rates up to 30%. Bleeding occurs in 0-10% of cases and is 2-3 times more frequent in children than in adults. This study aims to determine the diagnostic significance of specific laboratory tests in predicting adverse outcomes due to thrombohemorrhagic complications in LT.<h4>Methods</h4>This prospective observational analytical study employed a case-control design involving 30 liver recipients. Patients were categorized into two groups based on outcomes: favorable or unfavorable (thrombosis/bleeding leading to fatal outcomes in the early postoperative period).<h4>Results</h4>Among 30 patients, 17 (56.7%) had favorable outcomes without complications, while 13 (43.3%) experienced complications early postoperatively. Specifically, portal vein thrombosis (PVT) occurred in 7 (23.3%) cases, and fatal outcomes in the early postoperative period were observed in 5 (16.7%) cases. However, complications were successfully managed in 8 patients. Receiver operating characteristic (ROC) analysis demonstrated prognostic significance in predicting fatal thrombohemorrhagic complications post-LT for the following parameters: fibrinogen level below 160.1 mg/dL within the first day post-surgery showed a sensitivity of 89% and specificity of 96%, with an area under the ROC curve (AUC) of 0.896 (P<0.05), antithrombin-III levels below 15%, protein C levels below 17%, and plasminogen activity below 21% within the first day post-intervention. Intraoperative blood loss exceeding 1,200 mL was identified as a risk factor for hemorrhagic complications post-LT.<h4>Conclusions</h4>Key predictors of fatal thrombohemorrhagic complications following LT include antithrombin-III levels below 15%, protein C levels below 17%, and plasminogen activity below 21% on the first day post-surgery. A fibrinogen level under 160.1 mg/dL on the first day post-surgery, demonstrating 89% sensitivity and 96% specificity, strongly predicts fatal complications. Intraoperative blood loss over 1,200 mL represents a significant risk factor for post-LT hemorrhagic complications.

Also flagged:ureathioureadithiothreitolalbuminBSAdenaturation
Journal Article 2025-09-22 No Snippets González-Blanco L, Oliván M, Diñeiro Y, Bravo SB, Sierra V, Gagaoua M.
Show Full Abstract

Dark, firm, and dry (DFD) beef, also known as dark-cutting beef, lead to economic losses, food waste, and potential consumer rejection due to its very dark color at the point of sale. This condition is associated with a high ultimate pH, a limited blooming capacity, a redder cooked color that appears undercooked, and increased spoilage rates. Although several pre-slaughter factors have been linked to high ultimate pH, the mechanisms underlying DFD beef remain complex, multifactorial and not yet fully understood [1]. Proteomic approaches on <i>post-mortem</i> muscles have increasingly been employed to unravel the molecular mechanisms and biological pathways underlying this quality defect and to identify candidate protein biomarkers for its early prediction or better characterization using explanatory models. In this study, SWATH-MS proteomics, a data-independent acquisition strategy, was applied for the first time for an in-depth characterization and quantification of <i>post-mortem</i> muscle proteomes. The analysis was conducted using the most extensive dataset available to date on this quality defect conditions, which included 26 DFD beef samples (pH<sub>24</sub> ≥ 6.2) and 26 CONTROL samples (5.4 ≤ pH<sub>24</sub> ≤ 5.6). Muscle samples from the <i>Longissimus thoracis et lumborum</i> of <i>Asturiana de los Valles</i> yearling bulls were collected at 24 h <i>post-mortem</i> to investigate protein expression differences associated with DFD beef condition. A total of 735 proteins were quantified, among which 35 exhibited a significant difference in their abundances between the DFD condition and CONTROL samples, suggesting their potential as putative biomarkers for DFD beef. The data provided in this article can facilitate further research into beef quality defects and are available for reuse and/or reprocess and/or integration to support the development of early prediction tools for DFD beef. These data could further contribute to previous integrative studies [1], in the frame of integromics. Those approaches aimed combining multiple public proteomics datasets and DFD proteomics studies in a unique repository with the ultimate objective of refining the selection of dark-cutting beef biomarkers and deepen our understanding on the underlying biological mechanisms, hence revealing novel patterns inaccessible from individual datasets [1]. A more detailed analysis of this dataset is available in the study published by González-Blanco et al. [2]. The mass spectrometry (MS) proteomics data generated using a sequential window acquisition of all theoretical mass spectra (SWATH-MS) have been deposited to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository [3] with the dataset identifier PXD059876.

BTN2A1
Also flagged:cancercervical cancercell proliferationCMTM4phosphorylationAKT
Journal Article 2025-09-22 ✓ 1 Snippet Wang H, Liu J, A X, Wang J, Mu Q, Yang A, Zhou J.
In-Text Gene Mentions

…of BTN-family membersBTN2A1/3A1 ( 32 ).…

Show Full Abstract

<h4>Background</h4>CMTM4 is involved in various cellular processes, such as cancer progression and immune regulation. However, its precise role in cervical cancer remains unclear. This study aimed to investigate the impact of CMTM4 on HeLa cell behavior, tumorigenesis, myeloid-derived suppressor cell (MDSC) generation, and immunosuppressive effects in the context of cervical cancer.<h4>Methods</h4>HeLa cells were genetically engineered to overexpress <i>CMTM4</i> or to achieve <i>CMTM4</i> knockdown. Subsequently, both <i>in vitro</i> and <i>in vivo</i> experiments were performed to systematically evaluate cell proliferation, apoptosis, tumorigenesis, as well as the behavior of immune cells. MDSCs were isolated and treated to analyze the effects of CMTM4 on their function.<h4>Results</h4>Immunohistochemical and Western blot analyses indicated a diminished expression of the CMTM4 protein in cervical cancer tissues relative to adjacent non-cancerous tissues. <i>In vitro</i> experiments revealed that silencing <i>CMTM4</i> enhanced the viability of HeLa cells and reduced apoptosis, whereas its overexpression produced the opposite effects. Furthermore, <i>CMTM4</i> overexpression mitigated the immunosuppressive effects of MDSCs. However, the introduction of exogenous MDSCs counteracted the inhibitory impact of <i>CMTM4</i> on cervical cancer cell proliferation. Mechanistically, <i>CMTM4</i> knockdown resulted in increased phosphorylation levels of AKT, STAT3, and ERK, while its overexpression led to decreased phosphorylation of these proteins (p-AKT, p-STAT3, and p-ERK). In vivo experiments demonstrated that <i>CMTM4</i> overexpression significantly reduced tumor volume and weight, downregulated the expression of proliferation markers such as PCNA and Ki67, and inhibited the activation of the AKT/STAT3/ERK signaling pathway. Additionally, <i>CMTM4</i> overexpression was associated with a reduction in MDSC infiltration within cervical tumor tissues.<h4>Conclusions</h4>CMTM4 emerges as a critical regulator in cervical cancer, influencing both tumor cell behavior and the immune microenvironment.

Preprints.org 2025-09-22 Preprint (No Snippets API) Luu Hoang KN, Evans S, Willis TW, Davies K, Kockelbergh H, Silcock L, Piechocki K, Fowler A, Soilleux EJ.
Show Full Abstract

Coeliac disease (CeD) is a gastrointestinal enteropathy triggered by the consumption of gluten in predisposed individuals. Only around 50% of CeD genetic risk is understood, with the majority of risk attributed to the HLA loci. We investigated the butyrophilin family of immunomodulators as novel CeD risk loci. We sequenced the butyrophilin loci of 48 CeD and 46 control patients and carried out gene-based burden testing on the captured single nucleotide polymorphisms (SNPs). We found significantly increased BTN2A1 gene burden in CeD patients. To validate these results, the SNP data of 3094 CeD patients and 29 762 control participants from the UK Biobank database were subjected to single variant analyses. Fourteen BTN2A1, 10 BTN3A1, and 13 BTN3A2 SNPs were significantly associated with CeD status. Twenty of the 37 SNPs above were associated with CeD status independent of the risk associated HLA genotypes. All twenty of these SNPs, alongside a novel SNP not included in the above SNPs were associated with CeD in HLA-DQ2.5-matched case-control groups. This study reaffirmed the association of the BTN3A2 locus with CeD risk, and identified BTN2A1 and BTN3A1 as putative novel CeD risk loci.

Research Square 2025-09-22 Preprint (No Snippets API) Pelak VS, Mahmood A, Noteboom L, Croisile B, McKendrick A, Bettcher B.
Show Full Abstract

<title>Abstract</title> <p>Background Posterior Cortical Atrophy (PCA) is a rare and atypical presentation of neurodegenerative diseases, most commonly Alzheimer’s disease (AD). It is characterized by early impairment in visual and other posterior cortical functions. The rarity, the visual phenotype, and lack of longitudinal data hinder inclusion of PCA in AD clinical trials. To inform the design of a 12-month clinical trial readiness study for PCA, we conducted a 6-month study evaluating preliminary responsiveness of standard AD clinical trial outcome measures alongside PCA-targeted assessments. Methods Twelve participants with PCA completed the study. Baseline and 6-month follow-up assessments included the Mini-Mental State Examination (MMSE), Clinical Dementia Rating-Sum of Boxes (CDR-SB), Addenbrooke’s Cognitive Examination (ACE-III), Alzheimer’s Disease Cooperative Study – Activities of Daily Living Inventory (ADCS-ADL), and the Colorado Posterior Cortical Questionnaire (CPC-Q). Piloted PCA-targeted assessments included a rapid screening battery for PCA (VisCorD); three psychophysical tasks assessing center-surround contrast discrimination, global dot motion detection, and luminance increment detection in noise; and an English translation of the French-language Self-Assessment Questionnaire of Perceptual Abilities (Q-ACP). Results Significant declines in ACE-III (p = 0.02) and CDR-SB (p = 0.02), independent of age and symptom duration, were observed. All participants had abnormal CPC-Q scores. Two of three psychophysical tasks showed deficits too severe to be useful for tracking PCA. The Q-ACP demonstrated a high internal consistency. Conclusions This 6-month observational study offers preliminary insights into the performance of standard and PCA-specific outcome measures, suggesting that several may be sufficiently responsive and acceptable for a 12-month longitudinal validation study to confirm their utility as endpoints.</p>

Also flagged:DNAJB6DnaJ heat shock protein familyHsp40HSP70heat shock protein family AHSPH1
Journal Article 2025-09-21 No Snippets Mauthe M, Kampinga H, Reggiori F.
Show Full Abstract

Our recent study identifies a previously unrecognized requirement for protein aggregate fragmentation as a prerequisite for autophagic clearance of amorphous aggregates, a process that has been termed aggrephagy. We show that aggregate fragmentation depends on two distinct but cooperative components: the DNAJB6 (DnaJ heat shock protein family (Hsp40) member B6)-HSPA/HSP70 (heat shock protein family A (Hsp70))-HSPH1/HSP110 chaperone module and the 19S regulatory particles (RPs) of the proteasome. These factors act together to not only to fragment protein aggregates but also to compact them, enabling clustering of selective autophagy receptors (SARs) and subsequent local phagophore formation. Our results show that this fragmentase activity plays a role in the aggrephagic clearance of different aggregate species, including disease-related HTT (huntingtin) aggregates.<b>Abbreviations:</b> CLPB-caseinolytic peptidase B protein homolog; DNAJB6-DnaJ heat shock protein family (Hsp40) member B6; dualPIM-dual-particles induced by multimerization; ER-endoplasmic reticulum; HSPA/HSP70-heat shock protein family A (Hsp70); HTT-polyQ119-huntingtin with an expanded polyglutamine stretch of 119 units; RP-regulatory particle; SAR-selective autophagy receptor.

Also flagged:RETreceptor tyrosine kinaseKMT2Aacute myeloid leukaemia
Journal Article 2025-09-21 No Snippets Chavan A, Frett B, Armstrong DT, Acharya B, Lockyer P, Boerma M, Roy Choudhury S.
Show Full Abstract

No abstract available.

SERPINC1
Also flagged:coagulationinvasive meningococcal diseaseMDinvasive bacterial infectionsCFPFCGR2A
Journal Article 2025-09-21 ✓ 1 Snippet Bellos E, van Leeuwen K, Duret A, Hodeib S, Mashbat M, Kohlfuerst DS, Boeddha NP, Schlapbach LJ, Wright VJ, Fink CG, van der Flier M, van Deuren M, Sprong T, López-Trascasa M, López-Lera A, Martinón-Torres F, Salas A, Santillo D, Zenz W, Driessen GJ, Anderson ST, Secka F, Paulus S, de Groot R, Emonts M, Carrol ED, Herberg J, Levin M, Sancho-Shimizu V, Kuijpers T, EUCLIDS Consortium.
In-Text Gene Mentions

…VWF, PROS1, andSERPINC1, relevant to coagulation…

Show Full Abstract

<h4>Background</h4>The complement and coagulation pathways are implicated in the systemic manifestations of invasive meningococcal disease (MD). However, the genetic landscape of these 2 interconnected plasma proteolytic pathways has not been systematically explored.<h4>Objective</h4>We sought to investigate how genetic variation in the complement and coagulation pathways contributes to invasive MD.<h4>Methods</h4>Whole-exome sequencing (WES) and high-coverage amplicon-based sequencing were performed in a large series of 229 patients with MD. A group of 275 patients with other invasive bacterial infections was used as a control cohort.<h4>Results</h4>WES data showed an enrichment of rare variants in the complement and coagulation genes in MD, namely, CFP and FCGR2A. In a subcohort of severe MD, CFP and SERPINE1 were enriched for rare variants compared with the control cohort. Combining the amplicon panel and the WES data sets, 1 mild hemophilia A case, 5 properdin mutated individuals, and 4 digenic complement deficiencies were identified. In addition, a significant copy number variant association in the CFH/CFHR1-5 gene cluster was reported. This provides strong support for the role of complement regulation in MD. Furthermore, there are pathogenic variants in VWF, PROS1, and SERPINC1, relevant to coagulation and fibrinolysis.<h4>Conclusions</h4>The study demonstrates the value of a mechanistic pathway approach to describe the genetic landscape of infectious disease, particularly in understanding its course and outcome. Notably, we identify complement-mediated thrombotic microangiopathy as a key pathophysiologic mechanism involved, particularly in MD.

TRIM38
Also flagged:TRIMtripartite motif (TRIM)metabolismE3 ubiquitin ligasesglucoselipid
Journal Article 2025-09-21 ✓ 1 Snippet Wang J, Wang Q, Li X, Cai Q, Bi Y, Xu C, Bai H, Gu L, Chang G, Chen S.
In-Text Gene Mentions

…For example,TRIM38, TRIM11, and TRIM24…

Show Full Abstract

Recent findings have broadened our understanding of the tripartite motif (TRIM) protein family, positioning these proteins as pivotal regulators of cellular metabolism and cell fate. Primarily functioning as versatile E3 ubiquitin ligases, TRIM proteins orchestrate key metabolic pathways-including glucose, lipid, and amino acid metabolism-through both ubiquitination-dependent and -independent mechanisms such as oligomerization and epigenetic modification. For example, TRIM38, TRIM11, and TRIM24 have been reported to modulate glycolytic flux and insulin signaling by targeting key glucose transporters and glycolytic enzymes, with effects on cancer metabolism and insulin responses in model systems. Similarly, TRIM21 and TRIM56 have been implicated in fatty acid synthesis, oxidation, and cholesterol balance, with potential relevance to fatty-liver conditions and atherosclerosis. Moreover, TRIM-mediated regulation of amino acid metabolism-particularly through pathways involving glutamine and branched-chain amino acids-plays a central role in tumor metabolic reprogramming and survival. Beyond enzymatic regulation, TRIM proteins exert non-canonical functions through epigenetic modulation and interactions with signaling networks. This review synthesizes current insights into the multifaceted roles of TRIM proteins in metabolic control and cell death, suggesting that ferroptosis may link TRIM proteins to lipid and amino acid metabolism, and highlights the connection between TRIM proteins and metabolic stress as a key area for future research.

Also flagged:Gene TransferplastidssynthesisglycosidedetoxificationRNA
Journal Article 2025-09-21 No Snippets Azad RB, Kasfy SH, Molla K, Islam T.
Show Full Abstract

Horizontal gene transfer (HGT), a fundamental process long acknowledged in prokaryotic evolution, is increasingly recognized as a pivotal force in shaping the evolutionary trajectories of eukaryotes, including plants. Despite its established significance in prokaryotic adaptation, the role of HGT in eukaryotic evolution is still understudied. HGT plays a pivotal role in the evolution of eukaryotes, giving rise to novel features that allow organisms to exploit new environments and resources with reduced competition. Moreover, the coevolution of interacting organisms in any ecosystem is greatly influenced by HGT. Recent discoveries of HGT events among eukaryotic species such as gene transfers from fungi to plants and from plants to whiteflies highlight the importance of understanding this phenomenon in the context of plant biology. In this review, we provide an update of recent findings related to plant and associated organisms like microorganisms, insects, and critically discuss the profound implications of HGT for plant evolution and adaptation, probing into potential underlying mechanisms, highlighting the knowledge gap and discussing their implications. In particular, we explore the potential applications of the new knowledge of HGT in plant biotechnology, illuminating its pivotal role in shaping the future landscape of bioengineering.

Also flagged:Cleidocranial dysplasiaskeletal disorderdysostoseossificationRUNX2chromosome
Journal Article 2025-09-21 No Snippets Giri AK, Thapa B, Chaudhary M.
Show Full Abstract

Cleidocranial dysplasia (CCD) is a rare congenital skeletal disorder characterized by clavicular hypoplasia, craniofacial anomalies, and complex dental abnormalities, commonly caused by RUNX2 gene mutations. This report describes a 25-year-old female who presented with acute dental pain. Clinical examination revealed short stature, frontal bossing, open fontanelles, and retained primary teeth. Radiographic assessments, including panoramic radiography, chest X-ray, and cone-beam computed tomography, confirmed the presence of clavicular hypoplasia, multiple impacted and supernumerary teeth, Wormian bones, and delayed tooth eruption. Quantitative analysis of the panoramic radiograph was performed using established diagnostic criteria, including zygomatic arch downward bend, distance between coronoid and condyle, and best-fit gonial circle measurements, which further supported the diagnosis. A definitive diagnosis of CCD was made based on clinical and radiological findings in the absence of genetic confirmation. Emergency root canal treatment was performed to relieve acute irreversible pulpitis in tooth 46. Although genetic testing and definitive surgical-orthodontic rehabilitation were not pursued due to socioeconomic constraints, the case highlights the importance of conventional imaging in reaching a diagnosis in low-resource settings. It highlights the importance of early recognition and multidisciplinary care to address functional, aesthetic, and psychosocial challenges associated with CCD.

CACNA1E
Also flagged:Human epidermal growth factor receptor 2HER2breast cancertumorsantibodiestyrosine kinase
Journal Article 2025-09-21 ✓ 2 Snippets Yang Y, Pan L, Zhou W, Shao Z.
In-Text Gene Mentions

…ABCA13, CSMD3, andCACNA1E(all P <…

…ABCA13, CSMD3, andCACNA1E, in contrast to…

Show Full Abstract

<h4>Background</h4>The emergence of novel human epidermal growth factor receptor 2 (HER2)-targeting drugs has provided a new therapeutic option for HER2-low triple-negative breast cancer (TNBC) patients who had limited treatment choices previously. However, the biological implications and prognostic significance of HER2-low status in TNBC are still not fully appreciated.<h4>Methods</h4>Utilizing a single-center multi-omics cohort of TNBC patients that includes whole exome sequencing and RNA sequencing data, this study aims to explore the clinical and molecular characteristics between HER2-low and HER2-0 TNBC.<h4>Results</h4>The study comprised 207 patients with HER2-low TNBC and 153 patients with HER2-0 TNBC. Findings revealed that HER2-low tumors exhibited lower tumor grade, more nodal involvement and lower Ki-67 index compared to HER2-0 tumors. Additionally, HER2-low TNBC were associated with more mutations in PIK3CA and its corresponding pathways, a more prominent clock-like mutation signature, along with activation of androgen receptor (AR)-related pathways and fatty acid metabolism. While HER2-low status did not significantly influence recurrence-free survival (RFS) across the entire study population, HER2-low patients showed significant better RFS compared to HER2-0 patients within the luminal androgen receptor (LAR) subtype. This distinction was also evident at molecular level.<h4>Conclusion</h4>HER2-low TNBC demonstrated unique clinical, transcriptomic and genomic characteristics when contrasted with HER2-0 TNBC. In the LAR subtype, a clear molecular and prognostic discrepancy between HER2-0 and HER2-low tumors was identified.

HFE
Also flagged:Hepatocellular Carcinomacirrhosisviral hepatitismetabolic disorderstumorsalpha-fetoprotein
Journal Article 2025-09-21 ✓ 1 Snippet Brito VA, Aroucha DCBL, Arruda AM, Furtado LCC, Fonseca VP, Oliveira-Filho PCR, Branco ELPC, Brito MFBL, Pereira LMMB.
In-Text Gene Mentions

…conditions such ashemochromatosisor alpha-1-antitrypsin deficie…

Show Full Abstract

<b>Introduction:</b> Hepatocellular carcinoma (HCC), commonly associated with cirrhosis and factors such as viral hepatitis and metabolic disorders, is often diagnosed at advanced stages, influencing survival. Transarterial chemoembolization (TACE) is a primary therapeutic approach aimed at prolonging survival or serving as a link to liver transplantation. <b>Objective:</b> To identify factors associated with the response to TACE by modified Response Evaluation Criteria in Solid Tumors (mRECIST) in patients with HCC. <b>Materials and Methods:</b> This is a retrospective cohort study conducted at a Liver Institute in Brazil, including patients with HCC at Stages A and B treated with TACE from January 2011 to December 2021. Data were collected from electronic or digitized physical medical records and included demographic, clinical-laboratory, and tumor-related variables. Radiological response was assessed using mRECIST criteria. Statistical analysis encompassed various tests, with a significance level of 5%. <b>Results:</b> Seventy-six patients were evaluated, the majority being male (67.1%), with a median age of 62 years (57.0-70.0). Patients who responded to TACE showed a significant reduction in lesion size (<i>p</i> < 0.001) compared to the nonresponding group, resulting in lesion enlargement (<i>p</i> = 0.047). Only 38.2% of patients showed an objective response after the first TACE, with a trend towards a higher response in patients with stable disease (<i>p</i> < 0.001). Hepatitis C virus (HCV) etiology was associated with a higher chance of treatment response (<i>p</i> = 0.032). Initial disease staging was characterized by single tumors, while intermediate staging presented larger tumors after TACE. <b>Conclusion:</b> The association between HCV-induced cirrhosis and a better response to TACE underscores the importance of assessing liver function status in determining therapeutic response. No association was identified between pre-TACE alpha-fetoprotein levels and a higher likelihood of radiological response.

HFE
Also flagged:Non-alcoholic Fatty Liver DiseaseNAFLDmetabolic syndromealanine aminotransferaseALTinsulin resistance
Journal Article 2025-09-21 ✓ 1 Snippet Ahmad Z, Ghufran MH, Khan S, Muzaffar Z, Muhammad Safwan Q, Shuja MN, Usman H, Khan U, Ullah S, Jan SAA, Ullah N.
In-Text Gene Mentions

…autoimmune hepatitis, orhemochromatosis; pregnancy or lactation;…

Show Full Abstract

<h4>Background</h4> Non-alcoholic fatty liver disease (NAFLD) is a growing global health concern linked to metabolic syndrome (MetS) and insulin resistance.<h4>Objective</h4> The objective of the study is to compare the effectiveness of lifestyle interventions versus pharmacological therapy in the management of NAFLD across multiple healthcare centers using a real-world observational cohort design.<h4>Methodology</h4> This multicentric observational cohort study was conducted from January 2023 to December 2024 at the Lady Reading Hospital (LRH), Peshawar, and Hayatabad Medical Complex (HMC), Peshawar. The 12-month follow-up was completed by 367 (90.84%) of the 404 patients who were recruited. Participants were split into two groups: one for pharmaceutical treatment (n = 179) and another for lifestyle intervention (n = 188). At baseline and after a year, clinical, biochemical, and radiological data were evaluated. Statistical Package for the Social Sciences (SPSS) version 26 (IBM Corp., Armonk, NY, US) was used for data analysis.<h4>Results</h4>The lifestyle group showed significantly greater reductions in weight (-4.52 ± 2.10 kg vs. -1.65 ± 1.44 kg; p < 0.001), body mass index (BMI) (-1.43 ± 0.65 vs. -0.52 ± 0.48 kg/m²; p < 0.001), alanine aminotransferase (ALT) (-18.77 ± 10.84 vs. -15.23 ± 9.45 U/L; p = 0.004), and FibroScan (transient elastography) scores (-1.98 ± 0.84 vs. -1.47 ± 0.78 kPa; p < 0.001) compared to the pharmacological group. ALT reduction > 30% was observed in 112 (59.57%) lifestyle patients versus 89 (49.72%) pharmacological patients (p = 0.048), and BMI reduction ≥ 5% in 106 (56.38%) vs. 41 (22.91%), respectively (p < 0.001).<h4>Conclusion</h4> Lifestyle intervention is more effective than pharmacological therapy in improving metabolic and liver-related outcomes in NAFLD patients.

Also flagged:RUNX2alkaline phosphatasecollagen Isynthesismineralizationalginate
Journal Article 2025-09-21 No Snippets İyisan N, Rangel F, Funke L, Pan B, Özkale B.
Show Full Abstract

Sustained mechanical stimulation represents a powerful strategy for directing stem cell fate, yet its application within microscale injectable carriers remains limited. This study presents a dynamic microgel platform enabling osteogenic differentiation of single mesenchymal stem cells (MSCs) solely through hydrostatic pressure, without biochemical induction. Individual MSCs are encapsulated in ionically crosslinked, cell-adhesive alginate microgels and stabilized using an alginate-poly-l-lysine-alginate and calcium coating. Application of cyclic hydrostatic pressure at 200 kPa and 0.5 Hz frequency for 30 min per day leads to upregulation of early osteogenic markers RUNX2 and alkaline phosphatase, enhanced collagen I synthesis, and mineralization over 21 days. Results demonstrate that mechanical cues alone are sufficient to orchestrate osteogenic commitment in soft, confined microenvironments, offering a scalable approach to stem cell programming. This work establishes a versatile, high-resolution platform for engineering lineage specification at the single-cell level and highlights the potential of force-driven strategies for scalable production of therapeutic stem cells.

bioRxiv 2025-09-21 Preprint (No Snippets API) Go D, Lu B, Song L.
Show Full Abstract

Somatic embryogenesis, a developmental process advantageous as an alternative means for plant propagation due to the lack of maternal tissues and the ease of in vivo to in vitro knowledge transfer of embryogenesis, has been applied in studies on the regulatory mechanisms governing the developmental plasticity in plants. Core and accessory components of the polycomb repressive complexes (PRCs), the epigenetic regulatory machinery, are known to repress the transcription of genes that positively regulate the somatic embryogenesis in seedlings. Recent studies revealed that Arabidopsis thaliana SEED DORMANCY 4-LIKE (AtSDR4L), an interactor of a PRC accessory, represses the embryo developmental program for a successful switch from seed to seedling. However, little is known about the regulation of cell differentiation by AtSDR4L in seedlings. Here, we show that AtSDR4L, its paralog Dynamic Influencer of Gene expression 2 (DIG2), and PRC components share similar transcriptional regulatory dynamics, particularly on somatic embryogenesis-related genes. We further demonstrate that mutations in AtSDR4L and DIG2 lead to the formation of somatic embryo-like structures and a delay in cellular differentiation. Thus, transcriptional changes reflected by morphological defects associated with somatic embryogenesis in Atsdr4l dig2 mutants suggest that AtSDR4L and DIG2 prevent the dedifferentiation of cells for proper seedling growth through the transcriptional control of cell identity.

Also flagged:Hsp70Hsp90Molecular chaperonesHeat shock protein 70chaperonesco-chaperones
Journal Article 2025-09-20 No Snippets Backe SJ, Heritz JA, Mollapour M.
Show Full Abstract

Molecular chaperones maintain proteostasis by assisting protein folding, stability, and activity. Heat shock protein 70 (Hsp70) and Hsp90 (Hsp90) are ATP-dependent chaperones essential for protein quality control, signaling, and stress adaptation. Their activities are controlled not only by co-chaperones, but also by dynamic post-translational modifications (PTMs). This review dissects phosphorylation, acetylation, methylation, ubiquitination, glycosylation, and other PTMs of Hsp70 and Hsp90 across systems. These PTMs regulate the ATPase activity, localization, and interactions of the molecular chaperones with major implications in health and disease. The term "chaperone code" describes the PTM landscape that fine-tunes chaperone function. This code governs client fate, drug sensitivity, and stress responses. Importantly, combinatorial PTMs introduce regulatory complexity and flexibility, especially in cancer, neurodegeneration, and inflammation. The crosstalk between various PTMs and feedback loops add new regulatory layers to chaperone function. Additionally, these PTMs impact the function of the clients that are central in regulating specific cellular processes or pathways, such as transcription, autophagy, metabolism, and immune regulation. These pathways are usually affected in different maladies, such cancer, neurodegenerative, infectious and chronic diseases. Unlocking the chaperone code is essential for directing chaperone activity toward therapeutic benefit. This can be achieved by targeting enzymes that write, erase, or read the chaperone code, thereby offering new therapeutic strategies.

Also flagged:Tetrodotoxinion channels
Journal Article 2025-09-20 No Snippets Li Y, Zhang C, Han L, Qian Z.
Show Full Abstract

Tetrodotoxin (TTX)-sensitive/Nav1.7- and TTX-resistive/Nav1.8 Na<sup>+</sup> channels contribute to neuroexcitation in the sensory neurons of the nodose ganglion (NG); however, their specific roles remain debatable. Therefore, we aimed to study the action potential (AP) elicited from NG neurons isolated from adult rats and simulated by a dynamic current clamp (DCC) using gNa0/Nav1.7 and/or gNa1/Nav1.8 injection. We trained and tuned the voltage-dependent profiles of the Na<sup>+</sup> current generated from the DCC using the Hodgkin-Huxley/Vandenberg models to match the AP parameters elicited by a brief pulse. A- or C-type AP could be simulated using DCC by applying gNa0 or gNa0/gNa1 alongside reduced gNa0 to avoid overshooting the up-stroke. This indicates the indispensability of these two Na<sup>+</sup> channels for shaping the AP trajectory with tight orchestration. The hump over the repolarization period featuring C-type neurons could be generated using DCC by adding gNa1 in this cellular model. Furthermore, both A- and C-type repeated discharges can be simulated using gNa0 or gNa1 with a reduced gNa0. Similar experiments were performed on human embryonic kidney 293 cells with stable Nav1.7 expression to mimic A-type-like conditions for further verification. Both A- and C-type-like APs were simulated in this expression system by adding gNa0 or gNa0/gNa1. Therefore, Nav1.7/Nav1.8 is crucial in shaping the AP trajectory, with specific timing for Nav1.8 activation to retain neuroexcitation in the sensory nervous system. Additionally, this pilot study will establish a fundamental base for the pharmacological screening of targeted ion channels and validate the disease-based mechanism in cardiology and neuroscience.

Also flagged:immune responseinfectionimmune responsescytokinesepsisorgan dysfunction
Journal Article 2025-09-20 No Snippets Gu S, Zhang P, Zhang C, Tang T, Chang T, Dong L, Gao W, Tang Z.
Show Full Abstract

Sepsis represents a dynamic, dysregulated host immune response to infection in which unconventional T cells-γδ T cells, mucosal-associated invariant T (MAIT) cells, natural killer T (NKT) cells, and double-negative T cells-actively shape the balance between early hyperinflammation and subsequent immune paralysis across time and tissues. These cells employ unique antigen recognition mechanisms to trigger rapid immune responses. γδ T cells facilitate early pathogen elimination and immune regulation, whereas MAIT cells detect microbial metabolites and modulate the systemic inflammation. NKT cells balance immune homeostasis through dual pro- and anti-inflammatory cytokine production. This review classifies these subsets and examines their sepsis-related functions alongside immunotherapies targeting them, such as cytokine manipulation, immunomodulators, and checkpoint inhibitors. Elucidating the precise mechanisms underlying sepsis could advance therapies that restore immune equilibrium and potentially improve clinical outcomes. Future studies should unravel the interactions between unconventional T cells and broader immune networks while translating the findings into practical treatments. Understanding the dynamic roles of these cells provides pathways for tailored interventions in sepsis management.

ZNFX1
Also flagged:LTFMMP9SepsisAcute Lymphoblastic LeukemiaALLGene Expression
Journal Article 2025-09-20 ✓ 1 Snippet Xiao YP, Cheng YC, Chen C, Xue HM, Yang M, Lin C.
In-Text Gene Mentions

…NFX1-Type Containing 1 (ZNFX1) antisense RNA 1…

Show Full Abstract

<b>Background:</b> Pediatric sepsis is a life-threatening disease that is associated with the progression of acute lymphoblastic leukemia (ALL) and the recurrence of B-cell ALL (B-ALL). Although previous studies have reported a partial association between sepsis and ALL, there is limited research on the shared genes between pediatric sepsis and relapsed B-ALL. This study aims to further elucidate the more comprehensive and novel common genetic factors and molecular pathways between the two diseases. <b>Methods:</b> Gene expression datasets pertaining to pediatric sepsis (GSE13904, GSE80496) and relapsed B-ALL (GSE3910, GSE28460) were retrieved from the Gene Expression Omnibus database for this retrospective analysis. The initial analysis identified differentially expressed genes common to both pediatric sepsis and relapsed B-ALL. Subsequent investigations employed three complementary approaches: protein-protein interaction networks, molecular complex detection (MCODE) clustering functions, and support vector machine recursive feature elimination model to separately identify the diagnostic biomarkers for each condition. Importantly, key common genes were identified by overlapping the diagnostic genes for pediatric sepsis and relapsed B-ALL. Further characterization involved comprehensive functional analysis through the Metascape platform, construction of transcription factor (TF)-mRNA-microRNA (miRNA) networks, drug prediction, and molecular docking to explore their biological significance and potential therapeutic targets. <b>Results:</b> Comparative analysis of pediatric sepsis-related and relapsed B-ALL-related datasets revealed two shared genetic markers, lactotransferrin (LTF) and matrix metallopeptidase 9 (MMP9), exhibiting diagnostic significance and consistent upregulation in both disease groups. Transcriptional regulatory network analysis identified specificity protein 1 (SP1) as the principal transcription factor capable of coregulating LTF and MMP9 expression. In addition, molecular docking demonstrated high-affinity interactions between curcumin and MMP9 (-7.18 kcal/mol) as well as reserpine and LTF (-5.4 kcal/mol), suggesting their potential therapeutic utility for clinical evaluation. <b>Conclusions:</b> These findings elucidate the molecular pathogenesis involving LTF and MMP9 in pediatric sepsis and relapsed B-ALL, providing novel insights for clinical diagnosis and therapeutic development.

HFE
Also flagged:neurodegenerative disorderPDpathogenesistauβ-amyloidmethylation
Journal Article 2025-09-20 ✓ 1 Snippet Laffita-Mesa JM, Paucar M, Svenningsson P.
In-Text Gene Mentions

…, PLPP4 ,HFE, LRRK2 ,…

Show Full Abstract

Parkinson's disease (PD), the second most common neurodegenerative disorder globally, has a notably high prevalence in Sweden (136/10<sup>5</sup>). Although monogenic forms represent only a small subset of PD cases, several genetic factors-including nucleotide repeat expansions (NREs) in <i>ATXN2</i>, <i>ATXN3</i>, <i>C9ORF72</i>, <i>TBP</i>, <i>POLG</i>, <i>TOMM40</i>, <i>CACNA1A</i>, and <i>PRNP</i>-have been implicated in neurodegenerative conditions with parkinsonian features. However, their contribution to PD pathogenesis in the Swedish population remains understudied. We analyzed DNA from 161 Swedish PD patients and 546 controls and evaluated clinical and CSF biomarkers (tau, phospho-tau, and β-amyloid). Intermediate <i>ATXN2</i> CAG expansions were significantly associated with PD (3.40%, <i>p</i> = 0.0027), and novel promoter structural variations were identified. <i>C9ORF72</i> G4C2 expansions were also linked to PD (2.48%, <i>p</i> = 0.0018), with distinct methylation patterns in PD cases. POLG Not-10/Not-11Q alleles were positively associated (9.62%, <i>p</i> = 0.014), while <i>TOMM40</i> showed partial associations for rare genotypes (14.28%, <i>p</i> = 0.0014). Pathological expansions in <i>TBP</i> were marginally significant, while <i>ATXN3</i>, <i>CACNA1A</i>, and <i>PRNP</i> showed no associations. Two-way ANOVA identified significant interactions between <i>APOE E3</i>/<i>E4</i> and <i>POLG</i> 10/11Q genotypes, affecting age at diagnosis (<i>p</i> = 0.025) and CSF β-amyloid levels. Regression highlighted tau as a key predictor of age at diagnosis (<i>p</i> = 0.02). Longitudinally, <i>APOE E4</i> predicted cognitive decline (<i>p</i> = 0.015), and <i>TOMM40</i> haplotypes correlated with motor deficits. In conclusion, <i>ATXN2</i>, <i>C9ORF72</i>, and <i>POLG</i> emerge as key genetic risk factors for PD in the Swedish population, with <i>TOMM40</i> and <i>TBP</i> contributing partially. Altered CSF biomarker patterns support the existence of distinct molecular subtypes and warrant further investigation of novel <i>ATXN2</i> variants as potential PD modifiers.

Also flagged:glassesTricalciumHydroxyapatiteapatitesynthesiscrystal violet
Journal Article 2025-09-20 No Snippets De Micco S, Bellucci D, Cannillo V.
Show Full Abstract

The development of bioactive glasses (BGs) and ceramics, such as β-Tricalcium phosphate (β-TCP), Hydroxyapatite (HAp), and apatite-wollastonite (A-W), has revolutionized regenerative medicine (RM), offering innovative solutions for bone and tissue repair, due to the ability of these materials to bond with living bone tissue. Despite significant advancements, evaluating the bioactivity and biological responsiveness of these biomaterials remains a critical challenge. This review provides a comprehensive synthesis of the available methodologies, critically analyzing their advantages, disadvantages, and the possible gap between in vitro and in vivo assessments, including false positives and false negatives. Classical immersion tests techniques for bioactivity evaluation in simulated physiological solutions, such as simulated body fluid (SBF), Tris-buffer (TRIS), or phosphate-buffered saline (PBS) solutions, are discussed, along with the more innovative Simulated Wound Fluid (SWF). Additionally, traditional standardized methods, such as MTT, BrdU, EdU, and XTT, as well as emerging methods like qPCR and immunocytochemistry, used to study cellular behavior, proliferation, adhesion, and differentiation, are compared. Staining assays, including crystal violet, neutral red, and alizarin red, have also been investigated for their effectiveness in evaluating cellular adhesion and quantification. Notably, while all techniques have shown promise in studies involving BGs and ceramics, a multi-parametric approach remains the most reliable strategy for assessing bioactivity and biological responsiveness, highlighting the need for comprehensive studies to validate the results. Finally, the choice between static and dynamic approaches represents a further critical issue, as it significantly affects assay outcomes.

PRDX6
Also flagged:Male Infertilityunexplained infertilityOxidative Stress InfertilityOxidative StressInfertilityof the
Journal Article 2025-09-20 ✓ 1 Snippet Jašinskienė E, Čaplinskienė M.
In-Text Gene Mentions

…mitochondrial function (e.g.,PRDX6, SOD1, AKAP4)—are not…

Show Full Abstract

<i>Background and Objectives</i>: Male infertility is a growing public health concern, with up to 50% of cases lacking a clearly identifiable cause. This study aimed to assess the epidemiological characteristics of male infertility in Lithuania and evaluate the clinical utility of oxidative stress assessment using the MiOXSYS system. <i>Materials and Methods</i>: A two-stage retrospective study was conducted between 2019 and 2023 at one of the largest fertility centers in Lithuania. The first stage involved an epidemiological analysis of 718 men who met the inclusion criteria. In the second stage, 261 men underwent oxidation-reduction potential (ORP) testing using the MiOXSYS system. Semen parameters were evaluated according to World Health Organization (WHO) 2010 guidelines. ROC curve analysis was used to assess the diagnostic value of ORP. <i>Results</i>: Male infertility was identified as the sole factor in 20.1% of couples, while unexplained infertility accounted for 24.4% of all cases. Among normozoospermic men, 48.5% exhibited elevated ORP levels (>1.34 mV/10<sup>6</sup> sperm/mL). ROC analysis demonstrated moderate diagnostic accuracy of ORP (AUC = 0.634; sensitivity: 75.3%; specificity: 51.5%). The inclusion of ORP testing reduced the proportion of unexplained cases and supported their reclassification under the Male Oxidative Stress Infertility (MOSI) framework. <i>Conclusions</i>: This study provides novel epidemiological data on male infertility in Lithuania and highlights the potential of ORP testing as a supplementary diagnostic tool. Systematic evaluation of oxidative stress may help better identify cases previously labeled as unexplained and enable more personalized treatment strategies.

Also flagged:glaucomaNrf2blindnessflavonoidfarreroloxygen
Journal Article 2025-09-20 No Snippets Wang J, Liu Y, Rong R, Xia X.
Show Full Abstract

Glaucoma, a leading cause of irreversible blindness, is characterized by progressive retinal ganglion cell (RGC) degeneration with limited treatment options. The natural flavonoid farrerol exhibits neuroprotective potential through antioxidative and anti-inflammatory effects, but its therapeutic application is limited by poor bioavailability and photodegradation. This study investigates farrerol's neuroprotective mechanisms and develops an optimized nanoformulation for enhanced efficacy. In vitro oxygen-glucose deprivation/reperfusion (OGD/R) and in vivo ischemia-reperfusion (IR) models demonstrate that farrerol significantly improves RGC survival and visual function. Mechanistic studies reveal that farrerol activates the nuclear factor erythroid 2-related factor 2 (Nrf2) antioxidant pathway, reduces reactive oxygen species (ROS) accumulation, and modulates key ferroptosis markers (glutathione peroxidase 4 (GPX4) and acyl-CoA synthetase long-chain family member 4 (ACSL4)), thereby inhibiting RGC apoptosis. To overcome delivery limitations, farrerol-loaded bilirubin nanoparticles (FB-NPs) are developed, showing enhanced stability and neuroprotective effects in glaucomatous injury models. These findings identify the Nrf2/ferroptosis/apoptosis axis as a novel therapeutic target and present an effective nanodelivery strategy for glaucoma treatment.

ZNF644
Also flagged:COVID-19infectious diseaseslipiddegradationribonucleasespseudouridine
Journal Article 2025-09-20 ✓ 1 Snippet Ige MA, Ren X, Yang Y, Zhang H, Shen C, Jiang Y, Li J, Wan X.
In-Text Gene Mentions

…LRRC4 , andZNF644that were undetected…

Show Full Abstract

mRNA therapeutics have revolutionized medicine, offering a versatile platform to address previously untreatable diseases. Recent advancements in biotechnology have enabled the efficient production of functional proteins, antibodies, and peptides via mRNA, providing rapid and adaptable solutions for vaccine development and therapeutic interventions. The success of mRNA vaccines, exemplified during the COVID-19 pandemic, underscores their potential for combating infectious diseases with unparalleled speed and scalability. This review explores the latest developments in mRNA technology, including innovations in design, delivery, and disease treatment; modulation of immune response; and the role of AI. Particular emphasis is placed on optimizing mRNA constructs to maximize therapeutic efficacy, new delivery vehicles for mRNA, and the modulations of immune response evoked by mRNA vaccines. The potential applications of mRNA therapeutics in genetic disorders, infectious diseases, and cancer are highlighted, alongside a discussion of existing challenges such as delivery efficiency and production scalability. By integrating molecular biology, RNA technology, and nanotechnology, mRNA therapeutics hold the promise of transforming precision medicine. These advancements offer hope for patients with complex or intractable conditions, paving the way for a new era in targeted therapies and personalized healthcare.

CSE1L
Also flagged:Cognitive dysfunctionAlzheimer's diseaseADAPPPS1GPX1
Journal Article 2025-09-19 ✓ 4 Snippets Mao R, Zhao S, Chen J, Wang L, Zheng K, Li B.
In-Text Gene Mentions

…were identified: GPX1,CSE1L, and SULT1A1.…

…indicated that GPX1,CSE1L, and SULT1A1 are…

…of GPX1 andCSE1L, and high expression…

…GPX1,CSE1L, and SULT1A1 serve…

Show Full Abstract

Cognitive dysfunction associated with various diseases and its biomarkers have been extensively studied. However, research focusing on biomarkers related to cognitive function remains limited. This study aims to identify potential biomarkers associated with cognitive function and validate them through <i>in vitro</i> and <i>in vivo</i> experiments to address the current research gaps. We employed GWAS, PWAS, and TWAS analyses, combined with Mendelian randomization and colocalization analysis, to identify potential cognitive function-related biomarkers from European cohorts. An Alzheimer's disease (AD) cell model was established in SH-SY5Y and BV2 cells using Aβ<sub>25-35</sub> oligomers, and an APP/PS1 (AD mouse model) was purchased. The mRNA and protein expression levels of potential biomarkers were assessed in AD cells and mouse models using RT-qPCR and western blotting. Immunofluorescence was used to evaluate the fluorescence expression of these biomarkers in the AD cells, while immunohistochemistry was employed to assess staining intensity in the dorsolateral prefrontal cortex of AD model mice. Three potential biomarkers associated with cognitive function were identified: GPX1, CSE1L, and SULT1A1. KEGG enrichment analysis indicated that GPX1, CSE1L, and SULT1A1 are involved in various metabolic pathways, including those related to amyotrophic lateral sclerosis and Huntington's disease signaling. RT-qPCR and western blotting revealed low expression of GPX1 and CSE1L, and high expression of SULT1A1 in both AD cells and mouse models. These findings were further confirmed by immunofluorescence and immunohistochemistry, which demonstrated similar expression patterns in the AD cell and mouse models. GPX1, CSE1L, and SULT1A1 serve as biomarkers of cognitive function.

Also flagged:viral infectionviral infectionsantibodiesCCR5FUT2viral diseases
Journal Article 2025-09-19 No Snippets Langlois RA, Casanova JL.
Show Full Abstract

Human monogenic traits can confer resistance to viral infection in exposed individuals or predisposition to severe disease in infected individuals. Enhanced susceptibility can be driven directly by mutations in genes essential for control of the virus or indirectly via the production of autoantibodies against components of host defense. While the impact of viruses on individuals carrying these genotypes permitted their identification and has been amply studied, little is known about the impact of these human genotypes on the natural history of viruses, including not only persisting but also emerging viruses. We envisage several scenarios, including the possibility that genetically susceptible individuals serve as patient zeros, superspreaders, or mutation incubators, or that genetically resistant individuals even permit the selection of new viral mutants. Viruses are continually shared between individuals and even host species, where they can benefit from adaption to new environments. Current human viruses, as well as novel viruses from animal reservoirs, will continue to threaten the human population. Improvements in the scale of human genomic sequencing and analysis will permit testing hypotheses about the impact of human genetics on the origin and trajectory of viral infections, including future pandemics, which may ultimately help to prevent or curtail impending outbreaks.

HTT
Also flagged:HuntingtinHDpolyglutamineendocytosismetabolismcell division
Journal Article 2025-09-19 ✓ 5 Snippets Carpentier R, Kim J, Capizzi M, Kim H, Fäßler F, Hansen JM, Kim MJ, Denarier E, Blot B, Degennaro M, Labou S, Arnal I, Marcaida MJ, Peraro MD, Kim D, Schur FKM, Song JJ, Humbert S.
In-Text Gene Mentions

…Huntingtin (HTT) is a very…

HTTis ubiquitously expressed…

…protein: for example,HTTfacilitates intracellular tran…

HTThas been found…

…Consistent with this,HTThas been observed…

Show Full Abstract

The Huntingtin protein (HTT), named for its role in Huntington's disease, has been best understood as a scaffolding protein that promotes vesicle transport by molecular motors along microtubules. Here, we show that HTT also interacts with the actin cytoskeleton, and its loss of function disturbs the morphology and function of the axonal growth cone. We demonstrate that HTT organizes F-actin into bundles. Cryo-electron tomography (cryo-ET) and subtomogram averaging (STA) structural analyses reveal that HTT's N-terminal HEAT and Bridge domains wrap around F-actin, while the C-terminal HEAT domain is displaced; furthermore, HTT dimerizes via the N-HEAT domain to bridge parallel actin filaments separated by ~20 nanometers. Our study provides the structural basis for understanding how HTT interacts with and organizes the actin cytoskeleton.

POU3F2
Also flagged:Kabuki syndrome type 1neurodevelopmental disorderKMT2DH3K4 methyltransferaseKS1transcription factor
Journal Article 2025-09-19 ✓ 1 Snippet Cuvertino S, Martirosian E, Bhosale K, Cheng P, Garner T, Donaldson IJ, Jackson A, Stevens A, Sharrocks AD, Kimber SJ, Banka S.
In-Text Gene Mentions

…projection development (POU3F2, NTRK2 ) were…

Show Full Abstract

Kabuki syndrome type 1 (KS1) is a neurodevelopmental disorder caused by loss-of-function variants in KMT2D which encodes a H3K4 methyltransferase. The mechanisms underlying neurodevelopmental problems in KS1 are still largely unknown. Here, we track the epigenome and transcriptome across three stages of neuronal differentiation using patient-derived induced pluripotent stem cells (iPSCs) to gain insights into the disease mechanism of KS1. In KS1 iPSCs we detected significantly lower levels of functional KMT2D transcript and KMT2D protein, and lower global H3K4me1, H3K4me2 levels and modest reduction in H3K4me3. We identify loss of thousands of H3K4me1 peaks in iPSCs, neuronal progenitors (NPs) and early cortical neurons (CNs) in KS1. We show that the number of lost peaks increase as differentiation progresses. We also identify hundreds of differentially expressed genes (DEGs) in iPSCs, NPs and CNs in KS1. In contrast with the epigenomic changes, the number of DEGs decrease as differentiation progresses. Our analysis reveals significant enrichment of differentially downregulated genes in areas containing putative enhancer regions with H3K4me1 loss. We also identify a set of distinct transcription factor binding sites in differentially methylated regions and a set of DEGs related to KS1 phenotypes. We find that genes regulated by SUZ12, a subunit of Polycomb Repressive complex 2, are over-represented in KS1 DEGs at early stages of differentiation. In conclusion, we present a disease-relevant human cellular model for KS1 that provides mechanistic insights for the disorder and could be used for high throughput drug screening for KS1.

Also flagged:lactateoxygenmetabolismmitochondrialenzyme activitycitrate synthase
Journal Article 2025-09-19 No Snippets Fan J, Sun K, Liu X, Zhu T, Li Y.
Show Full Abstract

<h4>Purpose</h4>This study compared the effects of sprint interval training (SIT) versus high-intensity interval training (HIIT) on repeated sprint capacity and sport-specific performance in male tennis players.<h4>Methods</h4>Thirty collegiate tennis players (age: 22.39 ± 1.64 years) were randomly assigned to SIT (n = 15) or HIIT (n = 15) groups for an 8-week training intervention. Performance and physiological parameters were assessed using repeated sprint ability (RSA) test, hit-and-turn tennis test, and tennis-specific endurance test. Key metrics included maximal completed level, total time to exhaustion (TTE), repeated sprint parameters (RSATT, RSAbest, Sdec), maximal oxygen uptake ([Formula: see text]O₂max), ventilatory efficiency, and tennis performance index.<h4>Results</h4>Significant group × time interactions were observed for maximal completed level (F(1, 28)=22.649, p < 0.001, ηp2 = 0.89), RSATT (F(1, 28) =39.74, p < 0.001, ηp2 = 0.89), and ball accuracy (F(1, 28)=13.811, p < 0.001, ηp2 = 0.901). The SIT group showed greater improvements in maximal completed level (4.00 ± 0.28 vs. 2.14 ± 0.28, p < .001), RSATT (-4.84 ± 0.33s vs. -1.87 ± 0.33s, p < 0.001), and ball accuracy (12.85 ± 1.71% vs. 3.86 ± 1.71%, p < 0.001). Both groups improved significantly in [Formula: see text]O₂max (SIT: 52.84 ± 4.22 to 64.50 ± 3.85 mL.min-1.kg-1; HIIT: 51.79 ± 5.15 to 59.6 ± 4.44 mL.min-1.kg-1, p < 0.001) and TTE (SIT: ηp2 = 0.825; HIIT: ηp2 = 0.59). Time to the onset of blood lactate accumulation (OBLA) and second ventilatory threshold (VT2) showed significant main effects of time (p < .001) without group differences.<h4>Conclusion</h4>While both protocols improved aerobic fitness, SIT demonstrated superior effectiveness in enhancing tennis-specific performance, particularly in repeated sprint ability and technical stability. These findings suggest that SIT might be a more time-efficient training strategy for improving sport-specific performance in tennis players.

SUDS3
Also flagged:chromatinhead and neck squamous cell carcinomaChromatin factorshistonesnucleosomecancer
Journal Article 2025-09-19 ✓ 1 Snippet Cheng H, Jiang M, Kim S, Moshiri A, Dar MS, Akhtar J, Saloura V.
In-Text Gene Mentions

…], support thatchromatin modifiersmodifiers may have…

Show Full Abstract

Chromatin factors, defined here as proteins that chemically modify the DNA and histones, remodel chromatin and regulate nucleosome occupancy, play central roles in the transcriptional regulation of genes and are implicated in cancer initiation and progression in multiple cancer types. To systematically investigate the genomic and expression alterations of chromatin factors in head and neck squamous cell carcinoma (HNSCC), we utilized the molecular profiles from 530 HNSCC tumor samples in the Cancer Genome Atlas (TCGA), and characterized the mutational, copy number and transcriptional alterations of 422 chromatin factors, as well as their correlation with the "cold" tumor phenotype in HPV-negative and HPV-positive HNSCC. Histone-lysine N-methyltransferase 2D (MLL2) was the most frequently mutated chromatin factor in both HPV-negative and HPV-positive HNSCC, with mutation frequencies of 12-17 %. Actin Like 6A (ACTL6A), a component of the SWI/SNF chromatin remodeling complex, was the most frequently copy-number amplified chromatin factor in both HPV-negative and HPV-positive HNSCC, with amplification frequencies of 19-24 %. Double PHD Fingers 1 (DPF1), a component of the chromatin remodeling complex, and Ubiquitin Like With PHD AndRing Finger Domains1 (UHRF1) were the most overexpressed chromatin factors in HPV-negative and HPV-positive HNSCC tumors respectively. Components of the chromatin remodeling complex, such as ACTL6A, SMARCA1 and MORF4L2, were correlated with the "cold" tumor phenotype in both HPV-negative and HPV-positive HNSCC. This brief study highlights epigenetic chromatin factors that may drive oncogenesis and immune evasion, thereby identifying novel targets for cancer therapy in clearly defined, epigenetically-driven subtypes of HPV-negative and HPV-positive HNSCC.

Also flagged:Perchloric Aciddigestionnitrogenpeptidetrypsintrifluoroacetic acid
Journal Article 2025-09-19 No Snippets Albrecht V, Müller-Reif JB, Brennsteiner V, Mann M.
Show Full Abstract

Large-scale plasma proteomics studies offer tremendous potential for biomarker discovery but face significant challenges in balancing analytical depth, throughput, and cost-effectiveness. We present an optimized perchloric acid-based workflow with neutralization-PCA-N-that addresses these limitations. By introducing a neutralization step following protein precipitation, PCA-N enables direct enzymatic digestion without additional purification steps, reducing sample volume requirements to only 5 μl of plasma while maintaining deep plasma proteome coverage. The streamlined protocol allows preparation of over 10,000 samples per day using 384-well formats at costs comparable to undepleted plasma analysis (NEAT). Rigorous validation according to the recently introduced CLSI C64 guideline demonstrated that despite somewhat higher technical variability compared to NEAT, PCA-N maintained excellent biological resolution and reproducibility. We confirmed the workflow's exceptional stability through analysis of over 1700 quality control samples systematically interspersed among more than 40,000 plasma samples measured continuously over 353 days. Technical performance remained consistent across multiple instruments, sample preparation batches and nearly a year of measurements. Compared to NEAT plasma proteomics, PCA-N doubled the proteomic depth while maintaining comparable reagent costs and throughput. The minimal sample requirements, operational simplicity while using only common laboratory chemicals and exceptional scalability positions PCA-N as an attractive approach for population-level plasma proteomics, democratizing access to deep plasma proteomics analysis.

SOX6
Also flagged:Psoriasischronic inflammatory skin disorderkeratinocyte proliferationimmune responsespathogenesisMALAT1
Journal Article 2025-09-19 ✓ 1 Snippet Danis J, Széll M.
In-Text Gene Mentions

…Single-nucleotide polymorphismSOX6SRY-box transcription factor…

Show Full Abstract

Psoriasis is a chronic inflammatory skin disorder affecting approximately 2% of the global population, characterized by abnormal keratinocyte proliferation and dysregulated immune responses. This review examines the emerging role of long non-coding RNAs (lncRNAs) in psoriasis pathogenesis, highlighting their significance as regulatory molecules in disease initiation, progression, and chronicity. LncRNAs demonstrate distinct expression patterns in psoriatic lesions, with upregulated transcripts such as MALAT1, XIST, MIR31HG, and HOTAIR promoting keratinocyte hyperproliferation, inhibiting apoptosis, and amplifying inflammatory cascades through mechanisms including microRNA sponging and transcription factor modulation. These molecules primarily target key signaling pathways including NF-κB, STAT3, and PI3K/AKT. Conversely, downregulated lncRNAs like NEAT1, MEG3, and PRINS normally function as tumor suppressor molecules that maintain epidermal homeostasis through pro-apoptotic and anti-inflammatory mechanisms. Their reduced expression contributes to the pathological hyperproliferative phenotype characteristic of psoriatic skin. Importantly, genetic variants within lncRNA loci have been identified as significant contributors to psoriasis susceptibility and treatment responses across different populations. Single- nucleotide polymorphisms in genes such as TRAF3IP2-AS1, HOTAIR, and CDKN2B-AS1 demonstrate population-specific associations with disease risk and therapeutic outcomes, suggesting their potential utility as pharmacogenomic markers. The complex regulatory networks involving lncRNAs provide new insights into psoriasis pathogenesis and offer promising avenues for personalized treatment strategies. Integration of lncRNA profiling into clinical practice may enhance our understanding of disease heterogeneity and improve therapeutic outcomes for psoriatic patients.

Also flagged:Acute myeloid leukemiaAMLleukemiacell divisiondeathcancer
Journal Article 2025-09-19 No Snippets Maurya SS, Maurya S, Chaturvedi SK.
Show Full Abstract

Acute myeloid leukemia (AML) is a highly heterogeneous disease, with significantly higher incidence and fatality rates in the elderly. Even with recent decades of research progress in AML, the exact etiology of this deadly disease is still not fully understood, with recent advancements in sequencing technologies highlighting the role of a growing number of non-coding RNAs (ncRNAs) that are intimately associated with AML leukemogenesis. These ncRNAs have been found to have a significant role in leukemia-related cellular processes such as cell division, proliferation, and death. A few of these non-coding RNAs exhibit potential as prognostic biomarkers. The three main groups of ncRNAs that contribute unique activities, especially in cancer, are microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs). Their existence or altered expression levels frequently offer vital information on the diagnosis, course of treatment, and follow-up of cancer patients. The identification of ncRNAs has opened up new avenues for the diagnosis, prognosis, and therapy of acute myeloid leukemia. In order to provide a clear understanding of the significant influence that lncRNAs have on prognostic predictions and diagnostic accuracy in AML, this review aims to provide a comprehensive and insightful understanding of how these molecules actively participate in the complex landscape of the disease.

Also flagged:Programmed Cell DeathDiabetic Kidney Diseasepathogenesisautophagypyroptosisferroptosis
Journal Article 2025-09-19 No Snippets Tang S, Sun Y, Sun W, Kang X, Zhao X, Jiang L, Gao Q, An X, Ji H, Lian F.
Show Full Abstract

The escalating incidence and mortality of diabetic kidney disease (DKD) underscore the critical need to elucidate its pathogenesis. Programmed cell death (PCD) plays a dual role in maintaining physiological homeostasis and driving pathological processes in DKD. Accumulating evidence demonstrates that apoptosis, autophagy, pyroptosis, and ferroptosis contribute directly or indirectly to DKD progression via distinct gene-regulated signaling pathways. Recently identified PCD modes (eg, necroptosis, parthanatos) remain poorly characterized in DKD, with emerging evidence suggesting crosstalk between different PCD pathways. This review synthesizes current knowledge on PCD-mediated DKD pathogenesis and PCD-targeted therapies, while highlighting research limitations (eg, unclear PCD interactions, translational gaps). We propose that dissecting the multifaceted roles of PCD in DKD will deepen mechanistic understanding and accelerate the development of novel therapeutics, offering significant scientific and clinical benefits.

Also flagged:Non-Small Cell Lung CancerNSCLCcell cyclecytokinesecretiongene expression
Journal Article 2025-09-19 No Snippets Nisar H, Konda B, Hoffmann MD, Labonté FM, Arif M, Diegeler S, Schmitz C, Baumstark-Khan C, Chevalier F, Hellweg CE.
Show Full Abstract

Hypoxia-induced radioresistance in non-small cell lung cancer (NSCLC) hinders radiotherapy efficacy. Fractionated schedules exploit reoxygenation between fractions to reverse this resistance, but the effects of <i>post-irradiation</i> reoxygenation remain unclear and may depend on radiation quality. We investigated survival, cell cycle progression, cytokine secretion, and gene expression in hypoxic (1 % O<sub>2</sub>) and reoxygenated A549 cells irradiated with X-rays or carbon ions. Colony-forming assays revealed an Oxygen Enhancement Ratio (OER) > 1 for both hypoxic and reoxygenated cells after X-rays, indicating persistent radioresistance; carbon ion OER ≈ 1 reflected oxygen-independent cytotoxicity. Hypoxia weakened radiation-induced G<sub>2</sub> arrest, and this was unaffected by reoxygenation. IL-6 secretion increased after X-rays and IL-8 after carbon ions exposure; both were enhanced under hypoxia and reoxygenation. RNA sequencing revealed that hypoxia induced a pro-survival, epithelial-to-mesenchymal transition (EMT)-promoting, and immune-evasive transcriptional program, which was largely reversed by reoxygenation but without increased clonogenic killing. These findings indicate that short-term reoxygenation after irradiation can normalize hypoxia-driven transcriptional changes yet does not restore radiosensitivity, supporting the advantage of high-linear energy transfer (LET) carbon ions for targeting resistant hypoxic NSCLC cells.

HFE
Also flagged:Bitter Taste ReceptorsTAS2R8TAS2R10Proton SecretionCadmiumsecretion
Journal Article 2025-09-19 ✓ 2 Snippets Orth HN, Pirkwieser P, Giridhar M, Boger V, Somoza MM, Dunkel A, Somoza V.
In-Text Gene Mentions

…ion transport (HFE, FTL ,…

…zinc-associated genes (e.g.,HFE, FTL ,…

Show Full Abstract

Beyond sensing bitter-tasting compounds, bitter taste receptors (TAS2Rs) have been demonstrated to play a functional role in proton secretion as a key mechanism of gastric acid secretion (GAS) and the cellular uptake of the zinc metal ion. Given its chemical similarity and comparable effects in GAS, we focused this work on cadmium and hypothesized that gastric TAS2Rs are involved in (i) cadmium-induced inhibition of proton secretion and (ii) in its cellular uptake. To test this hypothesis, immortalized human parietal HGT-1 cells were exposed to 62.5-1000 µM CdCl<sub>2</sub> for 30 min to elucidate TAS2R-mediated proton secretory activity (PSA) using a fluorescence-based pH cell assay and to quantitate cellular cadmium uptake by ICP-MS. HGT-1 cells exposed to CdCl<sub>2</sub> exhibited a dose-dependent decrease in PSA, accompanied by a corresponding increase in intracellular cadmium concentrations. Following a <i>TAS2R</i> RT-qPCR screening, the functional roles of TAS2R8 and TAS2R10 were clarified using a siRNA knockdown approach, demonstrating that TAS2R8 promotes and TAS2R10 mediates protection against excessive cellular cadmium accumulation. An additional cDNA microarray screening revealed, via gene ontology analysis, a distinct gene association of <i>TAS2R8</i> and <i>TAS2R10</i> with several metal ion transporters. These results provide the first evidence for a specific role of individual TAS2Rs beyond taste perception, particularly in metal ion homeostasis and gastric physiology.

Also flagged:CopperCuproptosissynthesismitochondrialmetabolismcell growth
Journal Article 2025-09-19 No Snippets Genchi G, Catalano A, Carocci A, Sinicropi MS, Lauria G.
Show Full Abstract

Copper is a vital micronutrient for animals and plants acting as a crucial cofactor in the synthesis of numerous metabolic enzymes and contributing to mitochondrial respiration, metabolism, oxido-reductive reactions, signal transmission, and oxidative and nitrosative damage. In the cells, copper may exist in the Cu<sup>+</sup> and Cu<sup>++</sup> oxidation states and the interconversion between these two states may occur via various redox reactions regulating cellular respiration, energy metabolism, and cell growth. The human body maintains a low level of copper, and copper deficiency or copper excess may adversely affect cellular functions; therefore, regulation of copper levels within a narrow range is important for maintaining metabolic homeostasis. Recent studies identified a new copper-dependent form of cell death called cuproptosis. Cuproptosis occurs due to copper binding to lipoylated enzymes (for instance, pyruvate dehydrogenase and α-ketoglutarate dehydrogenase) in the tricarboxylic acid Krebs cycle. In recent years, extensive studies on copper homeostasis and copper-induced cell death in degenerative disorders, like Menkes, Wilson, Alzheimer, Parkinson's, Huntington's diseases, and Amyotrophic Lateral Sclerosis, have discussed the therapeutic potential of targeting cuproptosis. Copper contamination in the environment, which has increased in recent years due to the expansion of agricultural and industrial activities, is associated with a wide range of human health risks. Soil used for the cultivation of grapes has a long history of copper-based fungicide application (the Bordeaux mixture is rich in copper) resulting in copper accumulation at levels capable of causing toxicity in plants that co-inhabit the vineyards. Phytoremediation, which uses plants and biological solutions to remove toxic heavy metals and pesticides and other contaminants from soil and water, is an environmentally friendly and cost-effective technology used for the removal of copper. It requires plants to be tolerant of high levels of copper and capable of accumulating metal copper in plants' aerial organs and roots. This review aims at highlighting the importance of copper as an essential metal, as well as its involvement in cuproptosis and neurodegenerative diseases.

Also flagged:Lipid ASialic Acidamidebindingpolymyxin Bphagocytosis
Journal Article 2025-09-19 No Snippets Williams D, McAdorey A, Lei E, Beaudoin G, Ling B, Callaghan D, Fatehi D, Verner A, Slinn J, Moreno M, Iqbal U, Qian H, Yan H, Chen W, Zou W.
Show Full Abstract

As part of an antimicrobial resistance (AMR) strategy, we have prepared α,ε-<i>N</i>,<i>N</i>'-di-stearoyl lysine-based amide lipids to improve the chemical and biological stabilities of nanoparticles. Those amide lipids incorporated a variety of head groups, including lipid A-binding ligand (polymyxin B nonapeptide, PMBN) for bacterial targeting and sialic acid as an alternative to PEGylation for phagocytosis resistance. The study demonstrated that the PMBN-liposome specifically targeted lipid A-containing Gram-negative <i>Acinetobacter baumannii</i> bacteria, but not Gram-positive <i>Staphylococcus aureus</i>. However, such interaction was interrupted by the adsorption of serum proteins onto liposomes, demonstrating the complexity and challenge of targeted delivery. As expected, slower uptake of sialic acid-liposomes by human leukemia monocytic THP-1 cells was observed, suggesting their resistance to phagocytosis. Additionally, in a mouse model, the sialic acid-containing liposomes showed more favorable biodistribution and longer retention time than the comparable phospholipid-only liposomes. We observed that both sialic acid-incorporated and PEGylated liposomes distributed over the whole mouse bodies and remained for over 48 h. In contrast, the phospholipid-only liposomes rapidly migrated to the liver (5-15 min). In conclusion, although this study did not achieve bacteria-targeted liposome delivery, it provided evidence that the sialic acid-amide lipid can serve as an alternative to PEGylation in future nanomedicine.

Also flagged:STINGstimulator of interferon genestype I interferoncytokineneurological diseasesneurodegenerative disorders
Journal Article 2025-09-19 No Snippets Zhang H, He Z, Yin C, Yang S, Li J, Lin H, Hu G, Wu A, Qin D, Hu G, Yu L.
Show Full Abstract

The stimulator of interferon genes (STING) plays a crucial role as an adaptor in innate immune defense, orchestrating key inflammatory processes through the modulation of type I interferon signaling and activation of cytokine networks. Recent studies have identified STING-induced neuroinflammatory responses as a major factor in the progression of neurological diseases, particularly in neurodegenerative disorders. This review methodically explores the structural basis of STING activation and its role in driving pathological inflammation. And the classic and non-classic pathways of STING as well as their roles in neurodegenerative diseases were discussed. Additionally, it critically assesses new pharmacological approaches that target the STING pathway, emphasizing anti-inflammatory treatments ranging from synthetic small-molecule inhibitors to bioactive compounds sourced from traditional Chinese medicines, which aim to mitigate neurotoxic inflammation. By combining mechanistic insights with therapeutic advancements, this paper presents an innovative transformation framework aimed at developing anti-inflammatory therapies targeting the STING pathway to treat neurodegenerative diseases. The core contribution of this framework lies in systematically bridging the innate immune regulation and neuroinflammation control mechanisms, providing a new strategy for disease intervention.

PRDX6
Also flagged:metabolismhead and neck squamous cell carcinomaHead and neck squamous cell carcinomasgene expressiontumorcancer
Journal Article 2025-09-19 ✓ 1 Snippet Yang L, Hai J, Liu J, Shen S, Su L, Sun J.
In-Text Gene Mentions

…as ERP44 ,PRDX6, TXNRD1 ,…

Show Full Abstract

Head and neck squamous cell carcinomas (HNSC) are associated with alterations in redox metabolism. This study aims to identify differentially expressed genes (DEGs) related to redox metabolism in HNSC and assess their prognostic values. We utilized the limma package for identifying redox metabolism-related DEGs and performed univariate and multivariate Cox regression analyses to evaluate their prognostic significance. Gene set variation analysis (GSVA), immune cell infiltration analysis, and single-cell RNA sequencing were utilized to explore the relationships between gene expression and tumor processes. Chemotherapy sensitivity was assessed based on <i>ERP44</i> expression levels. Additionally, pan-cancer analysis was conducted to evaluate <i>ERP44</i> expression and its prognostic value across different cancer types. The analysis identified several DEGs with significant prognostic value, including <i>ERP44</i>, which was significantly associated with poor prognosis in HNSC patients. High <i>ERP44</i> expression correlated with reduced overall survival, disease-specific survival, and progression-free interval. <i>ERP44</i> was notably overexpressed in tumor tissues and associated with key oncogenic pathways and immune cell infiltration patterns. Chemotherapeutic drug sensitivity analysis revealed that high <i>ERP44</i> expression increased sensitivity to Paclitaxel, Vinblastine, and Sorafenib but decreased sensitivity to Rapamycin. Pan-cancer analysis indicated that <i>ERP44</i> is differentially expressed and prognostic across multiple cancer types. Our findings highlight the crucial role of redox metabolism-related DEGs, particularly <i>ERP44</i>, in HNSC progression and prognosis. <i>ERP44</i> serves as a potential biomarker for prognosis and therapeutic response, warranting further research into its biological functions and potential as a therapeutic target.

PRDX6
Also flagged:Nucleophosmin 1Phenobarbitalconstitutive androstane receptorhepatocyte proliferationcell proliferationCAR
Journal Article 2025-09-19 ✓ 5 Snippets Elcombe M, Wallace S, Plummer S.
In-Text Gene Mentions

…Peroxiredoxin 6 (PRDX6), regulated by NPM1,…

…the expression ofPRDX6, an antioxidant protein,…

…while knocking outPRDX6in hepatocellular carcinoma…

…nclude significantly increasedPRDX6protein expression [25]…

…genes NPM1 andPRDX6, together with several…

Show Full Abstract

A key event in the process of rat but not human liver carcinogenesis caused by constitutive androstane receptor activators such as phenobarbital (PB) is hepatocyte proliferation, but the mechanism(s) underpinning this response is not fully understood. Previously we showed that rat liver microtissues (LiMTs) can recapitulate a PB-induced hepatocyte proliferation response (1). In this follow up study we used our microTMA technology coupled with transcriptomics and immunofluorescence (IF) staining to elucidate mechanisms of rat liver carcinogenesis in this model. We performed gene set enrichment analysis (GSEA) on transcriptomics data generated from laser microdissected liver microtissue microTMA FFPE sections from control and PB-treated LiMTs against custom liver cell proliferation and constitutive androstane receptor (CAR) activation signatures (2) and found that the former signature was significantly (q<0.25) enriched in rat but not human LiMT differentially expressed gene lists. This process also identified the cell proliferation gene nucleophosmin 1 (NPM1) as being significantly induced (p < 0.05) in rat but not human LiMTs. IF staining of parallel microTMA FFPE sections coupled with quantitative image analysis confirmed that the NPM1 protein was induced by PB treatment in rat but not human liver microtissues after 24 and 48 hrs PB treatment. In conclusion we have identified induction of nuclear NPM1 expression as an early event in PB-induced rat hepatocyte cell proliferation.

Also flagged:nanodiamondNanodiamondsimmune responseIgGantibodyepidemic diarrhea
Journal Article 2025-09-19 No Snippets Ho TT, Tran HT, Nguyen PMT, Bui HT, Nguyen HTT, Le TBT, Pham MD, Hsiao WW, Nguyen DH, Chu HH, Pham NB, Hoang HTT.
Show Full Abstract

Porcine epidemic diarrhea virus (PEDV) continues to be a major infectious threat in swine, especially endangering piglets. The COE and S1D domains have been identified as crucial antigens suitable for designing subunit vaccines. Nanodiamonds (NDs), owing to their biocompatibility, large surface area, and modifiable surfaces, have gained interest as novel carriers to improve recombinant protein vaccines. In this study, we transiently expressed a COE-S1D fusion protein containing the GCN4pII motif (COE-S1D-pII) in <i>Nicotiana benthamiana</i>. The recombinant protein was subsequently mixed with nanodiamonds at various mass ratios to form COE-S1D:ND complexes. SDS-PAGE and Western blot analyses identified the optimal ratio as 1:24 (w/w). Additional size, zeta and morphology characterization of these complexes was carried out. We then assessed the immune response of the COE-S1D:ND complex (1:24, w/w) in pregnant sows and their piglets, comparing it to the response induced by the free COE-S1D-pII protein. After administering a booster dose, the COE-S1D:ND mixture significantly enhanced PEDV-specific IgG and COE-S1D-specific IgA levels, as well as neutralizing antibody titers, as measured by ELISA and virus neutralization assays in their piglets. Overall, the results highlight that ND nanoparticles can strengthen both systemic and mucosal immunity, supporting the potential of using plant-produced COE-S1D-pII protein in combination with nanodiamonds as a next-generation subunit vaccine candidate against PEDV.

Also flagged:proteasomeubiquitindegradationagingneurodegenerative diseasesprotein degradation
Journal Article 2025-09-19 No Snippets Cobb SG, Tepe JJ.
Show Full Abstract

The ubiquitin-independent proteasome system has emerged as an attractive point of intervention for a variety of diseases, including neurodegenerative diseases. Though inhibition of this system has been studied for decades, 20S proteasome enhancement is much younger by comparison, but substantial levels of progress have been made in this field especially within the last five years. This microperspective will highlight these advancements, focusing on the novel developments being made in designing potent enhancers and evaluating them in disease-relevant systems.

HTT
Also flagged:brain-related disordersoxygenorganizationpsychiatric disorderssubstance abusemovement disorders
Journal Article 2025-09-19 ✓ 1 Snippet Santucci F, Jimenez-Marin A, Gabrielli A, Bonifazi P, Ibáñez-Berganza M, Gili T, Cortes JM.
In-Text Gene Mentions

…characterized by mutantHTTgene expression, leading…

Show Full Abstract

Brain structure-function coupling has been studied in health and disease by many different researchers in recent years. Most of the studies have estimated functional connectivity matrices as correlation coefficients between different brain areas, despite well-known disadvantages compared with partial correlation connectivity matrices. Indeed, partial correlation represents a more sensible model for structural connectivity since, under a Gaussian approximation, it accounts only for direct dependencies between brain areas. Motivated by this and following previous results by different authors, we investigate structure-function coupling using partial correlation matrices of functional magnetic resonance imaging brain activity time series under various regularization (also known as noise-cleaning) algorithms. We find that, across different algorithms and conditions, partial correlation provides a higher match with structural connectivity retrieved from density-weighted imaging data than standard correlation, and this occurs at both subject and population levels. Importantly, we also show that regularization and thresholding are crucial for this match to emerge. Finally, we assess neurogenetic associations in relation to structure-function coupling, which presents promising opportunities to further advance research in the field of network neuroscience, particularly concerning brain disorders.

Also flagged:Brain Disorderagingbrain diseasebraindementia diseaseneurodegenerative disorders
Journal Article 2025-09-19 No Snippets Lyu Y, Zhang J, Zhang L, Ruan W, Liu T, Zhu D.
Show Full Abstract

During the process of brain aging, the changes of white matter structural connectivity are closely correlated with the cognitive traits and brain function. Genes have strong controls over this transition of structural connectivity-altering, which influences brain health and may lead to severe dementia disease, e.g., Alzheimer's disease. In this work, we introduce a novel deep-learning diagram, an oblique genomics mixture of experts(OG-MoE), designed to address the prediction of brain disease diagnosis, with awareness of the structural connectivity changes over time, and coupled with the genomics influences. By integrating genomics features into the dynamic gating router system of MoE layers, the model specializes in representing the structural connectivity components in separate parameter spaces. We pretrained the model on the self-regression task of brain connectivity predictions and then implemented multi-task supervised learning on brain disorder predictions and brain aging prediction. Compared to traditional associations analysis, this work provided a new way of discovering the soft but intricate inter-play between brain connectome phenotypes and genomic traits. It revealed the significant divergence of this correlation between the normal brain aging process and neurodegeneration.

medRxiv 2025-09-19 Preprint (No Snippets API) Kerrebijn I, Bjornsdottir G, Arbabi K, Urpa L, Haapaniemi H, Thorleifsson G, Stefansdottir L, Frangakis S, Valliere J, Kunorozva L, Abner E, Ji C, Aagaard B, Bliddal H, Brunak S, Bruun MT, Didriksen M, Erikstrup C, Geirsson AJ, Gudbjartsson DF, Hansen TF, Jonsdottir I, Knight S, Knowlton KU, Mikkelsen C, Nadauld LD, Olafsdottir TA, Ostrowski SR, Pedersen OB, Saevarsdottir S, Skuladottir AT, Sørensen E, Stefansson H, Sulem P, Sveinsson OA, Thorlacius GE, Thorsteinsdottir U, Ullum H, Vikingsson A, Werge TM, Chronic Pain Genomics Consortium, FinnGen, DBDS Genomic Consortium, Estonian Biobank Research Team, Genes & Health Research Team, Saxena R, Stefansson K, Brummett CM, Glintborg B, Clauw DJ, Thorgeirsson TE, Williams FM, Sinnott-Armstrong N, Ollila HM, Wainberg M.
Show Full Abstract

Fibromyalgia is a common and debilitating chronic pain syndrome of poorly understood etiology. Here, we conduct a multi-ancestry genome-wide association study meta-analysis across 2,563,755 individuals (54,629 cases and 2,509,126 controls) from 11 cohorts, identifying the first 26 risk loci for fibromyalgia. The strongest association was with a coding variant in HTT , the causal gene for Huntington’s disease. Gene prioritization implicated the HTT regulator GPR52 , as well as diverse genes with neural roles, including CAMKV , DCC , DRD2 / NCAM1 , MDGA2 , and CELF4 . Fibromyalgia heritability was exclusively enriched within brain tissues and neural cell types. Fibromyalgia showed strong, positive genetic correlation with a wide range of chronic pain, psychiatric, and somatic disorders, including genetic correlations above 0.7 with low back pain, post-traumatic stress disorder and irritable bowel syndrome. Despite large sex differences in fibromyalgia prevalence, the genetic architecture of fibromyalgia was nearly identical between males and females. This work provides the first robust genetic evidence defining fibromyalgia as a central nervous system disorder, thereby establishing a biological framework for its complex pathophysiology and extensive clinical comorbidities.

medRxiv 2025-09-19 Preprint (No Snippets API) Molinari E, Nickerson A, Quistrebert J, Kless A.
Show Full Abstract

Short tandem repeat expansions are significant contributors to human disease and several repeat-carrying loci have been identified as responsible for severe neurological disorders. Recent population-based studies showed that the frequency of repeat expansion variants is considerably higher than the prevalence of the disease they cause, suggesting that additional genetic, epigenetic, or environmental factors may influence penetrance and clinical manifestation. This is expected in the case of severe, adult-onset disorders where penetrance is age-dependent, and the incidence is lower than the prevalence. Nonetheless, it remains uncertain whether these variants also exhibit incomplete penetrance in later stages of life. The availability of genetic data linked to longitudinal health records in the UK Biobank allows for direct tracking of disease risk for repeat expansion carriers by age. In our work show that the penetrance of C9ORF72 repeat expansions, but not that of HTT or CACNA1A , remains low even late in life and we leverage this feature to identify potential protective variants in ALS.

bioRxiv 2025-09-19 Preprint (No Snippets API) Jiang M, Shi T, Miryala R, Rodriguez M, Wang R, Sultania R, Guttman L, Johnston J, Mulligan L, Li Y, Cui A, Belkas K, Xue Y, Um Y, Yuan A, Holland C, Troncoso JC, Duan W, Ratovitski T, Smith W, Ross CA.
Show Full Abstract

<h4>Summary</h4> The loss of striatal medium spiny neurons is a hallmark of Huntington’s disease (HD). To identify potential disease-modifying treatments, we previously developed a human neuronal model by immortalizing and differentiating HD patient-derived iPSCs into highly homogeneous striatal precursor neurons (ISPNs). Using a 96-well screening platform, and two rounds of re-screening, we tested a kinase inhibitor library and identified 5 compounds that protected HD ISPNs from mutant huntingtin (mHTT)-induced toxicity. Among these, we prioritized the PKC-α/β1 inhibitor GO6976, which rescued HD ISPNs from mHTT toxicity in a dose-dependent manner. Further, we found increased phosphorylation of PKC-α and PKC-β1 in HD cells and tissues, while their overexpression was toxic to HD ISPNs. Knockdown of PKC-α/β1 protected the neurons, and both isoforms interacted and colocalized with HTT. These results suggest that PKC-α/β1 plays a role in HD neurodegeneration, and that inhibiting their activity may offer a potential therapeutic approach for HD. <h4>Graphical abstract</h4> <h4>Highlights</h4> HD patient-derived iPSC-based striatal precursor neurons (ISPNs) were used to screen and identify neuroprotective compounds. The PKC-α/β1 inhibitor GO6976 rescues HD ISPNs from mutant huntingtin (HTT)-induced toxicity. The phosphorylation of PKC-α/β1 is elevated in HD cell and tissues, and PKC-α/β1 interact with both wild-type and mutant huntingtin. Overexpression of PKC-α/β1 is toxic to HD ISPNs, while its knockdown protects the neurons.

PRDX6
Also flagged:Agingneurodegenerative diseasesParkinson's diseaseNeuromelanin granulesmitochondrialcognition
Journal Article 2025-09-18 ✓ 1 Snippet Eggers B, Hausherr M, Lim M, Schork K, Karacora B, Grugel R, Eisenacher M, Aldea IG, Riederer P, Gerlach M, Marcus K.
In-Text Gene Mentions

…of PRDX1 andPRDX6, both proteins essential…

Show Full Abstract

Physiological aging is accompanied by structural and molecular changes in the brain, with varying degrees in different brain areas, and is considered one of the major risk factors for neurodegenerative diseases. Thus, the present study focuses on elucidating age-related changes in the substantia nigra pars compacta (SNpc), a brain region particularly vulnerable in Parkinson's disease. Here, the aim is to gain a spatially resolved view of aging-dependent alterations to conclude early processes potentially involved in neurodegeneration. Neuromelanin granules and SNpc tissue are isolated from tissue samples of young and elderly individuals via laser microdissection and measured by mass spectrometry to ascertain changes in protein expression in response to age. The findings include the identification of reduced levels of proteins involved in dopaminergic neurotransmission, either suggesting a specific loss of dopaminergic neurons or a reduction in metabolic activity. Furthermore, increased neuroinflammation is observed in elderly individuals and alterations in vesicular trafficking as well as mitochondrial proteins. Consequently, this exploratory study suggests that alterations causing known pathomechanisms of Parkinson's disease are already occurring in the physiological aging process. Since aging is still the most important risk factor for neurodegenerative diseases, these findings strengthen the necessity for studying age-related changes.

Also flagged:ethanolalcoholalcohol dehydrogenaseADHaldehyde dehydrogenaseALDH
Journal Article 2025-09-18 No Snippets Cox LA, Daunais JB, Howard TD, Li G, Puppala S, Chan J, Hamid Z, Gawrieh S, Lee SM, Ferguson B, Grant KA, Olivier M.
Show Full Abstract

<h4>Background</h4>Consumed ethanol is primarily metabolized by the liver, with resulting products of ethanol metabolism, acetaldehyde and salsolinol that influence brain activity and alcohol drinking behavior. Alcohol consumption in humans is highly heritable with numerous associated genetic variants. Functional variants in the ADH and ALDH genes influence liver alcohol metabolism but only account for a small percentage of variance in consumption. We hypothesized that variation in hepatic molecular networks during the induction phase, where animals consume identical amounts of alcohol, predicted variation in drinking behavior during subsequent ad libitum access in nonhuman primates (NHPs).<h4>Methods</h4>We studied male rhesus macaques at baseline and during the uniform consumption phase that became discordant at the later ad libitum phase. The study design increased the likelihood of identifying functional molecular differences between light drinkers (LD) and very heavy drinkers (VHD) before animals exhibited differences in drinking behavior. We analyzed liver biopsies, provided by the Monkey Alcohol and Tissue Research Resource (MATRR), collected at baseline and after 3 months of uniform consumption, using multiomic and histologic methods.<h4>Results</h4>We found hepatic molecular pathways and networks differed between LD and VHD at baseline and in response to identical consumption. Notably, Sirtuin Signaling and a MYC-regulated network were significantly enriched for differentially abundant molecules in both LD and VHD response to uniform alcohol consumption. Potential epigenomic mechanisms regulating response to alcohol consumption were significantly different with LD response primarily through microRNAs, and VHD primarily through DNA methylation. Histological analysis of liver biopsies showed no liver pathologies in either group.<h4>Conclusions</h4>Our findings of differences in molecular networks prior to alcohol consumption suggest genetic variation contributes to drinking phenotypes, and differences in molecular response to uniform alcohol consumption suggest epigenetic mechanisms regulating liver networks also contribute to the development and progression of drinking phenotypes in NHP.

Also flagged:β-adrenergic receptorsβ-AdrenoceptorsmembraneisoprenalinePolyEthyleneGlycol
Journal Article 2025-09-18 No Snippets Madders GWP, Barthé M, Lefebvre F, Langlois E, Lefebvre F, Lechêne P, Dia M, Iturrioz X, Llorens-Cortes C, Ha-Duong T, Moine L, Tsapis N, Fischmeister R.
Show Full Abstract

β-Adrenoceptors (β-ARs) regulate cardiac function during sympathetic nerve stimulation. β-ARs are present in both the cardiac T-tubule (TTM) and outer surface membrane (OSM), but how their location impacts their function is unknown. Here, we developed a technology based on size exclusion to explore the function of β-ARs located in the OSM. We synthesized a PEG-Iso molecule by covalently linking isoprenaline (Iso) to a 5000 Da PolyEthylene-Glycol (PEG) chain to increase the size of the β-AR agonist and prevent it from accessing the T-tubule network. The affinity of PEG-Iso and Iso on β<sub>1</sub>- and β<sub>2</sub>-ARs was measured using radioligand binding. Molecular dynamics simulation was used to assess PEG-Iso conformation and visualize the accessibility of the Iso moiety to water. Using confocal microscopy, we show that PEGylation constrains molecules outside the T-tubule network of adult rat ventricular myocytes (ARVMs) due to the presence of the extracellular glycocalyx. β-AR activation in OSM with PEG-Iso produced a lower stimulation of [cAMP]<sub>i</sub> than Iso but a larger stimulation of cytosolic PKA at equivalent levels of [cAMP]<sub>I</sub> and similar effects on excitation-contraction coupling parameters. However, PEG-Iso produced a much lower stimulation of nuclear cAMP and PKA than Iso. Thus, OSM β-ARs in ARVMs control mainly cytosolic cAMP/PKA pathway and contractility, while TTM β-ARs control mainly nuclear cAMP, PKA, and consequent nuclear protein phosphorylation. Size exclusion strategy using ligand PEGylation provides a unique approach to evaluate the respective contribution of T-tubule vs. OSM proteins in cardiac cells.

MLLT10
Also flagged:KMT2Aacute myeloid leukaemiaAMLMLLT3ACACancer
Journal Article 2025-09-18 ✓ 4 Snippets Fayez H, Elsherif M, Salem S, Elsharkawy N, Elnashar A, Kamal M, Khedr R, Lehmann L, Ahmed S, Elhaddad A.
In-Text Gene Mentions

…0;11) (p12;q23) (10p12/KMT2A::MLLT10fusion), t(10;11)(p11.2;q23) (…

…15), t(10;11) 10p12 (KMT2A::MLLT10) ( n =…

…ith t(10;11) (p12;q23) KMT2A::MLLT10and t(11;19) (p13.3;q23)…

…), t(10;11) (p12;q23) (KMT2A::MLLT10), t(6;11) (q27;q23) (KMT2A::A…

Show Full Abstract

<h4>Background and purpose</h4>Chromosomal rearrangements involving KMT2A (KMT2A-r) occur in 20% of paediatric acute myeloid leukaemia (AML). Previous studies reported that the outcome depends on the specific fusion partner. The study aimed to report the outcomes of paediatric KMT2A-r AML patients and to assess the impact of different fusion partners. Patient/material and methods: We retrospectively analysed 610 paediatric patients with intermediate-risk (IR) AML diagnosed at Children's Cancer Hospital Egypt, from January 2008 to December 2021. Patients were assigned to four groups based on fusion partner.<h4>Results</h4>Of 610 patients diagnosed with IR-AML, 150 (24.6%) had KMT2A rearrangements. KMT2A-r was significantly associated with hyperleukocytosis (P = 0.029), central nervous system (CNS) disease (P = 0.003), monocytic differentiation (P = 0.001), additional cytogenetic abnormalities (ACA) (P = 0.04), and complex karyotype (P = 0.001). Fusion partner, t(9;11) (p22;q23) (9p22/KMT2A::MLLT3 fusion) was most prevalent (40.8%). KMT2A-r was an independent predictor of relapse with a cumulative incidence of relapse (CIR) of 46% versus 30% in KMT2A negative group (P = 0.006). Within the KMT2A-r group, ACA and complex karyotype adversely affected the outcome with 5-year overall survival (OS) of 34% versus 53% (P = 0.027) and 26% versus 51% (P = 0.004), respectively. Outcome varied depending on fusion partner. Event-free survival (EFS) ranged from 50% to 17%, OS from 54% to 27%, and CIR from 75% to 38%.<h4>Interpretation</h4>KMT2A-r is an independent prognostic factor for relapse, and presence of ACA and a complex karyotype in KMT2A-r patients is associated with poorer outcomes, emphasising the need for aggressive and innovative therapeutic strategies.

Also flagged:Ferroptosisdeathironlipidagingcancer
Journal Article 2025-09-18 No Snippets Hino K, Nishina S, Yanatori I.
Show Full Abstract

Ferroptosis is a form of nonapoptotic cell death that is driven by iron-dependent lipid peroxidation and is relevant to a wide range of biological processes, such as development, aging, immunity, and cancer. Ferroptosis has also been linked to numerous hepatic metabolic pathways, including the metabolism of iron, fatty acids, and amino acids, such as cysteine. During the last decade, studies on the biology of and molecules regulating ferroptosis have shed light on the role of ferroptosis in liver disease and its implications. The susceptibility of liver cells to ferroptosis determines the extent of liver injury and affects the progression of nonneoplastic diseases, whereas liver cancer cells display intrinsic or acquired resistance to ferroptosis, which promotes cancer progression. These findings indicate that ferroptosis represents a promising target for the prevention and treatment of many forms of liver disease. In this review, we provide an update on the mechanisms regulating ferroptosis, focusing on the peroxidation of phospholipids, the antioxidant pathways that limit lipid peroxidation, and the regulation of the labile iron pool, all of which are closely connected. We also summarize the roles and importance of ferroptosis in the pathogenesis of liver disease, and the therapeutic potential of targeting ferroptosis in liver diseases.

Also flagged:Metastatic cancermetastatic tumorCancertumortumorscell–cell adhesion
Journal Article 2025-09-18 No Snippets Sinai Borker N, Sajimon J, Subhadarshini S, Aara R, Jolly MK, Prabhu JS, Nair R.
Show Full Abstract

Metastatic cancer is the final frontier in disease progression with few avenues of treatment open to patients. The failure of therapeutic options at the end-stage disease is confounded by the presence of diverse clones in the metastatic tumor which contributes to intratumoral heterogeneity (ITH), resulting in intrinsic and acquired drug resistance. We aim to elucidate the contribution of ITH to the development of metastasis with a focus on the origins and molecular mechanisms driving ITH, as well as the clinical and technical challenges of acquiring and studying metastatic cohorts in which we can investigate this phenomenon. Bioinformatic approaches that could help in silico analysis will be discussed, which could shed light on how to design new therapeutic strategies for metastatic cancer and give hope to patients living under the shadow of the sword of Damocles.

TNFSF4
Also flagged:PRKCDnon-small cell lung cancerNSCLCluciferaseimmune responsesCD80
Journal Article 2025-09-18 ✓ 2 Snippets Chen X, Kong R, Qi Y, Li L, Yin C, Sun L, Jian C, Cai P, Yang Q, Sun J.
In-Text Gene Mentions

…CD80, CD86, andTNFSF4.…

…CD80, CD86, andTNFSF4was also significantly…

Show Full Abstract

<h4>Purpose</h4>Overcoming miRNA-mediated radioresistance and enhancing its synergy with immunotherapy remained significant challenges.<h4>Methods</h4>A total of 23 patients with locally advanced non-small cell lung cancer (NSCLC) undergoing thoracic radiotherapy from a single center were enrolled. Pre-radiotherapy blood samples were collected and analyzed using real time qPCR array to detect miRNA expression profiles, identifying differential miRNAs between responders and non-responders. In vitro experiments further assessed the impact of radiotherapy on significant differential miRNAs. Targeted immune genes of miRNAs were predicted through bioinformatics websites and validated by cellular experiments. Using TCGA and GEO datasets, the association between immune gene of interest and survival outcomes and immune infiltration were investigated. In vivo experiment was further performed to investigate the relationship between dendritic cell (DC) expression and miR-26b-5p following radiotherapy.<h4>Results</h4>Using pre-radiotherapy blood samples from 23 NSCLC patients, 22 differentially expressed miRNAs were identified between responders and non-responders. Among them, miR-26b-5p exhibited significant differential expression, suggesting its role as a potential radioresistant molecule. The dual-luciferase assay confirmed miR-26b-5p targeted PRKCD, an immune-related gene. After continuous three days of 2-Gy irradiation, the expression of miR-26b-5p decreased significantly, while the expression of PRKCD increased. The effect of radiotherapy on PRCKD expression were further validated in clinical samples, which demonstrated elevated PRCKD expression after thoracic radiotherapy. Bioinformatic analysis using TCGA and GEO datasets revealed that a higher PRKCD expression was correlated with better survival outcomes, increased immune cell infiltration, and better outcomes. Further in vivo experiments showed that, after radiotherapy, the inhibition of miR-26b-5p showed a significantly higher proportion of DCs than the controls, along with increased expression of CD80, CD86, and TNFSF4.<h4>Conclusion</h4>miR-26b-5p and PRKCD modulates dual resistance of both radiotherapy and immunotherapy in NSCLC. These insights demonstrate that downregulating miR-26b-5p could offer a promising therapeutic strategy to enhance radiosensitivity and immune responses.

Also flagged:ALLBCL2venetoclaxacute lymphoblastic leukemiaT-cell acute lymphoblastic leukemia-cell differentiation
Journal Article 2025-09-18 No Snippets Gigliotti F, Brescia C, Audia S, Gallo Cantafio ME, Malatesta P, Bellisario ML, Torcasio R, Cantaffa R, Galea E, Iuliano R, Viglietto G, Trapasso F, Galati MC, Amodio N, Amato R.
Show Full Abstract

<h4>Background</h4>Early T-cell precursor acute lymphoblastic leukemia (ETP-ALL) is a rare, high-risk subtype of T-ALL characterized by distinctive immunophenotypic and genomic features. It is often associated with induction failure and frequent relapses. Despite recent advances in its molecular characterization, the prognosis remains dismal, and effective targeted therapies are limited.<h4>Methods and results</h4>We report a pediatric, multi-refractory ETP-ALL case with novel cytogenetic alterations, including a 4q deletion and a t(16;18)(q24;q21) translocation. Molecular profiling revealed progressive activation of the BCL2 pathway and disruption of Th17-related immune markers. Ex vivo sensitivity assays performed at different disease stages demonstrated increasing BCL2 dependency. Based on these findings, venetoclax was administered on a compassionate-use basis, resulting in rapid hematologic recovery and a marked reduction in blast percentage.<h4>Conclusions</h4>This case highlights the role of clonal evolution and immune deregulation in accompanying BCL2 addiction in relapsed ETP-ALL. Altogether, our findings underscore the therapeutic potential of venetoclax in refractory pediatric ETP-ALL cases with progressive BCL2 dependency.

DCC
Also flagged:chromosomedosage compensationspermatogenesissex chromosomessex chromosomechromosomes
Journal Article 2025-09-18 ✓ 4 Snippets Price PD, Parkus SM, Lloyd VJ, Alston BT, Bradshaw SL, Bates S, Hughes MA, Paterson S, Burke T, Darolti I, Pomiankowski A, Wright AE.
In-Text Gene Mentions

…dosage compensation complex (DCC) that operates in…

…role of theDCCcomplex in regulating…

…components of theDCC, our results further…

…dosage compensation complex (DCC) in Drosophila .…

Show Full Abstract

Sex-linked meiotic drivers limit the inheritance of the alternate sex chromosome in the heterogametic sex, subsequently skewing the offspring sex ratio. They consequently have large impacts on genome evolution, adaptation, and the emergence and maintenance of sexually selected traits. Despite this, our understanding of their molecular basis and consequences for gametogenesis and sex chromosome regulation more broadly has focused on a handful of model organisms, primarily Drosophila and mouse, which are not representative of the broad diversity of reproductive modes and drive systems in nature. Here, we employ single-cell RNA sequencing (scRNA-seq) to investigate a sex-linked meiotic driver in the Malaysian stalk-eyed fly, Teleopsis dalmanni. First, we produce a comprehensive single-cell atlas of the male T. dalmanni gonad and identify major testis cell types. We then provide a comprehensive profile of the cellular and transcriptional landscape of the testis, providing evidence for a lack of complete meiotic sex chromosome inactivation and complex trajectory of dosage compensation. Second, by contrasting single-cell expression data between drive and standard testes, we provide insight into the consequences of a meiotic driver for the transcriptomic landscape of the testis and sex chromosome regulation. Importantly, we show that the presence of a meiotic driver does not perturb fundamental patterns of X-linked regulation. Our results provide insight into how the meiotic driver might bias its transmission to the next generation and highlight genes with perturbed expression as a potential consequence of the disruption of spermatogenesis.

SOX6
Also flagged:Neural tube defectsNTDsFolic acid deficiencyorganizationfolate deficiencyNTD
Journal Article 2025-09-18 ✓ 5 Snippets Zhang T, Lin L, Li J, Li C, Liang S, Bai X, Wang F, Bao Y, Guo D, Bo X, Li H, Chen H, Xie Q.
In-Text Gene Mentions

Sox6and Nrg1 regulate…

…loop in theSox6locus nearby DSB…

…expression changes inSox6potentially attributed to…

Sox6, an important…

…The results revealedSox6downregulation in the…

Show Full Abstract

Neural tube defects (NTDs) are one of the most common congenital malformations. Folic acid deficiency in pregnant women increases the risk of developing NTDs; however, the underlying etiology and mechanisms remain elusive. In this study, the role of DNA double-strand breaks (DSBs) in 3D genome organization in NTDs with folate deficiency is reported. The NTD mouse model is burdened with abundant DSBs associated with the disruption of 3D genome organization. DSBs occurring in active genes lead to the stalling of RNA polymerase II (Pol II) and formation of R-loops in the 3D genome. The DSB ratios of the genomic regions negatively correlated with the distance from the transcription start sites of the gene. The DSB ratios of the proximal and distal enhancers are significantly higher and induce the displacement of loops with busy anchors. Furthermore, DSB-associated dysregulation of chromatin loops occurs in neural tube closure-associated genes that are abnormally expressed in human NTDs. Taken together, excessive DSB-associated 3D genome organization disruption within NTDs with folate deficiency contributes to the dysregulation of neural tube closure-associated genes.

Also flagged:cardiovascular diseasesdiabetescognitive impairmentsmood disordersARCC
Journal Article 2025-09-18 No Snippets Vikoler T, Ganesch H, Dubravac J, Traut-Mattausch E.
Show Full Abstract

<h4>Background</h4>The use of digital technology enabled examining stress in everyday life. However, ambulatory research depends on the natural occurrence of stressful situations while most standardized stress inductions rely on cost- and labor-expensive laboratory experiments, which are limited in their infrequent applicability.<h4>Objective</h4>We developed the Salzburg Mobile Stress Induction (SMSI), a newly conceptualized toolbox including 6 different stress-inducing paradigms (Matrices test, Cube Net test, Arithmetic test, Number Series test, Word Scramble test, and Word Pair test) and 1 control paradigm (Caesar Cipher test), which are based on cognitive performance tests. These 7 tests aim to provide researchers with an open-access, standardized method to repeatedly induce stress in an ambulatory setting.<h4>Methods</h4>We recruited university students from a local university and through a crowdsourcing platform for a preregistered ambulatory study. After completing a web-based survey, participants used the m-path app on their smartphones to conduct the 7 SMSI tests in a randomized order over 4 days. By comparing the stress-inducing tests with the control test, we investigated changes in momentary negative and positive affect from baseline (t0) to between (t1) and after (t2) each test using the International Positive and Negative Affect Schedule Short Form.<h4>Results</h4>A total of 100 participants (60/100 women; mean age 24.43, SD 6.21 years; 69/100 local sample; 31/100 crowdsourcing sample) completed all 7 SMSI tests. Participants' negative affect significantly increased during all 6 stress-inducing tests compared to the control test from t0 to t1 (Ps<.001) and from t0 to t2 (Ps<.001) with medium to large effect sizes (η<sub>p</sub>²s=0.10 to 0.30). Post hoc pairwise comparisons showed significant increases of negative affect during all stress-inducing tests from t0 to t1 (Ps<.001) and from t0 to t2 (Ps<.001) and a slight increase in the control test from t0 to t2 (P=.006). Reported positive affect significantly differed between the stress-inducing tests and the control test from t0 to t1 (Ps<.001) and from t0 to t2 (Ps<.001) with medium to large effect sizes (η<sub>p</sub>²s=0.14 to 0.33). Post hoc pairwise comparisons revealed a significant increase in positive affect in the control test from t0 to t1 (P<.001) and from t0 to t2 (P<.001) and varying significant decreases to nonsignificant changes in the stress-inducing tests over time (Ps>.99 to <.001).<h4>Conclusions</h4>The SMSI presents novel and easy-to-implement standardized stress induction procedures to repeatedly induce stress in ambulatory research. We discussed new opportunities for positive eustress inductions and outlined subsequent validation studies combining physiological stress assessment and ambulatory methods. The development of additional language versions of the SMSI is illustrated.

FBXL4
Also flagged:uridineadenosine deaminaseADARadenosineinosinenucleus
Journal Article 2025-09-18 ✓ 2 Snippets Smargon AA, Pant D, Gomberg TA, Fagre C, Glynne S, Nguyen J, Naritomi JT, Gilbert WV, Yeo GW.
In-Text Gene Mentions

…knockdown: DENND4A ,FBXL4and PDE4DIP (Fig.…

…~5% antisense snRNA;FBXL4–dPSI, ~35% A>I…

Show Full Abstract

Endogenous uridine-rich small nuclear RNAs (U snRNAs) form RNA-protein complexes to process eukaryotic pre-mRNA into mRNA. Previous studies have demonstrated programmable U snRNA guide-targeted exon inclusion and exclusion. Here we investigated whether snRNAs can also enhance RNA base editing over state-of-the-art RNA-targeting technologies in human cells. Compared with adenosine deaminase acting on RNA (ADAR)-recruiting circular RNAs, we find that guided A>I snRNAs consistently increase adenosine-to-inosine editing for higher exon count genes, perturb substantially fewer off-target genes and localize more persistently to the nucleus where ADAR is expressed. A>I snRNAs also more efficiently edit long noncoding RNAs and pre-mRNA 3' splice sites to promote splicing changes. Lastly, snRNA-H/ACA box snoRNA fusions (U>Ψ snRNAs) increase targeted RNA pseudouridylation without DKC1 overexpression, facilitating improved CFTR rescue from nonsense-mediated mRNA decay in a cystic fibrosis human bronchial epithelial cell model. Our results advance the endogenous protein-mediated RNA base editing toolbox and RNA-targeting technologies to treat genetic diseases.

ABT1
Also flagged:chromatincancertumorMED1bindingdeath
Journal Article 2025-09-18 ✓ 1 Snippet Taghbalout A, Tung CH, Clow PA, Tjong H, Wang P, Wong CH, Mao DD, Maurya R, Huang MF, Ngan CY, Kim AH, Wei CL.
In-Text Gene Mentions

ABT1

Show Full Abstract

Extrachromosomal, circular DNA (ecDNA) is a prevalent oncogenic alteration in cancer genomes, often associated with aggressive tumor behavior and poor patient outcome. While previous studies proposed a chromatin-based mobile enhancer model for ecDNA-driven oncogenesis, its precise mechanism and impact remains unclear across diverse cancer types. Our study, utilizing advanced multi-omics profiling, epigenetic editing, and imaging approaches in three cancer models, reveals that ecDNA hubs are an integrated part of nuclear condensates and exhibit cancer-type specific chromatin connectivity. Epigenetic silencing of the ecDNA-specific regulatory modules or chemically disrupting nuclear condensates breaks down ecDNA hubs, displaces MED1 co-activator binding, inhibits oncogenic transcription, and promotes cell death. These findings substantiate the trans-activator function of ecDNA and underscore a structural mechanism driving oncogenesis. This refined understanding expands our views of oncogene regulation and opens potential avenues for alternative therapeutic strategies in cancer treatment.

Also flagged:nucleusbrain disordersCNS disordersneurodegenerative disordersspinal cord injuryintracerebral hemorrhage
Journal Article 2025-09-18 No Snippets Khakh BS.
Show Full Abstract

A long-standing question in biology and medicine concerns how astrocytes influence neurons. Here, progress concerning how astrocytes affect neurons and neural circuits is summarized by focusing on data and concepts from studies of the striatum, which has emerged as a model nucleus. Mechanisms broadly applicable across brain regions and disorders are emphasized, and knowledge gaps are described. Experiments spanning multiple scales of biology show that astrocytes regulate neural circuits by virtue of homeostatic signaling and through astrocyte-neuron interactions. During disease, astrocytes contribute to nervous system malfunction in context-specific ways through failures of normal functions and the development of maladaptive responses. As ideally positioned endogenous cellular neuromodulators, astrocytes can be targeted for strategies to regulate neural circuits in brain disorders. After a historically slow start for the field, astrocyte-neuron interactions are now recognized as consequential for physiology and behavior, critically involved in pathophysiology, and exploitable in disease.

DARS2
Also flagged:peripheral neuropathyLeukoencephalopathylactateaspartyl-transfer RNA (tRNA) synthetaseaspartatecognitive impairment
Journal Article 2025-09-18 ✓ 3 Snippets Avadhani D, Ramesh R, Ranganathan LN, B N N, Hazeena P, S S.
In-Text Gene Mentions

…mutations of the <i>DARS2</i> gene that encodes…

…analysis revealed a <i>DARS2</i> mutation.…

…associated with a <i>DARS2</i> mutation and the…

Show Full Abstract

Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation is a disorder with an autosomal recessive mode of inheritance. It is caused by mutations of the <i>DARS2</i> gene that encodes aspartyl-transfer RNA (tRNA) synthetase enzymes responsible for the accurate charging of aspartate-specific tRNA with aspartate. Clinical features include seizures, cognitive impairment, cerebellar signs, upper motor neuron type of weakness, peripheral neuropathy, muscle weakness, cramps and deformities. Exclusive involvement of the peripheral nervous system has not been reported so far. We describe a case in which the patient presented with peripheral neuropathy mimicking hereditary motor and sensory neuropathy type 1, and genetic analysis revealed a <i>DARS2</i> mutation. This case highlights the potential phenotypic variability that can be associated with a <i>DARS2</i> mutation and the importance of comprehensive genetic testing in unexplained neuropathies, while acknowledging the limitations, as it is a variant of uncertain significance. More research is necessary to establish definite causation.

DCC
Also flagged:cytoplasmicnetrin receptorribosomal subunitTransmembrane receptorsprotein synthesisaxon
Journal Article 2025-09-18 ✓ 5 Snippets Paukovich N, Spear EA, MacFadden A, Nowling NN, Henen MA, Vögeli B, Filbin ME.
In-Text Gene Mentions

…in Colorectal Cancer,DCC, and the 60S…

…ctrostatic interaction betweenDCCand the 60S…

…findings reveal howDCCdirectly regulates local…

…the absence ofDCC’s growth cue, netrin-1.…

…membrane-proximal portion ofDCC’s cytoplasmic tail, specifica…

Show Full Abstract

Transmembrane receptors in neurons act as transducers of extrinsic growth cues by regulating local protein synthesis of specific mRNAs to facilitate axon guidance. In the absence of cues, receptors tether and silence translation at the membrane, but little is known about this receptor-ribosome interaction. Here, we show the direct and specific interaction between the transmembrane receptor Deleted in Colorectal Cancer, DCC, and the 60S subunit that leads to translation inhibition in the absence of DCC's growth cue, netrin-1. We combined translation assays, equilibrium binding, and NMR spectroscopic approaches and identified the plasma membrane-proximal portion of DCC's cytoplasmic tail, specifically residues 1123 to 1158, bind the 60S subunit. We show that this region is unstructured, providing evidence for how the subunit is tethered at the membrane. Pinpointing the electrostatic interaction between DCC and the 60S subunit protein eL5/uL18 that leads to translational silencing, we propose a two-part binding interaction that facilitates this function. Our findings reveal how DCC directly regulates local translation, shedding light on the role of transmembrane receptors in controlling protein synthesis during axon guidance.

Also flagged:Epoxy fatty acidsarachidonic acidepoxyeicosatrienoic acidsvasodilationcytochromes P450dihydroxyeicosatrienoic acids
Journal Article 2025-09-18 No Snippets Edin ML, Graves JP, Zeldin DC.
Show Full Abstract

Epoxy fatty acids (EpFAs), including arachidonic acid (AA)-derived epoxyeicosatrienoic acids (EETs), are endogenously produced bioactive signaling molecules with diverse physiological effects, including vasodilation, anti-inflammation, and cardioprotection. EETs are generated by a subset of cytochromes P450 and their biological activity is reduced by hydrolysis to dihydroxyeicosatrienoic acids (DHETs) by epoxide hydrolases. Inhibition of soluble epoxide hydrolase (sEH) has shown significant therapeutic promise in preclinical models of disease. Despite the profound physiological impact of EETs and the therapeutic potential of sEH inhibitors, the precise signaling mechanisms by which EETs elicit their biological effects remain unknown. Many have sought to identify a high-affinity, EET-activated, G-protein-coupled receptor (GPCR). This review synthesizes current knowledge regarding the evidence supporting the existence of one or more EET-GPCRs and weighs this evidence against alternative or complementary EET signaling pathways. The breadth of these studies highlights the complexities and challenges in fully elucidating the precise molecular mechanisms of EET actions.

Also flagged:Autophagyprotein homeostasisprotein synthesisdegradationagingage-related diseases
Journal Article 2025-09-18 No Snippets Lange CM, Higuchi-Sanabria R, Kumsta C.
Show Full Abstract

Proteostasis (protein homeostasis), the balance of protein synthesis, folding, and degradation, is critical for cellular function and organismal health. Its disruption leads to the accumulation of misfolded and aggregated proteins, hallmarks of aging and age-related diseases, including neurodegeneration. Autophagy, a conserved lysosome-mediated degradation pathway, is central to proteostasis by clearing toxic proteins and damaged organelles. In Caenorhabditis elegans, studies across conserved longevity paradigms and models of neurodegenerative diseases have defined key mechanisms by which autophagy maintains proteostasis during aging and stress. Beyond its degradative functions, autophagy contributes to spatial quality control by promoting the formation of potentially protective protein inclusions and coordinating with the ubiquitin-proteasome system. Emerging evidence also points to noncanonical autophagy pathways, such as unconventional secretion and inter-tissue communication, that broaden its role in systemic proteostasis. Together, these advances underscore autophagy's multifaceted contribution to protein quality control, with wide-ranging implications for aging, stress resistance, and neurodegenerative disease.

HFE
Also flagged:Chronic Liver DiseaseLiver Cirrhosisalbuminaspartate aminotransferasegadoliniumexcretion
Journal Article 2025-09-18 ✓ 1 Snippet Demirşah AC, Gündoğdu E.
In-Text Gene Mentions

hemochromatosis, Wilson’s disease), is…

Show Full Abstract

<h4>Introduction</h4>In chronic liver disease (CLD) and liver cirrhosis (LC), assessing hepatic function and disease severity is crucial for patient management. This study aimed to evaluate the relationship between platelet-albumin-bilirubin (PALBI) grade and aspartate aminotransferase/platelet ratio index (APRI) with the functional liver imaging score (FLIS) and liver-to-kidney enhancement ratio (LKER) using gadolinium ethoxybenzyl diethylenetriamine pentaacetic acid (Gd-EOB-DTPA)-enhanced hepatobiliary phase (HBP) magnetic resonance imaging (MRI).<h4>Methods</h4>After applying exclusion criteria, 86 patients with CLD or LC who underwent Gd-EOB-DTPA-enhanced MRI between January 2018 and October 2023 were included. APRI and PALBI grades were calculated from laboratory data. FLIS was determined as the sum of three HBP imaging features (liver parenchymal enhancement, biliary excretion, and portal vein sign), with each scoring 0-2. LKER was calculated by dividing liver signal intensity by kidney intensity using region of interest (ROI) measurements. Spearman's correlation was used to assess relationships between the variables.<h4>Results</h4>APRI showed a weak negative correlation with both FLIS (r = -0.327, p = 0.02) and LKER (r = -0.308, p = 0.004). PALBI showed a moderate negative correlation with FLIS (r = -0.495, p = 0.001) and LKER (r = -0.554, p = 0.0001).<h4>Discussion</h4>FLIS and LKER moderately correlated with PALBI and weakly with APRI. LKER may be a more practical tool due to its quantitative nature. Despite limitations, combining imaging and lab-based scores could enhance liver function assessment.<h4>Conclusion</h4>FLIS and LKER can validate, rather than predict or exclude, liver dysfunction in CLD and LC.

Also flagged:Membranesorganellesendoplasmic reticulummitochondrialMitochondriaMembrane
Journal Article 2025-09-18 No Snippets Hong H, Guo Z, Ge J, Li H.
Show Full Abstract

Membrane contact sites enable organelles to interact closely, thereby coordinating cellular homeostasis and functional regulation. Among diverse subcellular membrane architectures, mitochondria-associated endoplasmic reticulum membranes (MAMs) assume a crucial role in the physiological and pathological environments. A plethora of cellular processes are intertwined with MAMs, such as Ca<sup>2+</sup> translocation, lipid metabolism, endoplasmic reticulum (ER) stress response, mitochondrial dynamics, and mitophagy. In the event of improper modulation of MAMs components, the incidence of diseases would surge remarkably. This review endeavors to expound upon the functions of key MAMs proteins in healthy state and decipher their regulatory mechanisms under physiological and pathological circumstances. In addition, we try to probe into the specific contribution of MAMs within the occurrence and development of diseases, and subsequently collate drug compounds and clinical trials that target MAMs components. Finally, we proffer our insights regarding the contentious perspectives and prospective research directions of MAMs. Understanding the roles and mechanisms of MAMs may potentially offer novel diagnostic biomarkers and treatment targets in clinical practice, paving the way for more precise and effective clinical interventions for common diseases.

Also flagged:Polyphenolsdeathcanceroleuropeinhydroxytyrosolcancers
Journal Article 2025-09-18 No Snippets Anwar MJ, Anwar MH, Imran M, Noman AM, Hussain M, Raza H, Mohamed HM, Mohamed GA, Ibrahim SRM, Yehuala TF, Alsagaby SA, Al Abdulmonem W, Abdelgawad MA, Mostafa EM, Ghoneim MM, Selim S.
Show Full Abstract

Cancer is emerging as a leading cause of death globally. Considering the disease burden, scientists are working to develop various strategies by exploring natural sources for cancer treatment. The use of olive oil (OO) and its phytochemicals, specifically oleuropein and hydroxytyrosol (HT), as a remedy against various types of cancer is gaining attention among scientists and researchers. The current review aimed to highlight the antioxidant potential and summarize the various pathways and markers involved in the prevention and treatment of different human cancers. The databases, including Google Scholar, PubMed, and Web of Science, were searched to collect relevant data. The studies showed that some markers are specifically linked to particular types of cancers (such as 27-OHC, ATF-2, TNFRSF10B, HER2, and MET, which are linked to breast cancer; iNOS and NO, which are linked to thyroid cancer; GLUT1 and GLUT4, HIF-1α, MCT4, PKM2, PD-1, PD-L1, and CTLA-4, which are linked to colorectal cancer). Olive oil is involved in the management of these markers to prevent and/or treat all types of cancers by upregulating tumor suppressor genes, downregulating oncogenes, and modulating different pathways (PI3K/AKT/mTOR, Wnt/β-catenin, and MAPK). Taken together, it can be concluded that olive oil and its components have prominent potential to cure cancers in the human body. However, further investigations can be carried out to suggest the lethal doses of olive oils as a whole and its phytochemicals individually for the treatment of cancer.

Also flagged:ExtracellularVesicleExtracellular vesiclesmembranecancerinfectious disorders
Journal Article 2025-09-18 No Snippets Star AT, Hewitt M, Badhwar A, Ding W, Tremblay TL, Hill JJ, Willmore WG, Sandhu JK, Haqqani AS.
Show Full Abstract

<h4>Background</h4>Extracellular vesicles (EVs) are an important source of blood biomarkers and are emerging as next-generation therapeutics. Demonstrating the purity of isolated EVs is essential for applications ranging from proteomics-based biomarker discovery to biomanufacturing. In this study, we systematically evaluated multiple EV isolation methods for plasma and developed a scoring method to identify the approach best suited for proteomics.<h4>Methods</h4>Commonly used enrichment techniques, including size-exclusion chromatography (SEC) and precipitation-based methods, were compared against the starting plasma in terms of particle yield and size, proteomic overlap, depletion of abundant plasma proteins, and enrichment of EV markers and unique proteins. To enable rigorous purity assessment, we established a targeted parallel reaction monitoring (PRM) mass spectrometry assay that quantified key EV markers and contaminant proteins across preparations.<h4>Results</h4>Among the methods tested, SEC showed the greatest enrichment of EV markers and unique proteins, with the lowest level of contaminants, resulting in the highest overall purity scores. SEC also allowed for the detection of EV-free proteins. Other methods, by contrast, performed sub-optimally and were less reliable for proteomics-driven biomarker discovery.<h4>Conclusions</h4>SEC provides the most EV-enriched plasma isolates for proteomics information, with minimal contamination from plasma proteins. The PRM-based purity scoring offers an objective means of benchmarking EV preparations and may help standardize EV isolation quality for both biomarker discovery and therapeutic manufacturing.

Also flagged:hatchingcarbohydratebrush-bordercarbohydratesfatty acidsembryogenesis
Journal Article 2025-09-18 No Snippets Roura E, Khaskheli AA, Meijer MMY, Navarro M, Niknafs S, Zhou X, Nguyen HTT, van den Brand H, Uni Z, Ferket P.
Show Full Abstract

The post-hatching period in chickens is marked by the transition in nutrient source from the endogenous liquid yolk to exogenous solid feed, and the vulnerability to environmental pathogens underscoring the importance of an early development of the digestive and immune systems. This review explores innovative strategies to address these challenges, including developmental programming through broiler breeder interventions, and in ovo applications. Developmental programming mechanisms evolved as evolutionary strategies to optimize the survival of future generations in anticipation of environmental challenges including nutritional scarcity. These may involve chemosensory pathways influenced by dietary volatile compounds (VOCs) becoming one of the main factors determining feeding behaviour and appetite immediately after hatch. Dietary VOCs are transferred from the breeder diet to the fertile egg, shaping innate food preferences in the next generation. Other plant functional compounds include essential oils (EO) which are also partially transferable to the developing embryo with functional activities relevant to gut health in chickens. Carvacrol (the main active compound in oregano EO) can be supplemented through breeder diets to influence embryonic development. A systematic study on in ovo applications of EO identified compounds enhancing embryonic growth and the development of the digestive and immune systems. Changes in the pH of egg compartments (particularly albumen and yolk) respond to the metabolism of the developing embryo. These compartments show a high buffering capacity required for a tight control of the pH. The in ovo application of organic acids has the potential of changing compartmental pH and modulate enzymatic activities. Thus, it is possible to control nutrient release by controlling pH dynamics. Several of the environmental effects on developmental biology involve epigenetic mechanisms. A review of current epigenetic modifications relevant to chicken embryonic and post-hatch development has been outlined. In summary, this review highlights trans- or inter-generational mechanisms and novel in ovo strategies that have the potential to improve post-hatch robustness in chickens.

OLFM4
Also flagged:TumorCancerresponse to treatmenttumorscolorectal cancerimmune responses
Journal Article 2025-09-18 ✓ 1 Snippet Coppo R, Inoue M.
In-Text Gene Mentions

…LGR5 + ,OLFM4+ , and…

Show Full Abstract

Cancer cell plasticity, defined as the ability of tumor cells to reversibly adopt distinct functional states, plays a central role in tumor heterogeneity, therapy resistance, and disease relapse. This process enables cells to enter stem-like, dormant, or drug-tolerant persister states in response to treatment or environmental stress without undergoing genetic changes. Such reversible transitions complicate and limit current treatments. Conventional cancer models often fail to capture the complexities of these adaptive states. In contrast, patient-derived tumor organoids (PDOs), which retain the cellular diversity and structure of primary tumors, provide a unique system for investigating plasticity. This review describes how PDOs can model cellular plasticity, such as the emergence of drug-tolerant persister cells and the interconversion between cancer stem cell states across multiple tumor types. We particularly focused on colorectal cancer organoids, for which research on the mechanism of plasticity is the most advanced. Combined with single-cell analysis, lineage tracing, and functional assays, PDOs can help identify the molecular pathways that control plasticity. Understanding these mechanisms is important for developing therapies to prevent treatment failure and control disease progression.

HFE
Also flagged:menopauseobesitytype 2 diabetesliver steatosistransaminasessteatosis
Journal Article 2025-09-18 ✓ 1 Snippet Milani I, Parrotta ME, Colangeli L, Chinucci M, Palleschi S, Rossi B, Sbraccia P, Mantovani A, Leonetti F, Guglielmi V, Capoccia D.
In-Text Gene Mentions

…injury, autoimmune hepatitis,hemochromatosis, primary sclerosing cholangit…

Show Full Abstract

<b>Background</b>: Age over 50, menopause, obesity and type 2 diabetes (T2D) are key risk factors for Metabolic dysfunction-associated steatotic liver disease (MASLD). This observational study aimed to assess sex differences in anthropometric and clinical profile, including non-invasive liver steatosis indices, in subjects with MASLD, obesity and/or T2D, aged ≥ 50 years. <b>Methods</b>: Anthropometric and clinical parameters, non-invasive indices for steatosis and fibrosis and FibroScan<sup>®</sup> data were collected. <b>Results</b>: Among 213 patients (65.7% women, median age 63.0 years and mean Body Mass Index (BMI 34.9 kg/m<sup>2</sup>), men had higher body weight and waist circumference (WC), whereas women showed higher BMI and waist-to-height ratio (WHtR), and were more likely to exceed WC sex-specific and WHtR risk cut-offs. While transaminases values were higher in men, sex-specific cut-offs revealed that women more frequently exceeded these thresholds. No sex-differences were found for Fatty Liver Index (FLI), Fibrosis-4 (FIB-4) or FibroScan<sup>®</sup>, although higher rate of mild fibrosis in women. The diagnostic accuracy of FLI for detecting steatosis was significantly higher in men and unsatisfactory in women (Area Under the ROC Curve, AUC 0.863 vs. 0.655). <b>Conclusions</b>: While MASLD is more common in men, these results suggest that postmenopausal women with visceral obesity showed similar or worse liver and cardiometabolic profiles than men, despite appearing healthier based on standard clinical parameters. Notably, common markers like transaminases and the FLI were less accurate in detecting steatosis in women, underscoring the need for sex-specific diagnostic criteria and greater clinical attention to older women, particularly those with central obesity, to ensure early identification and management of MASLD.

Also flagged:ARPCamethylationenzalutamideDNMTCRPC
Journal Article 2025-09-18 No Snippets Selmani Z, Peixoto P, Overs A, Hervouet E.
Show Full Abstract

For ten years, DNA methylation appeared as a major step in the understanding and issues of prostate cancers. Indeed, although classical biochemical parameters are still useful for prostate cancer diagnosis, they have poor sensitivity and are not specific for prostate cancer subtypes. The recent boom in the identification of specific DNA methylation profiles and the rapid development of liquid biopsies have completely modified the care of patients and may greatly influence outcomes in the future. Indeed, DNA methylation modifications could substantially improve the diagnosis by identifying specific prostate subtypes, improve follow-up to monitor residual disease, improve therapeutic efficiency by predicting the response to treatment, and improve the health quality of patients since these epigenetic modifications can easily be detected in non-invasive liquid biopsies.

Also flagged:Circadian RhythmsRedoxHomeostasislocomotionsarcopeniaredox homeostasis
Journal Article 2025-09-18 No Snippets Sutton E, Pekovic-Vaughan V.
Show Full Abstract

Skeletal muscle plays vital roles in locomotion, metabolic regulation and endocrine signalling. Critically, it undergoes structural and functional decline with age, leading to a progressive loss of muscle mass and strength (sarcopenia) and contributing to a systemic loss of tissue resilience to stressors of multiple tissue systems (frailty). Emerging evidence implicates misalignments in both the circadian molecular clock and redox homeostasis as major drivers of age-related skeletal muscle deterioration. The circadian molecular clock, through core clock components such as BMAL1 and CLOCK, orchestrates rhythmic gene, protein and myokine expression impacting diurnal regulation of skeletal muscle structure and metabolism, mitochondrial function, antioxidant defence, extracellular matrix organisation and systemic inter-tissue communication. In parallel, the master redox regulator, NRF2, maintains cellular antioxidant defence, tissue stress resistance and mitochondrial health. Disruption of either system impairs skeletal muscle contractility, metabolism, and regenerative capacity as well as systemic homeostasis. Notably, NRF2-mediated redox signalling is clock-regulated and, in turn, affects circadian clock regulation. Both systems are responsive to external cues such as exercise and hormones, yet studies do not consistently include circadian timing or biological sex as key methodological variables. Given that circadian regulation shifts with age and differs between sexes, aligning exercise interventions with one's own chronotype may enhance health benefits, reduce adverse side effects, and overcome anabolic resistance with ageing. This review highlights the essential interplay between circadian and redox systems in skeletal muscle homeostasis and systemic health and argues for incorporating personalised chrono-redox approaches and sex-specific considerations into future experimental research and clinical studies, aiming to improve functional outcomes in age-related sarcopenia and broader age-related metabolic and musculoskeletal conditions.

DCC
Also flagged:axonalaxonmyelinCa 2+ion channels2
Journal Article 2025-09-18 ✓ 2 Snippets Numata T, Tsutsumi M, Sato-Numata K.
In-Text Gene Mentions

…their receptors (e.g.,DCC, Unc5, ROBO1) constitute…

…through interactions withDCCand integrins […

Show Full Abstract

Schwann cells (SCs) are central players in peripheral nerve repair, facilitating axonal regrowth, remyelination, and modulation of the regenerative microenvironment. A pivotal driver of these functions is intracellular Ca<sup>2+</sup> signaling, regulated by both endogenous Ca<sup>2+</sup>-permeable ion channels and engineered optogenetic actuators. Recent developments in optogenetics, particularly the application of Ca<sup>2+</sup>-permeable channelrhodopsins such as CapChR2, have enabled precise, light-controlled activation of SCs, allowing for targeted investigation of Ca<sup>2+</sup>-dependent pathways in non-neuronal cells. This review synthesizes emerging evidence demonstrating that optogenetically or endogenously induced Ca<sup>2+</sup> influx in SCs leads to the release of a diverse set of neurotrophic and regulatory factors. These Ca<sup>2+</sup>-triggered secretomes modulate SC phenotypes and surrounding neurons, orchestrating axon regeneration and myelin repair via autocrine and paracrine mechanisms. We further discuss the roles of key endogenous Ca<sup>2+</sup> channels-including transient receptor potential (TRP) channels and store-operated Ca<sup>2+</sup> entry (SOCE; STIM/Orai)-in orchestrating SC activation under physiological and injury-induced conditions. By integrating insights from optogenetic manipulation and intrinsic signaling biology, this review proposes a conceptual framework in which Ca<sup>2+</sup>-triggered SC secretomes act as structural and functional scaffolds for nerve repair. We highlight how SC-derived factors shape the regenerative niche, influence adjacent neurons and glia, and modulate repair processes in peripheral and autonomic nerves.

HTT
Also flagged:Nicotinamide Mononucleotide Adenylyl Transferaseschaperonelocalizationsneurological disordersNMNATtranslational
Journal Article 2025-09-18 ✓ 1 Snippet Lee YC, Lin SJ.
In-Text Gene Mentions

…HAAO 3-hydroxyanthranilic acid3,4-dioxygenase HttHtt Huntingtin aggregates…

Show Full Abstract

Nicotinamide adenine dinucleotide (NAD<sup>+</sup>) is an essential metabolite, and abnormal NAD<sup>+</sup> metabolism has been linked to numerous human diseases. The nicotinamide mononucleotide adenylyl transferases (NMNATs) catalyze NAD<sup>+</sup> production through both de novo and salvage pathways. NMNATs are multi-functional enzymes with NAD<sup>+</sup> synthesis activity and chaperone activity. Interestingly, NMNATs are involved in neuroprotection, and whether these neuroprotective effects require NAD<sup>+</sup> synthesis activity appears to vary depending on the context. Nevertheless, NMNATs can modulate cellular processes primarily through supporting NAD<sup>+</sup> homeostasis. In this review, we discuss the roles of NMNATs in NAD<sup>+</sup> homeostasis, their functional domains, and how their subcellular localizations influence the compartmentalized NAD<sup>+</sup> pools. We present an integrative framework to help understand the diverse impacts of NMNATs in human diseases, with a focus on neurological disorders caused by different insults. To address knowledge gaps, we integrate the regulation of NMNATs in both human and model organisms. We also discuss the current understanding and limitations of NMNAT activators and inhibitors to help evaluate their translational significance as therapeutic targets for NAD<sup>+</sup> modulation.

TNFSF4
Also flagged:Atopic DermatitisADautoimmune diseasesautoimmune disordersinflammatory bowel diseaserheumatoid arthritis
Journal Article 2025-09-18 ✓ 3 Snippets Lazanas P, Antonatos C, Tsoumani KT, Sgourou A, Vasilopoulos Y.
In-Text Gene Mentions

…including MRPS21 andTNFSF4in chromosome 1,…

…encoded by theTNFSF4gene and the…

…ntigen-presenting cells, whereTNFSF4signaling contributes to…

Show Full Abstract

Atopic dermatitis (AD) and autoimmune diseases exhibit epidemiological comorbidity, yet the shared genetic architecture remains incompletely understood. We investigated the genetic overlap between AD and three autoimmune disorders including inflammatory bowel disease (IBD), rheumatoid arthritis (RA), and vitiligo, leveraging genome-wide association data. Despite modest evidence for global genetic correlations, we found 113 independent pleiotropic loci shared among AD and autoimmune diseases, with 11 displaying a concordant effect across all 3 pairwise comparisons. Gene-set and tissue enrichment analyses evidenced the inflammatory background of pleiotropic associations. Multi-trait colocalization analysis prioritized 22 loci, linking the tissue-specific expression of <i>DOK2</i>, <i>GPR132</i>, <i>RERE</i>, <i>RERE-AS1</i>, <i>SUOX</i>, <i>TNFRSF11A</i>, and <i>TRAF1</i> pleiotropic genes with AD risk. Mendelian randomization revealed no causal effect of genetic liability to AD on autoimmune diseases. Nevertheless, genetic liability to IBD increased AD risk, while vitiligo exhibited a protective effect post outlier correction. Our findings provide mechanistic insights into the multimorbidity of atopic dermatitis (AD) and autoimmune diseases, offering additional evidence for the pleiotropic genetic architecture of AD that contributes to systemic immune dysregulation across multiple organ systems.

HFE
Also flagged:GranulinPrediabetesdiabetesobesityinsulin resistanceglucose
Journal Article 2025-09-18 ✓ 1 Snippet Chou YH, Kao Y, Chan KC, Chou HW, Liang YC, Wu HT, Ou HY.
In-Text Gene Mentions

…cholangitis, Wilson’s disease,hemochromatosis, or other hepatic…

Show Full Abstract

<b>Background</b>: Recently, the incidence of diabetes has increased. A rapid method for the diagnosis of prediabetes is needed. Although granulin levels are associated with obesity and insulin resistance, it remains unclear whether serum granulin concentration may serve as a biomarker of prediabetes and diabetes. Here, we examined the association between serum granulin and glycemic status in a clinical population. <b>Methods:</b> In total, 180 age- and sex-matched participants with normal glucose tolerance (NGT), impaired fasting glucose (IFG), impaired glucose tolerance (IGT) and newly diagnosed diabetes (NDD) were recruited. Serum granulin levels were measured via an enzyme-linked immunosorbent assay. Multivariate linear regression analysis was performed to evaluate the relationships between the level of granulin and different glycemic statuses. The utility of the granulin concentration for diagnosis of prediabetes and diabetes was evaluated with a receiver operating characteristic (ROC) curve. <b>Results:</b> Serum granulin concentrations were significantly greater in the IFG, IGT and NDD groups than in the NGT group. Multiple linear regression analysis revealed that obesity and glycemic status were independently associated with granulin concentrations. The ROC curve analysis revealed an area under the curve of 0.781 (95% CI, 0.709-0.853; <i>p</i> < 0.001). <b>Conclusions:</b> An elevated serum granulin concentration has potential utility as a biomarker for screening prediabetes and diabetes.

Also flagged:ImmunoregulationESAT-6PathogenesisTuberculosissecretionmembrane
Journal Article 2025-09-18 No Snippets Lu W, Lin J, He Y, Yang B, Qiu F, Dai Z.
Show Full Abstract

The early secreted antigenic target of 6 kDa (ESAT-6), a main effector molecule of the ESX-1 secretion system, is identified as a virulence determinant and immunoregulatory protein of <i>Mycobacterium tuberculosis</i> (Mtb), affecting the interaction between host immune cells and pathogens. ESAT-6 facilitates the survival of mycobacteria and their cell-to-cell spreading through membrane-permeabilizing activity and the regulation of host immune cell functions. In this review, we first summarize the recent knowledge of the roles of ESAT-6 in the survival of bacteria, phagosomal escape, and pathogenicity during Mtb infection. Then, we focused on its complex immunomodulatory effects on different immune cells, such as macrophages, dendritic cells, neutrophils, and T cells, accentuating its capability to either facilitate or inhibit immune responses through different signaling pathways. While our review has summarized its main roles in immunopathology in the context of tuberculosis, we additionally search for emerging evidence indicating that ESAT-6 has anti-inflammatory and immunosuppressive properties. Particularly, we discuss recent preclinical studies showing its capability to suppress transplant rejection and alloimmunity, probably via the induction of regulatory T cells. Nevertheless, the potential clinical use of ESAT-6 remains uncertain and needs further verification by comprehensive preclinical and clinical studies. Thus, we propose that ESAT-6 may be exploited to ameliorate immunopathology in TB infection and to suppress immune-mediated inflammation or transplant rejection as well.

Also flagged:infertilityreverse transcriptioncyclophosphamideoxygensuperoxide dismutaseSOD
Journal Article 2025-09-18 No Snippets Huang P, Chen S, Cai J, Jiang C, Liu B, Fu Y, Lin D.
Show Full Abstract

Decreased ovarian reserve (DOR) refers to the decreased ability of the ovaries to produce eggs and the low quality of the follicles, which may lead to abnormal menstruation and infertility. However, the role of circular RNAs (circRNAs) in DOR remains poorly understood. Through circRNA sequencing, hsa_circ_0005379 was identified as the most significantly upregulated circRNA in the follicular fluid exosomes of patients with DOR. The present study aimed to characterize the circRNA expression profile and investigate the function of hsa_circ_0005379 in DOR. Exosomes were isolated from the follicular fluid of individuals with DOR and healthy controls, followed by sequencing using the Illumina HiSeq platform. Functional enrichment analysis, including Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analysis, was performed on the differentially expressed circRNAs. To further validate the results, the expression of five circRNAs was assessed in follicular fluid via reverse transcription-quantitative PCR (RT-qPCR). A DOR cell model was established by treating KGN granulosa cells with cyclophosphamide (CTX). Cell viability was evaluated using a Cell Counting Kit-8 assay following CTX exposure. hsa_circ_0005379 was either overexpressed or knocked down in the CTX-treated cells, and the levels of cell apoptosis, reactive oxygen species (ROS), malondialdehyde (MDA) and superoxide dismutase (SOD) were analyzed by flow cytometry and biochemical assays. Eight differentially expressed circRNAs were identified in individuals with DOR compared with controls, including seven upregulated and one downregulated. RT-qPCR confirmed that the expression trends of hsa_circ_0000344, hsa_circ_0001126, hsa-circ_0005379, hsa_circ-0005777 and hsa_circ_0007509 aligned with those from the sequencing results. Furthermore, overexpression and knockdown of hsa_circ_0005379 in KGN cells was verified by RT-qPCR. Silencing hsa_circ_0005379 in CTX-treated KGN cells promoted cell viability and reduced apoptosis, accompanied by reduced ROS and MDA levels and enhanced SOD activity. Overexpression of hsa_circ_0005379 yielded the opposite results. Collectively, the results suggested that hsa_circ_0005379 played a key role in regulating cell viability and oxidative stress in CTX-treated granulosa cells.

Also flagged:diethylanthracenedysprosiumLanthanidedianthracenesmethyl
Journal Article 2025-09-18 No Snippets Qin YH, Ma XF, Hou X, Huang XD, Bao SS, Tian Y, Zhang YQ, Zheng LM.
Show Full Abstract

Lanthanide-anthracene complexes that can undergo reversible photocycloaddition reaction are attractive for the development of photoresponsive luminescent single-molecule magnets (SMMs). However, how to regulate the de-dimerization temperature of <i>in situ</i> formed dianthracenes remains an open question. Here, we report two binuclear dysprosium-anthracene complexes [Dy<sub>2</sub>(SCN)<sub>4</sub>(L)<sub>2</sub>(depma)<sub>2</sub>(DEPP)<sub>2</sub>] (1) and [Dy<sub>2</sub>(SCN)<sub>4</sub>(L<sup>Me</sup>)<sub>2</sub>(depma)<sub>2</sub>(DEPP)<sub>2</sub>] (2), where L is 2,6-dimethoxyphenol, L<sup>Me</sup> is 4-methyl-2,6-dimethoxyphenol, depma is 9-diethyl-phosphonomethylanthracene, and DEPP is diethylpropylphosphonate. Both undergo single-crystal-to-single-crystal (SC-SC) photocycloaddition reactions to form the 1D coordination polymers [Dy<sub>2</sub>(SCN)<sub>4</sub>L<sub>2</sub>(depma<sub>2</sub>)(DEPP)<sub>2</sub>] <sub><i>n</i></sub> (1UV) and [Dy<sub>2</sub>(SCN)<sub>4</sub>(L<sup>Me</sup>)<sub>2</sub>(depma<sub>2</sub>)(DEPP)<sub>2</sub>] <sub><i>n</i></sub> (2UV), where depma<sub>2</sub> is photo-dimerized depma, concomitant with changes in photoluminescence and magnetic properties. Interestingly, the de-dimerization temperatures of 1UV (80 °C) and 2UV (71 °C) are much lower than those of the known lanthanide-dianthracene complexes (≥100 °C). We found that the stability of <i>in situ</i> formed dianthracene depends largely on the spacing and slip angle of the anthracene pair in the original complex, with spacing being more important, and these parameters can be modulated by choosing suitable co-ligands. In addition, we investigated the kinetics of the photocycloaddition reaction of 1 at different temperatures and found that the rate of the reaction reached a maximum at the temperature of complete de-dimerization.

Also flagged:nanohydroxyapatitequercetinflavonoidchitosancollagenpore
Journal Article 2025-09-18 No Snippets Arpornmaeklong P, Kongjaroen A, Kangwarnwiboon S, Vajatieng O, Apinyauppatham K, Boonyuen S, Ummartyotin S.
Show Full Abstract

This study focused on creating bioactive, injectable hydrogels for bone regeneration, utilizing cuttlebone derived nanohydroxyapatite (CB-nHA) and quercetin (QT), a natural flavonoid, to enhance their capacity. It explored how different ratios of CB-nHA and chitosan/collagen, along with QT, in calcium carbonate (CaCO<sub>3</sub>-QT) microcapsules influenced the injectability and osteoconductive properties of thermosensitive chitosan/collagen hydrogels. The hydrogels were prepared with varying concentrations of CB-nHA (0 %, 5 %, 10 %, and 15 % w/v) and chitosan/collagen ratios (7:1 and 14:1 w/w). Their microstructure, mechanical, and physical properties, rheological and injectability tests were examined to identify optimal hydrogel's formulations. Additionally, cytotoxicity and osteoconductivity of the hydrogel were evaluated using encapsulated human fetal osteoblasts (hFOB) obtained from ATCC (USA). It was found that higher concentrations of CB-nHA and chitosan reduced pore size and degradation while increasing complex modulus and injection force. The CaCO<sub>3</sub>-QT promoted cell growth by effectively storing and releasing QT. The optimal formulation, a 5 % CB-nHA and 1 % CaCO<sub>3</sub>-QT hydrogel with a 7:1 chitosan/collagen ratio, was injectable and exhibited a pore size of 116 ± 47 μm. The hydrogel encapsulated cells demonstrated high viability and extensive intercellular connections, with ALP activity levels significantly higher than those in the groups with 0 % CB-nHA and CaCO<sub>3</sub> alone (p < 0.05). In conclusion, the CB-nHA and CaCO<sub>3</sub>-QT enhanced the osteoconductive property of the injectable hydrogel. A thermosensitive hydrogel composed of 5 % CB-nHA, 1 % CaCO<sub>3</sub>-QT, and a 7:1 ratio of chitosan to collagen is a bioactive and injectable carrier for osteoblasts and QT to enhance bone regeneration.

HFE
Also flagged:Autosomal Dominant Polycystic Kidney DiseaseADPKDIdiopathicmultisystemrenal cystCyst
Journal Article 2025-09-18 ✓ 1 Snippet Beridze L, Vardiashvili L, Aladashvili Z, Lekishvili T, Kintsurashvili T.
In-Text Gene Mentions

…rs (e.g., hyperparathyroidism,hemochromatosis), and, rarely, neoplastic…

Show Full Abstract

Pubic symphysis diastasis (PSD) is characterized by widening of the pubic symphysis, most often associated with pregnancy, childbirth, or trauma, while idiopathic PSD is exceedingly rare. Autosomal dominant polycystic kidney disease (ADPKD) is a multisystem disorder, but PSD has not been previously reported in this context. We present a 22-year-old female with ADPKD and progressive hip discomfort and clicking since childhood. Examination revealed mildly restricted, painful hip motion without instability. Radiography showed a pubic symphysis width of 25.5 mm, with no sacroiliac, traumatic, or degenerative findings. With no obstetric, traumatic, or inflammatory history, idiopathic PSD was diagnosed. The patient was managed conservatively with physical therapy, activity modification, and orthopedic follow-up. This is the first reported case of idiopathic PSD in an ADPKD patient, expanding the spectrum of musculoskeletal manifestations in ADPKD and highlighting the need to consider pelvic structural disorders in unexplained hip or pelvic pain.

Also flagged:mineralsoligosaccharideslactationlactoseantimicrobial proteinswater
Journal Article 2025-09-18 No Snippets Perrin MT, Mansen K, Israel-Ballard K, Bode L, Hampel D, Shahab-Ferdows S, Allen LH, Maggio FC, Njuguna EM, Tran HT, Wesolowska A.
Show Full Abstract

<h4>Background</h4>Currently, clinical care of preterm infants is limited by a dearth of information on the nutritional and bioactive composition of donor human milk (DHM).<h4>Objectives</h4>The primary objective is to assess and compare the macronutrients, vitamins, minerals, human milk oligosaccharides (HMOs), and antimicrobial proteins in human milk from approved milk banks in a variety of low-, middle-, and high-income settings. The secondary objective is to explore factors that influence composition, including gestational stage (preterm compared with term), lactation stage, maternal age, lifetime donation volume, and storage duration.<h4>Methods</h4>We conducted a cross-sectional study of human milk collected systematically from unique, approved milk bank donors (n = 600) in Chile, Kenya, Poland, the United States, and Vietnam. True protein, total fat, lactose, HMOs, vitamins, minerals, and antimicrobial proteins were assessed. Analysis of variance and Tukey's tests were used to evaluate normally distributed data; Kruskal-Wallis and Dunn's tests were used for nonparametric data. Multiple regression was used to explore factors associated with milk composition.<h4>Results</h4>The only site with predominantly preterm donors was Kenya (26/50). Kenya also had an early donation model (mean lactation stage 1.6 ± 1.1 wk), whereas the remaining sites had a mature donation model (mean lactation stage ranged 14.2-21.4 wk). Most nutrients differed significantly (P < 0.05) between geographies. For instance, true protein in Kenya was 1.3 ± 0.3 g/dL compared with 0.8 ± 0.2 at all United States banks. Many minerals were higher in the early donation model whereas lactose and several water-soluble vitamins were higher in the mature donation model. Although the lactation stage typically had the most predictive value, most nutrient variation (>60%) remained unexplained.<h4>Conclusions</h4>Clinical protocols for feeding DHM to preterm infants, including setting-specific fortifier products, may need to take into consideration the local donor milk banking model. Multidonor pooling warrants further investigation as a tool for milk banks to ensure minimum nutrient standards for DHM.

Also flagged:Alzheimer's diseaseADaphasiaapraxiaagnosiaexecutive dysfunction
Journal Article 2025-09-18 No Snippets Guo Y, Jiang Q, Gu Z, Cao H, Zuo C, Huang Y, Song Y, Chen X, Wang F.
Show Full Abstract

Iron metabolism plays a vital role in maintaining physiological homeostasis, and its dysregulation is implicated in a range of pathological consequences and illnesses, including Alzheimer's disease (AD). Prior studies have demonstrated that Tau protein and amyloid precursor protein are involved in iron homeostasis disorder. Ferroptosis, an iron-dependent form of regulated cell death, has emerged as a key contributor to AD pathogenesis and a promising therapeutic target. Acyl-CoA synthetase long-chain family 4 (ACSL4) is a lipid metabolizing enzyme that enhances ferroptosis sensitivity by promoting the incorporation of oxidizable polyunsaturated fatty acids into membrane phospholipids. Beyond ferroptosis, ACSL4 also plays crucial roles in neuroinflammation and oxidative stress, which are implicated in AD progression. Therefore, targeting ACSL4 is fantastic and has a lot of promise for treating AD. Nevertheless, the precise mechanisms through which ACSL4 contributes to AD pathology have yet to be fully elucidated. This review reveals a potentially vital role of ACSL4 in AD, focusing on its involvement in ferroptosis, oxidative stress, and neuroinflammation. Additionally, we describe some natural and synthetic compounds targeting ACSL4 with therapeutic potential in AD. Building on the theoretical findings of earlier studies about focused interventions of the ACSL4 path, our evaluation provided a broad basis for the clinical transformation in the treatment of AD strategies.

MLLT10
Also flagged:Acute myeloid leukemiaAMLchromosomepolymeraseTP53NRAS
Journal Article 2025-09-17 ✓ 3 Snippets de Oliveira Mota F, de Toledo SRC, Tesser-Gamba F, Pires MGC, Gouveia JT, Oliveira ID, da Silva Santos N, Delbuono E, Rhein BN, Guimarães RFDC, Zecchin VG, de Martino Lee ML, de Sousa AVL.
In-Text Gene Mentions

…14::ABL1; KMT2A::MLLT1; KMT2A:MLLT10); indels (ASXL; KIT;…

…and the other KMT2A::MLLT10.…

…(Table 1 ), KMT2A::MLLT10was detected in…

Show Full Abstract

Survival rate of children with Acute Myeloid Leukemia (AML) improves gradually through cooperative studies. However, the outcome depends on heterogeneous mechanisms. Comprehending the genetic background of pediatric Acute Myeloid Leukemia (AML) is the key to risk stratification. Next Generation Sequencing (NGS) technology uses target panels that may detect additional genetic subsets. The study describes the experience of using NGS for treating pediatric AML patients at an institution. Patients who showed poor outcome aberration were referred to hematopoietic stem cell transplant (HSCT). 11 patients were tested. Aberrations were found in all subjects, mainly only in the NGS panel, indicating referral to HSCT in first remission in 2 cases and helping to outline the genetic features in all cases. The availability of NGS resources has had a therapeutic impact. NGS helped outline the patients' genetic features and decision for HSCT. NGS is a valuable tool in the precision medicine era and should be widely accessible.

Also flagged:Hypogonadotropic Hypogonadismsecretiongonadotropin-releasing hormoneGnRHinfertilityKallmann syndrome
Journal Article 2025-09-17 No Snippets Topaloğlu AK, Kotan LD.
Show Full Abstract

Idiopathic hypogonadotropic hypogonadism (IHH) comprises a group of disorders characterized by deficient secretion or action of gonadotropin-releasing hormone (GnRH), leading to impaired pubertal development and infertility. Traditionally, IHH is classified into Kallmann syndrome, associated with anosmia, and normosmic IHH, in which olfactory function is preserved. The condition exhibits marked genetic heterogeneity. Advances in next generation sequencing have significantly expanded the genetic landscape of IHH, with pathogenic variants identified in over 60 genes, accounting for up to 50% of cases. Oligogenic inheritance is increasingly recognized, occurring in 10-20% of individuals. The potential for spontaneous or treatment-induced clinical recovery in a subset of patients, along with phenotypic overlap with constitutional delay of growth and puberty, presents additional diagnostic challenges. Despite these complexities, genetic studies of IHH have provided critical insights into fundamental neuroendocrine processes, most notably the recent elucidation of the Kisspeptin, Neurokinin B, Dynorphin neurons as the GnRH pulse generator. These discoveries have also informed the development of targeted therapies, exemplified by the recent FDA approval of fezolinetant, a neurokinin B receptor antagonist, for the treatment of menopausal vasomotor symptoms.

OLFM4
Also flagged:Colorectal CancerExtracellular VesiclesextracellularvesiclestumorsANXA11
Journal Article 2025-09-17 ✓ 1 Snippet Ding X, Huang X, Jiang J, Han S, Zhou Y, Bai Z, Gong F.
In-Text Gene Mentions

…KPNB1, OIT3, andOLFM4) in CRC sEVs.…

Show Full Abstract

The clinical management of colorectal cancer (CRC) urgently requires more accurate serum protein biomarkers. While conventional proteomic approaches are hindered by the high abundance of resident blood proteins, this study utilized a highly sensitive four-dimensional label-free quantitative (4D-LFQ) proteomic strategy to analyze the protein cargo of small extracellular vesicles (sEVs). We purified sEVs via ultracentrifugation from pooled serum samples of 76 CRC patients and 40 healthy controls, alongside seven paired CRC tumors and adjacent normal tissues. A total of 1187 high-confidence proteins were identified in serum sEVs using 4D-LFQ analysis. Validation in an independent cohort using four-dimensional parallel reaction monitoring (4D-PRM) confirmed the significant elevation of six candidate proteins (ANXA11, ANXA5, CALR, KPNB1, OIT3, and OLFM4) in CRC sEVs. These candidates exhibited strong diagnostic performance (AUCs 0.769 - 0.869). Crucially, in early-stage CRC, the sEV candidate proteins were significantly elevated compared to controls (<i>p</i> < 0.001), whereas conventional markers CEA and CA19-9 failed to discriminate (<i>p</i> > 0.05). A logistic regression model combining the five available sEV proteins and two conventional markers demonstrated 78.26% sensitivity and 96.67% specificity for early detection (AUC = 0.961). Our findings nominate these sEV protein signatures as promising noninvasive biomarkers for CRC diagnosis.

Also flagged:PD-1cancersprogrammed cell death protein 1glioblastomaGBMtumor
Journal Article 2025-09-17 No Snippets Artzi SB, Klausen MN, Harwood DSL, Michaelsen SR, Maarup SB, Locallo A, Fougner V, Bager NS, Hammouda NM, Nørøxe DS, Hasselbalch B, Lassen U, Weischenfeldt J, Kristensen BW.
Show Full Abstract

Immune checkpoint inhibitors have transformed treatment for several cancers, yet clinical trials of programmed cell death protein 1 (PD-1) blockade in glioblastoma (GBM) have consistently failed to show therapeutic benefit. While some studies have reported treatment-related transcriptional changes, particularly in T cells, findings remain limited and inconsistent. The aim of this study was to investigate changes in tumor cells and tumor-associated macrophages (TAMs) after PD-1 blockade in recurrent GBM using spatial transcriptomics. We performed Digital Spatial Profiling (GeoMx, NanoString) on FFPE tumor samples from 26 patients with matched primary and recurrent IDH-wildtype GBM, including 16 patients who received neoadjuvant nivolumab at recurrence. Tumor (SOX2⁺) and TAM (IBA1⁺) segments were selected for targeted spatial analysis. Following quality control and filtering, transcriptomic profiles were compared between nivolumab-treated and untreated recurrent tumors. PD-1 blockade did not induce detectable gene expression changes in either tumor cells or TAMs. There were no significant differences in global expression profiles or in more targeted analyses of malignant cell states, cell cycle activity, interferon signaling, or myeloid transcriptional programs. These results consistently indicate that neoadjuvant PD-1 blockade does not elicit measurable responses at the spatial transcriptomic level in tumor cells or TAMs in recurrent GBM. These findings align with the lack of clinical benefit observed in trials and highlight the need for alternative strategies to improve immunotherapy outcomes in GBM.

HTT
Also flagged:Extracellular vesiclesmembraneextracellular spacevesiclesmultivesicular bodiesorganelles
Journal Article 2025-09-17 ✓ 1 Snippet Monyror J, Kadam V, Morales LC, Ordóñez D, Ibanga J, Zaidi AK, McNamara E, Pink D, Stenlund M, Reyes K, Maguire AD, Huang J, Cortez LM, Sim VL, Mok SA, Posse de Chaves E, Sipione S.
In-Text Gene Mentions

…from the endogenousHttlocus ( 71…

Show Full Abstract

Gangliosides are glycosphingolipids with important roles in cell signaling and neuroprotection. While present on extracellular vesicles (EVs)-key mediators of intercellular communication-their role in EV biogenesis remains unclear. Here, we identify gangliosides as key modulators of EV biogenesis, with the specific composition of their glycan headgroup and the presence or absence of sialic acid and <i>N</i>-acetyl-d-galactosamine residues dictating whether they promote or inhibit EV biogenesis. GM1 and other complex gangliosides enhance EV secretion, while disruption of ganglioside synthesis impairs it. GM1 supplementation restores EV secretion in Huntington's disease (HD) fibroblasts and cell models with ganglioside deficiency, including models of neurodegenerative diseases caused by a genetic block of ganglioside synthesis. Notably, GM1 enhances EV-mediated secretion of pathogenic misfolded proteins, including mutant huntingtin (mHTT), α-synuclein, and tau, reducing intracellular burden and providing mechanistic insight into the mHTT-lowering effects of GM1 in HD models. Our findings shed light on the neuroprotective roles of gangliosides and their therapeutic potential in misfolded protein disorders.

RABGAP1L
Also flagged:alcoholalcohol dependenceADchronic diseasesproblematic alcohol usealcohol use disorder
Journal Article 2025-09-17 ✓ 2 Snippets Lee DJ, Song M, Lim S, Park S, Kim H, Ahn Y, Choi F, Myung W, Won HH.
In-Text Gene Mentions

…, MAPK8IP1P2 ,RABGAP1L, TCTA ,…

…also observed forRABGAP1L, SLC4A8 ,…

Show Full Abstract

<h4>Background</h4>Problematic alcohol use (PAU) is a serious global health issue with limited treatment options. Although genetic studies have identified genomic regions associated with PAU, the specific causal genes and proteins remain unclear. This study aimed to identify these causal genes by integrating diverse genetic and molecular data to inform better treatment strategies.<h4>Methods</h4>We used Mendelian randomisation (MR) to identify genes and proteins that may cause PAU by combining genetic data with gene activity in brain and blood tissues. Multiple statistical tests confirmed shared genetic signals between expression and PAU. We also examined their effects on other traits and potential interactions with existing drugs.<h4>Findings</h4>We identified 97 genes and 13 proteins that are likely to play a causal role in PAU through MR, with strong enrichment in brain tissues. These associations remained significant after Bonferroni correction and were further supported by colocalisation analyses (posterior probability of hypothesis 4 > 0.75) and consistency across multiple datasets. Some targets also showed concordant effects with PAU on other health outcomes, supported by Bonferroni-significant associations in phenome-wide analyses, suggesting potential for drug repurposing.<h4>Interpretation</h4>This study highlights molecular signatures in both brain and blood tissues that may contribute to the development of PAU. Integrative multi-omics analyses revealed shared biological pathways across neural and peripheral systems, suggesting the potential for developing multi-systemic interventions with favourable safety profiles.<h4>Funding</h4>This study was supported by Samsung Research Fund, Sungkyunkwan University, 2023.

Also flagged:opioid dependencemu-opioid receptordopamineopioid use disorderopioidaddiction
Journal Article 2025-09-17 No Snippets Branco P, Cox J, Wu Y, Morison SL, Parker JG, Lerner TN, Martina M, Awatramani R, Surmeier DJ, Apkarian AV.
Show Full Abstract

Positive reinforcement via mu-opioid receptor-mediated disinhibition of ventral tegmental area (VTA) dopamine neurons is crucial in opioid use disorder (OUD). However, VTA dopamine neurons are more heterogeneous than initially thought, both at the molecular and computational levels. Besides encoding reward prediction error, subpopulations of dopamine neurons have also been proposed to encode salience and aversion. How opioid use alters these distinct encoding properties remains unclear. Negative reinforcement-learning to avoid adverse outcomes like withdrawal-also drives chronic drug use, implicating the mesolimbic dopamine system in both positive and negative reinforcement in OUD. This review explores how chronic opioid use modifies heterogeneous VTA neuron populations, enhancing sensitivity to aversive stimuli, promoting negative affect, and motivating withdrawal-avoidance behaviors. We also examine how chronic pain may amplify these effects and discuss the importance of charting circuit-level interactions between chronic pain and OUD for clinical translation.

CACNA1E
Also flagged:gene expressionChd8chromodomain helicaseautism spectrum disordernucleusneurodevelopmental disorders
Journal Article 2025-09-17 ✓ 1 Snippet Yim KM, Baumgartner M, Krenzer M, Rosales Larios MF, Hill-Terán G, Nottoli T, Muhle RA, Noonan JP.
In-Text Gene Mentions

…(e.g., AP2S1 ,CACNA1E, CACNA2D3 ,…

Show Full Abstract

Disruptive variants in the chromodomain helicase CHD8 are associated with risk for autism spectrum disorder (ASD). CHD8 haploinsufficiency is hypothesized to contribute to ASD by perturbing neurodevelopmental gene expression. However, insight into cell-type-specific transcriptional effects of CHD8 haploinsufficiency remains limited. We used single-cell and single-nucleus RNA sequencing to identify dysregulated genes in the embryonic and juvenile Chd8<sup>+/-</sup> mouse cortex. Chd8 and other ASD risk-associated genes showed a convergent expression trajectory conserved between mouse and human developing cortex, increasing from progenitor zones to the cortical plate. Genes associated with neurodevelopmental disorders or involved in chromatin remodeling and neuron projection development were dysregulated in Chd8<sup>+/-</sup> embryonic radial glia. Genes implicated in synaptic activity and organization were dysregulated in Chd8<sup>+/-</sup> postnatal excitatory cortical neurons, suggesting impaired synaptogenesis. Our findings reveal complex patterns of transcriptional dysregulation due to Chd8 haploinsufficiency, potentially with distinct impacts on progenitors and maturing neurons in the excitatory neuronal lineage.

Also flagged:metal ionsgrapheneferrocenewatercadmiumNile blue
Journal Article 2025-09-17 No Snippets Li F, Dong P, Wu Z, Xue L, Luo M, Tan Y.
Show Full Abstract

As ubiquitous pollutants, heavy metal ions can accumulate in the food chain, increasing toxicity through synergistic effects and posing health risks to humans and other organisms. In this study, we successfully developed a dual-signal aptasensing interface for simultaneous detection of cadmium ions (Cd<sup>2+</sup>) and lead ions (Pb<sup>2+</sup>). The 2D layered Ti<sub>3</sub>C<sub>2</sub> MXene and liquid exfoliated graphene (LEG) composite nanomaterials were employed as ITO electrode modification materials, which exhibited enhanced electrochemical properties. The Cd<sup>2+</sup>-specific aptamer labeled with Nile blue and Pb<sup>2+</sup>-specific aptamer labeled with ferrocene bind to their complementary strands immobilized on the electrode surface, resulting in a dual-signal interface. In the presence of target ions, the aptamers specifically recognized and captured the targets, subsequently detaching from the electrode surface, leading to changes in the dual-signals and thereby enabling simultaneous detection of Cd<sup>2+</sup> and Pb<sup>2+</sup>. The limits of detection for Cd<sup>2+</sup> and Pb<sup>2+</sup> were determined to be 0.689 pM and 1.548 pM, with linear response ranges of 0.1 pM to 10 μM and 0.01 pM to 10 μM. The effectiveness of the proposed aptasensor in determining Cd<sup>2+</sup> and Pb<sup>2+</sup> simultaneously in water and vegetables has been demonstrated, providing substantial evidence for its potential application in food safety and environmental monitoring.

Also flagged:InfluenzaCOVID-19Chronic Renal Insufficiencychronic kidney diseaseCOVID-19 infectioninfections
Journal Article 2025-09-17 No Snippets Zou G, Jaar BG, Lash JP, Chen J, Charleston JB, Jittirat A, Patel DM, Brown J, He J, Cornish-Zirker D, Rincon-Choles H, Appel LJ, Crews DC, Riekert KA, Dowdy DW, Matsushita K, Ishigami J, CRIC Study Investigators.
Show Full Abstract

<h4>Rationale & objective</h4>Vaccine uptake among individuals with chronic kidney disease (CKD) is suboptimal. Understanding the perceptions associated with vaccine hesitancy can help inform programs aimed at addressing these concerns.<h4>Study design</h4>Cross-sectional survey.<h4>Setting & participants</h4>A subset of participants from the Chronic Renal Insufficiency Cohort (CRIC) Study, recruited from 3 study sites.<h4>Exposure</h4>Participants' perceptions about influenza and COVID-19 infection risks, benefits and harms of vaccines, vaccine skepticism, access barriers, and cues to action, according to the Health Belief Model.<h4>Outcome</h4>Influenza and COVID-19 vaccine hesitancy, defined as being uncertain about or not planning to receive a future dose of these vaccines.<h4>Analytical approach</h4>Responses were measured on a 5-point Likert scale (1 = strongly disagree, 2 = disagree, 3 = neutral, 4 = agree, 5 = strongly agree). Linear regression models were used to analyze differences in mean Likert scale scores between participants with and without vaccine hesitancy.<h4>Results</h4>Between July 2022 and June 2023, 278 CRIC participants completed the survey, of whom 47 (16.9%) and 46 (16.8%) had influenza and COVID-19 vaccine hesitancy, respectively. Linear regression models identified key perceptions associated with vaccine hesitancy, including perceived harms of the vaccines (eg, the vaccine causes influenza; ΔMean Likert scale, 1.25 [95% CI, 0.96-1.55]) and vaccine skepticism (eg, benefits of the influenza vaccine are exaggerated, 0.96 [95% CI, 0.65-1.26]). Perceived benefits were negatively associated with vaccine hesitancy (eg, influenza vaccines prevent serious illness, -0.93 [-1.23 to -0.62]). More than 40% perceived that they were not at risk of influenza, but this perception was not associated with vaccine hesitancy (0.02 [-0.35 to 0.40]). These findings were overall consistent for COVID-19, although vaccine skepticism was more prevalent and more strongly associated with vaccine hesitancy.<h4>Limitations</h4>The study population consisted of individuals with CKD who were enrolled in a cohort study and voluntarily responded to the survey.<h4>Conclusions</h4>Among individuals with CKD, perceptions of vaccine harms and vaccine skepticism were significant factors contributing to vaccine hesitancy. Improved dissemination of accurate vaccine information through tailored patient education initiatives may enhance vaccination uptake in this population.<h4>Plain-language summary</h4>People with chronic kidney disease (CKD) are at higher risk for infections, but some are hesitant to get vaccines. This study surveyed 278 CKD patients to understand why some avoid flu and COVID-19 vaccines. The study found about 17% were hesitant about each vaccine. People who were hesitant often believed the vaccines could be harmful or doubted their benefits. For example, some thought the flu vaccine could cause the flu or that vaccine benefits were exaggerated. By contrast, those who believed vaccines prevent serious illness were less hesitant. These findings suggest that clear, trustworthy information about vaccine safety and effectiveness-shared in ways that address patient concerns-could help increase vaccination rates in people with CKD.

HFE
Also flagged:cholesterolACAT2dyslipidemiahypercholesterolemiamonosaccharidePR
Journal Article 2025-09-17 ✓ 1 Snippet Wang X, Chen M, Su Y, Zhang X, Chen J, Huang Z, Xie J, Xie Q, He L, Su L, Su Z, Wang H, Li Y.
In-Text Gene Mentions

…in mice withHFE-elicited hypercholesterolemia…

Show Full Abstract

<h4>Ethnopharmacological relevance</h4>Polygonati Rhizoma (PR) has the function of "invigorating spleen and tonifying kidney", and is historically applied as a homology of medicine and food to prevent and treat dyslipidemia in China. However, there is limited experimental evidence to support this application, and the underlying mechanism has not been fully deciphered.<h4>Aim of the study</h4>To analyze the composition and illuminate the cholesterol-lowering potential and molecular mechanism of PR's aqueous extract (PRE) in high-fat emulsion (HFE)-induced hypercholesterolemia mouse model.<h4>Materials and methods</h4>Ion chromatograph was employed to determine the monosaccharide composition of PRE. HFE-induced Kunming mouse model was constructed to evaluate the anti-hypercholesterolemia effect of PRE. Metagenomic sequences and liquid chromatography-mass spectrometry (LC-MS) analysis were performed to elucidate the mechanism through which PR regulated cholesterol metabolism. Antibiotic cocktail (ABX) intervention and fecal microbiota transplantation (FMT) were used to validate whether PRE regulated cholesterol metabolism through the intestinal microbiota. The cholesterol-reducing effect of cholesterol sulfate (CS) was explored in poloxamer 407 (P407)-induced mouse model of dyslipidemia. Molecular docking and molecular dynamics (MD) simulation were also employed to elucidate the underlying mechanisms. Furthermore, a combination of qRT-PCR, Western blot, and surface plasmon resonance (SPR) were employed to delineate its mechanism.<h4>Results</h4>Our study indicated that the polysaccharides of PRE were mainly composed of fructose (92.33 %) and glucose (5.25 %). PRE treatment effectively blocked body weight gain, significantly decreased serum and hepatic levels of triglycerides (TG), total cholesterol (TC), and low-density lipoprotein cholesterol (LDL-C), and increased high-density lipoprotein cholesterol (HDL-C) level. Additionally, PRE ameliorated hepatic lipid accumulation in mice with HFE-elicited hypercholesterolemia. Notably, metagenomic sequencing and LC-MS analysis indicated that PRE markedly increased the abundance of intestinal genera Bacteroides and significantly elevated the fecal CS concentration in HFE mice. Genome-based functional analysis further indicated that cofactors of sulfonation (ATP sulfurylase CysD and CysN, BT0414-BT0415) were significantly upregulated after treatment with PRE. The cholesterol-lowering effect of PRE was largely contingent upon microbial conversion of cholesterol-to-CS mediated by Bacteroides, as validated by antibiotics-induced intestinal microbiota depletion in pseudo-germ-free model and restoration of gut microbiota through FMT. In vitro study also showed that PRE promoted the growth of Bacteroides thetaiotaomicron. Furthermore, CS markedly alleviated serum, hepatic, bile, and fecal levels of TG, TC, LDL-C, HDL-C, and TBA, indicative of appreciable lipid-lowering effect. MD simulation and SPR results indicated that CS directly bound to ACAT2. Consistent with this interaction, CS greatly downregulated the mRNA and protein expression of ACAT2 in small intestinal tissue.<h4>Conclusion</h4>These findings for the first time suggested that PR acted as a prebiotic agent to ameliorate hypercholesterolemia, at least in part, via dual mechanism involving modulation of Bacteroides-mediated sulfonation metabolic pathway and feedback inhibition of ACAT2 by CS, highlighting its therapeutic potential for cholesterol-related disorders. This work might also offer novel mechanistic insight and further buttressed the ethnopharmacological application of PR in the therapy of hypercholesterolemia.

MMS22L
Also flagged:infectionpathogenesissynthesisviral genomeneurotrophinmitochondrial
Journal Article 2025-09-17 ✓ 1 Snippet Duru IC, Plavec Z, Ylinen A, Laine P, James M, Riihimäki L, Butcher SJ, Anastasina M, Auvinen P.
In-Text Gene Mentions

…of genes (EXD2,MMS22L, FANCM and RFWD3)…

Show Full Abstract

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection triggers complex host responses, including alterations in RNA transcription and modification. Understanding these changes is crucial for elucidating viral pathogenesis and identifying potential therapeutic targets. We used direct RNA sequencing to comprehensively profile the transcriptomic and epitranscriptomic landscapes of human HEK-AT cells infected with SARS-CoV-2 at 8 h post-infection, compared to mock controls. We analysed viral and host transcriptomes, focusing on gene and transcript expression, isoform usage and RNA m6A modifications. Viral RNA sequencing reads showed 3' end-biassed coverage indicative of subgenomic RNA synthesis, with high expression of <i>N</i> gene subgenomic RNA reads. Sixteen m6A modification sites were consistently identified in the viral genome, primarily within the <i>ORF1ab</i> and <i>S</i> genes. In the human transcriptome, we found 254 positions with significantly altered m6A modification rates, with 119 showing decreased modification and 135 showing increased modification in infected cells. Genes with decreased m6A modifications were enriched in the neurotrophin signalling pathway. Transcript-level analysis identified 19 upregulated and 12 downregulated transcripts. Notably, transcript discovery and quantification revealed a novel isoform of the <i>HIST1H2BK</i> gene, which was significantly more expressed in infected cells compared to mock controls. Isoform switching analysis revealed 24 significant switches involving 21 genes, implicating mitochondrial reprogramming and immune-related pathways. In conclusion, this study provides a detailed, direct RNA sequencing-based characterization of host-virus RNA interactions, revealing key insights into SARS-CoV-2 infection mechanisms and potential therapeutic targets.

Also flagged:Phosphorussteroidal saponinssteroidalsaponinaluminum phosphateiron phosphate
Journal Article 2025-09-17 No Snippets Zhou Y, Wang Y, Xu L, Lan G, Guo D, Zhang H, Zhou N.
Show Full Abstract

To improve the phosphorus utilization efficiency and medicinal quality of the traditional Chinese medicinal herb <i>Paris polyphylla</i> var. <i>yunnanensis</i>, three inorganic phosphorus-solubilizing bacteria strains (<i>Bacillus cereus</i> Y1-1, <i>Bacillus aryabhattai</i> Z6-1, and <i>Bacillus aryabhattai</i> Z3-4) were inoculated individually and in combination into the rhizosphere soil of <i>Paris polyphylla</i> var. <i>yunnanensis</i> in a greenhouse pot experiment. At the late growth stage, the contents of total and inorganic phosphorus in the rhizosphere soils, as well as the total phosphorus and six steroidal saponins in the plants, were measured. The proportion of inorganic phosphorus in rhizosphere soils of treatment groups increased by 9.83~30.43%. The content of effective phosphorus form Ca<sub>2</sub>-P in the rhizosphere soils of treatment groups increased by 50.81~328.37%. Inoculation with <i>B. aryabhattai</i> (S2, S3, and S6) significantly increased total steroidal saponin content in plants by 9.14%, 10.64%, and 16.58%, respectively. An antagonistic effect was observed when multiple bacterial strains were inoculated together. Thus, mixed inoculation was less effective than single-strain inoculation in improving rhizosphere soil phosphorus structure. In conclusion, inoculation with inorganic phosphorus-solubilizing bacteria could enhance phosphorus availability in rhizosphere soil and improve medicinal quality of <i>Paris polyphylla</i> var. <i>yunnanensis</i>. These findings provide a basis for efficient phosphorus resource utilization and sustainable cultivation to enhance medicinal plant quality.

HFE
Also flagged:Familial Dilated CardiomyopathycardiomyopathyDilated cardiomyopathymyocardial diseaseleftheart failure
Journal Article 2025-09-17 ✓ 1 Snippet Vrettos A, Monteiro RP, Triantafyllou M, Gul U, Bhattacharyya S, Lopes LR, Antonopoulos A, Protonotarios A, Lloyd G, Gossios T, Savvatis K.
In-Text Gene Mentions

…GLA, GLB1, GUSB,HFE, HRAS, ILK, JPH2,…

Show Full Abstract

<b>Background/Objectives</b>: Early detection of familial dilated cardiomyopathy (DCM) is crucial for initiating timely interventions. Myocardial work (MW) analysis, which integrates strain imaging and blood pressure, shows promise in identifying subclinical disease. To assess the utility of MW in detecting early myocardial changes in relatives of DCM patients with a positive genotype (G+) compared to genotype-negative (G-) controls. <b>Methods</b>: This study involved asymptomatic relatives of DCM patients who underwent comprehensive echocardiographic evaluation, including MW analysis. Subjects (N = 77) were classified into G+ (<i>n</i> = 39) and (<i>n</i> = 38) groups based on genetic testing. Myocardial work parameters-myocardial global work index (GWI), global constructive work (GCW), global wasted work (GWW), and global work efficiency (GWE)-were measured. Statistical analyses compared these parameters between groups and assessed their predictive value for genotype status. Follow-up data were collected and analysed accordingly. <b>Results</b>: Among 77 participants (mean age 36 ± 14 years; 49% women), there were no significant differences in baseline characteristics between G+ and G- groups. S' septal, s' average, e' lateral, E max and E/A were found to be significantly different between the two groups. G+ individuals had significantly reduced GWE (94% vs. 96%, <i>p</i> < 0.001) and increased GWW (113 mmHg% vs. 80 mmHg%, <i>p</i> = 0.001). After adjustment for significant echocardiographic parameters, GWE (OR = 0.746, 95% CI: 0.560-0.994, <i>p</i> = 0.045) and GWW (OR = 1.012, 95% CI: 1.002-1.024, <i>p</i> = 0.047) remained significant predictors of gene carrier status in multivariable analysis. The addition of GWE and GWW significantly increased the area under the curve of a model identifying G+ individuals (<i>p</i> < 0.05). During a median period of follow-up of 53 months, 16 (21%) individuals expressed a cardiomyopathy phenotype. There was a significant correlation between increased baseline GWW, reduced GWE, and the expression of cardiomyopathy phenotype. <b>Conclusions</b>: Myocardial work analysis, specifically GWE and GWW, identifies early myocardial dysfunction in asymptomatic carriers of genetic variants for DCM. These findings suggest that MW could complement traditional imaging in the early detection and management of familial DCM.

Also flagged:Amoebic Meningoencephalitisamino estermiltefosineautophagyursolic acidtriterpenoids
Journal Article 2025-09-17 No Snippets Ben Youssef M, Chao-Pellicer J, Hernández-Álvarez E, Omrani A, Sifaoui I, Sebai H, Bazzocchi IL, Piñero JE, Jiménez IA, Lorenzo-Morales J.
Show Full Abstract

Current therapies for Primary Amoebic Meningoencephalitis (PAM) present several limitations; consequently, there is an urgent need to develop new therapeutic agents. In this regard, we undertook bioassay-guided isolation of <i>Mentha rotundifolia</i> leaves which allowed the identification of ursolic acid (<b>1</b>) as the main bioactive metabolite against two ATCC strains of <i>Naegleria fowleri</i> (ATCC<sup>®</sup> 30808<sup>TM</sup> and ATCC<sup>®</sup> 30215<sup>TM</sup>). Moreover, ten ursolic acid derivatives (<b>2</b>-<b>11</b>) were synthesized through esterification and nucleophilic substitution to obtain halo or amino ester derivatives. Among these derivatives, compound <b>7</b> exhibited the highest activity against the <i>N. fowleri</i> ATCC<sup>®</sup> 30808<sup>TM</sup> strain with an IC<sub>50</sub> value of 28.66 µM, whereas compound <b>10</b> showed the top activity against the <i>N. fowleri</i> ATCC<sup>®</sup> 30215<sup>TM</sup> strain with an IC<sub>50</sub> of 7.61 µM, surpassing the efficacy of the reference drug, miltefosine. Both compounds, <b>7</b> and <b>10</b>, showed a good selectivity index and hence low toxicity in vitro. Structure-activity relationship studies revealed that the type of acylating agent played a crucial role in the activity. Furthermore, both compounds induced autophagy and apoptosis-like processes in both treated <i>N. fowleri</i> strains. These results highlight the potential of ursolic acid-related triterpenoids as drug scaffolds and identify <i>M. rotundifolia</i> as a promising natural source of amoebicidal agents against PAM.

POU3F2
Also flagged:ObesitySex Hormone-Binding GlobulinSHBGsynthesisembryogenesiscell proliferation
Journal Article 2025-09-17 ✓ 1 Snippet Ponomarenko M, Reshetnikov E, Churnosova M, Aristova I, Abramova M, Novakov V, Churnosov V, Polonikov A, Churnosov M, Ponomarenko I.
In-Text Gene Mentions

…Pou2f2, SMC3, PU1,Pou3f2, Sin3Ak-20, PRDM1, Pou6f1,…

Show Full Abstract

The main goal of this study was to consider the role of obesity/overweight as a potential modifier of associations between gene single nucleotide polymorphisms (SNPs) affecting the sex hormone-binding globulin level (SHBG<sub>level</sub>) and uterine myoma (UM). In the two women cohorts differentiated by body mass index (BMI) (BMI ≥ 25, n = 782 [379 UM/403 control] and BMI < 25, n = 760 [190 UM/570 control]), the association of genome-wide association studies (GWAS)-correlated SHBG<sub>level</sub>-tied nine loci with UM was studied by method logistic regression with a subsequent in-depth evaluation of the functionality of UM-causal loci and their strongly linked variants. BMI-conditioned differences in the associations of SHBG<sub>level</sub>-tied loci with UM were revealed: in the BMI < 25 group, a variant rs17496332 (A/G) <i>PRMT6</i> was UM-correlated (OR = 0.70; <i>p<sub>perm</sub></i> = 0.024), and in the BMI ≥ 25 cohort, a SNP rs3779195 (T/A) <i>BAIAP2L1</i> was UM-associated (OR = 1.53; <i>p<sub>perm</sub> =</i> 0.019). Both the UM-causal loci and their proxy SNPs have pronounced probable functionality in the organism as a whole, as well as in the liver (the SHBG synthesis place), adipose tissue, uterus, etc., thereby influencing significant processes for UM biology such as regulation of the gene transcription, embryogenesis/development, cell proliferation/differentiation/apoptosis, metabolism, lipid exchange, etc. In conclusion, the results of our work demonstrated, for the first time, the essential role of obesity/overweight as a meaningful modifier of associations between SHBG<sub>level</sub>-tied polymorphisms and UM.

PRDX6
Also flagged:SLC38A2cancerscancerGlutaminetumoramino acid transporter
Journal Article 2025-09-17 ✓ 2 Snippets Liao M, Rao Y, Li M, Guo J, Guo K, Li K, Zheng R, Liu Y, Wang Q, Wang M, Chen D, Zhang M, Wang Y, Zhao Y, Li S.
In-Text Gene Mentions

…CHAC1, GSTO1, andPRDX6( Figure 5A…

…GSTT2B, SMS, andPRDX6( Figure 5D…

Show Full Abstract

<h4>Background</h4>Glutamine metabolic reprogramming is a hallmark of tumor progression and is highly correlated with poor clinical outcomes. The excessive uptake of glutamine by tumor cells is a key factor contributing to widespread invasion, metastasis, and immune suppression. SLC38A2, an amino acid transporter widely expressed on the surface of tumor cells, has not been thoroughly studied regarding its function and prognostic significance in tumor progression. Our objective is to employ bioinformatics methods to conduct a comprehensive and in-depth analysis of SLC38A2 across various cancers, aiming to elucidate its role and prognostic value in tumor biology.<h4>Methods</h4>By comprehensively incorporating gene expression and clinical data from the TCGA tumor database, GTEx database, Human Protein Atlas, and GEO database, we analyzed the expression profile, mutations, and established prognostic models for SLC38A2 across various cancers. Additionally, we investigated the enrichment of SLC38A2 at the single-cell level in 12 types of cancer and analyzed its temporal expression patterns in different cell subgroups in breast and pancreatic cancer. We also studied the correlation between SLC38A2 and glutathione metabolism.<h4>Results</h4>Compared to normal tissues, SLC38A2 exhibits significant differential expression in 15 types of cancer and serves as a prognostic risk factor in BRCA (HR = 1.597, <i>p</i> < 0.05), LUAD (HR = 1.650, <i>p</i> < 0.01), MESO (HR = 2.007, <i>p</i> < 0.05), and PAAD (HR = 1.761, <i>p</i> < 0.05), while acting as a protective factor in KIRC (HR = 0.625, <i>p</i> < 0.05). Furthermore, SLC38A2 is positively correlated with tumor and stromal cells, negatively correlated with immune cell infiltration, and associated with immune exhaustion. In BRCA, SLC38A2 is highly expressed during early differentiation of malignant and stromal cells, and enriched in late differentiation of immune cells. Moreover, the expression of SLC38A2 shows a general positive correlation with glutathione metabolism genes in BRCA, LUAD, MESO, and PAAD, demonstrating diagnostic value.<h4>Conclusion</h4>SLC38A2 shows widespread changes in expression patterns within tumor tissues, making it an effective diagnostic and prognostic biomarker. It is enriched in malignant cells and tumor-infiltrating stromal cells, while negatively correlated with the infiltration of many cells involved in anti-tumor immunity. Targeting SLC38A2 presents a viable therapeutic strategy by inhibiting glutamine competition and relieving immune suppression in the tumor microenvironment.

TNFSF4
Also flagged:cancerantibodiesIgG1bindingcell activationsecretion
Journal Article 2025-09-17 ✓ 1 Snippet Rapuano Lembo R, Passariello M, Manna L, Froechlich G, Belardo M, Nicosia A, Sasso E, De Lorenzo C.
In-Text Gene Mentions

…(3388-OX), human OX40 Ligand/TNFSF4Protein, Fc Tag…

Show Full Abstract

<h4>Introduction</h4>The second generation of Antibody-based Immunotherapy includes monoclonal antibodies against Immune Checkpoints (ICs), to modulate specific T cell responses against cancer or viruses. We recently generated a large repertoire of fully human antibodies targeting ten different ICs through a novel selection strategy based on the combination of phage libraries on human lymphocytes and next generation sequencing (NGS). Here we generated and tested four novel fully human IgG1 mAbs specific for OX-40, an immunostimulatory receptor expressed on immune cells, which has been shown to be a promising target for immune-based therapeutic strategies.<h4>Methods and results</h4>By ELISA and Biolayer Interferometry we demonstrated that they all specifically bind with high affinity to OX-40 and they recognize distinct epitopes. Three of them interfere with the binding of OX-40 and its ligand, thus suggesting that they compete with it for the receptor binding. T cell activation assays confirmed the agonistic properties of these 3 antibodies which are able to mimic the ligand by activating the pathway downstream the receptor. This activation results into an effective proliferation of hPBMCs and secretion of proinflammatory cytokines. Co-culture assays of hPBMCs with tumor cells confirm their ability to induce the activation of immune cells against cancer cells. The fourth antibody, even though non-agonistic, was able to induce the activation of lymphocytes by a different mechanism of action, based on NK-mediated Treg killing in co-culture assays.<h4>Discussion and conclusions</h4>Combinations of these anti-OX40 mAbs targeting different epitopes lead to stronger activation of immune cells. Moreover, epitope binning analyses show that they recognize distinct epitopes not overlapping with that of the clinically validated Rocatinlimab, thus they could become potential new therapeutic tools. Taking advantage of the different behaviour of the novel mAbs, we also exploited them to clarify the unclear role of OX-40 on NK cells. We show here for the first time that NK cells express higher levels of a medium glycosylated OX-40 form than T cells, which is preferentially recognized by the novel mAbs but not by OX-40L, which instead binds to a highly glycosylated OX-40 variant absent on non-immune cells. Thus, glycosylation pattern could affect the recognition and biological effects of OX-40 binders and should be considered for the design of novel drugs.

VRK2
Also flagged:hepatocellular carcinoma-related kinasetumorGene Expressionimmune checkpointwound healing
Journal Article 2025-09-17 ✓ 5 Snippets Fu Z, Liu D, Chen M, Zhong G, Zhao Z, Gong J, Dai X, Hu J, Jia D, Cheng L, Cai D, Gong J.
In-Text Gene Mentions

…the biofunction ofVRK2in HCC.…

…high VRK1 orVRK2expression in the…

…validation revealed thatVRK2knockdown inhibited HCC…

VRK2is a potential…

…genes include VRK1,VRK2, and VRK3.…

Show Full Abstract

<h4>Background</h4>Vaccinia-related kinase (VRK) family genes play a multifunctional role in tumor development. However, the role of VRK family genes in hepatocellular carcinoma (HCC) requires further research. Moreover, the clinical potential of the VRK-related model remains unclear. The aim of this study is to construct a VRK-related model to predict HCC prognosis and therapeutic efficacy.<h4>Methods</h4>The data of HCC patients were extracted from The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC), and Gene Expression Omnibus (GEO) databases. The single-sample gene set enrichment analysis (ssGSEA) algorithm was used to calculate the VRK score of each sample. Tumor IMmune Estimation Resource 2.0 (TIMER 2.0) and Tumor Immune Dysfunction and Exclusion (TIDE) were used to evaluate immune cell infiltration and the immune checkpoint response. pRRophetic was used for predicting drug sensitivity. CCK-8, colony formation, wound healing, transwell and xenograft assays were used to experimentally validate the biofunction of VRK2 in HCC.<h4>Results</h4>We found that all VRK family genes were highly expressed in HCC. Compared with patients with low VRK scores, patients with high VRK1 or VRK2 expression in the TCGA, ICGC, and GSE14520 cohorts had poorer outcomes. Moreover, patients with a high VRK score in the TCGA, ICGC, and GSE14520 cohorts also had poorer outcomes. Importantly, Cox analysis revealed that the VRK score was a potential independent risk factor for HCC. Notably, TIMER2.0 and TIDE suggested that patients with high VRK scores had higher immune checkpoint response rates. Similarly, drug sensitivity analyses suggested that patients with high VRK scores were more resistant to sorafenib, paclitaxel, cisplatin, and gemcitabine. Finally, experimental validation revealed that VRK2 knockdown inhibited HCC development <i>in vitro</i> and <i>in vivo</i>.<h4>Conclusion</h4>The VRK score was found to be a reliable indicator for predicting HCC prognosis and therapeutic efficacy. VRK2 is a potential therapeutic target for HCC.

HTT
Also flagged:primary angle-closure glaucomaophthalmic diseasetransportersneurotransmitter receptortransportermembrane
Journal Article 2025-09-17 ✓ 1 Snippet Hu Y, Hu RY, Yang HJ, Xu TT.
In-Text Gene Mentions

…5-HT2AR, 5-HT4R, 5-HT6R, 5-HTT, α4β2, CB1R, D1R,…

Show Full Abstract

<h4>Objective</h4>Primary angle-closure glaucoma (PACG), an incurable ophthalmic disease, is a serious risk to human visual health. Previous studies have demonstrated a strong link between PACG and neuroimaging changes in the brain. This study utilizes dynamic low-frequency fluctuation amplitude (dALFF) with the aim of resolving the potential dynamic alterations in neurological function in PACG and integrating transcriptomics profiles with spatial distribution characteristics of neuromodulatory receptors/transporters to systematically elucidate the underlying neurophysiopathological mechanisms.<h4>Methods</h4>We used sliding time windows of 30TR, 50TR and 80TR to calculate dALFF values and performed partial least squares regression (PLS) analysis of t-values after two-sample test of dALFF values under the sliding window of 50 TR against the Allen Human Brain Atlas (AHBA) to screen genes. Enrichment analysis, tissue-specific expression analysis and protein-protein interactions (PPI) network construction were implemented. The t-values were also analyzed for spatial correlation with neurotransmitter receptor/transporter density profiles distributed throughout the brain.<h4>Results</h4>The two-sample tests under three sliding windows revealed extensive brain alterations in PACG and each abnormal brain region showed elevation (the Gaussian Random Field method, with significance at the voxel level set at <i>p</i> < 0.005 (two-tailed) and at the cluster level at <i>p</i> < 0.01), which was mainly in the occipital lobe and angular gyrus. Enrichment analysis were mainly "regulation of neuron projection development" and "membrane organization" pathways (<i>p</i> < 0.05, no corrected). Specific expression analysis revealed that the relevant genes were involved in all stages of thalamic development. PPI analysis demonstrated the role of PACG-associated genes in the formation of functional network. Neurotransmitter receptor/transporter correlation analysis revealed significant associations with 5-HT4R and mGlu5R (<i>p</i> < 0.05, FDR corrected).<h4>Conclusion</h4>The present study reveals that a wide range of brain regions in PACG patients show significant functional remodeling, elucidating the molecular regulatory network behind this type of pathological alteration.

BTN3A3
Also flagged:RNA polymerasepolymeraseinfectioninfluenzavirus infectionbinding
Journal Article 2025-09-17 ✓ 1 Snippet Wei JQ, Zhang S, Li YD, Jiang SY, Yan SR, Liu Y, Chen YH, Feng Y, Ding X, Li YC, Kang XP, Liu W, Wu A, Jiang T, Tong Y, Li J.
In-Text Gene Mentions

…22 ] andBTN3A3[ 23 ]…

Show Full Abstract

Frequent infection cases with avian H5N1 influenza A viruses (IAVs) are posing pandemic risks of human/avian-reassorted IAVs. We aimed to build an attentional deep learning model named HAIRANGE, for predicting potentially human-adapted reassortment of H5N1 and human IAVs. A biologically relevant and non-pretrained embedder named Codon2Vec in HAIRANGE performed competitively in benchmarking against other embedders, such as ESM2, DNABERT2 and others, indicating a high association of genomic context with viral hosts or serotypes, for IAV RNA polymerase-related genes. HAIRANGE accurately predicted the adaptation of each polymerase-related gene and the adaptive polymerase-related gene reassortment with polymerase activity validated by <i>in vitro</i> reporting assay. Worryingly, an adaptive reassortment between avian H5N1 and human H3N2 IAVs was predicted by HAIRANGE and validated by polymerase activity assay. Summarily, HAIRANGE can predict adaptive IAV reassortment based on embedded genomic context. Current avian H5N1 IAV is posing pandemic potential via possible reassortment with human IAVs.

bioRxiv 2025-09-17 Preprint (No Snippets API) Suarez Peredo Rodriguez MF, Jilderda LJ, Gaviria Agudelo C, Simon JE, Heberle AM, van Kaam A, Bakker PL, Hong C, Roorda M, Lavoie G, Roux PP, Oeckinghaus A, van Vugt MA, Thedieck K, Foijer F.
Show Full Abstract

Most cancers display chromosomal instability (CIN), a condition that leads to increased rates of chromosome missegregation and thus yields aneuploidy. CIN and aneuploidy are detrimental to healthy cells and therefore, aneuploid cells rely on aneuploidy-tolerating mechanisms to adopt a malignant fate. We previously found PRMT5 to be frequently amplified in a mouse model for aneuploid T cell lymphoblastic lymphoma. In this study, we investigated a possible role of PRMT5 as an aneuploidy tolerating gene. We report that PRMT5 is prone to aggregation when expressed at supra-stoichiometric levels compared to its obligate partner protein MEP50 (methylosome protein 50, WDR77). Intriguingly, we also find that protein aggregation, induced by CIN, is mitigated by jointly increased expression of PRMT5 and MEP50. Accordingly, concomitant PRMT5:MEP50 expression renders cancer cells less sensitive to proteasome inhibitors and CIN while inhibition sensitizes cells to CIN. Our findings provide a possible explanation for why PRMT5 and MEP50 display increased expression, particularly in aneuploid cancers and might reveal a targetable vulnerability of aneuploid cancer.

bioRxiv 2025-09-17 Preprint (No Snippets API) Park Y, Fanti R, Sadeghi S, Chandrasekaran R, Edwards AM, Harding RJ, Houston DW.
Show Full Abstract

<h4>BACKGROUND</h4> Reliable detection of huntingtin (HTT) is essential for understanding Huntington’s disease (HD) biology and evaluating therapeutic strategies. However, high-quality monoclonal antibodies (mAbs) against the HTT C-terminal domain remain limited. <h4>OBJECTIVE</h4> We sought to generate and validate novel monoclonal antibodies targeting the HTT C-terminal HEAT-containing domain to better detect HTT independently of potential effects of polyglutamine length that can impact some N-terminally targeted antibodies. <h4>METHODS</h4> We immunized mice with a highly purified, well-characterized recombinant protein corresponding to the HTT C-terminal domain. We generated monoclonal antibody-producing hybridoma cell lines and characterized the antibodies using parental and HTT-knockout cell lines in common immuno-applications. <h4>RESULTS</h4> Three novel, independent hybridoma lines producing anti-HTT monoclonal antibodies were derived. Using CRISPR-edited HTT knockout cell lines we identified one clone, anti-HTT [2F8], that was specific and effective across Western blot, immunofluorescence, and ELISA assays. All antibodies bound full-length HTT irrespective of HAP40 interaction or polyQ length and showed no cross-reactivity to the N-terminal HEAT domain. <h4>CONCLUSIONS</h4> These C-terminal HTT mAbs are thus valuable additional tools for studying endogenous HTT function in both normal and disease contexts.

SERPINC1
Also flagged:Antithrombinbindingheparansulfateantithrombin IIIAT
Journal Article 2025-09-16 ✓ 1 Snippet Clausen TM, Weiss RJ, Tremblay JR, Kellman BP, Coker J, Dworkin LA, Rodriguez JP, Chang IM, Chen T, Padala V, Karlsson R, Song H, Peck KL, Ogawa S, Sandoval DR, Joshi HJ, Wang G, Ferguson LP, Bhalerao N, Moores A, Reya T, Sander M, Caffrey TC, Grem JL, Aicher A, Heeschen C, Le D, Lewis NE, Hollingsworth MA, Grandgenett PM, Bellis SL, Miller RL, Fuster MM, Dawson DW, Engle DD, Esko JD.
In-Text Gene Mentions

…antithrombin III (AT,SERPINC1), which enhances the…

Show Full Abstract

3-O-sulfation of heparan sulfate (HS) is the key determinant for binding and activation of antithrombin III (AT). This interaction is the basis of heparin treatment to prevent thrombotic events and excess coagulation. Antithrombin-binding HS (HSAT) is expressed in human tissues but is thought to be expressed in the subendothelial space, mast cells, and follicular fluid. Here, we show that HSAT is ubiquitously expressed in the basement membranes of epithelial cells in multiple tissues. In the pancreas, HSAT is expressed by healthy ductal cells, and its expression is increased in premalignant pancreatic intraepithelial neoplasia lesions but not in pancreatic ductal adenocarcinoma (PDAC). Inactivation of HS3ST1, a key enzyme in HSAT synthesis, in PDAC cells eliminated HSAT expression, induced an inflammatory phenotype, suppressed markers of apoptosis, and increased metastasis in an experimental mouse PDAC model. HSAT-positive PDAC cells bind AT, which inhibits the generation of active thrombin by tissue factor and factor VIIa. Furthermore, plasma from patients with PDAC showed accumulation of HSAT, suggesting its potential as a marker of tumor formation. These findings suggest that HSAT exerts a tumor-suppressing function through recruitment of AT and that the decrease in HSAT during progression of pancreatic tumorigenesis increases inflammation and metastatic potential.

Also flagged:HELmelanomaglucoseglutaminepyruvatewater
Journal Article 2025-09-16 No Snippets Ranieri G, Lapucci A, Orsomando G, Raffaelli N, Chiarugi A, Buonvicino D.
Show Full Abstract

In a previous study, we showed that the NAD antimetabolite Vacor is metabolized by two enzymes implicated in the NAD salvage pathway-to Vacor mononucleotide (VMN) by nicotinamide phosphoribosyltransferase (NAMPT) and, in turn, to Vacor adenine dinucleotide (VAD) by nicotinamide mononucleotide adenylyltransferase 2 (NMNAT2)-leading to NAD depletion and antitumor activity. Recent findings in neurons show that VMN activates SARM1, a NAD glycohydrolase, triggering NAD depletion and degeneration. In this study, we report that altering NMNAT2 levels did not affect Vacor-induced NAD depletion or cell death. In contrast, SARM1 expression alone was sufficient to induce Vacor sensitivity. Further, we report that cancer cells sense the abnormal expression of SARM1 and readily induce the expression of NMNAT2. Overall, the data underscore the antitumor potential of pharmacological approaches aimed at activating SARM1.

PRDX6
Also flagged:ironmetabolismBeta-Thalassemiaβ-thalassemiapathogenesistransfusion-dependent β-thalassemia
Journal Article 2025-09-16 ✓ 5 Snippets Wei R, Qiu D, Zeng X.
In-Text Gene Mentions

…Hepb1 , andPrdx6downregulated and Spta1…

…included Bcl2l1 ,Prdx6, and Snca…

…Hepb1 , andPrdx6was significantly downregulate…

…, Hepb1 ,Prdx6downregulation; Spta1 ,…

…of BCL2L1, Hepb1,Prdx6, Spta1, Snca and…

Show Full Abstract

Approximately 1.5% of individuals with hemoglobin disorders carry the β-thalassemia gene variant, impacting around 40,000 newborns annually. Given the incomplete understanding of β-thalassemia pathogenesis, there is an urgent need to identify effective biomarkers to advance research, diagnosis, and treatment. This study aims to identify potential biomarkers for two key purposes: (1) diagnosing transfusion-dependent β-thalassemia (TDT) and (2) detecting iron overload complications, with a focus on functional markers that reflect iron metabolism dysregulation in TDT. This study integrates transcriptomic data from the Genome Sequence Archive dataset (CRA003639) with bioinformatics analysis to identify potential biomarkers associated with β-thalassemia. Subsequently, Hbb-bs and Hbb-bt double knockout mice were used to establish a β-thalassemia model, while C57BL/6JCya mice served as the control group, to validate the identified biomarkers through animal experiments. Seventeen reliable cell subsets were identified through rigorous annotation and screening. Quantitative analysis revealed a decreased proportion of immune cells (natural killer [NK] cells, T cells, macrophages, neutrophils, and monocytes) and an increased proportion of erythroid cells in the β-thalassemia group. Cell subset analysis focused on subsets that closely communicated with erythroid cells. Enrichment analysis of driver genes in these subsets revealed iron metabolism-related pathways in Erythroid_02 and Erythroid_03, and a ferroptosis-related pathway in Erythroid_05. Thalassemia model mice exhibited stronger iron ion fluorescence signals in primary hepatocytes, increased levels of total iron, Fe<sup>2+</sup>, and Fe<sup>3+</sup> in liver tissue, and decreased serum iron (SI) levels, indicating iron metabolism disorders. Reverse transcription polymerase chain reaction (RT-PCR) results showed differential gene expression, with BCL2L1, Hepb1, and Prdx6 downregulated and Spta1 and Snca upregulated in the TDT model group. This study comprehensively characterizes TDT at the cellular and molecular levels, offering insights into its pathogenesis and identifying potential therapeutic targets.

HTT
Also flagged:candesartanangiotensinneurodegenerative diseasesAngiotensin II Type 1 receptorAngiotensin II Type 2 receptorMas receptor
Journal Article 2025-09-16 ✓ 2 Snippets Elgindy AM, Atwa AM, El-Awady EE, El-Sayed NM, El-Orabi NF.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, leading…

…mutant huntingtin protein (htt) activates the JNK…

Show Full Abstract

Renin-Angiotensin System has been implicated in neurodegenerative diseases such as Huntington's (HD). It is made up of two axes: one is the Angiotensin II Type 1 receptor (AT1R) or Angiotensin II Type 2 receptor (AT2R), while the other is angiotensin-(1-7) [Ang-(1-7)], and Mas receptor; the latter has reported developing a neuroprotective effect; oppositely, AT1R activation has been linked to neurodegenerative diseases. This study aims to elucidate the potential neuroprotective effect of Candesartan (Cand) an AT1R blocker in mitigating neuronal degeneration caused by 3-Nitropropionic acid (3NP) induced HD by revealing the prospective role of Ang II/AT2R/Ang-(1-7)/Mas receptor, CREB/BDNF/PGC1-α besides JNK/c-Jun trajectories, as well as the anti-apoptotic survivin. HD was induced by 3NP (10 mg/kg) for 14 days. Rats received Candesartan (2.5 or 5 mg/kg) for 14 days, after which brain and striatum were isolated for the histopathological, immunohistochemical, and biochemical analysis. Cand displayed significant improvement in the rats' behavioral tests, enhancing their memory, motor, and cognitive functions induced by 3NP, which was confirmed by the striatal histopathological and immunohistochemical examination of the GFAP. In addition, Cand activated the Ang II/AT2R/Ang-(1-7)/Mas receptor axis. Moreover, Cand stimulated the production of striatal neurotrophic proteins CREB/BDNF/PGC1-α which in turn decreased the levels of inflammatory mediators NF-κB and IL-1β, accompanied by an increase in the antioxidants NQO1 and HO-1 levels. Similarly, Cand led to the inhibition of the JNK/c-Jun with activation of survivin. In conclusion, Candesartan has mitigated the striatal degeneration and mitochondrial dysfunction induced by 3NP through various mechanistic pathways.

POU3F2
Also flagged:CancerpathogenesisCarcinoma of the prostateprostate carcinomasandrogen receptorAR
Journal Article 2025-09-16 ✓ 3 Snippets Bose A, Bankhead A, Coleman I, Persse T, Han W, Galipeau P, Hanratty B, Chu T, Lucas J, Li D, Bilkis R, Itagi P, Hassan S, Beightol M, Ko M, Dumpit R, Haffner M, Pritchard C, Ha G, Nelson PS.
In-Text Gene Mentions

…transcription factors: NR3C1,POU3F2, NR2F1, and TBX2,…

…differential upregulation ofPOU3F2, NR2F1, and TBX2…

…spanning NR3C1 ,POU3F2, NR2F1 ,…

Show Full Abstract

A cornerstone of research to improve cancer outcomes involves studies of model systems to identify causal drivers of oncogenesis, understand mechanisms leading to metastases, and develop new therapeutics. Although most cancer types are represented by large cell line panels that reflect diverse neoplastic genotypes and phenotypes found in patients, prostate cancer is notable for a very limited repertoire of models that recapitulate the pathobiology of human disease. Of these, the lymph node carcinoma of the prostate (LNCaP) cell line has served as the major resource for basic and translational studies. Here, we delineated the molecular composition of LNCaP and multiple substrains through analyses of whole-genome sequences, transcriptomes, chromatin structure, androgen receptor (AR) cistromes, and functional studies. Our results determined that LNCaP exhibits substantial subclonal diversity, ongoing genomic instability, and phenotype plasticity. Several oncogenic features were consistently present across strains, but others were unexpectedly variable, such as ETV1 expression, Y chromosome loss, a reliance on WNT and glucocorticoid receptor activity, and distinct AR alterations maintaining AR pathway activation. These results document the inherent molecular heterogeneity and ongoing genomic instability that drive diverse prostate cancer phenotypes and provide a foundation for the accurate interpretation and reproduction of research findings.

OLFM4
Also flagged:Cancersolid tumorstumorcolorectal tumorstumorsgene expression
Journal Article 2025-09-16 ✓ 5 Snippets García-Rodríguez JL, Korsgaard U, Vissing SM, Paasch TP, Semenova M, Vendelbo SL, Jensby EF, Williams HL, Salachan PV, Brandt CB, Hanimann J, Lin L, Zlobec I, Sørensen KD, Kjems J, Hager H, Kristensen LS.
In-Text Gene Mentions

…The localization ofOLFM4and PIGR within…

…probes (Hs-PIGR-C1 and Hs-OLFM4-C2) targeting PIGR and…

…targeting PIGR andOLFM4were used for…

…a 1:50 ratioOLFM4-C2 to PIGR-C1 probes…

…e.g., EPCAM ,OLFM4, and KRT19…

Show Full Abstract

The formation of budding cancer cells at the invasive front of solid tumors is one of the first steps of metastasis. However, this process is still incompletely elucidated. Here, we used spatial molecular imaging to disentangle the complex interactions between cancer cells and the tumor microenvironment at the invasive front of colorectal tumors. Employing a 1000-plex gene panel, we defined all major cell types in tumors and adjacent normal tissue with accurate spatial information. Individual cancer cell clusters were located together, consistent with an expected mutation- and epigenetic-driven clonal evolution. However, cancer cell clusters encompassing budding cells exhibited a markedly different spatial distribution as they also contained cells that were scattered around the periphery of the main cancer cell masses. Moreover, these cells were frequently in contact with cancer-associated fibroblasts (CAFs) and underwent broad gene expression changes, mainly related to epithelial-mesenchymal transition (EMT), remodeling of the extracellular matrix (ECM), and migration. In addition, we defined an 11-gene signature (TYK2, IL2RG, KRT17, HLA-B, NPPC, WIF1, IL32, B2M, CCND1, CRIP1, ITGB1), which characterizes cancer cells en route to metastasis and is associated with inferior outcomes. Collectively, our findings suggest that CAFs induce pro-invasive gene expression changes involved in EMT, ECM remodeling, and migration.

NEGR1
Also flagged:Ischemic strokedeathstrokeneurogenesisangiogenesistumor
Journal Article 2025-09-16 ✓ 2 Snippets Weber RZ, Achón Buil B, Rentsch NH, Perron P, Halliday S, Bosworth A, Zhang M, Kisler K, Bodenmann C, Zürcher KJ, Uhr D, Meier D, Peter SL, Generali M, Lin S, Rüegg MA, Nitsch RM, Tackenberg C, Rust R.
In-Text Gene Mentions

…the TENM3–ADGRL3 andNEGR1–NEGR1 ligand–partner pairs su…

…the TENM3–ADGRL3 and NEGR1–NEGR1ligand–partner pairs suggest…

Show Full Abstract

Stroke remains a leading cause of disability due to the brain's limited ability to regenerate damaged neural circuits. Here, we show that local transplantation of iPSC-derived neural progenitor cells (NPCs) improves brain repair and long-term functional recovery in stroke-injured mice. NPCs survive for over five weeks, differentiate primarily into mature neurons, and contribute to regeneration-associated tissue responses including angiogenesis, blood-brain barrier repair, reduced inflammation, and neurogenesis. NPC-treated mice show improved gait and fine-motor recovery, as quantified by deep learning-based analysis. Single-nucleus RNA sequencing reveals that grafts predominantly adopt GABAergic and glutamatergic phenotypes, with GABAergic cells engaging in graft-host crosstalk via neurexin, neuregulin, neural cell adhesion molecule, and SLIT signaling pathways. Our findings provide mechanistic insight into how neural xenografts interact with host stroke tissue to drive structural and functional repair. These results support the therapeutic potential of NPC transplantation for promoting long-term recovery after stroke.

SOX6
Also flagged:oligodendrogenesismyelinationmyelinEPOEPORgene expression
Journal Article 2025-09-16 ✓ 1 Snippet Ye L, Daguano Gastaldi V, Curto Y, Wildenburg AF, Yu X, Hindermann M, Eggert S, Ronnenberg A, Wang Q, Butt UJ, Kawaguchi R, Geschwind D, Möbius W, Boretius S, Singh M, Nave KA, Ehrenreich H.
In-Text Gene Mentions

…, Plp1 ,Sox6, Sox10 ).…

Show Full Abstract

Oligodendrocytes differentiate from oligodendrocyte progenitor cells (OPC) in early postnatal development, but some oligodendrogenesis is maintained throughout adulthood, where oligodendrocyte lineage dynamics may contribute to neuroplasticity, adaptive myelination, and myelin repair. Here, we studied the effect of erythropoietin (EPO) and its receptor (EPOR) on oligodendrocyte lineage dynamics employing murine hippocampus and its myelinated fibers as model region. Using multiple stage-specific markers and single-nuclei-RNA-seq data, we find that EPO stimulates all oligodendroglial lineage cells directly, driving differentiation/maturation. Differential gene expression analysis reveals multiple EPO-regulated mRNAs, including downregulated transcripts for GABA-A receptors, fitting the known inhibition of oligodendrocyte maturation by GABA. Importantly, analogous oligodendrocyte responses are seen when endogenous EPO expression in brain is stimulated by hypoxia. Mice lacking EPOR from mature oligodendrocytes show subtle deficiencies of adult myelination in hippocampal fimbria and mild working memory deficits. These gain- and loss-of-function experiments may further suggest EPO as clinically safe treatment for remyelination therapies.

Also flagged:folateα-tocopherolfolic acidpeptidefolate receptorslung cancer
Journal Article 2025-09-16 No Snippets Abdel-Hafez SH, Alexeree SMI.
Show Full Abstract

<h4>Purpose</h4>In this study, a new chemical folate conjugated to α-tocopherol (VAF) is introduced. The main goal is to investigate the potential of VAF as a strong anticancer agent. This improves the drug-targeting delivery system and lessens the negative effects associated with traditional chemotherapy.<h4>Procedure</h4>To synthesize VAF, α-tocopherol, and folic acid were linked by a peptide bond, creating an amphiphilic structure that allowed for self-assembly in aqueous conditions. With an emphasis on evaluating VAF's capacity to target folate receptors, In vitro experiments were carried out utilizing A549 lung cancer cells to assess the anticancer effects of VAF.<h4>Results</h4>VAF was synthesized under mild circumstances, and its characterization was carried out using many analytical techniques, such as FTIR spectroscopy and NMR. In vitro investigations showed that VAF's improved active targeting via folate receptors results in excellent anticancer effects. Additionally, the cell viability of Wi-38 and A549 was assessed by using confocal laser scanning microscopy (CLSM).<h4>Conclusion</h4>According to the research, VAF reduces the possibility of adverse effects while increasing the efficacy of anticancer treatments. The compound exhibits promising properties that make it a great option for additional research and development in cancer treatments. Research provides important new information about drug-targeting delivery systems and improves a potentially useful method for anticancer drug therapeutic indices.

Also flagged:neurodegenerative diseasesADPDHDfrontotemporal lobar degenerationFTLD
Journal Article 2025-09-16 No Snippets Wang J, Dai L, Zhang Z.
Show Full Abstract

<h4>Abstract</h4>Neurodegenerative diseases constitute a group of chronic disorders characterized by the progressive loss of neurons. Major neurodegenerative conditions include Alzheimer's disease, Parkinson's disease, Huntington's disease, frontotemporal lobar degeneration, and amyotrophic lateral sclerosis. Pathologically, these diseases are marked by the accumulation of aggregates formed by pathological proteins such as amyloid-β, tau, α-synuclein, and TAR DNA-binding protein 43. These proteins assemble into amyloid fibrils that undergo prion-like propagation and dissemination, ultimately inducing neurodegeneration. Understanding the biology of these protein aggregates is fundamental to elucidating the pathophysiology of neurodegenerative disorders. In this review, we summarize the molecular mechanisms underlying the aggregation and transmission of pathological proteins, the processes through which these protein aggregates trigger neurodegeneration, and the interactions between different pathological proteins. We also provide an overview of the current diagnostic approaches and therapeutic strategies targeting pathological protein aggregates.

Also flagged:Glucagon-Like Peptide-1 ReceptorNeurodegenerative DiseasesGLP-1translationaldementiaAD
Journal Article 2025-09-16 No Snippets Ibrahim R, Kambal A, Abdelmajeed MA.
Show Full Abstract

There is a steadily increasing global burden of neurodegenerative diseases (NDs) such as dementia, including Alzheimer's disease (AD), and movement disorders like Parkinson's disease (PD), which emphasizes the importance of disease-modifying therapy (as opposed to symptomatic therapy). This review considers a new disease-modifying strategy through the so-called glucagon-like peptide-1 receptor agonists (GLP-1 RAs) in these NDs, and the mechanistic rationale and evidence base. The review considers a multi-targeting strategy, translational issues, and a future research agenda. Translational challenges for these agents are also discussed, particularly the need to understand how the timing of treatment may influence outcomes. The review also considers unwanted side effects like unintended weight loss, which may compromise "at-risk" patient groups. In conclusion, GLP-1 RAs are an intriguing multitarget treatment option for people with NDs, and future research should focus on optimizing treatment for clinical trials, evolved agonists that can penetrate the central nervous system (CNS), and combination therapies.

HFE
Also flagged:FOXO3aTLR2MyD88NF-κBferroptosistheaflavin
Journal Article 2025-09-16 ✓ 1 Snippet Bakhsh A, Salama SA, Althobaiti MM, Alsufyani SE, Almalki AM, Alanazi ST.
In-Text Gene Mentions

…secondary consequence tohemochromatosisand anemias that…

Show Full Abstract

<h4>Background</h4>While iron is essential in trace amounts, elevated level represents a serious health problem. Elevated iron level arises as a secondary consequence to hemochromatosis and anemias that necessitate frequent blood transfusions, leading to organ toxicity, particularly liver toxicity.<h4>Methods</h4>The current study investigated the potential ameliorating impact of theaflavin against the iron-elicited liver toxicity. A model of iron intoxication was established in male Wistar rats, and theaflavin was given over a 10-day period. Blood and liver specimens were collected and subjected to histopathological, ELISA, biochemical, and Western blotting investigations.<h4>Results</h4>Theaflavin suppressed the iron-evoked liver injury as indicated by a significant decrease in activity of the hepatocellular enzymes in sera and improved hepatic histopathological architecture. Theaflavin activated the antioxidant transcription factor FOXO3a with upregulation of its responsive antioxidant gene products including thioredoxin reductase, superoxide dismutase, and catalase, along with reduced DNA oxidative modification. Equally important, theaflavin suppressed TLR2 inflammatory cascade as evidenced by a significant downregulation in protein expression of TLR2 and its adaptor protein MyD88, and inhibition of phosphorylation and nuclear translocation of its downstream inflammatory transcription factor NF-κB. In the same context, theaflavin markedly reduced levels of NF-κB-responsive cytokines TNF-α and IL-6. Interestingly, theaflavin repressed the iron-elicited hepatocellular ferroptosis as indicated by modulation of its biomarkers GPx4 and COX-2 protein expression, and levels of lipid hydroperoxides and hepatocellular iron load.<h4>Conclusion</h4>These findings emphasize the ameliorating impact of theaflavin against the iron-elicited liver toxicity and shed light on FOXO3a, TLR2/MyD88/NF-κB cascade, and ferroptosis as possible molecular targets.

SOX6
Also flagged:MAPKcytoskeletonS100A1MBOAT2CA3GYG2
Journal Article 2025-09-16 ✓ 3 Snippets Wang K, Li X, Liu X, Liufu S, Xiao L, Chen B, Chen W, Jiang J, Liu Y, Ma H.
In-Text Gene Mentions

…RFX2 , whereasSOX6, MAF ,…

…three TFs (SOX6, MAF ,…

SOX6and MAF are…

Show Full Abstract

Skeletal muscles, accounting for 40% of mammalian body mass, exhibit pronounced heterogeneity due to their distinct anatomical locations. Animal husbandry has focused excessively on <i>longissimus dorsi</i> (LDM) development while neglecting other muscles. In this study, we integrated Bulk RNA Sequencing (bulk RNA-seq) and Liquid Chromatography-Mass Spectrometry (LC-MS) analyses of <i>Soleus</i> (SOL), <i>Gastrocnemius</i> (GAS), and <i>Psoas major</i> muscles (PMM) across three key stages in Duroc pigs. We identified nine critical genes (<i>S100A1</i>, <i>MBOAT2</i>, <i>CA3</i>, <i>GYG2</i>, <i>ACTN3</i>, <i>ENO3</i>, <i>SLC3A2</i>, <i>SLC16A10</i>, and <i>GAPDH</i>) and eight metabolites potentially involved in regulating both skeletal muscle development and fiber-type transformation. The heterogeneity between SOL and GAS was low at birth but increased gradually during development. In contrast, PMM exhibited higher heterogeneity than SOL and GAS from birth. Notably, expression levels of <i>MYH7</i>, <i>MYH1</i>, and <i>MYH4</i> displayed stage-specific and muscle type-dependent variations. Moreover, we observed a developmental shift from the MAPK signaling pathway (1-21 d) to the regulation of the actin cytoskeleton (21-120 d). Pairwise comparisons between the SOL, GAS, and PMM revealed that the signaling pathways were enriched in muscle fiber-type switching. Collectively, through the integration of bulk RNA-seq and LC-MS data, this study provides novel molecular breeding strategies for the genetic improvement of meat-producing animals.

Iron: More than Meets the Eye.

HFE
Also flagged:Ironmitochondrialsynthesisphototransductionpathogenesisocular disorders
Journal Article 2025-09-16 ✓ 1 Snippet Naquin ER, Garg R, Chen WJ, Karmakar E, Prasad A, Mandadi S, Depala K, Gopianand JS, Gnana-Prakasam JP.
In-Text Gene Mentions

…homeostatic iron regulator (HFE) protein interacts with…

Show Full Abstract

Iron is an essential micronutrient integral to ocular physiology, supporting biochemical processes such as mitochondrial respiration, DNA synthesis and phototransduction. Disruptions in systemic or local iron homeostasis, whether due to overload or deficiency, have been increasingly implicated in the pathogenesis of a broad range of anterior and posterior segment ocular disorders. Iron deficiency may compromise retinal bioenergetics, impair cellular repair, and increase susceptibility to oxidative stress, while iron overload facilitates the generation of reactive oxygen species, contributing to lipid peroxidation, mitochondrial dysfunction, and ferroptosis. Dysregulated iron metabolism has been associated with several ocular pathologies, including age-related macular degeneration, diabetic retinopathy, glaucoma, retinal detachment, cataracts, and anemic retinopathy. The eye possesses specialized iron regulatory mechanisms involving proteins such as transferrin, ferritin, ferroportin, and hepcidin that govern iron transport, storage, and export across ocular barriers. Aberrations in these pathways are now recognized as contributing factors in disease progression. This narrative review explores the complex dual role of iron overload and deficiency in ocular diseases. It highlights the molecular mechanisms underlying iron-mediated pathologies in both the posterior and anterior segments of the eye, along with the clinical manifestations of iron imbalance. Current therapeutic approaches are discussed, including oral and parenteral iron supplementation for deficiency and emerging chelation-based or antioxidant strategies to address iron overload, while highlighting their limitations. Key challenges remain in developing targeted ocular delivery systems that optimize bioavailability and minimize systemic toxicity. Hence, maintaining iron homeostasis is critical for visual function, and further research is needed to refine therapeutic interventions and clarify the mechanistic role of iron in ocular health and disease.

Also flagged:dicalcium phosphatecalciumphosphorusphytasemineralizationALP
Journal Article 2025-09-16 No Snippets Mafi A, Khalaji S, Hedayati M, Kaviani F.
Show Full Abstract

An experiment was conducted to evaluate the influence of the drying temperature of the di-calcium phosphate (DCP) on its X-ray diffraction patterns (XRD), spatial structure and solubility, retention of calcium and phosphorus, growth performance, tibia mineralization and strength in broiler chickens fed diets supplemented with phytase. A total of 500, 1-d-old Ross 308 female broiler chickens were randomly allocated to a 5  ×  2 factorial arrangement and fed diets contained DCPs dried at 5 different temperatures (60, 90, 110, 160 and 200°C) and two levels of phytase enzyme supplementation (0 or 1000 FYT/kg). There were 10 treatments and 5 cages with 10 chicks per each treatment. XRD pattern of DCP showed sharp peaks in lower temperature which indicting good crystallinity of DCP particles. Increasing the drying temperature resulted in amorphous solid with a XRD pattern typical for amorphous solid with reduced peaks height. Field emission scanning electron microscope (FESEM) images revealed considerable agglomeration and clustering of the DCP particles by increasing the drying temperature especially at 160 and 200°C compared to the DCP dried at 60°C. Solubility of DCP in 2 % citric acid (CA) was reduced by increasing the drying temperature linearly (P < 0.01). The solubility of DCPs dried at 60, 90, 110, 160 and 200°C were 96.2, 91.4, 88.1, 82.6 and 78.2 % respectively. Chicks fed diets supplemented with DCP dried at 160 and 200°C had lower BW and higher FCR (P ≤ 0.01) compared to the other chicks fed diet supplemented with DCP dried at 60, 90 and 110°C. Plasma Ca and P concentration was significantly higher (P ≤ 0.01) in chicks fed diets supplemented with DCP dried at 110°C on day 20. At day 30, plasma P concentration was significantly higher (P ≤ 0.01) in chicks fed diets supplemented with DCP dried at 60°C. Phytase supplementation had no significant effect on Ca, P and serum alkaline phosphatase (ALP) activity throughout the experiment. No significant difference in serum ALP activity were found among chicks fed different DCPs, however, intestinal ALP activity was higher (P ≤ 0.05) in chicks fed diets contain DCP dried at 110°C. Intestinal ALP activity was reduced significantly (P ≤ 0.05) by inclusion of exogenous phytase. Birds fed diet contained DCP dried at 60°C had the highest (P ≤ 0.01) level of P retention at both 10 and 32 days of age. Increasing the drying temperature of DCP reduced P retention significantly (P ≤ 0.05). Calcium retention were not affected (P > 0.05). The proximal length and proximal head thickness of femur bone, tibia ash and P content was higher (P ≤ 0.05) in birds fed diets contained DCP dried at 60°C. Tibia breaking strength was reduced in birds fed diets contained DCP dried at 160°C (P ≤ 0.05). In conclusion, the results of this study indeed showed that higher drying temperature of DCP negatively affect its structure and reduced its crystallinity and solubility which was illustrated by XRD diffraction patterns and FESM images.

Also flagged:ALSamyotrophic lateral sclerosisbehaviouralneurodegenerative diseasedeathmotor neural network syndrome
Journal Article 2025-09-16 No Snippets Vucic S, Shahrizaila N, Kano O, Menon P, Agustini S, Kulkantrakorn K, Atchayaram N, Lee YC, Prado MB, Ng KWP, Chai J, Son B, Talman P, Nghia HTT, Tuan LTQ, Shibuya K, Izumi Y, Atsuta N, Henderson RD, Cui L, Liu M, Ohnmar O, Rabani R, Hong YH, Sung JJ, Fan D, Raykar V, Kuwabara S, Kim SH, Sobue G, Kiernan MC.
Show Full Abstract

The Pan-Asian Consortium for Treatment and Research in ALS (PACTALS) guidelines were developed for the management of amyotrophic lateral sclerosis (ALS) patients living in the Asia-Pacific countries, taking into consideration the ethnic, racial and economic diversity of the region. The majority of patients reside in low-income (limited-resource setting) and middle-income countries. Grading of Recommendations Assessment, Development, and Evaluation (GRADE) methodology was utilised for development of the PACTALS management guidelines. Nine broad research questions, divided into sections, were addressed. Evidence was derived from existing Cochrane reviews, systematic reviews, meta-analysis, and randomized controlled trials (RCT) along with consensus when evidence was limited. Recommendations were provided for diagnostic pathways, use of disease modifying therapies, appropriateness of multidisciplinary care models, management of respiratory dysfunction, communication and nutrition, addressing symptoms that affect the quality of life, managing cognitive, behavioural and emotional symptoms as well as appropriate implementation of palliative care services and addressing end-of-life issues. The PACTALS guidelines provide a much-needed framework for the management of ALS patients living in the Asia-Pacific region. The management guidelines will be updated as the treatment landscape evolves and evidence of novel management approaches becomes available.

Also flagged:nucleotideneurological disordersgene expressionbrain disorderslong interspersed nuclear element-1brain development
Journal Article 2025-09-16 No Snippets Pepe G, Storto M, Di Pardo A, Maglione V.
Show Full Abstract

Genomic instability is a key feature of many neurological disorders, with transposon activation and nucleotide triplet repeat instability playing critical roles. Transposons, which are also referred to as mobile genetic elements, have the potential to destabilize the genome and interfere with gene expression. Conversely, changes in nucleotide triplet sequences, such as expansions or contractions, can lead to the production of abnormal proteins or nonfunctional RNAs. In this perspective, we discussed the intricate relationship between these two forms of genomic instability and their influence on brain disorders. We analyzed the molecular mechanisms that contribute to these phenomena, the shared regulatory systems that govern them, and their role in neurological conditions. Additionally, we provided some insights into the development of potential therapies for brain disorders linked to these genomic alterations.

Also flagged:Metal ionscytoplasmmembranesodiumpotassiumpyroptosis
Journal Article 2025-09-16 No Snippets Gong Q, Shi L, Wen L, Zhang Y, Chen Z, Wei X, Song X, Dong J, Liang C.
Show Full Abstract

Metal ions serve as indispensable regulators in fundamental biological processes, maintaining critical physiological functions including osmotic equilibrium, acid-base regulation, intracellular signaling, and biomolecular recognition. Perturbations of ionic homeostasis can disrupt cellular integrity, leading to functional impairment and ultimately programmed cell death. Capitalizing on this paradigm, emerging nanotherapeutic approaches have pioneered the strategic induction of tumor-selective ions overloading as a potent anticancer strategy. This comprehensive review critically evaluates the roles of key metal ions (Na<sup>+</sup>, K<sup>+</sup>, Ca<sup>2+</sup>, Cu<sup>2+</sup>, Zn<sup>2+</sup>, Fe<sup>2+/3+</sup>, Mn<sup>2+</sup>) in tumor progression and their mechanisms of action when overaccumulated, and highlights innovative nanomaterial designs that exploit ions overloading to induce apoptosis, pyroptosis, or immunogenic cell death. Meanwhile, the combinatorial approaches integrating ions-overloading with other therapy including immunotherapy, chemodynamic therapy et al. would be discussed. By integrating the mechanisms and contemporary research advances, this work provides a conceptual framework for developing next-generation of ions-disrupting nanomedicines and identifies promising directions for combinatorial anticancer regimens.

Also flagged:organizationmethylationhistonemodificationsregulation ofgene expression
Journal Article 2025-09-16 No Snippets He Y, Li W, Li L, Yang Y, Lu Y, Pan Y, Wang Q, Sun Y, Xie Y, Wu M, Luo P, Sun W, Zhang H.
Show Full Abstract

Stem cell lineage commitment is governed by intricate interactions between epigenetic mechanisms and 3D genome organization. Traditional linear epigenetics, including DNA methylation and histone modifications, cannot fully elucidate the complex spatiotemporal regulation of gene expression. Recent advances in spatial genomics technologies, such as high-throughput chromosome conformation capture (Hi-C), single-cell Hi-C, and Chromatin immunoprecipitation combined with Hi-C (Hi-ChIP), have provided unprecedented insights into genome architecture, revealing key structural units like chromatin compartments, topologically associating domains (TADs), and chromatin loops. These structures dynamically reorganize during differentiation, influencing transcriptional accessibility and lineage-specific gene activation. Additionally, liquid-liquid phase separation (LLPS)-mediated transcriptional condensates, such as transcription factories and super-enhancers, have emerged as essential regulators of gene expression patterns during cell fate transitions. The integration of multiomics data and artificial intelligence-driven predictive modeling further enhances the understanding of these regulatory networks. Despite ongoing technical challenges, including limitations in resolution, data complexity, and causal inference, recent advances continue to push the field forward. Engineered interventions such as CRISPR-based spatial genome editing and AI-powered computational platforms hold great promise for translating structural insights into targeted therapeutic strategies in regenerative medicine.

Also flagged:bacterial vaginosismetronidazoleLBPcervical dysplasiamedroxyprogesteroneacetate
Journal Article 2025-09-16 No Snippets Chetty C, Mafunda N, Happel AU, Khan A, Cooley Demidkina B, Yende-Zuma N, Saidi Y, Mahabeer Polliah A, Lewis L, Osman F, Radebe P, Passmore JS, Kwon D, Ravel J, Ngcapu S, Liebenberg L, Symul L, Holmes S, Mitchell CM, Potloane D.
Show Full Abstract

<h4>Background</h4>Globally, approximately 30 % of women have bacterial vaginosis (BV). Antibiotic treatment is frequently followed by recurrence, likely due to lack of colonization with beneficial lactobacilli.<h4>Methods</h4>This is a Phase 1, randomized, placebo-controlled trial of vaginal live biotherapeutic products (LBP) after antibiotic treatment for BV to establish <i>Lactobacillus</i> colonization. The LBP are vaginal tablets containing 6 <i>L. crispatus</i> strains (LC106) or 15 <i>L. crispatus</i> strains (LC115), at 2 x 10<sup>9</sup> colony forming units (CFU) per dose. Participants with BV in the United States and South Africa will receive seven days of oral metronidazole twice daily and will be randomized 1:1:1:1:1 to: seven days placebo; seven days LC106; three days LC106/four days placebo; seven days LC106 starting day 3 of the metronidazole course; or seven days LC115. Safety will be assessed by the number and percentage of ≥ Grade 2 related adverse events during or after product use. The primary outcome is LBP colonization defined as relative abundance ≥5 % of any LBP strain or ≥10 % of a combination of LBP strains by metagenomic sequencing any time in the 5 weeks after randomization. A generalized linear model will measure the association between treatment group and colonization, adjusting for site.<h4>Conclusions</h4>This study seeks to establish proof of concept for a multi-strain LBP to promote vaginal <i>L. crispatus</i> colonization in two geographically distinct populations.<h4>Trial registration</h4>South African National Clinical Trials Registry (SANCTR DOH-27-102023-8342; October 27, 2023) and ClinicalTrials.gov (NCT06135974; November 11, 2023).<h4>Protocol version</h4>2.0 dated October 03, 2023.

Also flagged:Lung cancercancercancerslung cancersnon-small cell lung carcinomaNSCLC
Journal Article 2025-09-16 No Snippets Chao CH, Di YP.
Show Full Abstract

Lung cancer is the leading cause of cancer-related deaths, with the highest mortality among all cancers. Despite the significant advances in cancer treatments in recent years, especially with the development of checkpoint inhibitor immunotherapy, a definitive treatment has yet to be discovered to cure lung cancer. Lung tumorigenesis involves genetic alterations in a multi-step process with heterogeneity and diversity, such that even though cigarette smoke has been widely acknowledged as a major associated risk factor, many non-smokers still develop lung cancer. Among lung cancers, 85 % are non-small cell lung carcinoma (NSCLC), with adenocarcinoma as the most prevalent NSCLC subtype, making up around 40 % of all lung cancers. The major genetic mutation drivers include the epidermal growth factor receptor (<i>EGFR</i>), anaplastic lymphoma kinase (<i>ALK</i>), and Kirsten rat sarcoma viral oncogene homolog (<i>KRAS</i>). While the advancement of newer-generation anti-cancer drugs has successfully treated <i>EGFR</i>- and <i>ALK</i>-associated lung cancers, <i>KRAS</i> mutation-associated lung cancer remains extremely challenging and has limited therapeutic options. This review outlines the etiology, epidemiology, and categorization of lung cancer, describing the current therapeutic options and limitations, with a focus on the most challenging-to-treat <i>KRAS</i>-mutated lung cancer. Furthermore, this paper highlights the current state and development of <i>KRAS</i>-mutated cancer treatment by describing the mechanisms and utilities of various <i>KRAS</i>-targeted therapies entering clinical trials, and it underlines the most promising treatment options.

Also flagged:tumorcancerchlorin e6synthesisconjugationoxygen
Journal Article 2025-09-16 No Snippets Paul M, Biswas S.
Show Full Abstract

A major concern of conventional photodynamic therapy is its non-specific toxicity due to off-site drug accumulation. Micelles tend to localize the drug to the tumor site. However, rapid drug release at high concentrations from the micelles to kill the cancer cells remains a formidable task. In this manuscript, we have introduced the 2-nitrobenzyl (2NB)-moiety as the linker between mPEG and the photosensitizer, chlorin e6 (Ce6), to prepare the conjugate, mPEG(2-nitrobenzyl)Ce6. We envision that 2NB as a linker between hydrophobic, Ce6, and hydrophilic mPEG would be more effective in releasing Ce6 by disassembling PEGylated 2-nitrobenzyl chlorin e6 (mPNCe6) Ms. Characterization through Fourier transform infrared spectroscopy and <sup>1</sup>H, <sup>13</sup>C nuclear magnetic resonance spectra validated the successful synthesis of the conjugate. By conjugating Ce6 into the hydrophobic core of the micelles, exposure to near-infrared light significantly hastened the dissociation of the micelles, facilitating a controlled and rapid release of Ce6's hydrophobic components within the micelles. A cellular uptake study was performed, showing that Ce6 conjugation has improved the uptake of Ce6. The cell viability assay revealed that the formulation had shown concentration-dependent cytotoxicity upon laser irradiation. mPNCe6 group with laser irradiation has generated abundant reactive oxygen species (ROS) inside cells and exhibited green solid fluorescence, indicating the efficient delivery of Ce6 by mPNCe6 micelles and its excellent ROS generation ability inside cells upon laser irradiation. Further, in vivo studies on MOC2 tumor-bearing mice demonstrate reduced tumor growth, lung metastasis, and drug accumulation in the tumor region. The developed nanomedicine could be a potential treatment strategy for oral cancer, minimizing the occurrence of lung metastasis.

HFE
Also flagged:vitamin D receptorCirrhosisdeathhepatocellular carcinomaVDRcancer
Journal Article 2025-09-16 ✓ 1 Snippet Lima SPS, Fernandes-Ferreira R, Brait BJ, Aguiar FL, Pinhel MAS, Dos Santos Abreu A, Silva RF, Silva RCMA, Souza DRS.
In-Text Gene Mentions

…syndrome, ductopenic syndrome,hemochromatosis, biliary cirrhosis, sclerosin…

Show Full Abstract

Cirrhosis is the fourteenth leading cause of death globally and significantly increases the risk of hepatocellular carcinoma (HCC). Polymorphisms in the vitamin D receptor (VDR) can influence inflammation, fibrosis progression and cancer susceptibility. We analysed the association of genetic polymorphisms of the VDR (VDR-rs2228570, VDR-rs731236 and VDR-rs7975232) in cirrhosis with or without HCC, considering clinical, biochemical profiles and survival. A total of 158 patients with cirrhosis, with or without HCC, were studied and distributed into Group 1 (G1 = 60): cirrhosis and HCC; Group 2 (G2 = 98): isolated cirrhosis and control group (G3 = 225): without liver disease. Genetic polymorphisms were analysed by real-time polymerase chain reaction; clinical and biochemical profiles were obtained from medical records. A significance level of α = 5% was adopted. The homozygous mutant for VDR-rs731236 and rs7975232 predominated in G1 compared to other groups (<i>p</i> < 0.05). For VDR-rs2228570, the homozygous mutant predominated in patients, while heterozygotes were found in controls (<i>p</i> > 0.05). A positive correlation between vitamin D and parathyroid hormone was observed in patients (<i>R</i>² = 0.3273). VDR-rs2228570 emerged as a protective factor for G2 (<i>p</i> = 0.0057) and was associated with increased survival, as was rs7975232. In conclusion, VDR-rs731236 and VDR-rs7975232 are associated with cirrhosis and HCC, with VDR-rs7975232 identified as independent predictors for isolated cirrhosis. VDR-rs2228570 confers protection and is associated with increased survival in cirrhosis, as well as a better clinical profile for both conditions in the Brazilian cohort. These findings highlight the potential clinical relevance of VDR polymorphisms as biomarkers for risk assessment and prognosis in cirrhosis and HCC.

bioRxiv 2025-09-16 Preprint (No Snippets API) Yabushita T, Tanaka Y, Fukushima T, Wakahashi K, Umemoto T, Takizawa H, Goyama S, Kitamura T, Nishiyama A, Tamura T, Yamazaki S, Suda T.
Show Full Abstract

Long-term hematopoietic stem cells (HSCs) can generate all blood lineages but typically remain quiescent, becoming activated only in response to acute stress. We previously demonstrated that quiescent HSCs exhibit heterogeneity in intracellular calcium levels. However, the mechanisms underlying this heterogeneity and its physiological relevance remain unclear. Herein, we identify phospholipase C-like 1 ( Plcl1 ), a noncatalytic protein that binds inositol 1,4,5-trisphosphate (IP 3 ), as being selectively enriched in the most quiescent HSC subset. Loss-of-function studies revealed that Plcl1 deficiency at steady state reduced basal intracellular calcium levels and skewed the HSC compartment toward CD41⁺ subsets while preserving overall HSC numbers and long-term reconstitution capacity. Under acute hematopoietic stress, Plcl1 loss accelerated and amplified platelet rebound and the expansion of non-canonical megakaryocyte progenitors (ncMkPs), indicating activation of the thrombopoietic bypass pathway. In aged HSCs, Plcl1 deficiency exacerbated aging-related features, including expansion of the HSC pool, accumulation of CD41⁺ HSCs and ncMkPs, and myeloid-skewed differentiation with impaired competitive reconstitution. These changes were accompanied by diminished induction of calcium-responsive immediate-early genes. Collectively, we identified Plcl1 as an intrinsic regulator that stabilizes calcium dynamics in HSCs, thereby restraining stress- and aging-associated megakaryocytic priming and preserving stem cell function.

bioRxiv 2025-09-16 Preprint (No Snippets API) Chen C, Wang Q, Jarnot N, Dijkgraaf I, Deshpande S.
Show Full Abstract

Living organisms use biomolecular condensates to respond to dynamic environments and create functional materials with complex architectures. Exploring such phase-separated systems beyond the naturally occurring scenarios may offer valuable insights for emergent synthetic biosystems. Here, we report the self-assembly behavior of a short, disordered peptide sequence (termed CT45) derived from a protein present in the bioad-hesive system of tick ectoparasites. We show that CT45 spontaneously accumulates at polar-nonpolar interfaces, and further undergoes liquid-liquid and liquid-to-solid phase transitions to create mechanically stable structures. When encapsulated within vesicles and presented with a stable oil-water interface, CT45 rapidly forms solid shells, which can be reinforced by up-concentrating the material through osmotic imbalance. Unex-pectedly, when presented with a transient acetone-water interface, CT45 condenses at the evaporating interface and forms interconnected, porous mesoscopic scaffolds. The underlying mechanism is found to be the amphiphilic nature of CT45 leading to in-terfacial accumulation, enhancing intermolecular π -based interactions to trigger phase transitions. The micron-sized shells exhibit appreciable mechanical strength and the porous scaffolds present a highly stable platform capable of retaining molecules. In conclusion, the presented condensate-based microscopic and mesoscopic scaffolds hold significance in customizable condensate architectures, with potential applications in biomedical engineering and synthetic biology.

Also flagged:neurological disordersneurogenesisgene expressiondeathnucleotidesdegradation
Journal Article 2025-09-15 No Snippets Lee Y, Boschian C, Ko K.
Show Full Abstract

Neural stem cells (NSCs) are multipotent stem cells with self-renewal capacity, able to differentiate into all neural lineages of the central nervous system, including neurons, oligodendrocytes, and astrocytes; thus, their proliferation and differentiation are essential for embryonic neurodevelopment and adult brain homoeostasis. Dysregulation in these processes is implicated in neurological disorders, highlighting the need to elucidate how NSCs proliferate and differentiate to clarify the mechanisms of neurogenesis and uncover potential therapeutic targets. MicroRNAs (miRNAs) are small, post-transcriptional regulators of gene expression involved in many aspects of nervous system development and function. Multiple studies have shown that miRNAs control the balance between self-renewal and differentiation during development through transcriptional networks and fine-tuned signalling pathways. They also regulate key biological processes, including cell fate determination, developmental timing, neurogenesis, gliogenesis, and apoptosis. Transcriptomic analyses and high-resolution profiling have revealed temporally and spatially restricted miRNA expression patterns in NSCs and their progeny, suggesting highly context-dependent regulatory functions. Here, we provide an integrated overview of recent advances in miRNA biology relevant to NSC maintenance and lineage specification, with a focus on the mechanistic understanding of miRNA roles in neuronal differentiation, glial development, and programmed cell death across neural development.

HFE
Also flagged:vareniclineα4β2 nicotinic acetylcholine receptoralcohol use disorderacamprosatenaltrexonehepatic encephalopathy
Journal Article 2025-09-15 ✓ 1 Snippet Danpanichkul P, Pang Y, Kim D, Suenghataiphorn T, Ko D, Ibrahim AF, Prasitsumrit V, Duangsonk K, Noureddin M, Wijarnpreecha K, Liangpunsakul S.
In-Text Gene Mentions

…liver disease, andhemochromatosis, as well as…

Show Full Abstract

<h4>Background</h4>Varenicline, a partial agonist of the α4β2 nicotinic acetylcholine receptor, is effective for smoking cessation and has shown promise in treating alcohol use disorder (AUD). However, its impact on patients with concurrent alcohol-associated liver disease (ALD) remains understudied. We aimed to evaluate the association between varenicline use and long-term clinical outcomes in this population.<h4>Methods</h4>We conducted a retrospective cohort study using the TriNetX federated network of deidentified electronic health records. Adults with diagnoses of both ALD and AUD were included. Patients prescribed varenicline were compared to those receiving FDA-approved AUD pharmacotherapies (acamprosate or naltrexone), using 1:1 propensity score matching based on demographics, comorbidities, medications, and laboratory values. The primary outcome was major adverse liver outcomes (MALO); secondary outcomes included all-cause mortality and other liver-related complications. Hazard ratios (HRs) were estimated using Cox proportional hazards models over a five-year follow-up period.<h4>Results</h4>A total of 1278 patients were included after matching. Varenicline use was associated with lower all-cause mortality (14.4% vs. 17.4%; HR 0.75, 95% CI 0.57-0.99) and a significantly reduced risk of hepatic encephalopathy (3.5% vs. 6.7%; HR 0.47, 95% CI 0.28-0.79). Although overall MALO rates were similar between groups (17.3% vs. 17.6%; HR 0.89, 95% CI 0.66-1.20), subgroup analyses revealed reduced MALO incidence among females and all-cause mortality among individuals aged ≥65 years.<h4>Conclusion</h4>In this real-world cohort study, varenicline use was associated with improved survival and a lower risk of hepatic encephalopathy compared to standard AUD pharmacotherapies in patients with co-occurring ALD and AUD. These findings support further investigation of varenicline as a potential therapeutic option, ideally through randomized controlled trials.

DARS2
Also flagged:lactateLBSLaspartatemitochondrialataxiaprimary axonopathy
Journal Article 2025-09-15 ✓ 5 Snippets Garofolo I, Lindsay B, Liang Y, Ratajczak B, Janowski M, Walczak P, Fatemi A, Nemeth CL.
In-Text Gene Mentions

…AAV9-DARS2Gene Therapy Rescues…

…in the geneDARS2.…

DARS2is an essential…

…cells and neuronalDars2deficient mice…

…supplementation, using AAV9-DARS2in LBSL patient…

Show Full Abstract

<h4>Objective</h4>Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is a rare, autosomal recessive disorder caused by variants in the gene DARS2. DARS2 is an essential and ubiquitously expressed enzyme that catalyzes the attachment of aspartate to its cognate tRNA for mitochondrial protein translation. LBSL is clinically characterized by progressive spasticity, ataxia, and dorsal column dysfunction, and is considered a primary axonopathy with secondary demyelination.<h4>Methods</h4>Herein, we tested the efficacy of gene supplementation, using adeno-associated virus, serotype 9 (AAV9)-DARS2 in LBSL patient cells, as well as in an LBSL mouse phenolog in which Dars2 was deleted in CamKIIα-expressing neurons of the hippocampus and cortex.<h4>Results</h4>In vitro, patient neurons treated with AAV9-DARS2 showed increased gene expression of the gene mirrored by improved mitochondrial function, axonal growth, and reduced lactate release, despite variation in impairment across lines. Knockout mice showed improved behavior and reduced cortical neurodegeneration 6 months after a single intracerebroventricular injection of AAV9-DARS2.<h4>Interpretation</h4>Together, this work provides proof-of-concept data that gene supplementation can improve cell function and survival for an extended period of time. AAV9 therapy has proven especially useful for loss of function monogenetic disorders, and these data may support further investigation into therapies for LBSL. ANN NEUROL 2026;99:59-72.

Also flagged:copper oxidephotonsiliconLTO1
Journal Article 2025-09-15 No Snippets Gao B, Nikbin E, Johnstone G, Shi Z, Heath C, Appathurai N, Moreno BD, Rahemtulla A, Gu GD, Tranquada JM, Howe JY, Kim YJ.
Show Full Abstract

Strain engineering has attracted significant attention in recent years due to its capability in tuning lattice and electronic structures of quantum materials. Using moderate uniaxial compressive strain, structural phase separation is induced in the low-temperature phase of x = 1/8 La2-xBaxCuO4$\rm La_{2-x}Ba_{x}CuO_{4}$ (LBCO) single crystals. These structures are low temperature tetragonal (LTT), low temperature less orthorhombic (LTLO), and a plastically deformed nano-domain structure (PDNS), comprised of few-nanometer-sized orthorhombic domains within an amorphous matrix. These three structures exhibit distinct superconducting behaviors. The volume fraction of the LTT structure is suppressed with increasing strain, while its superconducting transition temperature increases and broadens. The LTLO structure exhibits a sharp superconducting transition above 32 K, which increases up to ≈ 36 K at maximum strain. The PDNS phase exhibits a very broad superconducting transition and persists even after removing the strain. This study illustrates the sensitivity of superconductivity to the structure of the LBCO sample near its stripe instability.

Also flagged:bile refluxObesityp53NeoplasiaAdenocarcinomaBarrett
Journal Article 2025-09-15 No Snippets Asano N, Koike T, Saito M, Hatayama Y, Ogata Y, Jin X, Kanno T, Hatta W, Uno K, Imatani A, Masamune A.
Show Full Abstract

<h4>Background</h4>Barrett's esophagus and its malignant progression to Barrett's adenocarcinoma are becoming increasingly prevalent worldwide, yet their underlying mechanisms remain incompletely understood.<h4>Summary</h4>The pathogenesis of Barrett's esophagus and Barrett's adenocarcinoma is multifactorial, involving environmental, genetic, and cellular factors. Chronic acid and bile reflux are well-established contributors, promoting cellular transformation in the esophageal epithelium. Obesity further exacerbates this risk, both indirectly by increasing reflux and directly via proinflammatory adipokines. Recent genetic studies have identified several genetic risk variants, with loss of p53 recognized as critical event in malignant progression. Moreover, the origin of Barrett's esophagus remains under investigation, with proposed sources including cells of esophageal submucosal glands, cells of gastric cardia, and circulating bone marrow-derived cells.<h4>Key messages</h4>The pathophysiological mechanisms underlying Barrett's esophagus and the development of Barrett's adenocarcinoma are still under active investigation. Understanding these mechanisms is essential for developing effective preventive and therapeutic strategies.

HFE
Also flagged:irondementiaParkinson's diseasePDAnemiaosteoporosis
Journal Article 2025-09-15 ✓ 5 Snippets Casanova F, Tian Q, Williamson DS, Lucas MR, Zweibaum D, Ding J, Atkins JL, Melzer D, Ferrucci L, Pilling LC.
In-Text Gene Mentions

…conditions 16 plushemochromatosisand 4 dementia…

…type-2 diabetes, andhemochromatosis.…

…Forhemochromatosiswe investigated the…

…known disease-causing variantsHFEC282Y and H63D,…

…those with diagnosedhemochromatosis( Supplemental Table…

Show Full Abstract

BackgroundBrain iron in specific subcortical regions increases risk of dementia and Parkinson's disease (PD). Genetic and environmental factors affect iron deposition, but underlying mechanisms are unclear.ObjectiveIdentify risk factors and diseases associated with brain iron; assess causality using genetics.Methods41,581 UK Biobank participants had MRI-estimated brain iron (QSM method) in five dementia or PD-associated subcortical regions (caudate, hippocampus, putamen, substantia nigra, thalamus). We investigated common risk factors (including adiposity, blood pressure, health behaviors, inflammation) and diseases observationally, using covariate-adjusted regression models, and genetically, with Mendelian randomization.ResultsParticipants diagnosed with Alzheimer's disease, PD, or other diseases had higher MRI-estimated brain iron. Anemia, osteoporosis, and hyperparathyroidism were associated with lower brain iron. Higher body mass index and blood pressure, smoking history, and self-reported meat consumption, increased brain iron. Hematological parameters, inflammatory and kidney biomarkers, and calcium, were also associated. Genetics support causal effects of depression, type-2 diabetes, and 7 other diseases with increased iron, but not Alzheimer's disease. Evidence supports a causal effect of osteoporosis on lower iron in the substantia nigra. We found causal associations between adiposity and proteins (including IL-6 receptor and transferrin receptor) on subcortical brain iron.ConclusionsWe identified causal effects for liability to type-2 diabetes, depression, and other conditions, on subcortical MRI-estimated brain iron, but not to Alzheimer's disease, supportive of dementia as a consequence of brain iron deposition, not a cause. The role of adiposity reducing interventions on brain iron should be investigated. Relationships between brain iron, osteoporosis, calcium, and hyperparathyroidism warrant further investigation.

DCC
Also flagged:WntNetrincell migrationorganogenesismig-21touch receptor
Journal Article 2025-09-15 ✓ 5 Snippets Li X, Gordon KL.
In-Text Gene Mentions

…the Netrin receptor UNC-40/DCCto regulate cell…

…the Netrin receptor UNC-40/DCCinteracts with MIG-21/PTP-3…

…with its receptors, UNC-40/DCC[ 30 ],…

…between MIG-21 and UNC-40/DCC(as UNC-5 and…

…MIG-21 and the UNC-40/DCCNetrin receptor are…

Show Full Abstract

The gonad of Caenorhabditis elegans hermaphrodites is a longstanding model of cell migration, stem cell niche function, and organogenesis, but it has not yet been investigated using single-cell RNA-sequencing (scRNA-seq). Using a recently published scRNA-seq dataset of adult C. elegans hermaphrodites, we identified a previously unknown regulator of the leader cell of gonad migration (the distal tip cell, or DTC). The gene mig-21 is both highly and specifically expressed in the DTC, yet has no known role in that cell. However, mig-21 regulates cell migration in other developmental contexts. Using classical genetics techniques, RNAi knockdown, and live cell imaging, we discovered that mig-21 acts synergistically with the Wnt and Netrin pathways to guide anteroposterior and dorsoventral phases of migration in the DTC at the level of signaling, not DTC cell structure. Known interactors of mig-21 in other cell types-like PTP-3C-also act with MIG-21 in DTC migration. Despite its expression in stationary adult DTCs, mig-21 does not play a role in the cessation of DTC migration but instead seems to impart continued sensitivity of the DTC to Wnt and Netrin in adulthood. This study reveals additional complexity of signaling integration between major regulators of germline stem cell niche migration, and as a proof of concept it demonstrates the utility of scRNA-seq datasets in revealing testable hypotheses about genetic networks that were masked by redundancy in traditional screening methods.

SERPINC1
Also flagged:polycythemia verafactor Xdeficiencybleedingbleeding disorderJanus kinase
Journal Article 2025-09-15 ✓ 1 Snippet Cornibe JL, Katz AH.
In-Text Gene Mentions

…Antithrombin III (ATIII) was prophylactically brought…

Show Full Abstract

Published literature about patients with polycythemia vera (PV) undergoing cardiac surgery while utilizing cardiopulmonary bypass (CPB) is scarce, even more so when coupled with an additional rare bleeding disorder. These patients require a multidisciplinary approach to achieve optimal clinical management. Several cases have been reported of oxygenator failure or thrombosis within the extracorporeal circuit. We present a successful CPB run on a patient with coexisting PV and Factor X deficiency undergoing coronary artery bypass grafting.

PLCL1
Also flagged:crotonylationclear cell renal cell carcinomacancerccRCCangiogenesiscalcium
Journal Article 2025-09-15 ✓ 5 Snippets Dai H, Zhao K, Zhao Y, Jiang K, Hang Z, Huang X, Luo W, Nie J, Qin C, Zhou W.
In-Text Gene Mentions

…5-gene prognostic model (PLCL1, DNASE1L3, CD248, CDH13,…

…e, 5’-CCGGCATTGAAGTCACCCAT-3’;PLCL1: Forward, 5’-AAAGTCCGGCCAAATT…

…incorporating five genes:PLCL1, DNASE1L3, CD248, CDH13,…

…Specifically,PLCL1expression was enriched…

…However,PLCL1expression was not…

Show Full Abstract

<h4>Background</h4>Crotonylation, a post-translational modification, is implicated in cancer progression, but its prognostic significance in clear cell renal cell carcinoma (ccRCC) remains unclear. This study aimed to demystify crotonylation heterogeneity and establish a robust prognostic model for ccRCC.<h4>Methods</h4>Using multi-omics approaches, we analyzed transcriptomic data from TCGA-KIRC and GEO cohorts (GSE40435, GSE167573, GSE29609). Crotonylation scores were calculated via ssGSEA, with related gene modules identified through WGCNA. We integrated 10 machine learning algorithms to develop a prognostic model. Immune microenvironment was profiled using Cibersort, mutation landscapes via maftools, and drug sensitivity through oncoPredict. Spatial transcriptomics and single-cell data were analyzed for expression patterns, validated by qRT-PCR in 786-O and HK-2 cell lines.<h4>Results</h4>Dysregulation of 16/18 crotonylation-related genes was observed in ccRCC. WGCNA revealed crotonylation related modules significantly enriched in angiogenesis, calcium/Ras signaling, and cancer stemness pathways. A 5-gene prognostic model (PLCL1, DNASE1L3, CD248, CDH13, PDGFD) demonstrated robust stratification: High-risk patients showed poorer overall survival, higher Treg infiltration, elevated tumor mutation burden and increased sensitivity to several chemotherapy approaches like Cisplatin. Molecular docking identified diacetylmorphine as a potential therapeutic agent (binding energy: -7.278 kcal/mol with DNASE1L3). Spatial/single-cell analyses confirmed cell-type-specific gene expression and the diffferential expression between tumor and normal cell lines was validated by qRT-PCR.<h4>Conclusion</h4>This study establishes a crotonylation-based prognostic model that effectively stratifies ccRCC risk and elucidates key mechanisms linking crotonylation heterogeneity to immune evasion, mutational burden, and metabolic reprogramming. The model offers clinical utility for personalized therapy selection.

HFE
Also flagged:deathIronbloodstream infectionsepsisCOVID-19bloodstream infections
Journal Article 2025-09-15 ✓ 2 Snippets Mohus RM, Gustad LT, Damås JK, Drakesmith H.
In-Text Gene Mentions

…mutations in theHFE, a gene…

…ForHFEC282Y homozygotes, their…

Show Full Abstract

Sepsis is a leading cause of death and disability worldwide, so identifying preventable risk factors is important. Iron is essential for immune function and microbial growth, and iron status varies substantially between individuals, across demographics, and is therapeutically modifiable. Here, we review the current understanding of iron status and associated risks of bloodstream infection, sepsis and severe COVID-19 highlighting relevant population-based studies and Mendelian randomisation studies. Both low and high iron status are associated with increased risk of sepsis. Low iron status is associated with sepsis, bloodstream infections and pneumonia. High iron status and mutations affecting hepcidin regulation are linked to increased risk of bloodstream infections, sepsis and COVID-19. Both iron status pathologies and sepsis are global health issues, and the epidemiological studies described indicate they may be linked. More population-scale investigations on iron status, infection and immunity, especially in areas of high iron deficiency and infectious burden are warranted.

Also flagged:DCC1phytocytokinereceptor kinasebinding
Journal Article 2025-09-15 No Snippets Yin C, Shi S, Lu Z, Li H, Wang L, Zhang Y, Yan J, Du C, Zhang H, Lu H, Zhu Y, Luo X, Wang C, Qin G, Ding X, Hou S.
Show Full Abstract

No abstract available.

Also flagged:epinephrinedexamethasonebronchiolitisoxygenglucocorticoidsasthma
Journal Article 2025-09-15 No Snippets Plint AC, Heath A, Rowe T, Vogel KI, Wills-Ibarra N, O'Brien S, Borland ML, Johnson DW, Zorc JJ, Pechlivanoglou P, Schuh S, Rao M, Bonisch M, Craig SS, Gouin S, Kochar A, Thompson GC, Lash C, Wallace A, Dixon A, Sawyer S, Joubert G, Oakley E, Offringa M, Klassen TP, Dalziel SR.
Show Full Abstract

<h4>Introduction</h4>Bronchiolitis exerts a significant burden of illness on infants worldwide. National guidelines advise only supportive care. There is evidence that treating infants with bronchiolitis with a combination of inhaled epinephrine and dexamethasone may reduce hospital admissions.<h4>Objective</h4>The aim of this study is to determine if infants with bronchiolitis treated with inhaled epinephrine (delivered by metered dose inhaler with spacer or nebuliser) in the emergency department and a 2-day course of oral dexamethasone have fewer hospitalisations compared to infants treated with placebo.<h4>Methods</h4>The BIPED study (Bronchiolitis in Infants Placebo <i>versus</i> Epinephrine and Dexamethasone) is a randomised, placebo-controlled, observer, investigator, clinician and patient blinded superiority clinical trial being conducted in 12 emergency departments across three countries (Canada, New Zealand and Australia). We will recruit 864 infants between 60 days and 12 months of age with bronchiolitis to receive either: 1) two inhaled epinephrine treatments (3 mg <i>via</i> nebuliser or 625 µg <i>via</i> metered dose inhaler with spacer) 30 min apart and a simultaneous dose of oral dexamethasone (0.6 mg·kg<sup>-1</sup>, maximum 10 mg) in the emergency department with the dexamethasone repeated at 24 h; or 2) inhaled placebo and oral placebo. The primary outcome is hospital admission for bronchiolitis within 7 days (168 h) of enrolment. Secondary outcomes include hospital admission during enrolment and all-cause hospital admissions within 21 days of enrolment.<h4>Conclusion</h4>Given the burden of bronchiolitis, there is urgent need for a trial to confirm if combination therapy with epinephrine and dexamethasone is effective.

Also flagged:Huntingtinneurodegenerative diseasesHuntington's diseasefibrils
Journal Article 2025-09-15 No Snippets Mishra A, Chowdhury PK.
Show Full Abstract

Protein aggregation plays a crucial role in various neurodegenerative diseases, including Huntington's disease. Understanding the factors influencing aggregation kinetics is essential for deciphering disease mechanisms. This research paper investigates the aggregation of a mutant Huntingtin protein (HD39Q) under various conditions, focusing on the impact of macromolecular crowding agents. The study employs multiple techniques, including fluorescence spectroscopy, circular dichroism, and nanoparticle tracking analysis, to characterize the aggregation kinetics and morphology. The results demonstrate that crowding agents significantly accelerate aggregation, with different agents exhibiting varying effects depending on their physicochemical properties. Fluorescence correlation spectroscopy provides insights into early-stage oligomerization. Confocal and scanning electron microscopy help visualize the resulting aggregates and fibrils. These findings contribute to a better understanding of how intracellular-like environments influence protein aggregation and provide valuable insights into the biophysical properties of aggregation-prone proteins.

PTGIS
Also flagged:Triple-Negative Breast CancertumorHematoxylincell proliferationtumourstumour
Journal Article 2025-09-15 ✓ 1 Snippet Xu J, Long J, Li ZY, Wang C, Zhang Y, He H, Hu Q, Yin S, Li H, Wang N, Gao Q, Tang S, Zhu Y, Wang P, Feng R, Liu Y.
In-Text Gene Mentions

…XDH, HAL, PLA2G4A,PTGIS, DPT, ITPK1, CAMK1,…

Show Full Abstract

<h4>Objective</h4>To explore the effects of <i>Clinacanthus nutans</i> extract (CnE) on triple-negative breast cancer (TNBC) and mechanism of action.<h4>Methods</h4>In vitro, the human TNBC cell lines were treated with the extract at various concentrations. Cell viability was assessed using the CCK8 assay. In vivo, establishing a subcutaneous xenograft tumor model of TNBC, Hematoxylin-eosin staining and TUNEL assay were used to evaluate the effect of CnE on tumor proliferation. Tumor proteins were extracted, Quantitative proteomics and subsequently analyzed using bioinformatics approaches. Finally, immunohistochemistry evaluates the protein expression differences of ATP2A3, PLA2G4A, and ITPK1.<h4>Results</h4>In vitro, CnE inhibited TNBC cell proliferation in a concentration-dependent manner, with IC50 values of 420 ± 35 μg/mL (MDA-MB-231) and 380 ± 28 μg/mL (MDA-MB-468), showing maximal 68.5% inhibition at 800 μg/mL (p < 0.001). The TNBC xenograft model was successfully established, and tumours in the extract-treated group were markedly smaller than those in the saline group. On day 28, the tumour inhibition rate was 28.66%, significantly higher than that in the saline group (P < 0.05). Haematoxylin-eosin staining staining and TUNEL assay showed increased tumor necrosis and apoptosis induction.(P < 0.001). Proteomic analysis showed that among the 4,908 identified proteins, 80 were upregulated, and 7 were downregulated. Bioinformatics analysis indicated involvement in the extracellular matrix, fatty acid metabolism, cell apoptosis, ferroptosis, immune response, choline metabolism, and amino acid metabolism. Immunohistochemistry revealed increased expression of ATP2A3 (1.3-fold, p < 0.05), PLA2G4A (1.6-fold, p < 0.05) and ITPK1 (3.2-fold, p < 0.01) proteins in the extract group compared to the control group.<h4>Conclusion</h4>CnE inhibits TNBC cell proliferation, suppresses tumor growth, The mechanism likely involves multiple biological processes and pathways, Key pathways included apoptosis, ferroptosis, and necroptosis signaling.

Also flagged:Nrfnuclear factor erythroid 2-related factorCNC-bZIP transcription factorNrf-2NFE2L2Nrf-1
Journal Article 2025-09-15 No Snippets Cui C, Song H, Guo Y, Shi J, Geng B, Wang G.
Show Full Abstract

This review systematically elucidates the molecular mechanisms and therapeutic potential of nuclear factor erythroid 2-related factor (Nrf) family members in the cardiovascular system. As critical components of the CNC-bZIP transcription factor family, the Nrf family (including Nrf-2/NFE2L2, Nrf-1/NFE2L1, and Nrf-3/NFE2L3) orchestrates antioxidant response element (ARE)-dependent gene expression networks, playing pivotal roles in maintaining redox homeostasis, modulating inflammatory responses, improving mitochondrial function, and regulating programmed cell death (apoptosis, autophagy, and pyroptosis). Clinical data have demonstrated that in patients with myocardial infarction, the expression of Nrf-3 gene is significantly upregulated in myocardial cells within the infarcted area. Its high expression is associated with increased in-hospital mortality during the acute phase and accelerated progression of ventricular remodeling. Knockout of the Nrf-3 gene can reduce the acute-phase mortality of myocardial infarction, improve ventricular remodeling, and enhance cardiac function. Additionally, a crossover trial involving 19 participants showed that after 2 months of administration of olive oil by-product pâté tablets, the plasma Nrf-2 level in the subjects increased by 88.9% with concurrent improvement in cardiovascular risk factors. Collectively, these findings confirm the impact of the Nrf family on cardiovascular prognosis and its potential for intervention. Furthermore, we comprehensively analyze the regulatory functions of Nrf members in major cardiovascular pathologies, including myocardial ischemia-reperfusion injury, atherosclerotic plaque formation/stabilization, and heart failure progression. Based on recent advances, we also discuss innovative therapeutic strategies targeting the Nrf pathway, encompassing pharmacological activators, gene/epigenetic therapies, combinatorial approaches, and lifestyle interventions, thereby providing a theoretical framework and novel perspectives for the precision medicine of cardiovascular diseases.

PRDX6
Also flagged:seleniumselenidesmethoxynaphthacyl selenidesperoxiredoxin-6post-translational modifications
Journal Article 2025-09-15 ✓ 5 Snippets Roy B, Das E, Shieh M, Ogata S, Jung M, Fujita H, Zhang S, Robinson JR, Akaike T, Xian M.
In-Text Gene Mentions

… recombinant peroxiredoxin-6 (PRDX6) and PRDX6-overexpressing HEK…

…peroxiredoxin-6 (PRDX6) andPRDX6-overexpressing HEK293T cells.…

…S -selenylation onPRDX6

…on peroxiredoxin 6 (PRDX6), a key regulator…

…this modification enablesPRDX6to act as…

Show Full Abstract

Hydrogen selenide (H<sub>2</sub>Se) is an important metabolite in selenium biochemistry and plays a crucial role in redox biology. While its significance has become increasingly recognized, research on H<sub>2</sub>Se is challenging due to its instability and high reactivity. Suitable compounds (aka donors) that can selectively produce H<sub>2</sub>Se in biological systems would facilitate this research field. In this work, we explored photo-triggered H<sub>2</sub>Se donors by utilizing two structural templates: 2-nitrobenzyl selenides and 2-methoxy-6-naphthacyl selenides. The photoreactions of these compounds under light were studied. 2-Nitrobenzyl selenides were found to release H<sub>2</sub>Se (and its oxidized form H<sub>2</sub>Se<sub>2</sub>) slowly under UV light, but the released H<sub>2</sub>Se/H<sub>2</sub>Se<sub>2</sub> could further react with the photoproduct and be consumed. On the other hand, naphthacyl selenides could undergo clean and fast reactions to produce H<sub>2</sub>Se/H<sub>2</sub>Se<sub>2</sub>, as well as a stable and fluorescent photoproduct. This self-monitoring and quick releasing ability make naphthacyl selenides ‛smart donors' for biological applications. Importantly, this donor was found to induce protein <i>S</i>-selenylation (CysS-SeH) on Cys47 and Cys91 in both recombinant peroxiredoxin-6 (PRDX6) and PRDX6-overexpressing HEK293T cells. This photo-triggered donor system may serve as a new strategy to control selenium-based protein post-translational modifications for mechanistic studies into selenium metabolic pathways and ferroptosis.

PTGIS
Also flagged:colorectal cancergene expressioncolon adenocarcinomarectal adenocarcinomaCancerglycolysis
Journal Article 2025-09-15 ✓ 5 Snippets Liu D, Zhang M, Nie Y, Li X, Liu W, Yue L, Meng X, Li P, Wang L, Mei Q.
In-Text Gene Mentions

…PHGDH , andPTGIS, is highly…

…, PRKACB ,PTGIS, STC1 ,…

…, PHGDH ,PTGIS, VEGFA )…

…IL1A , andPTGIS, and CCNA2…

…and CCNA2 withPTGIS(| r |…

Show Full Abstract

<h4>Background</h4>Cancer stemness, hypoxia, and glycolysis collectively influence colorectal cancer (CRC) progression. However, the intricate relationships among these factors remain incompletely understood.<h4>Methods</h4>This study (1) explored hypoxia and glycolysis-related genes (HGRGs) in CRC by mRNA stemness index (mRNAsi), analyzed the gene expression profiles from Gene Expression Omnibus and The Cancer Genome Atlas (TCGA) databases, (2) established a Cox-prognostic model based on single-sample gene set enrichment analysis, differentially expressed gene analysis, weighted gene co-expression network analysis, and Least Absolute Shrinkage and Selection Operator (LASSO) and Cox regression analyses, and (3) assessed the predictive accuracy of the model. Decision curve analysis (DCA) was employed to determine the clinical utility of the model.<h4>Results</h4>Ten HGRGs were selected based on mRNAsi to create the LASSO model. High-risk CRC patients in the TCGA dataset displayed unfavorable clinical outcomes and responses to immunotherapy. Consensus cluster analysis revealed two distinct colon adenocarcinoma/rectal adenocarcinoma clusters, with patients in cluster 2 having a worse prognosis compared to patients in cluster 1. A five-gene prognostic nomogram was developed through univariate and multivariate Cox regression analyses, with DCA confirming its accuracy.<h4>Conclusions</h4>This innovative prognostic model, incorporating <i>ALDOB</i>, <i>AQP1</i>, <i>IL1A</i>, <i>PHGDH</i>, and <i>PTGIS</i>, is highly accurate in predicting patient survival.

PLCL1CCDC92
Also flagged:pathogenesisdiabetic nephropathyDNsynthesisslit-diaphragmlipid
Journal Article 2025-09-15 ✓ 4 Snippets Silva JS, Miguel CB, Felipe AGB, Martins ALMDS, Miguel RB, Carrijo MO, Mazurek L, Araújo LS, da Silva CA, Góes-Neto A, Oliveira CJF, Machado JR, Reis MA, Rodrigues WF.
In-Text Gene Mentions

…DOT1L–PLCL1improves lipid handling…

…regulators add causality:CCDC92promotes lipid deposition…

…dividends: HGF and DOT1L/PLCL1/BTG2 restore autophagy/lipid …

…tophagy/lysosomal flux; DOT1L–PLCL1improves lipid handling;…

Show Full Abstract

Podocyte injury is a central event in the pathogenesis of diabetic nephropathy (DN). We conducted a systematic review across four major databases, identifying 7769 records and including 130 studies that met predefined eligibility criteria. Methodological quality was assessed with Joanna Briggs Institute tools, yielding a mean score of 81.3%, indicating overall moderate-to-high rigor despite design-contingent limitations. Publication activity was sparse until 2018 but increased markedly thereafter, with more than 80% of studies published between 2019 and 2025. Temporal analyses confirmed a strong positive trend (<i>p</i> = 0.86, <i>p</i> < 0.0001), reflecting the rapid expansion of this field. Study designs evolved from early human-only descriptions to integrated multi-model approaches combining human tissue, animal experiments, and in vitro systems, thus balancing clinical relevance with mechanistic exploration. Geographically, Asia emerged as the leading contributor, complemented by increasing multinational collaborations. Mechanistic synthesis highlighted five reproducible pillars of podocyte injury: slit-diaphragm and adhesion failure, mTOR-autophagy-ER stress disequilibrium, mitochondrial and lipid-driven oxidative injury, immune, complement, and inflammasome activation, and epigenetic and transcriptomic reprogramming. Collectively, these findings underscore a convergent mechanistic cascade driving podocyte dysfunction, while also providing a framework for therapeutic interventions aimed at restoring barrier integrity, metabolic balance, and immune regulation in DN.

HFE
Also flagged:metabolismActinin Alpha 3ACTN3Angiotensin I Converting EnzymeACE IPeroxisome Proliferator-Activated Receptor Alpha
Journal Article 2025-09-15 ✓ 2 Snippets Mijaica R, Tohănean DI, Alexe DI, Balint L.
In-Text Gene Mentions

…, MCT1 ,HFE, COMT ,…

…in MCT1 andHFE, have been…

Show Full Abstract

<b>Background/Objectives</b>: This systematic review aimed to gather the most recent evidence regarding the link between genetic polymorphisms and physical performance in team sports, with a focus on the practical utility of this information for athlete selection, training personalization, and injury prevention. <b>Methods</b>: Sixteen studies published between 2018 and 2025 were analyzed and selected from six international databases, in accordance with the PRISMA guideline. Only English-language studies were included, which evaluated active athletes in team sports and investigated associations between genetic variations, such as Actinin Alpha 3 (<i>ACTN3 R577X</i>), Angiotensin I Converting Enzyme (<i>ACE I/D</i>), Peroxisome Proliferator-Activated Receptor Alpha (<i>PPARA</i>), Interleukin 6 (<i>IL6</i>), and Nitric Oxide Synthase 3 (<i>NOS3</i>), and physical performance parameters. The methodological quality of the studies was assessed using the Q-Genie tool, with all studies scoring over 45 across all 11 items, indicating high quality. <b>Results</b>: The <i>ACTN3</i> and <i>ACE</i> genes stood out due to their consistent association with traits such as strength, speed, endurance, and recovery capacity. Other genes, such as <i>PPARA</i>, Fatty Acid Amide Hydrolase (<i>FAAH</i>), Angiotensinogen (<i>AGT</i>), and <i>NOS3</i>, complemented this genetic profile by being involved in the regulation of energy metabolism and injury predisposition. An increasing number of studies have begun to adopt cumulative genotype scores, suggesting a shift from a monogenic approach to complex predictive models. <b>Conclusions</b>: The integration of genetic profiling into the evaluation and management of athletes in team sports is becoming increasingly relevant. Although current evidence supports the applicability of these markers, robust future research conducted under standardized conditions is necessary to validate their use in sports practice and to ensure sound ethical standards.

Also flagged:Nitrogen MonoxideNitric EsterIbuprofenNaproxenCOXNitric esters
Journal Article 2025-09-15 No Snippets Tziona P, Theodosis-Nobelos P, Lepesiotis D, Gavalas A, Rekka EA.
Show Full Abstract

Nitric esters are among the compounds that can liberate nitrogen monoxide (NO) in the organism. Due to the vasodilatation caused by nitrogen monoxide, NO-donors have been shown to protect endothelial function, acting as vasodilators, promoting efficient oxygen supply to tissues, to lower blood pressure, and to inhibit platelet aggregation. Incorporation of a NO-liberating moiety in the structure of non-steroidal anti-inflammatory drugs results in anti-inflammatory agents that are safer for the gastrointestinal system. In this research, ibuprofen and naproxen, two commonly applied non-steroidal anti-inflammatory drugs (NSAID), non-selective inhibitors of cyclooxygenases, were used to design novel anti-inflammatory agents able to release NO in the organism. Thus, the NSAIDs were amidated with beta-alanine and L-proline, which were able to incorporate the 2-nitro-oxyethyl moiety as the NO donor. The resulting compounds were anti-inflammatory agents, found to be more potent than the mother drugs, demonstrating remarkable inhibition of cyclooxygenase-2 over cyclooxygenase-1 and the ability to release NO in vitro. Furthermore, two of the most active anti-inflammatory compounds proved to be effective hypolipidemic agents, decreasing plasma total cholesterol, triglycerides, and LDL-cholesterol in hyperlipidemic rats significantly. The most effective compound in all the above tests was the ibuprofen derivative 5, which inhibited COX-2 by 95%, decreased inflammation by 73%, and reduced all lipidemic indices by more than 50%. Furthermore, docking experiments of compound 5 on the active sites of COX-1 and COX-2 showed that it interacts intensely with the binding site of COX-2, and the binding energy is equivalent to that of the relevant to celecoxib selective COX-2 inhibitor 4-[5-(4-bromophenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl] benzenesulfonamide (SC-5580). In conclusion, the performed structural modifications resulted not only in the improvement of the anti-inflammatory activity, compared with the parent NSAID, but also acquired strong hypolipidemic activity. Thus, the combination of structural characteristics resulting in a decrease in lipidemia, with possible inhibition of atherosclerosis, due to their anti-inflammatory activity and vasodilatation ability, via the liberated NO, may constitute a useful rationale for new compounds.

Also flagged:photoneugenolphenylpropanoidsβ-ocimenegermacrene Dphotosynthesis
Journal Article 2025-09-15 No Snippets Chu HTT, Vu TN, Dinh TTT, Do PT, Tien TQ, Tong QC, Ha QT, Tran KQ, Setzer WN.
Show Full Abstract

This study investigated optimal supplemental multispectral light-emitting diode (LED) conditions for the growth and essential oil accumulation of <i>Ocimum gratissimum</i> L. (OG) cultivated in a net house over 15 weeks. We hypothesized that supplemental lighting could increase biomass while affecting oil yield or vice versa. Nine lighting treatments were established, combining red (R) and blue (B) with ultraviolet-A (UV-A), green (G), or far-red (Fr) lights, applied for 4, 6, or 8 h/night at 80-120 µmol·m<sup>-2</sup>·s<sup>-1</sup>. Essential oils were analyzed by GC/MS-FID, revealing 21-28 compounds, dominated by phenylpropanoids (59.4-71.2%). Eugenol (58.5-69.8%), (<i>Z</i>)-β-ocimene (10.2-12.1%), and germacrene D (7.6-12.1%) were the major constituents. The oils showed weak antimicrobial activity against <i>Candida albicans</i>. All lighting treatments significantly enhanced fresh biomass and oil yield (<i>p</i> < 0.001) compared with the control. The optimal treatment (F2; R, B, and UV-A lights at a photon flux ratio of 71:20:9; 100 µmol·m<sup>-2</sup>·s<sup>-1</sup>, 6 h/night) yielded the highest fresh biomass (13.07 ± 0.71 Mg/ha), essential oil (31.39 ± 1.71 L/ha), and eugenol (21.09 ± 1.15 L/ha). These findings demonstrate the strong influence of spectral composition and exposure duration on OG productivity and highlight the potential of tailored LED strategies to improve both biomass and oil quality in cultivation systems.

HFE
Also flagged:CytokinesChronic Hepatitis C Infectionmineraltumor necrosis factor alphaTNF-αinterleukin 6
Journal Article 2025-09-15 ✓ 1 Snippet Lo Re V, Carbonari DM, Newcomb CW, Torgersen J, Weinstein EJ, Smith SM, Brecker KL, Liu XS, Kostman JR, Trooskin S, Hubbard RA, Baker JF, Zemel BS, Leonard MB.
In-Text Gene Mentions

…(ie, hepatitis B,hemochromatosis, alpha-1-antitrypsin, autoimm…

Show Full Abstract

<h4>Background</h4>It remains unclear if cure of hepatitis C virus (HCV) infection with direct-acting antivirals (DAAs) ameliorates HCV-related inflammation and bone deficits. We evaluated changes in cytokines and bone measurements by high-resolution peripheral quantitative computed tomography (HR-pQCT) prior to DAA treatment and 18 months following initiation and compared changes in uninfected controls over 18 months.<h4>Methods</h4>We conducted a cohort study of 40 participants who initiated DAAs and achieved cure and 48 without HCV as controls. At enrollment and 18 months later, participants had measurements of volumetric bone mineral density, cortical dimensions, and mechanical properties of the radius and tibia by HR-pQCT; visceral fat area and appendicular lean mass by whole-body dual-energy X-ray absorptiometry; and serum tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), and interleukin 18 (IL-18). Multivariable linear regression was used to estimate group differences in mean changes in bone measurements and cytokines.<h4>Results</h4>We observed no significant differences in month 0-18 changes in HR-pQCT measurements between participants with cured HCV and controls in unadjusted models or after adjustment for age, sex, appendicular lean mass index, visceral fat area, and smoking. Participants with cured HCV had decreases in IL-18 (mean change, -0.085 vs +0.086 log pg/mL; <i>P</i> < .001) and TNF-α (mean change, -0.050 vs +0.084 log pg/mL; <i>P</i> < .001), but not IL-6 (mean change, +0.108 vs +0.009 log pg/mL; <i>P</i> = .214) versus controls.<h4>Conclusions</h4>Participants with cured HCV had no significant changes in bone microarchitecture by HR-pQCT 18 months after DAA initiation compared with controls, but did have decreases in IL-18 and TNF-α versus controls.

Also flagged:PeroxiredoxinGastric Cancer
Journal Article 2025-09-15 No Snippets Unknown Authors
Show Full Abstract

[This corrects the article DOI: 10.1155/2020/3948183.].

STAU1
Also flagged:lung adenocarcinomamitochondrialLUADatypicaladenocarcinoma in situminimally invasive adenocarcinoma
Journal Article 2025-09-15 ✓ 1 Snippet Xu X, Gong T, Huo Z, Duan Y, Chu Q, Qin J.
In-Text Gene Mentions

STAU1

Show Full Abstract

Lung adenocarcinoma (LUAD) develops through a stepwise progression from pre-cancerous lesions, including atypical adenomatous hyperplasia (AAH), adenocarcinoma in situ (AIS), and minimally invasive adenocarcinoma (MIA). Understanding the molecular dynamics underlying these transitions is critical for early detection and therapeutic interventions. A comprehensive proteomic analysis was performed on pre-cancerous and early LUAD samples using label-free quantitative mass spectrometry. Immunohistochemistry (IHC) and double fluorescence staining were applied to validate protein expression and mt-dsRNA localization. Trajectory inference was utilized to model dynamic proteomic changes during lesion progression. Mt-dsRNA levels were significantly elevated in pre-cancerous lesions, peaking in AIS. Double fluorescence staining revealed partial co-localization with the mitochondrial marker TOMM20, suggesting mitochondrial origin. Differential γ-H2AX staining patterns, with nuclear positivity in AAH and cytoplasmic positivity in AIS and MIA, indicated stage-specific dynamics of the DNA damage response. Upregulation of dsRNA sensors, including RIG-I and MDA5, and dsRNA-binding proteins (dsRBPs) such as ADAR1 and HNRNPA2/B1, highlighted a complex regulatory feedback network for both oncogenic and anti-tumorigenic effects. Notably, in dsRNA-IP assay, ASPH was enriched across all stages including LUAD, while TMED9 and HNRNPA2/B1 were specific to pre-cancerous lesions, reflecting their stage-dependent roles in tumor transformation. Finally, Trajectory analysis identified distinct proteomic shifts, with AAH lesions exhibiting high progression scores resembling AIS and MIA, underscoring their malignant potential. This study reveals the multifaceted roles of mt-dsRNA and its associated proteins in pre-cancerous lesions, providing insights into immune activation, stress adaptation, and early carcinogenesis. These findings establish a framework for developing biomarkers and targeted therapies aimed at preventing the transition to invasive LUAD.

bioRxiv 2025-09-15 Preprint (No Snippets API) Wu P, Fallesen T, Uhlmann F.
Show Full Abstract

Mitotic chromosome dimensions differ between organisms, and they differ within a species between developmental stages. The physiological determinants of chromosome size remain poorly understood. Here, we investigate chromosome size determinants in the fission yeast Schizosaccharomyces pombe . Super-resolution microscopy and semi-automated measurements reveal that cell or nuclear volume in interphase, or the time spent in mitosis (both previously proposed chromosome size determinants), have little influence on resultant chromosome dimensions. Instead, levels of the chromosomal condensin complex affect chromosome size, with increasing condensin levels resulting in more compact, shorter and thinner, chromosomes. These observations inform our understanding of how chromosome dimensions are controlled in an organism. They suggest that a chromosome-intrinsic mechanism sets chromosome size, more so than the environment in which chromosomes find themselves in.

Also flagged:CurcuminPyrazolePyridineSynthesisbenzenecancer
Journal Article 2025-09-14 No Snippets Doan NQH, Nguyen HTT, Huynh HT, Truong TN.
Show Full Abstract

In recent years, curcumin analogs have not only demonstrated potent anticancer activities but have also addressed several limitations of curcumin itself, thereby remaining a promising focus of research within the scientific community. Building upon the findings of our previous studies, structural modifications of potent curcumin analogs fused with 1H-pyrazole are performed by applying the bioisosteric replacement strategy of a benzene ring with a pyridine ring, to develop a series of novel curcumin analogs containing pyrazole-pyridine hybrids (3a-4h) as promising anticancer agents. Among them, curcumin analog 4c emerges as the most potent compound, exhibiting the strongest cytotoxicity against various human cancer cell lines, including HepG2 (liver), MDA-MB-231 (breast), and A549 (lung), as well as significant apoptosis-inducing effects in HepG2 cells. Furthermore, compound 4c is predicted to possess a favorable physicochemical-pharmacokinetic-toxicological profile, as well as an effective binding mode at the colchicine-binding site of the α,β-tubulin heterodimer. Importantly, the bioisosteric replacement in compound 4c is found to exert beneficial effects on its anticancer activities, physicochemical-pharmacokinetic-toxicological properties, and binding affinity, in comparison with its parent compounds.

HFE
Also flagged:HLApeptidesClass I HLACD8killer‐cell immunoglobulin‐like receptorsKIR
Journal Article 2025-09-14 ✓ 1 Snippet Tran L, Nickens R, Luu V, Petersdorf EW, Mack SJ.
In-Text Gene Mentions

…the HLA ,HFE, MICA ,…

Show Full Abstract

The highly polymorphic HLA genes inform susceptibility and resistance to infectious and autoimmune diseases and cancers and are key for successful solid-organ and stem-cell transplantation therapies. Over 41,000 HLA alleles are known and are unevenly distributed across the human population. Here, we describe HLAtools, Searching Shared HLA Amino-Acid Residue Prevalence (SSHAARP) and the Global Frequency Browser (GFB), new informatic tools developed to facilitate working with HLA data and visualizing the global distribution of HLA variants in human populations. HLAtools is an R package that consumes static resources for HLA alleles and sequences and makes these data locally computable alongside data-query, data-customization and data-analysis functions. The package further includes new reference datasets that dissect and catalogue HLA regions and HLA gene structures and provide insight into the organization of HLA pseudogenes and gene fragments. SSHAARP is an R package that describes the frequency distributions of individual HLA haplotypes, alleles and amino-acid motifs as global heatmaps. Allele frequency maps for more than 800 HLA alleles can be browsed using the GFB web and mobile applications. HLAtools and SSHAARP are available from the Comprehensive R Archive Network, and the GFB apps are available on GitHub.

Also flagged:SynthesisaminesesterhydrogenPolyamidescarbon
Journal Article 2025-09-14 No Snippets Ma Y, Zheng C, Raphaël Bréas D, Slor G, Molleyres APA, Liao Q, Stellacci F.
Show Full Abstract

Imination and amidation are two fundamental condensation reactions central to modern chemical synthesis, and devising energy-efficient ways to trigger them is highly relevant in advancing low-carbon manufacturing, with most approaches relying on the use of catalysts. Here, we revisit the dimethyl acetone-1,3-dicarboxylate (DADC) chemistry, and show that it can react with a broad range of small-molecule and macromolecular amines at moderate temperatures (80‒120 °C) in the absence of any catalysts. This represents a significant reduction in processing temperatures compared to traditional polycondensation methods for polyamide synthesis, which often require temperatures exceeding 230 °C. Mechanistic and model studies reveal that the high reactivity of DADC toward amines arises from its synergistic substituent effects; Specifically, the two ester groups in the symmetric β-position of DADC's ketone facilitate initial imination via conjugation and electron-withdrawing effects, generating a β-enamino intermediate. This β-enamine subsequently engages in intramolecular hydrogen bonding with one ester group, reducing steric hindrance on the remaining ester and thus promoting its amidation. Moreover, we demonstrate that the DADC-synthesized polyamides are thermally reprocessable, and chemically recyclable under either acidic or basic conditions at mild temperatures, and the chemical recycling is possible both for the neat polymer and its mixture with other plastics.

BTN3A3
Also flagged:Butyrophilin 3A1Systemic lupus erythematosusSLEautoimmune diseaseBTN3A1ferroptosis
Journal Article 2025-09-14 ✓ 1 Snippet Xu WD, Wang DC, Tang YY, Huang Q, Fu L, Chen YY, Yang LQ, Feng SY, Su LC, Huang AF.
In-Text Gene Mentions

…BTN3A1, BTN3A2, andBTN3A3, plays a key…

Show Full Abstract

Systemic lupus erythematosus (SLE) is an autoimmune disease of unknown origin. Recent evidence has linked butyrophilin 3A1 (BTN3A1) to immune dysregulation. This study was to elucidate the relationship of BTN3A1 in SLE. Expression of BTN3A1 in plasma and peripheral blood mononuclear cells from SLE patients and healthy controls explored the association between BTN3A1 and SLE. We found that BTN3A1 mRNA, plasma levels, and expression in CD4<sup>+</sup> T cells were significantly elevated in SLE patients. In BTN3A1 gene knock-in (BTN3A1<sup>KI</sup>) mice, inflammation and lupus-like manifestations occurred, including increased proportions of Th1, Th2, and Th17 cells, decreased Treg cells, elevated levels of inflammatory cytokines and anti-dsDNA antibodies, renal injury, and suppressed IL-38 serum levels. Intraperitoneal injection of IL-38 in pristane-treated BTN3A1<sup>KI</sup> mice notably alleviated these pathological changes. Mechanistic investigations revealed that CD4<sup>+</sup> T cells and the ferroptosis pathway were closely associated with the effects mediated by the BTN3A1-IL-38 axis. In vitro experiments showed that IL-38 stimulation reduced proliferation, apoptosis, and decreased the expression of ferroptosis-related proteins, Fe<sup>2</sup>⁺, glutathione, and malondialdehyde in CD4<sup>+</sup>BTN3A1<sup>+/+</sup> T and BTN3A1<sup>+/+</sup> Jurkat T cells. Overall, BTN3A1 plays a crucial role in SLE pathogenesis by regulating CD4<sup>+</sup> T cell function.

ZNFX1
Also flagged:gene expressioninnate immune responsebiomineralizationmetabolismimmune responsereproduction
Journal Article 2025-09-14 ✓ 2 Snippets Meng Y, Zhang Y, Wang W, Zhao Y, Qiu D, Li Z, Sun G, Cui C, Wang Q, Liu Z, Yang J.
In-Text Gene Mentions

…NFX1-type containing 1 (ZNFX1) recognizes and binds…

…innate immunity (STING1,ZNFX1, Mpeg1, etc.).…

Show Full Abstract

Ploidy level exerts profound influences on the phenotypic and physiological traits of <i>Crassostrea gigas</i>. Compared to diploids, triploids exhibit desirable characteristics such as sterility, a faster growth rate, and improved meat quality. In contrast, tetraploids often suffer from slow growth, yet the mechanisms underlying these polyploid-associated traits remain unclear. This study aimed to elucidate these mechanisms by comparing differences in growth-related phenotypes and gene expression among diploid, triploid, and tetraploid oysters. We identified 1533 differentially expressed genes (DEGs) between diploids and triploids, 946 DEGs between triploids and tetraploids, and 1326 DEGs between diploids and tetraploids. Through trend analysis, we clustered genes with similar expression changes across ploidy levels and conducted functional enrichment analysis on these gene clusters. The results revealed that genes associated with the innate immune response were significantly up-regulated in tetraploids, whereas genes related to biomineralization and metabolism were markedly up-regulated in triploids. These findings suggest that tetraploid oysters may mount a stronger innate immune response compared to diploids and triploids, while triploids demonstrate superior growth performance. This study provides valuable resources for investigating the functional aspects of genes related to polyploid phenotype differences.

Also flagged:Sugarsucralosemale infertilitysucrosediabetes mellitus type Itrichloro
Journal Article 2025-09-14 No Snippets Miranda N, Tkach VV, Barros AN, Martins-Bessa A, Gaivão I.
Show Full Abstract

Sugar and sucralose are frequently used together and separately in human food and beverages, which is the reason why studying their biological action on different organisms is really important. Nevertheless, the effect of highly concentrated sugar diet on male infertility is still under evaluation. The most important is that biological activity of sucralose, a chloroorganic synthetic sweetener, is highly persistent and difficultly altered in the environment, as its influence on the biological activity of other substances has not been completely elucidated yet. For this reason, in this work, sugar and sucralose-sugar mixtures, frequently used in beverages and other food products, influence <i>Drosophila melanogaster</i> behavior, longevity, reproductive performance, and genomic integrity is investigated. It has been demonstrated that an increase in sugar concentration promotes biological viability by enhancing prolificacy, lifespan, and locomotor performance. However, this only occurs up to a certain threshold concentration; beyond this, metabolic imbalance occurs. The presence of sucralose in solutions further augments the toxic effect, indicating high genotoxicity of the sweetener at doses over 0.5%, leading to significant DNA alterations and changing the <i>Drosophila melanogaster</i> behavior pattern. Therefore, either sugar or sucralose metabolic impact and toxicity is dose-related and their common presence in the solution might lead to the synergetic effect.

SERPINC1
Also flagged:chronic kidney diseasecognitive impairmentCIcognitive dysfunctionHDACE
Journal Article 2025-09-14 ✓ 4 Snippets Chandana S, M J, Suresh S, Sekhar M.
In-Text Gene Mentions

…dialysis care, routineACE-IIIscreening can facilitate…

…overall and domain-specificACE-IIIscores were significantly…

…assessed using theACE-IIIwas 40%, reflecting…

…still influence theACE-IIIeven after it…

Show Full Abstract

Background Among patients with chronic kidney disease (CKD) undergoing maintenance hemodialysis (HD), cognitive impairment (CI) is a significant yet often unknown side effect. This study used Addenbrooke's Cognitive Examination-III (ACE-III) to assess the prevalence and pattern of cognitive dysfunction in a South Indian HD population. It also aimed to determine the correlations with clinical and sociodemographic factors. Methods A cross-sectional study was conducted in a tertiary care facility in Chennai, Tamil Nadu, India, involving 175 patients undergoing maintenance HD for more than three months. The Indian English version of the ACE-III was used to evaluate cognitive function. Clinical and demographic data, including age, gender, education, duration of dialysis, comorbidities, and hemoglobin levels, were collected and analyzed. A p-value of <0.05 was considered statistically significant. Results Almost half of the patients, that is, 82 (46.9%), were classified as having CI with ACE-III scores of 60-80. Lower cognitive scores were significantly associated with greater age, lower educational levels, and longer time spent on dialysis (p<0.05). Conclusion In South India, CI is prevalent among HD patients, with memory and attention being the areas that are most affected. Age, level of education, and dialysis duration are contributing factors. In dialysis care, routine ACE-III screening can facilitate early detection and targeted interventions.

medRxiv 2025-09-14 Preprint (No Snippets API) Leitner DR, Walsh SR, Suzuki M, Desjardins M, Hannaford A, Sherman AC, Levine H, Carr L, Hammerness E, Osaki A, Sullivan E, Wang B, Balazs GI, Park Chang JB, Slater DM, Puri N, Kuehl CJ, Chen WH, Harris JB, Piantadosi S, Baden LR, Waldor MK.
Show Full Abstract

<h4>Background</h4> Current whole-cell killed oral cholera vaccines have utility but require multiple doses and have limited efficacy in young children. PanChol is a single-dose live-attenuated cholera vaccine derived from the current seventh pandemic Vibrio cholerae O1 strain. It co-expresses Inaba and Ogawa antigens, over-expresses the non-toxic cholera toxin B subunit, and is designed to minimize reactogenicity and prevent toxigenic reversion. We assessed safety and immunogenicity in a first-in-human trial. <h4>Methods</h4> In a dose-escalation phase at Brigham and Women’s Hospital (Boston, MA, USA), seven cohorts received one dose of 10 4 -10 10 colony-forming-units (CFU) PanChol. Two dosing groups of 2×10 7 and 2×10 8 were subsequently evaluated in a double-blind, placebo-controlled module. Fecal shedding was assessed until day five; safety and immunogenicity were monitored for six months. This trial is registered with ClinicalTrials.gov , NCT05657782 . <h4>Findings</h4> Between Dec 2022 and Feb 2025, 57 healthy adults were enrolled (dose-escalation: n=21; expansion n=28 vaccine and n=8 placebo recipients). PanChol was safe and well-tolerated at all doses, and no safety concerns were identified including no vaccine-related serious adverse events. In the dose-escalation phase, 81% (17/21) of participants had 39 unsolicited adverse events (AE). In the randomized module, at least one AE occurred in 64% (9/14) at 10 7 dose and in all 10 8 (13/13) and placebo (7/7) recipients. Most AEs were mild and only four were >grade 2 (all unrelated to vaccine). Shedding was detected in 44 recipients of ≥10 5 CFU, with no relationship to dose. All 45 vaccinees given ≥10 5 CFU seroconverted vibriocidal antibodies to both serotypes, with comparable mean titers across doses. IgM responses targeting Inaba or Ogawa polysaccharides were detected in 44 and 41 vaccinees respectively, and anti-toxin IgG responses were measured in 21 vaccinees. Antibody lymphocyte supernatant assays demonstrated mucosal IgA to these antigens and to colonization factor, TcpA. <h4>Interpretation</h4> A single oral dose of PanChol induced 100% vibriocidal seroconversion over a 100,000-fold dose range with no safety concerns. These findings support further development of PanChol as a new tool for cholera prevention, including studies in endemic settings and in children. <h4>Funding</h4> Wellcome Trust. <h4>Research in context</h4> <h4>Evidence before this study</h4> Cholera remains a global public health threat; killed oral cholera vaccines (OCVs) are important for control. However, they have limited efficacy in young children and require multiple doses for maximum efficacy. Live-attenuated OCVs, like natural infection, may induce protective immunity with a single dose. While other live-attenuated OCVs have been developed, none are WHO prequalified. We searched PubMed from inception to July 2025 for studies evaluating OCVs using the terms “live oral cholera vaccine trial O1”, yielding 25 non-review clinical trial articles. All tested live vaccines were derived from the extinct classical V. cholerae biotype or early El Tor biotype strains and were Inaba serotype. None were engineered to be resistant to reversion to toxigenicity. <h4>Added value of this study</h4> This first-in-human trial establishes that PanChol, a live-attenuated OCVs engineered from the current global pandemic El Tor V. cholerae O1 strain, is safe and immunogenic in an adult population in Boston, USA. Unlike previous live-attenuated vaccines, PanChol expresses both Inaba and Ogawa serotype antigens, is engineered for enhanced genetic stability, and resists toxigenic reversion. PanChol shedding, a marker for vaccine replication in the intestine, was detectable across doses 10 5 -10 10 CFU. Whole genome sequencing of PanChol isolated from vaccinees’ stool confirmed the vaccine’s genomic stability. Across all doses, 100% of vaccinees seroconverted to both Inaba and Ogawa serotypes, demonstrating potent immunogenicity. <h4>Implications of all the available evidence</h4> PanChol’s favorable safety profile and immunogenicity support additional development as a new agent for cholera control. Since PanChol is derived from the current pandemic strain, and natural infection stimulates more potent immunity to cholera than killed vaccines, PanChol may offer effective single-dose protection for children. It may be beneficial for reactive vaccination campaigns and for alleviating the global shortage of killed OCVs. These positive results warrant the establishment of the vaccine’s safety and immunogenicity in cholera endemic settings and age de-escalation trials.

Also flagged:localizationnucleotidestranslation initiationtranslationprotein modificationsubiquitin
Journal Article 2025-09-13 No Snippets Morrison EJ, Rissland OS.
Show Full Abstract

N-terminal proteoforms are protein variants with altered N termini that arise from RNA-driven processes, such as alternative promoter usage, splicing, and translation initiation site usage, as well as protein alterations, such as N-terminal processing and modifications. While our understanding of these mechanisms has grown substantially over the past decade, the interplay between RNA-driven processes and N-terminal proteoforms has received less attention. Here, we summarize recent advancements in our understanding of N-terminal proteoform creation, function, and usage. We highlight advances in alternative translation initiation site usage as well as newly discovered N-degron pathways, and we explore how differences in N termini via processing and modifications can give rise to different N-degrons: elements at the extreme N terminus of proteins that trigger turnover. Many regulatory pathways converge on the N terminus and corresponding nucleotides, and an integrated, multidisciplinary approach holds the potential to reveal new insights into gene regulation and function.

SOX6
Also flagged:chromatingene expressionPIK3R1
Journal Article 2025-09-13 ✓ 1 Snippet Li X, Su Y, Chen Q, Pu Y, He X, Jiang L, Ma Y, Zhao Q.
In-Text Gene Mentions

…regulatory elements ofSOX6and PIK3R1, which…

Show Full Abstract

<h4>Background</h4>Sheep (Ovis aries) are economically important agricultural animals, which provide meat, wool, and fur for humans. The growth and development of embryonic skeletal muscle are crucial for ovine muscle quality and yield. Increasing evidence has shown the three-dimensional (3D) genome structure is involved in gene transcriptional regulation and a variety of biological processes. Although the 3D genome structure in various species and cell types has been characterized, the dynamic remodeling of chromatin architecture during ovine skeletal muscle development remain poorly understood.<h4>Results</h4>Using Hi-C, RNA-seq, and ChIP-seq methods, we systematically explored the dynamics of the 3D genome structure, transcriptome, and epigenome in ovine skeletal muscle tissue from 90-day-old (D90) and 120-day-old fetuses (D120). Compared to the D90, the D120 exhibited a decrease in slow muscle fibers and an increase in fast muscle fibers. Additionally, we observed significant reorganization in chromatin compartments, topologically associating domains (TADs), and loop structures during muscle development. Notably, 18.07 % of A/B compartments switched, with A compartments transitioning to B compartments (9.09 %) and B compartments shifting to A compartments (8.98 %). The number of TADs was slightly lower in D120 (6937) compared to D90 (7036). Additionally, the number of loops increased from 7201 in D90 to 10,008 in D120. We also identified distal regulatory elements of SOX6 and PIK3R1, which play crucial roles in regulating sheep muscle development through loop structures. These findings provide valuable insights into the 3D genome architecture and its role in muscle development.<h4>Conclusions</h4>Our study provides the dynamic 3D chromatin structure of ovine middle and late fetuses skeletal muscle and revealed 3D genome structure is involved in gene expression of fetus skeletal muscle during development. In addition, we identified several potential cis-regulatory elements that regulate gene expression through long range chromatin interactions. We present the first 3D genome data for ovine fetuses skeletal muscle, providing valuable information for epigenome studies. This study offers novel insights into the regulatory mechanism underlying growth and development of ovine muscles.

PRDX6
Also flagged:breast cancerseleniumcancerzinccoppergene expression
Journal Article 2025-09-13 ✓ 1 Snippet Argente Del Castillo P, Morla-Barcelo PM, Martinez-Bernabe T, Sánchez Asís S, Delgado Rodríguez JA, Nadal-Serrano M, Llompart Alabern I, Roca P, Cordoba O, Sastre-Serra J, Bauça JM.
In-Text Gene Mentions

…SOD2, PRDX2, PRDX5,PRDX6, TXN, UCP2, and…

Show Full Abstract

<h4>Background</h4>Breast cancer is the most frequently diagnosed malignancy among women worldwide. Trace elements, such as selenium, play a crucial role in antioxidation and have gained interest in cancer research. This study aimed to assess the association between prediagnostic serum trace element concentrations and breast cancer risk, as well as their relationship with the expression of key antioxidant enzymes in leukocytes of ER-positive breast cancer patients.<h4>Methodology</h4>A cross-sectional study compared breast cancer patients to cancer-free individuals. Serum samples were analyzed for zinc, selenium, and copper concentrations, while leukocytes were isolated for the quantification of antioxidant-related gene expression, including SOD1, SOD2, PRDX2, PRDX5, PRDX6, TXN, UCP2, and UCP5. The predictive diagnostic capacity of identified trace elements and genes was assessed using receiver operating characteristic (ROC) curves, and correlations between gene expression and patient prognosis were evaluated.<h4>Results</h4>Breast cancer patients had lower serum selenium and zinc levels and reduced PRDX2, PRDX5, and UCP2 mRNA expression in leukocytes, whereas TXN, UCP5, and SOD2 were upregulated. Two signatures based on potential trace elements and genes showed high predictive accuracy (AUC = 0.97 and 0.98, respectively). Moreover, upregulated genes correlated with ER-positive tumors associated with poor prognosis.<h4>Conclusions</h4>These mRNA expression patterns and bioinformatic approaches, in combination with clinical variables and trace elements plasma levels, could give an approximation to create a signature to better understand the progression or aggressiveness of ER-positive breast cancer with a simple and cost-effective blood test.

Also flagged:IL-6RBP4Colorectal CancercancerobesityInterleukin-6
Journal Article 2025-09-13 No Snippets Żulicka M, Piątkowska D, Grzanka D, Bonowicz K, Jerka D, Gagat M, Antosik P.
Show Full Abstract

<b>Background/Objectives:</b> Colorectal cancer (CRC) is one of the leading causes of cancer-related mortality worldwide. Inflammation and metabolic dysregulation, particularly those related to obesity, have emerged as critical contributors to CRC progression. Interleukin-6 (IL-6) and retinol-binding protein 4 (RBP4), an adipokine involved in metabolic regulation, may be key mediators of these processes. This study aimed to evaluate the expression levels of IL-6 and RBP4 in CRC tissues and their associations with clinicopathological features and overall survival. Furthermore, in silico analyses were performed to explore the molecular networks and signaling pathways related to both biomarkers. <b>Methods:</b> Immunohistochemical staining of IL-6 and RBP4 was conducted in 118 CRC and matched adjacent normal tissues. Expression levels were assessed using the H-score system and correlated with clinical parameters. Survival analysis was performed using Kaplan-Meier curves. In silico analyses were based on RNA-seq data from TCGA and included pathway enrichment, gene co-expression, and protein-protein interaction networks. <b>Results:</b> IL-6 and RBP4 expression were significantly elevated in tumor tissue compared to adjacent normal mucosa. High IL-6 expression correlated with age and obesity measures, while RBP4 expression showed significant associations with pT stage, lymph node involvement, TNM stage, and obesity-related parameters. Kaplan-Meier analyses indicated shorter overall survival in patients with high IL-6 or RBP4 expression. In silico analysis confirmed upregulation of IL6 and RBP4 in CRC and highlighted immune-related pathways for IL-6 and developmental signaling for RBP4. <b>Conclusions:</b> Elevated expression of IL-6 and RBP4 in CRC tissue is associated with adverse clinical features and reduced survival, underscoring their potential role as prognostic biomarkers. These findings support the involvement of inflammation and metabolic dysfunction in CRC progression and suggest IL-6 and RBP4 as candidates for future targeted therapeutic approaches.

CA10
Also flagged:carbonateSODCATGSH-PXmetabolismCitrate
Journal Article 2025-09-13 ✓ 1 Snippet Ye W, Wang W, Hua J, Xu D, Qiang J.
In-Text Gene Mentions

…pathway enrichment analysis,CA10was enriched in…

Show Full Abstract

The utilization of saline-alkali water resources presents a promising approach for freshwater aquaculture. Red tilapia (<i>Oreochromis</i> spp.) exhibits moderate salinity tolerance, but its adaptation mechanism to alkaline conditions remains poorly understood. In the current study, five alkaline carbonate concentrations in a 60-day chronic stress experiment on red tilapia were evaluated. The experimental design included a control group (CA0, 0 mmol/L) and three treatment groups (CA10, 20 mmol/L; CA30, 30 mmol/L; and CA40 40 mmol/L). The results indicated that at alkaline carbonate concentrations exceeding 20 mmol/L, the gill filaments exhibited curling and deformation, the hepatocytes displayed migration, and tissue damage increased significantly. The gill's antioxidant capacity initially decreased and then increased, with severe gill injury in the CA40 group, leading to significantly reduced levels of SOD, CAT, and GSH-PX compared to the CA40 group (<i>p</i> < 0.05). Conversely, the enzymatic activities related to energy metabolism showed an opposite trend under alkaline carbonate stress. The transcriptome analyses of gill tissues across five groups identified significant alterations in key pathways, including the metabolic process (endocytosis, focal adhesion, PI3K-Akt signaling pathway, MAPK signaling pathway, and Citrate cycle (TCA cycle)), and immune responses (mTOR signaling and NOD-like receptor signaling pathways). Additionally, we screened 13 differentially expressed genes (DEGs) as potential regulators of alkaline stress and validated their expression levels using quantitative real-time PCR (qPCR). This study preliminarily elucidated the molecular mechanism of red tilapia in the physiological regulation process under chronic alkaline stress, and offers a theoretical foundation for breeding programs aimed at developing alkali-tolerant strains for aquaculture in alkaline water environments.

HTT
Also flagged:HDXBP1IRE1autosomal dominant neurodegenerative disorderpolyglutaminechorea
Journal Article 2025-09-13 ✓ 2 Snippets Makeeva VS, Sivkov AY, Zakian SM, Malakhova AA.
In-Text Gene Mentions

…exon of theHTTgene.…

…mutation in theHTTgene on ER…

Show Full Abstract

iPSCs and their derivatives are used to investigate the molecular genetic mechanisms of human diseases, to identify therapeutic targets, and to screen for small molecules. Combining technologies for generating patient-specific iPSC lines and genome editing allows us to create cell models with unique characteristics. We obtained and characterized three iPSC lines by reprogramming peripheral blood mononuclear cells of a patient with Huntington's disease (HD) using episomal vectors encoding Yamanaka factors. iPSC lines expressed pluripotency marker genes, had normal karyotypes and were capable of differentiating into all three germ layers. The obtained iPSC lines are useful for modeling disease progression in vitro and studying pathological mechanisms of HD, such as ER stress. A transgene of genetically encoded biosensor XBP1-TagRFP was introduced into the iPSCs to visualize ER stress state of cells. The study demonstrated that iPSC-derived medium spiny neurons develop ER stress, though the IRE1-mediated pathway does not seem to be involved in the process.

HTTSOX6
Also flagged:FOXC1NFKBIASLC38A2SLC6A20TFNFAT
Journal Article 2025-09-13 ✓ 2 Snippets Öztan G, İşsever H, Şahin L.
In-Text Gene Mentions

…repeat in theHTTgene, resulting in…

…(e.g., PDGFRA ,SOX6), providing a…

Show Full Abstract

Cortical transcriptional dysregulation is widespread in Huntington's disease (HD). We re-examined prefrontal Brodmann Area 9 (BA9) RNA-seq (GSE64810; 20 HD, 49 controls) using BH-FDR and GEO2R to obtain differential-expression statistics for downstream in silico integration. A compact, direction-aware 80-gene panel was assembled for visualization/ranking only, while inference relied on validated target sets and full-universe testing. At FDR < 0.05, we detected Up = 2923 and Down = 2448 genes (ratio 1.19), indicating a mild predominance of up-regulation. MIR219A2 was strongly down-regulated, and four experimentally validated targets (FOXC1, NFKBIA, SLC38A2, SLC6A20) overlapped the up-regulated core; as expected for <i>n</i> = 4, no GO/KEGG/Reactome term met FDR < 0.05, and STRING returned no high-confidence edges. Beyond the curated panel, we tested MIR219A2 (hsa-miR-219a-5p; hsa-miR-219a-1-3p; hsa-miR-219a-2-3p) targets against the full FDR-significant BA9 up-regulated universe. Two orthogonal, experimentally supported resources-miRTarBase functional assays and ENCORI/starBase CLIP-showed direction-consistent, FDR-controlled enrichment, with effect sizes and uncertainty reported in the main text, supporting a BA9-specific, MIR219A2-aligned association signal. On the TF axis, MSigDB C3:TFT (gene symbols) revealed significant over-representation of TF target sets among BA9-Up under the same BA9 expressed-gene background after BH-FDR (e.g., NFAT motifs, C/EBP, FOXA/HNF3), while TRRUST v2 applied to the MIR219A2 CLIP-BA9-Up subset provided target-level transparency. MIR219A2 enrichments were robust to composition sensitivity analyses (marker-excluded and neuron/glia-stratified backgrounds). Exploratory GO-Biological Process bubbles are shown for trend summarization only; no term met FDR < 0.05 in the primary analysis. All conclusions are analysis-only; no wet-lab or biofluid/peripheral assays were performed, and findings are BA9-specific-generalization to other regions remains hypothesis-generating.

STAU1
Also flagged:Reticulon-3host cellDENV infectionofReticulon 3non-structural protein 3
Journal Article 2025-09-13 ✓ 4 Snippets Bitazar R, Asaba CN, Shegefti S, Noumi T, Van Grevenynghe J, Islam ST, Labonté P, Bukong TN.
In-Text Gene Mentions

…RNA-binding protein Staufen1 (STAU1) is a cytosolic…

…Like RTN3,STAU1can interact with…

…replication complexes, butSTAU1functions primarily in…

…In DENV,STAU1might theoretically help…

Show Full Abstract

The dengue virus (DENV) exploits host cell exosome pathways to disseminate and evade immunity. However, the host factors enabling this process remain poorly defined. Here, we demonstrate that DENV infection robustly induces expression of the short isoform of Reticulon 3 (RTN3S) in hepatic (Huh7) and monocytic cells, and that RTN3S is a critical driver of infectious exosome biogenesis. RTN3S physically associates with double-stranded viral RNA and the DENV non-structural protein 3 (NS3) in infected cells, indicating its integration into the viral replication complex. Loss of RTN3 markedly reduced exosome production and the exosomal export of viral RNA and proteins, demonstrating that RTN3S is required for efficient exosome-mediated viral release. Conversely, overexpression of full-length RTN3S dramatically increased the release of infectious virus-containing exosomes; truncation of the RTN3S C-terminal domain abolished this enhancement, confirming the essential role of the C-terminus in RTN3S's pro-viral exosomal function. In DENV-infected monocytes, we observed a shift toward a CD16-positive intermediate phenotype, accompanied by the upregulation of genes involved in vesicle biogenesis and stress response. These infected monocytes also secreted higher levels of inflammatory cytokines. Similarly, monocytes from Dengue patients exhibited high RTN3 expression, which correlated with an expansion of intermediate (CD16<sup>+</sup>) subsets and enriched expression of vesicle trafficking machinery genes. These findings reveal a previously unrecognized mechanism by which DENV hijacks RTN3S to promote the formation of infectious exosomes, thereby facilitating viral dissemination and immune evasion. RTN3S thus represents a novel element of the Dengue pathogenesis and a potential target for host-directed antiviral strategies.

HTT
Also flagged:Huntington diseaseseleniumglutaminefibril formationbindingAggregation
Journal Article 2025-09-13 ✓ 5 Snippets Torricella F, Tugarinov V, Clore GM.
In-Text Gene Mentions

…huntingtin exon‐1 protein (httex1 ) fibrils…

…SeNP modulation ofhttex1 aggregation is…

…Fibril formation ofhttex1 entails two…

…SeNPs with twohttex1 protein constructs,…

…ex1 protein constructs,httex1 Q 7…

Show Full Abstract

Accumulation of huntingtin exon-1 protein (htt<sup>ex1</sup>) fibrils within neurons occurs when the polyglutamine region exceeds ≈35 residues and is responsible for Huntington disease, a fatal neurodegenerative condition. Recent work has shown that selenium nanoparticles (SeNP) are protective against neurodegeneration. Herein, the mechanistic basis for SeNP modulation of htt<sup>ex1</sup> aggregation is explored. Fibril formation of htt<sup>ex1</sup> entails two distinct processes on timescales differing by many orders of magnitude: prenucleation oligomerization on the microsecond timescale to generate a low population of transient tetramers that undergo slow (hours timescale) unimolecular conversion into elongation-competent nuclei, followed by elongation and secondary nucleation. Using NMR spectroscopy, fluorescence immunostaining, and transmission electron microscopy, the interaction of SeNPs with two htt<sup>ex1</sup> protein constructs, htt<sup>ex1</sup>Q<sub>7</sub> and htt<sup>ex1</sup>Q<sub>35</sub> containing 7 and 35 glutamine repeats, respectively, is studied. htt<sup>ex1</sup>Q<sub>7</sub> undergoes transient prenucleation tetramerization but remains largely monomeric over a period of weeks, while htt<sup>ex1</sup>Q<sub>35</sub> forms fibrils within a period of hours. It is shown that SeNPs reduce the rate of fibril formation substoichiometrically with respect to monomer by selectively targeting and binding with nanomolar affinity to the extendable ends of elongation-competent species of htt<sup>ex1</sup>Q<sub>35</sub>, thereby reducing the pool of free extendable ends.

bioRxiv 2025-09-13 Preprint (No Snippets API) Crowell HL, Llaó-Cid L, Frigola G, Gunz S, Ruano I, Lorden P, Ruiz M, Kulis M, Martin-Subero JI, Heyn H, Campo E, Pascual-Reguant A.
Show Full Abstract

The tonsil is a highly compartmentalized organ in which different microanatomical structures orchestrate designated (immune) functions. We use this already well-studied tissue to survey spatial molecular imaging data (CosMx SMI) for studying immune responses in native tissue context; and, to demonstrate the advantages of SMI for faithfully recapitulating cellular composition in direct comparison with single-cell RNA sequencing. While SMI data still poses many analytical challenges and lacks standardization, we established a versatile analysis pipeline focused on the profitable particularities of these data: considering organization (microenvironment), interactions (signaling), and function (higher-order structures) across scales. Specifically, we resolve ~ 2M cells into 52 subpopulations across immune and, in particular, structural compartments. Various spatial niches partition tonsillar tissue into architecturally and functionally distinct regions, which we characterize through cell-cell colocalization and communication analyses, while performing various non-standard analyses at the level of spatial features. These topological readouts may help elucidate where certain immunological processes occur (e.g., class switch recombination); and, where signaling pathways are active (e.g., TNF and galectin, which have been implicated in diverse lymphomas). In all, we provide an analytical framework for Spatial Immunology, and showcase alternative views that such techniques and concomitant computational approaches can bring on tissue composition and architecture.

bioRxiv 2025-09-13 Preprint (No Snippets API) Ye L, Gastaldi VD, Curto Y, Wildenburg A, Yu X, Hindermann M, Eggert S, Ronnenberg A, Wang Q, Butt UJ, Kawaguchi R, Geschwind D, Möbius W, Boretius S, Singh M, Nave K, Ehrenreich H.
Show Full Abstract

<h4>ABSTRACT</h4> Oligodendrocytes differentiate from oligodendrocyte progenitor cells (OPC) in early postnatal development, but some oligodendrogenesis is maintained throughout adulthood, where oligodendrocyte lineage dynamics may contribute to neuroplasticity, adaptive myelination, and myelin repair. Here, we studied the effect of erythropoietin (EPO) and its receptor (EPOR) on oligodendrocyte lineage dynamics employing murine hippocampus and its myelinated fibers as model region. Using multiple stage-specific markers and single-nuclei-RNA-seq data, we find that EPO stimulates all oligodendroglial lineage cells directly, driving differentiation/maturation. Differential gene expression analysis reveals multiple EPO-regulated mRNAs, including downregulated transcripts for GABA-A receptors, fitting the known inhibition of oligodendrocyte maturation by GABA. Importantly, analogous oligodendrocyte responses are seen when endogenous EPO expression in brain is stimulated by hypoxia. Mice lacking EPOR from mature oligodendrocytes show subtle deficiencies of adult myelination in hippocampal fimbria and mild working memory deficits. These gain- and loss-of-function experiments may further suggest EPO as clinically safe treatment for remyelination therapies.

Also flagged:Major Histocompatibility ComplexMHCpeptideDQB1amino acidinfectious disease
Journal Article 2025-09-12 No Snippets Fortier AL, Pritchard JK.
Show Full Abstract

Classical genes within the Major Histocompatibility Complex (MHC) are responsible for peptide presentation to T cells, thus playing a central role in immune defense against pathogens. These genes are subject to strong selective pressures including both balancing and directional selection, resulting in exceptional genetic diversity-thousands of alleles per gene in humans. Moreover, some allelic lineages appear to be shared between primate species, a phenomenon known as trans-species polymorphism (TSP) or incomplete lineage sorting, which is rare in the genome overall. However, despite the clinical and evolutionary importance of MHC diversity, we currently lack a full picture of primate MHC evolution. In particular, we do not know to what extent genes and allelic lineages are retained across speciation events. To start addressing this gap, we explore variation <i>across</i> genes and species in our companion paper (Fortier and Pritchard, 2025), and here we explore variation <i>within</i> individual genes. We used Bayesian phylogenetic methods to determine the extent of TSP at 17 MHC genes, including classical and non-classical Class I and Class II genes. We find strong support for ancient TSP in 7 of 10 classical genes, including-remarkably-between humans and old-world monkeys in MHC-DQB1. In addition to the long-term persistence of ancient lineages, we additionally observe rapid evolution at nucleotides encoding the proteins' peptide-binding domains. The most rapidly-evolving amino acid positions are extremely enriched for autoimmune and infectious disease associations. Together, these results suggest complex selective forces-arising from differential peptide binding-that drive short-term allelic turnover within lineages while also maintaining deeply divergent lineages for at least 31 million years in some cases.

TNFSF4
Also flagged:Cancercolorectal cancerdeathNAMPTepithelial-mesenchymal transitioninflammatory response
Journal Article 2025-09-12 ✓ 1 Snippet Yang L, Yang X, Fang C, Han J, Ji Z, Zhang R, Zhou S.
In-Text Gene Mentions

…LAIR1, NRP1, TNFRSF18,TNFSF4, and VTCN1 were…

Show Full Abstract

Accurate prognosis prediction in colorectal cancer (CRC) is essential for personalized treatment. Soluble mediators are promising predictive biomarkers for evaluating outcomes. We sourced transcriptome data of CRC (COAD+READ) from TCGA and GEO. Soluble mediator-related genes (SMRGs) were identified via GeneCards. Through univariate Cox and Lasso regression analyses, prognosis-related feature genes were determined. A prognostic model was created using multivariate Cox regression, categorizing patients into high-risk (HR) and low-risk (LR) groups based on the median riskscore. KEGG pathway enrichment analysis and GSEA were undertaken on groups. ssGSEA assessed immune cell scores, while ESTIMATE analysis evaluated stromal and immune cell scores along with tumor purity. The CellMiner database identified potential drugs for HR patients. Pearson correlation analysis revealed the relationship between mismatch repair (MMR) genes and model genes. We identified 10 SMRGs. Pearson correlation analysis indicated positive correlations among these genes. GO analysis showed that most feature genes were linked to binding functions. KEGG analysis revealed that the HR group was enriched in pathways like Basal cell carcinoma and Glycosaminoglycan biosynthesis. The ssGSEA indicated higher immune cell scores in the LR group, alongside lower stromal scores. LR group also exhibited a lower TIDE score and higher immunophenoscore. Drug sensitivity analysis suggested PF-4708671, PI-103, and XAV939 as potential treatments for HR patients. There was significant correlation between model gene and MMR genes. The CRC prognostic model based on SMRGs effectively predicts patient prognosis and guides treatment strategies.

PLCL1
Also flagged:mitochondrialmetabolismmitochondrial oxidative phosphorylationcomplex IVfatty acidaging
Journal Article 2025-09-12 ✓ 1 Snippet Weidenhamer CJ, Huang YH, Natua S, Kalsotra A, Hernández-Saavedra D.
In-Text Gene Mentions

Plcl1

Show Full Abstract

Exercise protects against age-related declines in skeletal muscle mass and function while improving overall health. Exercise can also prime long-term muscle health to enhance adaptations upon exercise retraining, a phenomenon termed muscle memory that remains largely understudied. To assess how prior endurance training elicits a lasting metabolic memory in skeletal muscle, we used C57BL/6 mice fed either a control (CD) or obesogenic diet [high-fat diet (HFD)] that underwent 4-wk training, detraining, and retraining periods. Our results show that exercise retraining attenuated weight gain and potentiated muscle growth, even with reduced voluntary running volumes. Training increased fiber size [fiber cross-sectional area (fCSA)], which disappeared with detraining and was recovered with retraining regardless of diet, pointing to a glycolytic-to-oxidative fiber shift. Transcriptomic analysis (bulk RNA-Seq) of the retrained muscle revealed a robust enhancement of mitochondrial oxidative phosphorylation (OxPhos) and mitoribosomal genes, paralleled by increases in OxPhos protein complex IV levels, higher long-chain fatty acid oxidative capacity [acyl-CoA dehydrogenase, long chain (ACADL)], and sustained citrate synthase activity 1 wk after retraining, reinforcing the optimization of mitochondrial metabolism. Although transcriptomic evidence revealed a major overlap between HFD- and CD-fed mice, discrepancies in protein abundance emerged, which point to an intricate regulation of mitochondrial programming that supports the muscle memory of growth. Our study identifies common and selective mechanisms by which the muscle memory of exercise overrides dietary challenges and promotes fiber hypertrophy, offering insight into potential mechanisms to leverage to promote healthy aging.<b>NEW & NOTEWORTHY</b> Here we provide evidence that exercise memory in skeletal muscle fine-tunes mitochondrial metabolism to respond to dietary challenges and support muscle growth. Using physiological, RNA sequencing, and biochemical approaches, we show that exercise retraining optimizes mitochondrial metabolism to increase fatty acid oxidative capacity. These findings enhance our understanding of how prior exercise primes muscle for enhanced adaptations, offering insights into strategies to promote healthy aging.

STAU1
Also flagged:Tissue developmentprotein modificationschemical modificationsamino acidshistonemethylation
Journal Article 2025-09-12 ✓ 1 Snippet Vikhe Patil K, Sanz NC, Mak KH, Yang W, Annusver K, Makkar J, Grommisch D, Lei L, Sharma P, Driskell RR, Kasper M, Genander M.
In-Text Gene Mentions

…sporter/trafficking proteins (STAU1and SNUT1) were…

Show Full Abstract

Posttranslational protein modifications have emerged as a mechanism regulating progenitor cell state transitions during tissue formation. Herein, we exploit the stereotyped hair follicle development to delineate the function of PADI4, an enzyme converting peptidylarginine to citrulline. Single-cell sequencing places <i>Padi4</i> in both progenitor and differentiated hair lineage cells and indicates that PADI4 acts to repress transcription during hair follicle development. We establish PADI4 as a negative regulator of proliferation, acting on LEF1-positive hair shaft committed progenitor cells. Mechanistically, PADI4 citrullinates proteins associated with mRNA processing and ribosomal biogenesis, and lack of PADI4 promotes protein synthesis and ribosomal RNA transcription in vivo. Characterizing key translational effectors, we demonstrate that PADI4 citrullinates the translational repressor 4E-BP1 and reveal a cross-talk between PADI4 activity and 4E-BP1 phosphorylation. This work sheds light on how posttranslational modifications affect progenitor cell states and tissue formation.

Also flagged:LRRK2bindingBIOPTIC B1leucine-rich repeat kinase 2Parkinson's diseasePD
Journal Article 2025-09-12 No Snippets Vinogradov V, Nguyen KT, Steshin S, Izmailov I, Doronichev A.
Show Full Abstract

The rapid expansion of chemical space presents significant challenges in identifying novel ligands for drug targets. Here, we introduce BIOPTIC B1, an ultra-high-throughput ligand-based virtual screening system capable of rapidly evaluating multi-billion-molecule libraries in minutes. In retrospective analyses across seven diverse drug targets, BIOPTIC B1 demonstrated performance comparable to state-of-the-art machine learning models, including Chemprop and Gradient Boosting. Prospectively, we applied BIOPTIC B1 to leucine-rich repeat kinase 2 (LRRK2), a high-priority drug target for Parkinson's disease. BIOPTIC B1 successfully identified multiple novel ligands binding both wild-type and G2019S-mutant LRRK2 with dissociation constants (K<sub>d</sub>) as low as 110 nM, directly from the Enamine REAL Space of 40 billion molecules. These findings highlight BIOPTIC B1 as a powerful tool for novel hit identification and scaffold hopping within ultra-large chemical space, offering significant advancements in virtual screening for drug discovery.

Also flagged:stimulator of interferon genesSTINGsensingtumortissue homeostasistransmembrane protein
Journal Article 2025-09-12 No Snippets Arora K, Sheehy TL, Schulman JA, Loken JR, Lehmann Z, Kimmel BR, McAtee C, Bharti V, Stone PT, Weaver AM, Tyska M, Pathak RK, Wilson JT.
Show Full Abstract

A promising class of stimulator of interferon genes (STING) agonists is the non-nucleotide, small molecule, dimeric amidobenzimidazoles (diABZI), which have recently been incorporated into polymer- and antibody-drug conjugates to improve pharmacokinetics and modulate biodistribution for disease-specific applications. These approaches have leveraged diABZI variants functionalized at the 7-position of the benzimidazole for conjugation and tunable drug release from carriers. However, since this position does not interact with STING and is exposed from the binding pocket when bound in an "open lid" configuration, we sought to evaluate the activity of macromolecular diABZI conjugates that lack stimuli-responsive release and are instead conjugated to polymers via a stable amide linker. By synthesizing stable mPEG-diABZI conjugates and <i>N</i>,<i>N</i>-dimethylacrylamide (DMA) homopolymers from a diABZI-functionalized reversible addition-fragmentation chain-transfer (RAFT) agent, we found that these conjugates could activate STING <i>in vitro</i> with similar kinetics to highly potent diABZI analogues. Our data indicate that although diABZI-DMA conjugates enter cells via endocytosis, they can still colocalize with the ER, suggesting that intracellular trafficking processes can promote the delivery of endocytosed macromolecular diABZI compounds to STING. Furthermore, we demonstrated the <i>in vivo</i> activity of these macromolecular diABZI platforms, which inhibited tumor growth to a similar extent as small molecule variants. In conclusion, we have described new chemical strategies for the synthesis of stable macromolecular diABZI conjugates with unexpected immunostimulatory activity─findings that have potential implications for the design of polymer-diABZI conjugates and further motivate investigation of endosomal and intracellular trafficking as an alternative route for STING activation.

Also flagged:porehyaluronic acidmyocardial infarctioncellmigrationtissue growth
Journal Article 2025-09-12 No Snippets Rodriguez-Rivera GJ, Sharma S, Maduka CV, Boyd S, Perry AR, Di Caprio N, Riley L, Miksch CE, Lee D, Segura T, Issadore D, Burdick JA.
Show Full Abstract

Granular hydrogels are emerging as an important class of scaffolds for biomedical applications, due to their injectability and pore structure to support cellular infiltration. Past research has primarily focused on spherical microgels, which allows limited control over granular hydrogel pore size and void volume fraction; however, investigation into microgels with higher aspect ratios has allowed even higher porosity. This study explores the impact of hyaluronic acid microgel aspect ratio (ranging from 3 to 5) on granular hydrogel porosity and cellular interactions. Both simulations and experimental results show increased void volume fractions and pore sizes in granular hydrogels formed from rod-like microgels when compared to volume-matched spherical microgels, which results in increased cellular invasion with an endothelial cell spheroid migration assay. Injection of the hydrogels into a confined space alters particle packing and void space, but porosity is still higher when rod-like microgels are used, which results in increased cellular invasion when injected subcutaneously. Finally, the highest aspect ratio microgels are used as injectable granular hydrogels to treat myocardial infarction in rats and show reduced infarct area and enhanced functional outcomes when compared to untreated controls. This work provides further insight into microgel shape considerations for engineered granular hydrogels.

HTT
Also flagged:neurological disordersWDFY3behavioralHDAlfyneurodegenerative diseases
Journal Article 2025-09-12 ✓ 1 Snippet Croce KR, Ng C, Pankiv S, Albarran E, Langfelder P, Ramos de Jesus A, Duncan GM, Wang N, Basile A, McHugh C, Litt NA, Li A, Friedman S, Cortes EP, Zody MC, Yang XW, Ding JB, Vonsattel JPG, Simonsen A, Housman DE, Wexler NS, Yamamoto A.
In-Text Gene Mentions

HTT

Show Full Abstract

The study of disease modifiers is a powerful way to identify patho-mechanisms associated with disease. Using the strong genetic traits of Huntington's disease (HD), we identified a rare, single-nucleotide polymorphism (SNP) in WDFY3 associated with a delayed age of onset of up to 23 years. Remarkably, the introduction of the orthologous SNP into mice recapitulates this neuroprotection, significantly delaying neuropathological and behavioral dysfunction in two models of HD. The SNP increases expression of the protein autophagy-linked Fab1, YOTB, Vac1, and EEA1 (FYVE) protein (Alfy), an autophagy adaptor protein for the clearance of aggregated proteins, whose ectopic overexpression is sufficient to capture the neuroprotective effects of the variant. Increasing Alfy expression protects not only against HD but also against the toxicity due to phospho-α-synuclein and AT8-positive accumulation. By combining human and mouse genetics, we have uncovered a pathway that protects against multiple proteinopathies, revealing a much-sought-after, shared therapeutic target across a broad range of neurodegenerative diseases.

Also flagged:oxygenmetabolismHuntington's diseaseHDneurodegenerative disorderPHP1
Journal Article 2025-09-12 No Snippets Wu Q, Yao M, Liu H, Kakazu A, Ouyang Y, Liu C, Li R, Yang F, Wang A, Surasinghe S, Gerochi D, Baldo B, Jahn S, Tang H, Lu H, Wei Z, Duan W.
Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a CAG-repeat expansion in exon-1 of the huntingtin gene. Currently, no disease-modifying therapies are available, with a significant challenge in evaluating therapeutic efficacy before clinical symptoms emerge. This highlights the need for early biomarkers and intervention strategies. Therefore, it is essential to develop and characterize accurate mouse models and identify early biomarkers for preclinical therapeutic development. In this study, we characterized the pathological progression of the heterozygous zQ175 neodeleted knock in (zQ175DN) mouse model across four age groups: 3, 6, 10, and 16 months to identify human translatable outcome measures. T2-relaxation-under-spin-tagging (TRUST) MRI was used to assess global CMRO<sub>2</sub>, while T2-weighted MRI was used to analyze regional brain volumes. Significant striatal volume loss was detected as early as 6 months of age, worsening progressively with age in the zQ175 DN mice, resembling HD progressive striatal atrophy. A decline in CMRO<sub>2</sub> was observed in 6-month-old zQ175 DN mice, with significant and progressive reductions in 10- and 16- months old HD mice. Additionally, PHP1-positive mutant huntingtin (mHTT) aggregates were detectable in the striatum and cortex of zQ175 DN mice at all four ages, with intranuclear localization prior to 6 months, transitioning to co-exist of intranuclear and increased extracellular aggregates in older zQ175 DN mice, suggesting that the localization of mHTT aggregates may reflect the severity of HD pathogenesis. Interestingly, plasma neurofilament light chain (NfL) protein levels were significantly elevated at 6 months of age and older zQ175DN mice. These findings provide valuable insights for selecting outcome measures in preclinical evaluations of HD therapies using the zQ175 DN mouse model.

Also flagged:Neurodegenerative Diseasesneurodegenerative disorderscentral nervous systemCNS) disordersmembranejunctions
Journal Article 2025-09-12 No Snippets Sun M, Qin F, Bu Q, Zhao Y, Yang X, Zhang D, Cen X.
Show Full Abstract

Neurodegenerative diseases present significant therapeutic challenges, primarily due to the restrictive nature of the blood-brain barrier (BBB), which limits drug delivery to the brain. While the BBB is crucial for protecting the brain from harmful substances, it also hinders the effectiveness of treatments for neurodegenerative diseases. Consequently, there is an urgent need for innovative drug delivery systems capable of bypassing the BBB to improve therapeutic outcomes. Exosomes, as endogenous nanoscale carriers, offer substantial promise for brain-targeted drug delivery. Their unique characteristics, including the ability to cross biological barriers, high biocompatibility, intrinsic targeting capacity, natural intracellular transport mechanisms, and robust stability, render them highly promising candidates for drug delivery in the treatment of neurodegenerative disorders. This review delves into various engineering strategies for exosome-mediated targeted drug delivery and provides an in-depth analysis of the structural and functional properties of the BBB under normal and pathological conditions. We emphasize the potential of exosomes as drug delivery vehicles for the central nervous system, particularly in addressing neurodegenerative disorders. Furthermore, we address the key obstacles to the clinical application of exosome-based therapies and propose future research directions aimed at optimizing these methods to develop more effective treatment strategies.

Also flagged:Mitochondrial DiseasesPathogenesismitochondrialphosphorylationoxygenmitophagy
Journal Article 2025-09-12 No Snippets Mei J, Ding P, Gao C, Zhou J, Li Z, Zhang C, Gao J.
Show Full Abstract

Mitochondrial diseases are a heterogeneous group of inherited disorders caused by pathogenic variants in mitochondrial DNA (mtDNA) or nuclear genes encoding mitochondrial proteins, culminating in defective oxidative phosphorylation and multisystem involvement. Key pathogenic mechanisms include heteroplasmy driven threshold effects, excess reactive oxygen species, disrupted mitochondrial dynamics and mitophagy, abnormal calcium signaling, and compromised mtDNA repair, which together cause tissue-specific energy failure in high demand organs. Recent advances have expanded the therapeutic landscape. Precision mitochondrial genome editing-using mitochondrial zinc finger nucleases, mitochondrial transcription activator-like effector nucleases, DddA-derived cytosine base editor, and other base editing tools-enables targeted correction or rebalancing of mutant genomes, while highlighting challenges of delivery and off-target effects. In parallel, metabolic modulators (e.g., coenzyme Q10, idebenone, EPI-743) aim to restore bioenergetics, and mitochondrial replacement technologies and transplantation are being explored. Despite these promising strategies, major challenges remain, including off-target effects, precise delivery, and ethical considerations. Addressing these issues through multidisciplinary research and clinical translation holds promise for transforming mitochondrial disease management and improving patient outcomes. By bridging the understanding of mitochondrial dysfunction with advanced therapeutic interventions, this review aims to shed light on effective solutions for managing these complex disorders.

DCC
Also flagged:CD55Extracellular VesiclesGlucoseagingDecay-accelerating factorscomplement regulator
Journal Article 2025-09-12 ✓ 1 Snippet Yue X, Liang S, Zhang H, Dai T, Wu J.
In-Text Gene Mentions

…that mutations inregulatory factors Ifactors I and…

Show Full Abstract

<h4>Background</h4>Extracellular vesicles (EVs) play a pivotal role in driving aging, serving as vehicles for the transmission of aging-related signals. Decay-accelerating factors (DAFs), also known as CD55, a crucial complement regulator, exhibits age-associated alterations, yet its expression on circulating EVs remains poorly characterized. This study aims to investigate differences in plasma EVs and CD55 positive EVs concentrations in younger and older adults, and explore their correlations with age and blood glucose levels.<h4>Methods</h4>In this study, 40 older adults (≥65 years) undergoing routine physical examinations at Beijing Jishuitan Hospital and 40 gender-matched younger adults (<65 years) were enrolled prospectively. Blood glucose levels were measured using the standard glucose oxidase method. Circulating EVs concentrations were quantified by flow cytometry, including circulating total EVs, endothelial EVs (EEVs), platelet EVs (PEVs), red blood cell EVs (REVs), lymphocyte EVs (LEVs), monocyte EVs (MEVs), neutrophil EVs (NEVs), white blood cell EVs (WEVs), and CD55-positive EVs.<h4>Results</h4>Compared to younger adults, older adults exhibited significantly lower concentrations of LEVs, MEVs, NEVs, and WEVs (<i>p</i> < 0.05). Concentrations of CD55 positive EVs, including CD55+EEVs, CD55+PEVs, CD55+LEVs, CD55+MEVs, CD55+NEVs, and CD55+WEVs, were markedly reduced in older adults (<i>p</i> < 0.05). Notably, CD55+PEVs showed the strongest negative correlation with age (r = - 0.6228, <i>p</i> < 0.001). Furthermore, significant inverse correlations were found between blood glucose levels and concentrations of CD55+EEVs (<i>p</i> = 0.001), CD55+PEVs (<i>p</i> = 0.006), CD55+LEVs (<i>p</i> < 0.001), CD55+MEVs (<i>p</i> = 0.001), and CD55+WEVs (<i>p</i> = 0.003).<h4>Conclusion</h4>Our findings indicate significant differences in plasma EVs subtypes between older and younger adults and demonstrate robust negative correlations between CD55+ EVs subtypes and both aging and elevated glucose levels. Thus, these results suggest CD55+ EVs as a critical contributor to metabolic disorders in aging, offering potential risk assessment and monitoring strategies in older populations.

HFE
Also flagged:Hereditary Hemochromatosis Type 2ADiabetesOsteoporosisjuvenile hemochromatosisironarthritis
Journal Article 2025-09-12 ✓ 4 Snippets Thulaseedharan A, Jabbar PK, Mosses S.
In-Text Gene Mentions

…Unlike classicHFE-hemochromatosis, which typica…

…Unlike classic HFE-hemochromatosis, which typically manifests…

…biochemical findings ofhemochromatosis[ 7 ].…

…also well-documented inhemochromatosisand may relate…

Show Full Abstract

Hereditary hemochromatosis type 2A (juvenile hemochromatosis) is a rare autosomal recessive disorder caused by mutations in the <i>HJV</i> gene. It results in severe systemic iron overload and multiorgan dysfunction, including endocrine and skeletal manifestations. A 32-year-old woman presented with secondary amenorrhea, progressive skin hyperpigmentation, arthritis, and poorly controlled diabetes. Evaluation revealed hypogonadotropic hypogonadism, elevated serum ferritin (>2000 ng/mL), transferrin saturation of 93.8%, and osteoporosis (lumbar spine T-score -3.3; femoral neck -3.7). Magnetic resonance imaging showed iron deposition in the pituitary gland, liver, pancreas, and heart. Genetic testing confirmed a homozygous <i>HJV</i> mutation (c.1063G > T, p.Asp355Tyr). Management included weekly therapeutic phlebotomy (target ferritin ∼50 ng/mL), a basal-bolus insulin regimen, estrogen-progestin hormone replacement, and calcium/vitamin D supplementation. After 3 months, skin pigmentation lightened, glycated hemoglobin dropped from 8.5% to 7.8%, ferritin fell to 1294 ng/mL, and menstrual cycles resumed. This case emphasizes the importance of suspecting juvenile hemochromatosis in young patients with unexplained hypogonadism, diabetes, or osteoporosis. Early diagnosis and multidisciplinary treatment can prevent irreversible organ damage and improve long-term outcomes.

Also flagged:TBCPMUC5ACMMP8lung diseasesTuberculosis
Journal Article 2025-09-12 No Snippets Marcantonio E, Woron AM, Whelen AC, Prisic S.
Show Full Abstract

<h4>Background</h4>Patients with pulmonary tuberculosis (TB) typically produce sputa, which are used to identify the pathogen. Sputum also contains host proteins that may aid in diagnosis. We hypothesized that sputa from TB patients will have unique proteomes when compared to other lung diseases.<h4>Methods</h4>Sputa were collected from 219 patients with suspected TB. Neutrophil-derived protein calprotectin (CP), which was used as a marker for lung damage, was quantified and compared between TB and non-TB groups. Three sputa with high or low CP from each group were selected and analyzed using label-free proteomics.<h4>Results</h4>There was no difference in CP amounts between TB and non-TB groups. However, TB samples had other differentially abundant neutrophil-associated proteins. Compared to low CP, samples with high CP had much smaller number of proteins that could differentiate between TB and non-TB groups. Only two proteins, MUC5AC and MMP8, were more abundant in TB samples, regardless of CP levels.<h4>Conclusions</h4>Our findings suggest that TB sputa may have unique proteomes that depend on CP levels, which should be further validated due to the small sample size. Therefore, controlled and more advanced TB may need a different set of biomarkers to reliably distinguish TB from other lung diseases.

DCC
Also flagged:Pancreatic Cancercell cyclecentrosometumorgene expressionKRAS
Journal Article 2025-09-12 ✓ 4 Snippets Sun Y, Hu T, Li Y, Li M.
In-Text Gene Mentions

…follow-up, tumor location,DCChistological subtype, history…

…95% CI: 0.2566–0.7980),DCCsubtype (HR =…

…history of radiotherapy,DCCsubtype, and residual…

…residual tumor, andDCChistological subtype (…

Show Full Abstract

<b>Background:</b> Centrosome amplification, a hallmark of cell cycle dysregulation, drives carcinogenesis through aneuploidy induction and invasive phenotype acquisition. In pancreatic adenocarcinoma-a malignancy characterized by profound genomic instability-the molecular circuitry of centrosome amplification remains enigmatic. Critical gaps persist in understanding its spatiotemporal dynamics in tumor microenvironment remodeling and therapy resistance. <b>Methods:</b> This study integrated centrosome amplification-related genes from TCGA and Genecards, established a prognostic risk model through univariate Cox regression-LASSO penalized Cox regression-multivariate Cox regression analyses, and validated it using GEO datasets. Single-cell sequencing analyses dissected transcriptional heterogeneity and intercellular communication networks, while spatially resolved transcriptomics unveiled spatiotemporal expression patterns and molecular regulatory mechanisms of core genes. With further experimental validation via PCR analysis of patient-derived tissue samples confirming key gene expression patterns. <b>Results:</b> This study identified 23 centrosome amplification-related prognostic genes in pancreatic adenocarcinoma, establishing <i>IFI27</i>, <i>KIF20A</i>, <i>KLK10</i>, <i>SPINK7</i>, and <i>TOP2A</i> as highly specific diagnostic and prognostic biomarkers. The constructed signature was established as an independent prognostic indicator correlating with aggressive clinicopathological characteristics and chemoresistance. Mechanistically linked to enhanced DNA repair capacity and accelerated cell cycle progression, also synergizes with KRAS mutational profiles. Tumor microenvironment analysis revealed significant associations with immunosuppressive. Single-cell resolution demonstrated cellular specificity of IFI27/KLK10 in ductal epithelial cells and fibroblasts, with intercellular communication networks exhibiting multidimensional regulatory features. Spatially resolved transcriptomics delineated tumor-region-specific expression patterns of core genes. While PCR validation on matched tumor/normal tissues confirmed significant differential expression of <i>IFI27</i>, <i>KIF20A</i>, <i>KLK10</i>, and <i>TOP2A</i>. <b>Conclusions:</b> This study deciphers the multidimensional clinic-molecular network orchestrated by centrosome amplification in PDAC, revealing its dual-pathogenic mechanism in fueling tumor aggressiveness through coordinated induction of genomic instability and immunosuppressive microenvironment reprogramming. These findings establish a translational framework for developing centrosome dynamics-based prognostic stratification and molecularly targeted therapeutic strategies.

OLFM4
Also flagged:Wntβ-Catenininflammatory responseNecrotic enteritisinfectionsynthesis
Journal Article 2025-09-12 ✓ 2 Snippets Deng H, Cheng S, Fan J, Hao H, Fang D, Li W, Wang Q.
In-Text Gene Mentions

…( Lgr5 ,Olfm4, and Sox9…

…SOX9 , andOLFM4), goblet cell…

Show Full Abstract

The objective of our study was to verify the intervention effect of <i>Bacillus amyloliquefaciens</i> SC06 on NE by constructing a <i>C. perfringens</i>-induced intestinal damage mouse model. A total of 40 mice were randomly assigned to four treatments: CON (basal diet), CP (basal diet + <i>C. perfringens</i>), SC06 + CP (basal diet + SC06 + <i>C. perfringens</i>) and SC06 (basal diet + SC06). Our findings indicated that SC06 supplementation was effective in maintaining the integrity of the intestinal barrier, enhancing the antioxidant capacity of the intestine, reducing the generation of an inflammatory response, and suppressing enterocyte apoptosis in the presence of <i>C. perfringens</i>. Furthermore, SC06 supplementation enhanced the prefoliation of intestinal stem cells (ISC) and prompted their differentiation into goblet cells and Paneth cells. Moreover, our findings indicate that SC06 promotes the proliferation of <i>C. perfringens</i>-induced jejunum organoids and the expression of genes and proteins associated with ISC differentiation and regeneration. The mechanism by which SC06 modulates ISCs has been validated, and the results align with those obtained in vivo. In conclusion, the findings demonstrated that SC06 stimulates the proliferation and differentiation of ISCs through the activation of the Wnt/β-catenin signaling pathway, thereby accelerating epithelial regeneration and repair.

HTT
Also flagged:polyphenolsfibrilsneurodegenerative diseasesfibril formationbindingAlzheimer
Journal Article 2025-09-12 ✓ 5 Snippets Zuccon G, Darnal A, Longo E, D'Aronco S, Boselli E, Orlando P, Ceccon A.
In-Text Gene Mentions

…exon 1 protein (httex1 ), responsible…

…exon 1 protein (httex1 ) as…

…Figure 1A ,httex1 aggregation proceeds…

…kinetic modeling ofhttex1 aggregation, we…

…experimental strategies onhttex1 aggregation that…

Show Full Abstract

Misfolding and aggregation of intrinsically disordered proteins into amyloid fibrils are central to neurodegenerative diseases such as Parkinson's, Alzheimer's, and Huntington's. Increasing evidence suggests that transient, low-populated oligomeric intermediates, rather than mature fibrils, are key cytotoxic species. Natural polyphenols have shown promise as amyloid inhibitors, though their mechanisms of action remain unclear due to the complexity of early aggregation. This perspective explores how solution-state NMR can quantitatively assess inhibitor mechanisms. Building on recent literature elucidating the aggregation mechanisms of the huntingtin exon 1 protein (htt<sup>ex1</sup>), responsible for Huntington's disease, we propose a kinetic framework that integrates early reversible oligomerization with downstream fibril formation and models the impact of small-molecule binding at distinct stages of the pathway. We show that monomer sequestration and inhibition of elongation-competent nuclei produce distinct aggregation profiles, resolvable through global fitting of NMR and kinetic data. This mechanistic insight enables classification of inhibitors by target stage-monomeric, oligomeric, or fibrillar-and demonstrates how polyphenols serve as a biologically relevant case study for applying this general NMR-driven framework to the design of small-molecule amyloid inhibitors.

OLFM4
Also flagged:extracellularvesiclesleishmaniasisvisceral leishmaniasisVLinfection
Journal Article 2025-09-12 ✓ 3 Snippets Torres A, Montero-Calle A, Lozano-Rendal M, Sánchez C, Bernardo L, Solana JC, San Martin JV, Barderas R, Moreno J, Carrillo E.
In-Text Gene Mentions

…sin-9 (MYH9), olfactomedin-4 (OLFM4), 14-3–3 protein zeta/delta…

…of olfactomedin 4 (OLFM4).…

…ITGB1, YWHATZ, MYH9,OLFM4, CD9, and FN1)…

Show Full Abstract

<h4>Introduction</h4>The most severe form of leishmaniasis, visceral leishmaniasis (VL), lacks standardized validated early predictors of treatment success or relapse. To distinguish between active infection and successful treatment, we searched for protein biomarkers in plasma-derived extracellular vesicles (EVs).<h4>Methods</h4>The proteomic profiles of EVs from immunocompetent patients with active VL (n=12) or 1, 3, or 6 months after completing a standard treatment regimen (n=12 each) were analyzed by LC-MS/MS. Six candidate biomarkers were further tested by ELISA in whole plasma.<h4>Results</h4>132 human proteins were differentially expressed in active VL- versus successfully treated patients. Pathway analysis identified pathogenic mechanisms associated with VL and pathways related to effective cure. SAA is directly measurable in whole plasma and exhibits differential expression levels, emerging as a promising, easily measurable, non-specific prognostic biomarker for patient management. Remarkably, we also identified <i>Leishmania</i> spp. proteins in EV samples, indicating a new source of parasite biomarkers in human samples.<h4>Conclusion</h4>Plasma EVs contain protein biomarkers that can be used to monitor the response to treatment, some of which are detectable in whole plasma after 1 month of treatment. Our study also provides a proteomic landscape of plasma EVs involved in VL, offering insight into the pathogenesis of this complex disease.

PRDX6
Also flagged:SeleniumcobaltferroptosisSLC7A11GPX4HIF-1α
Journal Article 2025-09-12 ✓ 5 Snippets Xu P, Liu F, Jiang S, Cai B, Ye C, Sun Y, Wang Y, Shen J, Zhou H, Liu Y.
In-Text Gene Mentions

…μM SeNPs upregulatedPRDX6and GPX4, thereby…

…activation of thePRDX6/GPX4 pathway…

…SeNPs upregulatePRDX6, enhancing the defense…

…primary antibodies, includingPRDX6(Servicebio, GB113124 ;…

…Peroxiredoxin 6 (PRDX6) is a novel…

Show Full Abstract

The long-term implantation of metallic joint prostheses results in the release of cobalt nanoparticles (CoNPs), leading to local and even systemic toxic reactions that pose risks to patient health. Previous studies have suggested that CoNPs-induced cytotoxicity may be associated with excessive oxidative stress and ferroptosis. Selenium nanoparticles (SeNPs), known for their anti-ferroptotic properties, have potential as surface coatings for metal implants. This study aims to investigate the role and mechanisms of SeNPs in inhibiting ferroptosis and mitigating cobalt-induced toxicity, thereby offering a mechanistic rationale for improving the material properties of metal prostheses. We first conducted molecular analyses on tissue samples from patients undergoing hip joint revision surgery, which revealed activation of ferroptosis-related signaling pathways. We then synthesized SeNPs capable of effective internalization by bone marrow-derived stromal cells (BMSCs). In vitro, 400 μM CoNPs induced hallmark features of ferroptosis in BMSCs by suppressing the SLC7A11/GPX4 axis and activating the HIF-1α/HO-1 signaling pathway. In contrast, treatment with 40 μM SeNPs upregulated PRDX6 and GPX4, thereby attenuating ferroptosis and preserving cell viability. Finally, intra-articular injection of SeNPs into mouse knee joints significantly alleviated CoNPs-induced local toxic responses, including synovial hyperplasia and cartilage destruction. Overall, this study provides novel insights into the ferroptosis-dependent mechanisms underlying CoNPs-induced toxicity and highlights the therapeutic potential of SeNPs as a detoxifying agent. These findings offer a mechanistic foundation for targeted detoxification strategies and inform the development of improved metal prosthetic materials.

HTT
Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disordercytosineadenineguanine
Journal Article 2025-09-12 ✓ 2 Snippets Nowakowski P, Waska G, Misztela-Lisiecka E, Miernik-Skrzypczak M, Strozak A.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, typically presenting…

…in the huntingtin (HTT) gene, resulting in…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by an expanded cytosine-adenine-guanine (CAG) trinucleotide repeat in the huntingtin (HTT) gene, typically presenting with progressive motor, cognitive, and psychiatric symptoms between the ages of 30 and 50 years. This study presents the clinical features of a 48-year-old woman with a three-year history of progressive memory impairment, concentration difficulties, and weakness. Neurological examination revealed psychomotor slowing, mild cognitive impairment, right-sided apparent weakness due to impaired motor coordination, right-sided hypoesthesia, hyperreflexia, mild dysarthria, extrapyramidal gait disturbances, and occasional choreiform movements. Laboratory tests excluded infectious and metabolic causes, and brain magnetic resonance imaging (MRI) showed no acute lesions. Electroencephalography (EEG) revealed focal slow waves in the left posterior region without epileptiform discharges, and neuropsychological assessment indicated borderline dementia with depressive-anxiety symptoms. Genetic testing confirmed a pathogenic CAG repeat expansion in the HTT gene (47 repeats in the affected allele), establishing the diagnosis of HD according to European Molecular Quality Network (EMQN) guidelines. This case emphasizes the importance of integrating clinical evaluation, neuropsychological assessment, and genetic testing in patients with progressive cognitive and motor symptoms, particularly when there is a positive family history.

HFE
Also flagged:PanhypopituitarismPituitary Macroadenomapituitary macroadenomassepsishyponatremiaanterior pituitary hormone deficiencies
Journal Article 2025-09-12 ✓ 1 Snippet Dalili M, Rahman SS, Kamal S, Zakir Z.
In-Text Gene Mentions

…histiocytosis, sarcoidosis orhemochromatosismay damage the…

Show Full Abstract

Panhypopituitarism is uncommon but clinically significant, most often caused by pituitary macroadenomas. Its presentation can be subtle and nonspecific, which may lead to misdiagnosis, particularly in elderly patients. We report the case of an 85-year-old woman admitted with fever, abdominal pain, hypotension, and acute confusion, initially managed as sepsis. Laboratory tests revealed hyponatremia and multiple anterior pituitary hormone deficiencies. Magnetic Resonance Imaging (MRI) confirmed a pituitary macroadenoma with suprasellar extension. The patient showed rapid clinical improvement after initiation of hydrocortisone and levothyroxine replacement. Ophthalmologic evaluation demonstrated preserved visual function, supporting conservative management. This case underscores the importance of considering endocrine causes, especially adrenal insufficiency due to pituitary disease, in elderly patients presenting with sepsis-like symptoms. Early recognition and timely hormone replacement can be life-saving.

HTT
Also flagged:oligonucleotidesCNS disordersp53neurological diseasescyclopropylenegene expression
Journal Article 2025-09-12 ✓ 1 Snippet Kuroda T, Yoshioka K, Mon SSL, Katsuyama M, Sato K, Isogai E, Yoshida-Tanaka K, Iwata-Hara R, Yamaguchi T, Obika S, Yokota T.
In-Text Gene Mentions

…and Huntingtin (HTT) mRNAs, as…

Show Full Abstract

Antisense oligonucleotides (ASOs) represent an attractive therapeutic approach for CNS disorders. However, ASO-induced neurotoxicity, especially late-onset adverse events, remains a crucial issue, leading to failures in clinical applications. This study aims to determine the neurological features and molecular mechanisms of the late-onset neurotoxicity and provide strategies to overcome this toxicity. We initially established neurobehavioral assays of rodent neurotoxicity with intracerebroventricular and intrathecal injections of various gapmer-type ASOs and a neuronal cytotoxicity analysis. Through both <i>in vitro</i> and <i>in vivo</i> assessments, we identified a site-specific chemical modification, 5'-cyclopropylene (5'-CP), that significantly reduced late-onset neurotoxicity without compromising knockdown activity, providing useful insights into structure-toxicity and structure-activity relationships in ASOs targeting CNS. Additionally, we revealed a toxicity-related mechanism as an elevation of p53-regulated transcripts and paraspeckle protein mislocalization in neuronal cells, which is alleviated through the chemical modifications. Our findings provide mechanistic insights into late-onset ASO-induced neurotoxicity and highlight the potential of optimized chemical modifications to expand the therapeutic window for clinical applications targeting intractable neurological diseases.

HFE
Also flagged:IronbindingHBanemiairon-deficiency anemiaIDA
Journal Article 2025-09-12 ✓ 1 Snippet Ghalandarpoor-Atta SN, Ghalandarpoor-Attar SM, Tayebi Tafreshi SMM, Ghorbani A.
In-Text Gene Mentions

…chronic kidney disease,hemochromatosis, or inflammatory disorders),…

Show Full Abstract

<h4>Background</h4>Iron deficiency during pregnancy poses a significant risk to maternal and fetal health, especially among anemic women whose physiological demand for iron increases drastically. This study aimed to evaluate the serum iron profile of non-anemic pregnant women at the time of delivery and to identify associated demographic and clinical factors.<h4>Materials and methods</h4>Conducted at Baharloo Hospital between 2022 and 2023, this cross-sectional study involved pregnant women who met the primary inclusion criteria of being non-anemic in the first and second trimesters and were admitted for scheduled labor. Serum ferritin, serum iron, and total iron-binding capacity (TIBC) were quantified, alongside comprehensive analysis of hemoglobin (HB) levels and red blood cell (RBC) indices. Data on demographic characteristics, and prenatal supplement usage were collected through medical records and analyzed using SPSS software.<h4>Results</h4>This study of 120 pregnant women (mean age 28.85 ± 6.34 years, gestational age 39.21 ± 0.8 weeks) found that most participants regularly consumed iron (93.33%) and multivitamin supplements (81.67%), with average serum iron levels of 98.73 ± 20.7 μg/dL at 3rd trimester. Key correlations included negative associations between gestational age and maternal age (r=-0.26) and between ferritin and gestational age (r=-0.18), while hemoglobin and hematocrit levels were strongly positively correlated. Logistic regression identified lower second-trimester hemoglobin as protective against delivery-time anemia (OR=0.29), and lower second-trimester MCV significantly predicted iron-deficiency anemia (IDA) (OR=0.70), when adjusting for age, gestational age, BMI, supplements or iron usage, multiparity, and educational level.<h4>Conclusion</h4>As iron and multivitamin supplementation did not significantly reduce anemia risk and it was basically related to second-trimester MCV and hemoglobin, higher thresholds of these markers should be assigned as the goal of anemia prevention programs for Iranian women.

DCC
Also flagged:AneurysmVascular MalformationsnitrogenpolymerasepathogenesisIA
Journal Article 2025-09-11 ✓ 2 Snippets Karasozen Y, McAvoy M, Parada CA, Busald T, Kondaboina S, Osbun JW, Ruzevick J, Levitt MR, Gonzalez-Cuyar LF, Kim LJ, Dorschner MO, Ferreira M.
In-Text Gene Mentions

…the following genes:DCC, ATXN1L ,…

…DNA repair (<i>SFB3</i>, <i>DCC</i>, <i>MLH1</i>), extracellu…

Show Full Abstract

<h4>Background</h4>Subarachnoid hemorrhage from ruptured saccular intracranial aneurysms (IAs) is fatal in ≈50% of cases. Significant effort has been devoted to identifying the molecular pathogenesis of IAs to develop new therapies to treat or halt the progression of IAs.<h4>Methods</h4>Paired deep whole-exome sequencing was performed on the walls of sporadic IAs in a discovery set of 11 sporadic IAs from 10 unrelated patients and matching peripheral blood DNA. Somatic alterations unique to the IA tissue were characterized. Variants were validated with gene-targeted deep next-generation sequencing. The genetic landscape of a validation cohort of 68 IAs was analyzed by targeted deep sequencing of all altered genes detected in the discovery cohort as well as other genes associated with aneurysm formation.<h4>Results</h4>Whole-exome sequencing revealed somatic variants in 7 of the 11 IA walls. These somatic variants were found at low allele frequencies (AFs), ranging from 2% to 19% at a consistent AF range within a sample, suggesting a cell-based population. Most coding somatic variants found were missense (91%). Notably, 2 IAs from 1 patient were included in the discovery set and both harbored unique somatic variants, not detected in the other sample. Similarly, a different aneurysm from a patient in the discovery cohort was included in the larger validation cohort and revealed a unique genotype. Saccular aneurysms harbored somatic variants in genes falling into several functional categories including angiogenesis (<i>PKD1</i>, <i>XDH</i>), DNA repair (<i>SFB3</i>, <i>DCC</i>, <i>MLH1</i>), extracellular matrix (<i>FBN1</i>, <i>COL4A1</i>, <i>COL4A5</i>, <i>MMP8</i>) and cancer genes (<i>ERBb4</i> and <i>PTCH1</i>). Deep targeted sequencing of these genes in a larger cohort by next-generation sequencing revealed other somatic variants in 11 of the same genes in IA walls from 10 unrelated patients, similarly in low AFs. Another custom designed next-generation sequencing panel identified 7 other somatic variants in genes associated with IA formation. Notably, there were no common somatic variants among the 2 aneurysms from the same patient.<h4>Conclusions</h4>Saccular IAs harbor somatic low AF variants in coding genes predicted to alter protein function. AFs occurred in a similar range within and between samples, suggesting a cell- based population driving the pathogenesis of saccular IAs. Recurrent variants in genes known to be involved in IAs such as <i>COL4A5</i> as well as novel genes (eg, <i>ERBb4</i> and <i>PABIR3</i>) also suggests a new frontier for further research.

Also flagged:high blood pressurebreast cancerasiaticoside-Dasiaticosiderotenoneoxygen
Journal Article 2025-09-11 No Snippets Jiang J, Han R, Ren H, Yao Y, Jiang W.
Show Full Abstract

<h4>Introduction</h4><i>Centella asiatica</i> (L.) Urb., a traditional medicinal plant widely distributed in Southeast Asia, has been demonstrated to possess significant neuroprotective effect. However, the pharmacological and molecular mechanisms of <i>C. asiatica</i> (CA) in treating neurological diseases remain to be further explored. This review synthesizes evidence on CA's pharmacokinetics, antioxidant/anti-inflammatory mechanisms, and therapeutic potential in various neurological disorders.<h4>Discussion</h4>Evidence shows CA can mitigate oxidative stress, inflammation, mitochondrial dysfunction, and neuronal apoptosis-key mechanisms underlying these conditions. In epilepsy models, asiatic acid suppresses glutamate release, improves synaptic and mitochondrial function, and reduces neuronal damage. In neurodegenerative diseases, CA extracts enhance memory and cognitive functions by activating antioxidant response pathways and protecting hippocampal mitochondria from oxidative stress. CA extracts also display anticonvulsant effects without major toxicity. Against Bisphenol A-induced neurotoxicity, CA alleviates oxidative stress and inflammation while restoring mitochondrial function. For radiation-induced brain injury, CA improves cognition and memory <i>via</i> antioxidant pathways and anti-inflammatory effects. In cerebral ischemia-reperfusion injury, asiaticoside reduces oxidative stress and neuroinflammation through NOD2/MAPK/NF-κB pathway modulation and microglial regulation. Recent research suggests that CA also plays a significant role in alleviating symptoms of anxiety and depression. The plant's active components have been found to regulate neurotransmitter activity, reduce oxidative stress, and modulate the hypothalamic-pituitary-adrenal (HPA) axis.<h4>Conclusions</h4>CA demonstrates broad neuroprotective potential, offering multi-target benefits with relatively low toxicity. These findings support its development as a novel therapeutic agent for neurological disorders. Further clinical research is warranted to confirm safety, optimize dosing, and translate preclinical results into effective human treatments.

PRDX6
Also flagged:cDNASstSnap25Cyp51Hmgcs1Dgat2
Journal Article 2025-09-11 ✓ 1 Snippet Jung H, Urban JF, Rosa BA, Mitreva M.
In-Text Gene Mentions

Prdx6( P adj…

Show Full Abstract

Trichuriasis, caused by the parasitic nematode <i>Trichuris trichiura</i>, affects 429-508 million people worldwide. Although the early phase of whipworm infection is crucial for establishing infection, its underlying molecular mechanisms remain unclear. In this study, we examined and compared host transcriptional responses during early infection of the mouse whipworm, <i>T. muris</i>, using first-stage larvae (L1) in proximal colons from <i>in vivo</i> models (B6 and STAT6-deficient mice) and <i>in vitro</i> colonoid models. Differentially expressed genes and functional enrichment analysis revealed that while the "neurotransmitter release" pathway was uniquely upregulated in B6 mice, the "lipid metabolism" pathway was commonly modulated in both mice and colonoids, which may have implications for intestinal epithelial function during infection. Enrichment of alternative splicing (AS) events in splicing-related pathways across all models highlighted the need for further investigation into AS regulation mechanisms and its functional roles during early infection. Temporal transcriptomic profiling of L1 <i>T. muris</i> in colonoids identified six clusters representing fundamental molecular pathways associated with parasite development and adaptation. Utilizing dual-RNA sequencing from infected colonoids, we conducted host-parasite co-expression analysis, identifying correlated gene pairs, including a negative correlation between <i>T. muris</i>-secreted serine proteases and mouse genes involved in metabolism and epithelial cell functions. These findings provide valuable insights into the dynamic transcriptional regulation during early L1 <i>T. muris</i> infection <i>in vivo</i> and <i>in vitro</i>, offering a resource for comparative studies in whipworm infection models. In conclusion, this comparative study serves as a starting point for deeper investigation into molecular mechanisms underlying early whipworm infection and opens up new opportunities for exploring host-parasite interactions.IMPORTANCETrichuriasis, caused by the parasitic nematode <i>Trichuris trichiura</i>, remains a major public health concern, particularly in resource-limited regions. Current anthelmintics show suboptimal efficacy against whipworm infections, highlighting the critical need for novel therapeutic strategies. This study provides a comparative framework by integrating transcriptional profiles from <i>in vivo</i> and <i>in vitro</i> models during the early infection phase of <i>T. muris</i>, a mouse model for <i>T. trichiura</i>. Through this approach, we demonstrate the potential of proximal colonoids as a model for investigating key aspects of host-parasite interactions, including epithelial invasion and transcriptional dynamics, during early <i>T. muris</i> infection. By employing dual-RNA sequencing, we not only characterize temporal gene expression dynamics of first-stage larvae but also identify host-parasite co-expression profiles, thereby shedding light on molecular pathways that may underlie infection establishment and host responses. This work builds upon and solidifies previous findings about the utility of organoid models for investigating early whipworm infection while providing a foundational resource for exploring intervention strategies targeting the initial stages of infection.

CACNA1E
Also flagged:light-activated cation channel rhodopsin2depolarizationMembraneCD34Ca 2+
Journal Article 2025-09-11 ✓ 1 Snippet Zawieja SD, Pea GA, Broyhill SE, Patro A, Bromert KH, Norton CE, Kim HJ, Sivasankaran SK, Li M, Castorena-Gonzalez JA, Drumm BT, Davis MJ.
In-Text Gene Mentions

…and we notedCacna1e, Fgf14 ,…

Show Full Abstract

Collecting lymphatic vessels (cLVs) exhibit spontaneous contractions with a pressure-dependent frequency, but the identity of the lymphatic pacemaker cell is still debated. Here, we combined immunofluorescence and scRNAseq analyses with electrophysiological methods to examine the cellular constituents of the mouse cLV wall and assess whether any cell type exhibited morphological and functional processes characteristic of pacemaker cells. We employed inducible Cre mouse models to target-specific cell populations including CkitCreER<sup>T2</sup> to target interstitial cells of Cajal-like cells, PdgfrβCreER<sup>T2</sup> to target pericyte-like cells; PdgfrαCreER<sup>TM</sup> to target CD34<sup>+</sup> adventitial cells; and Myh11CreER<sup>T2</sup> to target lymphatic muscle cells (LMCs) directly. These inducible Cre lines were crossed to the fluorescent reporter <i>Rosa26<sup>mTmG</sup></i>, the genetically encoded Ca<sup>2+</sup> sensor GCaMP6f, and the light-activated cation channel rhodopsin2 (ChR2). Only LMCs consistently, but heterogeneously, displayed spontaneous Ca<sup>2+</sup> events during the diastolic period of the contraction cycle, and whose frequency was modulated in a pressure-dependent manner. Further, optogenetic depolarization with ChR2 induced propagated contractions only in LMCs. Membrane potential recordings in LMCs demonstrated that the rate of diastolic depolarization significantly correlated with contraction frequency. These findings support the conclusion that LMCs, or a subset of LMCs, are responsible for mouse cLV pacemaking.

PRDX6
Also flagged:Chronic liver diseaseliver cancercancerdeathchronic hepatitis Balcohol
Journal Article 2025-09-11 ✓ 1 Snippet Crouchet E, Schaeffer E, Oudot MA, Moehlin J, Gadenne C, Jühling F, El Saghire H, Fujiwara N, Zhu S, Akter Rasha F, Durand SC, Charlot A, Ponsolles C, Martin R, Brignon N, Del Zompo F, Meiss-Heydmann L, Parnot M, Hamdane N, Heide D, Hetzer J, Heikenwälder M, Felli E, Pessaux P, Pochet N, Zoll J, Cunniff B, Hoshida Y, Mailly L, Baumert TF, Schuster C.
In-Text Gene Mentions

…was observed forPrdx6, which is…

Show Full Abstract

Treatment options for advanced liver disease and hepatocellular carcinoma (HCC) are limited, and strategies to prevent HCC development are lacking. Aiming to discover therapeutic targets, we combined genome-wide transcriptomic analysis of liver tissues from patients with advanced liver disease and HCC and a cell-based system predicting liver disease progression and HCC risk. Computational analysis predicted peroxiredoxin 2 (PRDX2) as a candidate gene mediating hepatocarcinogenesis and HCC risk. Analysis of tissues from patients with HCC confirmed a perturbed expression of PRDX2 in cancer. In vivo perturbation studies in mouse models for hepatocarcinogenesis driven by metabolic dysfunction-associated steatohepatitis showed that specific Prdx2 KO in hepatocytes improved metabolic liver functions, restored AMPK activity, and prevented HCC development by suppressing oncogenic signaling. Perturbation studies in HCC cell lines, a cell line-derived xenograft mouse model, and patient-derived HCC spheroids revealed that PRDX2 also mediates cancer initiation, cancer cell proliferation, and survival through its antioxidant activity. Targeting PRDX2 may therefore be a strategy to prevent HCC development in metabolic liver disease.

Also flagged:Diabetestype 2 diabetesglucoseinsulinchronic diseaseCOVID-19
Journal Article 2025-09-11 No Snippets Mahfuza U, Meyerowitz-Katz G, Rasheed RA, Dick H, Maberly G, Jayaballa R.
Show Full Abstract

<h4>Background</h4>The COVID-19 pandemic catalyzed the adoption of digital technologies in health care. This study assesses a digital-first integrated care model for type 2 diabetes management in Western Sydney, using continuous glucose monitoring (CGM) and virtual Diabetes Case Conferences (DCC) involving the patient, general practitioner (GP), diabetes specialist, and diabetes educator at the same time.<h4>Objective</h4>This study aims to assess the effectiveness of the innovative diabetes clinics in Western Sydney.<h4>Methods</h4>In 2020, a total of 833 new patients with type 2 diabetes were seen at Western Sydney Diabetes (WSD) clinics. An early cohort of 103 patients was evaluated before and after participation in virtual DCC, incorporating CGM data analysis, digital educational resources, and remote consultations with a diabetes multidisciplinary team. Assessments were conducted at baseline and 3-4 months post DCC.<h4>Results</h4>The integration of CGM and virtual consultations significantly improved glycemic control. Hemoglobin A<sub>1c</sub> (HbA<sub>1c</sub>) levels decreased notably from 9.6% to 8.2% (average reduction of 1.4%; 95% CI 1.03-1.82; P<.001). Time in range (TIR) as measured by CGM increased substantially from 46% to 73% (95% CI 20-32; P<.001), and the glucose management indicator (GMI) improved from 7.9% to 7% (average reduction of 0.9%; 95% CI 0.55-1.2; P<.001). Despite no significant change in the total daily insulin dose, the proportion of patients on insulin therapy rose from 27% to 39% (P<.001), indicating more targeted and effective diabetes management.<h4>Conclusions</h4>Our findings demonstrate the effectiveness of a digitally enabled integrated care model in managing type 2 diabetes. The use of CGM technology, complemented by virtual DCCs and digital educational tools, not only facilitated better disease management and patient engagement but also empowered primary care providers with advanced management capabilities. This digital approach addresses traditional barriers in diabetes care, highlighting the potential for scalable, technology-driven solutions in chronic disease management.

TNFSF4
Also flagged:kidney renal clear cell carcinomamalignant tumortumorNK) cell inhibitory receptorcell proliferationHLA-E
Journal Article 2025-09-11 ✓ 1 Snippet Zhang J, Li X, Yu X, Jiang W, He X, Mei C, Ou C.
In-Text Gene Mentions

…CD27 (TNFRSF7), andTNFSF4(OX40L); and antigen…

Show Full Abstract

Kidney renal clear cell carcinoma (KIRC) is a highly aggressive malignant tumor, and its occurrence and progression are influenced by tumor microenvironment (TME). CD159A, a natural killer (NK) cell inhibitory receptor, has emerged as a critical immune checkpoint in TME. We conducted a comprehensive multi-omics analysis of CD159A expression, prognostic significance, and functional enrichment in KIRC. Additionally, quantitative real-time PCR (qRT-PCR) and immunohistochemistry (IHC) were employed to perform CD159A expression in the Xiangya KIRC validation cohort. Furthermore, in vitro experiments were evaluated through cell proliferation, colony formation, and flow cytometry (FC) analysis of apoptosis in KIRC cell lines. Our study found that CD159A expression was significantly upregulated in KIRC tissues compared to normal tissues, as confirmed by TCGA data and the Xiangya KIRC validation cohort. In machine learning analyses, the biological significance of the regulatory network risk factors of the CD159A-HLA-E pathway is immunosuppressive receptors or abnormal antigen presentation that may promote immune escape. Elevated CD159A levels were observed in NK cells and CD8<sup>+</sup> T cells infiltrating KIRC by single-cell RNA sequencing analysis. A positive correlation between CD159A and NK/CD8<sup>+</sup> T cell infiltration was observed, and higher CD159A expression in KIRC patients receiving anti-PD-1/PD-L1 immunotherapy was associated with improved outcomes. In vitro experiments demonstrated that silencing CD159A significantly suppressed proliferation, colony formation and induced apoptosis in KIRC cells. Our research highlights the critical role of CD159A as a key immune checkpoint in KIRC progression and immune evasion, suggesting its potential as a prognostic and immunotherapy biomarker.

HTT
Also flagged:amino acidsaminoacyl-tRNA synthetasebindingcytoplasmcarbonamino acid
Journal Article 2025-09-11 ✓ 1 Snippet Yang S, Jin S, Zhang M, Chen Y, Guo Y, Hu Y, Wolynes PG, Xiao H.
In-Text Gene Mentions

Htt

Show Full Abstract

Fluorescent protein fusions with environmentally sensitive fluorophores have been widely used to investigate changes in the protein microenvironment. Unfortunately, these techniques often rely on bulky fluorescent proteins or tags to the N terminus or C terminus of the target protein, which can disrupt the behavior of the target protein and may limit their ability to investigate microenvironment changes with high spatial resolution. Here we develop a strategy to visualize microenvironment changes of protein substructures in real time by genetically incorporating environment-sensitive noncanonical amino acids (ncAAs) containing rotor-based fluorophores at specific positions of the target protein. Through computational redesign of aminoacyl-tRNA synthetase, we successfully incorporated these rotor-based ncAAs into several proteins in mammalian cells. Precise placement of these ncAAs at specific sites of proteins enables the detection of microenvironmental changes around individual residues during events such as aggregation, clustering, cluster dissociation and others.

PTGIS
Also flagged:gene expressionRCAhostlumenpolyglycolic acidECM proteins
Journal Article 2025-09-11 ✓ 5 Snippets Williams AR, Nash KM, Kirkton RD, Levitan GS, Daubert MA, Whitney SA, Naegeli KM, Benkert AR, McCartney SL, Prichard HL, Niklason LE, Kypson AP.
In-Text Gene Mentions

…PGI 2 synthase (PTGIS), and endothelin-1 (ET-1)…

…of eNOS andPTGIScould decrease proliferation…

…both eNOS andPTGIS( Figures 5A…

PTGISexpression was also…

…40 and constitutivePTGIS41 with a…

Show Full Abstract

Coronary artery bypass graft (CABG) uses the patient's internal mammary artery and saphenous vein; however, unavailable or poor quality autologous vessels limit revascularization. This study addresses the critical need for alternative CABG conduits by evaluating a small diameter acellular tissue-engineered vessel ([sdATEV], 3.5 mm) in a primate model. Adult baboons (n = 5) underwent CABG to the right coronary artery (RCA) with an sdATEV. Patency, diameter, and cardiac function were longitudinally assessed by computed tomography angiography. All sdATEVs remained patent throughout the 6-month study. Computed tomography angiography demonstrated that the distal sdATEV diameter gradually remodeled to approximate the smaller baboon RCA. Histology and spatial transcriptomics revealed that sdATEVs recellularized with host endothelial and smooth muscle cells including a quiescent neomedia layer with gene expression patterns similar to the RCA, indicating that host cell ingrowth from the bypassed coronary artery regulates sdATEV diameter. These results suggest that the sdATEV is a durable alternative CABG conduit.

OLFM4
Also flagged:CD8HIV infectionlipidlipid dropletsfatty aciddeath
Journal Article 2025-09-11 ✓ 1 Snippet Das Adhikari U, Froehle LM, Pipkin AN, Baharlou H, Linder AH, Shah P, Hussey A, Zhang Q, Nyquist S, Khwaled S, Chi F, Goswami S, Sedhain S, Hussain S, Diefenbach TJ, Read BJ, Kim B, Irvine D, Asowata O, Ladinsky M, Bjorkman P, Madela F, Kader S, Shalek AK, Ghebremichael M, Kloverpris H, Ringel AE, Yilmaz ÖH, Kwon DS.
In-Text Gene Mentions

Olfm4

Show Full Abstract

A hallmark of HIV infection is disruption of intestinal barrier integrity that persists in people with HIV (PWH) despite treatment with antiretroviral therapy (ART). This disruption is central to HIV disease progression, yet the causes remain incompletely understood. We report a mechanism by which immunometabolic defects in colon-resident CD8<sup>+</sup> T cells in PWH lead to intestinal epithelial apoptosis and disruption of intestinal barrier integrity. We show that in PWH, these cells downregulate the lipid sensor peroxisome proliferator-activated receptor-γ (PPARγ), which results in reduced intracellular lipid droplets, impaired fatty acid oxidation, and acquisition of lipids by CD8<sup>+</sup> T cells from intestinal epithelial cells, which then contributes to epithelial cell death. Our findings indicate that HIV-associated immunometabolic dysregulation of colon CD8<sup>+</sup> T cells leads to loss of intestinal epithelial homeostasis. These results identify potential strategies to reduce comorbidities in PWH and other disorders with disrupted intestinal barrier integrity.

Also flagged:extracellulardopaminenucleusbehavioralbindingaction potentials
Journal Article 2025-09-11 No Snippets Lodder B, Kamath T, Savenco E, Röring B, Siegel M, Chouinard JA, Lee SJ, Zagoren C, Rosen P, Hartman I, Timmins J, Adan R, Tian L, Sabatini BL.
Show Full Abstract

Dynamic signaling by extracellular and intracellular molecules impacts downstream pathways in a cell-type-specific manner. Fluorescent reporters of such signals are typically optimized to detect fast, relative changes in concentration of target molecules. They are less well suited to detect slowly changing signals and rarely provide absolute measurements. Here, we developed fluorescence lifetime photometry at high temporal resolution (FLIPR), which utilizes frequency-domain analog processing to measure the absolute fluorescence lifetime of genetically encoded sensors at high speed but with long-term stability and picosecond precision. We applied FLIPR to investigate dopamine signaling in functionally distinct striatal subregions. We observed higher tonic dopamine levels in the tail of the striatum compared with the nucleus accumbens core and differential and dynamic responses in phasic and tonic dopamine to appetitive and aversive stimuli. Thus, FLIPR reports fast and slow timescale neuronal signaling in absolute units, revealing previously unappreciated spatial and temporal variation even in well-studied signaling systems.

ZNFX1
Also flagged:E3 ubiquitin ligasesubiquitinproteasomeE3 ligasescancerprotein degradation
Journal Article 2025-09-11 ✓ 1 Snippet Ebadi P, Stratton CM, Olsen SK.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

The ubiquitin-proteasome system (UPS) is a central regulator of protein turnover and signaling, with E3 ubiquitin ligases conferring substrate specificity and chain-type control. Recent advances have revealed new mechanistic classes of E3 ligases and expanded our understanding of their roles in disease, including cancer, neurodegeneration, and immune dysfunction. These insights have fueled the development of targeted protein degradation strategies that harness the UPS to eliminate disease-associated proteins. Approaches such as proteolysis-targeting chimeras (PROTACs), molecular glues, and antibody-based degraders are broadening the druggable proteome. Despite this progress, key challenges remain, including limited E3 ligase diversity, difficulties in degrader delivery, and resistance mechanisms. This review outlines recent advances in E3 ligase biology and therapeutic degradation, emphasizing opportunities to expand and refine UPS-targeted interventions.

Also flagged:organizationWNTNotchBone Morphogenetic ProteinBMPFibroblast Growth Factor
Journal Article 2025-09-11 No Snippets Nguyen AL, Lausten MA, Boman BM.
Show Full Abstract

The goal of this review is to expand our understanding of how the cellular organization of the normal colonic crypt is maintained and elucidate how this intricate architecture is disrupted during tumorigenesis. Additionally, it will focus on implications for new therapeutic strategies targeting Epithelial-Mesenchymal Transition (EMT). The colonic crypt is a highly structured epithelial unit that functions in maintaining homeostasis through a complex physiological function of diverse cell types: SCs, transit-amplifying (TA) progenitors, goblet cells, absorptive colonocytes, Paneth-like cells, M cells, tuft cells, and enteroendocrine cells. These cellular subpopulations are spatially organized and regulated by multiple crucial signaling pathways, including WNT, Notch, Bone Morphogenetic Protein (BMP), and Fibroblast Growth Factor (FGF). Specifically, we discuss how these regulatory networks control the precise locations and functions of crypt cell types that are necessary to achieve cellular organization and homeostasis in the normal colon crypt. In addition, we detail how the crypt's hierarchical structure is profoundly perturbed in colorectal cancer (CRC) development. Tumorigenesis appears to be driven by LGR5+ cancer stem cells (CSCs) and the hyperproliferation of TA cells as colonocytes undergo metabolic reprogramming. Goblet cells lose their secretory phenotype, while REG4+ Paneth-like cells foster SC niches. Tumor microenvironment is also disrupted by upregulation of M cells and by tumor-immune crosstalk that is promoted by tuft cell expansion. Moreover, the presence of enteroendocrine cells in CRC has been implicated in treatment resistance due to its contribution to tumor heterogeneity. These cellular changes are caused by the disruption of homeostasis signaling whereby: overactivation of WNT/β-catenin promotes stemness, dysregulation of Notch inhibits differentiation, suppression of BMP promotes hyperproliferation, and imbalance of FGF/WNT/BMP/NOTCH enhances cellular plasticity and invasion. Further discussion of emerging therapies targeting epithelial markers and regulatory factors, emphasizing current development in novel, precision-based approaches in CRC treatment is also included.

Also flagged:HydroxyprolineEpigallocatechin-3-GallateWound Healingextracellularpolysaccharidepullulan
Journal Article 2025-09-11 No Snippets Ding P, Sun Y, Jiang G, Nie L.
Show Full Abstract

Immunoregulation is an emerging treatment strategy to promote wound healing by modulating the local immune system at the wound site. In this study, an extracellular matrix biomimetic and polysaccharide-based hydrogel was engineered to regulate the wound immune environment through Michael-type addition between maleimidyl pullulan and chitosan modified with hydroxyproline. The proposed hydrogel exhibited favorable injectable and self-healing properties, which facilitated the full coverage of irregularly shaped wounds. A natural polyphenol, epigallocatechin-3-gallate (EGCG), was incorporated into hydrogels, which thereby exhibited excellent biocompatibility, good reactive oxygen species (ROS) scavenging ability, anti-inflammatory activity, and antibacterial properties against <i>S. aureus</i> and <i>E. coli</i>. Furthermore, evaluations of a full-thickness skin defect mice model showed that the hydrogel with EGCG effectively alleviated the inflammatory response by reducing pro-inflammatory cellular infiltration and down-regulating the inflammatory cytokine TNF-α, while up-regulating anti-inflammatory cytokine IL-10. Notably, a faster wound healing rate was also achieved by the better promotion effect of the hydrogel on increasing the formation of re-epithelialization, granulation tissue generation, collagen deposition, and angiogenesis. Therefore, our immunoregulatory strategy showed great potential in the design of biomaterials for wound management.

ABT1
Also flagged:chromosomebindingABP1pre-rRNA-eighteenS factor 2
Journal Article 2025-09-11 ✓ 5 Snippets Davydova ED, Kotov AA, Chernizova AV, Yakovleva EY, Olenina LV.
In-Text Gene Mentions

…addition to RNA-bindingABT1-like domain preservation, all…

…ional Diversification of Esf2/ABT1Family Genes in…

…the nuclear proteinABT1(activator of basal…

…nuclear protein ABT1 (activator of basal transcription 1of basal transcription…

…molecular function ofABT1is described as…

Show Full Abstract

Gene duplications are considered to be the major evolutionary resource of novel functions. The gene family <i>Esf2/ABP1</i> is conserved in metazoan organisms from yeast to humans. Here we performed a search and characterization of <i>Esf2/ABP1</i> homologs in the <i>Drosophila</i> genus. Whereas in the majority of <i>Drosophila</i> species this gene family is represented by only a single gene, in the <i>melanogaster</i> and <i>suzukii</i> subgroups recurrent gene duplications arose, providing 47 homologous genes located on the X chromosome. To study the evolutionary history of duplicates, we performed phylogenetic, functional domain, and tissue-specific expression analyses. We revealed a male-specific and testis-biased transcription pattern of duplicated copies in <i>Drosophila melanogaster</i> and <i>Drosophila sechellia</i> compared to ubiquitous expression of the parental gene. The amplification of 21 repeated paralogs within the heterochromatic piRNA cluster resulted in the ovarian-specific transformation of these repeats into piRNAs in <i>D. melanogaster.</i> In three species of the <i>suzukii</i> subgroup, <i>Esf2/ABP1</i> genes evolved with domain diversification: in addition to RNA-binding ABT1-like domain preservation, all homologous proteins acquired expanded intrinsically disordered regions. By studying the duplicated copies of the <i>Esf2/ABP1</i> family in <i>Drosophila</i>, we offer insight into how novel gene functions emerge and are maintained, contributing to life's diversity and complexity.

SUDS3
Also flagged:OxaliplatinColorectal AdenocarcinomaPlatinumcolorectal cancerredoxoxygen
Journal Article 2025-09-11 ✓ 1 Snippet Morshneva A, Gnedina O, Fedotova K, Yartseva N, Aksenov N, Igotti M.
In-Text Gene Mentions

…romatin remodeling (hsa03082),polycomb repressiverepressive complex (hsa03083),…

Show Full Abstract

Platinum-based chemotherapy resistance remains a critical barrier in colorectal cancer (CRC) treatment. In this study, cytogenetic karyotyping was combined with transcriptomic profiling (RNA-seq) to elucidate resistance mechanisms by comparing two CRC cell lines: oxaliplatin-sensitive HCT116 and its resistant derivative HCT116 oxpl-R. Karyotyping unveiled tetraploidization and extensive genomic rearrangements in resistant cells, accompanied by prominent transcriptomic changes: 1807 differentially expressed genes (1216 upregulated and 519 downregulated). Pathway enrichment highlighted altered redox homeostasis and metabolic adaptation. Specifically, HCT116 oxpl-R cells exhibited elevated reactive oxygen species (ROS) production and enhanced energy metabolism. These findings establish a direct association between structural genomic alterations, transcriptional rewiring, and functional phenotypes in platinum resistance, providing a framework for targeting metabolic vulnerabilities in refractory CRC.

HFE
Also flagged:FibrosisMetabolic Dysfunction-Associated Steatotic Liver Diseasemitochondrialcoppermetabolic liver diseasescirrhosis
Journal Article 2025-09-11 ✓ 1 Snippet Shabaneh S, Berry EM, Imam A, Suki M, Salhab A, Khalaileh A, Safadi R.
In-Text Gene Mentions

…patitis, autoimmune hepatitis,hemochromatosis, alcoholic liver disease),…

Show Full Abstract

<b>Background:</b> Copper is an essential trace element involved in antioxidant defense and mitochondrial function. Evidence suggests that copper homeostasis may also influence metabolic liver diseases. We investigated the association between hepatic copper levels (HCLs) and liver-related outcomes among patients with Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). <b>Methods:</b> In this retrospective cohort study, we analyzed 215 MASLD patients who underwent liver biopsy with copper quantification. Patients were categorized based on hepatic copper content; normal < 50 vs. high ≥ 50 μg/g dry tissue (165 vs. 50 patients, respectively). The primary outcomes were progression in non-invasive fibrosis score (FIB-4) and incidence of clinical events (cirrhosis, liver transplantation, cardiovascular events or death) during a median follow-up of 4.9 ± 4.2 years. Multivariable linear and logistic regression models were adjusted for metabolic and demographic confounders. <b>Results:</b> Both liver copper groups shared similar baseline characteristics. High hepatic copper levels independently predicted higher FIB-4 scores at the end of follow-up in the fully adjusted linear regression model (β = 0.41; 95% CI: 0.05-0.76; <i>p</i> = 0.026). Logistic regression confirmed that high HCLs were associated with significant FIB-4 deterioration (OR = 41.3; 95%; <i>p</i> = 0.008). Kaplan-Meier analysis revealed significantly reduced overall survival among patients with high HCLs (Log-Rank <i>p</i> = 0.034), and multivariable Cox regression showed a markedly increased mortality risk (HR = 18.51; 95%; <i>p</i> = 0.032). Subgroup analyses highlighted greater risk among females, patients with diabetes or dyslipidemia, and individuals of Arab ethnicity. <b>Conclusions:</b> Elevated hepatic copper levels are associated with long term worsened liver fibrosis and higher mortality in MASLD. These findings support hepatic copper as a potential nutritional biomarker for risk stratification. Further studies are needed to explore copper modulation as a therapeutic target in MASLD.

Also flagged:Major Depressive Disordertransporterscytochrome P450CYP2D6CYP2C19metabolism
Journal Article 2025-09-11 No Snippets Bertollo AG, Mocelin R, Ignácio ZM.
Show Full Abstract

<b>Purpose:</b> Genetic polymorphisms within specific genes play a role in both the genetic predisposition to Major Depressive Disorder (MDD) and the variation observed in responses to antidepressant treatments. Pharmacogenetics examines how these polymorphisms affect medication response. This review highlights significant disparities in the pharmacogenetic influences on antidepressant response, with a focus on ethnic and sex-based differences. <b>Methods:</b> This review synthesizes findings from a comprehensive literature search conducted between 2000 and 2025. It utilized databases such as PubMed, Scopus, and Web of Science, using search terms including "pharmacogenetics", "antidepressants", "Major Depressive Disorder", "CYP450", "neuroplasticity", and "genetic variations". This review integrates pharmacogenetics with neurotransmitters and their transporters, neuroplasticity, growth factors, and the cytochrome P450 family, providing promising insights for personalized MDD treatment strategies. We analyzed and synthesized findings from over 50 relevant studies, focusing on those with a clear emphasis on genetic associations with antidepressant efficacy and adverse effects. <b>Results:</b> Pharmacogenetic analysis facilitates personalized antidepressant prescriptions by identifying key genetic variants that influence treatment outcomes. Specifically, variations in CYP2D6 and CYP2C19 can significantly impact drug metabolism and tolerability. A high percentage of patients with non-normal metabolizer phenotypes are predisposed to adverse drug reactions or ineffective responses. Furthermore, this review identifies significant ethnic and sex-based disparities in treatment response. For example, the L allele of the 5-HTTLPR polymorphism confers a higher likelihood of response and remission following SSRI treatment in white people compared to Asians. Additionally, in women, specific 5-HTTLPR polymorphisms have a more pronounced influence on mood and MDD pathophysiology, with a significant reduction in mood in response to tryptophan depletion. <b>Conclusions:</b> Integrating pharmacogenetic insights, encompassing genetic factors, neurotransmitter pathways, neuroplasticity, and the influence of ethnicity and sex, is crucial for developing personalized antidepressant treatment strategies. This will ultimately optimize patient recovery and minimize adverse effects.

HTT
Also flagged:β-CaryophylleneNeurodegenerative diseasesxanthohumolneurodegenerative disorderslipidbehavioral
Journal Article 2025-09-11 ✓ 1 Snippet Ivanova S, Dzhakova Z, Todorova V, Boyuklieva R, Simeonov P, Katsarov P.
In-Text Gene Mentions

…PSEN1 , andHTTgenes), inflammation, and…

Show Full Abstract

Neurodegenerative diseases (NDDs) represent a class of incurable and progressive disorders characterized by the gradual degeneration of the structure and function of the nervous system, particularly the brain and spinal cord. A range of innovative therapeutic approaches is currently under investigation, such as stem cell-based therapies, gene-editing platforms such as CRISPR, and immunotherapies directed at pathogenic proteins. Moreover, phytochemicals such as β-caryophyllene and xanthohumol have demonstrated significant neuroprotective potential in preclinical models. These natural agents exert multifaceted effects by modulating neuroinflammatory pathways, oxidative stress responses, and aberrant protein aggregation-pathological mechanisms that are central to the development and progression of neurodegenerative disorders. Recent investigations have increasingly emphasized the optimization of the pharmacokinetic properties of β-caryophyllene and xanthohumol through the development of advanced drug-delivery systems, including polymer- and lipid-based nano- and microscale carriers. Such advancements not only enhance the bioavailability and therapeutic potential of these phytochemicals but also underscore their growing relevance as natural candidates in the development of future interventions for neurodegenerative disorders.

FBXL4
Also flagged:amino acidF-box proteinsCul1E3 ubiquitin ligasesbindingE3 ubiquitin ligase
Journal Article 2025-09-11 ✓ 5 Snippets Sicheri E, Mao D, Tyers M, Sicheri F.
In-Text Gene Mentions

…liganded structures, andFBXL4and FBXW2, which…

…Analysis ofFBXL4

FBXL4is responsible for…

…for ubiquitination byFBXL4and subsequent degradation…

…and BNIP3 andFBXL4is direct and…

Show Full Abstract

The projection of conservation onto the surface of a protein's 3D structure is a powerful way of inferring functionally important regions. For this reason, we created ProteoSync, a Python program that semi-automates the process. The program creates an annotated sequence alignment of orthologs from a diverse set of selectable species and enables the fast projection of amino acid conservation onto a predicted or known 3D model in PyMOL <sup>1</sup>. As a test case, we used ProteoSync to analyze a subset of 31 F-box proteins, which function as substrate recognition subunits for a large family of Cul1-based E3 ubiquitin ligases. We correctly identified known substrate interaction surfaces for 11 F-box members with previously solved structures. We also identified likely ligand binding sites for 16 other members, thus demonstrating ProteoSync's utility for discovering conserved, functionally relevant surfaces.

DCC
Also flagged:cAMP-dependent protein kinasesPKAserine proteaseskinasescancercAMP-dependent protein kinase A
Journal Article 2025-09-11 ✓ 1 Snippet Wlodawer A, Rubach P, Dauter Z, Dec W, Minor W, Brzezinski D, Jaskolski M.
In-Text Gene Mentions

…higher than theirDCCequivalents (0.240 and…

Show Full Abstract

We have evaluated the quality of all 325 deposits in the PDB (as of December 2024) that correspond to (or contain) the catalytic domain of cAMP-dependent protein kinases (PKA). Detailed analysis was possible for 289 deposits of crystal structures that included not only the atomic coordinates but also structure factors. These structures represent 35 years of studies, and it is not surprising that the more recent structures are generally of better quality than the older ones. We did not encounter deposits with very severe problems, although some minor problems were found. To assess whether a uniform method of structure re-refinement, as implemented in the pipeline and website PDB-REDO, leads to significant improvement of structural models, we compared structure quality indicators for the originally refined structures and their counterparts resulting from PDB-REDO refinement. The re-refinement procedure significantly improved only some older structures, while its success was generally limited. We paid particular attention to the quality of small-molecule ligands, finding that most of them fit the electron density very well. This type of analysis helps identify the highest quality structures among many deposits for certain protein families and, thus, could be extended to other groups of proteins as well.

Also flagged:pancreatic lipaseobesitysynthesisPLtriacylglycerolacyl hydrolase
Journal Article 2025-09-11 No Snippets Jagtap UA, Paul AT.
Show Full Abstract

Taking a stand against obesity is an urgent priority, as it significantly impacts both the global economy and public health. Synthetic pancreatic lipase (PL) inhibitors represent one of the most effective therapeutics in the management of obesity. PL is a triacylglycerol acyl hydrolase from the family of serine hydrolases that play a key role in the hydrolysis of dietary fat into monoglycerides and fatty acids. Further, fatty acids get deposited in adipose tissue, which progressively results in weight gain. Over the last decade, various new drugs have been studied; however, orlistat still remains the first-line FDA-approved drug for obesity management. However, long-term use of orlistat can lead to serious health complications, including liver toxicity, osteoporosis, and gastrointestinal issues. Notably, the formation of an irreversible covalent bond of the β-lactone moiety of orlistat with the active serine site of HPL and PPL enzyme has been considered to be responsible for these complications. A deeper understanding of the crystal structure of HPL indicates that repositioning the hydrophobic lid domain, also known as the flap, opens access for designed inhibitors to interact with the active site residues: Ser152, His263, and Asp176. Additionally, predicting the mode of inhibition and the inhibition constant (<i>K</i> <sub>i</sub>) value through enzyme kinetic study is helpful. This review presents a comprehensive overview of the <i>in silico</i> design, synthetic strategies, <i>in vitro</i> assays using human (HPL) and porcine (PPL) enzymes, <i>in vivo</i> activity, and structure-activity relationship (SAR) studies of synthetic PL inhibitors reported since 2014, aimed at the development of anti-obesity agents. Additionally, we propose the challenges to overcome and a potential path for future development in this field.

Also flagged:pattern recognition receptorscancerimmune responsesToll-like receptorsTLRsretinoic acid-inducible gene 1-like receptors
Journal Article 2025-09-11 No Snippets Ouyang D, Chen R, Xie H, Yang X, Li Q, Chen J.
Show Full Abstract

Pattern recognition receptors (PRRs) play a crucial role in immune responses, acting as primary sensors for microbial and host-derived signals. PRRs, which include Toll-like receptors (TLRs), retinoic acid-inducible gene 1-like receptors, nucleotide-binding oligomerization domain-like receptors, C-type lectin receptors, and various cytoplasmic DNA sensors, are essential for initiating immune responses that regulate both inflammation and tumor immunity. Recent studies have highlighted their dual roles in cancer, where they can either suppress or promote tumor progression by influencing the tumor microenvironment and modulating responses to immunotherapy. In the context of cancer, PRRs not only activate immune cells but also contribute to immune evasion mechanisms within tumors. Therapeutically, targeting PRRs represents a promising approach for cancer treatment, with related drugs showing potential to enhance the efficacy of existing immunotherapies. Numerous PRR-based agents, particularly TLR agonists, are currently under clinical investigation for their ability to augment antitumor immunity and overcome resistance to immune checkpoint inhibitors. This review examines the molecular mechanisms by which PRRs influence cancer, with a focus on recent advancements in PRR-targeted therapies and their integration with contemporary immunotherapeutic strategies.

HFE
Also flagged:steatosisliver fibrosismetabolic dysfunction-associatedsteatotic liver diseasehepatic steatosisdiabetes
Journal Article 2025-09-11 ✓ 1 Snippet Masrour O, Ehrhard F, Guillaume M, Boursier J, Gournay J, Aziz K, Schnee M, Garlantézec R, de Lédinghen V, Morcet J, Lainé F, Allaume P, Turlin B, Gandon Y, Bardou-Jacquet E.
In-Text Gene Mentions

…HBV or HCV,hemochromatosis, Wilson’s disease, autoimmune…

Show Full Abstract

<h4>Background</h4>Transient elastography (TE) can be used to accurately screen for severe liver fibrosis in metabolic dysfunction-associated steatotic liver disease (MASLD). However, some studies suggest that steatosis influences liver stiffness measurement (LSM). Thus, treatment that modifies steatosis might impact the relevance of TE in the management of patients. The use of magnetic resonance imaging (MRI)-proton density fat fraction (PDFF) has shown good reliability and accuracy for quantifying hepatic steatosis. Therefore, the aim of our study was to evaluate the performance of TE combined with MRI-PDFF for the diagnosis of severe fibrosis in patients with MASLD. The study is registered at ClinicalTrials.gov (NCT03245606).<h4>Methods</h4>In this prospective multicenter study, patients with MASLD and indication for biopsy underwent MRI and TE within the same month. Biopsies were centrally reviewed using the steatosis, activity, and fibrosis (SAF) score. PDFF was centrally quantified using MRQuantif software. AUROCs for the diagnosis of fibrosis ≥F2 and ≥F3 were determined for LSM alone and LSM combined with PDFF as a continuous or categorical variable in a logistic regression.<h4>Results</h4>In total, 208 patients were studied. The median age was 59 years, 63.9% were men, the median body mass index (BMI) was 31.2 kg/m<sup>2</sup>, and 47.6% had diabetes. Of these patients, 56.3% had fibrosis ≥F2 and 30.3% had fibrosis F3-F4 on biopsy. Based on the SAF score, 35.7% of patients had MASH. The AUROC of LSM for fibrosis ≥F3 was 0.78 (95% CI 0.72-0.85), with no significant difference compared with the AUROC of LSM combined with PDFF (0.78; 95% CI 0.72-0.85; <i>p</i> = 0.96). The AUROC of LSM for fibrosis ≥F2 was 0.67 (95 % CI 0.60-0.74), with no significant difference compared with the AUROC of LSM combined with PDFF (0.66; 95% CI 0.59-0.73, <i>p</i> = 0.48).<h4>Conclusions</h4>TE performance for the diagnosis of liver fibrosis does not appear to be affected by the level of liver steatosis. Thus, quantifying hepatic steatosis using MRI-PDFF allows a comprehensive and accurate assessment of liver steatosis.<h4>Impact and implications</h4>TE is a reliable tool for screening severe liver fibrosis in patients with MASLD. However, some studies suggest that the severity of steatosis influences LSM. Thus, treatment that modifies steatosis might impact the relevance of TE in the management of patients. This prospective multicenter study evaluated whether combining TE with MRI-PDFF, a precise method for measuring liver fat, could improve diagnostic accuracy for severe fibrosis in patients with MASLD. Our results show that TE performance in fibrosis diagnosis remains consistent regardless of steatosis levels, reinforcing the use of non-invasive methods, particularly TE, for regular patient monitoring, even as steatosis levels fluctuate.

DCC
Also flagged:glycosyltransferasemelanomatumorSkin Cutaneous Melanomaimmune responsesMGAT4A
Journal Article 2025-09-11 ✓ 1 Snippet Jia-Xin M, Yun-Bin Z, Zhong-Ting L, Zhi-Dong G.
In-Text Gene Mentions

…BRAF, PTPRT, GRIN2A,DCC, CNTNAP2, PREX2, PTPRD,…

Show Full Abstract

This study aimed to develop a predictive model based on glycosyltransferase-related genes (GTs) to forecast the survival time of patients with Skin Cutaneous Melanoma (SKCM) and to explore the pathways and mechanisms through which GTs influence SKCM prognosis. Transcriptomic data of SKCM from The Cancer Genome Atlas (TCGA) were utilized for individualized predictive modeling, and the model's reliability was validated using GEO data. Univariate Cox regression and LASSO-Cox regression analyses were employed to select prognostically relevant biomarkers, and a predictive risk score was constr, ucted using multivariate Cox regression. Functional annotation of the risk score was performed through GO, KEGG, and GSEA analyses. The performance of the nomogram model was evaluated using ROC curves, calibration curves, and the concordance index (C-index). Furthermore, subsequent analyses based on risk grouping were conducted to assess immune infiltration, somatic mutations, and immune responses, and these findings were validated by real-time quantitative PCR (qPCR), Western Blot, and immunohistochemistry (IHC). Our results revealed a significant correlation between the risk score derived from multivariate Cox regression and the overall survival of SKCM patients. Enrichment analysis of the risk score indicated its association with immune functions. The nomogram model, which integrates the risk score with clinical prognostic factors, exhibited robust predictive performance in both training and validation datasets. Further analyses-including immune infiltration, single-cell analysis, somatic mutation analysis, and immune response assessment-demonstrated a strong correlation between the key gene MGAT4A and the infiltration of CD8<sup>+</sup> T cells as well as monocytes/macrophages in tumor tissues. In summary, we have developed an individualized predictive model for forecasting the 1-year, 3-year, 5-year, and 10-year survival rates of SKCM patients. This model holds promise as a potential tool for guiding personalized diagnosis and treatment of SKCM.

Preprints.org 2025-09-11 Preprint (No Snippets API) Nguyen PV, Vu DM, Do BN, Nguyen HTT, Hoang HT, Pham KH, Nguyen BC, Nguyen PT, Mai TD, Nguyen DT, Ta TB, Tran TV.
Show Full Abstract

(1) Malaria remains a significant health threat to military and civilian personnel de-ployed to endemic regions. Despite recommended chemoprophylaxis, compliance var-ies substantially, potentially impacting clinical outcomes when infections occur. This study investigated the relationship between antimalarial prophylaxis compliance and disease severity among United Nations peacekeepers and associated personnel in South Sudan. (2) Methods: A prospective observational study was conducted at the Vietnam Level 2 Field Hospital in Bentiu, South Sudan from 2018-2024, analyzing 258 confirmed malaria cases. Patients were stratified based on prophylactic medication adherence: a prophylaxis group (n=140, including both regular and irregular users) and a non-prophylaxis group (n=118). Clinical manifestations, laboratory parameters, parasite density, and disease severity were compared between groups. (3) Results: De-spite similar rates of atypical fever presentations between groups (65.0% vs. 55.9%, p=0.14), significant differences emerged in disease severity and laboratory parameters. Non-adherence to prophylaxis was associated with increased risk of anemia (OR=2.81, 95%CI 1.27-6.25, p&lt; 0.01), severe thrombocytopenia (OR=3.76, 95%CI 2.24-6.31, p&lt; 0.01), and elevated liver enzymes (AST: OR=2.26, 95%CI 1.36-3.75, p&lt; 0.001; ALT: OR=1.86, 95%CI 1.13-3.05, p&lt; 0.01). Most importantly, prophylactic abstention signifi-cantly increased risk for malaria with warning signs (OR=2.33, 95%CI 1.25-4.34, p&lt; 0.01) and high parasite density (OR=3.07, 95%CI 1.81-5.20, p&lt; 0.001). All patients achieved parasitological clearance by day three post-treatment. (4) Conclusions: While antimalarial prophylaxis did not prevent infection in our cohort, it significantly re-duced disease severity, parasitemia, and laboratory abnormalities when breakthrough infections occurred. These findings emphasize the importance of prophylactic com-pliance among non-immune individuals in high-transmission settings, even when per-fect adherence cannot be achieved.

Research Square 2025-09-11 Preprint (No Snippets API) Nguyen V, Dong P, Phan H, Tran T, Hoang L, Phan T, Vo H, Bui X, Tran KHN, Le HTT.
Show Full Abstract

<title>Abstract</title> <p> Eleven known compounds, including four triterpenoids ( <bold>1</bold> – <bold>4</bold> ), four sterols ( <bold>5</bold> – <bold>8</bold> ), two phenolic compounds ( <bold>9</bold> – <bold>10</bold> ), and a dipeptide ( <bold>11</bold> ), were isolated from <italic>Excoecaria cochinchinensis</italic> . Their structures were confirmed through spectroscopic analysis and compared with the existing literature. Eight compounds ( <bold>1</bold> , <bold>2</bold> , <bold>5</bold> – <bold>8</bold> , <bold>10</bold> – <bold>11</bold> ) have been identified in this species for the first time. The cytotoxicity of isolated compounds against MCF-7, A549, and HeLa cancer cell lines, antioxidant, <italic>α-</italic> glucosidase, and tyrosinase inhibitory activities were evaluated. The results revealed moderate cytotoxic effects against MCF-7 cells ( <bold>2</bold> – <bold>4</bold> ), A549 cells ( <bold>1</bold> – <bold>4</bold> ), and HeLa cells ( <bold>1</bold> – <bold>5</bold> ), while compounds <bold>6</bold> – <bold>8</bold> , <bold>10</bold> , and <bold>11</bold> showed no activity in any of the cell lines tested. Compound <bold>1</bold> exhibited more potent antioxidant activity and tyrosinase inhibitory properties than the positive control. Meanwhile, compound <bold>4</bold> showed a significant inhibitory effect on the <italic>α-</italic> glucosidase. In <italic>silico</italic> study, the molecular docking simulation of compound <bold>1</bold> to antioxidant (3RP8) and tyrosinase proteins (2Y9X), and of compound <bold>4</bold> to MCF-7 (1H7K), A549 cells (4ZXT), and <italic>α</italic> -glucosidase proteins (MAL32) were performed to calculate their binding affinities and to identify the ligand-binding sites. </p>

BTN2A1
Also flagged:kidney cancerA Virus Cellular Receptor 1HAVCR1cancerTumorpathogenesis
Journal Article 2025-09-10 ✓ 1 Snippet Liu W, Chen W, Dong D, Zhang G, Xing N.
In-Text Gene Mentions

…proteins such asBTN2A1, TNFRSF1A, PGF, TGFBR2,…

Show Full Abstract

<h4>Background</h4>The pathophysiological changes driving incident kidney cancer remain unclear. This study aimed to identify protein biomarkers and underlying mechanisms using pre-diagnostic plasma proteomics.<h4>Materials and methods</h4>Among 48 851 UK Biobank participants, 165 were diagnosed with kidney cancer, and 2911 plasma proteins were analyzed. Dynamic changes in significant proteins were assessed up to 15 years before diagnosis using locally estimated scatterplot smoothing method. A mediation analysis using a four-component framework was conducted to evaluate the mediating role of proteomic features in the associations of body mass index (BMI) and smoking with kidney cancer risk. Additionally, an absolute shrinkage and selection operator regression model was developed for proteomics-based risk prediction.<h4>Results</h4>Over a follow-up period exceeding 11 years, 24 proteins were significantly associated with kidney cancer risk ( P < 0.05, Bonferroni-corrected for 2911), with Hepatitis A Virus Cellular Receptor 1 (HAVCR1) exhibiting the most statistically significant association (HR = 3.18, 95% CI: 2.70-3.74, P = 1.11 × 10 -40 ). Trajectory modeling revealed that HAVCR1 exhibited the most significant fluctuations, with abnormal expression detectable up to 15 years before diagnosis. Unsupervised clustering identified four distinct protein trajectory patterns, suggesting different mechanisms may drive kidney cancer progression at various stages. Proteomic data mediated the effects of BMI and smoking on cancer risk, contributing 38.6% and 9.2% to the risk, respectively. The proteomic model significantly improved kidney cancer risk prediction compared to the clinical model (concordance index [C-index]: 0.811 vs. 0.713, P = 0.029), with HAVCR1 alone demonstrating comparable discriminative ability (C-index: 0.754).<h4>Conclusions</h4>This large-scale plasma proteomics study highlights the potential of biomarkers, particularly HAVCR1, for early detection and insight into kidney cancer pathophysiology.

Also flagged:myocardial ischemiaatherosclerosissynthesiscell proliferationinterferonmitosis
Journal Article 2025-09-10 No Snippets Brown SD, Malinowska AL, Bennett M, Correa-Sánchez AF, Horcasitas Valencia LL, Lucignoli AP, Barton AK, Clark L, Sluimer JC, Webster SP, Rodor J, Newby DE, Cunningham M, Baker AH.
Show Full Abstract

Coronary artery bypass graft (CABG) surgery remains the gold standard of care to prevent myocardial ischemia in patients with advanced atherosclerosis; however, poor long-term graft patency remains a considerable and long-standing problem. Excessive vascular smooth muscle cell (SMC) proliferation in the grafted tissue is recognized as central to late CABG failure. We previously identified SMILR, a human-specific SMC-enriched long noncoding RNA that drives SMC proliferation, suggesting that targeting SMILR expression could be a novel way to prevent neointima formation, and thus CABG failure. Here, we sought to identify a lead siRNA for clinical development. We describe the design and synthesis of a library of 76 chemically enhanced SMILR-targeting siRNA. From this library, we identify a lead siRNA, BHF7, which demonstrates potent and reproducible silencing of SMILR expression, and which robustly blocks vascular smooth muscle cell proliferation, both in vitro and in the ex vivo human saphenous vein model. We further demonstrate using RNA-sequencing that BHF7 down-regulates the expression of genes associated with proliferation and does not induce the expression of interferon or apoptosis genes, suggesting it has a favorable safety profile, both on- and off-target. Finally, we performed TUNEL staining on BHF7-treated tissues and measured the levels of cleaved caspase-3 by enzyme-linked immunosorbent assay after BHF7 treatment. This demonstrated that BHF7 does not induce a cytotoxic response either in vitro or ex vivo. Collectively, these data represent a preclinical package into the function and specificity of BHF7 which warrants further investigation into the possibility of utilizing BHF7 as a novel, ex vivo RNA therapeutic for the prevention of CABG failure in humans.

NEGR1
Also flagged:Type 1 diabetesendocrine disorderinsulinpathogenesistoautoantibody
Journal Article 2025-09-10 ✓ 1 Snippet Melton R, Jimenez S, Elison W, Tucciarone L, Howell A, Wang G, Berti D, Beebe E, Miller M, Zeng C, McGrail C, VanderStel K, Korgaonkar K, Elgamal R, Mummey H, Chiou J, Griffin E, Kusmartseva I, Atkinson M, Preissl S, Theis FJ, Sander M, Gaulton KJ.
In-Text Gene Mentions

…CADM1 , andNEGR1from all endocrine…

Show Full Abstract

Cell type-specific regulatory programs that drive type 1 diabetes (T1D) in the pancreas are poorly understood. Here, we performed single-nucleus multiomics and spatial transcriptomics in up to 32 nondiabetic (ND), autoantibody-positive (AAB<sup>+</sup>), and T1D pancreas donors. Genomic profiles from 853,005 cells mapped to 12 pancreatic cell types, including multiple exocrine subtypes. β, Acinar, and other cell types, and related cellular niches, had altered abundance and gene activity in T1D progression, including distinct pathways altered in AAB<sup>+</sup> compared to T1D. We identified epigenomic drivers of gene activity in T1D and AAB<sup>+</sup> which, combined with genetic association, revealed causal pathways of T1D risk including antigen presentation in β cells. Last, single-cell and spatial profiles together revealed widespread changes in cell-cell signaling in T1D including signals affecting β cell regulation. Overall, these results revealed drivers of T1D in the pancreas, which form the basis for therapeutic targets for disease prevention.

NEGR1
Also flagged:depressionnoncommunicable diseasesobesitybrain developmenteating disordersbehavioral
Journal Article 2025-09-10 ✓ 2 Snippets Chen J, Shan R, Yuan W, Wu Q, Yang Y, Yang YH, Liu JY, Xiao WC, Zhang S, Wen LM, Zhang XR, Liu Z, Song Y.
In-Text Gene Mentions

…loci, such asNEGR1(neuronal growth regulator…

…such as NEGR1 (neuronal growth regulator 1growth regulator 1…

Show Full Abstract

<h4>Background</h4>Adolescence is a critical transitional period between childhood and adulthood, marked by dramatic changes in physical and psychosocial health. Adolescents are vulnerable to both depression and adiposity, but how these conditions evolve over time from adolescence to early adulthood and whether sex differences exist remains unclear.<h4>Objective</h4>This study aims to first identify the population heterogeneity in the joint trajectories of depressive symptoms and BMI from adolescence to early adulthood and then explore the sex differences in the joint trajectories.<h4>Methods</h4>In this study, we adopt the latent class trajectory modeling to identify the combined trajectories of depressive symptoms and BMI from adolescence at baseline to early adulthood at follow-ups using a longitudinal study (2010-2020). We used the multinomial logistic regressions to examine the sex-specific associations with the trajectory classifications.<h4>Results</h4>Our results found that individuals' depressive symptoms and BMI might not always change parallelly from adolescence to early adulthood. Instead, some individuals appeared to be prone to depressive symptoms or elevated BMI, while others were multimorbid with both of them. Moreover, our study identified a clear sex-specific pattern in the joint trajectories of depressive symptoms and BMI: the females were at a higher risk of developing depressive symptoms but remained relatively stable weight status over time (odds ratio [OR] 0.68, 95% CI 0.52-0.89), while the males were at a lower risk of developing depressive symptoms but with an increasing risk of developing adiposity over time (OR 1.83, 95% CI 1.35-2.49).<h4>Conclusions</h4>Depressive symptoms and BMI might not always change in parallel from adolescence to early adulthood, and there is a clear sex-specific pattern in the joint trajectories of depressive symptoms and BMI. This will inform the design of future sex-specific interventions that match the distinguished profiles in male and female participants during the period of adolescence and early adulthood, respectively, thus maximizing the intervention effects in preventing both depression and adiposity in early life.

PRDX6
Also flagged:PUM2HDAC9Acute Kidney Injurydiabetes mellitushematoxylinreverse transcription
Journal Article 2025-09-10 ✓ 1 Snippet Chen W, Lu H, Dai W, Li H, Chen Y, Liu G, He L.
In-Text Gene Mentions

…and peroxiredoxin 6 (PRDX6) has been identified…

Show Full Abstract

<h4>Backgruound</h4>Contrast-induced acute kidney injury (CIAKI) is the third leading cause of hospital-acquired acute kidney injury and diabetes mellitus (DM) has been identified as a risk factor for CIAKI. However, the molecular mechanism underlying DM-CIAKI remains unclear and requires further investigation.<h4>Methods</h4>Mouse and cell models of DM-CIAKI were established. Kidney function was evaluated by measuring biochemical indicators and using hematoxylin and eosin staining. Gene and protein abundance was assessed using real-time quantitative reverse transcription polymerase chain reaction, immunohistochemistry, immunofluorescence, and Western blotting. Glutathione peroxidase, superoxide dismutase, and malondialdehyde were measured using commercial kits, and reactive oxygen species were detected using a dihydroethidium (DHE) probe and the 2',7'-dichlorofluorescein diacetate (DCFH-DA) method. Apoptosis in tissues and cells was evaluated by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL). Cell viability and proliferation were measured using Cell Counting Kit-8 and 5-ethynyl-2'-deoxyuridine (EdU) assays. The interaction between pumilio RNA binding family member 2 (PUM2) and histone deacetylase 9 (HDAC9) was validated using RNA immunoprecipitation (RIP) and RNA pull-down assays.<h4>Results</h4>PUM2 expression was markedly reduced in DM-CIAKI models, whereas HDAC9 expression was notably increased. Subsequently, PUM2 silencing aggravated kidney injury in DM-CIAKI mice by enhancing oxidative stress and suppressing autophagy, whereas HDAC9 inhibition or HDAC9 silencing had the opposite effects. Mechanistically, PUM2 could suppressed the stability of HDAC9 mRNA, thereby attenuating HDAC9 expression. Furthermore, HDAC9 overexpression abolished PUM2 overexpression-mediated inhibition of oxidative stress and promotion of autophagy in high glucose- and contrast media-treated human kidney-2 (HK-2) cells.<h4>Conclusion</h4>PUM2 overexpression suppressed oxidative stress and promoted autophagy to alleviate renal injury in DM-CIAKI by interacting with HDAC9 mRNA, which mediated HDAC9 and mRNA degradation and inhibited HDAC9 expression.

Also flagged:ABCA7phosphatidylcholinelipid transporternucleusgene expressionmetabolism
Journal Article 2025-09-10 No Snippets von Maydell D, Wright SE, Pao PC, Staab C, King O, Spitaleri A, Bonner JM, Liu L, Yu CJ, Chiu CC, Leible D, Ni Scannail A, Li M, Boix CA, Mathys H, Leclerc G, Menchaca GS, Welch G, Graziosi A, Leary N, Samaan G, Kellis M, Tsai LH.
Show Full Abstract

Loss-of-function variants in the lipid transporter ABCA7 substantially increase the risk of Alzheimer's disease<sup>1,2</sup>, yet how they impact cellular states to drive disease remains unclear. Here, using single-nucleus RNA-sequencing analysis of human brain samples, we identified widespread gene expression changes across multiple neural cell types associated with rare ABCA7 loss-of-function variants. Excitatory neurons, which expressed the highest levels of ABCA7, showed disrupted lipid metabolism, mitochondrial function, DNA repair and synaptic signalling pathways. Similar transcriptional disruptions occurred in neurons carrying the common Alzheimer's-associated variant ABCA7 p.Ala1527Gly<sup>3</sup>, predicted by molecular dynamics simulations to alter the ABCA7 structure. Induced pluripotent stem (iPS)-cell-derived neurons with ABCA7 loss-of-function variants recapitulated these transcriptional changes, displaying impaired mitochondrial function, increased oxidative stress and disrupted phosphatidylcholine metabolism. Supplementation with CDP-choline increased phosphatidylcholine synthesis, reversed these abnormalities and normalized amyloid-β secretion and neuronal hyperexcitability-key Alzheimer's features that are exacerbated by ABCA7 dysfunction. Our results implicate disrupted phosphatidylcholine metabolism in ABCA7-related Alzheimer's risk and highlight a possible therapeutic approach.

Also flagged:synapsesSmall cell lung cancerSCLClung cancerinnervationtumours
Journal Article 2025-09-10 No Snippets Sakthivelu V, Schmitt A, Odenthal F, Ndoci K, Touet M, Shaib AH, Chihab A, Wani GA, Nieper P, Hartmann GG, Pintelon I, Kisis I, Boecker M, Eckert NM, Iannicelli Caiaffa M, Ibruli O, Weber J, Maresch R, Bebber CM, Chitsaz A, Lütz A, Kim Alves Carpinteiro M, Morris KM, Franchino CA, Benz J, Pérez-Revuelta L, Soriano-Campos JA, Huetzen MA, Goergens J, Jevtic M, Jahn-Kelleter HM, Zempel H, Placzek A, Hennrich AA, Conzelmann KK, Tumbrink HL, Hunold P, Isensee J, Werr L, Gaedke F, Schauss A, Minère M, Müller M, Fenselau H, Liu Y, Heimsoeth A, Gülcüler Balta GS, Walczak H, Frezza C, Jachimowicz RD, George J, Schmiel M, Brägelmann J, Hucho T, von Karstedt S, Peifer M, Annibaldi A, Hänsel-Hertsch R, Persigehl T, Grüll H, Sos ML, Reifenberger G, Fischer M, Adriaensen D, Büttner R, Sage J, Brouns I, Rad R, Thomas RK, Anstötz M, Rizzoli SO, Bergami M, Motori E, Reinhardt HC, Beleggia F.
Show Full Abstract

Small cell lung cancer (SCLC) is a highly aggressive type of lung cancer, characterized by rapid proliferation, early metastatic spread, frequent early relapse and a high mortality rate<sup>1-3</sup>. Recent evidence has suggested that innervation has an important role in the development and progression of several types of cancer<sup>4,5</sup>. Cancer-to-neuron synapses have been reported in gliomas<sup>6,7</sup>, but whether peripheral tumours can form such structures is unknown. Here we show that SCLC cells can form functional synapses and receive synaptic transmission. Using in vivo insertional mutagenesis screening in conjunction with cross-species genomic and transcriptomic validation, we identified neuronal, synaptic and glutamatergic signalling gene sets in mouse and human SCLC. Further experiments revealed the ability of SCLC cells to form synaptic structures with neurons in vitro and in vivo. Electrophysiology and optogenetic experiments confirmed that cancer cells can receive NMDA receptor- and GABA<sub>A</sub> receptor-mediated synaptic inputs. Fitting with a potential oncogenic role of neuron-SCLC interactions, we showed that SCLC cells derive a proliferation advantage when co-cultured with vagal sensory or cortical neurons. Moreover, inhibition of glutamate signalling had therapeutic efficacy in an autochthonous mouse model of SCLC. Therefore, following malignant transformation, SCLC cells seem to hijack synaptic signalling to promote tumour growth, thereby exposing a new route for therapeutic intervention.

Also flagged:anionarginineamidesproteinssulfatephosphate-binding protein
Journal Article 2025-09-10 No Snippets Ji K, Pack EK, Maydew C, Alberto KA, Abeyrathna S, Villones RLE, Gull H, Meloni G, Nielsen SO, Dodani SC.
Show Full Abstract

Promiscuity, or selectivity on a spectrum, is an encoded feature in biomolecular anion recognition. To unravel the molecular drivers of promiscuous anion recognition, we have employed a comprehensive approach - spanning experiment and theory - with the Staphylococcus carnosus nitrate regulatory element A (ScNreA) as a model. Thermodynamic analysis reveals that ScNreA complexation with native nitrate and nitrite or non-native iodide is an exothermic process. Further deconvolution of the association and dissociation kinetics for each anion reveals that the release event can be limiting, in turn, giving rise to the observed selectivity: nitrate > iodide > nitrite. These conclusions are supplemented with molecular dynamics simulations that capture an entry and exit pathway coupled to subtle global protein motions unique to each anion. Taken together, our data point to how structural plasticity of the binding pocket controls the relative promiscuity of ScNreA to guarantee physiological nitrate sensing.

Also flagged:atherosclerosisaneurysmchromatingene expressiontranscription factorstranscription factor
Journal Article 2025-09-10 No Snippets Weldy CS, Kundu S, Monteiro J, Gu W, Pedroza AJ, Dalal AR, Worssam MD, Li D, Palmisano B, Zhao Q, Sharma D, Nguyen T, Kundu R, Fischbein MP, Engreitz J, Kundaje AB, Cheng PP, Quertermous T.
Show Full Abstract

Vascular sites have distinct susceptibility to atherosclerosis and aneurysm, yet the epigenomic and transcriptomic underpinning of vascular site-specific disease risk is largely unknown. Here, we performed single-cell chromatin accessibility (scATACseq) and gene expression profiling (scRNAseq) of mouse vascular tissue from three vascular sites. Through interrogation of epigenomic enhancers and gene regulatory networks, we discovered key regulatory enhancers to not only be cell type, but vascular site-specific. We identified epigenetic markers of embryonic origin including developmental transcription factors such as Tbx20, Hand2, Gata4, and Hoxb family members and discovered transcription factor motif accessibility to be vascular site-specific for smooth muscle, fibroblasts, and endothelial cells. We further integrated genome-wide association data for aortic dimension, and using a deep learning model to predict variant effect on chromatin accessibility, ChromBPNet, we predicted variant effects across cell type and vascular site of origin, revealing genomic regions enriched for specific TF motif footprints-including MEF2A, SMAD3, and HAND2. This work supports a paradigm that cell type and vascular site-specific enhancers govern complex genetic drivers of disease risk.

CACNA1EDCC
Also flagged:Alzheimer's diseaseADneurodegenerative disorderssynaptic transmissionbeta-amyloid
Journal Article 2025-09-10 ✓ 3 Snippets Ramonet D, Daerr A, Hallbeck M.
In-Text Gene Mentions

…netrin receptors (Unc5c,Dcc) in AMPA receptor…

…channels (Cacna1c, Cacna1d,Cacna1e), particularly in CA1…

…ated Ryr2 and Cacna1c/Cacna1d/Cacna1eexpression, consistent with…

Show Full Abstract

Disruptions in synaptic transmission and plasticity are early hallmarks of Alzheimer's disease (AD). Endosomal trafficking, mediated by the retromer complex, is essential for intracellular protein sorting, including the regulation of amyloid precursor protein (APP) processing. The VPS35 subunit, a key cargo-recognition component of the retromer, has been implicated in neurodegenerative diseases, with mutations such as L625P linked to early-onset AD. Despite growing evidence for retromer dysfunction in AD, its role in synaptic pathology and neuroinflammation remains incompletely understood. Here, we investigate the acute molecular effects of retromer stabilization in the 5xFAD mouse model of AD using the pharmacological chaperones R55 and R33, previously identified to enhance VPS35 stability. Following intracranial stereotaxic injections, we performed transcriptomic profiling, quantitative histology, and immunohistochemistry to assess synaptic function, neuroinflammation, and endosomal trafficking. Our findings reveal that retromer stabilization reverses multiple AD-associated molecular changes. R55 treatment significantly reduced Aβ-related pathology, normalized synaptic gene expression, and restored long-term potentiation (LTP)-associated pathways, including Gria1 (AMPA receptors), Grip1, and semaphorin/plexin signaling. Additionally, retromer stabilization counteracted dysregulated calcium signaling by modulating Ryr2 and L-type calcium channel expression. Beyond synaptic effects, we observed broad transcriptional and structural changes in the endosomal system. Notably, R55 treatment decreased VPS13 family gene expression, implicated in membrane contact site regulation, while increasing RAB7 levels, suggesting enhanced late-endosomal recycling. VPS35-positive vesicles were redistributed away from the nucleus, indicating restored intracellular trafficking dynamics. In the neuroinflammatory domain, retromer stabilization modulated microglial activation, shifting towards a profile characterized by balanced pro-inflammatory (Il1, Nfkb2) and anti-inflammatory (Il4r, Il13ra1, Stat6) markers, consistent with disease-associated microglia (DAM) phenotypes. Together, these findings demonstrate that retromer dysfunction contributes to key AD pathologies, including synaptic dysfunction and neuroinflammation, and that pharmacological retromer stabilization can restore cellular homeostasis. Given that 5xFAD mice lack direct VPS35 mutations, our results suggest that retromer-targeting strategies may be applicable to both familial and sporadic AD, offering a promising therapeutic avenue for modifying disease progression.

HFE
Also flagged:Dilated CardiomyopathyFGFR1AZD4547heart failureheart diseaseisoflurane
Journal Article 2025-09-10 ✓ 1 Snippet Hata R, Funakoshi S, Makiyama T, Kato T, Narita M, Matsumura Y, Hirohata R, Naka Y, Ida K, Ito H, Yoshizawa A, Nannya Y, Haga H, Ogawa S, Ono K, Kimura T, Yoshida Y.
In-Text Gene Mentions

…, drug-induced cardiomyopathy,hemochromatosis, takotsubo cardiomyopathy, pu…

Show Full Abstract

Cardiac fibrosis drives dysfunction in dilated cardiomyopathy (DCM); yet, effective therapies are limited. This study identifies FGFR1 as a critical target in cardiac fibrosis using transcriptomic and histological analyses of 58 human DCM biopsies. FGFR1 expression correlated with fibrosis severity, and inhibition by AZD4547 reduced fibrosis and improved cardiac function in organoid and murine models. These findings validate FGFR1 inhibition as a promising therapeutic strategy for mitigating fibrosis and improving outcomes in heart failure associated with DCM.

CA10
Also flagged:diabetic retinopathydiabetesMMP8BST1ARL1MRPL33
Journal Article 2025-09-10 ✓ 2 Snippets Liang Y, Huang Y, Zhang X, Du Z, Wang Y, Yu H, Hu Y.
In-Text Gene Mentions

…plement C4; prot-c-4481_34_2),CA10(Carbonic anhydrase-related pr…

…C4; prot-c-4481_34_2), CA10 (Carbonic anhydrase-related protein 10anhydrase-related protein 10;…

Show Full Abstract

<h4>Background</h4>Diabetic retinopathy (DR) is a common microvascular complication of diabetes that has the potential to progress to vision-threatening DR (VTDR) even in the absence of symptoms. Plasma proteins in response to physiological and pathological conditions in the body may be intricately connected to the initiation of VTDR.<h4>Objective</h4>To determine the causality between 4489 plasma proteins and the risk of VTDR to explore potential therapeutic targets for VTDR.<h4>Design</h4>A Mendelian randomisation (MR) study.<h4>Setting</h4>A two-sample MR study was performed to investigate the causality between plasma proteins and VTDR.<h4>Participants</h4>Genetic information on plasma proteins and VTDR in European populations from IEU OpenGWAS.<h4>Primary and secondary outcome measures</h4>Mediation analysis was performed to evaluate the indirect impacts of plasma proteins on VTDR via related risk variables. Furthermore, the druggability and potential role of the target proteins in VTDR were explored.<h4>Results</h4>According to the MR study, 92 proteins out of 4489 plasma proteins had causal relationships with VTDR. Five potential proteins (MMP8, BST1, ARL1, MRPL33 and SDF2L1) were causally related to both VTDR and risk factors. Mediation analysis revealed that the protein-mediating effects on VTDR outcomes were achieved through risk factors (body mass index; glycated haemoglobin). Seven drugs that interacted with MMP8 were potential target drugs for VTDR.<h4>Conclusions</h4>Our investigation elucidated the causal connections between plasma proteins, risk factors and VTDR, identified MMP8 protein as a potential drug target and highlighted seven candidate drugs. These results provide a translational framework for developing novel therapies for VTDR.

Also flagged:NF-κBnuclear factor kappa Bneurodegenerative diseasesAmyotrophic lateral sclerosisALSbinding
Journal Article 2025-09-10 No Snippets Wang L, Feng L, Ning B, Wang Z, Dai C, Li M.
Show Full Abstract

This review summarizes recent advances in leveraging natural products from Chinese medicine to modulate the nuclear factor kappa B (NF-κB) signaling pathway for the prevention and treatment of neurodegenerative diseases (NDDs), focusing specifically on Alzheimer's disease (AD), Parkinson's disease (PD), and Amyotrophic lateral sclerosis (ALS). NF-κB proteins regulate cellular biological activity by binding to promoter regions in the nucleus and transcribing various protein-coding genes. Emerging evidence indicates that NF-κB plays a pivotal role in driving key hallmarks of NDD progression, including neuroinflammation, oxidative stress, mitochondrial dysfunction, and dysregulation of the cell cycle. Natural products from Chinese medicine exert modulatory effects on NF-κB signaling through diverse pharmacological mechanisms, ultimately improving cognitive and motor impairments in preclinical NDDs models. The pleiotropic nature of natural products derived from traditional Chinese medicine (TCM)-which operate through subunit-specific modulation of NF-κB-underscores their potential as next-generation therapeutics. Investigating the intricate regulation of NF-κB by natural products from Chinese medicine will not only enrich our understanding of the pathogenesis of NDDs but also establish a theoretical foundation for the development of new therapeutic drugs for NDDs, providing innovative strategies for prevention and treatment.

ZNFX1
Also flagged:respiratory diseasereproductive disordersNF-κBSTATimmune responsesinfection
Journal Article 2025-09-10 ✓ 5 Snippets Huang M, Chen L, Ma Y, Luo B, Li X, Chen Q.
In-Text Gene Mentions

…analysis identified RSAD2,ZNFX1, and TRIM25 as…

…BAG3, STAT1, andZNFX1were up-regulated.…

…B2M, TRIM25, STAT1,ZNFX1, CTSS, BLB1, STOML1,…

…brown module, includingZNFX1, IFIT5, IRF1, IRF7,…

…IFIT5, RSAD2 (Viperin),ZNFX1, TRIM25, IRF1, CCL19,…

Show Full Abstract

Infectious Bronchitis Virus (IBV), a γ-coronavirus, is responsible for respiratory disease, renal injury, and reproductive disorders in poultry. This study presents a comparative transcriptomic profiling of chicken kidney infected with either the virulent GD17/04 strain or the attenuated 4/91 vaccine strain of IBV. RNA sequencing and functional enrichment analyses revealed that both strains initially activate antiviral sensing pathways. However, the virulent strain subsequently provoked sustained and amplified immune activation, involving NF-κB signaling, Jak-STAT signaling, and adaptive immune responses, culminating in severe renal dysregulation. In contrast, infection with the vaccine strain elicited a tempered immune response, accompanied by enhanced metabolic homeostasis and tissue repair processes. Through WGCNA, we identified a virulence-specific immune module (turquoise) and a renal development-associated module (yellow) linked to virus-induced nephropathy for GD17/04, alongside a balanced immune regulatory module (brown) for the 4/91 strain. Intersection analysis further revealed that the virulent strain induced a broader spectrum of immune activation, whereas the vaccine elicited a more restrained response, largely encompassed within that of the virulent infection-including shared pathways such as NOD-like receptor signaling. Among 69 core genes commonly upregulated in a virulence- and time-dependent manner by both strains, protein-protein interaction analysis identified RSAD2, ZNFX1, and TRIM25 as central hub genes. Functional investigations established TRIM25 as a pro-viral host factor: its knockdown significantly suppressed viral replication, whereas its overexpression exacerbated viral propagation. This work provides the first WGCNA-based transcriptional landscape of renal infection by IBV, elucidating virulence-dependent immune signatures and underscoring the pivotal role of TRIM25 in viral pathogenesis.

HTT
Also flagged:depressionneurodevelopmental disordersglucocorticoidsneuropsychiatric disordersADHDschizophrenia
Journal Article 2025-09-10 ✓ 5 Snippets Spulber S, Bose R, Elberling F, Conti M, Ceccatelli S.
In-Text Gene Mentions

…otonin transporter knock-out (5-HTTKO), in which…

…to FLX, namely5-HTTKO and DEX…

…also only in5-HTTKO and DEX-exposed…

…In5-HTTKO mice, considered…

…lack of functional5-HTTincreases the availability…

Show Full Abstract

Most neuropsychiatric conditions, including neurodevelopmental disorders, can have different etiology depending on genetic influences, environmental factors, and gene-environment interactions. Consistent evidence points to low birth weight, commonly associated with prenatal exposure to excess glucocorticoids (GC), as risk factor for neuropsychiatric disorders including depression, ADHD and schizophrenia. In this review we give an overview of our behavioral and mechanistic studies linking prenatal exposure to GC to depression. The behavioral analyses in our mouse model revealed that prenatal exposure to synthetic GC dexamethasone (DEX) alters hippocampal neurogenesis and induces depression-like behavior that responds differently to antidepressive therapies. Using neural progenitor cells as an <i>in vitro</i> experimental model, we could show changes in the methylation state of genes regulating proliferation, differentiation, and migration suggesting that epigenetic modifications are involved in neurogenesis alterations induced by GC. A particularly interesting observation was the alteration in circadian patterns of activity accompanied by weaker coupling between the central clock and peripheral oscillators preceding the late onset of depression in mice exposed to DEX <i>in utero</i>. The results suggest that alterations in patterns of circadian spontaneous activity may predict the onset of depression and the response to therapy in depressed patients. Our collaborative clinical investigations provide evidence for the prognostic value of circadian activity analysis in predicting the response to antidepressant treatments in patients affected by major depressive disorder.

RABGAP1L
Also flagged:ovarian cancercrotonylationcancersPDL1CD40vinblastine
Journal Article 2025-09-10 ✓ 5 Snippets Li X, Wu W, Tao J, Guo X.
In-Text Gene Mentions

…NUCB2, PAF1, PMP22,RABGAP1L, S100A13 and USO1).…

…+ (-0.181 *RABGAP1Lexpression) + (0.005…

…NUCB2, PAF1, PMP22,RABGAP1L, S100A13, and USO1)…

…NUCB2, PAF1, PMP22,RABGAP1L, and USO1 was…

…USO1, DDT, PMP22,RABGAP1L, S100A13, BANF1) via…

Show Full Abstract

<h4>Background</h4>Ovarian cancer remains the deadliest gynecological malignancy with 5-year survival rates below 40% due to frequent recurrence and chemoresistance. Aberrant crotonylation, a type of epigenetic modification, has been implicated in the proliferation, metastasis, and immune evasion of various cancers. However, its role in the ovarian cancer microenvironment and clinical outcomes remains unexplored. The aim of this study was to develop a prognostic model for ovarian cancer on the basis of crotonylation and to investigate the underlying mechanisms and potential of crotonylation for targeted therapy.<h4>Methods</h4>We systematically analyzed single-cell RNA-seq and bulk transcriptomic datasets from ovarian cancer patients. Cellular crotonylation activity was quantified using AUCell algorithm. Potential prognostic genes were identified through DEG analysis and Weighted gene correlation network analysis (WGCNA), and the associated molecular mechanisms were elucidated via Gene set enrichment analysis (GSEA). An ovarian cancer prognosis model were constructed by integrating machine learning algorithms. Immune microenvironment features were assessed using CIBERSORT, ESTIMATE and TIDE algorithms, with drug sensitivity predicted via genomics of drug sensitivity in cancer.<h4>Results</h4>The ovarian cancer microenvironment is characterized by abundant immune cell infiltration, with significant differences in crotonylation levels among 7 cell subtypes. We identified 451 key crotonylation-related genes. The crotonylation risk score (RS) model demonstrated robust prognostic performance. High-RS groups showed immunosuppressive characteristics: decreased follicular helper T cells and activated NK cells, concomitant with M2 macrophage enrichment. Elevated RS was associated with increased stromal activation, as indicated by a higher ESTIMATE score, and enhanced immune evasion potential, reflected by an elevated TIDE score. Notably, high-RS patients exhibited upregulated PDL1 and CD40, suggesting increased immunotherapy susceptibility. Pharmacogenomic analysis identified vinblastine with differential sensitivity, providing actionable targets for RS-stratified therapy.<h4>Conclusion</h4>We elucidated the significant impact of crotonylation on the ovarian cancer microenvironment and prognosis. We developed and validated a novel prognostic model for ovarian cancer that can serve as a tool for predicting patient outcomes and characterizing the immune microenvironment. These findings enhance our understanding of the role of crotonylation in ovarian cancer and establish a robust framework for developing therapeutic strategies targeting crotonylation.

POU3F2
Also flagged:axonsmyelinSchwann cell myelinationhearinglossGuillain-Barre Syndrome
Journal Article 2025-09-10 ✓ 1 Snippet Montigny DJ, Kempfle JS.
In-Text Gene Mentions

…3 Homeobox 1;POU3F2/BRN2, POU Class 3…

Show Full Abstract

Schwann cells are classically known as the constituent supporting cells of the peripheral nervous system. Beyond the scope of merely myelinating axons of the more saliently known neurons, Schwann cells comprise the majority of peripheral nervous system tissue. Through the lens of the inner ear, additional properties of Schwann cells are becoming elucidated. Therein, the process of myelin formation in development is more aptly understood as a homeostatic oscillation of differentiation status. Perpetual interaction between neural and non-neural cells of the inner ear maintains an intricate balance of guidance, growth, and maturation during development. In disease, aberration to Schwann cell myelination contributes to sensorineural hearing loss in conditions such as Guillain-Barre Syndrome and Charcot-Marie-Tooth disease, and tumorigenic over proliferation of Schwann cells defines vestibular schwannomas seen in neurofibromatosis type 2. Schwann cells demonstrate plasticity during oscillations between differentiation and dedifferentiation, a property that is now being leveraged in efforts to regenerate lost neurons. Emerging strategies of reprogramming, small molecule modulation, and gene therapy suggest that Schwann cells could serve as progenitor cells for regenerated neurons. Understanding the duality of Schwann cells in pathology and repair could transform the approach to treating sensorineural hearing loss.

HTT
Also flagged:Spinocerebellar ataxiasmovement disordersataxiahypokinetic movement disordershyperkinetic movement disordersparkinsonism
Journal Article 2025-09-10 ✓ 1 Snippet Wei S, Zhao Z, Li N, Guo X, Chen J, Hu J.
In-Text Gene Mentions

…C9orf72 , andHTT.…

Show Full Abstract

<h4>Background</h4>Spinocerebellar ataxias (SCAs) exhibit substantial clinical and genetic heterogeneity. SCAs primarily present with progressive ataxia as the cardinal clinical feature. However, they may co-occur with non-ataxic motor symptoms, including various movement disorders. Notably, certain SCA subtypes may present with movement disorders as their primary manifestation. This phenotypic complexity poses significant diagnostic challenges, particularly in distinguishing SCAs from other neurodegenerative conditions with overlapping presentations.<h4>Methods</h4>This study enrolled 35 probands initially diagnosed with movement disorders. Participants were stratified into hypokinetic movement disorders and hyperkinetic movement disorders groups. After excluding known genetic causes of movement disorders through targeted next-generation sequencing (NGS) panel, negative cases received SCA repeat expansion testing. Genetically confirmed SCA cases received comprehensive clinical-genetic characterization.<h4>Results</h4>Four SCA cases were identified in the hypokinetic movement disorders group (<i>n</i> = 28), accounting for 14.29% (4/28). Notably, an SCA8-associated familial parkinsonism pedigree manifested a novel clinical constellation: Parkinson's disease -like phenotype with spastic paraplegia and levodopa responsive parkinsonism with dystonia. Additionally, we observed: (i) An SCA2 pedigree demonstrating intrafamilial phenotypic heterogeneity; (ii) Two sporadic early-onset parkinsonism cases harboring pathogenic expansions in SCA8 (CTA/CTG 55 repeats) and SCA3, respectively. Two SCA cases were detected in the hyperkinetic movement disorders group (<i>n</i> = 7), representing 28.57% (2/7). We observed: (i) an SCA3 preataxic carrier presenting with Tourette syndrome; (ii) an SCA17 case (CAG/CAA 41 repeats) manifesting dystonia and spastic paraplegia.<h4>Conclusion</h4>We characterized a novel clinical constellation in an SCA8-associated familial parkinsonism pedigree: Parkinson's disease -like phenotype with spastic paraplegia and levodopa responsive parkinsonism with dystonia. We report the first documented occurrence of Tourette syndrome in the pre-ataxic stage of SCA3, though it is more likely a coincidental comorbidity independent of SCA3 progression. Furthermore, our findings indicate that SCA subtypes presenting with movement disorder-dominant phenotypes are likely underestimated in clinical practice.

Also flagged:myocardial infarctionMIangiogenesispathogenesisatherosclerosisendothelial dysfunction
Journal Article 2025-09-10 No Snippets Ding N, Zheng Z, Zhang C.
Show Full Abstract

Myocardial infarction (MI) remains a leading cause of cardiovascular mortality despite advances in reperfusion strategies, necessitating innovative therapeutic approaches. Human umbilical cord mesenchymal stem cell-derived exosomes (HUCMSCs-Exos) have emerged as promising next-generation therapeutics, offering superior advantages including enhanced stability, reduced immunogenicity, and ability to cross biological barriers compared to cellular therapies. These naturally occurring nanovesicles exert comprehensive cardioprotective effects through multifaceted mechanisms encompassing anti-apoptotic signaling, angiogenesis promotion, immunomodulation, anti-fibrotic activity, oxidative stress reduction, and cardiac regeneration enhancement. The therapeutic arsenal includes diverse molecular cargo such as microRNAs (miR-29b, miR-133a-3p, miR-24-3p), long non-coding RNAs, circular RNAs, and bioactive proteins that synergistically target key pathophysiological processes in MI. Advanced engineering approaches, including genetic modification, surface functionalization, and biomaterial integration, have further enhanced therapeutic efficacy through targeted delivery and sustained release systems. While preclinical studies demonstrate significant cardioprotective effects, clinical translation faces challenges in standardization, manufacturing scalability, and regulatory approval. The convergence of innovative engineering strategies, personalized medicine approaches, and emerging technologies positions HUCMSCs-Exos as promising therapeutic approach that could fundamentally alter MI treatment paradigms and improve global cardiovascular health outcomes.

Also flagged:oxygenpigmentationtranslationalacrocyanosisgestationHb
Journal Article 2025-09-10 No Snippets Helman J, Bawa M, Gugino S, Bradley N, Nielsen L, Prasath A, Blanco C, Kasu MD, Abbasi H, Rawat M, Chandrasekharan P.
Show Full Abstract

<h4>Background</h4>Expert guidelines recommend using pulse oximetry (PO) in the delivery room to monitor oxygen saturation (SpO<sub>2</sub>) and heart rate (HR). Umbilical cord pulse oximetry (UCP) is a novel concept that, despite being postductal, could provide accurate measurements of SpO<sub>2</sub> and HR, as it overcomes barriers associated with skin pigmentation.<h4>Methods</h4>This pilot study used NONIN pulse oximetry on an intact umbilical cord that underwent deferred cord clamping (DCC) to evaluate umbilical cord SpO<sub>2</sub> in a preterm asphyxiated ovine model (N of 5) with an HR of <100 bpm. The UCP HR served as a surrogate marker for umbilical vessel flow. A receiver operator characteristic (ROC) curve was used to evaluate UCP parameters with arterial saturations (SaO<sub>2</sub>) and carotid HR between 2 and 10 min.<h4>Results</h4>Following asphyxia, five preterm lambs underwent DCC for 4 min. A significant relationship was noted between SaO<sub>2</sub> and umbilical SpO<sub>2</sub> (area under the curve (AUC) of 0.907, CI 0.857-0.968, <i>p</i> < 0.0001) along with carotid and umbilical HR (AUC) of 0.842 (CI 0.663-0.902, <i>p</i> < 0.0001).<h4>Conclusions</h4>In a translational preterm model, UCP accurately predicted preductal SaO<sub>2</sub> and carotid HR (a surrogate for umbilical flow). Using UCP in the delivery room will help guide supplemental oxygen and determine the optimal duration of clamping the umbilical cord. These proof-of-concept studies/pilot findings require validation with larger animal cohorts and newborn infants.

SERPINC1
Also flagged:CongenitalThrombophiliaCTEPHchronic thromboembolic pulmonary hypertensionthrombophiliasprotein S deficiency
Journal Article 2025-09-10 ✓ 3 Snippets Borsi E, Potre C, Ionita I, Samfireag M, Secosan C, Potre O.
In-Text Gene Mentions

…analysis identified rareSERPINC1, PROC, and PROS1…

…hrombin deficiency”[tiab] OR “SERPINC1”[tiab]) OR (“Factor V…

…pathogenic variants inSERPINC1, PROC, and PROS1…

Show Full Abstract

<b>Background and Objectives:</b> Congenital thrombophilias are biologically plausible contributors to chronic thromboembolic pulmonary hypertension (CTEPH), yet their frequency and clinical impact remain uncertain. We undertook a systematic review to (i) estimate the pooled prevalence of specific hereditary defects among adults with CTEPH, (ii) characterise associated demographic and haemodynamic phenotypes, and (iii) summarise peri-operative and survival outcomes after pulmonary endarterectomy (PEA) or balloon pulmonary angioplasty (BPA) in genetically defined subgroups. <b>Methods:</b> A protocol compliant with PRISMA-2020 was registered prospectively on the Open Science Framework (OSF). PubMed/MEDLINE, Scopus, and Web of Science were searched from inception to 1 June 2025 using validated, PRESS-reviewed strings combining CTEPH and thrombophilia terms. Observational cohorts, case-control studies and trials reporting laboratory-confirmed congenital thrombophilias in adults with right-heart-catheter-defined CTEPH were eligible. <b>Results:</b> Eight studies encompassing 677 unique CTEPH patients met the inclusion criteria. Among the 400 individuals screened for deficiencies of the natural anticoagulant pathways, 56 possessed a defect: protein S deficiency 5.3% (21/400; 95% CI 3.3-8.0), protein C deficiency 4.3% (17/400; 2.5-6.8), and antithrombin deficiency 1.5% (6/400; 0.6-3.3). In 520 genotyped patients, factor V Leiden and prothrombin G20210A were infrequent (1.3% and 1.0%, respectively) and confined to European/North American cohorts. Baseline haemodynamics were uniformly severe (mean mPAP 46.7 mm Hg; pulmonary vascular resistance ≈ 9 WU). Definitive reperfusion therapy was common (PEA 63%; BPA 18%), reducing mPAP to 20.5 mm Hg and yielding a weighted one-year survival of 96.2%. No study demonstrated a thrombophilia-specific effect on surgical candidacy or early survival. <b>Conclusions:</b> Approximately one in seven patients with CTEPH harbours a congenital thrombophilia, most often protein S or protein C deficiency, whereas classic venous-thrombo-embolism mutations are rare and ethnically restricted. Current evidence indicates that genetic status does not materially influence haemodynamic severity, uptake of PEA/BPA, or short-term survival, supporting guideline recommendations for universal referral to specialist reperfusion centres. Future multicentre registries integrating systematic genotyping and long-term outcome capture are needed to clarify genotype-specific prognostic and therapeutic implications.

DCC
Also flagged:Nucleotidetranslationalhereditary diseasemetabolismsolid tumorshematologic malignancies
Journal Article 2025-09-10 ✓ 1 Snippet Process V, Ambavaram MMR, Vasantgadkar S, Khanal S, Werner M, Berkeley MA, Herbert ZT, Endress G, Thomann U, Daviso E.
In-Text Gene Mentions

…7 additional genes,DCC, HSPH1 ,…

Show Full Abstract

<b>Background:</b> Coverage uniformity is pivotal in whole genome sequencing (WGS), as uneven read distributions can obscure clinically relevant variants and compromise downstream analyses. While enzyme-based fragmentation methods for WGS library preparation are widely used, they can introduce sequence-specific biases that disproportionately affect high-GC or low-GC regions. Here, we compare four PCR-free WGS library preparation workflows-one employing mechanical fragmentation and three based on enzymatic fragmentation-to assess their impact on coverage uniformity and variant detection. <b>Results:</b> Libraries were generated with Coriell NA12878 and DNA isolated from DNA blood, saliva, and formalin-fixed paraffin-embedded (FFPE) samples. Sequencing was performed on an Illumina NovaSeq 6000, followed by alignment to the human reference genome (GRCh38/hg38) and local realignment. We assessed coverage at both chromosomal and gene levels, including 504 clinically relevant genes detected in the TruSight™ Oncology 500 (TSO500) panel. Additionally, we examined the relationship between GC content and normalized coverage, as well as variant detection across high- and low-GC regions. <b>Conclusions:</b> Our findings show that mechanical fragmentation yields a more uniform coverage profile across different sample types and across the GC spectrum. Enzymatic workflows, on the other hand, demonstrated more pronounced coverage imbalances, particularly in high-GC regions, potentially affecting the sensitivity of variant detection. This effect was evident in analyses focusing on the TSO500 gene set, where uniform coverage is critical for accurate identification of disease-associated variants and for minimizing false negatives. Downsampling experiments further revealed that mechanical fragmentation maintained lower Single Nucleotide Polymorphism (SNPs) false-negative and false-positive rates at reduced sequencing depths, thereby highlighting the advantages of consistent coverage for resource-efficient WGS. This study introduces a novel framework for evaluating WGS coverage uniformity, providing guidance for optimizing library preparation protocols in clinical and translational research. By quantifying how fragmentation strategies influence coverage depth and variant calling accuracy, laboratories can refine their sequencing workflows to ensure more reliable detection of clinically actionable variants-especially in high-GC regions often implicated in hereditary disease and oncology.

HTT
Also flagged:dopaminehypermethylationSLC6A4serotonin transporterMAOBmonoamine oxidase B
Journal Article 2025-09-10 ✓ 2 Snippets Bellia F, Girone N, Benatti B, Vismara M, Pettorruso M, Martinotti G, Dell'Osso B, D'Addario C, Pucci M.
In-Text Gene Mentions

…e serotonin transporter (SERT/5-HTT), while MAOB encodes…

…stalk subunit P0 SERT/5-HTTSerotonin transporter SLC6A4…

Show Full Abstract

This study investigated the complexity of neurotransmitter-related gene regulation in peripheral blood mononuclear cells (PBMCs) of patients with obsessive-compulsive disorder (OCD), aiming to identify clinically relevant molecular markers. We analyzed three key genes: <i>SLC6A4</i> (serotonin transporter), <i>MAOB</i> (monoamine oxidase B, a dopamine-degrading enzyme), and <i>COMT</i> (catechol-O-methyltransferase, a dopamine/norepinephrine metabolizing enzyme). OCD patients exhibited significant downregulation of <i>SLC6A4</i> and <i>MAOB</i>, accompanied by upregulation of <i>MB-COMT</i>. The contrasting expression of <i>MAOB</i> and <i>MB-COMT</i> suggests a dysregulated compensatory mechanism in dopamine homeostasis, which contributes to clinical heterogeneity and variability in treatment for OCD. Epigenetic analysis revealed that downregulation of <i>SLC6A4</i> was associated with hypermethylation of the gene promoter, demonstrating the critical role of epigenetic mechanisms in neurotransmitter system dysregulation. Moreover, gene-gene correlations identified distinctive molecular expression patterns that reliably discriminated OCD patients from healthy individuals, proposing their potential as peripheral biomarkers. In conclusion, serotonergic and dopaminergic abnormalities characterize OCD, where epigenetic regulation contributes to gene dysregulation. The identified molecular signatures may explain the inefficiency of treatments and support biomarker-guided clinical approaches. Given that peripheral gene regulation and core neurotransmitter systems are similar, this study contributes to the biological picture of OCD, indicating the accuracy of diagnoses and treatments.

DNAJC1
Also flagged:Membrane ProteinBiogenesismembrane proteinspolypeptidesmembraneendoplasmic reticulum
Journal Article 2025-09-10 ✓ 1 Snippet Zimmermann R.
In-Text Gene Mentions

…SEC63 and theDNAJC1(encoding the putative…

Show Full Abstract

In human cells, the biogenesis of membrane proteins, which account for one quarter of polypeptides and sixty percent of human drug targets, is initiated at the membrane of the endoplasmic reticulum (ER). This process involves N-terminal signal peptides or transmembrane helices in the membrane protein precursors. Over one hundred proteins enable membrane-targeting and -insertion of the precursors as well as their folding and covalent modifications. Four targeting pathways to the Sec61 channel in the ER membrane with their effectors and three cooperating or independent membrane protein-insertases have been identified. We combined knock-down of individual components of these pathways and insertases in HeLa cells with label-free quantitative mass spectrometric analysis of the proteomes. Differential protein abundance analysis in comparison to control cells was employed to identify clients of components involved in the targeting or membrane insertion of precursors. Alternatively, knock-out cells or relevant patient fibroblasts were employed. The features of the client polypeptides were characterized to identify the client types of the different components and, ideally, their rules of engagement. In this review/article-hybrid, the focus is on global lessons from and limitations of the proteomic approach in answering the cell biological question, as well as on new aspects, such as N-terminal acetylation of membrane protein precursors.

PRDX6OLFM4
Also flagged:gene expressionHIST1H2ADTMEM176BACAT2HBBtranscription factors
Journal Article 2025-09-10 ✓ 3 Snippets Danielewski M, Walkowiak J, Wielgus K, Nowak JK.
In-Text Gene Mentions

…, RNASE3 ,OLFM4, RNASE3, CEBPE ,…

…, DEFA3 ,PRDX6, ITGA2B ,…

PRDX6, however, was…

Show Full Abstract

<h4>Background</h4>Correlation of genes within tissues has attracted much attention. In contrast, genes that are INDependent In Expression (INDIE) remain poorly understood, even though they may represent tissue admixtures, reflect new regulatory mechanisms, either transcriptional or post-transcriptional, and contribute to biomarkers or machine learning algorithms. We hypothesised that INDIE genes can be found, may remain uncorrelated across tissues, and replicate within tissues in external datasets.<h4>Methods</h4>Biweight midcorrelation was calculated for each gene against all other genes with sufficiently high expression in the given tissue from the GTEx dataset v8, along with the means of absolute values of obtained correlation coefficients. The threshold for gene designation as INDIE was both absolute (r) and relative (Z-score), while the threshold for external validation in the whole blood (four datasets) and the ileum (two datasets) was relative.<h4>Results</h4>Only one gene, <i>RPL13P12</i>, was INDIE in all the analysed GTEx tissues, but it did not replicate in the external datasets. In contrast, <i>HIST1H2AD</i> and <i>TMEM176B</i> were not only INDIE in GTEx whole blood but also replicated in all four external datasets, despite their heterogeneity. Moreover, <i>ACAT2</i> replicated in both external ileal datasets. The haemoglobin gene <i>HBB</i> belonged to most widespread INDIE genes in various GTEx tissues and was validated in an external ileal dataset, pointing towards the importance of tissue heterogeneity in bulk samples.<h4>Conclusions</h4>A set of genes exhibiting independent expression patterns across various tissues of GTEx was described. Results for each tissue are made available. Even though many findings can be explained by tissue heterogeneity, some results point towards interesting mechanisms of gene expression regulation.

Also flagged:DapagliflozinEmpagliflozinSGLT2Type 2 diabetic Mellitusdiabeteslipid
Journal Article 2025-09-10 No Snippets Cokro F, Sauriasari R, Tahapary DL, Setiawan H, Tricaesario C, Hidayati N, Soegondo S.
Show Full Abstract

<h4>Background</h4>Previous studies compared the cardiorenal efficacy of these two types of SGLT2 inhibitors; however, the findings are inconsistent and do not reflect the population of Type 2 diabetic Mellitus (T2DM) patients in Indonesia, which ranks fifth globally in diabetes prevalence. This study aims to evaluate the effects and safety of dapagliflozin and empagliflozin on cardiorenal risk factors in T2DM Indonesian patients over a 12-month.<h4>Methods</h4>This study utilized a multicenter retrospective cohort to evaluate diverse cardiorenal risk factors, encompassing glycemic control, blood pressure, lipid profile, body weight, Body Mass Index (BMI), calculated 10-year Atherosclerotic Cardiovascular Disease (ASCVD) risk, and estimated Glomerular Filtration Rate (eGFR), alongside the safety profile of SGLT2is. Paired data analysis, comparative analysis between groups, and linear regression were conducted to adjust the confounding.<h4>Results</h4>Both groups exhibited enhancements in HbA1c, Fasting Plasma Glucose (FPG), Systolic Blood Pressure (SBP), and Low-Density Lipoprotein Cholesterol (LDL-C). Improvements in BMI, Diastolic Blood Pressure (DBP), triglycerides, ASCVD risk, and High-Density Lipoprotein Cholesterol (HDL-C) were only seen in the dapagliflozin group. Although dapagliflozin was associated with greater reductions in body weight and BMI, these differences were not statistically significant after adjustment for confounding factors. No significant differences were observed in the average alteration of HbA1c, FPG, SBP, DBP, LDL-C, HDL-C, triglycerides, total cholesterol, eGFR, and ASCVD risk values. A comparable safety profile was found between groups.<h4>Conclusion</h4>Dapagliflozin and Empagliflozin provide similar advantages in reducing cardiorenal risk and safety after 12 months of treatment in Indonesian patients with T2DM.

POU3F2
Also flagged:glioblastomaGBbrain tumorPIWIangiogenesistranslational
Journal Article 2025-09-10 ✓ 1 Snippet Parikh D, Shah M.
In-Text Gene Mentions

…as SOX2 andPOU3F2that are critical…

Show Full Abstract

Glioblastoma (GB) remains the most aggressive and treatment-resistant primary brain tumor, characterized by extensive heterogeneity, therapeutic resistance, and dismal prognosis. In this comprehensive review, we aimed to synthesize emerging insights into the roles of non-coding RNAs (ncRNAs)-including microRNAs, long non-coding RNAs, circular RNAs, and PIWI-interacting RNAs-in the regulation of glioblastoma progression, resistance mechanisms, and potential therapeutic strategies. We critically evaluated the molecular functions of ncRNAs in key oncogenic processes such as proliferation, angiogenesis, epithelial-mesenchymal transition (EMT), and immune evasion. Additionally, we reviewed current detection methods, delivery technologies, and clinical trials targeting these ncRNAs. A central goal of this review was to bridge a notable gap in the literature by highlighting underrepresented ncRNA classes such as circRNAs and piRNAs, which exhibit regulatory complexity and potential as biomarkers and therapeutic agents in GB. We further discussed delivery challenges posed by the blood-brain barrier and explored promising nanocarrier and exosome-based approaches to enhance therapeutic targeting. Through curated case studies, we showcased the translational potential of targeting specific ncRNAs to reverse multiple resistance types and improve immunotherapy response. This review provides a consolidated framework for understanding the dynamic role of ncRNAs in glioblastoma and proposes an expanded toolkit for precision oncology approaches. Our findings not only underscore the therapeutic promise of ncRNAs but also call for future investigations into the lesser-known subclasses that could redefine the landscape of GB management.

SERPINC1
Also flagged:Central Nervous System TumoursCNS tumourscognitive declinecranial nervous system tumoursCentral Nervous SystemCNS
Journal Article 2025-09-10 ✓ 2 Snippets Baruah P, Ms A, Banerjee S, Sunny J, Simon P, Pai M, Kamath M, Shetty A, Srinivas C, Lobo D, Srinivasan S, Prakash P, E A, Krishna A.
In-Text Gene Mentions

…with missing post-treatmentACE-IIIdata (due to…

…the mean post-treatmentACE-IIItotal score was…

Show Full Abstract

<h4>Background</h4>Radiation therapy (RT) for central nervous system (CNS) malignancies can result in neurocognitive decline, affecting quality of life. While hippocampal-sparing approaches are well documented, limited data exist on the impact of radiation dose to other cognitive structures. This prospective study evaluates domain-specific cognitive changes following RT and explores correlations with radiation dose to key brain regions.<h4>Methodology</h4>Twenty-five patients with primary CNS tumours undergoing focal radiotherapy, with or without concurrent chemotherapy, were enrolled. Neurocognitive function was assessed using the Addenbrooke's Cognitive Examination III (ACE-III) tool, pre- and six months post-treatment. Radiation dose-volume histogram (DVH) data were analyzed for structures including the hippocampus, amygdala, cerebellum, and corpus callosum. Patients were stratified based on ACE-III score decline (≥3 points vs. <3 points), and dose-response correlations were examined.<h4>Results</h4>A statistically significant decline in mean ACE-III scores was observed post-treatment (pre: 89.48 ± 6.84 vs. post: 87.91 ± 6.29, p = 0.007). Attention, language, and fluency were the most affected domains. Patients with cognitive decline received higher radiation doses to all examined structures, with the corpus callosum showing the strongest association (mean dose in decline group: 35.91 Gy vs. 30.70 Gy; p = 0.440). However, no dose-response relationship reached statistical significance.<h4>Conclusion</h4>This study highlights early, domain-specific neurocognitive decline following focal RT for CNS tumours, with attention and language being most vulnerable. Corpus callosum dose emerged as a key correlate. These findings suggest the need to broaden neuroprotection strategies beyond the hippocampus and emphasize the value of incorporating routine neurocognitive assessment.

Also flagged:copperblood vessel formationosteogenesismesenchymal stem cell differentiationosteoblastsangiogenesis
Journal Article 2025-09-10 No Snippets Rahimi MJS, Kianvash A, Rezvani M, Memar MY.
Show Full Abstract

Copper (Cu) has gained significant attention from the researchers on biomaterials due to its important biological roles in the body. Researchers have found that Cu has biological properties, especially in orthopedic applications as an additive element in alloys or bio-compatible coatings. Additionally, Cu has anti-bacterial, angiogenic, and osteogenic properties. The antibacterial properties of Cu provide an alternative to antibiotics and prevent the development of antibiotic resistance. Furthermore, Cu contributes to bone and blood vessel formation and improves the performance of biological materials. This study examines the potential of Cu-containing implant materials in anti-bacterial and bone and blood vessel regeneration.

Also flagged:FXYD domain-containing ion transport regulatorsamino acidsNKAion channelspotassiumsodium
Journal Article 2025-09-10 No Snippets Li X, Long M, Zhong S, Luo JL.
Show Full Abstract

The FXYD family (FXYD domain-containing ion transport regulators) proteins consist of short, single-pass transmembrane proteins that primarily regulate the Na<sup>+</sup>/K<sup>+</sup>-ATPase (NKA) pump, a key player in maintaining cellular ion homeostasis. Ranging from 60 to 160 amino acids in length, FXYD proteins display tissue-specific expression patterns and influence not only NKA activity but also the function of other ion channels, including potassium, sodium, and chloride channels. These proteins interact with NKA in diverse ways, modulating its activity to meet the specific needs of different tissues. In addition to their physiological roles, FXYD proteins are implicated in the development and progression of various diseases, such as cancer, cardiovascular disorders, renal diseases, and neurological conditions. This review offers an overview of the structures, biological functions, and molecular mechanisms through which FXYD proteins regulate ion transport. Furthermore, we explore their emerging roles in disease pathogenesis and discuss potential therapeutic strategies for targeting FXYD proteins in disease management.

HFE
Also flagged:Hepatocellular Carcinomachronic hepatitis BSteatosishypertensiondyslipidemiadiabetes
Journal Article 2025-09-09 ✓ 1 Snippet Patmore LA, Carey I, Feld JJ, Brouwer WP, Patel K, Buti M, Honkoop P, Postma DF, Blokzijl H, Koc ÖM, van Oorschot E, Agarwal K, van der Valk M, Lieveld FI, Kilany M, Kramer M, de Bruijne J, Claassen MAA, Hansen BE, de Man RA, Janssen HLA, Takkenberg RB, Sonneveld MJ.
In-Text Gene Mentions

…sclerosing cholangitis andhemochromatosis), and cases in…

Show Full Abstract

<h4>Introduction</h4>Metabolic dysfunction and metabolic dysfunction-associated steatotic liver disease (MASLD) are associated with an increased risk of hepatocellular carcinoma (HCC) in patients with chronic hepatitis B (CHB). We aimed to study risk factors for HCC and to assess the performance of the PAGE-B score in this population.<h4>Methods</h4>We included CHB patients with ≥ 1 metabolic comorbidity from nine centres. Steatosis was diagnosed by ultrasound, CAP, or histology. Risk factors were analysed by Cox regression, and the performance of the PAGE-B score was assessed in the overall population and across relevant subgroups.<h4>Results</h4>We included 1922 patients. 1730 (90.0%) were overweight, 434 (22.6%) had hypertension, 254 (13.2%) dyslipidemia, 230 (12.0%) diabetes and 732 (38.1%) MASLD. Presence of cirrhosis, older age, lower platelets and lower albumin were independent risk factors for HCC. The 5-year HCC risk was 0.1%/2.0%/12.4% patients with low/intermediate/high PAGE-B scores (p < 0.001). Consistent results were obtained in patients with MASLD (0/2.8/11.1% for low, intermediate and high PAGE-B scores (p < 0.001)). PAGE-B stratified risk in patients without cirrhosis (0% vs. 1.2% and 1.8%, p < 0.001). Among the subset of patients with cirrhosis, risks were 4.2% (low), 6.9% (intermediate) and 27.3% (high) (p < 0.001).<h4>Conclusions</h4>CHB patients with metabolic dysfunction and/or MASLD are at significant risk of HCC. The PAGE-B score can be used to stratify HCC risk in this population, with negligible 5-year HCC incidence in those without cirrhosis and low PAGE-B scores. However, caution should be exercised in patients with cirrhosis in whom HCC risk remains significant even among those with a low PAGE-B score.

Also flagged:COVID-19immune responsesviral infectionviral diseasesinfectionsrespiratory infections
Journal Article 2025-09-09 No Snippets Brenna C, Bramon Mora B, Ioannidou K, Bodelet J, Siebmanns ML, Burgermeister S, Georgakis S, Orfanakis M, Muller YD, Sédille N, Feinstein MJ, Lomasney JW, Chén OY, Pantaleo G, Berezowska S, de Leval L, Gottardo R, Petrovas C.
Show Full Abstract

The regulation of follicular (F) and germinal center (GC) immune reactivity in human lymph nodes (LNs), particularly during the acute stages of viral infection, remains poorly understood. We have analyzed lung-draining lymph nodes (LD-LNs) from COVID-19 autopsies using multiplex imaging and spatial transcriptomics to examine the immune landscape with respect to follicular immune reactivity. We identified 3 groups of donors based on the Bcl6 prevalence of their reactive follicles (RFs): RF-Bcl6no/lo, RF-Bcl6int, and RF-Bcl6hi. A distinct B/Tfh immune landscape, associated with increased prevalence of proliferating B cell and Tfh cell subsets, was found in RF-Bcl6hi LD-LNs. The comparison between LD-LNs and subdiaphragmatic (SD) LNs from the same donor revealed a divergent Bcl6 expression between the 2 anatomical sites. LD-LN Bcl6 expression was also associated with a distinct spatial transcriptomic profile. TH1-associated genes/pathways (e.g., CXCR3, STAT5, TNF signaling) were significantly upregulated in RF-Bcl6no/lo tissues, while the RF-Bcl6hi tissues exhibited significant upregulation of GC-promoting genes/pathways (e.g., CXCL13, B-cell receptor signaling). Our findings reveal a heterogeneous F/GC landscape in COVID-19 LD-LNs, highlighting specific molecular targets and pathways that could regulate human F/GC immune dynamics during acute viral infections.

HFE
Also flagged:alcoholhepatitisalcohol-associated hepatitisAHliver diseaseAlcoholic Hepatitis
Journal Article 2025-09-09 ✓ 1 Snippet Dasarathy S, Tu W, Welch N, Gawrieh S, Yu Y, Tang Q, Kettler C, Sanyal AJ, Szabo G, Shah VH, Bataller R, Nagy LE, McClain CJ, Chalasani N, Kerr T, Mitchell MC, for AlcHepNet Investigators.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background aims</h4>The clinical course and outcomes of alcohol-associated hepatitis (AH) remain poorly understood. Major adverse liver outcomes do not capture the added risk of return to drinking. We examined the natural history of AH and developed a composite endpoint using a contemporary observational cohort of AH.<h4>Approach results</h4>A cohort of 1127 participants: 712 AH patients, 256 heavy drinking controls without clinically evident liver disease, and 159 healthy controls, were prospectively followed for 6 months at 8 United States centers as part of the Alcoholic Hepatitis Network (AlcHepNet) consortium. Outcomes included mortality and a composite endpoint (AlcHepNet composite index) that included death, liver transplantation, hepatic decompensation (new onset/worsening ascites, HE, variceal bleeding), liver-related hospital admission, MELD increase ≥5, and return to drinking. Of 712 AH patients (age 45±10.7 y; 59.1% male), 558 (79.0%) had severe and 148 (21.0%) had moderate AH, 232 (32.5%) died, and 86 (12.1%) underwent liver transplantation. Mortality rates in moderate AH and severe AH were 0.7% versus 17.2% (30 d), 3.4% versus 26.5% (90 d), and 8.8% versus 30.5% (180 d), respectively (all p <0.001). Composite liver/alcohol use events were noted in 459 (64.5%) AH patients. Higher MELD score, lower mean arterial pressure, and baseline leukocytosis were associated with higher 90-day mortality in AH (all p <0.05). College education and higher ALP were associated with lower mortality. Heavy drinking controls had low mortality (n=3; 1.2%).<h4>Conclusions</h4>This large observational study showed a high incidence of composite liver and alcohol-use events within 6 months, reiterating the need for early interventions.

Also flagged:lipidcardiovascular diseaseCVDdeathLDLRfamilial hypercholesterolemia
Journal Article 2025-09-09 No Snippets Selvaraj MS, Li X, Li Z, Van Buren E, Haidermota S, Postupaka D, Hornsby W, Bis JC, Brody JA, Cade BE, Chung RH, Curran JE, Damrauer SM, de Las Fuentes L, de Vries PS, Duggirala R, Freedman BI, Graff M, Guo X, Hidalgo BA, Hou L, Irvin R, Judy R, Kalyani RR, Kelly TN, Konigsberg IR, Kral BG, Kwee LC, Levy D, Li C, Manichaikul AW, Martin LW, Montasser ME, Morrison AC, Naseri T, North KE, O'Connell JR, Palmer ND, Peyser PA, Reiner AP, Shah SH, Smit RAJ, Smith JA, Taylor KD, Tiwari H, Tsai MY, Viali S, Wang Z, Wang Y, Zhao W, Arnett DK, Blangero J, Boerwinkle E, Bowden DW, Carlson JC, Chen YI, Ellinor PT, Fornage M, He J, Heard-Costa N, Kaplan RC, Kardia SLR, Kooperberg C, Kraus WE, Lange LA, Loos RJF, Mitchell BD, Psaty BM, Rader DJ, Redline S, Rich SS, Yanek LR, Gibbs R, Gabriel S, Viaud-Martinez KA, Dutcher SK, Germer S, Kim R, Rotter JI, Lin X, Peloso GM, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, Natarajan P.
Show Full Abstract

<h4>Background</h4>Rare genetic variation provided by whole genome sequence datasets has been relatively less explored for its contributions to human traits. Meta-analysis of sequencing data offers advantages by integrating larger sample sizes from diverse cohorts, thereby increasing the likelihood of discovering novel insights into complex traits. Furthermore, emerging methods in genome-wide rare variant association testing further improve power and interpretability.<h4>Results</h4>Here, we conduct the largest meta-analysis of whole genome sequencing for low-density lipoprotein cholesterol (LDL-C), a therapeutic target for coronary artery disease, analyzing data from 246 K participants and integrating 1.23B variants from the UK Biobank and the Trans-Omics for Precision Medicine (TOPMed) program. We identify numerous rare coding and non-coding gene associations related to LDL-C, with replication across 86 K participants in All of Us. Our findings are based on single-variant analyses, rare coding and non-coding variant aggregation tests, and sliding window approaches. Through this comprehensive analysis, we identify 704 novel single-variant associations, 25 novel rare coding variant aggregates, 28 novel rare non-coding variant aggregates, and one novel sliding window aggregate.<h4>Conclusions</h4>This study provides a meta-analysis framework for large-scale whole genome sequence association analyses from diverse population groups, yielding novel rare non-coding variant associations.

CCDC92
Also flagged:KIF13Bextracellularvesiclesciliary membraneorganelleextracellular vesicle
Journal Article 2025-09-09 ✓ 2 Snippets Rezi CK, Frei A, Campestre F, Boldt K, Mary B, Fixdahl AM, With Petersen AL, Sicot A, Berggreen CR, Laplace J, Johansen SL, Sørensen JKT, Chamlali M, Berchtold MW, Christensen ST, Anvarian Z, May-Simera HL, Pedersen LB.
In-Text Gene Mentions

…distal appendage proteinCCDC92, which also localizes…

…gradual depletion ofCCDC92and PC2 from…

Show Full Abstract

Dynamic control of ciliary membrane protein content is crucial for the organelle's homeostasis and signaling function and involves removal of ciliary components by intraflagellar transport (IFT) and BBSome-mediated export, endocytic retrieval, and/or extracellular vesicle (EV) shedding. We report that the kinesin-3 motor KIF13B regulates ciliary protein composition and EV shedding in cultured kidney epithelial cells, with effects that vary over time. In early stages of ciliation, Kif13b<sup>-/-</sup> cells aberrantly accumulate polycystin-2 (PC2) within cilia and release large EVs enriched with CCDC198 and the centriole distal appendage protein CCDC92, which also localizes to the ciliary tip. These cells also produce fewer small EVs through the neutral sphingomyelinase 2 pathway. Upon cilia maturation, Kif13b<sup>-/-</sup> cells accelerate large EV release of numerous ciliary proteins, including PC2, BBSome, and IFT components, which correlates with gradual depletion of CCDC92 and PC2 from the ciliary tip and shaft, respectively. Furthermore, over time, Kif13b<sup>-/-</sup> cells show an upregulation in the release of small EVs, which differ in composition from wild-type small EVs. Specifically, mutant small EVs lack several proteins that are enriched in small EVs from BBSome-deficient cells, including palmitoyl transferase ZDHHC5, which localizes to cilia where it accumulates upon BBSome dysfunction and regulates ciliary length and PC2 levels. Our results suggest that KIF13B acts at the level of centriole distal appendages to limit ciliary protein entry and promote endocytic retrieval downstream of the BBSome, thereby suppressing EV release from cilia. Furthermore, the ciliary localization of CCDC198 and ZDHHC5 indicates they are potential novel ciliopathy candidates.

HTT
Also flagged:MembranesHuntington's diseaseHDneurodegenerative disorderpolyglutaminepathogenesis
Journal Article 2025-09-09 ✓ 2 Snippets Legleiter J.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, resulting in…

…(polyQ) tract inHTTprotein.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin (HTT) gene, resulting in an expanded polyglutamine (polyQ) tract in HTT protein. Expanded polyQ tracts cause mutant HTT (mHTT) to aggregate and accumulate as cellular inclusions. Recent studies highlight the interactions between mHTT and different cellular membranes that contribute to HD pathogenesis. Beyond being targets for mHTT-induced damage, membranes modify mHTT aggregation in a complex manner. This review explores the membrane abnormalities observed in a variety of HD models and the interplay between binding to and subsequent aggregation of mHTT on membranes, with an emphasis on N-terminal mHTT fragments. Understanding mHTT-lipid interactions may provide potential targets for therapeutic intervention that would complement other efforts.

PEBP1
Also flagged:oral aphthaeferroptosisDihydrolipoamide DehydrogenaseDLDironoral mucosal disorder
Journal Article 2025-09-09 ✓ 1 Snippet Jia B, Wu X, Wang Q, Ren J, Li G, Zheng X, Yang S.
In-Text Gene Mentions

…= 0.047) andPEBP1(IVW: p heterogeneity…

Show Full Abstract

The incidence of recurrent oral aphthae (ROA) is on the rise. Its etiology is unknown, particularly its relationship with the FODMAP diet. This investigation delved into their genetic correlation and elucidated the role of ferroptosis. Two-sample Mendelian randomization (MR) analysis was performed, and mediation MR analysis to investigate the relationship between the FODMAP Diet, Ferroptosis, and ROA using GWAS data from Finngen for ROA, deCODE for ferroptosis, and UKB for the FODMAP Diet. Subsequently, a two-step mediation analysis was conducted to examine the mediating role of Ferroptosis in the association between the FODMAP Diet and ROA. MR revealed a protective association between dried fruit and tea consumption and the risk of ROA, while poultry and beef intake showed a significant positive correlation with ROA risk. Subsequent investigation into iron-related genes identified 10 key proteins that may mediate the impact of dietary habits on ROA development. Mediation analysis demonstrated that tea consumption indirectly influenced ROA progression by modulating Dihydrolipoamide Dehydrogenase (DLD) protein expression, accounting for 21.15% of the total effect. Sensitivity analyses confirmed our results, enhancing the statistical validity of our findingsstatistical validity. This study underscores the significance of the FODMAP Diet in preventing and treating ROA. It proposes the clinical utility of DLD as a diagnostic and therapeutic target for ROA and underscores the critical role of dietary management.

PRDX6
Also flagged:Peroxiredoxin 6seleniumglutathione peroxidaseNSGPxagingheat shock proteins
Journal Article 2025-09-09 ✓ 5 Snippets Zuo H, Huang L, Huang M, Ma X, Zheng C, Holman BWB, Zhang Y, Luo X, Mao Y.
In-Text Gene Mentions

…Peroxiredoxin 6 (Prdx6) and oxidative stress…

…of peroxiredoxin 6 (Prdx6)-mediated non‑selenium glutat…

…highlights peroxiredoxin 6 (Prdx6) as a crucial…

…demonstrate that inhibitingPrdx6's on‑selenium glutathione per…

…targeted manipulation ofPrdx6activity can optimize…

Show Full Abstract

This research explored the role of peroxiredoxin 6 (Prdx6)-mediated non‑selenium glutathione peroxidase (NSGPx) activity in modulating the tenderization process of beef during post-mortem aging, extending up to 168 h. Shear force, NSGPx activity, differential protein abundance, heat shock proteins (HSP70, HSP27), and troponin-T levels were analyzed in beef longissimus lumborum muscles treated with hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>), N-acetylcysteine (NAC), mercaptosuccinic acid (MA), or saline (Control). MA treatment inhibited NSGPx activity and accelerated tenderization compared to NAC. Proteomics revealed that proteins differentially abundant between 0 and 24 h post-mortem were linked to cytoskeleton, extracellular matrix, amino acid metabolism, and apoptosis pathways.MA upregulated HSP70 abundance, oxidative stress, and troponin-T breakdown. H<sub>2</sub>O<sub>2</sub> upregulated HSP70 and HSP27 abundance only within 6-12 h post-mortem. These results demonstrate that oxidative stress treatments modulate protein dynamics during aging, offering insights into strategies to enhance beef tenderness. SIGNIFICANCE: This study highlights peroxiredoxin 6 (Prdx6) as a crucial regulatory element that affects oxidative stress-associated pathways involved in the meat tenderization process during post-mortem beef aging. We demonstrate that inhibiting Prdx6's on‑selenium glutathione peroxidase (NSGPx) enzymatic activity with mercaptosuccinic acid (MA) increases HSP70 abundance and accelerates troponin-T proteolysis through enhanced oxidative stress and calcium signaling pathways. Conversely, antioxidant N-acetylcysteine (NAC) delays tenderization by preserving cytoskeletal integrity. Our TMT-based proteomics further identifies 35 core proteins linking extracellular matrix remodeling, amino acid metabolism, and apoptosis to tenderness modulation. These findings provide the first mechanistic evidence that targeted manipulation of Prdx6 activity can optimize beef aging efficiency. For the meat industry, MA treatment offers a science-driven strategy to reduce tenderization time by >20 % within 24-72 h post-mortem, lowering processing costs while maintaining quality. This work also establishes HSP70 and troponin-T degradation as novel biomarkers for real-time monitoring of oxidative stress in meat processing systems.

HFE
Also flagged:ferricironcarbohydratecarboxymaltosederisomaltoseiron deficiency anemia
Journal Article 2025-09-09 ✓ 1 Snippet Dominguez Rieg JA, Domenech Acevedo M, Nogueira Coelho J, Stevens M, Thomas L, Rieg T.
In-Text Gene Mentions

…overload, also calledhemochromatosis, can be hereditary…

Show Full Abstract

Intravenous (IV) iron-carbohydrate nanoparticles like ferric carboxymaltose (FCM) and ferric derisomaltose (FDI) are used to treat iron deficiency anemia (IDA); however, they differ in their side-effects (e.g., hypophosphatemia). We compared the effects of FCM and FDI in a newly generated mouse model of IDA and determine their efficacy in resolving IDA and effects on mineral homeostasis. Eight-week-old female C57Bl/6J mice were fed an iron-deficient diet for 5 weeks followed by IV bleeding (0.7 % of body weight) for 3 consecutive days to establish IDA. On day 1 and 7 after induction of IDA, mice were injected with vehicle, FCM or FDI (both 20 mg kg<sup>-1</sup>). On day 14, blood, urine and tissues were collected. Compared to baseline, all mice developed microcytic hypochromic anemia. FCM and FDI treatment resolved IDA, reversed thrombocytosis, and prevented the development splenomegaly and cardiomegaly observed in vehicle-treated anemic mice. Plasma iron increased to a greater extent with FCM versus FDI. Plasma iron showed an inverse relationship with intact fibroblast growth factor 23 (iFGF23) and C-terminal FGF23 (cFGF23). The ratio of iFGF23:cFGF23 increased in all groups but for different reasons: vehicle (iFGF23↑, cFGF23↔); FCM and FDI (iFGF23↔, cFGF23↓). The ratio was ∼1.8-fold greater in FDI versus FCM at the end of the experimental period. Only FCM caused hypophosphatemia, despite the abundance of the renal Na<sup>+</sup>-P<sub>i</sub> cotransporter 2a being similarly lower (∼30 % versus vehicle) with FDI. Our results demonstrate that while FCM and FDI are equally effective at resolving IDA, hypophosphatemia is not solely caused by renal mechanisms.

Also flagged:Hydrogen sulfidecarbon monoxideYY1RKIPgastrointestinal cancerspathogenesis
Journal Article 2025-09-09 No Snippets Korbut E, Lasota M, Jankowski D, Szeleszczuk Ł, Magierowski M.
Show Full Abstract

Gastrointestinal (GI) cancers remain among the leading causes of cancer-related mortality, with challenges in early detection, therapeutic resistance, and poor prognosis. Two key molecular players, Yin Yang 1 (YY1) and Raf kinase inhibitor protein (RKIP), have emerged as important regulators of cancer progression and treatment response. This review highlights their individual and interactive roles across various GI malignancies, including gastric, colorectal, pancreatic, and liver cancers. Evidence indicates an antagonistic relationship, where YY1 promotes tumor growth and epithelial-mesenchymal transition (EMT), while RKIP counters these effects by suppressing oncogenic signaling pathways. On the other hand, endogenous gaseous transmitter, nitric oxide (NO) has been clearly shown to influence the YY1-RKIP axis. NO directly inhibits YY1 via S-nitrosylation and promotes RKIP expression, reinforcing pro-apoptotic and anti-metastatic pathways. Although some scientific evidence exists, the role of another gaseous mediator, hydrogen sulfide (H₂S), as a modulator of YY1 or RKIP remains poorly characterized. Its regulatory influence, especially via interaction with NO signaling, suggests a complex, context-dependent role. H<sub>2</sub>S/sulfides-mediated posttranslational modification of proteins - persulfidation - has been shown recently to be functionally important but not in the context of YY1 or RKIP activity. Moreover, carbon monoxide (CO) that interacts with metalloproteins has been completely overlooked as possible regulator of YY1/RKIP-dependent cancer biology. Therefore, we indicate here the possible interplay between H<sub>2</sub>S and CO with YY1/RKIP that may provide new further scientific direction in this field, based on aggressive GI tumors.

Also flagged:Neurodegenerative Diseasesmitochondrialoxygenenzyme activityamyotrophic lateral sclerosisorganelle
Journal Article 2025-09-09 No Snippets Gao L, Wang J, Bi Y.
Show Full Abstract

Neurodegenerative diseases-including Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis-are characterized by progressive neuronal loss and complex pathological mechanisms such as protein aggregation, mitochondrial dysfunction, and neuroinflammation. Conventional therapies offer limited efficacy due to the blood-brain barrier (BBB) and lack of targeted delivery. Nanotechnology has emerged as a transformative strategy for precise brain-targeted treatment. This review summarizes recent advances in nanoparticle-based drug delivery systems, including polymeric nanoparticles, liposomes, inorganic nanomaterials, and biomimetic carriers, highlighting their design features, BBB-penetration mechanisms, and disease-specific applications. Emphasis is placed on stimuli-responsive nanocarriers that react to pH, reactive oxygen species, or enzyme activity, enabling site-specific drug release. Additionally, organelle-targeting strategies-particularly those directed at mitochondria and lysosomes-are explored for their role in subcellular precision therapy. The integration of diagnostic and therapeutic modalities in theranostic nanoplatforms is also discussed. By consolidating preclinical progress and emerging technologies, this review offers insights into the future of nanomedicine in treating neurodegenerative diseases and lays the groundwork for clinical translation.

Also flagged:tumordeathcancerprogrammed cell deathpyroptosisautophagy-dependent
Journal Article 2025-09-09 No Snippets Ye X, Ju X.
Show Full Abstract

Ferroptosis is a novel class of programmed cell death that is mainly dependent on intracellular iron accumulation and lipid peroxidation. Ferroptosis is closely related to a variety of human diseases, especially different kinds of cancer. Several small molecule inducers have been developed to induce ferroptosis in tumor cells, some of which have been used in clinical studies. However, these chemical small molecules have toxic effects that limit its wide application. Natural products, however, have a natural advantage in cancer therapy due to their low toxicity and side effects. Some natural products have been found to inhibit tumor growth by inducing ferroptosis in tumor cells. In this review, we reviewed the molecular mechanism of ferroptosis and how natural products targeting ferroptosis signaling pathways affect tumor growth. We also analyzed the application of various natural products such as flavonoids, terpenoids, and alkaloids in inducing ferroptosis in tumor cells. This review will assist in the future discovery and study of more natural product inducers that can induce ferroptosis in tumor cells, and ultimately provide insights into identifying natural products that can be applied to clinical applications.

MLLT10
Also flagged:LeukemiahematopoiesisLymphomachildhood cancerscentral nervous system tumorslymphomas
Journal Article 2025-09-09 ✓ 2 Snippets Onder G, Ozdemir O, Taylan F, Canpolat C, Yalcin K, Erbey F, Sozmen BO, Asarcikli F, Bayhan T, Akcabelen YM, Yarali N, Ozbek NY, Bozkaya IO, Kacar D, Ergun B, Akkus A, Albayrak D, Ince E, Demirsoy U, Ozdemir GN, Dogru O, Aras S, Aydin E, Unal B, Amanvermez U, Dogan OA, Akyoney S, Sayitoglu M, Nordgren A, Bugra Agaoglu N, Ozbek U, Ng OH.
In-Text Gene Mentions

…JAK3, KSR1, MAP2K2,MLLT10, MUTYH, MYH11, MVP,…

…TGFBRS1, PAPSS2, andMLLT10, but none…

Show Full Abstract

<h4>Background</h4>Leukemia is the most common cancer in children, and 10%-15% of patients with leukemia/lymphoma carry pathogenic germline cancer-predisposing variants. Identifying these variants is critical for understanding the genetic predisposition and optimizing clinical management.<h4>Methods</h4>We performed germline short-read sequencing in 36 individuals from 20 families with suspected leukemia/lymphoma predisposition, including 20 index cases, 9 affected relatives, and 7 unaffected members.<h4>Results</h4>We identified 13 clinically relevant germline variants in known cancer predisposition genes including <i>TP53, ETV6, MSH6, MLH1,</i> and <i>BRCA1</i>. Notably, we uncovered novel candidate variants in <i>ATR, TNFRSF9, ETAA1</i>, and <i>KSR1</i>, which was supported by segregation analysis, consanguinity patterns, and secondary malignancy phenotypes. Several index cases exhibited striking familial cancer syndromes involving both hematologic and solid tumors, with progression from ALL to AML or glioma. Deep clinical-genomic correlation enabled reclassification of variants and refined diagnostic and therapeutic decision-making in multiple cases. The patients were referred to genetic counseling for surveillance of carriers and risk assessment for various family members.<h4>Conclusion</h4>These findings emphasize the clinical utility of germline testing in pediatric hematologic cancers by providing novel insights into the predisposition to leukemia/lymphoma and contributing to treatment regimens, donor selection, and diagnostic refinement, particularly in populations with high consanguinity.

SOX6
Also flagged:Multiple sclerosisneurodegenerative disorderaxonalmyelinextracellularMS
Journal Article 2025-09-09 ✓ 1 Snippet García-Domínguez M.
In-Text Gene Mentions

…like Hes5 andSox6, thereby disrupting the…

Show Full Abstract

Multiple sclerosis is a chronic, immune-mediated neurodegenerative disorder of the central nervous system, characterized by widespread demyelination, axonal injury, and progressive neurological impairment. The pathophysiology of multiple sclerosis involves complex interactions between immune cells and central nervous system resident cells, with oligodendrocytes (the myelin-producing glial cells) occupying a central role in both the disease's onset and progression. Oligodendrocyte dysfunction, including diminished regenerative capacity, heightened vulnerability to inflammatory cytokines, and increased susceptibility to oxidative stress, contributes significantly to the failure of remyelination observed in chronic multiple sclerosis lesions. Key factors such as microglial activation, T-cell-mediated cytotoxicity, and altered signaling pathways affecting oligodendrocyte progenitor cell maturation are explored in depth. Some therapeutic strategies under investigation encompass the use of pharmacological agents, cell-based interventions, and modulation of both the extracellular matrix and the immune microenvironment. Advancing our understanding of oligodendrocyte biology, along with the intrinsic and extrinsic factors that impede effective remyelination, is critical for the development of innovative, targeted therapies aimed at attenuating neurodegeneration and enhancing long-term clinical outcomes in patients with multiple sclerosis.

Also flagged:AMLacute myeloid leukemiamyelodysplastic neoplasmsGM-CSFimmune responsesCTLA4
Journal Article 2025-09-09 No Snippets Feng X, Filippini Velázquez G, Bohlscheid S, Unterfrauner M, Anand P, Rejeski HA, Hartz A, Baudrexler T, Schmid C, Schmetzer HM.
Show Full Abstract

<b>Background:</b> Allogeneic hematopoietic stem cell transplantation (allo-HCT) is a potentially curative treatment for high-risk acute myeloid leukemia and myelodysplastic neoplasms (AML/MDS). However, AML/MDS relapse post-transplant is driven by immune escape mechanisms, limiting treatment options and contributing to poor prognosis. Granulocyte-Macrophage Colony-Stimulating Factor (GM-CSF) and Prostaglandin-E1 (PGE-1) (termed "Kit M") induce dendritic cells of leukemic origin (DC<sub>leu</sub>) that have been shown to induce antileukemic immune responses. <b>Methods:</b> Using flow cytometry, we analyzed ICM/ICML-expressing uncultured T-cells/blasts in whole blood (WB) samples from patients with AML/MDS relapse post-allo-HCT who had received salvage treatment. Using Kit M, DC<sub>leu</sub> were generated ex vivo. T-cell-enriched mixed-lymphocyte cultures (MLC) were performed for functional assessment of DC/DC<sub>leu</sub> to stimulate (leukemia specifically) patients' immune cells. After MLC, ICM/ICML-expressing cells and immune activation were assessed. The experimental results were correlated with patients' clinical responses to salvage treatment. <b>Results</b>: WB samples from 15 patients were analyzed. On average, high frequencies of ICM (CTLA4/PD1)-co-expressing blasts and high frequencies of ICM (CTLA4/PD1/TIGIT/TIM3/2B4)-co-expressing T-cells were found in uncultured WB, compared to the frequencies of healthy ICM-expressing T-cells. Treatment with Kit M induced DC/DC<sub>leu</sub>, which, after MLC, downregulated ICM-expressing T-cells and enhanced activated and memory T-cells. High frequencies of ICM-co-expressing uncultured T-cells/blasts correlated negatively with the blast lysis capacity and patients' clinical response to relapse treatment. However, post-MLC, Kit-mediated modulation of ICM-expressing T cells did not correlate with blast lysis, nor with patients' clinical response to treatment. <b>Conclusions:</b> We conclude that Kit M contributes to overcoming impaired antileukemic reactions, independent of the presence of ICM-expressing T-cells in relapsed AML patients after allo-HCT ex vivo.

Also flagged:B-cell acute lymphoblastic leukemiaB-ALLALLmethylationhistone modificationsETV6
Journal Article 2025-09-09 No Snippets Veselinova Y, Esteller M, Ferrer G.
Show Full Abstract

B-cell acute lymphoblastic leukemia (B-ALL) remains a major clinical challenge in hematologic oncology, characterized by a continuous evolution of molecular drivers that shape its heterogeneity across the age spectrum. Pediatric B-ALL is generally associated with high cure rates, while adult forms of the disease are often more aggressive and less responsive to treatment. This review examines the age-specific genetic and epigenetic landscapes that contribute to this disparity, revealing how the nature and timing of molecular alterations point to fundamentally different leukemogenic processes. Favorable genetic aberrations, such as <i>ETV6::RUNX1</i> and hyperdiploidy, are predominant in children, whereas adults more frequently present with high-risk features, including <i>BCR::ABL1</i> fusions and <i>IKZF1</i> deletions. Epigenetic distinctions are similarly age-dependent, involving divergent patterns of DNA methylation, histone modifications, and non-coding RNA expression. For example, pediatric B-ALL frequently harbors mutations in epigenetic regulators like <i>SETD2</i> and <i>CREBBP</i>, while adult B-ALL is more commonly affected by alterations in <i>TET2</i> and <i>IDH1/2</i>. These molecular differences are not only prognostic but also mechanistic, reflecting distinct developmental trajectories and vulnerabilities. Understanding these age-driven transitions is essential for improving risk stratification and developing precision therapies tailored to the unique biology of B-ALL across the lifespan.

OLFM4
Also flagged:BRAFMEKColorectal cancercancerdeathsesquiterpene lactone
Journal Article 2025-09-09 ✓ 1 Snippet Chen JS, Enwolo-Chibueze CG, Chinyama HA, Lai CT, Ezeala IC, Huang PY, Wu ATH, Huang YJ.
In-Text Gene Mentions

…PI3K mutation upregulatesOLFM4, which promotes tumor…

Show Full Abstract

Colorectal cancer (CRC) remains a leading cause of cancer-related death worldwide, with resistance to targeted therapies presenting a significant clinical challenge. This study combines computational and experimental methods to identify and validate Antrocin, a natural sesquiterpene lactone, as a potential multi-target inhibitor of the BRAF/MEK/PI3K oncogenic pathway in CRC. Differential gene expression and mutational analyses were performed using public datasets (TCGA, TNMplot, GEPIA2, GSCA, PANDA, and cBioPortal) to assess the prevalence and clinical significance of BRAF, MEK, and PI3K alterations in CRC. In silico molecular docking, using AutoDock Vina, predicted strong binding affinities of Antrocin to BRAF (ΔG = -8.5 kcal/mol), MEK (ΔG = -7.3 kcal/mol), and PI3K (ΔG = -6.9 kcal/mol), comparable to those of FDA-approved inhibitors for BRAF (Dabrafenib), MEK (Trametinib), and PI3K (Alpelisib). Drug-likeness and ADME properties were evaluated via SwissADME and ADMETlab, supporting Antrocin's potential as a drug candidate. In vitro assays using HCT116 and RKO CRC cell lines validated that Antrocin treatment suppressed cell viability, spheroid formation, and migration, accompanied by reduced expression levels of the oncogenic BRAF/MEK/PI3K signaling pathway. Antrocin-treated tumor-conditioned medium experiments demonstrated Antrocin's ability to reduce the differentiation of cancer-associated fibroblasts and the polarization of M2 macrophages. Preclinical mouse xenograft experiments demonstrated a delay in tumor growth following treatment with Antrocin. These results suggest that Antrocin, identified through computational screening and validated experimentally, could be a promising multi-target agent to overcome therapy resistance in CRC.

Also flagged:GliotoxinepidithiodiketopiperazinesdisulfidediketopiperazinesynthesisNF-κB
Journal Article 2025-09-09 No Snippets Li L, Liu Y, Wang Q, Song H.
Show Full Abstract

Gliotoxin, an important fungal secondary metabolite, belongs to the class of epidithiodiketopiperazines (ETPs) and exhibits various biological activities, including immunosuppression, induction of apoptosis, and antimicrobial, antiviral, and antitumor effects. Since the initial discovery of gliotoxin and its derivatives from various fungal species, significant progress has been made in the development of isolation methods for these compounds. Understanding biosynthetic pathways and studying the functions of associated gene clusters have provided valuable mechanistic insights. To overcome the challenges of large-scale production, organic chemists have developed innovative strategies, including the construction of disulfide-containing diketopiperazine scaffolds, the synthesis of key intermediates, and the performance of enantioselective total synthesis. Recent research has further broadened our knowledge of their biological activities and molecular mechanisms, especially regarding apoptosis induction, immunomodulatory effects, antimicrobial and antitumor efficacy, structure-activity relationships, and pharmaceutical potential. This review systematically covers the evolution of gliotoxin research, from isolation techniques and biosynthetic gene cluster analysis to synthetic route development and pharmacological studies, emphasizing its diverse applications in biomedical and pesticide fields.

Also flagged:cancertumorlocalizationtumorstranslationalpathogenesis
Journal Article 2025-09-09 No Snippets Su YY, Ji FY, Zheng ZJ, Peng JY, Xie JJ.
Show Full Abstract

In recent years, the global burden of cancer has grown substantially, yet available treatments and clinical outcomes remain inadequate. Accordingly, research into novel therapeutic targets for cancer has become a major focus. Super-enhancers (SEs), which are clusters of multiple enhancers, represent essential epigenetic oncogenic factors that are critical for maintaining cancer cell identity. Moreover, SE-driven long non-coding RNAs (lncRNAs) play a crucial regulatory role in tumor initiation and progression. Targeting cancer-specific SE-driven lncRNAs can slow tumor development and offer a novel strategy for cancer treatment. This review first outlines the characteristics of SEs, including their relevance to phase separation (PS) and the core transcriptional regulatory circuitry (CRC). It then describes the fundamental characteristics, intracellular localization, and functions of SE-driven lncRNAs, with emphasis on the analytical methods for these lncRNAs and their roles in tumors. Finally, the review highlights the clinical applications of existing SE inhibitors in oncology and their potential for targeting SE-driven lncRNAs, aiming to advance translational research in this field.

bioRxiv 2025-09-09 Preprint (No Snippets API) Pulido Barrera DC, You JE, Xu F, Verheijen T, Sawh AN, Kos P, Giorgetti L, Molina N, Brückner D, Mango SE.
Show Full Abstract

Chromosomes fold into distinct domains that regulate transcription, replication, and repair. Beyond well-characterized TADs and compartments, the diversity of heterochromatin domains remains poorly defined at the sequence level. Using single-molecule tracing of nascent heterochromatin in C. elegans , we identify three classes of megabase-scale domains: (i) sharp-boundary, Condensin I–dependent Topological Associating Domain-like domains (TADLs); (ii) similarly sized, but Condensin-independent, el egans Condensin -Independent D omains (elCIDs); and (iii) weaker, diffuse structures that are abundant in the population. TADLs arise early in development, preceding elCIDs, and both become progressively compacted through H3K9 methylation, which promotes intra- and inter-domain proximity. Condensin mutations disrupt TADLs, yet single molecules can still form domain-like structures, as recapitulated by free polymer simulations. However, these differ markedly in boundary positioning and biophysical properties. Our results uncover previously unrecognized heterochromatin architectures and demonstrate that single-molecule analysis and mutational dissection provide valuable approaches for distinguishing between domain types.

B4GALT5
Also flagged:sulfatideintraductal papillary mucinous neoplasmintraductal papillary mucinous neoplasmsPDACsulfatidesFA2H
Journal Article 2025-09-08 ✓ 1 Snippet Chen Y, Ballarò R, Sans M, Thege FI, Zuo M, Dou R, Min J, Yip-Schneider M, Zhang J, Wu R, Irajizad E, Makino Y, Rajapakshe KI, Rudsari HK, Hurd MW, León-Letelier RA, Katayama H, Ostrin E, Vykoukal J, Dennison JB, Do KA, Hanash SM, Wolff RA, Guerrero PA, Kim M, Schmidt CM, Maitra A, Fahrmann JF.
In-Text Gene Mentions

B4GALT5

Show Full Abstract

<h4>Background</h4>We conducted an integrated cross-species spatial assessment of transcriptomic and metabolomic alterations associated with progression of intraductal papillary mucinous neoplasms (IPMNs), which are <i>bona fide</i> cystic precursors of pancreatic ductal adenocarcinoma (PDAC).<h4>Objective</h4>We aimed to uncover biochemical and molecular drivers that underlie malignant progression of IPMNs to PDAC.<h4>Design</h4>Matrix-assisted laser desorption/ionisation (MALDI) mass spectrometry (MS)-based spatial imaging and Visium spatial transcriptomics (ST) was performed on human resected IPMN/PDAC tissues (n=23) as well as pancreata from a mutant <i>Kras;Gnas</i> mouse model of IPMN/PDAC. Functional studies in murine IPMN/PDAC-derived <i>Kras;Gnas</i> cells were performed using CRISPR/cas9 technology, small interfering RNAs, and pharmacological inhibition.<h4>Results</h4>MALDI-MS analyses of patient tissues revealed long-chain hydroxylated sulfatides to be selectively enriched in the neoplastic epithelium of IPMN/PDAC. Integrated ST analyses showed cognate transcripts involved in sulfatide biosynthesis, including <i>UGT8</i>, <i>Gal3St1</i>, and <i>FA2H</i>, to co-localise with areas of sulfatide enrichment. Genetic knockout or pharmacological inhibition of UGT8 in <i>Kras;Gnas</i> IPMN/PDAC cells decreased protein expression of FA2H and Gal3ST1 with consequent alterations in mitochondrial morphology and reduced mitochondrial respiration. Small molecule inhibition of UGT8 elicited anticancer effects via ceramide-mediated compensatory mitophagy and activation of intrinsic apoptosis pathways. In vivo, UGT8 inhibition suppressed tumour growth in allograft models of murine IPMN/PDAC cells derived from <i>Kras;Gnas</i> and <i>Kras;Tp53;Gnas</i> mice.<h4>Conclusion</h4>Our work identifies enhanced sulfatide metabolism as an early metabolic alteration in cystic precancerous lesions of the pancreas that persists through invasive neoplasia and a potential actionable vulnerability in IPMN-derived PDAC.

Also flagged:Infertilitymale infertilitymale infertilityemotional distressmale factor infertilityreproduction
Journal Article 2025-09-08 No Snippets Barada S, Alameer M, Aldhaheri RH, Hamdan H, Kashir J.
Show Full Abstract

Infertility is a global health issue affecting a significant portion of couples, estimated at ∼10-15% of reproductive-aged couples worldwide, with the World Health Organisation (WHO) suggesting roughly one in six (∼17.5%) of the adult population experiences infertility. Male causes of infertility are attributable as a sole or leading cause in 40-50% of cases. Furthermore, sperm/semen counts have plummeted by ∼60% over the past 50-60 years in males attending fertility clinics. There is thus an urgent need to understand the causes behind these numbers to address such worrying trends. However, human male infertility is a heterogeneous and often idiopathic condition, with genetic factors increasingly recognised as major contributors. In this review, we examine known and emerging genetic causes of male infertility, highlighting how knockout mouse models have been leveraged to understand not only male reproductive biology and sperm physiological function, but also to illustrate how specific genetic disruptions correspond to particular reproductive failures, discussing how such mouse models are illuminating the causes of human idiopathic male infertility and guiding the discovery of novel infertility genes. We compare the similarities and differences between human and mouse infertility, not only identifying areas of further investigation that require urgent attention, but also potential novel avenues of therapeutic treatment.

HFE
Also flagged:MucormycosisNeutropenic Enterocolitisfungal infectioncolitisB-cell acute lymphoblastic leukemiaamphotericin
Journal Article 2025-09-08 ✓ 2 Snippets AlBassam HJ, Alanazi W, Al Rashid F, Alruwaii ZI, Almusa Z.
In-Text Gene Mentions

Hemochromatosisand deferoxamine therapy…

…used to treathemochromatosis, paradoxically increases the…

Show Full Abstract

BACKGROUND Gastrointestinal mucormycosis is an underrecognized and underreported fungal infection with a high mortality rate. Diagnosis is often confounded by a non-specific constellation of signs and symptoms. We present a case of neutropenic colitis and ileocecal perforation secondary to gastrointestinal mucormycosis. CASE REPORT The patient was a 19-year-old man recently diagnosed with B-cell acute lymphoblastic leukemia, on active chemotherapy. He presented with abdominal pain and tenderness, and a contrast-enhanced CT revealed neutropenic colitis. Despite broad-spectrum antibiotics, his condition worsened, prompting reassessment. Follow-up CT showed bowel ischemia and a pelvic collection. He underwent an emergency laparotomy, which revealed destruction of the anterior cecal wall and detachment from the terminal ileum and ascending colon. Ileocecal resection was performed and histopathologic examination demonstrated angioinvasive fungal elements consistent with Mucor spp. He was diagnosed with gastrointestinal mucormycosis and promptly started on amphotericin intravenously. He improved over the next 2 weeks and was discharged with a plan to continue his 6-week course as an outpatient, followed by oral posaconazole maintenance therapy. Several weeks later, his infection relapsed secondary to non-compliance. He underwent repeat surgical debridement and antimicrobial therapy was restarted with intravenous amphotericin and Isavuconazole. He successfully completed 6 weeks of treatment and was transitioned to oral Isavuconazole prophylaxis. He remained stable and relapse-free at 6 months following his second procedure. CONCLUSIONS The case highlights the importance of early recognition of patients at risk for this infection, maintaining a high index of suspicion, and employing aggressive medical and surgical management strategies to avoid mortality.

Also flagged:NQO1diabetic kidney diseaseNAD(P)H: quinone oxidoreductase 1hyperglycemiafoot processribosome
Journal Article 2025-09-08 No Snippets Lee Y, Lee SH, Moon E, Park H, Jo J, Hwang JH, Choi DE.
Show Full Abstract

Diabetic kidney disease (DKD) involves oxidative stress-driven damage to glomeruli (Gloms) and proximal convoluted tubules (PCT). NAD(P)H: quinone oxidoreductase 1 (NQO1) regulates redox balance, but its compartment-specific role remains unclear. Streptozotocin (STZ)-induced hyperglycemia increased albuminuria and foot process effacement, with NQO1 KO (NKO) mice exhibiting greater podocyte injury than WT, indicating exacerbated glomerular damage. To investigate the underlying mechanisms, we conducted compartment-specific transcriptomic Gene Set Enrichment Analysis (GSEA) in Gloms and PCT. In Gloms, ribosome biogenesis and immune pathways were upregulated in WT-STZ compared to WT but suppressed in NKO-STZ compared to STZ, indicating impaired protein synthesis and immune regulation in NQO1 deficiency. In PCT, ribosome activity, oxidative phosphorylation, glutathione metabolism, and cytoskeletal pathways were elevated in WT-STZ compared to WT but suppressed in NKO-STZ compared to WT-STZ. However, ribosome activity was relatively less affected than in Gloms. Additionally, adherens junction activation was more pronounced in WT-STZ Gloms than in NKO mice Gloms, suggesting a compensatory mechanism to maintain podocyte foot process integrity. This response involved key cytoskeletal genes, including Actg1, Ctnna1, Tjp1, Rhoa, and Iqgap1. These findings highlight compartment-specific adaptive responses to STZ-induced hyperglycemia and underscore NQO1's role in regulating these adaptations. Our results suggest that enhancing NQO1 activity may restore redox balance and preserve nephron integrity, supporting its potential as a therapeutic target for DKD. Furthermore, the observed compartment-specific responses highlight the need for precision redox therapies tailored to glomerular and tubular vulnerabilities.

ZNF644
Also flagged:myopiaSLC39A5TNFRSF21CPSF1high myopiaHigh
Journal Article 2025-09-08 ✓ 5 Snippets Liu Y, Zhang SC, Zhang W, Xue ZQ, Qin YX, Piao SY, Li WJ, Ji ML, Zhuang WJ.
In-Text Gene Mentions

…in TNFRSF21, CPSF1,ZNF644, and SLC39A5 are…

…of TNFRSF21, CPSF1,ZNF644, and SLC39A5 on…

…> G) inZNF644, and (…

…to autosomal dominant:ZNF644[ 12 ]…

…TNFRSF21, CPSF1, OPN1LW,ZNF644, and SLC39A5 ,…

Show Full Abstract

<h4>Purpose</h4>To investigate the variants in 18 disease-causing genes associated with nonsyndromic myopia in 83 Chinese individuals diagnosed with early-onset high myopia(eo-HM).<h4>Methods</h4>Variants in 18 candidate genes in 83 probands with eo-HM were distinguished by whole-exome sequencing (WES) and assessed by multistep bioinformatics analysis.<h4>Results</h4>Four likely pathogenic variants were detected in 4 of the 83 probands (4.8%) with eo-HM. All of these are missense variants, such as (NM_014452: c.443C > T) in TNFRSF21, (NM_013291: c.799C > G) in CPSF1, (NM_201269.3: c.3266A > G) in ZNF644, and (NM_001135195: c.577G > A) in SLC39A5. These variants were verified by Sanger sequencing, and all allele frequencies were less than 0.01 in the 1000G, ExAC, ESP6500, and gnomAD databases. In addition, the pathogenicity of these variants was determined using several computational tools including SIFT, Mutation Taster, Polyphen-2, PROVEAN, M-CAP, CADD, and DANN. However, it should be noted that the Tyr1089Cys variant was classified as neutral solely using PROVEAN.<h4>Conclusion</h4>Our findings support the hypothesis that the variants observed in TNFRSF21, CPSF1, ZNF644, and SLC39A5 are the causative genes of eo-HM and expand the spectrum of eo-HM variants observed across various ethnic groups. The dissemination of knowledge on the impact of TNFRSF21, CPSF1, ZNF644, and SLC39A5 on eo-HM is under investigation.

PRDX6
Also flagged:brain damageto hypoxiareflexHIF1Gene expressionHIF
Journal Article 2025-09-08 ✓ 1 Snippet Rodriguez-Casariego JA, Gillette P, Schmale M, Miller MW, Fieber LA.
In-Text Gene Mentions

…xidant/quality-control genes (PRDX6, SOD1 ,…

Show Full Abstract

Current therapeutics for hypoxic/ischemic brain damage can benefit from insights resulting from the study of hypoxia/anoxia-resistant organisms. Hypoxia resistance, however, is not a common feature in mammalian models. Being naturally exposed to hypoxic/anoxic conditions, the sea hare <i>Aplysia californica</i> could become a very useful model for the study of hypoxia resistance. Here, we experimentally exposed two cohorts of <i>A. californica</i>, resulting from crosses of adults with different environmental exposure histories, to daily 6 h pulses of hypoxic water conditions (<1.8 mgO<sub>2</sub>/mL) for six consecutive days. The transcriptional response to hypoxia was evaluated in the abdominal and pleural/pedal ganglia through the exposure, during rapid reoxygenation, and after >12 h of recovery. Resistance to hypoxia was observed in the offspring of wild animals, with no significant changes in growth and reflex performance, compared with unexposed controls of the same cohort. Impairments were observed however in the offspring of lab-reared individuals. Transcriptional response to hypoxia was larger in the abdominal ganglia compared with the pleural/pedal for both cohorts, and significant differences between cohorts were observed for both ganglia. Overall, wild-cross animals displayed a significant reduction in the expression of metabolic genes, and an increased expression of genes involved in stress-response and immune system functions compared with the lab-cross cohort, both under control conditions and during hypoxia exposures. The resistant group displayed similar gene-level regulation as that described to be involved in hypoxia/ischemia preconditioning (HPC/IPC) in mammalian models, including the frontloading of HIF1-a orthologs and other neuroprotective genes like VEGF and HSP70.<b>NEW & NOTEWORTHY</b> Our results indicate that regular exposure to challenging natural conditions activates mechanisms involved in hypoxia resistance in <i>Aplysia californica</i>. This experience is passed to the next generation, fading in the absence of exposure for at least two generations. Gene expression and physiological responses varied significantly between resistant and sensitive sea hares under normoxic and hypoxic conditions, displaying clear evidence of preconditioning in core hypoxia response pathways like HIF.

PRDX6
Also flagged:Infectious diseaseszoonosisantibodyimmune responseviral infectionPattern recognition receptors
Journal Article 2025-09-08 ✓ 1 Snippet Chen J, Li P, Li L, Li J, Jiang Y, Zou W, Hao P, Gao Z, Hao J, Shi X, Fei D, Ma M, Wang G, Li C.
In-Text Gene Mentions

…(PRDX5), and 1-Cys (PRDX6) [ 24 ,…

Show Full Abstract

In this study, we identified a new chicken-specific protein, named chicken interferon-related antiviral protein (chIRAP) after sequence analysis and comparison, which inhibited the proliferation of various viruses including influenza A virus (IAV) and Newcastle Disease Virus (NDV) in vitro, and chicken embryos with high expression of chIRAP reduced IAV infection. Mass spectrometry analysis of chIRAP interacting proteins and screening of interacting proteins affecting the function of chIRAP revealed that the deletion of endogenous chicken peroxiredoxin 1 (chPRDX1) significantly reduced the antiviral effect of chIRAP. In order to clarify the functional site of chPRDX1 affecting the antiviral effect of chIRAP, we constructed the point mutants of chPRDX1 based on the results of molecular docking (D79A, T90A, K93A, Q94A, R110A, R123A), and screened the sites affecting the antiviral effects of chIRAP by knockdown of endogenous chPRDX1 combined with the overexpression mutant strategy, the results showed that the mutations in the sites affected the antiviral effects of chIRAP to different degrees, with D79A being the most significant, and the D79A mutation of chPRDX1 reduces the ability of chPRDX1 to regulate reactive oxygen species (ROS). chIRAP may exert antiviral effects by regulating the intracellular ROS balance at the D79 site of chPRDX1. In conclusion, we identified a novel chicken-derived antiviral protein, clarified its antiviral effects and preliminarily explored its mechanism of action, which provides a new tool and option for the prevention and treatment of avian-origin viral diseases, especially avian-origin related zoonotic diseases.

Also flagged:hereditary hemorrhagic telangiectasiaepistaxisHHTautosomal dominant vascular disordermembranesarteriovenous malformations
Journal Article 2025-09-08 No Snippets Du X, Lu Y, Luo X, Cao X.
Show Full Abstract

Characterized by abnormalities of the blood vessel wall, hereditary hemorrhagic telangiectasia is an autosomal dominant disorder. Recurrent or spontaneous epistaxis is the most prevalent symptom of hereditary hemorrhagic telangiectasia, whose severity varies greatly, ranging from moderate self-limiting epistaxis to severe, life-threatening epistaxis, which often requires multiple treatments and is therefore a challenge for otorhinolaryngologists. This case report retrospectively analyzed the clinical data and family history of a patient who presented to the Department of Otorhinolaryngology, Hangzhou First People's Hospital, with recurrent epistaxis for 60 years. The patient was treated with Little's area septomucotomy combined with electrocoagulation for epistaxis, and her clinical symptoms and specialty findings showed significant improvement after four postoperative follow-up visits. This article reviews the possible mechanisms and treatment progress of epistaxis caused by hereditary hemorrhagic telangiectasia, with the aim of improving diagnosis and clinical management of this disease.

HFE
Also flagged:Liver Cancerhepatocellular carcinomacancerefflux pumpsATP-binding cassetteATPase
Journal Article 2025-09-08 ✓ 1 Snippet Yudhistira T, Yunker B, Dhir L, Ho YS, Liu S, Guo P.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Liver cancer, particularly hepatocellular carcinoma (HCC), poses significant treatment challenges due to chemoresistance and cancer recurrence. Similar to customs at the border, the liver detoxifies incoming chemicals via efflux pumps and overexpresses ATP-binding cassette (ABC) drug exporters, leading to chemoresistance. ABC contains a multihomosubunit structure and a revolving transport mechanism, actively effluxing drugs from cancer cells, thereby reducing intracellular drug accumulation and therapeutic efficacy. Based on the understanding of the dsDNA translocating mechanism and complete inhibition observed in the multihomosubunit-revolving ATPase of the Phi29 DNA packaging motor, we report here an unprecedented approach to develop a potent HCC drug mimicking the series-circuits of "Christmas light bulbs", as described by the calculation formula: x=(p+q)z=∑M=0Z(ZM)pZ-MqM=∑M=0Z(Z!M!(Z-M)!)pZ-MqM. RNA nanotechnology offers a novel "Christmas light bulb series circuit" strategy, inspired by the Phi29 hexameric RNA-driven DNA packaging motor, in which targeting a single subunit completely inhibits the entire cassette. The concept has been validated by delivering Paclitaxel and miRNA via RNA nanostructures to inhibit the homomeric multisubunit ABC drug efflux pump P-gp in HCC in a mouse model. The programmable and multivalent nature of RNA nanotechnology enables the codelivery of multiple high-payload therapeutics, combined with liver-targeting ligands such as GalNAc, thereby achieving synergistic anticancer effects. This review highlights the mechanistic insights into potent HCC drug design, the advantages of RNA nanotechnology, and the structure-function relationship of ABC and other ATPase transporters, emphasizing a targeted strategy to overcome chemoresistance in liver cancer.

PTGIS
Also flagged:deathmicrocirculationion channelsageing-associatedtransportationhistidine
Journal Article 2025-09-08 ✓ 1 Snippet Saemann L, Wächter K, Großkopf A, Pohl S, Georgevici AI, Hoorn F, Korkmaz-Icöz S, Karck M, Simm A, Szabó G.
In-Text Gene Mentions

…However,PTGIS, a prostaglandin-synthase, ad…

Show Full Abstract

We compared the effects of ex-vivo machine perfusion (EVMP) of hearts donated after circulatory death (DCD) with the single-shot solutions HTK-N and Del Nido cardioplegia (DNC) on left-ventricular (LV) contractility and myocardial microcirculation. In a DCD pig model, hearts were maintained by EVMP with hypothermic, oxygenated HTK-N (DCD-HTK-N; N = 8) or DNC (DCD-DNC; N = 8) followed by reperfusion with blood, including assessment of contractility and microcirculation with Laser-Doppler-Flow (LDF). We performed transcriptomics using microarrays. In DCD-HTK-N, the ESP, dp/dt<sub>max</sub> and dp/dt<sub>min</sub> were significantly higher (p < 0.05) compared to DCD-DNC. Relative LDF was higher in DCD-HTK-N vs. DCD-DNC. Pathways related to inflammatory mediators, cAMP, ion channels, intracellular signaling, and cell death were regulated differently. In DCD-HTK-N, longevity-associated pathways were up-, and ageing-associated pathways were downregulated. EVMP of DCD hearts with HTK-N results in a superior LV function, microcirculation, and regulation of pathways with short- and long-term relevance compared to DNC.

DCC
Also flagged:CXCL1CXCL2CXCL5CXCR2transcription factorscolitis
Journal Article 2025-09-08 ✓ 1 Snippet Li M, Wang X, Hu W, Cheng X, Sun Q, Wu Y, Huang Z, Chen J.
In-Text Gene Mentions

…including TP53 andDCC[ 12 –…

Show Full Abstract

Dysregulated transcription factors critically link chronic inflammation to oncogenesis in colitis-associated colorectal cancer (CAC), but their mechanistic roles remain incompletely understood. By integrating microarray and transcriptome sequencing data from ulcerative colitis (UC), colitis-associated cancer (CAC), and colorectal cancer (CRC) patients, we identify C/EBPβ as a key transcriptional regulator whose elevated expression inversely correlates with survival. In azoxymethane (AOM)/dextran sulfate sodium (DSS)-induced CAC models, intestinal epithelial C/EBPβ is upregulated during tumor progression, which is correlated with exacerbated tumor burden and neutrophil infiltration. Mice with intestinal epithelial-specific <i>Cebpb</i> deletion ( <i>Cebpb</i> <sup>ΔIEC</sup>) are resistant to carcinogenesis, accompanied by reduced neutrophil infiltration and tumor growth. Mechanistically, C/EBPβ transcriptionally activates CXCR2 ligands (CXCL1, CXCL2, and CXCL5) to drive neutrophil recruitment. Pharmacological inhibition of CXCR2 phenocopies the anti-tumor effects of <i>Cebpb</i> <sup>ΔIEC</sup> deletion, further validating this axis as a therapeutic target. Correlation analysis of patient tissues confirms positive relationships between C/EBPβ, CXCR2 ligands, and neutrophil infiltration, suggesting that targeting the C/EBPβ-CXCL1/2/5-CXCR2 axis may constitute a novel strategy for treating CAC.

HTT
Also flagged:SIRT1HDneurodegenerative disordermitochondrialSirtuin 1SIRT 1
Journal Article 2025-09-08 ✓ 1 Snippet Kardam S, Kumar P.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, leading to…

Show Full Abstract

Huntington’s disease (HD) is a progressive neurodegenerative disorder caused by mutations in the huntingtin (HTT) gene, leading to transcriptional dysregulation, mitochondrial dysfunction, and neuronal loss. Sirtuin 1 (SIRT 1), a NAD+-dependent deacetylase, can be neuroprotective in gene expression. Selective SIRT1 inhibition may restore transcriptional balance, making it a potential therapeutic strategy. To identify natural product-derived SIRT1 inhibitors with potential therapeutic relevance for HD. Selisistat (EX-527), a selective SIRT1 inhibitor, was used as a reference to retrieve 1401 structurally similar compounds (Tanimoto similarity ≥68%) from the LOTUS natural products database. Drug-likeness and ADMET properties were evaluated, followed by molecular docking against the catalytic domain of SIRT1 (PDB ID: 4I5I). Top hits underwent 100 ns molecular dynamics (MD) simulations in GROMACS 2023.3, and binding free estimation via MM/PBSA. Three compounds, LTS0217483, LTS0173725, and LTS0193492, showed higher binding affinities than Selisistat. LTS0217483 had the most favourable total binding energy (-183.52 kJ/mol) and maintained stable interactions with key catalytic residues. Hydrogen bond persistence analysis demonstrated consistent ligand-protein contacts. An integrated computational approach identified LTS0217483 as a promising natural SIRT1 inhibitor for potential HD treatment. Future work will focus on compound optimisation, quantitative structure-activity relationship (QSAR) modelling, and experimental validation in cellular and animal HD models. A computerised drug discovery system has identified potential SIRT1 inhibitors that can treat Huntington’s disease. The Tanimoto was used to search for the similarity of 276,518 natural products from the LOTUS database in the presence of Selisistat as a reference, and 1401 compounds were retrieved. An in-silico method to predict AMDET properties was used, and the molecules that satisfied Lipinski’s rule were found to be the lead set. These were also excluded from the BBB permeability, Brenk, and PAINS filters. Subsequently, molecular docking and molecular dynamics simulations were performed, and MM/PBSA binding free energy calculations were conducted to validate the thermodynamic stability of the protein-ligand complexes. The compound LTS0217483 was chosen because it has the best potential inhibitor, as it has a good binding capability and a more stable configuration that could be a future drug target.

POU3F2
Also flagged:genetic epilepsy syndromeepileptic encephalopathySCN8Asodium channel Nav1.6epilepsynucleus
Journal Article 2025-09-08 ✓ 1 Snippet McCrimmon CM, Toker D, Pahos M, Cao Q, Lozano K, Lin JJ, Parent JM, Tidball A, Zheng J, Molnár L, Mody I, Novitch BG, Samarasinghe RA.
In-Text Gene Mentions

…assembloids expressed BRN2 (POU3F2, superficial cortical layer),…

Show Full Abstract

Neurodevelopmental disorders often impair multiple cognitive domains. For instance, a genetic epilepsy syndrome might cause seizures due to cortical hyperexcitability and present with memory impairments arising from hippocampal dysfunction. This study examines how a single disorder differentially affects distinct brain regions using induced pluripotent stem cell (iPSC)-derived cortical- and hippocampal-ganglionic eminence assembloids to model developmental and epileptic encephalopathy 13, a condition arising from gain-of-function mutations in the SCN8A gene encoding the sodium channel Nav1.6. While cortical assembloids showed network hyperexcitability akin to epileptogenic tissue, hippocampal assembloids did not, and instead displayed network dysregulation patterns similar to in vivo hippocampal recordings from epilepsy patients. Predictive computational modeling, immunohistochemistry, and single-nucleus RNA sequencing revealed changes in excitatory and inhibitory neuron organization that were specific to hippocampal assembloids. These findings highlight the unique impacts of a single pathogenic variant across brain regions and establish hippocampal assembloids as a platform for studying neurodevelopmental disorders.

DCC
Also flagged:MACF1Microtubule-actin cross-linking factor 1microtubulesgrowth arrest-specific 2Gas2zinc
Journal Article 2025-09-08 ✓ 1 Snippet Dekker J, Schot R, Aldinger KA, Everman DB, Washington C, Jones JR, Sullivan JA, Spillmann RC, Shashi V, Vitobello A, Denommé-Pichon AS, Mosca-Boidron AL, Perrin L, Auvin S, Zaki MS, Gleeson JG, Meave N, Wallace C, Nambot S, Delanne J, Ruggiero SM, Helbig I, Fitzgerald MP, Leventer RJ, Grange DK, Argilli E, Sherr EH, Prakash S, Neilson DE, Nicita F, Sferra A, Bertini ES, Aiello C, Brockmann K, Kuranov AB, Kaulfuss S, Basit S, Alluqmani M, Almatrafi A, Friedman JM, Guimond C, Mohammed F, Sharma P, Goel D, Wirth T, Anheim M, Bahena P, Koparir A, Kolokotronis K, Vona B, Haaf T, Kunstmann E, Maroofian R, Sczakiel HL, Boschann F, Misra-Isrie M, Louie RJ, Stolerman ES, Sanchez-Lara PA, Mergler S, Oegema R, Zarate YA, Kariminejad A, Tajsharghi H, Zeidler S, Kievit AJA, Bouman A, Cappuccio G, Brunetti-Pierri N, Stuurman KE, Swols DM, Tekin M, Upadia J, Martin DM, Craven D, Hiatt SM, van de Pol LA, D'Arco F, Margot H, Wilke M, Yousefi S, Barakat TS, van Veghel-Plandsoen MM, Aronica E, Anink J, Rogers SL, Slep KC, Doherty D, Dobyns WB, Mancini GMS.
In-Text Gene Mentions

DCC

Show Full Abstract

Microtubule-actin cross-linking factor 1 (MACF1) is a large protein of the spectraplakin family, which is essential for brain development. MACF1 interacts with microtubules through the growth arrest-specific 2 (Gas2)-related (GAR) domain. Heterozygous MACF1 missense variants affecting the zinc-binding residues in this domain result in a distinctive cortical and brain stem malformation. Evidence for other MACF1-associated disorders is still limited. Here, we present a cohort of 45 individuals with heterozygous or bi-allelic MACF1 variants to explore the phenotypic spectrum and assess possible pathogenic relevance. We observe that de novo heterozygous missense variants in the EF-hand domains also result in distinctive brain malformation and provide experimental evidence that variants in the EF-hand/GAR module increase microtubule binding, suggestive of a toxic gain of function. Notably, no phenotype-genotype correlation was possible for the remaining heterozygous variants in other domains. A clinical review of eight families with bi-allelic variants reveals a possible complex neurodevelopmental syndrome of the central and peripheral nervous systems. In these individuals, bi-allelic variants mostly affect the Plakin domain. Furthermore, RNA sequencing and chromatin immunoprecipitation (ChIP) analyses of human fetal brain tissue reveal five MACF1 isoforms with region-specific expression, differing in their exon 1 transcription start sites but splicing to a common exon 2. This differential expression explains the frontal-predominant lissencephaly in an individual with a homozygous stop-gain in exon 1 (MACF1-204: c.70C>T [p.Arg24∗]), as this isoform is preferentially expressed in the frontal cortex. We conclude that MACF1-related disorders are strictly linked to domain function and the level of transcript expression, explaining the observed wide clinical heterogeneity.

OLFM4
Also flagged:esophageal adenocarcinomaBEintestinal metaplasiacarcinomaCD4gastroesophageal reflux disease
Journal Article 2025-09-08 ✓ 5 Snippets Wenzel MC, Dasmeh P, Plum PS, Giel AS, Hoppe S, Franitza M, Jonas C, Thieme R, Zhao Y, Heider D, Palles C, Fitzgerald RC, Bruns CJ, Buettner R, Quaas A, Gockel I, Maj C, Chon SH, Schumacher J, Hillmer AM.
In-Text Gene Mentions

…stem cell geneOLFM4

…olfactomedin 4 (OLFM4), 12 ,…

…stem cell markerOLFM4.…

OLFM4characterizes undifferentiated…

…strong expression ofOLFM4in intestinal metaplasia…

Show Full Abstract

Inherited genetic variants contribute to Barrett's esophagus (BE) and esophageal adenocarcinoma (EAC), but it is unknown which cell types are involved in this process. We performed single-cell RNA sequencing of BE, EAC, and paired normal tissues and integrated genome-wide association data to determine cell-type-specific genetic risk and cellular processes that contribute to BE and EAC. The analysis reveals that EAC development is driven to a greater extent by local cellular processes than BE development and suggests that one cell type of BE origin (intestinal metaplasia cells) and cellular processes that control the differentiation of columnar cells are of particular relevance for EAC development. Specific subtypes of fibroblasts and endothelial cells likely contribute to BE and EAC development, while dendritic cells and CD4<sup>+</sup> memory T cells seem to contribute to BE development. The diagnostic value of markers characterizing the cell types and cellular processes should be explored for EAC prediction.

Also flagged:mitochondrialMitochondriatoorganellesmembranecytochrome c
Journal Article 2025-09-08 No Snippets Gunawan AL, Liparulo I, Stahl A.
Show Full Abstract

A variety of stressors, including environmental insults, pathological conditions, and transition states, constantly challenge cells that, in turn, activate adaptive responses to maintain homeostasis. Mitochondria have pivotal roles in orchestrating these responses that influence not only cellular energy production but also broader physiological processes. Mitochondria contribute to stress adaptation through mechanisms including induction of the mitochondrial unfolded protein response (UPR<sup>mt</sup>) and the integrated stress response (ISR). These responses are essential for managing mitochondrial proteostasis and restoring cellular function, with each being tailored to specific stressors and cellular milieus. While excessive stress can lead to maladaptive responses, mitohormesis refers to the beneficial effects of low-level mitochondrial stress. Initially studied in invertebrates and cell cultures, recent research has expanded to mammalian models of mitohormesis. In this literature review, we describe the current landscape of mammalian mitohormesis research and identify mechanistic patterns that result in local, systemic, or interorgan mitohormesis. These investigations reveal the potential for targeting mitohormesis for therapeutic benefit and can transform the treatment of diseases commonly associated with mitochondrial stress in humans.

SERPINC1
Also flagged:Serine proteasecancerviral infectionsinfectionproteasesto
Journal Article 2025-09-08 ✓ 5 Snippets Rodriguez Galvan J, de Vries M, Belblidia S, Fisher A, Prescott RA, Crosse KM, Hearing P, Mangel WF, Duerr R, Dittmann M.
In-Text Gene Mentions

…antithrombin (encoded bySERPINC1) against SARS-CoV-2,…

…and cathepsin K;SERPINC1, thrombin and TMPRSS7;…

…full RCL mutant;SERPINC1, full RCL mutant;…

ATIII( SERPINC1 ),…

…ATIII (SERPINC1), PI-8 (…

Show Full Abstract

Serine protease inhibitors (SERPINs) are involved in various physiological processes and diseases, such as inflammation, cancer metastasis, and neurodegeneration. Their role in viral infections is poorly understood, as their expression patterns during infection and the range of proteases they target have yet to be fully characterized. Here, we show widespread expression of human SERPINs in response to respiratory virus infections, both in bronchioalveolar lavages from COVID-19 patients and in polarized human airway epithelial cultures. Using in silico docking of 10 SERPINs to 48 host proteases, we confirm known targets and predict new interactions. Protease activity assays validated selected interactions, confirming the newly predicted host targets for PAI-1 (SERPINE1) and PAI-2 (SERPINB2). PAI-1 inhibits cathepsin L, essential for SARS-CoV-2 maturation, and suppresses multi-cycle replication of both ancestral SARS-CoV-2 WA-1 and its variant Omicron BA.1. In addition, we identify PAI-2 as an antiviral SERPIN that reduces infectivity of human adenovirus 5 by directly inhibiting the adenoviral protease. Our study leverages in silico docking using full-length 3D protein structures to uncover new SERPIN targets, offering a range of candidate targets for therapeutic interventions.

OLFM4
Also flagged:NFATc3PMLtumorgene expressionSUMOylationnuclear factor of activated T cells 3
Journal Article 2025-09-08 ✓ 2 Snippets Kang T, Huang R, Wang R, Liu H, Chen S.
In-Text Gene Mentions

…genes (Lgr5 andOlfm4) under NFATc3 and…

…regulates Lgr5 andOlfm4expression, and co-expression…

Show Full Abstract

The nuclear factor of activated T cells 3 (NFATc3) plays a significant role in various cancer-related processes, but its interactions with transcriptional modulators, particularly Promyelocytic Leukemia protein (PML), remain poorly understood. PML, a nuclear scaffold protein, is involved in tumor suppression and transcriptional regulation. This study investigates the interaction between NFATc3 and PML, focusing on the role of SUMOylation and its impact on downstream target genes. In vitro experiments, including mass spectrometry and Co-immunoprecipitation (Co-IP), were conducted to explore this interaction. Additionally, constructs with lysine-to-arginine (K→R) mutations at key SUMOylation sites were generated to determine whether PML SUMOylation is necessary for its interaction with NFATc3. We also assessed the impact of NFATc3 SUMOylation on its binding to PML. Chromatin immunoprecipitation (ChIP) and quantitative real-time PCR (qRT-PCR) were employed to measure the expression of downstream genes (Lgr5 and Olfm4) under NFATc3 and PML overexpression or knockdown conditions. Pharmacological treatment with arsenic sulfide (As<sub>4</sub>S<sub>4</sub>) was used to further investigate modulation of the PML-NFATc3 axis. Our findings revealed that the NFATc3-PML interaction is independent of the SUMOylation status of PML. Additionally, mutations in NFATc3 SUMOylation sites did not affect its binding to PML. The PML-NFATc3 axis regulates Lgr5 and Olfm4 expression, and co-expression of NFATc3 and PML synergistically upregulated these genes. Arsenic sulfide treatment reduced this synergistic effect, indicating its potential as a modulator. This study provides new insights into the regulatory mechanisms of NFATc3 and PML, suggesting potential therapeutic targets in cancer.

HFE
Also flagged:HemidystoniaHereditary HemochromatosisMovement DisordersHHgenetic disorderiron
Journal Article 2025-09-08 ✓ 5 Snippets Kalampokini S, Plaitakis A, Spanaki C, Xiromerisiou G.
In-Text Gene Mentions

…variant of theHFEgene (encoding the…

…The association betweenhemochromatosisand movement disorders…

…mutations in theHFEgene, located on…

…iron regulator protein (HFEprotein), a transmembrane…

HFEis expressed not…

Show Full Abstract

<b>Background</b>: Hereditary hemochromatosis (HH) is a genetic disorder of iron metabolism, characterized by progressive iron accumulation. Neurological involvement, which can manifest with various symptoms, including movement disorders, is uncommon. <b>Methods</b>: We describe a case of a 50-year-old male patient homozygous for the H63D variant of the HFE gene (encoding the human homeostatic iron regulator protein), who also carried the c.340+4T>C polymorphism in the same gene and has been affected since the age of 13 years by hemidystonia involving primarily his right upper extremity. His brain MRI, obtained approximately 35 years after initial symptoms, revealed iron deposition predominantly in the contralateral pallidum. The patient has shown no progression of his neurologic syndrome and no systemic manifestations over the 35 years of follow-up. Moreover, we conducted a comprehensive literature search in Pubmed and Web of Science in English of all previously reported cases of movement disorders due to HH. <b>Results</b>: We found 19 studies including 69 patients with movement disorders. Movement disorders associated with HH were, in most cases, hypokinetic and less commonly hyperkinetic. The most common movement disorders were tremor, parkinsonism, ataxia, and less frequent dystonia, chorea, and myoclonus. Movement disorders could either precede the diagnosis of HH, or they could occur with a variable latency ranging from a few months up to 12 years after disease onset. Iron deposition on brain MRI in the basal ganglia or cerebellum was found in few of those cases. <b>Conclusions</b>: The association between hemochromatosis and movement disorders is rare. Blood analysis, including serum iron, ferritin, and transferrin saturation levels, should be investigated in patients with movement disorders of unknown etiology or with iron deposition on neuroimaging. A better understanding of genotype-phenotype correlations would facilitate the early diagnosis of HH.

Also flagged:Honokiolskin conditionsmelanomamelanoma skin cancersglycoproteinsmembrane
Journal Article 2025-09-08 No Snippets Chwil M, Dzida K, Terlecka P, Gruľová D, Matraszek-Gawron R, Terlecki K, Kasprzyk A, Kostryco M.
Show Full Abstract

<i>Magnolia</i> raw materials have long been used in Chinese folk medicine. The biologically active chemical compounds in <i>Magnolia</i>, mainly lignans, e.g., honokiol, exert health-enhancing effects in certain diseases, including skin conditions. Since the scientific literature does not provide a comparative analysis of the therapeutic properties of honokiol on the skin in various biological models, an attempt was made to supplement the knowledge in this field. This review presents the antimicrobial, anti-inflammatory, and photoprotective properties of honokiol used in dermatological problems and its anticancer activity in melanoma and non-melanoma skin cancers. Honokiol reduces the expression of HSV-1 genes, inhibits DNA replication, lowers the level of proteins, regulates the colonisation of viral glycoproteins with high membrane selectivity, and inhibits the endocytosis process. It has antibacterial activity, as it destroys bacterial cell walls and membranes. It disrupts vacuolar functioning and intracellular calcium homeostasis in dermatophyte cells and inhibits fungal growth by delaying germination, altering membrane permeability, and reducing hyphal growth. It reduces inflammatory cytokines and stimulates anti-inflammatory cytokine IL-10. Honokiol prevents UV-B induced skin cancer through targeting cell cycle regulators, inflammatory mediators, and cell survival signals. It induces apoptosis via extrinsic and intrinsic pathways, activating proapoptotic proteins. It acts as an inhibitor of the oncogenic protein KRT18 in melanoma and prevents the progression of highly metastatic melanoma. Future research should explore the signalling pathways and molecular mechanisms of honokiol action and its synergistic effects at the cellular level and help to develop methods for delivering honokiol to the organism by nanocarriers to improve selective therapies in some diseases.

Also flagged:DepressionDepressive disordermental illnessmetabolic disordersmetabolic dysfunctionGlucagon-Like Peptide-1
Journal Article 2025-09-08 No Snippets Dyndał K, Pańczyszyn-Trzewik P, Sowa-Kućma M.
Show Full Abstract

Depressive disorder is the most prevalent mental illness, and increasing evidence suggests its potential bidirectional relationship with metabolic disorders. Given the limited efficacy of conventional antidepressants (including Selective Serotonin Reuptake Inhibitors; SSRIs) and the growing prevalence of treatment-resistant depression, there is a significant need to identify alternative molecular pathways underlying the pathophysiology of depressive disorder, which may represent novel therapeutic targets for other agents. Emerging evidence indicates that metabolic dysfunction and depressive disorder share a common pathophysiological molecular mechanism and increase each other's risk. Targeting peripheral metabolic pathways and their interactions with the central nervous system may alleviate depressive symptoms. Glucagon-Like Peptide-1 agonists (GLP-1 RAs) and Sodium-Glucose Cotransporter-2 (SGLT2) inhibitors, widely used in the treatment of type 2 diabetes and obesity, exhibit neurotrophic and anti-inflammatory effects, ameliorate oxidative stress, and enhance mitochondrial function, collectively contributing to the antidepressant-like effects observed in preclinical studies. Peroxisome Proliferator-Activated Receptor (PPAR) α agonists primarily regulate lipid and glucose metabolism, which may potentially improve neuronal plasticity and mood regulation. Moreover, agents such as Angiotensin Receptor Blockers (ARBs) and Angiotensin Receptor-Neprilysin Inhibitors (ARNIs), used in hypertension treatment, exert central anti-inflammatory and neuroprotective effects via the modulation of the renin-angiotensin-aldosterone system (RAAS), implicated in affective disorders. Nevertheless, long-term, head-to-head trials are required to establish their efficacy, safety, and therapeutic positioning within current treatment paradigms. The aim of this review is to summarize current evidence on metabolic modulators as potential antidepressant strategies, focusing on their molecular mechanisms, preclinical and clinical findings, and prospects for integration into future therapies for depression.

Also flagged:azobenzenesynthesisazoheteroarenesarylhydrazonesdiarylethenesazobenzenes
Journal Article 2025-09-08 No Snippets Marcon M, Haag C, König B.
Show Full Abstract

Approaching the vast, colourful world of photoswitches from a different field of study or as an undergraduate student may be overwhelming: azobenzene is undoubtedly the most famous due to its easy synthesis and the extensively studied properties. However, there are several photoswitch classes beyond azobenzene with interesting properties that can be tailored to meet one's needs. In this tutorial review, we aim to explain the important terminology and discuss the synthesis, switching mechanisms, and properties of seven interesting photoswitch classes, namely azoheteroarenes, diazocines, indigoid photoswitches, arylhydrazones, diarylethenes, fulgides, and spiropyrans.

Also flagged:Tenascin-CTNCextracellular matrixtumortenascinextracellular proteins
Journal Article 2025-09-08 No Snippets Velázquez-Enríquez JM, Santos-Álvarez JC, González-García K, Reyes-Avendaño I, Acevedo-Sánchez V, Jalife Gómez A, Arcos-Román A, Arellanes-Robledo J, Vásquez-Garzón VR, Baltiérrez-Hoyos R.
Show Full Abstract

Tenascin-C (TNC) is an extracellular matrix (ECM) protein with key roles in various biological processes, such as embryonic development and tissue regeneration. However, its deregulated expression can contribute to pathological responses, promoting chronic inflammation, fibrosis, or tumor progression. It belongs to the tenascin family, a class of extracellular proteins that interfere with cellular events in both physiological and pathological contexts, interacting specifically with cells and other components of the ECM. TNC has emerged as a key player in the pathogenesis of chronic respiratory diseases (CRDs), including asthma, chronic obstructive pulmonary disease (COPD), lung cancer (LC), pulmonary hypertension (PH), and idiopathic pulmonary fibrosis (IPF). The influence of TNC on cellular responses, which is mediated by precise interactions with cellular receptors and ligands, triggers complex intracellular signaling cascades associated with the inflammatory response, fibrosis, and tumorigenesis in these CRDs. This review synthesizes recent evidence highlighting the multifaceted roles and underlying mechanisms of TNC in the context of these CRDs.

PTGIS
Also flagged:transdifferentiationcollagendegradationfibrotic diseasesEndometrial FibrosisEndometrosis
Journal Article 2025-09-08 ✓ 1 Snippet Méndez-Pérez L, Wong YS, Ibáñez BO, Martinez-Hormaza I, Rodríguez-Álvarez L, Castro FO.
In-Text Gene Mentions

…MMP1), Prostacyclin synthase (PTGIS), Signal transducer and…

Show Full Abstract

<h4>Background</h4>Endometrosis is a prevalent fibrotic condition in mares that impairs reproductive efficiency by inducing transdifferentiation of endometrial stromal cells into myofibroblasts, leading to excessive ECM deposition.<h4>Methods</h4>To elucidate the molecular mechanisms underlying fibrosis resolution, this study employed comprehensive proteomic techniques, including LC-MS/MS and SILAC, to analyze the interaction between myofibroblasts and mesenchymal stem cells derived from the endometrium (ET-eMSCs) preconditioned with PGE<sub>2</sub>. An in vitro co-culture system was used, with samples collected at baseline and after 48 h.<h4>Results</h4>Proteomic analysis identified significant alterations in proteins associated with ECM remodeling, immune regulation, and cellular stress response. Notably, proteins involved in collagen degradation, antioxidant defense, and growth factor signaling pathways were differentially abundant. Network analyses demonstrated robust interactions among these proteins, suggesting coordinated modulatory effects. The data indicate that PGE<sub>2</sub>-primed ET-eMSCs induce a shift in myofibroblast secretory profiles, promoting a reduction in ECM stiffness, tissue reorganization, and activation of resolution pathways. Data are available via ProteomeXchange with identifier PXD067551.<h4>Conclusions</h4>These findings reinforce the therapeutic potential of mesenchymal stem cell-based interventions for fibrotic diseases of the endometrium, opening avenues for regenerative strategies to restore reproductive function in mares.

Also flagged:Cardiovascular diseasesCVDAtherosclerosisASlipidinflammatory responses
Journal Article 2025-09-08 No Snippets Tang Y, Tian Y, Wang Y, Mei X, Luo L, Zhang F, Gao X, Wang Y, Hou J, Zhou C.
Show Full Abstract

<h4>Introduction</h4>Atherosclerosis (AS) is a primary cause of cardiovascular disease and significantly contributes to the global disease burden. Empagliflozin (EMP), a candidate drug for AS treatment, has not been clinically approved due to challenges including poor solubility, low bioavailability, and potential toxicity.<h4>Methods</h4>To address these challenges, we constructed a platelet membrane-biomimetic, mitochondria-targeted delivery system (PM@EPPT). This system was developed by loading EMP into PCL-PEG polymeric micelle, modifying the PEG terminus with triphenylphosphine (TPP), and coating the nanoparticle surface with platelet membranes. We then evaluated its efficacy against AS using both <i>in vitro</i> and <i>in vivo</i> models.<h4>Results</h4>The PM@EPPT system exhibited favorable physical properties and biocompatibility. <i>In vitro</i>, it alleviated oxidative stress-induced macrophage apoptosis by scavenging reactive oxygen species (ROS), restoring mitochondrial membrane potential, and activating mitophagy. In ApoE<sup>-/-</sup> mouse models, PM@EPPT significantly reduced aortic plaque area by 43%, decreased the expression of inflammatory markers (CD68 and MMP-9), increased levels of the plaque stability marker (α-SMA), and improved lipid profiles.<h4>Discussion</h4>In conclusion, PM@EPPT enhances EMP bioavailability through platelet membrane-mediated arterial plaque targeting and TPP-modified mitochondrial targeting. This study provides experimental evidence for optimizing EMP efficacy in AS treatment and developing therapeutic platforms for other poorly soluble drugs targeting AS.

SERPINC1
Also flagged:hyperlipidemiageniposidic acidlovastatinlipidamino acidmetabolism
Journal Article 2025-09-08 ✓ 2 Snippets Tang R, Li K, Liang M, Wang P, Li Z.
In-Text Gene Mentions

…CAT, FH, MTOR,SERPINC1and SOD1.…

…between FH, MTOR,SERPINC1and GPA are…

Show Full Abstract

<h4>Background</h4>Geniposidic acid (GPA) has been reported to possess hypoglycemic, hypolipidemic, and choleretic properties. However, its efficacy against hyperlipidemia and the associated mechanisms remain inadequately defined.<h4>Methods</h4>A hyperlipidemia model was established in mice using a high-fat diet, followed by a 12-week intervention with GPA or lovastatin (positive control). Serum biochemical parameters and Oil Red O staining were assessed to evaluate lipid-lowering effects. Furthermore, NMR- and MS-based metabolomics, network pharmacology, and molecular docking approaches were employed to explore the underlying mechanisms.<h4>Results</h4>Biochemical analysis confirmed the lipid-lowering efficacy of GPA. Urinary metabolomics revealed that both GPA and lovastatin restored disturbed metabolic profiles, notably involving the TCA cycle, glycolysis, amino acid metabolism, and ketone body synthesis. Over 40 differential metabolites were identified, constructing a comprehensive metabolic network. Network pharmacology further enriched relevant metabolic pathways and screened key targets. Molecular docking demonstrated strong binding affinities between GPA and several core proteins, including ALB, CAT, ACACA, ACHE, and SOD1, suggesting these may be potential therapeutic targets.<h4>Conclusion</h4>This study confirmed the anti-hyperlipidemic efficacy of GPA and, through integrated metabolomics and target prediction, elucidated its potential mechanisms of action. These findings provide a scientific basis for further research and offer a promising strategy for the development of novel antihyperlipidemic agents.

PRDX6
Also flagged:Gene Expressionpoxcytokineironmetabolismmicrocytic hypochromic anemia
Journal Article 2025-09-08 ✓ 4 Snippets Darwish AA, Alqahtani HA, Tahoun A, Ateya A, Helmy NA, Hafez AA, Alharbi HM, Alwutayd KM, Babaker MA, Al-Farga A, Al-Shahari EA, Salih ZA, Al-Duais MA, El-Sayed A.
In-Text Gene Mentions

…antioxidant defense (PRDX2,PRDX6, Nrf2, Keap1, OXSR1,…

…, PRDX2 ,PRDX6, and Nrf2…

…PRDX2 (420 bp),PRDX6(411 bp), Nrf2…

…( PRDX2 ,PRDX6, Nrf2 ,…

Show Full Abstract

Sheep pox, caused by sheep pox virus (SPV), is a transboundary disease that threatens sheep production and trade. This study aimed to identify genetic, immunological, and biochemical markers associated with susceptibility to SPV in Barki ewes. A total of 100 adult ewes were examined, including 50 clinically healthy and 50 naturally infected animals. PCR detected SPV DNA in 60% of suspected scab samples, highlighting diagnostic challenges in field investigations. Blood samples were analyzed for hematological indices, cytokine profiles, acute phase proteins, oxidative stress biomarkers, iron metabolism, and hormonal parameters. Expression profiles and single-nucleotide polymorphisms (SNPs) in 15 immune and antioxidant genes were characterized from cDNA-derived sequences. Infected animals exhibited microcytic hypochromic anemia, leukocytosis, elevated proinflammatory cytokines, and reduced IL-10. Acute phase proteins, oxidative stress markers, and cortisol were increased, whereas antioxidant capacity and transferrin were reduced. Twenty-three SNPs were identified, including non-synonymous variants, which showed promising but unvalidated associations with disease status. These findings highlight immune, oxidative, and genetic alterations in SPV-infected sheep, but further longitudinal and cross-validated studies are needed to establish their diagnostic or breeding utility.

Also flagged:ageingAge-related macular degenerationblindnessretinal degenerative diseasesvisionretinal degeneration diseases
Journal Article 2025-09-08 No Snippets Chee PL, Hao M, Liu G, Yew PYM, Kim E, Liu H, Sathasivam T, Xu G, Liu Z, Kai D.
Show Full Abstract

The growing strain placed on both society and the healthcare system due to an ageing population should not be underestimated. Age-related macular degeneration (AMD) is a leading cause of blindness worldwide and is projected to affect 288 million people globally by 2040. Current treatment options for AMD primarily focus on disease management rather than offering a definitive cure. Retinal tissue engineering, which aims to develop targeted regenerative strategies to restore or replace damaged retinal tissues, offers pioneering advances that could provide curative solutions for AMD and revolutionize its therapeutic landscape. This review aims to provide a comprehensive overview of biomaterial strategies for retinal repair and regeneration, with a particular focus on scaffold design. To effectively address the underlying causes of retinal degenerative diseases and develop functional scaffolds, the review examines the retinal anatomy, the vision-impairing diseases associated with degeneration and relevant cell types. Building on this foundation, it further discusses various scaffold design strategies, including the selection of biomaterials, the structural and mechanical mimicry of native tissues, and the fabrication of scaffolds for co-culturing. Beyond current strategies, we also explore potential features, such as electrically conductive and photo-responsiveness, that could shape the future of scaffold design in retina tissue engineering. Collectively, these insights provide a robust framework to drive and accelerate the next generation of scaffold development for retinal tissue engineering.

ZBTB37
Also flagged:Multiple myelomanon-Hodgkin's lymphomaChromosometumorfatty acidmitochondrial
Journal Article 2025-09-08 ✓ 1 Snippet Li P, Xu J, Xu B, Hu X, Xiong Y, Wang Y, Liu P.
In-Text Gene Mentions

…ATF6, TBX19, BLZF1,ZBTB37, LHX4, ZNF648, ZBTB41,…

Show Full Abstract

Multiple myeloma (MM) is a prevalent hematologic malignancy with improved survival rates over recent decades, although still uncurable. MM with chromosome 1q Gain (1q+) are clinically and biologically heterogeneous. In this study, we found that NR5A2, located on chromosome 1q and encoding an essential transcriptional regulator of lipid metabolism, has higher mRNA expression in 1q+ patients and could further stratify the prognosis of MM patients. Omics data were analyzed and related experiments were conducted. We demonstrated for the first time that NR5A2 promotes the proliferation and invasion of MM cells by regulating phospholipid metabolism and further inhibit ferroptosis by reducing the related specific substrate in MM cells. Through integrated analysis of the lipid metabolism and proteome, MBOAT1 and MBOAT2 were determined to be the downstream targets of NR5A2. Furthermore, it has been determined that the high expression of NR5A2 is closely related to the resistance of MM cells to dexamethasone (Dexa). Interestingly, we found for the first time that arachidonic acid co-culture with MM cells can promote their sensitivity to Dexa and significantly reverse the resistance to Dexa caused by high expression of NR5A2. These findings provide insights into disease-causing mechanisms and new therapeutic targets for MM patients with 1q+.

Also flagged:Neurodegenerative diseasesdeathmitochondrialcurcuminresveratrolginsenosides
Journal Article 2025-09-08 No Snippets Ghosh S, Debnath I, Bhunia S, Nandi S, Ashique S, Nayak A, Mallick S, Basak S.
Show Full Abstract

Neurodegenerative diseases (NDs), including Alzheimer's, Parkinson's, Huntington's, and amyotrophic lateral sclerosis, are progressive disorders marked by neuronal dysfunction and death, driven by pathological mechanisms such as oxidative stress, mitochondrial dysfunction, neuroinflammation, apoptosis, and protein misfolding. Despite scientific advances, current treatments remain largely palliative, underscoring the need for multitargeted therapeutic strategies. This narrative review synthesizes preclinical and clinical evidence to explore the neuroprotective potential of natural products, with a focus on their ability to modulate key molecular pathways implicated in NDs. A comprehensive literature search across Scopus, ScienceDirect, PubMed, MDPI, and Web of Science identified relevant studies. Bioactive compounds such as curcumin, resveratrol, ginsenosides, quercetin, and marine-derived molecules like fucoxanthin and phlorotannin demonstrated antioxidant, anti-inflammatory, anti-amyloidogenic, and mitochondrial-protective effects by modulating pathways including PI3K/Akt, NF-<i>κ</i>B, and Nrf2/ARE, thereby mitigating neuronal damage and promoting cell survival. Natural products from diverse sources, including honey, ginseng, marine macroalgae, and cyanobacteria, exhibited broad-spectrum neuroprotective properties, with advances in nano-formulations improving bioavailability and brain penetration. Furthermore, emerging approaches such as gene-drug interaction studies and scaffold-based drug design offer promising avenues for enhancing clinical translation. While natural products provide a holistic, multitargeted approach to combat NDs, challenges related to bioavailability and therapeutic translation persist, necessitating future research that integrates advanced drug delivery systems, precision medicine, and synthetic modifications to develop innovative and effective treatment paradigms.

medRxiv 2025-09-08 Preprint (No Snippets API) Sanders K, Naseri A, Lee C, Iwata J, He Y, Tokede B, Walji M, Zhi D, Rasmy L.
Show Full Abstract

Periodontitis is a multifactorial inflammatory disease whose pathogenesis is associated with intricate interactions between genetic and environmental factors. Leveraging electronic health records data from the All of Us Research Program, we stratified periodontitis by clinically relevant dimensions: stage, grade, and extent. Based on these phenotypes, we performed a multi-ancestry genome-wide association study, focusing on predominant ancestry populations of African, European, and Admixed American. Our study cohort comprised 3,881 periodontitis patients and a control group of 10,760 patients with dental caries and without periodontitis. Ancestry-specific GWAS revealed significant genetic associations (P<5x10 -8 ) in periodontitis grade phenotypes at the LINC00294 and CLMN loci in the African ancestry population and also confirmed via the multi-ancestry meta-analysis. In addition, the XYLT1 locus emerged as a significant signal associated with periodontitis grade phenotype in the admixed American GWAS. Our GWAS comparing periodontitis to dental caries in the admixed American population identified several significant loci, including RABGAP1L, previously linked to immune regulation, DCHS2, a cadherin-related gene involved in bone mineralization and tissue morphogenesis, and OSTM1, known to be crucial for bone remodeling. The findings of our study highlight the potential of integrating EHR and genomic data from large-scale biobanks to achieve informative dental phenotyping, uncover novel molecular insights into periodontal disease, and personalize treatment approaches.

Also flagged:MLLleukemiaHOXgene expressiononcoproteinchromatin-
Journal Article 2025-09-07 No Snippets Ernst P, S Kyei P, Yokoyama A.
Show Full Abstract

Gene rearrangements of the human mixed lineage leukemia (MLL) gene (also known as KMT2A) generate multiple fusion oncoproteins, which cause leukemia with poor prognosis. MLL is an epigenetic regulator that reads and writes epigenetic information and has an evolutionarily conserved role in maintaining expression of Homeotic (HOX) genes during embryonic development. Most MLL gene rearrangements found in leukemia generate a constitutively active version of the wild-type protein, which causes overexpression of HOX and other genes and leukemic transformation of normal hematopoietic progenitors. Elucidating the molecular mechanisms underlying how MLL activates gene expression and how gene rearrangements affect this gene-regulating activity provided therapeutic opportunities to block fusion oncoprotein-specific activities. One uniform molecular dependency of MLL fusion oncoproteins is its interaction with the chromatin-binding partner MENIN that is essential to maintain leukemic transformation. MENIN inhibitors that interfere with the MLL-MENIN interaction have been developed and are now entering clinical practice. Also, the MLL complex physically interacts with several histone acetyl transferases (HATs), including MOZ/MORF, HBO1, and EP300/CREBBP to effect MLL-MENIN-dependent gene activation. Aberrant recruitment of these HATs and other transcriptional effector complexes are key differences between MLL and MLL fusion oncoproteins. In this review, we first summarized our current understanding of wild-type MLL function and the aberrant function of its oncogenic variants. We then discussed in detail how chromosomal translocations generate constitutive-active forms of MLL and categorize them into five major classes. We touched on the collaborative gene activation by MLL and specific interacting HATs. Lastly, we discussed how these mechanistic insights have led to the development of the first-in-class MENIN inhibitors and discussed efforts to anticipate and treat both genetic and nongenetic mechanisms of resistance.

HTT
Also flagged:MRDegenerationIntervertebral disc degenerationADD1GFPT1MAPRE3
Journal Article 2025-09-07 ✓ 1 Snippet Zhang L, Zhao W, Yang H, Deng T, Li Y.
In-Text Gene Mentions

…that CENPA, PREB,HTT, and EMILIN1 achieved…

Show Full Abstract

<h4>Background</h4>Intervertebral disc degeneration (IDD) is a prevalent spinal condition frequently associated with pain and motor impairment, imposing a substantial burden on quality of life. Despite extensive investigations into the genetic predisposition to IDD, the precise pathogenic genes and molecular pathways involved remain inadequately characterized, underscoring the need for continued research to clarify its genetic underpinnings.<h4>Methods</h4>This study leveraged IDD data from the FinnGen R12 cohort and integrated expression quantitative trait loci data across 49 tissues from the Genotype-Tissue Expression version 8 database to perform a cross-tissue transcriptome-wide association study (TWAS). The analytical framework incorporated functional summary-based imputation (FUSION), unified test for molecular signatures (UTMOST), and gene-level analysis via multi-marker genome annotation (MAGMA). To substantiate the findings, Mendelian randomization (MR) and colocalization analyses were subsequently conducted.<h4>Results</h4>Through TWAS and MAGMA analyses, 33 susceptibility genes associated with IDD were identified. Subsequent MR and colocalization analyses refined this list to six candidate genes-ADD1, GFPT1, MAPRE3, MSANTD1, SLC30A6, and XBP1-which may contribute to the initiation and progression of IDD by modulating pathways implicated in the endoplasmic reticulum stress response.<h4>Conclusion</h4>Six susceptibility genes associated with the risk of IDD were identified in this study, offering novel insights into the genetic architecture and potential pathogenic pathways underpinning the development of IDD.

RABGAP1L
Also flagged:tumorextracellularcancerbreast cancermethylationhypermethylation
Journal Article 2025-09-07 ✓ 2 Snippets Jeon MS, Ding Z, Pei C, Li J, Xie L, Sauter E, Zhang KK.
In-Text Gene Mentions

RABGAP1Ldisplayed predominant hypometh…

…Functionally,RABGAP1Lwas shown to…

Show Full Abstract

Cell-free DNA (cfDNA), shed by malignant tumor cells into extracellular fluid, provides valuable epigenetic information indicative of cancer status. Nipple aspirate fluid (NAF), a noninvasive liquid biopsy from at-risk women, contains nucleic acid and protein biomarkers from adjacent cancer cells, showing promise for breast cancer (BrC) detection. However, despite its potential, the application of cfDNA in NAF for BrC screening is still underexplored. Here, we report a proof-of-concept study for using cfDNA bisulfite sequencing (cfBS) to assess tumor DNA methylation signatures from NAF samples. For four healthy individuals and three BrC patients, cfBS achieved greater than 20× sequencing depth with an average coverage of 26.5× on the genome. A total of 7471 differentially methylated regions were identified, with significant hypermethylation in BrC samples compared to healthy controls. Gene set enrichment analysis indicated that the differentially methylated genes (DMGs) were significantly associated with epithelial-mesenchymal transition (EMT). By developing a novel EMT scoring metric, we found that BrC samples had more of a mesenchymal phenotype than samples from healthy individuals. <i>CDH1</i>, <i>WNT2</i>, and <i>TRIM29</i> were hypermethylated near the promoter region, while <i>COL5A2</i> was hypermethylated in the coding region. The DNA methylation and EMT changes were validated through The Cancer Genome Atlas Breast Invasive Carcinoma study, which confirmed that DMGs were associated with gene expression change and that our methylation-based EMT score reliably distinguished tumors from healthy controls. Our findings support the utilization of the NAF cfDNA cfBS methylation profile for noninvasive BrC screening and pave the way for enhanced early detection of this disease.

PRDX6
Also flagged:FTOrenal fibrosisferroptosisACSL4chronic kidney diseaseobesity
Journal Article 2025-09-07 ✓ 1 Snippet Zhang D, Chiu CL, Wen R, Qiu Z, Garcia-Marques F, Bermudez A, Zhao M, Zhao H, Dixon SJ, Peehl DM, Rankin EB, Pitteri S, Brooks JD.
In-Text Gene Mentions

…ARF6, OTUB1, P4HB,PRDX6, and RRM2.…

Show Full Abstract

Renal fibrosis (RF) is the main pathological feature and a potential therapeutic target of chronic kidney disease (CKD), a prevalent health problem causing a high economic burden to the health care system. Fat mass and obesity-associated (FTO) inhibition, either genetically or pharmacologically, significantly reduced collagen deposition, lipid peroxidation, and ferroptosis marker expression after unilateral ureteral obstruction (UUO) compared with sham-operated controls in mice. In murine and human kidney epithelial cells as well as in human embryonic stem cell-derived kidney organoids, FTO inhibition reduced erastin-induced ferroptosis by decreasing lipid peroxidation and reactive oxygen species production by downregulating the ferroptosis driver ACSL4. Moreover, FTO inhibition directly downregulated <i>TGFBI,</i> which was strongly associated with reduced M2 macrophage accumulation after UUO. Our results provide a strong rationale for targeting FTO to alleviate RF in patients subjected to obstruction-related kidney injury, thereby reducing the prevalence of CKD and associated treatment costs and improving the quality of life.

PRDX6
Also flagged:myotrophinhydrogendeuteriumAPEX2peroxiredoxin 6mitochondrial
Journal Article 2025-09-06 ✓ 2 Snippets Xiao XY, Luo QW, Li WS, Chen ZK, Yang Z, Zhu YX, Lei MR, Zhuo FF, Yu M, Wei TT, Jin HW, Li ZY, Lu ZY, Zhang ZQ, Wang H, Wang YC, Xia Q, Yu W, Han B, Tu PF, Zeng KW.
In-Text Gene Mentions

…identified peroxiredoxin 6 (PRDX6) as a key…

…onformational change-dependentPRDX6release protected the…

Show Full Abstract

Nanoparticles bind to proteins in cells selectively and form a protein corona around them. However, the mechanisms of protein conformational changes underlying the interactions between nanoparticles and protein coronas remain poorly understood. In this study, we prepared small molecule self-assembled nanoparticles (Aloin NPs) as a research tool to investigate the allosteric mechanism of protein coronas. Aloin NPs showed a propensity to capture multiple proteins in cells. In particular, Aloin NPs specifically bound to myotrophin (MPTN) as a major protein corona through a multivalent hydrogen bond-mediated nanoprotein interface. Molecular modeling and hydrogen-deuterium exchange mass spectrometry (MS) demonstrated that Aloin NPs promoted a conformational rearrangement of MPTN via a 'finger-unclasping' pattern. We then adapted the APEX2 proximity labeling strategy to investigate the conformation-dependent changes in the MPTN interactome and identified peroxiredoxin 6 (PRDX6) as a key substrate protein of MPTN in microglia. Additionally, we observed that MPTN conformational change-dependent PRDX6 release protected the mitochondrial membrane by reducing reactive oxygen species. Consequently, Aloin NPs effectively inhibited the release of mitochondrial DNA to block the downstream cGAS-STING signaling pathway, thereby reprogramming microglial polarization. In translational medicine, Aloin NPs play a role in protecting neurons from microglia-induced inflammatory injury with no significant adverse effects, ultimately improving Parkinson's disease-associated symptoms. Taken together, our study provides insights into the molecular mechanisms by which nanoparticles regulate the conformational change of protein coronas for human disease therapy.

HTT
Also flagged:Huntington's choreaHuntington's diseaseHDautosomal dominant neurodegenerative disordercognitive declinepathogenesis
Journal Article 2025-09-06 ✓ 1 Snippet Tahir A, Jamal S, Shams UA, Mehmood S.
In-Text Gene Mentions

…expansions in theHTTgene, resulting in…

Show Full Abstract

Huntington's disease (HD) is a progressive, autosomal dominant neurodegenerative disorder characterized by motor dysfunction, cognitive decline, and psychiatric disturbances. It is caused by CAG repeat expansions in the HTT gene, resulting in the formation of mutant huntingtin protein that aggregates and disrupts neuronal function. This review outlines the pathogenesis of HD, including genetic, molecular, and environmental factors. Additionally, current management approaches and emerging therapeutic strategies-such as RNA interference, antisense oligonucleotides (ASOs), peptide inhibitors, and CRISPR/Cas9 gene editing-are discussed. Advancements in these novel therapies highlight a shift towards disease-modifying interventions. However, continued clinical and translational research is essential to develop a definitive cure.

Also flagged:aortopathydilated cardiomyopathygenetic diseasegenetic diseasesgene expressionglobin
Journal Article 2025-09-06 No Snippets Pitsava G, Hawley M, Auriga L, de Dios I, Ko A, Marmolejos S, Almalvez M, Chen I, Scozzaro K, Zhao J, Barrick R, Ah Mew N, Fusaro VA, LoTempio J, Taylor M, Mestroni L, Graw S, Milewicz D, Guo D, Murdock DR, Bujakowska KM, UCI-GREGoR Consortium, Xiao C, Délot EC, Berger SI, Vilain E.
Show Full Abstract

<h4>Purpose</h4>Advancements in sequencing technologies have significantly improved clinical genetic testing; yet, the diagnostic yield remains around 30% to 40%. Emerging technologies are now being deployed to address the remaining diagnostic gap.<h4>Methods</h4>We tested whether short-read genome sequencing could increase the diagnostic yield in individuals enrolled into the UCI-GREGoR research study, who had suspected Mendelian conditions and prior inconclusive testing. Two other collaborative research cohorts, focused on aortopathy and dilated cardiomyopathy, consisted of individuals who were undiagnosed but had not undergone harmonized prior testing.<h4>Results</h4>We sequenced 353 families (754 participants) and found a molecular diagnosis in 54 (15.3%) of them. Of these diagnoses, 55.5% were previously missed because the causative variants were in regions not originally interrogated. In 5 cases, they were deep intronic variants, all of which led to abnormal splicing and pseudoexons, as directly shown by RNA sequencing. All 5 of these variants had inconclusive spliceAI scores. In 26% of newly diagnosed cases, the causal variant could have been detected by exome sequencing reanalysis.<h4>Conclusion</h4>Genome sequencing can overcome limitations of clinical genetic testing, such as the inability to call intronic variants. Our findings highlight pseudoexons as a common mechanism via which deep intronic variants cause Mendelian disease.

DCC
Also flagged:neurodegenerative diseasemultiple system atrophyParkinsonian syndromealpha-synucleinbiosynthesiscoenzyme Q10
Journal Article 2025-09-06 ✓ 5 Snippets Smandzich NJ, Pich A, Gschwendtberger T, Greten S, Ye L, Klietz M, Di Fonzo A, Henkel LM, Wegner F.
In-Text Gene Mentions

…( MRPL47 ),netrin receptor DCCreceptor DCC (Deleted…

…in Colorectal Carcinoma,DCC), polyglutamine-binding prote…

…19 proteins (DCC, RRAGB ,…

…adhesion molecule (PC00069;DCC), protein-binding activity…

…the upregulated proteinDCCwas matched to…

Show Full Abstract

The rare and rapidly progressive neurodegenerative disease multiple system atrophy (MSA) mainly affects the striatum and other subcortical brain regions. In this atypical Parkinsonian syndrome, the protein alpha-synuclein aggregates and misfolds in neurons as well as glial cells and is released in elevated amounts by hypoexcitable neurons. Mitochondrial dysregulation affects the biosynthesis of coenzyme Q10 and the activity of the respiratory chain, as shown in an induced pluripotent stem cell (iPSC) model. Proteome studies of cerebrospinal fluid and brain tissue from MSA patients yielded inconsistent results regarding possible protein changes due to small and combined groups of atypical Parkinsonian syndromes. In this study, we analysed the cellular proteome of MSA patient-derived striatal GABAergic medium spiny neurons. We observed 25 significantly upregulated and 16 significantly downregulated proteins in MSA cell lines compared to matched healthy controls. Various protein types involved in diverse molecular functions and cellular processes emphasise the multifaceted pathomechanisms of MSA. These data could contribute to the development of novel disease-modifying treatment strategies for MSA patients.

PRDX6
Also flagged:mitochondrialmethylationMCL1Glycine amidinotransferaseGATMneuralgia
Journal Article 2025-09-06 ✓ 2 Snippets Liu CC.
In-Text Gene Mentions

…GSTZ1, HIBCH, andPRDX6in neck or…

…genes (GSTZ1, HIBCH,PRDX6) ( Figure 4…

Show Full Abstract

The causal contributions of specific mitochondrial genes to common pain phenotypes remain unclear. We employed a multi-omics Mendelian randomization (SMR) approach, integrating QTL data (expression, methylation, protein) for mitochondrial genes with GWAS summary statistics for seven pain phenotypes. We identified 18 candidate genes with robust SMR associations across omics layers. However, strong colocalization evidence (PP.H4 > 0.7) was largely absent, pointing towards complex genetic architectures. A notable exception was a strong signal for a shared causal variant found at the methylation level for the MCL1 gene in hip pain (PP.H4 = 0.962), nominating it as a high-confidence candidate. Additionally, genetically predicted higher protein levels of Glycine amidinotransferase (GATM) showed consistent protective associations with neck or shoulder, back, and knee pain. This study provides novel evidence for mitochondrial gene regulation in pain, highlighting the GATM pathway as protective and identifying MCL1 methylation as a potential causal mechanism in hip pain.

Also flagged:NeurodegenerationCancermitochondrialneurodegenerative diseasesmitochondriadeath
Journal Article 2025-09-06 No Snippets Dominiak A, Gawinek E, Banaszek AA, Wilkaniec A.
Show Full Abstract

Mitochondrial quality control (MQC) mechanisms, including proteostasis, mitophagy, mitochondrial dynamics, and biogenesis, are essential for maintaining mitochondrial function and overall cellular health. Dysregulation of these systems is a common feature of both neurodegenerative diseases and cancer, but the outcomes differ. Neurons depend strongly on healthy mitochondria and are easily damaged when MQC fails, resulting in organellar dysfunction and oxidative stress. By contrast, cancer cells often adapt by using MQC pathways to sustain survival and resist cell death. The mitochondrial unfolded protein response (mtUPR) and mitophagy are central to these processes, yet their roles are context-dependent. In neurodegeneration, activation of these pathways may help neurons survive, yet persistent stimulation can shift towards harmful effects. In cancer, these same pathways enhance metabolic flexibility, promote resistance to treatment, and support tumor progression. Although therapeutic strategies targeting MQC are being explored, their translation to the clinic is difficult, partly due to opposite effects in different diseases. The observed inverse epidemiological link between cancer and neurodegeneration may also reflect the distinct regulation of MQC pathways. A clearer understanding of these mechanisms is needed to identify new treatment strategies for disorders that are clinically distinct but share common mitochondrial defects.

PRDX6
Also flagged:CurcuminNeurodegenerative disordersADPDpost-stroke cognitive impairmentpolyphenols
Journal Article 2025-09-06 ✓ 1 Snippet Lehoczki A, Fekete M, Jarecsny T, Zábó V, Szappanos Á, Csípő T, Lipécz Á, Major D, Fazekas-Pongor V, Varga P, Varga JT.
In-Text Gene Mentions

…I3K—Phosphoinositide 3-kinase,Prdx6—Peroxiredoxin 6, ROS—Reactive…

Show Full Abstract

Neurodegenerative disorders, including Alzheimer's disease (AD), Parkinson's disease (PD), and post-stroke cognitive impairment (PSCI), represent an escalating global health and economic challenge. In the quest for disease-modifying interventions, natural polyphenols-most notably curcumin, the principal bioactive compound of Curcuma longa-have attracted considerable interest due to their pleiotropic neuroprotective effects. This narrative review critically synthesizes findings from a selection of peer-reviewed articles published between 2000 and 2025, chosen for their relevance to curcumin's molecular mechanisms and translational potential. Curcumin's complex chemical structure confers antioxidant, anti-inflammatory, and epigenetic modulatory properties; however, its clinical application is limited by poor oral bioavailability. Mechanistically, curcumin attenuates oxidative stress and suppresses key inflammatory mediators, including nuclear factor kappa B (NF-κB), cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS). Additionally, it modulates apoptosis, inhibits amyloid-beta aggregation, and enhances cellular quality control processes such as autophagy and mitophagy, while upregulating neurotrophic factors such as brain-derived neurotrophic factor (BDNF). Preclinical studies employing rodent models of AD, PD, and ischemic stroke have demonstrated curcumin's dose-dependent neuroprotective efficacy, with improved outcomes observed using nanoparticle-based delivery systems. Early-phase clinical trials further support curcumin's favorable safety profile and potential cognitive benefits, although challenges remain regarding pharmacokinetics, formulation standardization, and therapeutic reproducibility. Future directions include the development of advanced drug delivery platforms, combinatory therapeutic regimens, and personalized medicine approaches integrating curcumin within multifaceted neurotherapeutic strategies. Collectively, this narrative review highlights curcumin as a promising multi-targeted candidate for combating neurodegenerative diseases, while emphasizing the need for further translational and clinical validation.

HTT
Also flagged:Huntington diseaseHDoligonucleotideneurofilament light chainglial fibrillary acidic proteinGFAP
Journal Article 2025-09-06 ✓ 5 Snippets Caron NS, Fan J, Ma D, Yung A, Ko S, Bale K, Anderson C, Kozlowski P, Pouladi MA, Wellington CL, Hayden MR.
In-Text Gene Mentions

…expansion in theHTTgene that codes…

…tract in theHTTprotein.…

…constitutive knockout ofHttin mice is…

…conditional inactivation ofHttin adulthood leads…

…targeting human mHTT.…

Show Full Abstract

Therapies targeting mutant huntingtin (mHTT) reduction in the brain hold promise as disease-modifying treatments for Huntington disease (HD), necessitating biomarkers that accurately reflect treatment response. We evaluated candidate molecular and imaging biomarkers after mHTT reduction in YAC128 HD mice, with equal numbers of males and females per group. At 6 months of age, YAC128 mice received unilateral intracerebroventricular injections of saline or mHTT-lowering antisense oligonucleotide (HTT ASO). Plasma neurofilament light chain (NEFL) and glial fibrillary acidic protein (GFAP) were measured longitudinally from 6 to 12 months. Structural MRI was performed at 6, 9, and 12 months. At study endpoint, we quantified mHTT target engagement in the brain and performed striatal RNA sequencing. Treatment with HTT ASO produced a sustained reduction of mHTT levels throughout the brain for up to 6 months, significantly slowed plasma NEFL increases, and moderately attenuated GFAP elevation. Although mHTT levels inversely correlated with gray and white matter volumes, treatment did not significantly stabilize regional brain atrophy, highlighting an association between mHTT load and neuroanatomical integrity. HTT ASO also partially reversed striatal transcriptome dysregulation and restored oligodendrocyte-specific gene expression. Plasma NEFL, but not brain imaging, emerges as a sensitive and dynamic response biomarker for mHTT-lowering therapies.

Also flagged:coronary artery diseaseischemic heart diseaseatherosclerosisoxygenmyocardial ischemiaangina
Journal Article 2025-09-06 No Snippets Mostafavi S, Arasteh A, Mostafavi Montazeri SM, Hejazian SM, Farnood F, Abediazar S, Barzegari A, Zununi Vahed S.
Show Full Abstract

<h4>Introduction</h4>Coronary artery disease (CAD) is a life-threatening cardiac condition with high morbidity and mortality worldwide. This systematic review article highlighted the therapeutic roles of mesenchymal stromal cells (MSCs)-derived exosomal microRNAs (exo-miRs) in preclinical models of CAD.<h4>Methods</h4>A comprehensive search was conducted on PubMed, Web of Science, Scopus, and Google Scholar to identify relevant publications until 04 Apr 2025. The literature review focuses on the origin of MSCs, the technique employed for exosome extraction and identification, the route and frequency of exosomal administration, the mechanisms through which exo-miRs regulate paracrine activity, and their impact on cardiac outcome.<h4>Results</h4>After meticulous evaluation, fifty-six studies were deemed eligible for inclusion in this systematic review. Bone marrow-derived MSCs were the most commonly utilized cell type in the preclinical studies. The majority of studies employed the ultracentrifugation method for exosome isolation from MSCs. The administration of exosomes was primarily achieved through a single intramyocardial injection, utilizing a wide range of exosome concentrations (ranging from 0.02-400 μg/μL).<h4>Conclusion</h4>The included studies predominantly have reported the anti-inflammatory, anti-apoptotic, angiogenic, antifibrotic, and reparative effects of MSC-exo-miRs, especially under hypoxic conditions. These findings support the capacity of MSC-exo-miRs to regulate the immune system and facilitate cardiac recovery following an injury.

HFE
Also flagged:statinstransaminaseschronic liver diseasediabetes mellitushypertensiondyslipidemia
Journal Article 2025-09-06 ✓ 1 Snippet Wong PJW, Ng SC, George S, Rasdi RB.
In-Text Gene Mentions

…rimary sclerosing cholangitis,hemochromatosis, congenital liver diseases,…

Show Full Abstract

<h4>Background and aim</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) is the most common chronic liver disease worldwide and is strongly linked to metabolic comorbidities such as diabetes mellitus, hypertension, dyslipidemia, and coronary artery disease. Despite their cardiovascular benefits, statins are historically underused in patients with MASLD because of concerns regarding hepatotoxicity. This study aimed to evaluate the impact of statins on liver transaminase levels in patients with MASLD and assess whether statin type or dose influences these outcomes.<h4>Materials and methods</h4>We conducted a retrospective review of 104 patients with MASLD who attended outpatient clinics between January 2023 and December 2024. Patients on statins for ≥12 months were included, while those with viral hepatitis, autoimmune liver disease, or significant alcohol intake were excluded. The data collected included comorbidities, statin type/dose, and liver transaminase levels at baseline, 3, 6, and 12 months. Patients without baseline transaminase levels available at the time of statin initiation were excluded. Of the 104 patients recruited, only 21 underwent transient elastography, of which two had advanced chronic liver disease.<h4>Results</h4>The mean BMI was 34.26 kg/m<sup>2</sup>. Most patients had diabetes mellitus (86%), hypertension (88.5%), and dyslipidemia (98.1%). Transaminase levels remained stable over 12 months (ALT, χ<sup>2</sup>(3)=0.340, p=0.952; AST, χ<sup>2</sup>(3)=0.342, p=0.926). Statin type and dose had no significant effects on transaminase levels.<h4>Conclusion</h4>Statins of different types and doses did not significantly affect transaminases in patients with MASLD, indicating that statins are safe for use in patients with MASLD who meet the criteria for lipid-lowering therapy. Further studies are warranted to explore the long-term hepatic effects of statins in patients with metabolic dysfunction-associated steatohepatitis (MASH), focusing on histological outcomes.

TNFSF4
Also flagged:MethylationGene Expressionmethylinsulincarbohydratemetabolism
Journal Article 2025-09-05 ✓ 5 Snippets Joo M, Shin D, Truong XT, Nam S, Lee DH.
In-Text Gene Mentions

…PRKAR1B , andTNFSF4) were affected…

…, OR5P3 ,TNFSF4, and ZNF677…

…three genes (TNFSF4, CEL ,…

…, PRKAR1B ,TNFSF4, and TNFSF14…

…, RGS5 ,TNFSF4, CDKL2 ,…

Show Full Abstract

<h4>Backgruound</h4>Acute hyperinsulinemia may directly affect blood cells. In this study a hyperinsulinemic-euglycemic clamp (HEC) and multiomics methods were used to explore the epigenetic regulation by hyperinsulinemia in blood cells.<h4>Methods</h4>To assess short-term changes in DNA methylation (within 2 hours), blood samples were collected from five non-diabetic adults before and after HEC. mRNA sequencing (mRNA-seq) and targeted bisulfite sequencing (methyl-seq) were performed. Using mRNA-seq, 697 differentially expressed genes (DEGs) were identified, and methyl-seq was used to select those with changes in promoter or gene body methylation. In vitro validation study was also performed in THP1 and 3T3-L1 cells after acute insulin treatment.<h4>Results</h4>Among the 697 DEGs, 119 (henceforth, 'methyl-DEGs') showed methylation changes. Of these 697 DEGs, 45 ('publictrait- DEGs') were associated with pathways such as oxidative stress, insulin signaling, inflammation, and carbohydrate metabolism. Interaction networks between methyl-DEGs and public-trait-DEGs revealed that six genes (B3GALNT1, ESR1, FGF4, PER1, PRKAR1B, and TNFSF4) were affected by DNA methylation and linked to insulin response or diabetes. In response to acute insulin treatment, ESR1, PRKAR1B, PER1, and B3GALNT1 expression decreased in THP1 cells. Similar trends were seen in 3T3-L1 cells, except B3GALNT1. PER1 displayed consistent and significant downregulation across the clamp study and the two cell lines, indicating it as a key circadian-responsive gene under acute hyperinsulinemia.<h4>Conclusion</h4>These results provide epigenetic evidence for the role of DNA methylation in CpG regions and gene bodies in hyperinsulinemia- mediated regulation of gene expression in blood cells, which warrants further studies in relation to diabetes-related pathophysiology.

Also flagged:synthesisureasUreaMethicillinamidesbenzyl
Journal Article 2025-09-05 No Snippets González-Cruz JA, González-Gallardo G, Pérez-Velázquez JR, García-Mejía CD, Guevara-Vela JM, Oria-Hernández JA, Castillo-Villanueva A, Rinza-Rocha T, Hernández-Vázquez E.
Show Full Abstract

We describe the synthesis and activity against methicillin-resistant Staphylococcus aureus (MRSA) of a collection of urea-containing amides. The approach considered the ureido group as a bioisoster of known FabI inhibitors. NMR characterization and density functional theory studies demonstrated the presence of s-cis and s-trans rotamers in the N-benzyl examples (series 2). Preliminary screening showed the ability of series 1 and 3 (N-aryl and N-arilpiperidone derivatives, respectively) to inhibit the bacterial growth of two MRSA strains (a clinical isolate and ATCC 33591). Compound 3b inhibited 50% of the clinical strain and 34% of the ATCC. Subsequent biological assays let us determine the IC<sub>50</sub> values of the most active ureas in both strains, standing out compounds 1a (45.8 ± 2.3 μM) and 3b (43.6 ± 2.0 μM). Finally, molecular docking suggests FabI as a possible molecular target for the designed compounds.

HFE
Also flagged:breast cancerirontumorHereditary hemochromatosiscancerdeath
Journal Article 2025-09-05 ✓ 5 Snippets Buttignol M, Bouche C, Chrétien M, Taris N, Ozmen T, Mathelin C.
In-Text Gene Mentions

Hemochromatosis: A Risk Factor…

…most cases ofhemochromatosis, may contribute to…

…a link betweenhemochromatosisand breast cancer…

…an impact ofhemochromatosison tumor progression.…

…TheHFEgene variants C282Y…

Show Full Abstract

<h4>Objective</h4>Hereditary hemochromatosis and breast cancer are two major public health problems. The <i>HFE</i> gene variants C282Y and H63D, responsible for most cases of hemochromatosis, may contribute to carcinogenesis via iron overload, oxidative stress, and hormonal modulation. The aim of this study was to evaluate the association between <i>HFE</i> variants and breast cancer risk and propose a personalized surveillance strategy.<h4>Materials and methods</h4>A systematic review and a meta-analysis were conducted according to Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Eligible studies included case-control and cohort studies reporting breast cancer incidence in women with <i>HFE</i> gene C282Y and/or H63D variants. Data were pooled using a random-effects model. Subgroup analyses and meta-regressions explored sources of heterogeneity.<h4>Results</h4>Eight studies comprising 73,981 participants were included, published between 2000 and 2025. Among them, analysis of four revealed a link between hemochromatosis and breast cancer risk. In one study, a link was observed between the <i>HFE</i> C282Y allele and higher lymph node involvement, which may suggest an impact of hemochromatosis on tumor progression. By contrast, three studies did not find any link between the two diseases. Our meta-analysis showed a trend toward increased breast cancer risk in carriers of <i>HFE</i> variants, particularly C282Y homozygotes (odds ratio = 1.36, 95% confidence interval = 0.75-1.98). Substantial heterogeneity was present (I² >50%), but no tested covariates significantly explained this variation. Sensitivity analyses confirmed the robustness of the estimate.<h4>Conclusion</h4>In the absence of randomized trials with mortality endpoints, our findings do not yet justify changes in clinical practice. They nevertheless support prospective studies to assess whether women carrying these pathogenic variants, especially C282Y/C282Y homozygotes, could benefit from adapted breast cancer surveillance, potentially involving more frequent evaluations or advanced imaging to improve early detection.

Also flagged:keratoconusastigmatismvisionkeratectasiaPMS2DPP6
Journal Article 2025-09-05 No Snippets Huang X, Ma M, Chen X, Lian Y, Li H, Sheng X.
Show Full Abstract

<h4>Purpose</h4>Keratoconus (KC) is a bilateral, asymmetric disease causing corneal thinning, irregular astigmatism, and vision decline, with unclear etiology. This study aims to investigate pathogenic variants of candidate genes in Chinese KC families via whole exome sequencing (WES).<h4>Methods</h4>The Pentacam 3D anterior segment analysis system was applied for keratectasia detection, and the Corvis ST was used for corneal biomechanics measurement. Probands from KC families were screened via WES and further verified in other family members through Sanger sequencing. Additionally, qPCR was used to validate copy number variants and identify pathogenic gene loci. The identified variants were then classified according to the Standards and Guidelines for the Interpretation of Sequence Variants published by the American College of Medical Genetics and Genomics (ACMG). Finally, STRING protein-protein interaction (PPI) networks analysis was performed to investigate interactions among candidate gene-related proteins.<h4>Results</h4>Using WES, four heterozygous missense variants were detected in the ZNF469, KRT12, COL8A2, and COL18A1 genes: c.4384G > A: p.Asp1462Asn, c.1229T > G:p.Val410Gly, c.505A > G:p.Ile169Val, and c.1159G > A:p.Gly387Arg. Additionally, a heterozygous frameshift variant was detected in the PMS2 gene: c.1551_1572del:p.Ser517Argfs*71. The affected parents carried the same variants as the probands verified by Sanger sequencing. A copy number variant was detected in the DPP6 gene: seq[GRCh38] dup(7)(q36.2q36.2) chr7:g.153782360_ 153982491dup. According to ACMG guidelines, ZNF469, KRT12, COL8A2, and COL18A1 gene variants are Likely Pathogenic; PMS2 and DPP6 gene variants are Pathogenic. STRING analysis highlights a tightly interconnected network centered on COL8A2, involving COL18A1, FN1, ZNF469, and KRT12. DPP6 was involved in KC via affecting FN1. In four of six autosomal dominant KC (adKC) families, affected parents had the same variants as probands but milder phenotypes.<h4>Conclusion</h4>In this study, six novel variants in ZNF469, KRT12, COL8A2, COL18A1, PMS2, and DPP6 were linked to adKC. Family phenotypes showed variable expressivity with irregular dominance inheritance. Abnormal KC-related gene protein expression may contribute to corneal structural instability. This study broadened KC genetic screening candidates and suggested genetic testing could aid early KC diagnosis and intervention.

Also flagged:HBV infectionco-infectionsP. falciparum infectionsiliconAlanine transaminaseALT
Journal Article 2025-09-05 No Snippets Nyarko EN, Amakye EK, Ofori EK, Appiah M, Anim M, Lartey NL, Ametepe S, Adu EA, Kumi J, Dodoo DND, Adom M, Owiredu E, Kwafo E, Obirikorang C.
Show Full Abstract

Coinfection of humans with Hepatitis B Virus (HBV) and non-viral pathogens may worsen the outcome of HBV infection on the liver. This study determined the prevalence of Heliobacter pylori, Salmonella typhi, Plasmodium falciparum, and Toxoplasma gondii among Hepatitis B Virus (HBV)-infected persons in the Greater Accra Region (GAR) of Ghana and examined how such co-infections might affect the levels of selected liver function markers (LFM). The design was cross-sectional, involving 120 HBsAg-positive HBV-infected persons. Blood samples were collected. H. pylori, S. typhi, P. falciparum, and T. gondii were screened for, from the blood using lateral flow immunochromatographic assays. P. falciparum infection was further confirmed by blood film microscopy. LFM's and blood platelets were measured using clinical chemistry and reflective light suppression/silicon photomultiplier techniques respectively. Data were analyzed using SPSS v. 23.0, and GraphPad 7.0. Seventy-five,75(62.5%) of the participants were males, and 51.7% were 21-to-30-years old. Prevalence of H. pylori, S. typhi, T.gondii and P. falciparum were 40.8% (95% CI: 32.5-49.8), 2.5% (95% CI: 0.8-7.1), 19.2% (95% CI: 13.1-27.1), and 2.5% (95% CI: 0.8-7.1) respectively. Levels of Alanine transaminase (ALT) were higher in HBV-H.pylori coinfected persons compared with HBV-only (33.5vs23.5IU,p < 0.001). HBV-infected persons in the GAR have high prevalences of H. pylori and T. gondii coinfections. Some LFM's were elevated due to such coinfections. Care givers would need to widen their screening, monitoring, and diagnosis of HBV coinfections, beyond examination for malaria parasites, and monitor other possible causes of biochemical derangements among HBV-infected persons.

Also flagged:macromoleculecanceramino acidsynthesisCRISPRCas9
Journal Article 2025-09-05 No Snippets Hilbert L, Gadzekpo A, Vecchio SL, Wellhäusser M, Tschurikow X, Prizak R, Becker B, Burghart S, Oprzeska-Zingrebe EA.
Show Full Abstract

The genome stores and processes approximately 1.5 gigabytes of encoded information. In this article, we propose that the eukaryotic genome and its adaptable three-dimensional packing in the form of chromatin offer a valuable template for the system architecture of DNA-based digital computers. We examine embryonic and stem cells, which exhibit distinct chromatin-associated condensates enriched in transcription machinery. These dynamic biomolecular condensates facilitate the spatial association of genes, genomic control elements, and molecular machinery responsible for reading the genomic code. Drawing a compelling analogy to the von Neumann computer architecture-which integrates storage, processing, and memory in most electronic computers-we reflect on how the operational principles of these condensates could inspire the design of a similar architecture for future DNA computers. In particular, we describe how one could recreate such an architecture by exploiting the process of surface condensation, which underlies the formation of chromatin-associated condensates. We conclude by reviewing our initial steps of constructing synthetic DNA nanostructures that follow the same operational principles and enable programmable surface condensation. Finally, we outline how computational methods from accelerated materials design could further advance the development of DNA computer system architectures.

HFE
Also flagged:hallucinationCYP2D6CYP2C9CYP2C19metabolismBRCA1
Journal Article 2025-09-05 ✓ 2 Snippets Hsu HY, Chen LW, Hsu WT, Hsieh YW, Chang SS.
In-Text Gene Mentions

…cancer syndrome, andHFE-related hemochromatosis [ 14…

…syndrome, and HFE-relatedhemochromatosis[ 14 ].…

Show Full Abstract

<h4>Background</h4>The effective implementation of personalized pharmacogenomics (PGx) requires the integration of released clinical guidelines into decision support systems to facilitate clinical applications. Large language models (LLMs) can be valuable tools for automating information extraction and updates.<h4>Objective</h4>This study aimed to assess the effectiveness of repeated cross-comparisons and an agreement-threshold strategy in 2 advanced LLMs as supportive tools for updating information.<h4>Methods</h4>The study evaluated the performance of 2 LLMs, GPT-4o and Gemini-1.5-Pro, in extracting PGx clinical guidelines and comparing their outputs with expert-annotated evaluations. The 2 LLMs classified 385 PGx clinical guidelines, with each recommendation tested 20 times per model. Accuracy was assessed by comparing the results with manually labeled data. Two prospectively defined strategies were used to identify inconsistent predictions. The first involved repeated cross-comparison, flagging discrepancies between the most frequent classifications from each model. The second used a consistency threshold strategy, which designated predictions appearing in less than 60% of the 40 combined outputs as unstable. Cases flagged by either strategy were subjected to manual review. This study also estimated the overall cost of model use and was conducted between October 1 and November 30, 2024.<h4>Results</h4>GPT-4o and Gemini-1.5-Pro yielded reproducibility rates of 97.8% (7534/7700) and 98.9% (7612/7700), respectively, based on the most frequent classification for each query. Compared with expert labels, GPT-4o achieved 93.5% accuracy (Cohen κ=0.90; P<.001) and Gemini-1.5-Pro 92.7% accuracy (Cohen κ=0.89; P<.001). Both models demonstrated high overall performance, with comparable weighted average F1-scores (GPT-4o: 0.929; Gemini: 0.935). The models generated consistent predictions for 341 of 385 guideline items, reducing the need for manual review by 88.6%. Among these agreed-upon cases, only one (0.3%) diverged from expert labels. Applying a predefined agreement-threshold strategy further reduced the number of priority manual review cases to 2.9% (11/385), although the error rate slightly increased to 0.5% (2/374). The inconsistencies identified through these methods prompted the prioritization of manual review to minimize errors and enhance clinical applicability. The total combined cost of using both LLMs was only US $0.76.<h4>Conclusions</h4>These findings suggest that using 2 LLMs can effectively streamline PGx guideline integration into clinical decision support systems while maintaining high performance and minimal cost. Although selective manual review remains necessary, this approach offers a practical and scalable solution for PGx guideline classification in clinical workflows.

HTT
Also flagged:Pridopidineneurodegenerative disorderSigma-1 receptorHD-19gelatin
Journal Article 2025-09-05 ✓ 1 Snippet Reilmann R, Feigin A, Rosser AE, Kostyk SK, Saft C, Cohen Y, Schuring H, Hand R, Tan AM, Chen K, Feng W, Navon-Perry L, Cruz-Herranz A, Syltevik C, Boot D, Squitieri F, Kayson E, Mehra M, Goldberg YP, Geva M, Hayden MR, PROOF-HD study investigators.
In-Text Gene Mentions

…the huntingtin (HTT) gene, confirmed…

Show Full Abstract

Huntington's disease (HD) is a rare, neurodegenerative disorder for which only symptomatic treatments are available. The PROOF-HD study was a randomized, double-blind, placebo-controlled phase 3 trial evaluating the efficacy and safety of pridopidine, a selective Sigma-1 receptor agonist, in HD. The primary and key secondary endpoints, change in total functional capacity (TFC) and composite Unified Huntington's Disease Rating Scale (cUHDRS) score at week 65, were not met in the overall population. The TFC least-squares mean difference between pridopidine and placebo was -0.18 (95% confidence interval -0.49 to 0.14; P = 0.26). The cUHDRS least-squares mean difference between pridopidine and placebo was -0.11 (95% confidence interval -0.40 to 0.18; P = 0.45). Sensitivity analysis in a subgroup of participants not treated with antidopaminergic medications at any time demonstrated a consistent pattern favoring pridopidine across multiple measures, including TFC and cUHDRS. Notably, pridopidine 45 mg twice daily demonstrated a favorable safety and tolerability profile. Taken together, pridopidine has the potential to address a critical unmet need in HD. ClinicalTrials.gov identifier: NCT04556656 .

HFE
Also flagged:HemojuvelinIronBone Morphogenetic ProteinHepcidinBMPSMAD
Journal Article 2025-09-05 ✓ 5 Snippets Xiao X, Moschetta GA, Chowdhury SB, Phillips S, Ghatpande N, Fisher AL, Xue Y, Babitt JL.
In-Text Gene Mentions

HemochromatosisProteins Hemojuvelin and…

…homeostatic iron regulator (HFE) are hepcidin modulators…

…whether HJV andHFEinfluence hepcidin regulation…

…endothelial Bmp2/Hjv and Bmp5/Hfe.…

…with double endothelial Bmp2/HfeKO and Bmp6/Hjv…

Show Full Abstract

The bone morphogenetic protein (BMP)-SMAD signaling pathway is central to regulating hepcidin, the master regulator of systemic iron homeostasis. We have previously demonstrated that BMP6, BMP2, and, to a lesser extent, BMP5 are the major ligands contributing to hepcidin and iron homeostasis regulation in vivo. Hemojuvelin (HJV) and homeostatic iron regulator (HFE) are hepcidin modulators that are mutated in hereditary hemochromatosis. Although both HJV and HFE regulate hepcidin, at least partly, by functionally interacting with the BMP-SMAD pathway, the mechanisms are incompletely understood. Notably, both HJV and HFE can regulate hepcidin in a BMP6-independent manner. To understand whether HJV and HFE influence hepcidin regulation by BMP2 and/or BMP5, we investigated the iron phenotype of mice with combined mutations in endothelial Bmp2/Hjv and Bmp5/Hfe. We found that endothelial Bmp2/Hjv double knockout (KO) mice exhibit more severe hepcidin deficiency and iron overload than single endothelial Bmp2 or Hjv KO mice, similar to previous findings in mice with double endothelial Bmp2/Hfe KO and Bmp6/Hjv KO, or a functional loss of both Bmp6 and Hfe. Moreover, we found that iron completely fails to induce hepcidin in both endothelial Bmp2/Hjv and Bmp2/Hfe double KO mice. In contrast, a functional loss of BMP5 does not worsen hemochromatosis in Hfe KO mice. Together with other published data, these findings suggest a model whereby BMP2 and BMP6 can signal to hepcidin induction independently of HJV and HFE and vice versa. In contrast, BMP5, HJV, and HFE are all required for iron-mediated hepcidin regulation in the absence of BMP2 and BMP6.

DCC
Also flagged:Anorexia nervosaANbehavioralpsychiatric disorderschromosomeCadm1
Journal Article 2025-09-05 ✓ 1 Snippet Huang K, Magateshvaren Saras MA, Conn K, Greaves E, Reed F, Tyagi S, Munguba H, Foldi CJ.
In-Text Gene Mentions

…in which theDccgene, the product…

Show Full Abstract

<h4>Objective</h4>Converging evidence from neuroimaging studies and genome-wide association study (GWAS) suggests the involvement of prefrontal cortex (PFC) and striatum dysfunction in the pathophysiology of anorexia nervosa (AN). However, identifying the causal role of circuit-specific genes in the development of the AN-like phenotype remains challenging and requires the combination of novel molecular tools and preclinical models.<h4>Methods</h4>We used the activity-based anorexia (ABA) rat model in combination with a novel viral-based translating ribosome affinity purification (TRAP) technique to identify transcriptional differences within a specific neural pathway that we have previously demonstrated to mediate pathological weight loss in ABA rats (i.e., medial PFC neurons that project to the nucleus accumbens shell). We compared actively transcribed genes in rats susceptible to weight loss to the subpopulation of rats resistant to weight loss under the same experimental conditions.<h4>Results</h4>We reveal 1424 differentially expressed genes between Susceptible and Resistant rats, highlighting important transcriptional changes associated with ABA within this pathway. The changes observed were independent of current calorie deficit and associated with metabolic, mitochondrial, and neural functions. Further, we show that genes upregulated in Resistant rats were involved in mitochondrial function, while downregulated genes were associated with cytoskeletal, postsynaptic, and axonal functions, supporting the hypothesis that hyperexcitability of cortico-striatal circuit function is a critical mediator of pathological weight loss in ABA.<h4>Discussion</h4>These findings represent an essential first step in understanding how circuit-specific gene expression patterns may contribute to susceptibility to ABA and provide potential molecular targets for manipulation in this animal model of AN.<h4>Public significance</h4>This study identifies specific brain gene activity patterns that may explain why some individuals are more vulnerable to extreme weight loss, as seen in AN. Using an advanced molecular technique in a well-established animal model, key differences in a neural pathway linked to cognitive control were observed. These findings pave the way for more targeted treatments that could prevent or reverse this dangerous condition.

OLFM4
Also flagged:IL-25reproductionimmunityinfectioninflammatory disordersIL-25 receptor
Journal Article 2025-09-05 ✓ 1 Snippet Cortez VS, Viragova S, Koga S, Liu M, O'Leary CE, Ricardo-Gonzalez RR, Schroeder AW, Kochhar N, Vaka D, Boffelli D, Klein OD, Diamond MS, Liang HE, Locksley RM.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Adaptation of intestinal helminths to vertebrates involved the evolution of strategies to attenuate host tissue damage to support parasite reproduction and dissemination of offspring to the environment. Helminths initiate the IL-25-mediated tuft cell-type 2 innate lymphoid cell (ILC2) circuit that enhances barrier protection of the host, although viable parasites can target and limit this pathway. We used IL-25 alone to create small intestinal adaptation, marked by anatomic and immunologic changes that persisted months after induction. Adaptation was associated with heightened resistance to barrier pathogens, including in the lung, and was enforced by transcriptionally and epigenetically modified effector-memory ILC2s distinct from those described by innate "training"; epithelial stem cells remained unaltered. Despite requiring IL-25 for induction, effector-memory ILC2s maintained an activated state in the absence of multiple alarmins and supported mucosal resilience while avoiding adverse sensitization to chronic inflammation, revealing a pathway for deploying innate immune cells to coordinate a distributed mucosal defense.

SOX6
Also flagged:CXXC Finger Protein 1BMPprogenitorcell differentiationbone formationCFP1
Journal Article 2025-09-05 ✓ 1 Snippet Pignatti E, Jiang L, Shah MS, Karpurapu A, Miao J, Liu Y, Berber M, Kalagara R, Butler AE, Skalnik DG, Rosen V, Breault DT, Carlone DL.
In-Text Gene Mentions

Sox6

Show Full Abstract

The mechanisms mediating endochondral bone formation remain incompletely understood. Here, we show that CXXC Finger Protein 1 (CFP1) is required for the onset of chondrogenesis during forelimb development. CFP1-deficient mesenchymal progenitor cells (LMPs) retain an immature molecular signature with elevated FGF and SHH signaling and repressed BMP signaling, in part, due to (1) reduced expression of type I BMP receptors, (2) reduced Smad1 protein levels and (3) an altered extracellular niche. Moreover, the addition of exogenous BMP ligand or antagonism of heparan sulfate restores LMP differentiation toward a chondrogenic fate and enhances BMP signaling, suggesting a defect in BMP ligand bioavailability mediates the CFP1-deficient LMP phenotype. Together, these findings define CFP1 as a gatekeeper between the undifferentiated and differentiated state of LMPs during endochondral bone formation and as a physiological regulator of BMP signaling. CLASSIFICATION: Biological Sciences.

Also flagged:Congenital Heart Diseasepathogenesishypoplastic left heart syndromeHLHSseptal defectsventricular septal defect
Journal Article 2025-09-05 No Snippets Rao E, Annavarapu S.
Show Full Abstract

Congenital heart disease (CHD) is the most common congenital anomaly. While surgical and interventional advancements have improved survival, the management of associated complications and comorbidities remains complex and would benefit from a personalised approach that more accurately predicts individualised risks and prognoses. Recently, next-generation sequencing has uncovered diverse genetic factors, including epigenetic modifications, somatic mosaicism and regulatory non-coding variants. Despite these advances, challenges persist in translating genomic data into clinical risk prediction and therapeutic guidance. Experimental approaches, such as patient-derived induced pluripotent stem cells (iPSCs) and single-cell sequencing, offer promising preclinical models for interpreting novel variants. Integrating genomic insights into clinical practice requires multidisciplinary team collaboration. The clinicians need to keep themselves abreast with current genomic advancements to optimise customised, individualised care to improve future outcomes for patients with CHD. We aim to provide an overview of the advances in genomic technologies linking the genetics of cardiac development with the pathogenesis of CHD for a better understanding of molecular-morphological correlation.

NEGR1
Also flagged:prostate cancerType 2 diabetesmethylationgene expressionpsychiatric disordersTMX2
Journal Article 2025-09-05 ✓ 1 Snippet De Walsche A, Gauthier F, Boissot N, Charcosset A, Mary-Huard T.
In-Text Gene Mentions

…three remaining genesNEGR1, TMX2, and C11orf31…

Show Full Abstract

Composite hypothesis testing using summary statistics is a well-established approach for assessing the effect of a single marker or gene across multiple traits or omics levels. Numerous procedures have been developed for this task and have been successfully applied to identify complex patterns of association between traits, conditions, or phenotypes. However, existing methods often struggle with scalability in large datasets or fail to account for dependencies between traits or omics levels, limiting their ability to control false positives effectively. To overcome these challenges, we present the qch_copula approach, which integrates mixture models with a copula function to capture dependencies between traits or omics and provides rigorously defined <i>P</i>-values for any composite hypothesis. Through a comprehensive benchmark against eight state-of-the-art methods, we demonstrate that qch_copula controls Type I error rates effectively while enhancing the detection of joint association patterns. Compared to other mixture model-based approaches, our method notably reduces memory usage during the EM algorithm, allowing the analysis of up to 20 traits and 10<sup>5</sup>-10<sup>6</sup> markers. The effectiveness of qch_copula is further validated through two application cases in human and plant genetics. The method is available in the R package qch, accessible on CRAN.

Also flagged:TumorGlutaminemetabolismtriple-negative breast cancercytoplasmextracellular
Journal Article 2025-09-05 No Snippets Wei X, Cheng J, Geng M, Chen S, Gong L, Meng S, Chen K, Wang Z, Yuan Z, Cai K, Dai L.
Show Full Abstract

The inhibition of dependent glutamine metabolism is an effective treatment for triple-negative breast cancer (TNBC) starvation, but it is limited by compensatory glycolysis and inadequate delivery efficiency. Herein, we construct a pH-responsive size/charge-reprogrammed micelle with hierarchical delivery characteristics for TNBC suppression with glutamine depletion and vessel blockade. It consists of a positively charged prodrug micelle chemically grafted with the glutamine transport inhibitor V9302 as the inner core layer, the neovascular disruptor CA4P adsorbed in the middle layer, and a pH-responsive peelable polymer as the outer shell. The nanosystem PPD/PPQV@C could effectively reduce size and reverse charge in response to the tumor acidic microenvironment by removing the outer polymer PPD, as accompanying the release of CA4P. Furthermore, the remaining PPQV could responsively release V9302 in the cytoplasm of tumor cells, improving the bioavailability of cargoes and overcoming permeability barrier through precise hierarchical release strategy. Importantly, V9302 and CA4P localized in the tumor intracellular and extracellular matrix could effectively block TNBC-dependent glutamine metabolism and inhibit compensatory nutrient by blocking angiogenesis, achieving the desired tumor suppression with prolonged survival time. This work exhibits a smart nanoplatform for efficient TNBC treatment via dual blockade of the dependent glutamine metabolism and angiogenesis.

TRIM38
Also flagged:SOX8OPLLossificationSOXtranscription factorosteoblast differentiation
Journal Article 2025-09-05 ✓ 1 Snippet Wang Z, Tang Y, Gu C, Lu M, Wei Z, Zhou Q, Zhou S, Chen X.
In-Text Gene Mentions

…proteins, such asTRIM38, TRIM33, and TRIM16,…

Show Full Abstract

<h4>Background</h4>Ossification of the posterior longitudinal ligament (OPLL) is a pathological condition characterized by ectopic ossification of spinal ligaments, primarily driven by abnormal osteogenic differentiation of ligament fibroblasts with stem cell-like properties. The SOX transcription factor family is crucial in regulating cell stemness and differentiation. Among them, SOX8 is known to influence osteoblast differentiation, but its role in OPLL remains unclear.<h4>Methods</h4>SOX8 expression was analyzed in non-OPLL and OPLL ligament tissues and cells. Its role in osteogenic differentiation was assessed using ALP/Alizarin Red staining, qPCR, Western blotting, and subcutaneous ectopic ossification models in nude mice. Mass spectrometry and co-immunoprecipitation identified SOX8-interacting E3 ubiquitin ligases, with ubiquitination assays assessing their effects on SOX8 stability. RNA-seq, GTRD analysis, and dual-luciferase reporter assays revealed SOX8 target genes. Functional recovery experiments were conducted to explore the role of these interactions in the osteogenic differentiation of ligament fibroblasts.<h4>Results</h4>SOX8 expression was downregulated in OPLL ligament tissues and cells. Functional analyses showed that SOX8 inhibits osteogenic differentiation of ligament fibroblasts both in vitro and in vivo. Mechanistically, TRIM25, an E3 ubiquitin ligase, was found to interact with SOX8, promoting its ubiquitination and degradation. Rescue experiments showed that SOX8 knockdown or overexpression reversed the osteogenic effects of TRIM25 knockdown or overexpression in ligament fibroblasts. Additionally, OSR2 was identified as a transcriptional target of SOX8, with SOX8 promoting OSR2 transcription. OSR2 knockdown negated the inhibitory effects of SOX8 overexpression on osteogenic differentiation.<h4>Conclusions</h4>SOX8 serves as a critical negative regulator of osteogenic differentiation in ligament fibroblasts. TRIM25 promotes ectopic ossification in OPLL by enhancing SOX8 ubiquitination and degradation, while SOX8 inhibits osteogenic differentiation through transcriptional activation of OSR2. These findings highlight the TRIM25/SOX8/OSR2 axis as a key regulator in OPLL ectopic ossification, suggesting it to be a potential target for non-surgical treatment.

PTGIS
Also flagged:pathogenesisAlzheimer's diseasemitochondrialmetabolismADcognitive impairment
Journal Article 2025-09-05 ✓ 3 Snippets Bishara MA, Chum PP, Miot FEL, Hooda A, Hartman RE, Behringer EJ.
In-Text Gene Mentions

…Cgnl1, C1qc, Aebp1,Ptgis, Saa3, Fcrls, C1qa,…

…Cgnl1, C1qc, Aebp1,Ptgis, Saa3, C4b, Ednrb)…

…Pdk4, C1qb, C1qc,Ptgis, C4b, and Ednrb…

Show Full Abstract

<h4>Introduction</h4>Alzheimer's disease (AD) is a common neurodegenerative condition involving a complex blend of disturbances in synaptic development and maintenance, neurovascular cross-talk, ionic and nutrient transport, and mitochondrial metabolism. The precise molecular profile of AD onset with insight for major pathological contributors remains unclear with corresponding impedances in therapeutic development. The current study sought two objectives, as (i) to resolve the molecular pathogenesis from cognitive impairment to the onset of AD-like neuropathology and (ii) whether the novel agent cannabidiol (CBD), noted for its neuroprotective effects, influences the molecular transition associated with AD onset.<h4>Methods</h4>Dietary CBD was administered daily (80-100 mg/kg/day) in male <i>3xTg-AD</i> mice and wild-type B6129SF2/J animals from 4.5 to 6.5 mo of age with inclusion of vehicle controls. RNA sequencing encompassed longitudinal and cross-sectional blood and brain samples, respectively. Metabolomics and behavioral analyses examined brain regions (cortex, hippocampus) and associated integrated neurocircuitry.<h4>Results and discussion</h4>There were >1,000 differentially expressed markers of AD onset, whereby >75% were either eliminated or reversed in the direction of expression in response to CBD. Signaling pathways encompassed synaptic development and plasticity (e.g., Foxp2), neurovascular interactions (Smad9, Angptl6), receptors and ion channels (Gria4, Chrna2, Rgs7/Rgs7bp), mitochondrial genes (Ndufa7, Cox7a2), immunity (Ncr1), oxidation-reduction (Esr1), lipid synthesis (Fasn, ApoE), and carbohydrate metabolism (Mafa, Mlxipl). As potentially addressable with CBD treatment, AD onset represents molecular integration of neurovascular interactions, channelopathies, metabolic disturbances, and aberrations in developmental genes with involvement of major pathological contributors such as inflammation, oxidative signaling, dyslipidemia, and insulin resistance.

HTT
Also flagged:methelenedioxymethamphetamineposttraumatic stress disorderPTSDanxietyfear-based disordersphobias
Journal Article 2025-09-05 ✓ 1 Snippet Ahari NJ, Fonzo GA.
In-Text Gene Mentions

…dministered 5-HT transporter (5-HTT) inhibitors for 22…

Show Full Abstract

3,4-methelenedioxymethamphetamine (MDMA) can be effective in treating posttraumatic stress disorder (PTSD) in controlled trials, potentially secondary to MDMA's effects on neural circuits implicated in fear and reward. Although anxiety, stress, and fear-based disorders involve maladaptation of the neural circuits processing fear, threat, and reward, no studies have tested MDMA's therapeutic efficacy on specific phobias. This article proposes a naturalistic biopsychosocial model of MDMA assisted therapy (MDMA-AT) informed by the neurobiological mechanisms of MDMA and the theoretical models of Emotional Processing Theory (EPT), inhibitory learning, and cognitive behavioral interpersonal theory (CBIT) to inform transdiagnostic treatments for anxiety, stress, and fear-based disorders. As a fear-based disorder with a circumscribed focus, we apply the biopsychosocial model to propose a novel MDMA-assisted Dyadic One Session Treatment (DOST) model for spider phobia, one of the most common animal phobias. Specific phobias such as spider phobia offer a straightforward naturalistic model to test the effects of MDMA on normalizing approach behavior, avoidance behavior, and neural circuit function. We hypothesize that the neurobiological and prosocial effects of MDMA can promote enhanced emotional processing and inhibitory learning of phobic stimuli during exposure exercises to create more adaptive associations that lead to increases in approach behavior and reductions in spider phobia symptomatology. Such a model may spur greater thought towards integration of evidence-based exposure therapies (ETs) designed to optimally capitalize upon the pharmacological effects of MDMA and other psychedelic compounds to treat fear-based mental health conditions.

SERPINC1
Also flagged:Alcohol-Associated Liver DiseaseCognitive impairmentalcohol-related liver cirrhosishepatic encephalopathyHEACE
Journal Article 2025-09-05 ✓ 5 Snippets Grusiecka-Stańczyk M, Janik MK, Olejnik P, Golenia A, MaƗyszko J, Raszeja-Wyszomirska J.
In-Text Gene Mentions

…<82 on theACE-III(15%) versus those…

…TheACE-IIIscore was significantly…

…independently associated withACE-IIIscores below 82…

…transplantation, the meanACE-IIIscore was 80.62…

…The meanACE-IIIscore increased to…

Show Full Abstract

Cognitive impairment (CI) in alcohol-related liver cirrhosis (ALD) is often underestimated, primarily attributed to hepatic encephalopathy (HE), despite evidence suggesting that deficits may persist after liver transplantation (LT). This study assessed CI both before and after LT through a structured psychiatric evaluation. A total of 101 ALD patients listed for LT were assessed; 61 underwent transplantation. Three patients died pre-LT, and six post-LT, leaving 55 for longitudinal cognitive evaluation. The Addenbrooke's Cognitive Examination III (ACE III) was administered at LT listing and 7.1 months post-LT. Pre-LT CI was prevalent, with 86% scoring below the ACE III threshold. Mild cognitive impairment (MCI) was observed in 33%, and 52% had a high probability of dementia. Post-LT, ACE III scores improved (Δ +7.07 ± 8.47, P < 0.01), with the greatest gains in memory (+1.46, P = 0.01) and verbal fluency (+1.43, P = 0.02), while attention remained largely unchanged. Despite overall cognitive recovery, persistent deficits were observed, particularly in executive function and fluency. LT improves cognition, but persistent deficits suggest CI in ALD is not entirely reversible. These findings underscore the need for targeted cognitive interventions before and after LT.

HTT
Also flagged:Neurodegenerative Diseasesoligonucleotidesantibodiesspinal muscular atrophymembranesAmyotrophic Lateral Sclerosis
Journal Article 2025-09-05 ✓ 1 Snippet Schreiner TG, Menéndez-González M, Schreiner OD, Ciobanu RC.
In-Text Gene Mentions

…wild-type and mutantHTTmRNA transcripts […

Show Full Abstract

Neurodegenerative diseases (NDDs) pose an immense global health burden, and developing effective treatments is hindered by the blood-brain barrier (BBB). Intrathecal (IT) administration of therapeutics directly into the cerebrospinal fluid (CSF) bypasses the BBB, offering a promising avenue for antisense oligonucleotides (ASOs), gene therapies, antibodies, and stem cells for these disorders. This review synthesizes the current landscape of IT therapies for Alzheimer's disease, Parkinson's disease, Huntington's disease, and Amyotrophic Lateral Sclerosis based on the current literature and ClinicalTrials.gov. We highlight key trials and approaches, including the success of ASOs in spinal muscular atrophy and recent progress in other NDDs. However, the efficacy of these novel treatments is often constrained by the limitations of first-generation IT delivery systems, which struggle with uneven distribution, systemic leakage, and the demands of modern biologics. Drawing from recent analyses, we underscore the critical shortcomings of current devices and point out the innovations needed in shaping next-generation systems: subcutaneous access ports, CSF flow platforms, AI-driven adaptive dosing, nanoporous membranes, intrathecal pseudodelivery, and hydrogel scaffolds. We conclude by emphasizing the urgent need for these advanced IT drug delivery systems, alongside rigorous comparative assessments, cost-benefit analyses, and clear regulatory pathways to fully realize the potential of emerging CNS therapies and transform NDD management.

Also flagged:degranulationoxygenphagocytosisextracellularchemokinesimmune responses
Journal Article 2025-09-05 No Snippets Lin Z, Yang T, Chen D, Zhang P, Luo J, Chen S, Gu S, Shen Y, Tang T, Chang T, Dong L, Zhang C, Tang Z.
Show Full Abstract

Traditionally considered as homogeneous innate immune cells, neutrophils are now found to exhibit phenotypic and functional heterogeneity. How to determine whether the functional changes of neutrophils are caused by activation or the result of gene reprogramming? Recent advances in multi-omics technologies, including genomics, transcriptomics, proteomics, metabolomics, and spatial omics, have comprehensively explained the mechanism of neutrophil heterogeneity. At the same time, artificial intelligence, especially machine learning, has promoted the in-depth analysis of multi-omics. Here, we introduce the latest progress in the discovery of neutrophil subsets by omics research. We will further discuss the application of machine learning in analyzing the heterogeneity of neutrophils through omics methods. Our goal is to provide a comprehensive overview of how machine learning and multi-omics are reshaping our understanding of neutrophil biology and pathophysiology.

bioRxiv 2025-09-05 Preprint (No Snippets API) Squair DR, Rivers E, Sowar H, Balci A, Harmo R, Wright DJ, Beniwal G, Soetens M, Mathur S, Tollervey A, Stanton C, Fletcher AJ, Virdee S.
Show Full Abstract

The detection of viral RNA inside cells triggers a diverse range of antiviral responses, including global translation inhibition, interferon secretion and RNA sequestration. Mutations in the gene ZNFX1 cause severe paediatric immunodeficiencies, including chronic viral infection and autoinflammation. Here, we show that ZNFX1 is an RNA helicase with cryptic and unusual bifurcating E3 ubiquitin ligase activity. Nucleotide-dependent RNA binding stimulates ZNFX1 to generate complex ubiquitin chains via a two-component ubiquitin circuit wired in parallel, with ubiquitin flux occurring via either of two competing paths. One route produces K63-linked polyubiquitin that drives ZNFX1 aggregation and RNA entrapment; the other route produces K48-linked polyubiquitin that drives ZNFX1 turnover. RNA entrapment restricts RNA virus replication, and is reversible by deubiquitination. Patient ZNFX1 variants are defective for viral restriction, linking RNA entrapment to antiviral immunity in vivo .

DCC
Also flagged:Netrin-1axonalα-synucleinα-SynSNCAaxon
Journal Article 2025-09-04 ✓ 5 Snippets Han W, Wang T, Tan N, Liu H, He P, Hua Y, Fan Y.
In-Text Gene Mentions

…in colorectal cancer (DCC) increased, correlating with…

…NTN1 reduction andDCCelevation at 6…

…in colorectal cancer (DCC) system, which shapes…

…pathway genes, includingDcc, Ephb1 ,…

…in NTN1 andDCCconsistently tied to…

Show Full Abstract

<h4>Introduction</h4>Parkinson's disease (PD) is characterized by early synaptic and axonal dysfunction, driven by α-synuclein (α-Syn, encoded by the SNCA gene) aggregation. The axon guidance molecules play critical roles in neuronal integrity, yet their dysregulation in PD remains underexplored.<h4>Objectives</h4>This study aimed to demonstrate how α-Syn preformed fibrils (PFFs) alter the expression of axon guidance molecules, contributing to early synucleinopathy, and to evaluate the therapeutic potential of netrin-1 (NTN1).<h4>Methods</h4>Transgenic hSNCA<sup>Nestin</sup> mice and PFF-injected models were used. Behavioral assessments, Western blot analyses, and immunofluorescence quantified the expression of axon guidance molecules and neuronal morphology at multiple time points.<h4>Results</h4>In hSNCA<sup>Nestin</sup> mice, NTN1 mRNA and protein levels decreased significantly at 8 months, while deleted in colorectal cancer (DCC) increased, correlating with reduced dendritic length, spine density, and synaptic proteins. PFF-injected mice showed similar NTN1 reduction and DCC elevation at 6 months, alongside motor deficits and tyrosine hydroxylase-positive (TH<sup>+</sup>) neuron loss. Exogenous NTN1 application reversed morphological deficits in SH-SY5Y cells and primary neurons exposed to α-Syn PFFs, highlighting its protective role.<h4>Conclusion</h4>α-Syn-induced NTN1 reduction exacerbates early PD pathology by impairing axonal and synaptic integrity, while NTN1 restoration mitigates these effects, suggesting therapeutic potential. These findings emphasize axon guidance pathways as key contributors to PD pathogenesis and targets for disease-modifying strategies.

KLHL20
Also flagged:viral capsidmembrane proteinsaltsenzyme activitybindingsalt
Journal Article 2025-09-04 ✓ 5 Snippets Violi JP, Zhang C, Donald WA.
In-Text Gene Mentions

…family member 20 (KLHL20) containing 300 mM…

KLHL20, like KLHL7, is…

…However,KLHL20plays a broader…

…containing bCAII andKLHL20have no detectable…

…both bCAII andKLHL20were readily detected…

Show Full Abstract

Native mass spectrometry (MS) enables the analysis of protein interactions in complex biological mixtures. However, nonvolatile salts and buffers commonly present in such samples can cause ion adduction, peak broadening, and reduced signal intensity. Reducing the pressure surrounding the ionization emitter significantly improves native MS performance under these challenging conditions. Signal enhancements of up to 20-fold were observed with nanoscale emitters, and up to 7-fold with microscale emitters in high-salt solutions. Protein ions remained detectable in solutions containing up to 300 mM NaCl, unlike ambient pressure ionization. High signal-to-noise was observed for the DDB1:DCAF1 complex at 50 nM using reduced pressure ionization, whereas no readily assignable signal was detected at ambient pressure, demonstrating its utility for detecting tightly bound complexes at trace levels. Coupling to native ion mobility mass spectrometry showed that arrival time distributions and collision cross sections did not depend significantly on the pressure used, indicating that structural information is preserved. These results show that reduced pressure ionization improves native MS performance under conditions that typically suppress signal at ambient pressure, such as high salt or low analyte concentration. The method is compatible with both nano- and microscale emitters and requires only minor modifications to existing instrumentation. Reduced pressure ionization expands the range of conditions accessible by native MS and is expected to enable automated, high-throughput workflows in structural proteomics, biopharmaceutical characterisation, and protein-ligand interaction studies.

HFE
Also flagged:Metabolic DysfunctionSteatotic Liver DiseaseAlzheimer DiseaseADdementiafatty
Journal Article 2025-09-04 ✓ 1 Snippet Lim TS, Chung SJ, Jeon J, Kim JK, Kim J.
In-Text Gene Mentions

…(K83.0, K74.3, K75.4),hemochromatosis(E83.1), Wilson disease…

Show Full Abstract

<h4>Background/aims</h4>This study aimed to investigate the influence of metabolic dysfunction-associated steatotic liver disease (MASLD) and body mass index (BMI) on the incidence of Alzheimer disease (AD) in the general South Korean population.<h4>Methods</h4>The National Screening Program for Transitional Ages collected data from 66-year-old dementia-free Koreans in 2010 and 2011. MASLD was diagnosed based on the fatty liver index (≥30) and the presence of metabolic components, and overweight/obese status was defined as a BMI ≥23 kg/m<sup>2</sup>. The primary outcome was the development of AD up to December 2021. Multivariable Cox analyses were performed to evaluate whether the presence of MASLD or overweight/obese status influenced the risk of developing AD.<h4>Results</h4>A total of 376,902 dementia-free individuals aged 66 years were included in this cohort. The participants were categorized into four groups: overweight/obese non-MASLD (30.4%, n=114,528), overweight/obese MASLD (37.0%, n=139,551), lean non-MASLD (29.9%, n=126,692), and lean MASLD (2.7%, n=10,131). During a mean follow-up period of 10.38±1.90 years, 23,874 individuals (6.3%) were newly diagnosed with AD. Compared to the overweight/obese non-MASLD group, the adjusted hazard ratios (95% confidence interval) for AD in the lean MASLD, lean non-MASLD, and overweight/obese MASLD groups were 1.34 (1.24 to 1.45), 1.08 (1.04 to 1.13), and 1.13 (1.09 to 1.17), respectively.<h4>Conclusions</h4>A normal/underweight BMI and the presence of MASLD synergistically increased the risk of AD. The lean MASLD group had a higher risk of developing AD than the overweight/obese MASLD group, suggesting that the clinical relevance of MASLD for incident AD differs based on the BMI.

MLLT10
Also flagged:acute myeloid leukemiaAMLmyelodysplasia-relatedMRGMECOMEVI1
Journal Article 2025-09-04 ✓ 1 Snippet Villalba M, Montoro J, Balaguer-Roselló A, Chorão P, Cantó PA, Granados P, Gómez-Seguí I, Solves P, Such E, Cervera J, Barrragán E, Santiago M, Gil-Ortí JV, Lamas B, Bataller A, Louro A, De la Rubia J, Sanz MÁ, Sanz J.
In-Text Gene Mentions

…KMT2A, MECOM, MET,MLLT10, MLLT3, MYBL1, MYH11,…

Show Full Abstract

We analyzed the outcomes of 217 acute myeloid leukemia patients in complete remission who underwent allogeneic hematopoietic cell transplantation (HCT) with myeloablative conditioning and post-transplant cyclophosphamide-based graftversus- host disease prophylaxis, aiming to assess the prognostic significance of genetic risk categories. In the overall cohort, the 2-year overall survival (OS) and event-free survival (EFS) were 77% (95% confidence interval [CI]: 71-83) and 72% (95% CI: 66-78), respectively. European LeukemiaNet (ELN)2022 risk stratification lacked prognostic value in HCT. Instead, we identified four risk categories with distinct impact on OS: standard risk (ELN2022 favorable/intermediate and adverse risk without high-risk genetic risk under the defined subcategories), intermediate risk (≥2 myelodysplasia-related gene mutations) (hazard ratio [HR]=2.23; 95% confidence interval [CI]: 1.14-4.92), adverse risk (complex karyotype, monosomal karyotype, inv(3)/t(3;3), KMT2A rearrangement) (HR=4.24; 95% CI: 2.00-9.02), and very adverse risk (TP53 mutations) (HR=6.81; 95% CI: 3.00-15.5). These categories demonstrated similar predictive power for EFS and cumulative incidence of relapse. Moreover, integrating pre-transplant measurable residual disease (MRD) refined risk stratification, identified MRD-negative patients with ≥2 myelodysplasia-related gene mutations whose OS and EFS were comparable to standard-risk patients. This refined classification improves the prognostic value of ELN2022 for acute myeloid leukemia patients undergoing allogeneic HCT with modern platform by integrating genetic features and MRD status to better guide post-transplant management.

HFE
Also flagged:chromiumParkinson's diseasePDmetabolismpathogenesisiron
Journal Article 2025-09-04 ✓ 1 Snippet Dušek P, Subramanian RG, Serranová T, Šonka K, Růžička E, Kuta J.
In-Text Gene Mentions

…in some andhemochromatosisin others.…

Show Full Abstract

BackgroundGiven the increasing global prevalence of Parkinson's disease (PD) and its complex etiopathogenesis, understanding the role of environmental factors is crucial. Prior investigations suggested a potential link between metal exposure and PD, yet conflicting results emerged.ObjectiveTo identify differences in metal concentrations in whole blood and cerebrospinal fluid (CSF) in PD patients compared to controls.MethodsThe study involved an untreated de novo PD patient cohort from a single-center (n = 102, 38% females, mean age 59.5 (SD 12.5)) and a group of controls with comparable age and sex distribution (n = 127, 35% females, mean age 57.5 (SD 12.4)). Whole blood in all participants and CSF samples in a subgroup (n = 57/55 PD/controls) were collected and concentrations of V, Cr, Mn, Fe, Co, Ni, Cu, Zn, As, Se, Mo, Cd, Sn, Hg, and Pb, were determined through inductively coupled plasma mass spectrometry.ResultsPD patients exhibited higher concentrations of Hg in both blood and CSF (p = 0.003). Cr concentrations were lower in both blood (p = 0.004) and CSF (p < 0.001) of PD patients. Altered Fe metabolism was evident, with higher blood (p = 0.001) and lower CSF (p = 0.002) Fe concentrations. Other metal alterations in PD included higher Zn (p = 0.008) in blood and lower Co (p < 0.001), Mn (p = 0.006), V (p = 0.009), and Ni (p < 0.001) in CSF.ConclusionsThe findings highlight abnormalities in metal concentrations in biofluids associated with PD, particularly regarding Hg, Cr, and Fe which exhibited alterations in blood and CSF. These findings suggest metal dysregulation in PD, particularly Hg, Cr, and Fe, with potential implications for understanding PD pathogenesis.

Also flagged:oxygenNADPH oxidasesmitochondrialelectron transport chainchronic diseasescancer
Journal Article 2025-09-04 No Snippets Jomova K, Alomar SY, Valko R, Fresser L, Nepovimova E, Kuca K, Valko M.
Show Full Abstract

Cellular systems responsible for the formation and removal of reactive oxygen species (ROS), functioning within physiological limits, are essential for maintaining intracellular redox balance. This state is known as oxidative eustress. Key redox signaling molecules, such as superoxide anion radical (O<sub>2</sub><sup>•-</sup>) and hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>), operate at nanomolar concentrations and are produced by NADPH oxidases (regulated by various factors), the mitochondrial electron transport chain (ETC), and numerous enzymes. In addition, cell signaling is influenced by nitric oxide (NO<sup>•</sup>) and reactive lipid species. Disruption of ROS signaling can lead to oxidative stress, a harmful condition associated with many chronic diseases, including cancer. The dual nature of ROS is evident in premalignant and malignant cells at all stages of tumor development, including proliferation, migration/invasion, angiogenesis, inflammation, immune evasion, and metastasis. ROS can promote tumor formation by regulating immune cells, mitochondrial metabolism, DNA methylation, DNA damage [such as the DNA oxidation product, 8-oxo-dG, resulting from hydroxyl radical (<sup>•</sup>OH) attack], and other mechanisms. The tumor-promoting activity mediated by H<sub>2</sub>O<sub>2</sub> manifests through the promotion of epithelial-to-mesenchymal transition (EMT) and the formation of the tumor microenvironment (TME) by tumor-associated macrophages. While ROS are vital for tumor initiation and growth, their excessive production can also have anticancer effects by inducing senescence, apoptosis, or necrosis. ROS-related anticancer mechanisms include mitochondrial dysfunction, p53-dependent apoptosis, iron-dependent ferroptosis, activation of endoplasmic reticulum stress, inhibition of growth signaling pathways (such as the epidermal growth factor pathway, EGF), among others. Tumor cells employ a range of adaptive mechanisms to effectively maintain ROS levels within a dynamic range that promotes proliferation while preventing cell death. This regulation is achieved by fine-tuning the effects of antioxidants throughout all stages of cancer. During early tumor development, characterized by increased oncogene-induced oxidative stress, cancer cells depend on glutathione (GSH) and upregulated antioxidant gene expression controlled by nuclear factor erythroid 2-related factor 2 (NRF2) to maintain redox balance. The opposing roles of certain antioxidant enzymes, such as Mn-SOD (SOD2), illustrate the same duality as ROS, acting as potential tumor suppressors during early carcinogenesis and as tumor promoters during metastasis. Low-molecular-weight antioxidants such as vitamins C (ascorbate) and E (tocopherols), carotenoids (e.g., lycopene, β-carotene), flavonoids (e.g., quercetin), and isoflavones demonstrate effective antioxidant activity in vitro, but their anticancer effects in clinical settings remain unproven. Understanding the influence of the antioxidant network and the redox threshold on epithelial-to-mesenchymal transition and key tumor microenvironment components could lead to more effective therapeutic strategies. This review explores the dual roles of ROS and antioxidants throughout different stages of cancer progression.

Also flagged:Thyroid hormonebrain developmentthyroxinetriiodothyroninedeiodinaseshormone
Journal Article 2025-09-04 No Snippets Salas-Lucia F, Escamilla S, Charest A, Jiang H, Stout R, Bianco AC.
Show Full Abstract

Maternal low thyroxine (T4) serum levels during the first trimester of pregnancy correlate with cerebral cortex volume and mental development of the progeny, but why neural cells during early fetal brain development are vulnerable to maternal T4 levels remains unknown. In this study, using iPSCs obtained from a boy with a loss-of-function mutation in MCT8 - a transporter previously identified as critical for thyroid hormone uptake and action in neural cells - we demonstrate that thyroid hormone induces transcriptional changes that promote the progression of human neural precursor cells along the dorsal projection trajectory. Consistent with these findings, single-cell, spatial, and bulk transcriptomics from MCT8-deficient cerebral organoids and cultures of human neural precursor cells underscored the necessity for optimal thyroid hormone levels for these cells to differentiate into neurons. The controlled intracellular activation of T4 signaling occurs through the transient expression of the enzyme type 2 deiodinase, which converts T4 into its active form, T3, alongside the coordinated expression of thyroid hormone nuclear receptors. The intracellular activation of T4 in neural precursor cells results in transcriptional changes important for their division mode and cell cycle progression. Thus, T4 is essential for fetal neurogenesis, highlighting the importance of adequate treatment for mothers with hypothyroidism.

PLCL1
Also flagged:lipoxygenasewound healingPPARγmonohydroxy-phospholipidsfibroblast proliferation
Journal Article 2025-09-04 ✓ 1 Snippet Thomas CP, Tyrrell VJ, Burston JJ, Johnson SRC, Aldrovandi M, Alvarez-Jarreta J, Inglis R, Leonard A, Fice L, Costales J, Vidal-Puig A, Protty M, Guy C, Andrews R, Szomolay B, Cossins BC, Cardus Figueras A, Carobbio S, Jones SA, O'Donnell VB.
In-Text Gene Mentions

…Ncoa2, Ncoa3, Ppargc1b,Plcl1, Helz2, Chd9, and…

Show Full Abstract

12/15-lipoxygenase (12/15-LOX, <i>Alox15</i>) generates bioactive oxygenated lipids during inflammation, however its homeostatic role(s) in normal healing are unclear. Here, the role of 12/15-LOX in resolving skin wounds was elucidated, focusing on how its lipids act together in physiologically relevant amounts. In mice, wounding caused acute appearance of 12/15-LOX-expressing macrophages and stem cells, coupled to early generation of ~12 monohydroxy-oxylipins and enzymatically oxidized phospholipids (eoxPL). <i>Alox15</i> deletion increased collagen deposition, stem cell/fibroblast proliferation, IL6/pSTAT3, pSMAD3, and interferon (IFN)-γ levels. Conversely, CD206 expression, F480+ cells, and MMP9 and MMP2 activities were reduced. <i>Alox15<sup>-/-</sup></i> skin was deficient in PPARγ/adiponectin activity. Furthermore, while pro-inflammatory genes were upregulated as normal during wounding, many including <i>Il6, Il1b, ccl4, Cd14, Cd274, Clec4d, Clec4e, Csf3, Cxcl2, and miR-21</i> failed to revert to baseline during healing, indicating disruption of PPARγ's anti-inflammatory brake on NLRP3/inflammasome and TGF-β signaling. Reconstituting <i>Alox15<sup>-/-</sup></i> wounds with a physiological mixture of <i>Alox15</i>-derived primary oxylipins generated by healing wounds restored MMP and dampened collagen deposition. The oxylipin mixture activated the PPARγ response element in vitro, while in vivo, its coactivator, <i>Helz2</i>, was significantly upregulated as well as several fatty acid and prostaglandin PPARγ ligands. Additional inflammatory and proliferative gene networks impacted by <i>Alox15<sup>-/-</sup></i> included <i>Elf4, Cebpb</i>, and Tcf3. In summary, 12/15-LOX generates abundant monohydroxy oxylipins that act together via PPARγ. The identification of multiple gene alterations reveals several targets for treating nonhealing wounds. Our studies demonstrate that 12/15-LOX oxylipins act in concert, dampening inflammation in vivo, revealing the need to consider lipid signaling holistically.

Also flagged:breast hypoplasiapectus excavatumpectusdigestioncollagenasesAD
Journal Article 2025-09-04 No Snippets Gentile P.
Show Full Abstract

<h4>Background</h4>The author presents his own experience using breast implants (BIs) or fat grafting, commonly called lipofilling (LPF), to correct breast hypoplasia.<h4>Objectives</h4>Compare the aesthetic results obtained in a study group (SG) using BIs in breast hypoplasia correction with those of a control group (CG) treated with LPF, analyzing the influence of breast and chest deformities (tuberous breast, breast volume differences/asymmetries, nipple-areola complex asymmetry, pectus excavatum, and carinatum) in the outcomes.<h4>Methods</h4>A randomized, open-label controlled study was performed. A total of 95 patients affected by breast hypoplasia (SG) were treated with BI, comparing results with the CG (n = 90) treated with LPF. The pre-operative analysis was conducted through anamnesis (considering also the patient's expectations), clinical and photographic assessment, and an instrumental evaluation based on magnetic resonance imaging, mammography, and ultrasound. Post-operative follow-up occurred at 1, 2, 4 weeks, 3, 6, 12 months, and then annually until the fourth year.<h4>Results</h4>87,5% (n = 83) of SG patients treated with BI showed excellent aesthetic outcomes after 12 months compared with the CG patients treated with LPF, who showed the same results in 70% (n = 63) of cases. Breast augmentation maintenance in the SG was significantly higher than in the CG (p < .0001). However, more natural results were reported in the CG than in the SG (p < .0001).<h4>Conclusions</h4>BI and LPF were safe and effective in this controlled trial. CG's patients displayed more natural results, obtaining a better pectus excavatum correction, while SG's patients showed more evident and lasting results.<h4>Level of evidence i</h4>This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Also flagged:furan fatty acidcarboxymethylpropyl-furanpropionic acidfuran fatty acids
Journal Article 2025-09-04 No Snippets Bæk O, Klabunde B, Wang T, Bønnelykke K, Stokholm J, Brustad N, Nguyen DN, Chawes B.
Show Full Abstract

Circulating levels of 3-carboxy-4-methyl-5-propyl-2-furanpropionic acid (CMPF), a metabolite derived from dietary furan fatty acids primarily found in marine food sources, have long been recognized as biomarkers for fish intake. However, elevated CMPF levels are also observed in patients with type 2 diabetes or chronic kidney disease and in healthy people, associated with a reduced infection risk, suggesting potential bioactive roles in metabolism and immune function. Yet, the possible causal mechanisms behind these associations are unknown. The aim of this scoping review, derived from human observations as well as in vivo and in vitro experimental studies, is to present the hypothesis that CMPF has immunometabolic properties by providing an overview of the determinants of circulating CMPF levels and presenting the studies suggesting its influence on cellular energy metabolism, particularly through enhancing lipid β-oxidation, potentially via activation of peroxisome proliferator-activated receptors (PPARs). CMPF notably affects hepatic metabolism by increasing mitochondrial fatty acid utilization and promoting the expression of hepatokines such as fibroblast growth factor 21, which may exert systemic metabolic and anti-inflammatory effects. Additionally, elevated CMPF levels have complex impacts on pancreatic function, potentially impairing insulin secretion and modifying glucose homeostasis. These metabolic alterations in the liver and pancreas can indirectly influence immune responses, shaping energy metabolism within immune cells and enhancing anti-inflammatory phenotypes. Moreover, CMPF may also directly influence immune cell metabolism and function through PPAR activation. Epidemiological evidence further supports that elevated CMPF levels are associated with reduced susceptibility to infections. Collectively, there is compelling evidence supporting the hypothesis that CMPF is a bioactive metabolite with systemic metabolic and immunomodulatory effects, warranting further in-depth investigation.

HFE
Also flagged:congenital heart diseaseliver diseasesalcoholcongestive hepatic fibrosisliver fibrosisGGT
Journal Article 2025-09-04 ✓ 1 Snippet Iwaki M, Kobayashi T, Wada N, Saiki Y, Nagai K, Nogami A, Kawai S, Koyama S, Utsunomiya D, Nakajima A, Yoneda M.
In-Text Gene Mentions

…cholangitis, Wilson's disease,hemochromatosis, α1‐antitrypsin deficiency, d…

Show Full Abstract

<h4>Aims</h4>Many patients develop Fontan-associated liver disease (FALD) after undergoing the Fontan procedure-a surgical treatment for congenital heart disease such as single ventricle-owing to changes in venous pressure and cardiac output. Liver biopsy is the gold standard for diagnosing FALD, but has limitations. Magnetic resonance elastography (MRE) is a popular non-invasive method for evaluating liver stiffness and fibrosis in FALD; however, no unified view exists. This study aimed to assess the usefulness of MRE in evaluating the pathophysiology of FALD, including its correlation with cardiovascular parameters and histological findings.<h4>Methods and results</h4>This retrospective cohort study included 22 patients with FALD who underwent MRE at Yokohama City University Hospital. Patients with other liver diseases or a history of heavy alcohol consumption were excluded. Liver biopsies were assigned a congestive hepatic fibrosis score (CHFS). Liver stiffness was measured using MRE, and hemodynamic data were obtained using cardiac catheterization. The correlation between MRE-based liver stiffness and clinical, laboratory, and pathological findings was analyzed.Patients' median age was 21.5 years, and the Fontan procedure was performed 16.3 years (mean) ago. Biochemical findings showed elevated gamma-glutamyl transpeptidase (GGT) levels. Mean liver stiffness measured using MRE was high (5.3 kPa), which significantly correlated with CHFS stage of liver fibrosis, and also correlated with GGT levels, fibrosis 4 index, and central venous pressure.<h4>Conclusion</h4>MRE seems a promising non-invasive tool for liver fibrosis evaluation in FALD. However, it may also reflect hepatic congestion. Further studies are needed to establish its clinical utility and standard cutoff values.

SOX6
Also flagged:LipidMetabolismfatty acidPPARfads2synthesis
Journal Article 2025-09-04 ✓ 1 Snippet Wang J, Lei Q, Liu J, Sun Z, Yu X, Guo X, Tong J.
In-Text Gene Mentions

…transcription factor 6;sox6), and fads2…

Show Full Abstract

The orbital fat of bighead carp (<i>Hypophthalmichthys nobilis</i>) represents a structural fat deposit located posterior to the eyes and constitutes an important edible component of the head region. Nevertheless, molecular mechanisms governing lipid accumulation during ontogenetic development remain insufficiently characterized. Here, we performed RNA-Seq on orbital fat tissues from 6-month-old (juvenile) and 18-month-old (market-size) bighead carp. A total of 1042 DEGs were identified, with 807 up-regulated and 235 down-regulated in the 6-month-old stage. Functional enrichment revealed key pathways including fatty acid metabolism, PPAR signaling, and glycolysis/gluconeogenesis. qRT-PCR validation confirmed RNA-Seq reliability. Notably, the differential expression patterns of genes such as <i>cpt1a</i>, <i>cpt1b</i>, <i>slc27a1</i>, <i>fads2</i>, and <i>scd</i> suggest their association with an elevated capacity for lipid synthesis in the orbital fat of 18-month-old bighead carp. This study presents the first transcriptome analysis of orbital fat development in a freshwater fish, offering insights into the genetic improvement of head meat quality traits and growth in bighead carp head.

TNFSF4
Also flagged:FLT3LGM-CSFtumorcancerinterleukin-4IL - 4
Journal Article 2025-09-04 ✓ 1 Snippet Zheng Q, Zhang J, Sui H, Sun Y, Lv N, Liu L, Qu M, Tan J, Zhang B, Mo Z.
In-Text Gene Mentions

…Icosl , andTnfsf4in both FL/GM-DCs…

Show Full Abstract

<h4>Background</h4>Dendritic cells (DCs) play a crucial role in anti-tumor immunity by capturing, processing, and presenting tumor antigens to T cells, making DC-based immunotherapy a promising approach for cancer treatment. However, the most commonly used clinical strategy still relies on inducing DCs <i>in vitro</i> using granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-4 (IL - 4) (GM/IL4-DCs), which often results in a heterogeneous cell population with suboptimal anti-tumor function. Here, we compared DCs generated by co-stimulating with FMS-like tyrosine kinase 3 ligand (FLT3L) and GM-CSF (FL/GM-DCs) with the conventional GM/IL4-DCs.<h4>Method</h4>To compare the functional differences of DCs induced by different methods, we conducted a comprehensive study. Mouse bone marrow cells were continuously cultured for 9 days in a FLT3L/GM-CSF-containing medium. After cell collection, we analyzed the composition, subpopulations, and status of FL/GM-DCs using flow cytometry and scRNA-seq. Flow cytometry was also used to assess their antigen presentation and ability to stimulate T cells. <i>In vivo</i> experiments were performed to examine their distribution, anti-tumor effects, and therapeutic responses in tumor models. Finally, combining scRNA-seq and scTCR-seq, we explored the mechanisms by which FL/GM-DCs reshape the tumor microenvironment.<h4>Results</h4>The results showed that FL/GM-DCs exhibited a unique subpopulation distribution, characterized by an abundance of conventional cDC subpopulations, and demonstrated enhanced cross-antigen presentation capabilities. Notably, FL/GM-DCs were able to induce a broader and more tumor-specific CD8<sup>+</sup> T cell response, effectively reshaping the tumor microenvironment by promoting the infiltration of cytotoxic T lymphocytes (CTLs) and reducing immunosuppressive components. In contrast, GM/IL4-DCs contained fewer cDC subpopulations, eliciting a weaker initial CD8<sup>+</sup> T cell response and yielding relatively inferior anti-tumor effects.<h4>Conclusion</h4>In summary, FLT3L combined with GM-CSF induced DCs, through their unique subpopulation composition and functional state, can more effectively expand tumor-specific CD8<sup>+</sup> T cells and reshape the tumor microenvironment, thereby achieving superior immunotherapy outcomes. This study highlights the potential of FL/GM-DCs as a next-generation DC platform, paving the way for improved clinical translation of DC-based adoptive cancer immunotherapies.

Also flagged:chromosomesleaf rustrestriction enzymedigestionnitrogenwater
Journal Article 2025-09-04 No Snippets Jiang X, Liu C, Ma G, Zhao M, Li M, Chen T, Zhao P, Wang J, Luo Q, Guo T, Su L, Zhang Z, Wang J, Xiao Z, Xiao B, Zhou H, Li J, Bai X.
Show Full Abstract

Coffee (<i>Coffea</i> spp.), a globally important crop, faces challenges in germplasm conservation due to habitat loss, climate change, and limited genetic diversity validation. This study aimed to evaluate the genetic representativeness of a coffee germplasm collection (CCGC, n=185) spanning major global varieties and wild relatives using re-striction-site associated DNA sequencing (RAD-seq). We performed genome-wide SNP profiling (37,729 loci), population structure analysis (STRUCTURE, PCA), and selection sweep detection (π) to assess genetic diversity, differentiation, and functional gene coverage. Results demonstrated that CCGC captured 98% of known disease-resistance loci (e.g., <i>SH3</i>, <i>RppM</i>) and exhibited high genetic diversity (π=0.1456, He=0.3014). Population structure analysis (K=3) identified three genetically distinct subgroups, among which Group 2 exhibited the highest diversity (He=0.3014, comparable to global coffee genetic resources) and encompassed all known <i>Hemileia vastatrix</i> resistance loci. The SNP density (7.5× higher than 5K SNP arrays) enabled precise identification of 47 selective sweep regions linked to domestication and adaptation. These findings validate CCGC as a genomically representative resource for coffee breeding and conservation. This work advances coffee genetic research by bridging resource preservation with molecular breeding strategies to address climate resilience and sustainable production.

SOX6
Also flagged:Soxinfectionstranscription factorSox2Gagmembrane
Journal Article 2025-09-04 ✓ 1 Snippet Hossain MJ, Monde N, Sasaki H, Nyame P, Amesimeku WAO, Terasawa H, Matsumura S, Matsui T, Tsutsuki H, Maeda Y, Sawa T, Monde K.
In-Text Gene Mentions

…classified into Sox5,Sox6, and Sox13.…

Show Full Abstract

Human endogenous retroviruses (HERVs) were domesticated millions of years ago as ancestral relics through germline infections and have become part of the human genome (8.3%). Over time, HERVs lost their innate ability to become virulent. We have previously reported that the transcription factor Sox2 is critical for human endogenous retrovirus-K (HERV-K) LTR5H activation and transposition in induced pluripotent stem cells. In the present study, we identified HERV-K LTR5H and LTR5B activation following Sox overexpression. In addition, we found that HERV-K Gag localized in the plasma membrane and that virus-like particles were released from Sox-expressing cells. Notably, a deformed nucleus was induced by cleaved caspase-3 in the HERV-K Gag-expressing cells. The caspase-3 inhibitors increased the number of HERV-K Gag-expressing cells by inhibiting the apoptotic pathway. Furthermore, retrotransposition of HERV-K was significantly enhanced in Sox2-expressing cells treated with caspase-3 inhibitors. Taken together, these results indicate that several Sox proteins increase HERV-K expression with cleaved caspase-3, suggesting that induction of the cell apoptotic pathway prevents genome impairment by HERV-K expression and retrotransposition.

Also flagged:synthesisgypsumbentoniteGeopolymerscarboncarbide
Journal Article 2025-09-04 No Snippets Xie Z, Qian Z, Lu X, Wang H, Lai P.
Show Full Abstract

Aeolian sand is the primary geological material for construction in desert regions, and its stabilization with industrial solid wastes-based geopolymer (ISWG) provides an eco-friendly treatment replacing cement. This study comparatively investigated the enhancement effects of chemical activators and expansive agents on compressive strength of aeolian sand stabilized by ISWG (ASIG). Three chemical activators-NaOH, Ca(OH)<sub>2</sub>, and CaCl<sub>2</sub>-along with two expansive agents-desulfurized gypsum and bentonite-were considered. Through X-ray diffraction, thermogravimetric analysis, scanning electron microscopy, mercury intrusion porosimetry and pH values tests, the enhancement mechanisms of the additives on ASIG were elucidated. Results demonstrate that the expansive agent exhibits significantly superior strengthening effects on ASIG compared to the widely applied chemical activators. Chemical activators promoted ISWs dissolution and hydration product synthesis, thereby densifying the hydration product matrix but concurrently enlarged interparticle pores. Desulfurized gypsum incorporation induced morphological changes in ettringite, and excessive desulfurized gypsum generated substantial ettringite that disrupted gel matrix. In contrast, bentonite demonstrated superior pore-filling efficacy while densifying gel matrix through a compaction effect. These findings highlight bentonite superior compatibility with the unique microstructure of aeolian sand compared to conventional alkaline activators or expansive agents, and better effectiveness in enhancing the strength of ASIG.

Also flagged:lymphoproliferative disorderslymphocytosislymphomaantibodiesgene expressionTLR7
Journal Article 2025-09-04 No Snippets González-Méndez AS, Akbarin MM, Cerón-Téllez F, Acevedo-Jiménez GE, Rodríguez-Murillo C, González-Fernández VD, Ávila-De la Vega LM, Leal-Hernández M, Ramírez Álvarez H.
Show Full Abstract

<h4>Introduction</h4>Bovine leukemia virus is a single-stranded RNA virus that targets B cell CD5<sup>+</sup> lymphocytes in cattle. Only a tiny percentage of individuals develop malignant lymphoproliferative disorders, while most remain healthy carriers or experience persistent lymphocytosis. The exact mechanisms leading to lymphoma development are complex and not fully understood. RNA-seq analysis of cows' peripheral blood leukocytes (PBLs) with and without Bovine leukemia virus (BLV) antibodies was conducted to gain a deeper understanding of molecular events beyond BLV infection.<h4>Method</h4>Eighteen samples were selected, and their RNA was sequenced. For gene expression analysis and protein-protein network interactions, three groups were selected, including healthy negative samples (CT, n = 7), asymptomatic carriers (AC, n = 5), and persistent lymphocytosis (PL, n = 6), to provide the differentially expressed gene (DEG) and protein-protein interaction network (PPIN) outputs.<h4>Results</h4>Our results demonstrated that in comparison to CT, ACs upregulated TLR7 and transcription activation factors. In the CT vs. PL group, <i>MHC class II</i>, transcription activation factors, and anti-inflammatory cytokines increased, while the acute-phase proteins, antiviral receptors, and inflammatory cytokines decreased. Additionally, antiviral receptors, acute-phase proteins, and inflammatory receptors were downregulated in the PL versus the AC groups. Moreover, PPINs analysis suggested that nuclear receptor corepressor 1 (NCOR1), serine/arginine repetitive matrix 2 (SRRM2), LUC7 like 3 pre-mRNA splicing factor (LUC7L3), TWIST neighbor (TWISTNB), U6 small nuclear RNA and mRNA degradation associated (LSM4), eukaryotic translation elongation factor 2 (EEF2), ubiquitin C (UBC), CD74, and heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNP A2B1) are possible hub gene candidates in the PL group.<h4>Conclusions</h4>Our results suggest that innate and cellular immune responses are more loose in severe BLV infectious conditions, while the PPINs revealed that new protein interactions are necessary for oncogenesis.

bioRxiv 2025-09-04 Preprint (No Snippets API) Krans A, Albertson RM, Maltby CJ, Todd PK.
Show Full Abstract

Nucleotide repeat expansions support production of toxic peptides from putatively non-coding regions of the human genome without use of an AUG initiation codon. This process, known as RAN translation, was originally described at CAG repeats with products generated in all three possible reading frames. Recently, cryptic mis-splicing of mRNAs in which the CAG repeat acts as a splice acceptor was proposed as an alternative mechanism for RAN protein production. To investigate this, we generated DNA and RNA based reporters to assess RAN translation in the context of a CAG repeat expansion in exon 1 of the Huntingtin gene ( HTT), associated with Huntington Disease. HTT CAG repeats support RAN translation in both the alanine (GCA) and glutamine (CAG) frames, with or without upstream AUG start codons or near-AUG cognate codons, and at levels comparable to RAN translation from CGG and GGGGCC repeats. CAG RAN translation products were readily detectable from in vitro transcribed RNAs transfected into human cells and rodent neurons - suggesting that plasmid based aberrant splicing into CAG repeats cannot fully explain the observed phenomena. These findings indicate that RAN translation from HTT CAG repeats shares key mechanistic parameters with other disease-associated repeat expansions. <h4>Key Points</h4> Translation at HTT CAG repeats occurs in at least two reading frames absent any AUG start codon. Like RAN translation at other repeats, HTT CAG RAN translation is enhanced by cell stress. HTT CAG RAN translation readily occurs from in vitro transcribed RNAs in neurons.

bioRxiv 2025-09-04 Preprint (No Snippets API) Taylor LD, Gorman CE, Egan F, Ruane NM, McGinnity P, Hulsey CD.
Show Full Abstract

Vitamin D is a key micronutrient in vertebrate health that influences musculoskeletal function and likely modulates immune responses in tissues such as the skin. In aquaculture, Atlantic salmon ( Salmo salar ) are particularly vulnerable to skin pathogens, notably the ectoparasitic salmon louse ( Lepeophtheirus salmonis ). As the skin represents the first line of immunological defence, its capacity to mediate host-pathogen interactions may be influenced by dietary vitamin D. This study investigated the transcriptomic response of salmon skin following six months of dietary vitamin D supplementation, with a focus on immune-related gene expression. A total of 113 differentially expressed genes (DEGs) were identified, 46 of which are implicated in inflammation, immune signalling, and both innate and adaptive immunity. These DEGs were further compared to published RNA-seq data of salmon skin challenged with L. salmonis . Notably, while pro-inflammatory genes were regulated in opposing directions, heat shock proteins, lysozyme and antimicrobial peptides were consistently upregulated under both conditions. These findings suggest that vitamin D may modulate cutaneous immune responses by dampening inflammation and enhancing innate defences, potentially improving resistance to skin-associated pathogens such as salmon lice.

DCC
Also flagged:localizationCEP290blindnessLeber congenital amaurosisciliopathycilium
Journal Article 2025-09-03 ✓ 1 Snippet Moye AR, Robichaux MA, Agosto MA, Moulin AP, Graff-Meyer A, Rivolta C, Wensel TG.
In-Text Gene Mentions

DCC

Show Full Abstract

The most common genetic cause of the childhood blindness disease Leber congenital amaurosis is mutation of the ciliopathy gene CEP290. Despite extensive study, the photoreceptor-specific roles of CEP290 remain unclear. Using advanced microscopy techniques, we investigated the sub-ciliary localization of CEP290 and its role in mouse photoreceptors during development. CEP290 was found throughout the connecting cilium between the microtubules and membrane, with nine-fold symmetry. In the absence of CEP290 ciliogenesis occurs, but the connecting cilium membrane is aberrant, and sub-structures, such as the ciliary necklace and Y-links, are confined to the proximal connecting cilium. Transition zone (TZ) proteins AHI1 and NPHP1 were abnormally restricted to the proximal connecting cilium in the absence of CEP290, whereas other TZ proteins, like NPHP8 and CEP89 were unaffected. Although outer segment disc formation is inhibited in Cep290 mutant retina, we observed large numbers of extracellular vesicles. These results suggest roles for CEP290 in ciliary membrane structure, outer segment disc formation and photoreceptor-specific spatial distribution of a subset of TZ proteins, which collectively lead to failure of outer segment formation and photoreceptor degeneration.

Also flagged:membranesextracellularmembranetissue formationtissue developmentageing
Journal Article 2025-09-03 No Snippets Lennon R, Sherwood DR.
Show Full Abstract

Basement membranes (BMs) underlie or surround most tissues. They are formed of secreted proteins that associate with cell surfaces and are the most ancient animal extracellular matrix. Laminin and collagen IV are core components that polymerize into self-associating networks, providing BMs with an organizing scaffold and tensile strength. In humans, BMs also contain over 150 other secreted proteins, such as structural matrix components, enzymes and growth factors, as well as over 50 cell-membrane adhesion and signalling receptors. From this toolbox, BMs are tailored for tissue-specific functions, including filtration, shaping organs, connecting tissues and harbouring signals that guide cell migration and differentiation. Highlighting their importance to human health, defects in genes encoding BM proteins are associated with over 100 disease phenotypes. Advancing our understanding of BM regulation, function and dysregulation will reveal new approaches to prevent many human disorders and preserve tissue health. Here, we review our current understanding of BM composition, formation and function, and outline how BMs change with ageing and disease.

Also flagged:Irontransductioncell proliferationinfectionsdeathIron ions
Journal Article 2025-09-03 No Snippets Lan P, Lu Y, Fu Y, Yu Y, Zhou J.
Show Full Abstract

Iron is an essential nutrient for <i>Klebsiella pneumoniae</i>, a significant opportunistic pathogen. The host's innate immune system attempts to limit iron availability through nutritional immunity; however, <i>K. pneumoniae</i> has evolved sophisticated strategies to circumvent these defenses. This review explores the intricate mechanisms employed by <i>K. pneumoniae</i> to acquire iron from the host environment. We focus on the roles of siderophores, TonB-dependent transporters (TBDTs), and other iron acquisition systems in <i>K. pneumoniae</i>. Additionally, we discuss the regulation of iron acquisition, emphasizing the importance of intracellular iron storage and the Ferric Uptake Regulator (Fur). Novel therapeutic approaches based on these iron acquisition systems, including siderophore-associated antimicrobials, the use of gallium as an iron analog, and vaccines targeting siderophores and TBDTs, offer new insights into curbing severe <i>K. pneumoniae</i> infections. By elucidating the mechanisms of iron acquisition in <i>K. pneumoniae</i>, this review provides valuable insights into the pathogenesis of this opportunistic pathogen and presents potential strategies to combat multidrug-resistant and hypervirulent strains of <i>K. pneumoniae</i>.

Also flagged:olaparibtemozolomideoxaliplatinglioblastomatumorsgliomas
Journal Article 2025-09-03 No Snippets Zając-Grabiec A, Czopek A, Pazdan K, Jończyk J, Michałkiewicz F, Skóra T, Krzyżowska M, Biesaga B, Wiśniewski D, Ajersch P, Miszczyk J.
Show Full Abstract

<h4>Background</h4>Central nervous system (CNS) tumors, including gliomas, are among the most aggressive cancers, with glioblastoma multiforme (GBM) being the most common and lethal. This study explores the potential of multidrug repositioning as a modern chemotherapy strategy for GBM cell lines. It combines the standard GBM chemotherapeutic temozolomide (TMZ) with olaparib (OLA) and oxaliplatin (OXA), both repurposed from other cancer types. Most experimental drug therapy studies focus on just one or two selected high-grade GBM cell lines, but in this study, four such cell lines were used.<h4>Methods</h4>Glioblastoma (GBM) cell lines U118 MG, H4, U251 MG and U87 MG were treated for 72 h with oxaliplatin (OXA, 50-200 µM), olaparib (OLA, 1-100 µM), or temozolomide (TMZ, 10-100 µM). Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2 H-tetrazolium (MTS) assay. Half-maximal inhibitory concentration (IC₅₀) values were calculated using GraphPad Prism 8. A human fibroblast line (hFib) from a healthy donor was used as a control. The type of cell death following the above treatments was analysed using a fluorescence-based Apoptotic, Necrotic & Healthy Cells Quantification Kit.<h4>Results</h4>The combination of OLA, OXA, and TMZ significantly reduced cell viability and survival, inducing apoptosis/necrosis more effectively than TMZ alone. These synergistic effects alter glioblastoma metabolism, promote apoptosis, and enhance antitumor activity in vitro.<h4>Conclusions</h4>The proposed multidrug repositioning chemotherapy produced a therapeutic effect at lower doses, suggesting that it is potentially a safer and more effective treatment option.

OLFM4
Also flagged:cancerprostate cancermalignant tumorstumorGene ExpressionAQP2
Journal Article 2025-09-03 ✓ 1 Snippet Wang H, Li X, Wu L, Zhai Y, Zhu Y, Wang W, Chen D, Xing N, Ye X, Yang F.
In-Text Gene Mentions

…Notably, KRT13,OLFM4, and ITGB4 exhibited…

Show Full Abstract

<h4>Background</h4>Prostate cancer is one of the common malignant tumors in men. Recent studies have reported that non-invasive liquid biopsy is of great significance in tumor diagnosis. We hope to find relevant detection genes to establish a diagnostic and prognostic model for prostate cancer.<h4>Methods</h4>This study was based on the RNA expression data of prostate cancer patients from the The Cancer Genome Atlas (TCGA) database and the data of exosome-related genes from the GeneCards website. Key exosome-related differential genes were identified through cluster modeling, univariate and multivariate regression analyses. The roles of these genes in the occurrence and prognosis of prostate cancer were assessed using ROC curves and survival analysis. Validation was performed using prostate cancer patient data from the Gene Expression Omnibus (GEO) database.<h4>Results</h4>Firstly, we obtained 117 exosome-related differential genes (ERDEGs) from the RNA expression data of prostate cancer patients in the TCGA database. Next, through Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis, univariate Cox regression analysis, and multivariate Cox regression analysis of the ERDEGs, we obtained three genes that were significantly associated with prognosis (AQP2, H4C2, ZNF114) and calculated the risk score accordingly. Patients were divided into high-risk and low-risk groups based on this score, with significant differences in overall survival between the groups. At the same time, we conducted an immunological infiltration analysis on prostate cancer patients and Weighted correlation network analysis (WGCNA) on the ERDEGs. Finally, we used the GEO database (GSE69223, GSE229904) for verification and found that AQP2 and ZNF114 had good predictive value for the occurrence of prostate cancer.<h4>Conclusion</h4>Exosome-related genes such as AQP2 and ZNF114 exhibit good performance as non-invasive biomarkers in predicting the status and prognosis of prostate cancer to avoid the issues of high invasiveness associated with invasive examinations.

DCC
Also flagged:adhesion proteinsextracellularheparan sulfate sulfotransferasescell adhesionnucleotidesCas9
Journal Article 2025-09-03 ✓ 1 Snippet Santillan EM, Cormack ED, Wang J, Rodriguez-Steube M, Cochella L.
In-Text Gene Mentions

…rizzled, UNC-6/Netrin, UNC-40/DCC, and others) (…

Show Full Abstract

The transition from unicellular to multicellular life required the acquisition of coordinated and regulated cellular behaviors, including adhesion and migration. In metazoans, this involves adhesion proteins, signaling systems, and an elaborate extracellular matrix (ECM) that contributes to adhesion and signaling interactions. Innovations that enabled complex multicellularity occurred through new genes in these pathways, novel functions for existing genes, and regulatory changes. Gene regulation by microRNAs (miRNAs) expanded with multicellularity. A single miRNA, miR-100, arose in the last common eumetazoan ancestor and is widely conserved across animals. We reveal the molecular function of its <i>C. elegans</i> homolog, the miR-51 family. This family acts in a dose-dependent manner to control morphogenesis by regulating several genes involved in cell signaling, adhesion, and migration, including ECM modifiers-specifically heparan sulfate sulfotransferases (HSTs). Some of these targets are also predicted to be conserved targets across vertebrates. Our work suggests that this miRNA provided an innovation in the regulation of cellular interactions early in metazoan evolution.

B4GALT5
Also flagged:glycosyltransferaseglycosyltransferasesheart failureC1galt1Extl2Pigh
Journal Article 2025-09-03 ✓ 1 Snippet Wu J, Lu Y, Gao X, Hu X, Lu Z, Li C.
In-Text Gene Mentions

…B3gnt8, B3gnt9, B4galnt1,B4galt5, Chpf, Colgalt1, Galc,…

Show Full Abstract

<h4>Aims</h4>Protein glycosylation regulated by glycosyltransferases is an important type of post-translational modification. The role of the glycosyltransferase genes (GTGs) in heart failure (HF) remains unclear and requires further investigation.<h4>Methods</h4>Differential expression analysis was performed on the transverse aortic constriction (TAC)-related dataset GSE36074 to screen out the differentially expressed GTGs. Enrichment and protein-protein interaction analyses explored their functional mechanisms and interconnections. Pearson correlation analysis revealed the relationship between GTGs and pathological cardiac remodelling. The upstream miRNAs of GTGs were predicted using corresponding online databases, and the downstream target genes were identified by weighted correlation network analysis (WGCNA). Computer virtual screening and molecular docking predicted potential therapeutic drugs. The identified GTGs were validated in vivo, in vitro and in the human HF-related dataset GSE57338.<h4>Results</h4>Twenty-one differentially expressed GTGs were identified, and these genes were significantly up-regulated in the TAC model except for C1galt1, Extl2 and Pigh. Pearson correlation analysis revealed that 11 GTGs were significantly associated with pathological cardiac remodelling. Fifty-six miRNAs and 31 drugs were predicted to target these GTGs. WGCNA indicated that these GTGs were associated with lipid metabolism-related genes and pathways. Up-regulation of B3gnt9, C1galt1, Gcnt1, Gxylt2 and Mgat5b was observed in the TAC model. GXYLT2 is up-regulated and has high disease-predictive value in patients with dilated cardiomyopathy and ischaemic cardiomyopathy. Knockdown of GXYLT2 in human AC16 cardiomyocytes significantly attenuated angiotensin II (AngII)-induced hypertrophy.<h4>Conclusions</h4>Dysregulation of GTG expression may affect TAC-induced HF through metabolic pathways, and GXYLT2 may be a new potential therapeutic target for HF.

HTT
Also flagged:psychiatric illnesspsychiatric disordersbipolar disorder type IIBD IIbipolar disorder type IBD I
Journal Article 2025-09-03 ✓ 1 Snippet Sharma O, Nayak R, Mizrahi L, Rike WA, Choudhary A, Sadis H, Hussein Y, Rosh I, Tripathi U, Shemen A, Stern Y, Squassina A, Alda M, Stern S.
In-Text Gene Mentions

…Notable genes including5-HTT, SLC6A4 ,…

Show Full Abstract

This research aimed to develop a machine learning algorithm to predict suicide risk in bipolar disorder (BD) patients using RNA sequencing analysis of lymphoblastoid cell lines (LCLs). By identifying differentially expressed genes (DEGs) between high and low risk patients and their enrichment in relevant pathways, we gained insights into the molecular mechanisms underlying suicide risk. LCL gene expression analysis revealed pathway enrichment related to primary immunodeficiency, ion channels, and cardiovascular defects. Notably, genes such as LCK, KCNN2, and GRIA1 emerged as pivotal, suggesting their potential roles as biomarkers. Machine learning algorithms trained on a subset of the patients and tested on others demonstrated high accuracy in distinguishing low and high risk of suicide in BD patients. Additionally, the study explored the genetic overlap between suicide-related genes and several psychiatric disorders. Our study enhances the understanding of the complex interplay between genetics and suicidal behaviour, providing a foundation for prevention strategies.

Also flagged:UGCGglycosphingolipidtumor
Journal Article 2025-09-03 No Snippets Chen S, Wang X, Jounaidi Y.
Show Full Abstract

No abstract available.

Also flagged:deathneurological diseasesucroseTritonBSARNAse
Journal Article 2025-09-03 No Snippets Jeffries AM, Yu T, Ziegenfuss JS, Tolles AK, Baer CE, Sotelo CB, Kim Y, Weng Z, Lodato MA.
Show Full Abstract

Over time, cells in the brain and in the body accumulate damage, which contributes to the ageing process<sup>1</sup>. In the human brain, the prefrontal cortex undergoes age-related changes that can affect cognitive functioning later in life<sup>2</sup>. Here, using single-nucleus RNA sequencing (snRNA-seq), single-cell whole-genome sequencing (scWGS) and spatial transcriptomics, we identify gene-expression and genomic changes in the human prefrontal cortex across lifespan, from infancy to centenarian. snRNA-seq identified infant-specific cell clusters enriched for the expression of neurodevelopmental genes, as well as an age-associated common downregulation of cell-essential homeostatic genes that function in ribosomes, transport and metabolism across cell types. Conversely, the expression of neuron-specific genes generally remains stable throughout life. These findings were validated with spatial transcriptomics. scWGS identified two age-associated mutational signatures that correlate with gene transcription and gene repression, respectively, and revealed gene length- and expression-level-dependent rates of somatic mutation in neurons that correlate with the transcriptomic landscape of the aged human brain. Our results provide insight into crucial aspects of human brain development and ageing, and shed light on transcriptomic and genomic dynamics.

Also flagged:agingEPS8neurodegenerative diseasesALSRACFUS
Journal Article 2025-09-03 No Snippets Koyuncu S, Dominguez-Canterla Y, Alis R, Salarzai N, Petrovic D, Flames N, Vilchez D.
Show Full Abstract

Aging is a major risk factor for neurodegenerative diseases associated with protein aggregation, including Huntington's disease and amyotrophic lateral sclerosis (ALS). Although these diseases involve different aggregation-prone proteins, their common late onset suggests a link to converging changes resulting from aging. In this study, we found that age-associated hyperactivation of EPS8/RAC signaling in Caenorhabditis elegans promotes the pathological aggregation of Huntington's disease-related polyglutamine repeats and ALS-associated mutant FUS and TDP-43 variants. Conversely, knockdown of eps-8 or RAC orthologs prevents protein aggregation and subsequent deficits in neuronal function during aging. Similarly, inhibiting EPS8 signaling reduces protein aggregation and neurodegeneration in human cell models. We further identify the deubiquitinating enzyme USP4 as a regulator of EPS8 ubiquitination and degradation in both worms and human cells. Notably, reducing USP-4 upregulation during aging prevents EPS-8 accumulation, extends longevity and attenuates disease-related changes. Our findings suggest that targeting EPS8 and its regulatory mechanisms could provide therapeutic strategies for age-related diseases.

Also flagged:SerotoninAttention-Deficit Hyperactivity DisorderADHDpathogenesisneurotransmittersbehavioral
Journal Article 2025-09-03 No Snippets Solomon MB, Yegla B, Newcorn JH, Maletic V, Rubin J, Robbins TW.
Show Full Abstract

Attention-deficit hyperactivity disorder (ADHD) is characterized by core symptoms of inattention, hyperactivity, and impulsivity. Aberrant dopaminergic and noradrenergic neurotransmission are often implicated in the pathogenesis of these symptoms because ADHD treatments increase synaptic levels of these neurotransmitters in brain regions associated with attention and impulse control. However, some ADHD treatments also enhance serotonergic neurotransmission in these regions, which could contribute to their efficacy. Here, we review preclinical and clinical data highlighting functional interactions between the serotonergic and catecholaminergic systems in mediating ADHD phenotypes and responses to treatment. The potential utility of serotonergic compounds for treating distinct behavioral features and psychiatric comorbidities (e.g., depression) is also discussed. Overall, preclinical and clinical studies underscore important neuromodulatory effects of serotonin on the catecholaminergic system in mediating distinct ADHD behavioral phenotypes, notably hyperactivity-impulsivity and emotional dysregulation. Incorporating a basic understanding of dynamic monoaminergic interactions and their contributions to ADHD symptoms may identify new targets for treatment. Beyond ADHD core symptoms, emotional dysregulation, which is closely linked to serotonergic dysfunction, is common in ADHD and significantly contributes to negative outcomes across the lifespan. Therefore, an expanded conceptualization of ADHD that includes emotional dysregulation may facilitate insight into ADHD pathology and treatment.

CCDC92
Also flagged:SpermiogenesisKinasephosphorylationCSNK1G1TTBK2IFT88
Journal Article 2025-09-03 ✓ 1 Snippet Zhu T, Zhu Y, Jiang X, Zhang X, Wang B, Chen Y, Zhao Y, Wang Y, Zhou Q, Han Z, Qi Y, Luo M, Tu H, Hao B, Gao M, Ren J, Zhou X, Zhang X, Chen X, Li H, Huang Q, Situ C, Guo Y, Zhu H, Li Y, Guo X.
In-Text Gene Mentions

…shift assay withCCDC92, a previously reported…

Show Full Abstract

Spermiogenesis is the committed step of sperm production, during which spermatid cells undergo dramatic morphological transformations and transcriptional silencing. Post-translational modifications (PTMs), including phosphorylation, provide a level of protein function flexibility and play important roles in spermiogenesis. Dynamic protein phosphorylation profiles of spermatids are characterized across four different developing steps, and identified phosphorylation regulation of key proteins in spermiogenesis. Expression module and kinase-substrate phosphorylation network analysis revealed significant kinase activities of CSNK1G1 and TTBK2. CSNK1G1 is localized in the acrosome and is indispensable for acrosome biogenesis. Ttbk2 male germ cell conditional knockout mice are infertile with flagella development and head shaping defects. TTBK2 is essential for both the phosphorylation and stabilization of IFT88, an intraflagellar transport (IFT) protein with which TTBK2 colocalizes and interacts. Ciliogenesis defects in Ttbk2 knockout cells can be rescued by overexpression of TTBK2 or IFT88 but not kinase-dead TTBK2. Collectively, the systematic profiling of the spermiogenesis phosphoproteome revealed the dynamic nature and important functions of kinase phosphorylation in spermiogenesis and male fertility.

Also flagged:O-GlcNAcylationNeurodegenerative disorderstranslational modificationO-linked N-acetylglucosamine transferaseO-GlcNAcaseneurodegenerative diseases
Journal Article 2025-09-03 No Snippets Shao N, Zhang X, Ge Y, Tang J, Gao H, Si W, Cai B.
Show Full Abstract

Neurodegenerative disorders are typically caused by harmful protein accumulation and nerve cell damage. A post-translational modification called O-linked N-acetylglucosamine ylation acts as a critical regulator in these disorders by controlling protein behavior, cell signaling, and energy balance. This modification is dynamically balanced through the cooperative actions of O-linked N-acetylglucosamine transferase and O-GlcNAcase. In healthy brains, O-GlcNAcylation supports nerve cell function and survival, but its imbalance contributes to disease progression. Notably, the effects of O-GlcNAcylation differ across disorders. This review reveals how O-GlcNAcylation bridges molecular mechanisms to neurodegeneration, as well as the prospects of targeted O-linked N-acetylglucosamine acylation therapy for neurodegenerative diseases. In Alzheimer's disease, it blocks toxic changes in key proteins like tau and amyloid-beta. In Parkinson's disease, it reduces the clumping of alpha-synuclein, yet may disrupt dopamine production. In amyotrophic lateral sclerosis, it protects nerve fiber transport systems. Additionally, O-GlcNAcylation plays an indispensable part in other neurodegenerative conditions, including Huntington's disease, aging, Machado-Joseph disease, multiple sclerosis, and giant axonal neuropathy. New therapies targeting this mechanism include glucosamine supplements and O-GlcNAcase inhibitors, which show clinical promise but face translational challenges.

Also flagged:Ferroptosisagingdeathironlipidneurodegenerative diseases
Journal Article 2025-09-03 No Snippets Song Q, Sun S, Song Y, Wang Y, Yuan Y, Zhang L, Cui Q.
Show Full Abstract

Ferroptosis is a newly recognized form of programmed cell death characterized by iron overload-dependent lipid peroxidation. These pathological phenomena are often observed in neurodegenerative diseases. Aging is an irreversible process characterized by the deterioration of tissue and cell function. It has been shown to contribute to neurodegenerative diseases and increase susceptibility to ferroptosis. Therefore, ferroptosis may be involved in the progression of neurodegenerative diseases as a pathogenic factor, and aging is the common catalyst of both processes. The purpose of this review is to elucidate the latest progress on the mechanisms related to ferroptosis in neurodegenerative diseases, including iron overload, lipid peroxidation, antioxidant defense, cell membrane repair, and the regulation of autophagy and transcription factors. We also explored the relationship between ferroptosis and aging and reported that aging can induce ferroptosis by increasing iron overload, enhancing lipid peroxidation, and exacerbating autophagy disorders. Since ferroptosis is a pathogenic factor in neurodegenerative diseases, we screened gene bank databases and found that many genes associated with ferroptosis and neurodegenerative diseases overlap. Additionally, genes related to both the peroxidation pathway and ferroptosis are enriched. Ferroptosis occurs under conditions of age-related iron accumulation and lipid enrichment, as well as due to disorders in autophagy levels and transcription factors. Furthermore, in various neurodegenerative diseases, specific pathological changes or products can also contribute to the occurrence of ferroptosis. Finally, based on animal studies and clinical trials involving ferroptosis inhibitors, physical therapies, stem cell treatments, and exosome therapies in neurodegenerative diseases, it has been found that inhibiting ferroptosis can effectively reverse neurological dysfunction and cognitive impairment associated with these conditions. However, given various limitations, the conclusions of some animal studies and clinical trials have not been ideal, indicating that further large-scale research is necessary. Taken together, ferroptosis induces aging-related neurodegenerative diseases and neuronal cell death, triggering disease onset and progression. Ferroptosis inhibitors, physical therapies, stem cell treatments, and exosome therapies show great potential for inhibiting ferroptosis in neurodegenerative disease.

Also flagged:Prostaglandinsprostaglandinbiosynthesisprostaglandin receptorsimmune responsesdegradation
Journal Article 2025-09-03 No Snippets Wang Z, Sun Y, Luo M, He N, Wen Z, Wang Z, Zhang Y, Zhao J, Liu Y.
Show Full Abstract

As a class of bioactive substances that play important roles in a variety of physiological and pathological processes, prostaglandins have attracted increasing research attention. Published studies have identified the molecular characteristics of prostaglandins in peripheral organs, the enzymes involved in prostaglandin biosynthesis, and prostaglandin receptors. Some studies have also explored the characteristics of prostaglandins and their functions in the central nervous system. In particular, for immunomodulation, prostaglandins in the brain show a unique immunosuppressive effect, which is of great importance for maintaining brain immune homeostasis and preventing excessive immune responses. In this review, we review the biosynthesis and degradation of prostaglandins, discuss the regulatory effects of prostaglandin systems on the immune cells of the nervous system, and explore the therapeutic potential of targeting prostaglandin systems for neurological diseases, thereby providing new perspectives for the treatment of these diseases. Overall, prostaglandins play important roles in the immunomodulation of the nervous system, and the complexity of the underlying processes depends on the variety and types of specific receptors and, more importantly, the cell types prostaglandins act on. Therefore, additional in-depth studies of the specific mechanisms involving prostaglandins in immunomodulation, including the interactions among different types of prostaglandins and their roles in neuropathological conditions, are essential. The prostaglandin signaling pathway may represent another important direction for the development of new drugs for neurological diseases, and the combination of prostaglandin system targets with other therapies (such as immunomodulatory drugs and gene therapy) may yield better results.

Also flagged:Foxg1gene expressiontranscription factorsoftranscription factorribosomes
Journal Article 2025-09-03 No Snippets Mallamaci A, Artimagnella O, Liuzzi G.
Show Full Abstract

Moving from the most recent results on Foxg1 biology, we first summarize the available information on some special pleiotropic effectors of neurodevelopmental interest, involved in controlling both transcription and post-transcriptional steps of gene expression. Then, after further analysis of the literature, we report evidence that, not strictly limited to neurodevelopmental effectors, such pleiotropy also applies to other transcription factors, involved in physiology and homeostasis. Furthermore, through the systematic analysis of a major public protein-protein interaction database, we gather strong evidence that the involvement of "canonical" transcription factors in post-transcriptional control of gene expression could be a pervasive phenomenon, characterizing hundreds of effectors. Finally, we discuss the biological significance of these findings and propose three evolutionary mechanisms that may have contributed to such an unexpected scenario.

Also flagged:Neurodegenerative diseasesbehavioral disordersamyloid-betatauα-synucleinPD
Journal Article 2025-09-03 No Snippets Chen Y, Yin P, Chen Q, Zhang Y, Tang Y, Jin W, Yu L.
Show Full Abstract

Neurodegenerative diseases are a class of disorders with the gradual loss of the central nervous system and peripheral nervous system. Neurodegenerative diseases manifest primarily as cognitive and behavioral disorders that adversely affect the lives of millions of people worldwide. Therefore, it is necessary to elucidate the mechanism of neurodegenerative diseases further and find effective new therapies. In recent years, increasing evidence has shown that the immune system plays a significant role in the pathophysiology of neurodegenerative diseases and regulates this process. The central and peripheral immune systems exert different roles in the disease progression. The development of neurodegenerative diseases is influenced by interactions between them. This review focuses on how the immune system, including microglia mediated nucleotide-binding oligomerization domain-like receptor protein 3 inflammation activation and T cell-mediated neuroinflammation, interactions with neurodegenerative diseases by modulating protein aggregation and blood-brain barrier permeability. Besides, we gave particular attention to glial cell-centered multicellular interactions and the inflammatory signaling pathway. Insight into the immune system's functions and cellular interactions is essential for progressing disease research. In addition, the functions and mechanisms of these immune cells also suggest new ideas and targets for treatment. Therefore, this review summarizes some of the existing treatment strategies for amyloid-beta, tau, neuroinflammation, α-synuclein, associated microbiota, immune modulation, and neural injury repair. In addition, this review summarizes and compares animal models of different common neurodegenerative diseases and clinical research progress. In view of the current research status, new research directions and suggestions are proposed.

Also flagged:voltage-dependent anion channel 1outer membrane proteinmitochondriamitochondrialneurodegenerative diseasesamyotrophic lateral sclerosis
Journal Article 2025-09-03 No Snippets Parikh A, Cholavaram A, Chitti Babu AK, Deepankumar K, Vijayan M.
Show Full Abstract

Voltage-dependent anion channel 1 is an integral outer membrane protein of the mitochondria that governs apoptosis, enables metabolite exchange, and influences mitochondrial activity. In neurodegenerative diseases, such as amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, and Alzheimer's disease, oxidative stress, neuroinflammation, and mitochondrial dysfunction are frequent features. Voltage-dependent anion channel 1 is a key regulator of these processes. This review described the structure, membrane topology, and physiological function of voltage-dependent anion channel 1 in neurons and glial cells. We emphasize how it affects mitophagy, oxidative damage, and changes in mitochondrial permeability. Special attention is focused on how voltage-dependent anion channel 1 interacts with pathogenic proteins that damage mitochondrial integrity and cause neurotoxicity, including mutant huntingtin, phosphorylated tau, α-synuclein, amyloid-beta, and TAR DNA-binding protein 43. Furthermore, the paper examines the function of voltage-dependent anion channel 1 in astrocytic dysfunction and microglial activation, highlighting its impact on neuroinflammation. In a nutshell, we assess treatment strategies that target voltage-dependent anion channel 1, such as VBIT-4, a selective inhibitor of voltage-dependent anion channel 1 oligomerization, and newer methods, including structure-based drug design and CRISPR/Cas9 regulation. Improved knowledge of the hinter voltage-dependent anion channel 1 of the molecular mechanism may allow for new therapeutic approaches in neurodegenerative diseases.

SERPINC1
Also flagged:C1 inhibitorbradykininangioedemacoagulationkininfibrinolysis
Journal Article 2025-09-03 ✓ 1 Snippet Defendi F, Amen A, Clavarino G, Dumestre-Pérard C.
In-Text Gene Mentions

C1 InhibitorInhibitor (C1INH) is…

Show Full Abstract

C1 Inhibitor (C1INH) is a crucial regulator of multiple plasmatic pathways, including complement, coagulation, kallikrein-kinin systems, and fibrinolysis. C1INH deficiency results in the downstream overproduction of the vasoactive peptide bradykinin (BK), the primary mediator of angioedema (AE), a rare disease characterized by unpredictable attacks of swelling in various locations of the body. C1INH deficiency can be hereditary (caused by a mutation in SERPING1 gene) or acquired (frequently underlying lymphoproliferative disease); C1INH level and functional assays are the golden standard for biological diagnosis of C1INH deficiency. Other forms of hereditary angioedema with normal C1INH activity are emerged in recent years. The most recent guidelines have issue recommendations for classification, clinical and laboratory diagnosis, and management of AE with and without C1INH deficiency. Current axes of research aim to discover new diagnostic and/or prognostic markers of BK-mediated angioedema as well as emphasize the link between C1INH deficiency and chronic comorbidity.

SOX6
Also flagged:Tumorsironhematopoiesisanemiabone metastasiserythropoiesis
Journal Article 2025-09-03 ✓ 1 Snippet Han Y, Sarkar H, Xu Z, Lopez-Darwin S, Wei Y, Hang X, Liu F, Tran K, Wang W, Miller JM, DeCoste CJ, Blohm DS, Satcher RL, Zhang XH, Kang Y.
In-Text Gene Mentions

Sox6

Show Full Abstract

Bone marrow is both a primary site for hematopoiesis and a fertile niche for metastasis. The mechanism of the common occurrence of anemia among patients with bone metastasis remains poorly understood. Here, we show that a specialized population of VCAM1<sup>+</sup>CD163<sup>+</sup>CCR3<sup>+</sup> macrophages, normally essential for erythropoiesis by transporting iron to erythroblasts, are highly enriched in the bone metastatic niche in mouse models. Tumor cells hijack these macrophages for iron supply, reducing iron availability for erythroblasts, impairing erythropoiesis, and contributing to anemia. Increased iron supply enables tumor cells to produce hemoglobin in response to hypoxia, mimicking erythroblasts. We identify macrophages with similar iron-transporting features in human bone metastases and show that elevated HBB expression correlates with increased risk of bone metastasis. These findings establish iron-transporting macrophages as an essential component of the metastatic bone niche, revealing a critical interplay between immune cells, metal metabolism, and tumor cell plasticity in driving metastasis and anemia.

Also flagged:Osteoarthritischronic diseasejoint degenerationOAribosomaldegradation
Journal Article 2025-09-03 No Snippets Wang M, Dai Y, Ge X, Zheng L, Zhai M, Li W, Liu G, Cheng X, Wei J, Yang X, Liu L, Liu H, Sun J, Li B, Yuan F.
Show Full Abstract

Osteoarthritis (OA) is a prevalent chronic disease, characterized by progressive joint degeneration and primarily affects older adults. OA leads to reduced functional abilities, a lower quality of life, and an increased mortality rate. Currently, effective treatment options for OA are lacking. Non-coding RNAs (ncRNAs) are functional RNAs transcribed from DNA but not translated into proteins. Among ncRNAs, small interfering RNAs (siRNAs), transfer RNAs (tRNAs), and ribosomal RNAs (rRNAs) have become significant in the field, which is intricately linked to the progression of OA and perform significant regulatory functions in transcription, post-transcription, and post-translation, making them potential biological targets for the prevention, diagnosis, and treatment of OA. This review summarizes the general functions of siRNAs, tRNAs, and rRNAs and their application in OA. The primary focus has been on regulating cartilage degradation. Other participations include regulating synovium, protecting anterior cruciate ligament cells, and diagnosis. No clinical trials were found as challenges such as effective delivery systems, immune responses, long-term effects, and interactions between therapies need to be demonstrated first.

DNAJC1
Also flagged:XanthoneHyperthermiaOvarian CancerGene Expressionchaperonesmetabolism
Journal Article 2025-09-03 ✓ 3 Snippets Rech J, Żelaszczyk D, Marona H, Bednarek IA.
In-Text Gene Mentions

…DNAJA2, DNAJB2, DNAJB4,DNAJC1- C7 , DNAJC9,…

…, CIS ),DNAJC1(DnaJ heat shock…

…, MAG ),DNAJC1( C7 ,…

Show Full Abstract

<h4>Background/objectives</h4>In the fight against ovarian cancer, various therapies have been employed, with a strong focus on developing novel derivatives of existing substances.<h4>Methods</h4>In this study, we continue our research on novel xanthone derivatives in combination with mild hyperthermia, targeting ovarian cancer cell lines TOV-21G and SK-OV-3. Using qPCR arrays, we analyzed 84 cellular stress-related genes categorized into anti-oxidant and pro-oxidant enzymes, molecular chaperones, and xenobiotic metabolism including the cytochrome P450 group. Furthermore, we conducted in silico analyses to investigate the pathways of the most affected genes, gene set enrichment, and gene ontology.<h4>Results</h4>The most significant changes were observed in SOD2, SOD3, CYP2F1, CYP1B1, and HMOX1. Additional changes related to drug toxicity and the postulated mechanism of action were also identified. Based on in silico analyses, we concluded that the primary node of hyperthermia-induced changes is HSPA1A. Heat-induced alterations predominantly revolve around misfolded proteins, monooxygenase activity, and ATPase activity.<h4>Conclusions</h4>To summarize, the combined therapy of novel xanthone derivatives and mild hyperthermia shows promising results and warrants further investigation to fully elucidate the mechanisms of action underlying these effects.

HTT
Also flagged:neurodegenerative diseasespathogenesisdegradationα-synucleinchaperoneautophagy
Journal Article 2025-09-03 ✓ 1 Snippet Ciechanover A, Livneh I.
In-Text Gene Mentions

…of Huntington’s disease,httaggregation in inclusion…

Show Full Abstract

A key hallmark of neurodegenerative diseases (NDDs) is the formation of neurotoxic protein aggregates, which are considered to reflect inadequate protein quality control (PQC). In agreement with this fundamental pathophysiologic characteristic, the two main cellular systems responsible for cellular protein removal - the ubiquitin-proteasome system (UPS) and autophagy - have been extensively studied in the context of NDD. The involvement of these proteolytic machineries was interpreted in different ways - some pointed them as dysfunctional systems that may underlie pathogenesis, while others suggested they fulfill protective roles which delay the clinical presentation of these diseases. Perhaps not surprisingly, the growing body of knowledge concerning the different types of NDD portrays a more complex picture, and no distinct generalization can be made regarding the contribution of either the neurotoxic protein substrate(s) or proteolytic system(s) to the development of NDD. For instance, in Parkinson's disease, the toxic aggregation of <i>α</i>-synuclein, Parkinson's canonical culprit protein, can stem from seemingly unrelated events. Among them, alterations in <i>α</i>-synuclein itself, a mutation in Parkin - an E3 ubiquitin ligase targeting proteins and organelles to proteasomal and lysosomal degradation, respectively, as well as a mutation in LRRK2 - a kinase postulated to be linked with α-synuclein through their common removal by chaperone-mediated autophagy. Also, in amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD), the toxic aggregation of one protein - TDP-43 - can result from defects in other proteins, some of which are related to proteostasis, such as the shuttle protein Optineurin and the E3 ubiquitin ligase VCP. In contrast, ALS and FTLD demonstrate how common abnormalities leading to neurotoxic aggregate formation, may present clinically in profoundly different ways, from motor dysfunction to behavioral changes. In Alzheimer's Disease, the leading cause for dementia, rare cases were linked directly with PQC as they are caused by a mutation in one of the genes encoding ubiquitin itself, while the majority of cases were not directly linked to components of the two main proteolytic systems. All-in-all, the UPS and autophagy are heavily intertwined with NDD, either as part of the problem or as mitigating factors, and hopefully - as platforms for future therapeutics. In this review, we shall dissect NDDs from the perspective of protein turnover pathways, aiming to track both common and unique patterns of PQC failure in this group of diseases, which differ significantly from one another both in their clinical manifestations and affected anatomic regions, yet share the common trait of abnormal protein accumulation. We shall review some of the mechanistic understandings concerning protein aggregation in NDDs, describing the interactions of aggregated proteins with the UPS and autophagy, discuss recent controversies around the protein aggregates' hypothesis, and point to implications for developing therapeutic strategies.

BTN2A1
Also flagged:TGF-βosteosarcomaOSTransforming growth factor-betacytokinetumors
Journal Article 2025-09-03 ✓ 2 Snippets Silva JA, Gunasinghe K, Jonus HC, Branella GM, Schiaffino Bustamante AY, Okalova J, Yustein JT, Spencer HT.
In-Text Gene Mentions

…conformational change withBTN2A1that is specifically…

…expression levels ofBTN2A1and BTN3A1 in…

Show Full Abstract

The application of cellular immunotherapies (CI) for osteosarcoma (OS) has mainly focused on autologous products of αβ T cells and, to date, has shown little clinical benefit. Based on the multi-killing properties of γδ T cells, specifically Vγ9Vδ2 T cells, and their ability to be employed as an allogeneic, off-the-shelf cellular therapy, there is significant interest in this CI. Although there are efficient, clinical-scale expansion protocols, a concern is the short <i>in vivo</i> half-life of these cells due to the terminal differentiated phenotypes of expanded cells. Therefore, modifying the manufacturing process to generate a more memory-like phenotype could overcome hurdles associated with this CI. Transforming growth factor-beta (TGF-β) is a cytokine with multiple functions, and can induce a less differentiated phenotype in γδ T cells. We tested the hypothesis that the <i>in vivo</i> effectiveness of γδ T cells against osteosarcoma (OS) tumors is suboptimal because of the manufacturing process that produces terminally differentiated cells. We combined a modified expansion process with activation strategies known to enhance γδ T cell-based tumor killing. Introducing zoledronate (ZOL) to OS cells augments γδ T cell killing by upregulating phosphoantigens in treated cells, which induces butyrophilin complexes, which are recognized by the TCR of the γδ T cell and significantly increases target cell death in both control and TGF-β expanded γδ T cells. In addition, administering ifosfamide (IFO), a chemotherapy used for relapsed OS, induces stress antigens in OS cell lines that are recognized by NKG2D receptors on γδ T cells, which enhances γδ T cell killing. <i>In vivo</i> studies show the administration of TGF-β expanded γδ T cells, when combined with ZOL and IFO significantly increased overall survival in OS-bearing mice, which we show can be attributed, at least in part, to increased persistence compared to control cells. Together, these data demonstrate this chemoimmunotherapy strategy, which engages various targeting mechanisms of γδ T cells, significantly enhances killing of OS.

Also flagged:paeoniflorindepressionneurological diseasesglycosidemonoaminecalcium
Journal Article 2025-09-03 No Snippets Hou Y, Li H, Zhu L, Quan T, Feng X, Li Y, Bian Y, Wei Y.
Show Full Abstract

Paeoniflorin (PF) is widely present in species of the <i>Paeonia</i> genus. In recent years, numerous preclinical studies have shown that PF has preventive and therapeutic effects on various neurological diseases, particularly in the prevention and treatment of depression. Additionally, some classic traditional Chinese medicine formulas containing PF, such as Xiaoyao San, Chaihu Shugan San, and Sini San, have been proven to significantly improve depressive symptoms. However, the antidepressant mechanisms of PF and its containing classic traditional Chinese medicine formulas are not yet fully understood. PF, as a natural glycoside metabolite with a wide margin of safety and good tolerance, exhibits certain toxicity at high concentrations. The differences in standardized methods between the traditional formulations, such as extraction processes, dosages, and inherent metabolite variability in formulations, may affect the interpretation of results and clinical applications. Therefore, this article reviews the antidepressant mechanisms of PF from the perspectives of inhibiting the hypothalamic-pituitary-adrenal axis, increasing the levels of monoamine neurotransmitters, suppressing oxidative stress and apoptosis, regulating calcium homeostasis, inhibiting neuroinflammation, modulating mitochondrial function, regulating cellular autophagy, and increasing the levels of brain-derived neurotrophic factor, and elucidates the antidepressant effects and mechanisms of traditional Chinese medicine formulations containing PF. Additionally, we describe the physicochemical properties, toxinology, pharmacokinetic characteristics, and the transformation of PF <i>in vivo</i>. This review may contribute to the application of PF and its formulations in depression.

Also flagged:strontiumhydroxyapatitetantalumtitaniumPI3KAKT
Journal Article 2025-09-03 No Snippets Wang X, Chen T, Pan P, Jiang C, Liu W, Yan X.
Show Full Abstract

Owing to its excellent biocompatibility, tantalum has the potential to replace titanium as a new mainstream bone-repair material. However, it was recognized as an inert metal. Therefore, it is necessary to improve the bioactivity of tantalum through surface modification to achieve more stable osseointegration. The key to designing bone repair materials is to imitate the physical structure and chemical composition of natural bone. In this study, a microscale strontium-containing hydroxyapatite (Sr + HA) coating was loaded onto a tantalum surface using a hydrothermal method, which improved the protein adsorption ability and hydrophilicity of tantalum. The incorporation of Sr also promoted the release of Sr<sup>2+</sup> and Ca<sup>2+</sup>. Furthermore, the results of in vitro and in vivo experiments showed that Sr + HA had good biocompatibility and bone integration. The research and development of biomaterials needs to be based on an understanding of the mechanism of action between materials and cells. Combined with transcriptomics and label-free quantitative proteomics analyses, it was confirmed for the first time that Sr + HA could activate the PI3K/AKT pathway by up-regulating Itga6 to promote the osteogenic differentiation of cells, thereby providing a theoretical basis for the development of tantalum-based implants with excellent osseointegration properties.

HFE
Also flagged:cirrhosisliver failurehepatocellular carcinomaextracellulartransforming growth factor-βTGF-β
Journal Article 2025-09-03 ✓ 1 Snippet Cerrito L, Galasso L, Iaccarino J, Pizzi A, Termite F, Esposto G, Borriello R, Ainora ME, Gasbarrini A, Zocco MA.
In-Text Gene Mentions

…Wilson’s disease andhemochromatosis[ 20 ,…

Show Full Abstract

<h4>Background/objectives</h4>Liver fibrosis is a progressive consequence of chronic liver injury that can evolve into cirrhosis, liver failure, or hepatocellular carcinoma, representing a major global health burden. Fibrogenesis is driven by hepatic stellate cell (HSC) activation, excessive extracellular matrix deposition, and structural disruption of liver tissue, with transforming growth factor-β (TGF-β) signaling and inflammatory mediators as central pathways. Current therapies primarily target the underlying causes, which may halt disease progression but rarely reverse established fibrosis. This review aims to outline current and emerging therapeutic strategies for liver fibrosis, informing both clinical practice and future research directions.<h4>Methods</h4>A narrative synthesis of preclinical and clinical evidence was conducted, focusing on pharmacological interventions, microbiota-directed strategies, and innovative modalities under investigation for antifibrotic activity.<h4>Results</h4>Bile acids, including ursodeoxycholic acid and derivatives, modulate HSC activity and autophagy. Farnesoid X receptor (FXR) agonists, such as obeticholic acid, reduce fibrosis but are limited by adverse effects. Fatty acid synthase inhibitors, exemplified by denifanstat, show promise in metabolic dysfunction-associated steatohepatitis (MASH). Additional strategies include renin-angiotensin system inhibitors, omega-3 fatty acids, and agents targeting the gut-liver axis. Microbiota-directed interventions-probiotics, prebiotics, symbiotics, antibiotics (e.g., rifaximin), and fecal microbiota transplantation-are emerging as potential modulators of barrier integrity, inflammation, and fibrogenesis, though larger clinical trials are required. Reliable non-invasive biomarkers and innovative trial designs, including adaptive platforms, are essential to improve patient selection and efficiently evaluate multiple agents and combinations.<h4>Conclusions</h4>Novel modalities such as immunotherapy, gene editing, and multi-targeted therapies hold additional potential for fibrosis reversal. Continued translational efforts are critical to establish safe, effective, and accessible treatments for patients with liver fibrosis.

SOX6
Also flagged:embryogenesisPPARGangiogenesisosteogenesischondrogenesismyogenesis
Journal Article 2025-09-03 ✓ 1 Snippet Han J, Ma S, Wei Q, Zhao Z, Zhao Y, Pu Y, Zhao Q, He X, Ma Y, MacHugh DE, Jiang L.
In-Text Gene Mentions

…satellite cells, butSOX6, TEAD, MYOG, TCF12,…

Show Full Abstract

Embryonic adipogenesis remains one of the least understood aspects of adipose biology in mammals due to time sensitivity, limited tissue volume, and ethical concerns. Here, we uniquely applied single-cell multi-omics sequencing to the developing adipose tissues of fat-tailed sheep, characterized by genetically determined, significant fat deposition in the tail during embryogenesis. Our dataset spans all stages of adipogenesis (E50 to E80), revealing three major cellular origins of fat deposition: progenitor and stem cells, connective tissue progenitors, and vascular smooth muscle cells. By integrating scRNA-seq, snATAC-seq, and functional validation, we identified key enhancer-driven gene regulatory networks (eGRNs) governing adipogenesis, with <i>DBI</i> emerging as a critical regulator through its interaction with PPARG. Additionally, we delineated developmental trajectories and unique eGRNs underlying angiogenesis, osteogenesis, chondrogenesis, and myogenesis associated with fat formation. Our findings provide novel insights into embryonic adipogenesis in mammals and reveal critical regulons governing lineage specialization.

DCC
Also flagged:Duodenal AdenocarcinomaPulmonary lymphangitic carcinomatosisadenocarcinoma of the breastpathogenesisVillous adenoma of the duodenumadenocarcinoma of the duodenum
Journal Article 2025-09-03 ✓ 1 Snippet Reddy AP, Rifai ZJ, Song M, Bahrou M, Faiek S.
In-Text Gene Mentions

…in colorectal carcinoma (DCC) further contribute to…

Show Full Abstract

Pulmonary lymphangitic carcinomatosis (PLC) is a rare condition characterized by malignant infiltration within the lymphatic system. It most often arises from adenocarcinoma of the breast, lung, or pancreas. This rare diagnosis often evades detection due to diagnostic challenges, unknown pathogenesis, and indolent presentation. Villous adenoma of the duodenum is also an exceedingly rare malignancy that is often mistaken for various pancreatic pathologies. To our knowledge, we describe the first case of PLC secondary to biopsy-confirmed villous adenocarcinoma of the duodenum in a 56-year-old male who presented with dyspnea, cough, and weight loss. This case illustrates how an indolent-appearing duodenal lesion can manifest as aggressive pulmonary metastasis, emphasizing the need for clinicians to maintain a broad differential when evaluating diffuse pulmonary disease and the importance of integrating radiographic, histopathologic, molecular, and multidisciplinary tools to identify rare metastatic origins.

SOX6
Also flagged:ossificationsynthesisfibroblast growth factorsFGFsfibroblast growth factor receptorsFGFR 1
Journal Article 2025-09-03 ✓ 1 Snippet Li Q, Zhang Y, Ji P, Zhang Y, Jiang J, Jin J, Yuan Z, Tian G, Cai M, Feng P, Wu Y, Liu W, Wang P.
In-Text Gene Mentions

…(like Sox5 andSox6) was accompanied by…

Show Full Abstract

N7-methylguanosine (m<sup>7</sup>G) is a prevalent RNA modification and plays fundamental roles in embryonic stem cell self-renewal and differentiation. However, its specific contributions to mesenchymal stem cell differentiation during skeletal development remain poorly understood. In this study, we demonstrate that specific deletion of the m<sup>7</sup>G methyltransferase Mettl1 in mesenchymal lineage cells causes severe bone development defects, manifesting as dramatic limb shortening at birth. The absence of Mettl1 in mesenchymal stem cells significantly hinders osteoblast and chondrocyte differentiation. Integrative analyses of single-cell RNA-sequencing and m<sup>7</sup>G-MeRIP sequencing demonstrate that Mettl1 ablation disrupts m<sup>7</sup>G modifications of Fgfr2, resulting in reduced its mRNA stability. Fgfr2 downregulation impairs the PI3K-AKT and MAPK signaling pathways, which decreases Sp1 phosphorylation and promotes its ubiquitin-mediated degradation, ultimately leading to reduced transcription of Col1a1 and Col2a1. Pharmacological reactivation of Fgfr2 signaling rescues the defects caused by Mettl1 deletion. Our findings highlight the critical role of Mettl1-mediated m<sup>7</sup>G modification in regulating osteogenic and chondrogenic differentiation of mesenchymal stem cells during bone development and provide new insights into the regulatory mechanisms of RNA modifications in skeletal biology.

SOX6
Also flagged:cell adhesioncollagen type Icollagen Iglycosaminoglycanorganizationextracellular
Journal Article 2025-09-03 ✓ 1 Snippet Ramos-Díez S, Diaz-Gomez L, Paulis M, Camarero-Espinosa S.
In-Text Gene Mentions

…Sox5,Sox6and Sox9, also…

Show Full Abstract

Articular cartilage accounts for a multizonal structure with distinct matrix composition and chondrogenic phenotypes, responsible for the tissue's load-bearing ability. Upon damage, cartilage is clinically treated by microfracture, which allows bone marrow exudation to the previously abraded zone. However, mesenchymal stem cells (hMSC) of the marrow cannot differentiate into specific chondrogenic phenotypes and the resulting tissue is isotropic and non-functional. Here, we developed multilayer dual-porosity scaffolds with defined in-fiber and structural porosities that were able to steer hMSC's differentiation into specific chondrogenic phenotypes. A library of inks prepared from poly-(<i>L</i>)lactide-co-caprolactone and sacrificial gelatine microspheres of three different diameters (13 ± 8 μm, 24 ± 14 μm, and 47 ± 27 μm) were used to 3D print structures with different patterns (90°, 60° and 45°), giving rise to dual-porosity structures of tunable in-fiber and structural porosities. This pallet of structures allowed control over porosity, topography and mechanical properties (ranging from 3.1 ± 0.1 to 9.1 ± 1.8 kPa), which modulated cell adhesion, proliferation and differentiation. Multilayer scaffolds were fabricated from selected structures that promoted chondrogenic differentiation with distinct expression of collagen type I, type II (up to 9.9 fold-increase), aggrecan and versican genes, resulting on a tissue with characteristic collagen I and II deposition patterns, abundant glycosaminoglycan deposition (15.4 ± 2.0 μg <sub>GAG</sub> · μg<sup>-1</sup> <sub>DNA</sub>) and similar compression modulus to native cartilage (501.5 ± 72.7 kPa).

Also flagged:TBX2lung adenocarcinomatumorEgr1T-box transcription factorsTbx3
Journal Article 2025-09-03 No Snippets Khalil A, Dinh T, Parks M, Obeng RC, Gryder B, Kresak A, Wang Y, Maltas J, Bedrock M, Wei X, Faber Z, Rahm M, Scott J, LaFramboise T, Wang Z, McFarland C.
Show Full Abstract

The TBX2 subfamily of T-box transcription factors (<i>e.g.</i>, <i>Tbx2</i>, <i>Tbx3</i>, <i>Tbx4</i>, <i>Tbx5</i>) plays an essential role in lung development. Down-regulation of these genes in human lung adenocarcinoma suggests that these genes may be tumor-suppressive; however, because down-regulation appears to occur primarily via epigenetic change, it remains unclear if these changes causally drive tumor progression or are merely the consequence of upstream events. Herein, we developed the first multiplexed mouse model to study the impact of TBX2 subfamily loss, alongside associated signaling genes (<i>Egr1</i>, <i>Chd2</i>, <i>Tnfaip3a</i>, and <i>Atf3</i>) in <i>Ras</i>-driven lung cancer. Using tumor-barcoding with high-throughput barcode sequencing (TuBa-seq), a high-throughput tumor-barcoding system, we quantified the growth effects of these knockouts during early and late tumorigenesis. <i>Chd2</i> knockout suppressed both tumor initiation and progression, whereas <i>Tnfaip3</i> knockout enhanced tumor initiation and overall tumor growth. <i>Tbx2</i> loss showed stage-specific effects on tumor development. Notably, <i>Egr1</i> emerged as a strong tumor suppressor and its knockout resulted in approximately a fivefold increase in tumor size at 20 weeks (two-sample <i>t</i>-test, <i>p</i> < 0.05), exceeding the impact observed with <i>Rb1</i> loss. Transcriptomic analyses of <i>Egr1</i>-deficient tumors suggested immune dysregulation, including heightened inflammation and potential markers of T cell exhaustion in the tumor microenvironment. These findings indicate that <i>Egr1</i> may play a role in suppressing tumor growth through modulating immune dynamics, offering new insights into the interplay between tumor progression and immune regulation in lung adenocarcinoma.

bioRxiv 2025-09-03 Preprint (No Snippets API) Wood JI, Ppasia G, Rolland-Du-Roscoat P, Desai S, Choudhury S, Balbaa A, Gavriouchkina D, Blunskyte-Hendley M, Hardy J, Cummings DM, Salih D, Hanrieder J, Edwards FA.
Show Full Abstract

<h4>Summary</h4> Using microglia-enriched spatial transcriptomics on human Alzheimer’s disease tissue, we identify distinct gene expression changes across microglia located in direct contact with plaques, in periplaque regions, and in areas distant from plaques. We define a group of plaque contact–only microglial (PCOM) genes whose expression increases exclusively in microglia directly contacting plaques. These genes show significant overlap with previously reported gene sets, suggesting that many of the well-characterised disease-associated microglia (DAM) and other AD-related gene-expression signatures are only upregulated when microglia contact plaques. We further identify distinct co-expression networks associated with disease-relevant covariates, including an immune module linked to APOE genotype and a synaptic–mitochondrial module negatively associated with Braak stage. Finally, we compare the human dataset to our previously published data from 18-month-old App NL-F mice, generated using the same experimental paradigm and demonstrate cross-species concordance in gene expression particularly within plaque-contacting microglia.

medRxiv 2025-09-03 Preprint (No Snippets API) Fletcher-Lloyd N, Céspedes Gómez N, Capstick A, Fogel A, Bafaloukou M, Heydari M, Cairns A, Walsh C, True J, CR&T Group, Shariati B, Nilforooshan R, Barnaghi P.
Show Full Abstract

<h4>BACKGROUND</h4> Sleep disturbances and altered circadian rhythms are well-documented in both physiological and biological studies of dementia. The exact causal relationship remains unclear. Several other long-term health conditions may also influence sleep patterns. Examining sleep patterns in relation to chronological ageing and the variations and progression of dementia, considering factors such as age, sex, and disease stage, can offer new insights for developing early screening and risk identification measures. Remote sleep monitoring enables routine assessment of cognitive decline symptoms in high-risk groups, aiding early risk identification. Integrating predictive models with routine sleep data holds promise for shaping more proactive approaches to assessing and caring for older adults and people living with dementia (PLWD). <h4>METHODS</h4> We developed a machine learning pipeline to estimate Sleep Age Index (SAI) from longitudinal remote sleep monitoring data collected using under-the-mattress sleep sensors and use it to identify dementia risk. The study utilised a dataset of nocturnal activity and physiology data (n=1,672; 18,369 person-samples) collected from individuals in the general population and a cohort of PLWD. Dementia risk scores were stratified into high, medium and low-risk categories to support clinical monitoring and decision-making. <h4>RESULTS</h4> Our study indicates that sleep patterns in dementia do not follow typical ageing processes. For individuals with dementia, our pre-trained machine learning model predicted age in a negative direction. Further investigation revealed distinct patterns associated with these predictions, including irregular times to bed and rise, lower variation in deep sleep duration, and elevated breathing and heart rates. While age predictions were largely similar for female and male participants, the patterns observed in the female group were more consistent. Chronological age was predicted from sleep data with a mean absolute error of 5.52 (95% CI: 5.37 - 5.67) on held-out test data. A sensitivity of 75.7% (95% CI: 71.4% - 79.9%) and specificity of 74.7% (95% CI: 69.2% - 80.0%) was achieved post-stratification on unseen data in dementia versus control. To evaluate the real-world clinical applicability of the model, we conducted a pilot study in a population with a higher risk of cognitive decline (n = 50). Pilot data analysis indicated a slight positive bias between model predictions and the clinical experts’ judgement (mean difference 0.98 units, limits of agreement from −0.83 to 2.78 units, reported to 3 s.f.). This analysis also revealed that the traffic light system, designed to indicate the risk of cognitive decline, can serve as a complementary source of information to enhance decision support. This is especially evaluated for its applicability in improving clinical decision-making for high-risk groups, where there is often insufficient data available regarding an individual’s cognitive status. <h4>CONCLUSIONS</h4> The study offers new insights into sleep and dementia, highlighting how age and sex differences manifest differently in typical ageing compared to dementia. We demonstrate the utility of leveraging sleep monitoring data and predictive analysis in identifying individuals who may benefit from further clinical evaluation and early disease-modifying interventions.

Also flagged:allergic airways diseaseIL-5IL-13pathogenesisallergic asthmaallergic airways diseases
Journal Article 2025-09-02 No Snippets Cain J, Hurrell B, Akbari O.
Show Full Abstract

Group 2 innate lymphoid cells (ILC2s) play a pivotal role in the initiation and propagation of allergic airways disease. These cells, first discovered 15 years ago, respond to a range of stimuli in a non-antigen-dependent manner. ILC2s produce copious amounts of cytokines including IL-5 and IL-13, which are critical in the pathogenesis of allergic asthma. While allergic airways diseases have long been considered T-helper 2 cell-driven diseases, ILC2s are capable of inducing allergic-type pathologies in mice even in the absence of the adaptive immune system. The role of ILC2s in driving the pathology of allergic airways disease remains an expanding field of knowledge that may unlock novel therapeutic approaches in the management of asthma, a disease that affects up to 300 million people worldwide. In this review, we survey current knowledge of ILC2 immunobiology and present an overview of ILC2 phenotyping, concurrent with insights into ILC2 plasticity, and an exploration of the roles of costimulatory molecules, neuroendocrine signals, and diet-derived nutrients in modulating ILC2 activity.

KLHL20
Also flagged:CUL3protein degradationE3 ligasemacrocycledegradationBET
Journal Article 2025-09-02 ✓ 5 Snippets Fechtmeyer PH, Martinez C, Yeh JT.
In-Text Gene Mentions

…cterization of CUL3&lt;sup&gt;KLHL20&lt;/sup&gt;-Driven Targeted D…

…cently, we validated CUL3<sup>KLHL20</sup> E3 ligase as…

…ligand to engageKLHL20.…

…Linking theKLHL20ligand to JQ1,…

KLHL20

Show Full Abstract

Targeted protein degradation (TPD) is a promising modality that leverages the endogenous cellular protein degradation machinery to degrade selected proteins. Recently, we validated CUL3<sup>KLHL20</sup> E3 ligase as a new actionable E3 ligase for TPD application by developing a synthetic macrocycle ligand to engage KLHL20. Linking the KLHL20 ligand to JQ1, we created the PROTAC molecule BTR2004, which exhibited potent degradation of BET family proteins BRD 2, 3, and 4. As CUL3<sup>KLHL20</sup> is new to the TPD field, here we report the first temporal and spatial characterization of CUL3<sup>KLHL20</sup>-driven TPD with BTR2004. Our study revealed the target protein degradation kinetics, BTR2004 intracellular activity half-life, and the onset of BTR2004 cell permeabilization. Employing proximity ligation and confocal microscopy techniques, we also illustrate the subcellular location of the ternary complex assembly upon BTR2004 treatment. These characterizations provide further insight into the processes that govern TPD and features that could be incorporated into the design of future macrocyclic PROTAC molecules.

STAU1
Also flagged:DDX60mitochondrialmyocardial infarctionMIArl2CKO
Journal Article 2025-09-02 ✓ 1 Snippet Yuan T, Zhou C, Long Y, Chen X, Gao L, Li Y, Chen S, Lu X, Xu J, Wu X, Zhou G, Liu S, Yang W, Wei Y, Cai L.
In-Text Gene Mentions

…EIF3G, EIF4G1, andSTAU1(Fig. 5 B).…

Show Full Abstract

Mitochondrial dysfunction is increasingly recognized as a pivotal driver of cardiomyocyte apoptosis and cardiac deterioration following myocardial infarction (MI). This study identifies a significant upregulation of DDX60 in cardiomyocytes under hypoxic conditions. Elevated DDX60 levels enhance mitochondrial function and attenuate cardiomyocyte apoptosis in vitro, whereas its knockdown induces the opposite effects. In vivo, cardiomyocyte-specific DDX60 knockout markedly exacerbates mitochondrial dysfunction and apoptosis, accelerating post-MI cardiac remodeling and functional decline. Furthermore, we found that Arl2 knockdown partially negates the protective effects of DDX60 overexpression on ATP production and apoptosis. Conversely, adeno-associated virus-9 (AAV9)-mediated Arl2 overexpression partially restores cardiac function, reduces infarct size, and rescues mitochondrial integrity in DDX60 CKO mice post-MI. Mechanistically, DDX60 forms a translational complex with eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) that enhances Arl2 mRNA translation, a process essential for mitochondrial homeostasis. Collectively, these findings establish DDX60 as a key regulator of cardioprotection post-MI by enhancing Arl2 translation, highlighting its potential as a therapeutic target for ischemic heart disease.

ZNFX1
Also flagged:hepatocellular carcinomacancerstumorgene expressionliver cancertranscription factors
Journal Article 2025-09-02 ✓ 1 Snippet Jeng LB, Yang HR, Teng CF.
In-Text Gene Mentions

…SNHG17, SNHG20, andZNFX1 antisense RNA 1antisense RNA 1…

Show Full Abstract

Although significant advances have been made in the prevention and therapy, hepatocellular carcinoma (HCC) is still one of the most frequent and fatal human cancers worldwide. Discovery of independent prognostic biomarkers for the early identification and timely treatment of HCC patients with poor prognosis remains a key goal to achieve better patient survival. Long non-coding RNA (lncRNA) is one of the most-investigated classes of non-coding RNAs and plays important roles in controlling the occurrence and development of HCC through regulation of oncogene and tumor suppressor gene expression. Moreover, alterations in the expression levels of many lncRNAs are frequently observed in tumor tissues and blood circulation of HCC patients. LncRNAs have emerged as potential independent biomarkers for predicting the prognosis of HCC patients. This review comprehensively summarizes the evidence in the literature validating a single or a combination of lncRNA biomarker(s) with independent prognostic value in HCC patients.

TNFSF4
Also flagged:SLC38A4colorectal cancermetabolismARG1EDNRBtumor
Journal Article 2025-09-02 ✓ 4 Snippets Liu Y, Wei X, Chen N, Wang W.
In-Text Gene Mentions

…ARG1, EDNRB, andTNFSF4.…

…to the immunostimulatorTNFSF4( R =…

…negatively associated withTNFSF4.…

TNFSF4( OX40L )…

Show Full Abstract

<h4>Background</h4>Colorectal liver metastasis (CRLM) is the most frequent form of metastasis and the main reason for deaths associated with colorectal cancer. However, prognostic biomarkers originating from CRLM tissue remain limited. Additionally, the impact of the metabolism-associated gene SLC38A4 on patients with CRLM remains elusive.<h4>Methods</h4>Metabolism-related differentially expressed genes (MRDEGs) were identified between CRLM and adjacent normal liver (NL) tissues using GEO datasets (GSE38174, GSE41258). The prognostic significance of these MRDEGs in CRLM (GSE159216) was evaluated using Cox regression and Kaplan-Meier survival analyses. The differential expression of SLC38A4 was validated through multiple experiments, including qRT-PCR, Western blotting, and immunohistochemistry. Genes co-expressed with SLC38A4 were identified through a weighted gene co-expression network analysis, and enrichment analyses were conducted by clusterProfiler. The link between SLC38A4 and immune infiltration was assessed with the CIBERSORT algorithm, while drug sensitivity was analyzed using oncoPredict.<h4>Results</h4>SLC38A4 was identified as an independent favorable-prognosis biomarker for CRLM, with significantly lower expression in CRLM compared to NL tissues. Enrichment analyses indicated that SLC38A4-associated genes participate in diverse metabolic processes. Immune infiltration analysis indicated that SLC38A4 expression is linked to the infiltration of immune cells and three immune checkpoint genes: ARG1, EDNRB, and TNFSF4. Additionally, multiple anti-tumor drugs were positively associated with SLC38A4 expression.<h4>Conclusion</h4>Elevated SLC38A4 expression is correlated with a favorable prognosis in CRLM, likely through mechanisms involving metabolic reprogramming and immune infiltration. Thus, SLC38A4 may serve as both a prognostic biomarker and a potential biomarker for future therapeutic investigation, offering new precision medicine options for CRLM patients.

Also flagged:Ulcerative colitisinflammatory bowel diseaseGene ExpressionPLCB3DUOX2inflammatory response
Journal Article 2025-09-02 No Snippets Misaghian S, Jafri MS.
Show Full Abstract

Ulcerative colitis (UC) is a chronic type of inflammatory bowel disease (IBD). This study identified core genes and pathways involved in UC by performing transcriptional profiling of colon biopsies from UC patients and healthy controls using data from the Gene Expression Omnibus (GEO) database. A total of 202 samples, including 129 UC patients and 73 healthy controls, were analyzed, measuring the expression of 40,991 genes using a 44K formatted microarray. Differential gene expression (DGE) analysis and gene set enrichment analysis (GSEA) identified several biomarkers potentially involved in UC development. PLCB3 was significantly downregulated, which suggested its role in maintaining intestinal homeostasis. In contrast, DUOX2 was upregulated, which indicated its involvement in the inflammatory response and oxidative stress. Pathway analysis revealed that PLCB3 is associated with lipid metabolism, NOD-like receptor signaling, and NF-κB signaling pathways, while DUOX2 is linked to reactive oxygen species production and chemokine signaling. The interplay between PLCB3 and DUOX2 suggests their combined impact on inflammatory processes in UC. These insights into the molecular mechanisms underlying UC identify key genes and pathways that could serve as potential targets for diagnostic and therapeutic interventions.

Also flagged:Extracellular Regulated KinaseAutophagypancreatic ductal adenocarcinomasPDACmitogen-activated protein kinasehydroxychloroquine
Journal Article 2025-09-02 No Snippets Surana R, Morgado M, Somasundaram A, Bockorny B, Weekes CD, Coleman EC, Bird A, Wang J, Williams HL, Zheng H, Brais LK, Saxena N, Graham C, Ritterband L, Sawin M, Peters ML, Whooley P, Bullock A, Zerillo J, Sanoff HK, Clark JW, Parikh AR, Yurgelun MB, Patel AK, Mayer RJ, Cleary JM, Enzinger P, Rubinson DA, McCleary NJ, Enzinger A, Slater S, Ng K, Biller LH, Abrams TA, Huffman BM, Singh H, Raghavan S, Mancias JD, Bryant KL, Nowak JO, Aguirre AJ, Der CJ, Wolpin BM, Perez K.
Show Full Abstract

<h4>Purpose</h4>Oncogenic mutations in Kirsten rat sarcoma virus are present in over 90% of pancreatic ductal adenocarcinomas (PDACs). Preclinical data suggest that PDAC cells treated with inhibitors of the mitogen-activated protein kinase pathway demonstrate elevated autophagic flux. In this study, we evaluate the clinical efficacy of combining LY3214996 (extracellular regulated kinase inhibitor) with hydroxychloroquine (HCQ; autophagy inhibitor) in patients with metastatic PDAC.<h4>Methods</h4>Eligible patients had metastatic PDAC and at least one, but no more than two prior lines of systemic therapy. A safety lead-in evaluating the combination was conducted and the maximum tolerated dose level of LY3214996 was identified. Patients were then randomly assigned in a 1:1 fashion to receive either LY3214996 200 mg orally (PO) once daily + HCQ 600 mg PO twice a day (arm 1) or LY3214996 400 mg PO once daily (arm 2). The primary end point for this study was disease control rate (DCR). Secondary end points included overall survival (OS) and progression-free survival (PFS).<h4>Results</h4>Thirty-nine patients enrolled (20 in arm 1, 19 in arm 2). The DCR rates were 5% in arm 1 and 5.3% in arm 2. The median OS was 2.4 months in arm 1 (95% CI, 1.3 to 5.8) and 4.6 months in arm 2 (95% CI, 3.1 to 5.7). The median PFS was 1.3 months in arm 1 (95% CI, 0.8 to 1.8) and 1.9 months in arm 2 (95% CI, 1.644 to 2.4). The most frequently observed toxicities in both arms included nausea, diarrhea, elevated creatine phosphokinase, anorexia, and cytopenias. Exploratory analysis using patient-derived PDAC organoids did not show evidence of synergistic antiproliferative activity of LY3214996 in combination with chloroquine.<h4>Conclusion</h4>LY3214996 alone or in combination with HCQ did not result in clinical activity in patients with metastatic PDAC.

OLFM4
Also flagged:ironlipidsynthesiscancertumorsferroptosis
Journal Article 2025-09-02 ✓ 5 Snippets Vilaplana-Lopera N, Kim J, Nam G, Tullis IDC, Paillas S, Ruan JL, Lee PJ, Jiang Y, Park S, Hou T, Nasir A, Charlesworth E, Walker E, Abu-Halawa A, Hill MA, Choi C, Lee IJ, Jeong Y, Lakhal-Littleton S, Then CK, Shen SC, Giaccia AJ, Petersson K, Moon EJ.
In-Text Gene Mentions

…(ab64211, abcam) or anti-OLFM4antibody (39141, Cell…

…The number ofOLFM4positive crypts were…

…further supported byOLFM4staining, which was…

…8 Gy RT,OLFM4-positive cells were significa…

…the reduction inOLFM4-positive cells was comparable…

Show Full Abstract

Iron is vital to living cells, playing a key role in cellular respiration, DNA synthesis, and various metabolic functions. Importantly, cancer cells have a higher dependency on iron compared to normal cells to support their rapid growth and survival. Due to this fact, tumors are more vulnerable to ferroptosis, an iron-dependent form of regulated cell death. Radiation therapy (RT), a standard treatment for many cancer patients, is known to induce ferroptosis. Ultra-high dose rate FLASH RT offers an improved therapeutic window by minimizing damage to normal tissues while preserving tumor control. However, the precise biological mechanisms behind the protective effects of FLASH RT on normal tissues remain unclear. In this study, we propose that variations in lipid peroxidation and ferroptosis, driven by intrinsic differences in iron levels between normal and cancerous tissues, contribute to this effect. Our findings show that FLASH RT increases lipid peroxidation and induces ferroptosis in tumor cells but does not significantly elevate lipid peroxidation and ferroptosis in normal tissues compared to conventional RT. To determine whether raising iron levels in normal tissues could abrogate the protective effects of FLASH, mice were fed a high-iron diet before RT. A high-iron diet before and after RT reversed the protective effect of FLASH, resulting in increased intestinal damage and lipid peroxidation. This suggests that baseline iron levels and iron-driven lipid peroxidation are critical factors in mediating the protective outcomes of FLASH RT. Overall, our study sheds light on the role of iron in modulating RT responses and provides new mechanistic insights into how FLASH RT influences normal and cancerous tissues.

Also flagged:cell surfacetranslationalcancerbindingnucleasewater
Journal Article 2025-09-02 No Snippets Mah AH, Qi X, Zhao J, Wiseman K, Edoli L, Metcalfe K, Donohoe K, Ojeda M, Billings S, Moreno J, McCowin M, Krajacich B, Green K, Adhikary R, Boddicker A, Chan J, Mains P, Lajoie B, Devitt S, Kruglyak S, Levy S, Previte M.
Show Full Abstract

<h4>Background</h4>Hybrid capture is a critical technology for selective enrichment of genomic regions of interest in genomic analysis. Despite its widespread adoption, the core methodology has remained largely unchanged for over 15 years, with traditional workflows involving time-consuming bead-based capture steps, multiple temperature-controlled washes, and post-hybridization PCR. These steps introduce workflow complexity, increase turnaround time, and can negatively impact library complexity and variant calling accuracy.<h4>Results</h4>We present a simplified hybrid capture workflow that eliminates these complexities by directly loading the hybridization product onto the sequencing flow cell. The approach is enabled by the development of a streptavidin flow cell surface, a method to circularize and amplify captured targets on the flow cell, and a fast hybridization protocol. Our workflow reduces the time from the start of library preparation to the start of sequencing by over 50% while maintaining or improving capture specificity and library complexity. We demonstrate improved variant calling performance with indel false positive and false negative reductions of 89% and 67%, respectively. We also show how the approach can be used to create an entirely PCR-free targeted sequencing workflow.<h4>Conclusions</h4>We present a targeted sequencing workflow that eliminates bead-based capture, multiple washes, and post-hybridization PCR, while improving various aspects of data quality. The performance of the approach was evaluated by sequencing hundreds of samples and demonstrating high on-target rates, reduced duplicates, and improved indel accuracy. By combining the approach with a PCR-free library preparation, we enable an entirely PCR-free targeted sequencing assay which further improves indel calling, and shows the ability to call an HTT expansion, associated with Huntington's disease. This streamlined approach addresses key operational challenges in targeted sequencing, offering potential benefits for applications requiring rapid turnaround times or increased capability in variant detection.

CCPG1
Also flagged:autophagyrenal cell carcinomaRCCkidney cancerdegradationorganelles
Journal Article 2025-09-02 ✓ 1 Snippet Alimohammadi M, Noroozi M, Mafi A, Zare Khormizi F, Abbasi A, Farahani N, Khoshnazar SM, Hashemi M, Taheriazam A, Hushmandi K.
In-Text Gene Mentions

…lective macroautophagy includeCCPG1, TEX264, FAM134A/B/C (RETREG2…

Show Full Abstract

Renal cell carcinoma (RCC) is one of the most common and aggressive forms of kidney cancer, accounting for over 90% of cases. Despite advances in diagnosis and treatment, RCC is often detected at advanced stages and demonstrates poor response to traditional therapies such as chemotherapy, radiotherapy, and hormonal treatment. Consequently, novel molecular targets are urgently needed. Autophagy, a tightly regulated catabolic mechanism that preserves cellular homeostasis via degradation of damaged organelles and proteins, plays a dual role in RCC-acting both as a tumor suppressor in early stages and a tumor promoter under stress conditions. Recent studies have revealed that non-coding RNAs (ncRNAs), particularly long ncRNAs and microRNAs (miRNAs), are key regulators of autophagy in various cancers, including RCC. These ncRNAs influence the expression of autophagy-related genes and modulate critical signaling pathways such as PI3K/AKT/mTOR, AMPK, p53, and KEAP1/NRF2. By acting as molecular sponges, scaffolds, and transcriptional regulators, ncRNAs either enhance or suppress autophagic activity, thereby affecting tumor progression, metastasis, and treatment resistance. This review synthesizes current knowledge on the crosstalk between ncRNAs and autophagy in RCC. We identify specific ncRNAs involved in RCC pathogenesis, describe their regulatory mechanisms, and evaluate their potential as diagnostic biomarkers and therapeutic targets. Understanding these complex molecular interactions may lead to more effective, personalized treatment strategies and improved clinical outcomes for RCC patients.

SERPINC1
Also flagged:sepsiscytokineimmune responseimmunoglobulinIginfection
Journal Article 2025-09-02 ✓ 4 Snippets Bracht T, Kappler K, Bayer M, Grell F, Schork K, Palmowski L, Koos B, Rahmel T, Ziehe D, Unterberg M, Bergmann L, Rump K, Broecker-Preuss M, Limper U, Henzler D, Ehrentraut SF, von Groote T, Zarbock A, Pfaender S, Babel N, Marcus-Alic K, Eisenacher M, Adamzik M, Sitek B, Nowak H.
In-Text Gene Mentions

…C2, SERPINF2, C18orf63,SERPINC1, SERPINA4, and PON1…

…were ALB, GPLD1,SERPINC1and SERPINA4 (Fig.…

…and antithrombin III (SERPINC1) are readily available.…

…Antithrombin III (SERPINC1) as well as…

Show Full Abstract

<h4>Background</h4>The heterogeneity of sepsis represents a significant challenge to the development of personalized sepsis therapies. Sepsis subtyping has therefore emerged as an important approach to this problem, but its impact on clinical practice was limited due to insufficient molecular insights. Modern proteomics techniques allow the identification of subtypes and provide molecular and mechanistical insights. In this study, we analyzed a prospective multi-center sepsis cohort using plasma proteomics to describe and characterize sepsis plasma proteome subtypes.<h4>Methods</h4>Plasma samples were collected from 333 patients at days 1 and 4 of sepsis and analyzed using liquid chromatography coupled to tandem mass spectrometry. Plasma proteome subtypes were identified using K-means clustering and characterized based on clinical routine data, cytokine measurements, and proteomics data. A random forest machine learning classifier was generated to showcase future assignment of patients to subtypes.<h4>Results</h4>Four subtypes with different sepsis severity were identified. Cluster 0 represented the most severe form of sepsis, with 100% mortality. Cluster 1, 2 and 3 showed a gradual decrease of the median SOFA score, as reflected by clinical data and cytokine measurements. At the proteome level, the subtypes were characterized by distinct molecular features. We observed an alternating immune response, with cluster 1 showing prominent activation of the adaptive immune system, as indicated by elevated levels immunoglobulin (Ig) levels, which were verified using orthogonal measurements. Cluster 2 was characterized by acute inflammation and the lowest Ig levels. Cluster 3 represented the sepsis proteome baseline of the investigated cohort. We generated an ML classifier and optimized it for the minimum number of proteins that could realistically be implemented into routine diagnostics. The model, which was based on 10 proteins and Ig quantities, allowed the assignment of patients to clusters 1, 2 and 3 with high confidence.<h4>Conclusion</h4>The identified plasma proteome subtypes provide insights into the immune response and disease mechanisms and allow conclusions on appropriate therapeutic measures, enabling predictive enrichment in clinical trials. Thus, they represent a step forward in the development of targeted therapies and personalized medicine for sepsis.

DNAH10
Also flagged:primary ciliary dyskinesiagenetic disorderarm dynein heavy chainchronic respiratory infectionsrhinosinusitisCFAP57
Journal Article 2025-09-02 ✓ 5 Snippets Zheng R, Yang W, Yan J, Guo Z, Chen W, Chen L, Xu W.
In-Text Gene Mentions

DNAH10mutation cause primary…

DNAH10is an inner…

…mutations in theDNAH10gene among two…

…the expression ofDNAH10was confirmed in…

…also showed thatDNAH10was specifically expressed…

Show Full Abstract

Primary ciliary dyskinesia (PCD; MIM 244400) is a genetic disorder, and its morbidity has been previously underestimated. Mutations in ciliary proteins underlie the disease, resulting in ciliary dysfunction. DNAH10 is an inner arm dynein heavy chain that has been shown to play a critical role in the movement of sperm flagella. In the present study, we demonstrated the presence of loss-of-function mutations in the DNAH10 gene among two families affected by primary ciliary dyskinesia. Patients displayed characteristic symptoms associated with PCD, including chronic respiratory infections, productive cough, and rhinosinusitis. Additionally, a decrease in the expression of DNAH10 was confirmed in both patients. Dnah10 knockout (KO) mice exhibited phenotypic characteristics recapitulating the PCD symptoms observed in two patients. Scanning electron microscope results showed curved and defective cilia morphology in Dnah10 KO mice. Immunostaining also showed that DNAH10 was specifically expressed in the cilia cell. Ciliary structural studies highlighted that DNAH10 interacted with candidate PCD proteins, including CFAP57, DYNLL1, and CCDC73, contributing to the formation of a double-headed inner dynein arm f (IDAf) complex. Co-IP experiment confirmed that DNAH10 can interact with CFAP57, DYNLL1, and CCDC73. We then detected the reduced expression of CFAP57, DYNLL1, and CCDC73 in patient P02 and Dnah10 KO mice. Furthermore, through proteomic analysis, we demonstrated alterations in the expression of abnormal innate immune proteins, super-molecular fiber organization, and mitochondrial respiratory chains. These findings suggested that the loss of DNAH10 leads to improper assembly of the IDAf complex, resulting in ciliary dysfunction and pulmonary fibrosis as the signature manifestation. Notably, our research findings hold substantial implications for the advancement of therapeutic strategies aimed at addressing ciliopathies.

SOX6
Also flagged:glioblastomabrain tumortumorcancergene expressiontranscription factor
Journal Article 2025-09-02 ✓ 1 Snippet Pizzagalli MD, Suita Y, Leary OP, Tapinos N.
In-Text Gene Mentions

…−0.96 logFC), andSOX6(−1.11 logFC, overlaps…

Show Full Abstract

<h4>Background</h4>Glioblastoma, the most common primary malignant brain tumor, has a median survival of less than two years. This is due in part to a subpopulation of cells called glioblastoma stem cells (GSCs), which drive tumor recurrence. Transposable elements (TEs) are expressed at higher levels in cancer stem cells, enhancing the oncogenic potential and plasticity of cells through changes in gene expression, fusion transcript generation, and genomic rearrangement.<h4>Results</h4>Leveraging a large previously published dataset, we investigated the expression of TEs in bulk RNA sequencing data from 42 GSCs to identify subpopulations defined by their TE expression profile. Using telescope, a locus-specific approach to quantifying TE expression, we identified 858 TE loci that were expressed and defined two groups of GSCs using a consensus clustering approach. These TE-driven clusters displayed significant differences in both transcription factor (TF) and gene expression, with one group significantly enriched for a mesenchymal signature based on Gene Set Enrichment Analysis. Next, we extracted the locations and sequences of the TE regulatory domains and elucidated TF binding motifs within the TE sequences. This showed that the SOX11 consensus motif was enriched in the 5' untranslated region of differentially expressed long interspersed nuclear elements (LINE). SOX11, a known inducer of LINE expression, was significantly under-expressed in the mesenchymal GSC cluster, which correlated with the concurrent decreased expression of LINE transcripts. These loci also overlapped with the enhancer elements of genes that were significantly downregulated, suggesting a potential link between TF binding to TE regulatory regions and gene expression.<h4>Conclusions</h4>Although further mechanistic studies are required, the identified link between TE location, TE and TF expression, and corresponding gene expression suggests that TEs may play a regulatory role in GSC transcription regulation. The current findings highlight the need for further investigation into the role of TEs in defining the gene regulatory and expression landscapes of GSCs. Future studies in this area could have therapeutic implications, given that glioblastoma recurrence may be driven by these cells.

Also flagged:genetic disordersinborn errors in metabolismhematological disordersneurological disordersmusculoskeletal disordersdefects
Journal Article 2025-09-02 No Snippets Sheth J, Dhondekar T, Ajagekar M, Datar C, Kher A, Trivedi J, Thakkar S, Gandhi A, Soni M, Chaudhary M, Banker M, Jalan A, Muranjan M, Munshi S, Munshi A, Pandya M, Shah J, Nair A, Bhavsar R, Sheth F, Sheth H.
Show Full Abstract

<h4>Background</h4>Rare genetic disorders are increasingly diagnosed due to advancing genetic technology, whilst, treatment for them is challenging. Therefore, their prevention by prenatal diagnosis is a way forward to reduce the overall burden. The present study provides an overview of a cohort of patients who were offered prenatal diagnosis for genetic disorders at a tertiary genetic center in India.<h4>Methods</h4>The study included 1,738 prenatal samples for the period of 2008 to 2022, identified as being at high risk for rare genetic disorders based on family history, previous affected children, and abnormal ultrasound findings. Participants underwent prenatal diagnostic tests, including chorionic villus sampling or amniocentesis, or fetal blood by various molecular techniques and enzyme-based studies. Data regarding patient demographics, types of disorders screened, and diagnostic outcomes were collected and analyzed.<h4>Results</h4>Of the 1738 cases, 467 (26.87%) prenatal samples were identified as being affected by genetic anomalies. The diagnosed conditions included hematological disorders (n = 735/1738, 42.28%), inborn errors in metabolism (n = 513/1738, 29.52%), neurological disorders (n = 310/1738, 17.84%), musculoskeletal disorders (n = 45/1738, 2.59%), and other rare genetic disorders (n = 135/1738, 7.77%). Early diagnosis facilitated timely medical information and provided options for prevention, such as medical termination of pregnancy (MTP) in affected cases after genetic counseling.<h4>Conclusion</h4>Our study demonstrates that prenatal diagnosis for rare genetic disorders is an invaluable step toward reducing the burden of these conditions. The use of advanced genetic techniques, combined with genetic counseling, enables effective prevention strategies. However, challenges such as accessibility, cost, and ethical considerations continue to pose barriers to widespread implementation in India. Increased awareness and government policy support are essential to make these diagnostic services universally available and affordable.

SERPINC1
Also flagged:Amyotrophic Lateral SclerosisALSneurodegenerative diseasesCRYMPFKLCAPZA2
Journal Article 2025-09-02 ✓ 5 Snippets Scholl LS, Demleitner AF, Riedel J, Adachi S, Neuenroth L, Meijs C, Tzeplaeff L, Caldi Gomes L, Galhoz A, Cordts I, Lenz C, Menden M, Lingor P.
In-Text Gene Mentions

…PFKL, CAPZA2, ALDH16A1,SERPINC1, and HP, exhibited…

…significant differences ofSERPINC1and HP levels…

…(for CRYM, CAPZA2,SERPINC1, and HP) or…

…sc-376687, RRID: AB_11150103);SERPINC1rabbit monoclonal antibody…

…n = 3,SERPINC1ALS n =…

Show Full Abstract

The diagnosis of Amyotrophic Lateral Sclerosis (ALS) remains challenging, particularly in early stages, where characteristic symptoms may be subtle and nonspecific. The development of disease-specific and clinically validated biomarkers is crucial to optimize diagnosis. Here, we explored tear fluid (TF) as a promising ALS biomarker source, given its accessibility, anatomical proximity to the brainstem as an important site of neurodegeneration, and proven discriminative power in other neurodegenerative diseases. Using a discovery approach, we profiled protein abundance in TF of ALS patients (n = 49) and controls (n = 54) via data-independent acquisition mass spectrometry. Biostatistical analysis and machine learning identified differential protein abundance and pathways in ALS, leading to a protein signature. These proteins were validated by Western blot in an independent cohort (ALS n = 51; controls n = 52), and their discriminatory performance was assessed in-silico employing machine learning. 876 proteins were consistently detected in TF, with 106 differentially abundant in ALS. A six-protein signature, including CRYM, PFKL, CAPZA2, ALDH16A1, SERPINC1, and HP, exhibited discriminatory potential. We replicated significant differences of SERPINC1 and HP levels between ALS and controls across the cohorts, and their combination yielded the best in-silico performance. Overall, this investigation of TF proteomics in ALS and controls revealed dysregulated proteins and pathways, highlighting inflammation as a key disease feature, strengthening the potential of TF as a source for biomarker discovery.

Also flagged:psychological distressmajor depressive disordergeneralized anxiety disorderposttraumatic stress disorderPTSDcomplex PTSD
Journal Article 2025-09-02 No Snippets Keenan O, Murphy J, Dunlop P, Doherty E, McHugh R, Kirby K.
Show Full Abstract

The use of defective concrete in the construction of buildings in Ireland has led to widespread property deterioration, displacement, financial loss, and psychological distress for thousands of families. No research to date has examined mental health outcomes or associated risk factors among affected individuals. This study aimed to generate estimates of probable major depressive disorder (MDD), probable generalized anxiety disorder (GAD), probable posttraumatic stress disorder (PTSD), probable complex PTSD (CPTSD), and suicidal ideation in a sample of this population and to identify crisis-related stressors associated with outcomes, while adjusting for trauma history, sociodemographic characteristics, and social support. A convenience sample of 393 adults completed a self-report survey between March and September 2024. Estimates were 30.4% for MDD, 26.2% for GAD, 4.9% for PTSD, and 15.5% for CPTSD. Suicidal ideation, experienced after a property was suspected to have defective concrete, was present in 35.5% of the sample. Safety fears were associated with CPTSD, MDD, and suicidal ideation, odds ratios (ORs) = 2.09-4.39, whereas GAD was associated with relocating, OR = 2.25. These findings highlight the substantial psychological impact of the crisis and identify specific stressors associated with increased risk for adverse outcomes.

SOX6
Also flagged:mineralossificationleptin receptorchromatintranscription factorstranscriptional regulators
Journal Article 2025-09-02 ✓ 1 Snippet Fujita S, Tani S, Okada H, Saito T, Tanaka S, Ohba S, Chung UI, Hojo H.
In-Text Gene Mentions

…development, SOX5 ,SOX6, SOX9 ,…

Show Full Abstract

Osteoblast differentiation is essential for skeletal development and homeostasis. Although bone marrow-derived mesenchymal stem/stromal cells (BM-MSCs) are commonly used to study osteoblast differentiation in the context of bone homeostasis, their relevance to osteoblast differentiation during human skeletal development remains unclear. To understand the regulatory mechanisms underlying osteoblast differentiation in a human developmental context, we performed Assay for Transposase-Accessible Chromatin sequencing (ATAC-seq) and RNA-seq analyses on osteoblasts isolated from an in vivo implantation system using induced sclerotome derived from Col2.3-GFP reporter human embryonic stem cells (hESCs). The resulting datasets revealed skeletal development-associated chromatin accessibility and transcriptional profiles. Comparative analysis with BM-MSC-derived osteoblasts revealed that hESC-derived osteoblasts were enriched for regulatory gene sets associated with ossification. Notably, we identified a super-enhancer associated with DLX5, a known osteoblast regulator, consisting of multiple cooperative enhancer elements to drive transcription. Taken together, this study provides a valuable resource for examining cis-trans regulatory mechanisms in human skeletal development and highlights DLX5 as a key transcriptional regulator controlled by an osteoblast super-enhancer.

PRDX6
Also flagged:Peroxiredoxin-1pancreatic ductal adenocarcinomaPDACtumorRedox effector factor-1transcription factors
Journal Article 2025-09-02 ✓ 3 Snippets Kiran S, Wireman RS, Peil J, Mitchell DK, Potchanant ES, Rai R, Vilseck JZ, Cao S, Haiaty S, Georgiadis MM, Fishel ML, Kelley MR.
In-Text Gene Mentions

…the endoplasmic reticulum,PRDX6in cytosol/lysosomes)—PRDX1 is…

…IL) or PRDX2,PRDX6(Santa Cruz, Dallas,…

…PRDX4, PRDX5, andPRDX6, achieving a knockdown…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) remains highly resistant to therapy, surviving despite hypoxia, oxidative stress, and nutrient deprivation. Redox effector factor-1 (Ref-1) regulates several oncogenic transcription factors (TFs) and is controlled by peroxiredoxins (PRDX). We investigated how Ref-1 inhibition by APX2014, combined with PRDX expression, affects pancreatic cancer cells from multiple patient lines. Silencing or CRISPR/Cas9 knockout of PRDX1-but not PRDX2-6-sensitized PDAC cell lines to APX2014 both in vitro and in vivo without affecting Ref-1's DNA repair function of apurinic/apyrimidinic endonuclease. The combination of PRDX1 loss and APX2014 treatment increased apoptosis and decreased TF activity (NF-κB, HIF-1α) and their downstream targets, TNFAIP2, Survivin, and CA9. A 3D co-culture with PRDX1-null tumor spheroids and cancer-associated fibroblasts (CAFs) showed that (i) Ref-1 inhibition impaired PRDX1-null tumor growth, and (ii) PRDX1 loss reduced CAF viability, highlighting redox crosstalk within the tumor microenvironment (TME). In a PDAC xenograft model, PRDX1-knockout tumors treated with APX2014 had smaller volumes, lighter weights, lower Ref-1, and decreased Ki-67, with improved animal survival. Patient microarrays indicated increased Ref-1 and PRDX1 levels versus normal tissue, emphasizing their clinical relevance. Overall, these data identify PRDX1 as a key factor for PDAC's susceptibility to Ref-1 blockade, suggesting dual targeting could disrupt TME redox signaling, limit tumor progression, and improve APX therapy. These findings support dual targeting of Ref-1 and PRDX1 as a promising therapeutic approach in PDAC and other redox-driven cancers.

Also flagged:serotoninmajor depressionautosomeschromosomefluoxetinecitalopram
Journal Article 2025-09-02 No Snippets Levey D, Galimberti M, Deak J, Gupta P, Empke SLL, Adhikari K, Harrington K, Quaden R, Gaziano JJM, VA Million Veteran Program, Stein MB, Gelernter J.
Show Full Abstract

Antidepressants are among the most-prescribed drugs worldwide, and selective serotonin reuptake inhibitors (SSRIs) are among the most prescribed antidepressants, most commonly used for major depression. We sought to increase our understanding of the biological relationships between SSRI use and a range of psychiatric traits by conducting a genome-wide association study (GWAS) in two large datasets, the UK Biobank (UKB) and the US Million Veteran Program (MVP). GWAS was conducted across 22 autosomes and the X chromosome in 777,952 individuals of European ancestry (191,800 SSRI users, 586,152 control individuals) and 112,526 individuals of African ancestry (53,499 SSRI users, 59,027 control individuals). We identified 40 genome-wide significant (GWS) loci, including two on the X chromosome. Using linkage disequilibrium score regression, we detected strong genetic correlations between MVP and the independent UKB cohort for specific SSRIs (fluoxetine rg = 0.82, citalopram rG = 0.89) as well as with headaches (rG = 0.80), major depressive disorder (MDD; rG = 0.77), and spondylosis (rG = 0.84), suggesting stability in trait definition across cohorts. To evaluate differences in genomic variance captured by SSRI use vs. MDD, we performed a comparative rG analysis and found significant differences, most notably for educational attainment (SSRI rG = -0.38, MDD rG = -0.26), cognitive performance (SSRI rG = -0.31, MDD rG = -0.15), and depression (SSRI rG = 0.80, MDD rG = 0.97). In MVP, SSRI use showed greater locus discovery than MDD (28 vs. 17 loci); comparison to a prior GWAS of anxiety symptoms identified only five loci. SSRI use is likely a partial proxy for MDD, while also reflecting distinct features relevant to related disorders such as anxiety.

OLFM4
Also flagged:ALDH1A1interferongene expressionimmunoglobulin transporterPIGRBEST4
Journal Article 2025-09-02 ✓ 1 Snippet Malonga T, Knudsen C, Alberge J, Lhuillier E, Aymard P, Jones E, Lencina C, Despeyroux M, Riant E, Cabau C, Ivy A, Loving CL, Vialaneix N, Beaumont M.
In-Text Gene Mentions

…, MKI67 ,OLFM4) or downregulated…

Show Full Abstract

<h4>Background & aims</h4>The suckling-to-weaning dietary transition is a key step in intestinal development. The aim of our study was to identify the transcriptome changes induced in each cell type of the intestinal epithelium at the onset of solid food ingestion.<h4>Methods</h4>We compared the single-cell transcriptome of epithelial cells isolated from the cecum of age-matched littermate suckling male rabbits ingesting or not solid food.<h4>Results</h4>Our dataset provides the first single-cell atlas of the rabbit intestinal epithelium and highlights the interest of the rabbit as a model for studying BEST4<sup>+</sup> epithelial cells, which are absent in mice. Solid food ingestion induced extensive transcriptome changes in each epithelial cell type, with the most pronounced changes noted in absorptive and BEST4<sup>+</sup> cells. Some of the effects of solid food introduction were common to most epithelial cell types, such as the upregulation of ALDH1A1. Solid food ingestion remodeled epithelial defense systems, as observed by the increased expression of interferon-stimulated genes in mature absorptive and BEST4<sup>+</sup> cells. Solid food upregulated the gene expression of the immunoglobulin transporter PIGR in cells located at the base of epithelial crypts and in goblet cells. In addition, solid food triggered epithelial differentiation, which was associated with modification of the expression of genes involved in handling of nutrients, as well as changes in hormone expression by enteroendocrine cells. These cell type-specific transcriptome modifications induced by solid food ingestion coincided with changes in microbiota composition and were replicated, in part, by butyrate in organoids.<h4>Conclusions</h4>Our work provides a single-cell atlas of the transcriptome changes induced in the intestinal epithelium at the suckling-to-weaning transition.

Also flagged:thioredoxin reductase 1Txnrd1wateracute pancreatitisgene expressionAmylase
Journal Article 2025-09-02 No Snippets Einwächter H, Li B, Aichler M, Rickmann M, Chhabra NF, Oellinger R, Brielmeier M, Schmid RM.
Show Full Abstract

<h4>Background & aims</h4>Oxidative stress and antioxidant defense mechanisms have long been implicated in the pathogenesis of acute pancreatitis (AP). However, there is a notable lack of in vivo experimental evidence clarifying their precise role.<h4>Methods</h4>We generated and analyzed mice with a pancreas-specific deletion of Txnrd1 (Txnrd1<sup>Δpanc</sup>). AP was induced in these mice using cerulein injections. Pancreatic tissue was subsequently analyzed using immunoblotting, histology, immunohistochemistry, RNA sequencing, and biochemical assays.<h4>Results</h4>Txnrd1<sup>Δpanc</sup> mice exhibited normal growth, pancreatic weight, histology, and pancreatic function comparable to controls, although they experienced a slightly more severe course of AP. An increase in glutathione levels and upregulation of components within the glutathione system were observed in these mice. However, depletion of the glutathione pool led to pancreatic necrosis, followed by regeneration. When glutathione depletion was combined with AP, Txnrd1<sup>Δpanc</sup> mice suffered a profound and permanent loss of acinar tissue.<h4>Conclusions</h4>These findings indicate that the response to AP is closely linked to alterations in antioxidant systems. The thioredoxin and the glutathione systems appear to perform overlapping protective roles in safeguarding acinar cells during AP. A simultaneous disruption of both systems proves detrimental to pancreatic integrity during acute pancreatitis.

HFE
Also flagged:sodium-glucose cotransporter 2colchicinecoronary artery diseasetype 2 diabetesSGLT2iheart failure
Journal Article 2025-09-02 ✓ 2 Snippets Jaiswal V, Hanif M, Kumar D, Mashkoor Y, Garimella V, Jitta SR, Kumar T, Ahmed R, Mattumpuram J, Qamar A, Fonarow GC, Lavie CJ.
In-Text Gene Mentions

…heart failure excacerbation (HFE) after 6 month…

…mortality, MACE, andHFEamong CAD patients…

Show Full Abstract

<h4>Background</h4>Colchicine, an anti-inflammatory agent, has been demonstrated to reduce adverse cardiovascular events in coronary artery disease (CAD) patients. Sodium-Glucose Cotransporter 2 Inhibitors (SGLT2i) provide cardiovascular prevention beyond glycemic control including anti-inflammatory effect, and reduced heart failure risk. Given their complementary mechanisms, combining colchicine and SGLT2i may offer synergistic benefits in CAD patients with T2DM, yet the incremental effects of this combination remain underexplored.<h4>Objective</h4>This study aimed to assess the comparative effectiveness of combination therapy of SGLT2i with colchicine vs colchicine alone among patients with CAD and T2DM.<h4>Methods</h4>The TriNeTX Global Collaborative Network research database was used to identify patients aged ≥18 years of age from January 2015 to June 2024. Patients were categorized into two groups: one with a combination therapy of colchicine and SGLT2i and a control group with colchicine alone. Individuals were matched based on CVD risk factors and medications. After propensity score matching, Risk ratios (RR) were used to compare outcomes over follow-up periods of 6 months and 1 year.<h4>Results</h4>After 1:1 propensity score matching, the study cohort comprised 12,235 patients on colchicine and SGLT2i and 12,235 patients in the control group. The study population had a mean age of 71.5 ± 16.7 years. PSM analysis showed that combination therapy of colchicine and SGLT2i in CAD patients was associated with significantly lower risk of major adverse CVD events (MACE) after 6 month (RR, 0.70 (95 %CI 0.61-0.80), p < 0.01), after 1 year (RR, 0.78 (95 %CI 0.70-0.87), p < 0.01), all-cause mortality (ACM) after 6 month (RR, 0.50 (95 %CI 0.43-0.57), P < 0.01), after 1 year (RR, 0.57 (95 %CI 0.51-0.63), p < 0.01), heart failure excacerbation (HFE) after 6 month (RR, 0.80 (95 % CI 0.69-0.93), p < 0.01), after 1 year (RR, 0.81 (95 % CI 0.72-0.92), p < 0.01), and atrial fibrillation (AF) after 6 month (RR, 0.76 (95 %CI 0.63-0.91), p < 0.01) when compared with colchicine alone. However, the risks of ischemic stroke, acute myocardial infarction (AMI) and hemorrhagic stroke were comparable between the colchicine and SGLT2i groups and the colchicine alone group.<h4>Conclusion</h4>This study suggests that SGLT2i use along with colchicine was associated with significantly lower risk of mortality, MACE, and HFE among CAD patients in comparison to colchicine alone.

TNFSF4
Also flagged:deathPD-L1melanomamethacrylamideepirubicinpeptide
Journal Article 2025-09-02 ✓ 1 Snippet Li J, Al Faruque H, Cortes-Sanchez E, VanBrocklin M, Hu-Lieskovan S, Cina M, Young A, Kopeček J, Yang J.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Melanoma remains a challenging malignancy despite the significant outcomes achieved with immune checkpoint inhibitor (ICI) monotherapy. Here, we investigated a polymer-based chemo-immunotherapy strategy combining KT-1, a backbone-degradable N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer-epirubicin conjugate that induces immunogenic cell death (ICD), with MPPA, a multivalent HPMA copolymer-peptide antagonist of PD-L1 (PPA: (NYSKPTDRQYHF). In B16F10 melanoma, a 3-day dosing schedule significantly outperformed 7-day dosing. KT-1 monotherapy induced CD8<sup>+</sup> T cell-mediated immunity through increased infiltration and upregulation of effector genes (Prf1, Gzmk, Eomes, Xcl1, Cxcl10), with depletion studies confirming CD8<sup>+</sup> T cell dependence. Concurrent KT-1 + MPPA administration proved superior to sequential dosing. Single-cell RNA sequencing revealed that KT-1 promoted dendritic cell maturation and CD8<sup>+</sup> T cell activation, while MPPA selectively reversed KT-1-induced PD-L1 upregulation on tumor cells. The combination enhanced dendritic cell activation, CD8<sup>+</sup> T cell cytotoxicity, and reduced regulatory T cell immunosuppression. Importantly, MPPA did not induce autoimmune diabetes in NOD mice, in contrast to conventional anti-PD-L1 antibodies, and showed no observed immune-related adverse effects highlighting the safety. These findings support HPMA copolymer-based chemo-immunotherapy as a safer, effective alternative to traditional ICI regimens for treating immune-excluded tumors.

BTN2A2
Also flagged:ferroptosiscuproptosisdeathCoppergliomaschemokines
Journal Article 2025-09-02 ✓ 1 Snippet Saddozai UAK, Lu Z, Dong S, Khawar MB, Fan Z, Cai L, Guo X, Akbar MU, Khattak S, Sun H, Wang Y.
In-Text Gene Mentions

…ICGs, including CD276,BTN2A2, PDCDILG2, CD274, and…

Show Full Abstract

<h4>Background</h4>Ferroptosis and Cuproptosis are newly defined forms of cell death. Despite distinct mechanisms, both involve metabolic processes in the TCA cycle and downstream pathways, crucial for anticancer immunity.<h4>Methods</h4>We evaluated Iron (Fe) and Copper-induced cell death in lower-grade gliomas (LGG) using The Cancer Genome Atlas (TCGA) data by developing a metal-based ferroptosis and cuproptosis genes score (MBFCGs) risk model. Lasso regression and survival analyses assessed MBFCGs' significance. An MBFCGs-based nomogram was created and its predictive performance verified. Signaling pathways, immune checkpoints, chemokines, and therapeutic response indicators were quantified using R/oncoPredict and Tidepay. Immunohistochemistry (IHC) examined candidate gene expression.<h4>Results</h4>The MBFCGs risk model, based on BACH1, CDCA3, and TIMP1, predicts LGG prognosis. High MBFCGs were associated with poor clinical outcomes. Functional enrichment analysis showed upregulation in neurotransmitter receptor regulation, KRAS signaling, and hedgehog signaling pathways in the high-risk group. High-risk LGG patients exhibited higher tumor mutation burden (TMB) and lower IDH1 mutation incidence. These patients also had increased stromal and immune scores, with elevated levels of T helper cells, B cells, macrophages, neutrophils, and NK cells. Immune checkpoint analysis indicated higher expression of CD274, PDCD1, and other inhibitory molecules, suggesting potential for targeted cancer immunotherapy.<h4>Conclusion</h4>The MBFCGs risk model is a promising prognostic tool for LGG, offering insights into underlying mechanisms and new directions for immunotherapy strategies. Assessment of MBFCGs for individual LGG patients may provide clues for developing new immunotherapy strategies.

Also flagged:infectionscancersOX40LantibodyCD4CD14
Journal Article 2025-09-02 No Snippets Joo H, Baert L, Yang A, Duluc D, Yi J, Oh S.
Show Full Abstract

<h4>Introduction</h4>Immunity in the vaginal mucosa (VM) is of critical importance for the protection from infections and cancers. Dendritic cells (DCs) are the major antigen-presenting cells that can induce and control T cell responses. Interestingly, VM Langerhans cells (vLCs) and VM CD1c<sup>+</sup>CD14<sup>-</sup> DCs (vDCs) polarize CD4<sup>+</sup> T cells toward Th2-type. However, the mechanisms underlying Th2 polarization by vDCs remain unknown.<h4>Methods</h4>OX40L expression was determined in the human VM tissue sections, followed by the measurement of OX40L expression on vLCs, CD1c<sup>+</sup>CD14<sup>-</sup> vDCs, and VM macrophages (vMØs) by flow cytometry. The roles of OX40L on vDC subsets in the induction of different types of CD4<sup>+</sup> T cell responses were assessed.<h4>Results</h4>Both vLCs and CD1c<sup>+</sup>CD14<sup>-</sup> vDCs express surface OX40L. Neutralizing OX40L with anti-OX40L antibody significantly decreased the frequency of Th2-type CD4<sup>+</sup> T cells with a reduction of CD4<sup>+</sup> T cell proliferation, while increasing the frequency of IL - 10-producing CD4<sup>+</sup> T cell responses. Anti-OX40L did not affect vLC- or CD1c<sup>+</sup>CD14<sup>-</sup> vDC-induced Th1-type T cell responses. OX40L also contributed to the induction of IL - 21<sup>+</sup>CD4<sup>+</sup> T cell responses by vLCs and CD1c<sup>+</sup>CD14<sup>-</sup> vDCs. In contrast to vLCs and CD1c<sup>+</sup>CD14<sup>-</sup> vDCs, vMØs expressed a minimal level of surface OX40L. Likewise, anti-OX40L did not significantly affect vMØ-induced CD4<sup>+</sup> T cell responses.<h4>Conclusions</h4>OX40L contributes to vLC- and CD1c<sup>+</sup>CD14<sup>-</sup> vDC-induced Th2 polarization. It also significantly affects the frequency of vLC- and CD1c<sup>+</sup>CD14<sup>-</sup> vDC-induced IL - 10<sup>+</sup> and IL - 21<sup>+</sup>CD4<sup>+</sup> T cells. This study provides new insights into the immunological landscape of the human VM tissues, with implications for the development of targeted immunomodulatory strategies at this mucosal site.

HFE
Also flagged:beta - 2 - microglobulinBeta 2 MicroglobulinB2MnucleotidedisulfideAmino Acid
Journal Article 2025-09-02 ✓ 1 Snippet Daoud AK, Alqarqaz WA, Al Okor MM.
In-Text Gene Mentions

…), Qa1 andHFE( 8 )]…

Show Full Abstract

<h4>Background</h4>In Immunology, many molecules are composed of Immunoglobulin domains. Beta 2 Microglobulin (B2M) is the smallest Immunoglobulin Domain Superfamily member composed of a single domain that is highly conserved in nature in all vertebrates with low rate of Single Nucleotide Polymorphisms (SNP).<h4>Objective</h4>We wanted to mathematically evaluate the effects of the SNP's-induced Amino Acid (AA) substitutions on the primary structure of the protein.<h4>Methods</h4>A C++ computer program code was written to take the 360 B2M mature DNA nucleotide sequences giving back the corresponding protein sequence of 119 AA. For each nucleotide the corresponding 3 possible SNP's were generated and the 9 possible modifications per triplet were assessed, taking into consideration critically located AA's like Cysteine residues involved in disulfide bond formation and the formation of Stop Codons. We used Sneath Score for resemblance of chemical structure to further evaluate the AA Substitutions.<h4>Results</h4>In 22.1% of SNP's no change in the resulting AA was seen, and in 25.4% of cases a relatively small change was seen with an AA of the same group (Positively Charged, Negatively Charged, Polar, Special and Hydrophobic AA). In 5.3% of the cases, a Stop codon was generated which will lead to an early catastrophic termination of the DNA transcription process. Most cases of SNP's (47.2%) involve a relatively big change characterized by the substitution by an AA of a totally different chemical group leading to a possibly significant result.<h4>Conclusions</h4>The occurrence of SNP's in B2M is an important "random" event that can affect the structure of the protein. We attempted to evaluate the effect of SNP's on the primary structure of B2M and concluded that there is need to improve the computer software programs evaluating the effect of SNP's and other genetic modifications on the proteins as well as improving the scoring systems evaluating the AA substitutions.

TNFSF4OLFM4
Also flagged:tumorcancercolorectal cancermetabolismtransforming growth factor-βWNT
Journal Article 2025-09-02 ✓ 2 Snippets Yin X, Jiang Y, Huang J, Luo J, Xu L, Yang Q.
In-Text Gene Mentions

…EIF3L + 0.01*OLFM4– 0.031* LITAF…

…CD40, HAVCR2, andTNFSF4were overexpressed and…

Show Full Abstract

<h4>Background</h4>The tumor microenvironment (TME) is highly complex and significantly influences cancer prognosis and drug sensitivity. Tumor-associated neutrophils (TANs) play a key role in the TME. In this study, we aimed to investigate the TANs-related markers in colorectal cancer (CRC) and develop an integrated signature for prognostic stratification.<h4>Methods</h4>The CRC single-cell RNA sequencing (scRNA-seq) data and RNA-seq data were obtained from TCGA and GEO. A risk score was calculated based on the 18 TAN-associated genes identified in CRC by scRNA-seq data and LASSO regression. Prognosis, stromal and immune infiltration landscape, metabolism, and treatment response were then investigated in the low- and high-risk score clusters using RNA-seq data.<h4>Results</h4>Patients with a High-risk score had a significantly worse survival outcome than those with a Low-risk score (p < 0.0001). The prognostic predictive potency of the risk score was validated in both the TCGA validation cohort (p < 0.0001) and the GEO cohort (p < 0.00015). The areas under the curves of 1-, 3-, and 5-year survival were 0.76, 0.74, and 0.70 in the TCGA training set; 0.78, 0.68, and 0.78 in the TCGA validation set; and 0.65, 0.64, and 0.62 in the GEO set. The risk score was related to T, N, and M stages. A prognostic nomogram was constructed, and the predictive accuracy was assessed by calibration curve analysis. Decision curve analysis showed the clinical utility of the nomogram. Furthermore, the High-risk score cluster was significantly associated with the levels of cancer-associated fibroblasts, as well as activity in the transforming growth factor-β and WNT pathway. In depth, the High-risk score cluster exhibited lower levels of amino acid, tricarboxylic acid, and nucleotide metabolism, as well as poorer responses to chemotherapeutic agents such as 5-fluorouracil.<h4>Conclusion</h4>This novel TAN subtype, based on 18 prognostic-related genes, could provide new insights into the prognostic stratification and treatment options for CRC.

Also flagged:esophageal squamous cell carcinomaESCCgastric adenocarcinomatumorMCL1RECQL4
Journal Article 2025-09-02 No Snippets Miao C, Guo Y, Yang H, Zhu S, Chen Y, Zhao W, Hu X.
Show Full Abstract

Dual primary malignancies in the upper gastrointestinal tract are rare and pose diagnostic and therapeutic challenges. This study reports a case of synchronous esophageal squamous cell carcinoma (ESCC) and gastric adenocarcinoma (GAC), highlighting the role of genetic profiling in personalized treatment. A 78-year-old female patient was diagnosed with stage IIB ESCC and stage IIIA GAC. Due to surgical ineligibility, she received chemoradiotherapy and immunotherapy. Next-generation sequencing (NGS) was performed to identify potential genetic drivers. Genetic analysis revealed common chromosomal amplifications on 19p and 21q but no shared driver mutations, suggesting independent tumor origins. ESCC exhibited amplifications of MCL1, RECQL4, NKX2-1, PARP10, RSPO1, MUCL, and WTIP, while GAC showed deletions of APC and PRKG1, along with amplifications of ARRDC1 and NRARP. The patient achieved stable disease without recurrence following chemoradiotherapy and Sintilimab immunotherapy. This case underscores the role of genetic alterations in dual primary cancers and demonstrates the feasibility of precision treatment.

DCC
Also flagged:digestioncarbonAcidpigmentationaluminumcobalt
Journal Article 2025-09-02 ✓ 1 Snippet Barbosa AL, da Silva IJS, Torres BSS, Paim APS.
In-Text Gene Mentions

…between OCC andDCC.…

Show Full Abstract

This study aimed to determine the elemental composition (Al, Co, Cu, Mg, Mn, Ni, and Zn) of denim garments with varying compositions. An acid digestion method was developed using a 2<sup>3</sup> full factorial design to optimize sample preparation conditions, using an open-system digester block. Among 29 denim samples, 27 were successfully digested, exhibiting residual carbon and acidity below 2% and 10%, respectively. Elemental analysis was conducted using ICP OES, with validation through recovery tests (75-125%) and a certified reference material. No significant differences were found between the determined and certified values, as confirmed by a <i>t</i> test. DLS analysis revealed a particle size distribution of less than 1 μm in the digested samples. The method proved to be cost-effective, also reducing acid use by up to 80% compared to previous works. Additionally, the method attained an analytical Eco-Scale score of 83, thereby qualifying as an excellent example of green analytical methodology. While Mg showed the highest concentration (322.2 mg kg<sup>-1</sup>), the elements Co (0.34 mg kg<sup>-1</sup>) and Ni (0.67 mg kg<sup>-1</sup>) exhibited the lowest concentrations. Cu and Mn were found in concentrations higher than recommended levels (50 mg kg<sup>-1</sup> for Cu and 90 mg kg<sup>-1</sup> for Mn), with ranges of 0.07 to 89.3 mg kg<sup>-1</sup> Cu and 1.4 to 608.0 mg kg<sup>-1</sup> Mn. On the other hand, Ni concentrations were close to the established limit (1 mg kg<sup>-1</sup> Ni), ranging from 0.57 to 1.0 mg kg<sup>-1</sup>. These findings underscore the need for additional research on denim to identify toxic elements and their associated health risks.

DCC
Also flagged:MSvisionimmune system dysfunctionmenopauseheadacheHA
Journal Article 2025-09-02 ✓ 2 Snippets Oldham D, Saviola A, Alvarez E, Bruce KD.
In-Text Gene Mentions

…in colorectal carcinoma (DCC) ( Jasmin et…

…al., 2024 ),DCC, Semaphorin 6 A…

Show Full Abstract

Multiple sclerosis (MS) is an autoimmune disorder of the central nervous system (CNS) that is characterized by demyelination, inflammation, and neurological damage. MS is the most common neurological disorder of young adults, negatively impacting their quality of life. Recent population-based estimates have determined that the prevalence of MS in the United States is growing and can be up to 3 times higher in females. While the etiology of MS is complex, involving genetics, immune dysregulation, and environmental triggers, the factors elevating MS risk in women are relatively unexplored. Hence, there is a major need for studies that further our understanding of the pathophysiology of MS in women and identify potential biomarkers and therapeutic targets. To this end, we used highly sensitive and untargeted liquid chromatography-mass spectrometry (LC-MS) to identify proteins in the cerebrospinal fluid (CSF) of age-matched females who were either diagnosed with MS or headache (HA). We found that the CSF of female individuals with MS was enriched in proteins involved in macrophage and microglia function yet depleted in proteins involved in neurogenesis and neuronal function. Overall, our findings support recently identified therapeutic targets (e.g., FABP5), as well as highlighting potential targets that may predict or promote MS neuropathogenesis in females (e.g., CD99, APOC3), which should be studied in larger cohorts going forward.

Also flagged:Neurodegenerative DisordersNeurodegenerative diseasesoxygennitrogencholinesterasemitochondrial
Journal Article 2025-09-02 No Snippets Nagpal D, Nema S, Nagpal S, Pandey MM, Kaushik D, Kathuria H.
Show Full Abstract

Neurodegenerative diseases are associated with the senescence of functional neurons, which hampers brain functions. These diseases are caused by the accumulation of reactive oxygen species, reactive nitrogen species, cholinesterase malfunction, neuronal inflammation, and mitochondrial dysfunction. The incidence of neurodegenerative disease has been on the rise. Current therapeutic interventions are expensive, exhibit poor efficacy, and have numerous side effects. Several studies have explored the potential of crucial dietary substances rich in antioxidants and micronutrients in alleviating the clinical manifestations of such deadly diseases. Consumption of sufficient antioxidants, fatty acids, and polyphenols in regular diets delays the onset of neurodegenerative diseases. Several medicinal plants, such as Withania somnifera, <i>Curcuma longa</i>, Panax ginseng, Ginkgo biloba, aloe vera, Punica granatum, and various phytoextracts, contain such micronutrients in reasonable amounts. Specific dietary interventions, supplements, and patterns such as the Mediterranean-DASH intervention for neurodegenerative delay, ketogenic, paleolithic, and Wahls elimination diets have been beneficial in neurodegenerative conditions. These diet interventions and other functional foods can be an attractive, non-invasive, and inexpensive approach in the management and prevention of neurodegenerative conditions. This review discusses potential pharmacological bases involved in neurodegeneration, covering mitochondrial damage, impaired mitophagy, neuroinflammation, ferroptosis, glymphatic clearance dysfunction, brain-body interactions, and disruption of vagus nerve stimulation. The review further highlights clinical diet interventions and assorted functional foods, including fruits, vegetables, vitamins, specific supplements, and special diets, for neurodegenerative conditions. The discussion extends insights into clinical research and trials of these functional foods under neurodegenerative conditions. Overall, dietary interventions show promise in the prevention and management of neurodegenerative conditions.

bioRxiv 2025-09-02 Preprint (No Snippets API) Bell C, Chen L, Maristany MJ, Blaukopf C, Zhou H, Huertas J, Perez Lopez JI, Langer CCH, Steinacker TL, Schuette N, Doolittle L, Espinosa JR, Redding S, Collepardo-Guevara R, Rosen MK, Gerlich DW.
Show Full Abstract

During cell division, chromosomes reorganise into compact bodies in which centromeres localise precisely at the chromatin surface to enable kinetochore-microtubule interactions essential for genome segregation. The physical principles guiding this centromere positioning remain unknown. Here, we reveal that human core centromeres are directed to the chromatin surface by repulsion of centromere-associated proteins - independent of condensin-mediated loop extrusion and microtubule engagement. Using cellular perturbations, biochemical reconstitution, and multiscale molecular dynamics simulations, we show that chromatin surface localisation emerges from repulsion between condensed chromatin and both the kinetochore and the highly negatively charged centromere protein, CENP-B. Together, these elements form a centromeric region composed of two domains with opposing affinities, one favouring integration within the mitotic chromosome and the other favouring exposure to the surrounding cytoplasm, thereby driving surface positioning. Tethering synthetic negatively charged proteins to chromatin was sufficient to recapitulate this surface localisation in cells and in vitro, indicating that electrostatic repulsion is a key determinant of surface localisation. These findings demonstrate that centromere layering is not hardwired by chromatin folding patterns but instead emerges from phase separation in chromatin. Our work uncovers electrostatic polarity as a general and programmable mechanism to spatially organise chromatin.

SERPINC1
Also flagged:inflammatory skin diseasescanceracneatopic dermatitissystemic lupus erythematosuspsoriasis
Journal Article 2025-09-01 ✓ 2 Snippets Li Y, Cao Z, Wu J.
In-Text Gene Mentions

…targets include RARRES2,SERPINC1, GALK1, and ECM1…

…such as RARRES2,SERPINC1, and ECM1 were…

Show Full Abstract

<h4>Background</h4>Despite advances in cancer biomarkers and targeted therapies, early diagnosis and treatment of inflammatory skin diseases remain challenging. This study aims to identify circulating proteins causally linked to inflammatory skin diseases, including acne, atopic dermatitis, systemic lupus erythematosus, psoriasis, rosacea, and urticaria, through a Mendelian randomization (MR) framework.<h4>Methods</h4>A large-scale MR analysis was performed to assess the causal effects of thousands of plasma proteins on common inflammatory skin diseases. Additional methods, including Steiger filtering, transcriptome-wide association studies, summary data-based MR, protein-protein interaction networks, pathway enrichment analyses, Bayesian colocalization, and drug target evaluation, were employed to validate MR findings and explore therapeutic targets.<h4>Results</h4>This study identified >100 circulating proteins that may be involved in inflammatory skin diseases. Tier 1 therapeutic targets include RARRES2, SERPINC1, GALK1, and ECM1 for atopic dermatitis and RARRES2, PPID, and IL1RL1 for acne, rosacea, and urticaria. These proteins represent promising avenues for developing new treatments, with the potential to improve diagnostics and therapeutic strategies in the future.<h4>Conclusion</h4>This MR analysis revealed numerous plasma proteins associated with inflammatory skin diseases, offering insights into protein-mediated mechanisms and highlighting promising therapeutic targets for future interventions. Key message What is already known on this topic  Inflammatory skin diseases, including psoriasis, atopic dermatitis, and acne, are complex conditions linked to systemic factors such as alterations in circulating plasma proteins. Previous studies have identified certain proteins involved in skin immune responses; however, a comprehensive understanding of their causal roles remains lacking. What this study adds  This study utilized a large-scale proteome-wide Mendelian randomization analysis to identify >100 circulating proteins causally linked to inflammatory skin diseases. Notably, proteins such as RARRES2, SERPINC1, and ECM1 were highlighted as potential therapeutic targets for atopic dermatitis and acne, among others. How this study might affect research, practice, or policy  The findings provide novel insights into protein-mediated mechanisms underlying inflammatory skin diseases, suggesting new diagnostic and therapeutic avenues. Future research should focus on validating these protein targets in clinical settings and exploring their potential for therapeutic intervention.

Also flagged:HDdominant monogenic diseasecytosineadenineguaninebehavioural
Journal Article 2025-09-01 No Snippets Giboin LS, Simillion C, Rennig J, Bamdadian A, Kinsella FC, Smith AV, McColgan P, Lindemann M, Lipsmeier F, Wild EJ, Dorn J.
Show Full Abstract

Remote digital monitoring of Huntington's disease (HD) has potential to enhance the development of therapeutics, but no data-driven digital motor score exists to quantify the diversity of disease manifestations and track their progression. The HD Digital Motor Score (HDDMS), co-designed with people with HD and neurologists, is a composite score for measuring motor progression of HD in clinical research. It is derived from smartphone sensor-based motor tests included in a remote HD digital monitoring platform. Developing the HDDMS involved selecting features that quantify test performance according to desired measurement properties and combining these features in a weighted composite score using factor analysis. It was developed and subsequently validated using data from four separate studies [HD Natural History Study (NCT03664804), open-label extension (OLE) of the tominersen phase I/IIa study (NCT03342053), GENERATION HD1 (NCT03761849) and Digital-HD]. Based on data from 1048 (the total number of individuals whose data contributed to the construction of the score includes the 40 gene-negative volunteers) individuals, the HDDMS encompasses balance, chorea, speeded tapping and gait. It has favourable characteristics, including reliability (intraclass correlation coefficient > 0.95), correlation with the composite Unified Huntington's Disease Rating Scale (cUHDRS) (r = -0.5), and better sensitivity to change (STC) than the cUHDRS. In a post hoc analysis of GENERATION HD1, the STC of HDDMS at Week 20 was comparable to that of the cUHDRS at Week 68. The HDDMS promises substantial reduction in sample size in clinical trials.

SERPINC1
Also flagged:Parkinson's diseasePDProgressive supranuclear palsycorticobasal syndromebehaviouralfrontotemporal dementia
Journal Article 2025-09-01 ✓ 2 Snippets Hu MT, Coma AQ, Rowe JB, Zerenner T, Church A, Fumi R, Costantini A, Jabbari E, Jensen MT, Gerhard A, Pavese N, Kobylecki C, Leigh PN, Koychev I, Morris HR, Manohar SG.
In-Text Gene Mentions

…did not haveACE-III, however, and instead…

…from MoCA toACE-IIImight differ according…

Show Full Abstract

Atypical parkinsonian syndromes are distinguished from Parkinson's disease (PD) by additional neurological signs and characteristic underlying neuropathology. However, they can be diagnostically challenging, rapidly progressive and are often diagnosed late in disease course. Their different demographic features and prognoses are well studied, but the accompanying cognitive and psychiatric features may also facilitate diagnosis. Progressive supranuclear palsy (PSP) and corticobasal syndrome (CBS) may cause cognitive and behavioural manifestations that overlap with frontotemporal dementia, including non-fluent aphasia, apathy and impulsivity. Clinical diagnostic criteria have limited sensitivity, with pathologically confirmed PSP often having presented an initial clinical syndrome other than PSP-Richardson's syndrome. Here, we integrate cross-sectional multicentre baseline data from the PROSPECT-M-UK and Oxford Discovery cohorts. This allowed us to compare cognitive and psychiatric features across a total of 1138 people with PSP, CBS, multiple-system atrophy (MSA) and idiopathic PD. Data from the different cohorts were harmonized and compared using multiple linear regression. There were five key results: (i) different syndromes showed distinctive cognitive profiles, using readily applicable 'bedside' screening tools. Frontal executive dysfunction was most evident in PSP, visuospatial deficits in CBS, with milder deficits in memory and executive function in MSA, as compared with PD; (ii) the most prevalent neuropsychiatric features were depression and anxiety in CBS, apathy in PSP, with sleep disturbances common in PD. As expected, apathy correlated positively with impulsivity across all disorders. Neuropsychiatric features were generally better at discriminating between atypical parkinsonian syndromes than were the cognitive domains; (iii) both cognitive function and motor severity declined with disease duration, and motor function predicted cognition in PSP, CBS and PD but not in MSA, suggesting that in MSA cognitive and motor dysfunction are decoupled; (iv) plasma neurofilament light chain (NFL) levels, measured in a subset of patients, correlated with cognitive deficits in PSP, but not motor deficits; (v) cognitive deficits contributed to the impairment in activities of daily living after controlling for motor severity, with every two points on the Montreal Cognitive Assessment worsening the Schwab and England score by one point. In anticipation of future neuroprotective therapies, we present a classifier to improve diagnostic accuracy for atypical parkinsonian syndromes in vivo. Longitudinal cohort studies with resources for neuropathological gold standard diagnosis remain important to validate better diagnostic tools for people with PSP, CBD, MSA and atypical parkinsonism.

PRDX6
Also flagged:DeathSIRT6Nrf2acetylcysteinemembrane
Journal Article 2025-09-01 ✓ 1 Snippet Affandi T, Ohm AM, Speidel JT, Caino MC, Boulton DP, Reyland ME.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Protein kinase C δ (PKCδ) regulates DNA repair and apoptosis, and inhibition of PKCδ provides robust radioprotection. In this study, we show that depletion of PKCδ increases mitochondrial reactive oxygen species (ROS) production and induces an endogenous antioxidant response through nuclear factor erythroid 2-related factor 2 (Nrf2), resulting in decreased basal and irradiation (IR)-induced DNA damage and cell death. Radioprotection by PKCδ depletion can be reversed with the free radical scavenger, N-acetyl-L-cysteine, indicating an essential role for the antioxidant response. Whereas mitochondrial mass and membrane potential are increased in PKCδ-depleted cells, oxidative phosphorylation and the activity of electron transport chain complex I and complex III are reduced, suggesting that electron transport chain dysfunction is the source of the increased mitochondrial ROS. The antioxidant response induced by PKCδ depletion is mediated through Sirtuin 6 (SIRT6) and Nrf2. Increased mitochondrial ROS and Nrf2 activation are reversed in PKCδ/SIRT6 double knockdown cells, indicating a central role for SIRT6 in PKCδ-regulated DNA repair and cell death. Regulation of the endogenous antioxidant state through manipulation of the PKCδ/SIRT6 signaling pathway may be a novel clinical approach for protection of healthy tissues in patients undergoing IR therapy.<h4>Implications</h4>Regulation of the endogenous antioxidant state through manipulation of the PKCδ/SIRT6 signaling pathway may be a novel clinical approach for protection of healthy tissues in patients undergoing IR therapy.

SERPINC1
Also flagged:PlasminogenplasmindeathPAvenous thrombosisthromboembolism
Journal Article 2025-09-01 ✓ 1 Snippet Sang Y, Menegatti M, Brody JA, Wiggins KL, Cooley BC, Kapfer KN, Kangro K, de Laat B, Peyvandi F, Flick MJ, Smith NL, Shapiro AD, Wolberg AS.
In-Text Gene Mentions

…PROC , andSERPINC1) and VTE…

Show Full Abstract

<h4>Abstract</h4>Suppression of plasminogen activation and/or plasmin activity (PA) reduces blood loss and decreases hemorrhage-related death. However, whether the endogenous PA system is a biological mechanism to prevent intravascular thrombus formation is debated, and the potential that reduced PA may increase venous thrombosis/thromboembolism (VTE) risk cautions against the use of antifibrinolytic agents. We aimed to determine the contribution of PA to VTE. Type 1 plasminogen-deficient humans enrolled in the Hypoplasminogenemia International Retrospective and Prospective Cohort Study registry reported pathologic pseudomembrane formation, but not unprovoked VTE. When subjected to an experimental model of venous thrombosis, compared with Plg+/+ mice, neither partial (Plg+/-) nor complete (Plg-/-) deletion of plasminogen altered thrombus mass or thrombus nucleated cell, platelet, or fibrin(ogen) content at 24 or 6 hours after thrombus induction. Administration of tranexamic acid (TXA) to mouse plasma in vitro or healthy mice in vivo dose-dependently delayed and suppressed plasma plasmin generation for up to 3 hours. However, mice administered TXA did not have significantly altered thrombus mass or thrombus composition at 24 or 6 hours after thrombus induction, despite unexpectedly persistent TXA in plasma. In a genome-wide association study, variants in gene regions encoding PA pathway proteins were not significantly associated with VTE risk. In the UK Biobank repository, plasminogen protein levels were not significantly associated with VTE risk. These data from genetic, pharmacologic, and proteomic analyses of mice and humans indicate that perturbations in PA do not increase VTE risk. Collectively, these results suggest PA is not a molecular regulatory mechanism to protect against VTE. This trial was registered at www.clinicaltrials.gov as #NCT03797495).

HFE
Also flagged:UBA1VEXAS syndromevacuolesE1 enzymeautoinflammatory syndromeVEXAS
Journal Article 2025-09-01 ✓ 1 Snippet Wadsworth PA, Chen SB, Lawrence L, Ho CC, Le JE, Libiran P, Grayson PC, Ferrada MA, Beck DB, Suarez CJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>VEXAS (vacuoles, E1 enzyme, X-linked, autoinflammatory, somatic) is a recently described autoinflammatory syndrome caused by pathogenic variants in UBA1. However, there is a dearth of widely available UBA1 testing aside from large, expensive sequencing studies. Thus, we sought to rapidly develop, validate, and clinically deploy a cost-effective assay for detecting the most common UBA1 variants.<h4>Methods</h4>We developed, validated, and implemented a single base extension mass spectrometry assay for detecting pathogenic UBA1 variants at the c.121, c.122, and c.118-1 positions in patients with suspected VEXAS syndrome. Assay performance characteristics were assessed using peripheral blood and bone marrow samples from patients with (n = 8) and without (n = 36) VEXAS.<h4>Results</h4>The assay demonstrated a lower limit of detection (LOD) of 10% variant allele fraction for each mutation. The analytical accuracy, sensitivity, and specificity were each demonstrated to be 100% at the LOD, with excellent intra- and interrun reproducibility. Based on literature review of reported UBA1 variants associated with VEXAS, to date, this assay detects the most prevalent variants, with a clinical sensitivity of 97% or more.<h4>Conclusions</h4>A cost-effective, mass spectrometry-based assay with high analytical and clinical performance can feasibly be implemented in hospital laboratories for diagnosis of VEXAS syndrome.

HFE
Also flagged:infectious diseasesinfectionscoronavirus disease 2019COVID-19baricitinibtocilizumab
Journal Article 2025-09-01 ✓ 1 Snippet Hamilton F, Butler-Laporte G, Davey Smith G.
In-Text Gene Mentions

…example, variants inHFEthat increase iron…

Show Full Abstract

Mendelian randomization (MR) is an increasingly common study design in infectious diseases (ID). It holds promise for identifying causes and consequences of infections where conventional epidemiology has struggled, and can highlight plausible drug targets, as shown in successful coronavirus disease 2019 (COVID-19) trials (baricitinib, tocilizumab). However, many current applications provide limited insight due to violations of core assumptions, yielding uninterpretable results. This article reviews MR principles, assumptions, and specific challenges in ID. We highlight examples violating key assumptions, noting that MR studies using infection as an exposure are particularly prone to bias compared to using infection as an outcome. We discuss the future of MR in ID, emphasizing appropriate application to address causal questions unanswerable by other methods and capitalize on emerging opportunities where MR can provide unique insights.

PTGIS
Also flagged:fragile Xneuropsychiatric disordersFXTASneurodegenerative disorderFMR1X
Journal Article 2025-09-01 ✓ 3 Snippets Çalışkan G, Lacalle SE, Kul E, Del Ángel M, Zambrano AL, Hukema R, Santos M, Stork O.
In-Text Gene Mentions

…showing downregulation (e.g.PTGIS, PLIN4, ICAM1, MYH9,…

…MYLK, TAGLN andPTGIS) at both time…

…(INA, NEFL, CRYAB,PTGIS, ZBTB20, NDUFS3, CRYAB…

Show Full Abstract

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a late-onset neurodegenerative disorder caused by a preCGG repeat expansion in FMR1. Individuals with the FMR1 premutation often exhibit neuropsychiatric symptoms before FXTAS onset, leading to the identification of fragile X-associated neuropsychiatric disorders. Rodent models of FXTAS show motor impairments, pathological intranuclear inclusions and heightened anxiety. However, the early onset of neuropsychiatric features and underlying mechanisms remain poorly understood. To address the above issues, we used the doxycycline-inducible 90CGG mouse model, with transgene activation at two developmental stages: adolescence and young adulthood. Mice were evaluated in a behavioural battery to assess anxiety-like behaviour, exploration, and motor coordination and learning. Next, we conducted a combination of ex vivo extracellular local field potential recordings to measure synaptic physiology and oscillatory activity in the limbic system, particularly in the basolateral amygdala (BLA) and ventral hippocampus (vH) regions. Parvalbumin interneurons and intranuclear inclusions in the amygdala and hippocampus were investigated by immunofluorescence, and mass spectrometry and gene set enrichment were used to identify differentially expressed protein molecular pathways. Adolescent 90CGG mice displayed early-onset hyperactivity, transitioning to heightened anxiety in young adulthood, coinciding with the accumulation of intranuclear inclusions in the BLA and vH. Electrophysiological analysis revealed augmented gamma oscillations in the vH, emerging during adolescence and persisting in young adulthood. These changes were correlated with a reduction in parvalbumin interneurons in these regions, and together probably contribute to enhanced BLA excitability and impaired vH plasticity. Finally, proteomic analysis of the vH revealed altered proteins linked to attention deficit hyperactivity disorder in adolescence and anxiety/depression in adulthood, aligning well with behavioural findings. Importantly, these behavioural, electrophysiological and cellular alterations were reversible upon transgene inactivation. This study reveals a temporal progression of CGG premutation effects on behaviour, from hyperactivity to heightened anxiety to late-onset motor dysfunction. Moreover, these findings provide altered network activity in the limbic system as a putative mechanism in neuropsychiatric features of premutation carriers.

HFE
Also flagged:antibodiesHLAGYPBhereditary hemochromatosishemoglobinopathiessickle cell disorder
Journal Article 2025-09-01 ✓ 4 Snippets Gleadall NS, Koets L, Shamardina O, Gollub J, Gottschalk AJ, Razeghi O, Ochoa-Garay G, Stephens J, Varma R, Martin J, Allara E, Brown CJ, Daly J, Di Angelantonio E, Grimsley S, Howell WM, Hyvärinen K, Jentsch U, Kingston N, Montemayor C, Moya-Valera C, Ord J, Partanen J, Roberts D, Stirrups KE, Vege S, Walker L, Harmer A, Kaushikkar S, Ouwehand WH, van der Schoot CE, Westhoff CM, Veldhuisen B, Lane WJ.
In-Text Gene Mentions

…ary hemochromatosis-associatedHFEvariants were identified…

…(HH) in theHFEgene: His63Asp, Ser65Cys,…

…276 individuals hadHFEgenotypes causal of…

…of these HH-causingHFEvariants differs significantly…

Show Full Abstract

<h4>Abstract</h4>Blood transfusions save millions of lives worldwide each year, yet formation of antibodies against nonself antigens remains a significant problem, particularly in patients who receive frequent transfusions. We designed and tested the Universal Blood Donor Typing (UBDT_PC1) array for automated high-throughput simultaneous typing of human erythrocyte antigens (HEAs), platelet antigens (HPAs), leukocyte antigens (HLAs), and neutrophil antigens to support selection of blood products matched beyond ABO/Rh. Typing samples from 6946 study participants of European, African, Admixed American, South Asian, and East Asian ancestry at 2 different laboratories showed a genotype reproducibility of ≥99% for 17 244 variants, translating to 99.98%, 99.90%, and 99.93% concordance across 338 372 HEA, 53 270 HPA, and 107 094 HLA genotypes, respectively. Compared with previous clinical typing data, concordance was 99.9% and 99.6% for 245 874 HEA and 3726 HPA comparisons, respectively. HLA types were 99.1% concordant with clinical typing across 8130 comparisons, with imputation accuracy higher in Europeans vs non-Europeans. Seven variant RHD alleles, a GYPB deletion underlying the U- phenotype, and 14 high-frequency antigen-negative types were also detected. Beyond blood typing, hereditary hemochromatosis-associated HFE variants were identified in 276 participants. We found that the UBDT_PC1 array can reliably type a wide range of blood cell antigens across diverse ancestries. Reproducibility and accuracy were retained when transfusion-relevant targets from the UBDT_PC1 array were incorporated into the UKBB_v2.2 genome-wide typing array. The results represent the potential for significant advancement toward improved patient care by reducing harm in transfusion recipients through extended matching.

DCC
Also flagged:neuroblast migrationembryogenesismannosyltransferasedpy-19bindingneuroblast
Journal Article 2025-09-01 ✓ 1 Snippet Poon H, Zheng C.
In-Text Gene Mentions

…Moreover, UNC-40/DCC receptorreceptor, PTP-3/LAR-like recep…

Show Full Abstract

Maternal-effect genes mostly regulate early embryogenesis as their mRNAs or proteins are deposited into the oocytes to function during early embryonic development before the onset of zygotic transcription. Here, we report a case where a maternal-effect gene regulates postembryonic neuroblast migration long after the early embryonic stages. We found that the defects of the Q neuroblast migration in Caenorhabditis elegans mannosyltransferase dpy-19 mutants can be rescued by a maternal copy of the gene. Maternal dpy-19 mRNAs are deposited into the oocytes and persist throughout embryonic development into the Q cells to regulate their migration in early larval stages. These mRNAs appeared to be remarkably stable, since long-term developmental arrest, changing the 3'UTR sequence, and mutations in genes involved in RNA binding and modification all had weak effects on the maternal rescue of the neuroblast migration defects. Since the defects can also be rescued by a zygotic copy of dpy-19(+), our results suggest that postembryonic neurodevelopment is redundantly regulated by maternal and zygotic copies of the same gene.

Also flagged:diabetesdiabetes-related complicationsinsulinglucosetype 1 diabetesDigestive and Kidney Diseases
Journal Article 2025-09-01 No Snippets Barbosa C, Hoerger TJ, Mack NA, Bobashev GV, Neuwahl S, Hilscher R, Orchard T, Costacou T, Miller RG, D'Agostino R, Zhang P.
Show Full Abstract

<h4>Objective</h4>To develop a U.S.-based microsimulation model for assessing the cost-effectiveness of interventions to manage type 1 diabetes.<h4>Research design and methods</h4>We developed risk equations for 14 diabetes-related complications and mortality, 12 risk factor progression equations, and one equation for utilities associated with 14 complications using data from the Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) studies and the Epidemiology of Diabetes Complications (EDC) study. We integrated all equations into a simulation model. We conducted internal and external validation and demonstrated the utility of the model using a real-world example. Main model-generated outcomes included cumulative incidence of diabetes-related complications, life years, quality-adjusted life years, medical costs, and incremental cost-effectiveness ratios.<h4>Results</h4>The model generates long-term clinical and economic outcomes from changes in risk factors of type 1 diabetes complications. Internal validation comparing modeled outcomes to observed data used to develop the model yielded good prediction accuracy, with mean absolute percentage error across all complications of 9% and correlation of cumulative failure rates above 0.9. External validation results were mixed, with occurrence of slight under- or overprediction across complications and studies. We illustrated the model with a case study estimating the effects of expanding the use of an insulin pump with continuous glucose monitoring to all people with type 1 diabetes.<h4>Conclusions</h4>Our new comprehensive type 1 diabetes simulation model can generate valid and accurate results for assessing the long-term cost-effectiveness of interventions to manage type 1 diabetes in the U.S.

Also flagged:RNA-binding proteinsTaurine Upregulated Gene 1TUG1cancercamptothecinDEAD/DEAH-box RNA helicases
Journal Article 2025-09-01 No Snippets Xie J, Suzuki MM, Iijima K, Shinjo K, Nishimura T, Watanabe S, Nakagawa R, Ito T, Kondo Y.
Show Full Abstract

Long non-coding RNAs (lncRNAs) regulate a wide array of cellular processes through interactions with RNA-binding proteins (RBPs). Taurine Upregulated Gene 1 (TUG1) is an lncRNA that is overexpressed in many types of cancer and has been implicated in resolving R-loops, thereby maintaining genomic integrity. However, the full spectrum of its protein interactions and stress-responsive dynamics remains unclear. Here, we employed CRISPR-assisted RNA-protein interaction detection (CARPID) combined with mass spectrometry to comprehensively identify the interacting proteins of TUG1 in HEK293T cells. Using three distinct single-guide RNAs (sgRNAs) targeting different regions of TUG1, we consistently identified 17 TUG1-interacting proteins under basal conditions. Upon camptothecin (CPT) treatment, which induces R-loop formation, the number of associated proteins increased to 25. Under these stress conditions, the protein sets identified by each sgRNA showed greater overlap, suggesting a more conserved pattern of TUG1-protein interactions in response to R-loop accumulation. Many of these proteins are known R-loop-associated factors, including DEAD/DEAH-box RNA helicases, poly(ADP-ribose) polymerase 1 (PARP1) and heterogeneous nuclear ribonucleoproteins (HNRNPs), indicating that TUG1 engages R-loop regulatory machinery to maintain genome integrity. Our study provides new insights into lncRNA-mediated R-loop regulation and its role in genome maintenance.

PRDX6
Also flagged:ADamyloid-βtauendothelial dysfunctionAPP
Journal Article 2025-09-01 ✓ 1 Snippet Prabhu SS, Burrage EN, Coblentz T, Ball S, Thapa D, Simpkins JW, DeVallance E, Kelley EE, Chantler PD.
In-Text Gene Mentions

Prdx6

Show Full Abstract

BackgroundThis study uses the Unpredictable Chronic Mild Stress (UCMS) model to investigate the effects of mid-life stress (MLS) on vascular and neurobiological changes in triple transgenic Alzheimer's disease mice (3xTg-AD) during critical developmental stages.ObjectiveTo investigate how mid-life stress (MLS) affects cerebrovascular function and AD progression. We hypothesize that chronic stress in 3xTg-AD mice will accelerate cerebrovascular dysfunction and, subsequently, the associated AD pathology.MethodsWild-type (WT) and 3xTg-AD mice were subjected to UCMS for 8 weeks at 4 months of age, with physiological, vascular, and molecular outcomes assessed at 6 and 9 months of age. We evaluated cerebrovascular function in the middle cerebral artery (MCA) and measured the expression of key mRNA and protein alterations associated with amyloid-β (Aβ) and tau pathology, which drive AD progression.ResultsBoth WT and 3xTg-AD mice exposed to UCMS had significant MCA endothelial dysfunction. Additionally, UCMS accelerated the expression of key AD-related genes, and we observed increased oxidative stress, characterized by higher pro-oxidants and lower antioxidants. Elevated APP and BACE protein levels further suggest that MLS accelerated AD progression.ConclusionsThis study highlights the harmful effects of MLS on cerebrovascular health and the neurobiological mechanisms underlying AD progression. Our findings emphasize the critical link between chronic stress, oxidative dysfunction, and the acceleration of AD progression, offering important insights into potential therapeutic targets for alleviating the impacts of mid-life environmental stressors on AD development.

Also flagged:NOTCH2JAG1Alagille SyndromeALGSJagged1neonatal cholestasis
Journal Article 2025-09-01 No Snippets Vandriel SM, Li LT, She H, Wang JS, Loomes KM, Piccoli DA, Jankowska I, Czubkowski P, Gliwicz-Miedzińska D, D'Antiga L, Nicastro E, Lacaille F, Debray D, Sokal ÉM, Demaret T, Fawaz RL, Nastasio S, Kim KM, Oh SH, Fischler B, Arnell H, Larson-Nath C, Hardikar W, Shankar S, Sundaram SS, Chaidez A, Bulut P, Calvo PL, Kasahara M, Blondet N, Lurz E, Kavallar AM, Gonzales EM, Jacquemin E, Bouligand J, Ebel NH, Feinstein JA, Siew SM, Stormon MO, Karpen SJ, Romero R, Jensen MK, Jaramillo C, Squires JE, Bedoyan SM, Kelly DA, Hartley J, Verkade HJ, Lee WS, Lertudomphonwanit C, Fischer RT, Lin HC, Rock N, Mozer-Glassberg Y, Roberts AJ, Evans HM, Karnsakul W, Nebbia G, Wolters VM, Valentino PL, Bernabeu JQ, Aqul AA, Arikan C, Tamara ML, Busoms CM, Sandahl TD, Indolfi G, Zizzo AN, Zellos A, Quiros-Tejeira RE, Santos-Silva E, Schwarz KB, Brecelj J, Sanchez MC, Cavalieri ML, Tzivinikos C, Wiecek S, Eshun J, Kerkar N, Mujawar Q, Önal Z, Gonçalves C, Garcia J, Alam S, Jimenez-Rivera C, Bujanda L, Thompson RJ, Hansen BE, Spinner NB, Gilbert MA, Kamath BM, Global ALagille Alliance (GALA) Study Group.
Show Full Abstract

<h4>Background & aims</h4>Alagille syndrome (ALGS) is a rare, autosomal dominant disorder with high phenotypic heterogeneity. Disease-causing variants are primarily identified in Jagged1 (JAG1), with fewer reported in NOTCH2. JAG1 variants cause disease through a mechanism of haploinsufficiency, but the mechanism for NOTCH2 variants is not completely understood, making classification of variants more challenging. Using a large, international patient cohort acquired through the Global ALagille Alliance (GALA) study, we sought to improve classification of NOTCH2 variants and study phenotypic differences between NOTCH2- and JAG1-related disease.<h4>Methods</h4>Clinical and molecular data from 952 individuals with ALGS in GALA were analysed and disease features compared between those with JAG1 (n = 902) and NOTCH2 (n = 34) variants. Previously reported and newly identified NOTCH2 variants were reinterpreted based on disease-specific modifications to the American College of Medical Genetics and Genomics (ACMG) guidelines. The Kaplan-Meier method was utilised to assess native liver survival (NLS) and overall survival (OS) and gene comparisons were made with the log-rank test.<h4>Results</h4>Thirty NOTCH2 variants, including 18 novel variants, were identified and classified in our GALA cohort. Phenotypic analyses revealed a significantly lower incidence of characteristic facies, posterior embryotoxon, cardiac involvement and butterfly vertebrae in individuals with NOTCH2 variants compared to those with JAG1 variants (p < 0.001). No differences were identified in NLS or OS. Review of 61 previously reported NOTCH2 variants resulted in the re-classification of 19 likely pathogenic or pathogenic to VOUS (31.1%) with less than half retaining their originally published classification (34.4%; n = 21).<h4>Conclusions</h4>We report on a large global study on NOTCH2 genetics and phenotype, which increases the number of reported NOTCH2 variants by 30%. All variants were reclassified using current guidelines, and comparison of the JAG1 and NOTCH2 cohorts demonstrates clear phenotypic divergence between these groups. These data suggest that reliance on classical clinical phenotyping may miss patients with NOTCH2-related disease and supports an inclusive approach to genetic testing.

HTT
Also flagged:Huntingtinneurodegenerative diseaseHDnucleusorganelleheterochromatin
Journal Article 2025-09-01 ✓ 5 Snippets Barron JC, Coady ST, Fleming AC, Carew SJ, Taylor MCA, Hurley EP, Nafar F, Parsons MP.
In-Text Gene Mentions

…the huntingtin (HTT) gene.…

…huntingtin gene (HTT) causes Huntington’s…

…VariousHTT-lowering therapeutics have en…

…of both mutantHTT(mHTT) and wild-type…

…(mHTT) and wild-typeHTT(wtHTT) [ 1…

Show Full Abstract

Huntington's disease (HD), a fatal neurodegenerative disease, arises due to a CAG repeat expansion in the huntingtin (HTT) gene. Non-pathogenic wild type HTT (wtHTT) is essential for neurodevelopment as well as many vital cellular functions within the adult brain; however, the consequences of wtHTT reduction in adulthood and particularly in extrastriatal regions of the brain have not been well characterized. Understanding the implications of wtHTT loss is essential as numerous genetic therapies for HD non-specifically reduce the expression levels of both mutant and wtHTT. The aim of the current study was to characterize the effect of wtHTT reduction from the whole cell to synaptic level in primary hippocampal neurons using conventional and super-resolution imaging methods. Our results identified the nucleus as an organelle that is particularly vulnerable to wtHTT reduction, with hippocampal neurons exhibiting increased nuclear size relative to the soma, DNA decompaction and a progressive loss of heterochromatin, and biphasic changes in nuclear pCREB signaling following siRNA-mediated wtHTT knockdown. Other structural assessments including dendritic complexity, spine density and synaptic morphology appeared to be largely unaffected in our wtHTT-lowered cells. These findings highlight the nucleus as an organelle that may be particularly sensitive to huntingtin-lowering in the mammalian brain.

SERPINC1
Also flagged:metabolismhomocysteinevenous thrombosisliver failuremethioninecoagulation
Journal Article 2025-09-01 ✓ 1 Snippet Lee HO, Qai CQ, Slifker MJ, Kruger WD.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

Cystathionine beta-synthase (CBS) deficiency is an inborn error of metabolism that results in a large increase in plasma total homocysteine (tHcy) and a significant risk of venous thrombosis. Although a mouse model of CBS deficiency (Tg-I278T Cbs<sup>-/-</sup>) has several phenotypes in common with human patients, it has not been shown to have elevated thrombosis risk. Here, we describe a novel phenotype in which 40% of Tg-I278T Cbs<sup>-/-</sup> mice die of liver failure due to hepatic vein thrombosis shortly after being shifted from a low methionine diet (LMD) to a regular diet (RD). Importantly, no deaths or thromboses occur if the mice are continuously maintained on RD or LMD for extended periods of time. RNAseq analysis of the livers of Tg-I278T Cbs<sup>-/-</sup> mice that were shifted to RD for 3 days after spending 1 week on LMD (RD3D) shows significant differences in many transcripts involved in coagulation and fibrinolysis, key processes involved in thrombosis. Interestingly, the liver gene expression profile and serum amino acid profiles of both Tg-I278T Cbs<sup>-/-</sup> and Tg-I278T Cbs<sup>+/-</sup> mice maintained continuously on RD are also significantly different from RD3D mice. Since the only difference between RD and RD3D mice is their previous exposure to an LMD diet, this shows that the liver transcriptional profile is affected not only by the current diet but also by the animals' previous dietary history. Overall, our findings indicate that there is a strong gene-diet interaction between the Cbs genotype and dietary methionine and that this interaction may help explain the thrombosis phenotype in human CBS deficient patients.

Also flagged:T-cell acute lymphoblastic leukemiaNOTCH1ALLBlood Cancer
Journal Article 2025-09-01 No Snippets de Smith AJ.
Show Full Abstract

In this issue of Blood Cancer Discovery, Newman and colleagues investigated the impact of genetic ancestry on molecular subtypes, genomic alterations, and survival outcomes in a diverse cohort of patients with T-cell acute lymphoblastic leukemia. They demonstrated that the prognostic utility of genomic alterations varied by ancestry, in particular, with NOTCH1 mutations having no prognostic utility in patients of predominantly African ancestry, and their findings highlight the importance of considering genetic ancestry in the risk stratification of patients with T-ALL. See related article by Newman et al., p. 412.

Also flagged:protein kinaseripretinibwateracetic acidformic acidacetonitrile
Journal Article 2025-09-01 No Snippets Rakotovao C, Sharanek A, Burban A, Gueroue P, Bouchet S, Bouguéon G, Ducint D, Molimard M, Italiano A, Djabarouti S, Guyon J.
Show Full Abstract

Therapeutic drug monitoring of protein kinase inhibitors is widely practiced worldwide. Based on the example of ripretinib dosage requested by a clinician, we detailed the process of method development, using a literature-based approach while ensuring the sustainability of the method to be as environmentally friendly as possible. Therefore, a UPLC-MS/MS method for ripretinib and its active metabolite was optimized and validated using the corresponding stable isotopic internal standards in human plasma. The procedure employed a mobile phase mixture of water with 1% acetic acid and 0.1% formic acid, and acetonitrile. Positive electrospray ionization was performed, coupling with multiple reaction monitoring of m/z 510.4 → 417.4 and 510.4 → 389.4 for ripretinib, and 496.3 → 403.3 and 496.3 → 375.3 for N-desmethyl-ripretinib. The method was successfully validated according to the current version of the ICH Guideline provided by the EMA. The greenness assessment score of this procedure was better than previously published approaches using the AGREE metric. The validated UPLC-MS/MS method successfully monitored ripretinib and its metabolite concentrations in clinical and preclinical models.

NEGR1
Also flagged:Depressionneuropsychiatric disorderphysical illnessescardiovascular diseasestrokepsychiatric disorders
Journal Article 2025-09-01 ✓ 2 Snippets Hulwi E, Wang Q, Francis A, Verma AK, Dwivedi Y.
In-Text Gene Mentions

…genes, such asNEGR1( P =…

…(TENM4, KSR2, andNEGR1).…

Show Full Abstract

<h4>Background</h4>Mitochondria play a pivotal role in energy production, and their dysfunction not only hampers cells' ability to meet energy requirements but also contributes to the impairment of neural plasticity, a critical feature of depressive disorders. In this study, mitochondrial cross-omics analysis was carried out in the hippocampus of restraint rats to understand the role of mitochondria in depression pathophysiology.<h4>Methods</h4>The expression profiles of hippocampal mitochondrial and nuclear-encoded genes in mitochondrial fractions from restraint and handled control rats were obtained using high-throughput RNA sequencing. Weighted gene co-expression network analysis (WGCNA) was used to identify the gene co-expression and pathways associated with the restraint phenotype. Mutual Information Network algorithm tools Arance, CLR, and MRNET were additionally used to screen the functional modules and hub genes and their similarity with the WGCNA-based network analysis. Finally, cross-species homology followed by gene association analysis was conducted to obtain SNPs and haplotypes related to depression phenotype.<h4>Results</h4>A significant proportion of mitochondrial and nuclear-encoded genes showed differential regulation in the hippocampus of restraint rats. WGCNA and Mutual Information Network analysis yielded distinct functional modules significantly related to restraint phenotype. Further network analysis revealed distinct co-expression patterns associated with differentially expressed genes associated with these modules. Cross-species analysis showed 39 significantly associated SNPs with the depression phenotype, where the most significant SNP, rs10899570, was located within the TENM4 gene. Further, rs1573529 and rs10899570 were distributed into the linkage disequilibrium block where SNPs were highly correlated. Subsequent haplotype analysis showed that rs1573529 and rs10899570 were significantly associated with depressive behavior.<h4>Conclusions</h4>The study demonstrates a significant impact of restraint stress on mitochondrial functions and genetic association, suggesting their critical role in depression pathophysiology.

DNAJC1
Also flagged:gene expressiontumorNpyHPClimb developmentlimb morphogenesis
Journal Article 2025-09-01 ✓ 1 Snippet Wang Z, Xu K, Liu Y, Xu Y, Zhang L.
In-Text Gene Mentions

…al. 2017 ),DNAJC1( Zoppino et…

Show Full Abstract

<h4>Motivation</h4>The advent of spatially resolved transcriptomics (SRT) has revolutionized our understanding of tissue molecular microenvironments by enabling the study of gene expression in its spatial context. However, many SRT platforms lack single-cell resolution, necessitating cell-type deconvolution methods to estimate cell-type proportions in SRT spots. Despite advancements in existing tools, these methods have not addressed biases occurring at three scales: individual spots, entire tissue samples, and discrepancies between SRT and reference scRNA-seq datasets. These biases result in overbalanced cell-type proportions for each spot, mismatched cell-type fractions at the sample level, and data distribution shifts across platforms.<h4>Results</h4>To mitigate these biases, we introduce HarmoDecon, a novel semi-supervised deep learning model for spatial cell-type deconvolution. HarmoDecon leverages pseudo-spots derived from scRNA-seq data and uses Gaussian Mixture Graph Convolutional Networks to address the aforementioned issues. Through extensive simulations on multi-cell spots from STARmap and osmFISH, HarmoDecon outperformed 11 state-of-the-art methods. Additionally, when applied to legacy SRT platforms and 10x Visium datasets, HarmoDecon achieved the highest accuracy in spatial domain clustering and maintained strong correlations between cancer marker genes and cancer cells in human breast cancer samples. These results highlight the utility of HarmoDecon in advancing spatial transcriptomics analysis.<h4>Availability and implementation</h4>The HarmoDecon scripts, with the detailed tutorials, are available at https://github.com/ericcombiolab/HarmoDecon/tree/main.

CACNA1E
Also flagged:Methylationhyperglycemiagene expressiondiabetesGestational diabetes mellitusmaternal hyperglycemia
Journal Article 2025-09-01 ✓ 5 Snippets Assaf J, Khurana I, Abou Zaki R, Tam CHT, Correa I, Maxwell S, Kinnberg J, Christiansen M, Frørup C, Lee HM, Kaipananickal H, Okabe J, Marikar SN, Wong KK, Lim CKP, Yuen LY, Yang X, Wang CC, Chan JCN, Yip KYL, Lowe WL, Tam WH, Ma RCW, El-Osta A, El-Osta A.
In-Text Gene Mentions

…Specifically,CACNA1E, AGBL4 ,…

…KATNAL1 , andCACNA1E.…

…methylation of theCACNA1Egene was elevated…

…, TAF4B ,CACNA1E, FRAS1 ,…

…TheCACNA1Egene encodes the…

Show Full Abstract

<h4>Article highlights</h4>Maternal hyperglycemia is linked to 19 cord blood DNA methylation biomarkers that predict offspring metabolic dysfunction. These methylation changes, associated with maternal glycemic status, improved the prediction of β-cell dysfunction at 7, 11, and 18 years of age compared with clinical factors alone. Validation in human β-cells and pancreatic ductal epithelial cells confirmed that hyperglycemia influences methylation-dependent gene expression. These findings highlight the role of epigenetic modifications at birth as early indicators of diabetes risk, suggesting that in utero hyperglycemic exposure may mediate long-term metabolic outcomes in offspring.

PRDX6
Also flagged:Keap1DeathGpx4oxygenglutathione peroxidase 4lipid
Journal Article 2025-09-01 ✓ 3 Snippets Colyn L, Grube J, Wang C, Dietrich J, Kühnel M, Reinders J, Edlund K, Jonigk D, Gaßler N, Hengstler J, Trautwein C.
In-Text Gene Mentions

…, Pgd ,Prdx6, and Txn…

…Notably,Prdx6, which shares…

…the activity ofPRDX6[ 24 ].…

Show Full Abstract

<h4>Background & aims</h4>Acute liver failure (ALF) is a life-threatening condition with limited treatment options beyond liver transplantation in non-acetaminophen cases. The extensive loss of liver function results from severe hepatocyte death, where elevated reactive oxygen species (ROS) play a significant role. Nuclear factor erythroid-2 like 2 (Nrf2) is crucial in ROS defence by regulating genes like glutathione peroxidase 4 (GPX4), which prevents lipid peroxidation (LPO). GPX4 is involved in several regulated cell processes, including apoptosis and ferroptosis.<h4>Methods</h4>GPX4 expression was measured in liver samples from healthy, ALF, and acute-on-chronic liver failure (ACLF) patients. To investigate GPX4's role, mice with hepatocyte-specific deletion of Gpx4 (Gpx4<sup>Δhepa</sup>) and both Gpx4 and the Nrf2 repressor, Keap1, (Gpx4<sup>Δhepa</sup>Keap1<sup>Δhepa</sup>) were generated. ALF was induced in mice using carbon tetrachloride (CCl<sub>4</sub>) and bile duct ligation (BDL) cholestasis models, each lasting 48 h.<h4>Results</h4>ALF patients exhibited reduced GPX4 levels compared to healthy individuals and ACLF patients, consistent with observations in CCl<sub>4</sub>-treated wild-type mice. ALF-induced Gpx4<sup>Δhepa</sup> mice exhibited increased hepatocyte death and liver dysfunction upon CCl<sub>4</sub>, with increased apoptosis despite no changes in LPO markers. Activation of Nrf2 in Gpx4<sup>Δhepa</sup>Keap1<sup>Δhepa</sup> mice reversed CCl<sub>4</sub>-induced damage, reducing necrosis and apoptosis markers while inducing anti-apoptotic BCL2.<h4>Conclusion</h4>Our results demonstrate that Gpx4 plays a critical role in ALF as its absence exacerbates apoptosis. Activating Keap1-dependent pathways targeting antioxidant defence systems and upregulating BCL2 provides substantial protection against ALF in mice lacking Gpx4 in hepatocytes. Our findings suggest that the Keap1-Nrf2 axis is a promising therapeutic target in ALF.

Also flagged:behavioralnucleusestradiolglucocorticoidsciliumorganization
Journal Article 2025-09-01 No Snippets Milewski TM, Streifer M, Thompson LM, Sheinhaus D, Hynes A, Gore AC.
Show Full Abstract

Endocrine-disrupting chemicals (EDCs) are exogenous chemicals that are ubiquitous in our environment and found in everyday items. We previously reported that prenatal exposure of rats to a human-relevant mixture of EDCs, NeuroMix (NMX), led to alterations in physiological and behavioral phenotypes. Here, we used hypothalamic-pituitary-gonadal (HPG) tissues from these same male and female rats and conducted 3' Tag-based RNA sequencing (TagSeq) to investigate underlying molecular mechanisms. TagSeq revealed unique tissue- and sex-specific differentially expressed genes (DEGs). In males, among the HPG tissues, NMX had the greatest effects in the hypothalamic arcuate nucleus (ARC), with 613 DEGs. Gene ontology (GO) enrichment analysis revealed that genes upregulated in the ARC of NMX males were involved in synaptic plasticity, while genes downregulated related to responses to estradiol and glucocorticoids. In females, prenatal NMX exposure induced the largest transcriptome change in the ovaries, with 1295 DEGs. GO-enrichment analysis revealed upregulation of genes involved in cilium organization and movement, while genes downregulated in this region were related to immune-related processes. Using Qiagen Ingenuity Pathway Analysis, we identified the β-estradiol pathway to be activated in all NMX female tissues and the NMX male pituitary, and inhibited in NMX male ARC, ventromedial nucleus, and testes. To our knowledge, this is one of the first studies to conduct transcriptomic profiling across HPG tissues, with these results demonstrating that prenatal exposure to NMX affects gene expression across the HPG axis in a sex-dependent manner.

Also flagged:nitric oxideprostaglandinsthromboxanesendothelinsLung cancercancer
Journal Article 2025-09-01 No Snippets Demirel S, Sinag IN.
Show Full Abstract

Lung cancer is the most frequent cause of cancer-related mortality worldwide. Nitric oxide (NO), prostaglandins (PGs), thromboxanes (TXs), and endothelins (ETs) participate in numerous physiological processes. These agents play an important role in lung carcinogenesis by regulating cancer cell proliferation, apoptosis, invasion, and angiogenesis. NO is a gaseous free radical with tumoricidal and tumorigenic activities in lung cancer. Arachidonic acid-derived PGs, including PGD<sub>2</sub>, PGE<sub>2</sub>, 8-iso-PGF<sub>2α</sub>, and PGI<sub>2</sub>, are related to the development of lung cancer. PGD<sub>2</sub> and PGI<sub>2</sub> act as tumor suppressors, while PGE<sub>2</sub> and 8-iso-PGF<sub>2α</sub> promote tumor progression. TXA<sub>2</sub> catalyzed by cyclooxygenase induces proliferation as well as angiogenesis. Elevated levels of TXB<sub>2</sub>, an inactive metabolite of TXA<sub>2</sub>, are positively correlated with lung carcinoma stages. ET-1 and ET-2 are 21 amino acid polypeptides; their silencing hinders lung cancer cell proliferation and invasion. ET-2 depletion also triggers apoptotic death. This chapter review aims to provide a comprehensive overview of the role of NO, PGs, TXs, and ETs in lung cancer.

Also flagged:pancreatic fistulaextracellularpostoperative pancreatic fistulaPancreaticheart diseaseliver fibrosis
Journal Article 2025-09-01 No Snippets Nakamura A, Ogawa T, Tanaka K, Takahashi Y, Murai S, Tashiro Y, Wada A, Ueda Y, Sasaki Y, Minegishi Y, Matsuo K, Yamochi T.
Show Full Abstract

<h4>Background</h4>Pancreatic fibrosis, which decreases risk of postoperative pancreatic fistula (POPF), can be estimated using extracellular volume fraction (ECVf).<h4>Aim</h4>To investigate the correlation between ECVf and pancreatic histology, as well as the usefulness of ECVf in predicting POPF.<h4>Methods</h4>In 71 patients who underwent pancreatic resection, we caluculated pancreatic ECVf by comparing absolute enhancements of the pancreas and aorta between pre-contrast and equilibrium phases. Areas of fibrosis, fat, acini, and islets were calculated based on resection specimens.<h4>Results</h4>ECVf correlated with fibrosis (<i>r</i> = 0.724; <i>P</i> < 0.001) and negatively correlated with acini (<i>r</i> = -0.510; <i>P</i> < 0.001). Among 48 patients who underwent pancreatoduodenectomy, 21 developed POPF. Main pancreatic duct diameter ≤ 2 mm and ECVf < 36% were selected as risk factors by multivariate analysis [respective odds ratios (OR) and <i>P</i> values, 4.26 and <i>P</i> = 0.048; OR = 11.07 and <i>P</i> = 0.036]. Using these factors as a risk score (0-2 points), POPF occurred in 0%, 50%, and 70% of patients with 0, 1, and 2 points, respectively.<h4>Conclusion</h4>ECVf is useful in predicting acinar loss and pancreatic fibrosis, and ECVf < 36% may be a risk factor for POPF.

KLHL20
Also flagged:TumorGene ExpressionFASLGbindingFascancer
Journal Article 2025-09-01 ✓ 5 Snippets Fletcher EA, Dabkowski TR, Varkhedi M, Blanck G.
In-Text Gene Mentions

…PIGC, SUCO, andKLHL20.…

…of FASLG, andKLHL20is telomeric of…

…PIGC, SUCO, andKLHL20( Figure 4…

…R-value=0.182, p< 0.00001;KLHL20CGCI-BLGSP: R-value=0.529, p<…

…R-value=0.529, p< 0.0001;KLHL20TCGA-BRCA: R-value=0.133, p=…

Show Full Abstract

<h4>Background/aim</h4>Typically expressed on T-cells and NK cells, FASLG induces apoptosis in target cells upon binding Fas. However, assessing potential FASLG expression in tumor cells with convenient genomics approaches has been challenging.<h4>Materials and methods</h4>This study applied a novel assessment of FASLG copy numbers (CNs) and gene expression levels, applicable to bulk exome and RNAseq files.<h4>Results</h4>Analyses indicated high FASLG CN associated with worse survival outcomes. Interestingly, higher FASLG gene expression was found to be associated with better survival outcomes, which led to a determination of whether this result was due to FASLG expression from tumor-infiltrating lymphocytes (TILs) instead of cancer cells demonstrating the higher CNs. In fact, T-cell markers CD4 and CD8A highly correlated with FASLG expression, consistent with the hypothesis that the high FASLG expression was associated with the TILs. Subsequent analyses confirmed that CN increases led to increased gene expression in the genomic region of the FASLG gene, particularly with an assessment of the expression of the neighboring PRRC2C gene. In sum, FASLG CN assessments, even independently of a corresponding gene expression correlation, may provide important characterizations of tumor cells.<h4>Conclusion</h4>This study indicates that FASLG CN increases could represent a mechanism of tumor escape from TILs and a prognostic indicator; and tumor FASLG may be a suitable drug target for reducing tumor evasion of T-cells.

Also flagged:Clear Cell Renal Cell CarcinomaccRCCcancersABCD3peroxisomal long-chain fatty acid transportercolon cancers
Journal Article 2025-09-01 No Snippets Heyliger S, Turley TN, Roach T, Saulsbury MD, Taka E, Reynolds JP, Copland JA, Kase AM, Reams RR.
Show Full Abstract

<h4>Background/aim</h4>Clear cell renal cell carcinoma (ccRCC) is among the 10 most common cancers diagnosed in the United States. Despite its severity and aggressive nature, biomarkers that can serve as prognostic and predictive factors for ccRCC are lacking. ABCD3, a peroxisomal long-chain fatty acid transporter, has been shown to serve as a prognostic factor in both prostate and colon cancers. Thus, this study aimed to ascertain if ABCD3, which is highly expressed in kidney tissues, may also serve as a biomarker for renal cancer.<h4>Materials and methods</h4>Bioinformatics and immunohistochemical staining were employed to systematically investigate the relationship between the ABCD3 gene and protein expression, the immune microenvironment, and survival outcomes in ccRCC. We extensively harnessed data from publicly available databases, including The Cancer Genome Atlas (TGCA), UALCAN, Gene Set Cancer Analysis, UCSC Xena, and various other databases.<h4>Results</h4><i>In silico</i> analyses of the TCGA database revealed that ABCD3 transcripts and protein levels were significantly reduced (<i>p</i><0.001) across all tumors and stages. Moreover, decreased ABCD3 expression was associated with poorer patient survival [hazard ratio=0.45 (0.33-0.61), <i>p</i><0.001]. Immunohistochemical and CPTAC database analyses revealed that ABCD3 was significantly downregulated in ccRCC patients (<i>p</i><0.05). Multivariate Cox regression analysis revealed that ABCD3 expression is an independent factor for overall survival [HR=0.4534 (0.2859-0.7189), <i>p</i><0.001].<h4>Conclusion</h4>Our findings suggest that ABCD3 is a novel biomarker for ccRCC and that the downregulation of ABCD3 expression, and other members of the peroxisomal VLCFA oxidation pathway may represent a unique molecular feature of ccRCC.

Also flagged:gene expressionsex chromosomeschromosomalchromosomeSrychromosomes
Journal Article 2025-09-01 No Snippets Heitzmann LD, Saunders PA, Perez J, Boursot P, Veyrunes F.
Show Full Abstract

Sex chromosomes are expected to play a role in shaping the transcriptional architecture of sexual dimorphism, through the direct expression of sex-linked genes, by regulating autosomal genes, or in interactions with hormones. Yet, their degree of involvement remains elusive partly because chromosomal sex (e.g. XX/XY) and gonadal sex (ovaries or testes) are usually inextricably intertwined. They are, however, dissociated in the African pygmy mouse, Mus minutoides, in which a feminizing X (X*) has evolved, resulting in three female genotypes (XX, XX*, and X*Y) and one male genotype (XY). Furthermore, all sex chromosomes are fused to autosomes (neo-sex chromosomes: neo-X, neo-X* and neo-Y). Despite complete sex reversal, X*Y females show distinctive phenotypes with greater fertility, divergent maternal care strategies, and the masculinization of some traits (e.g. enhanced aggressiveness). By comparing the brain transcriptome of the four sexual genotypes, we show that differential gene expression is mainly linked to gonadal sex but also, and significantly, to chromosomal sex. Genes influenced by chromosomal sex are overrepresented on sex-linked genomic regions, and some are strong candidates to explain X*Y-specific behavioral and reproductive traits. Our results also suggest the preferential inactivation of the X* chromosome in XX* females, only in the brain, which could explain their trait similarities with XX females. Overall, we show that sex and neo-sex chromosomes have profoundly impacted the brain transcriptome in ways that reflect their new transmission modes, evolutionary trajectories, and resulting genomic conflicts.

CCPG1
Also flagged:LAPTM4Bcopperendoplasmic reticulumlysosomeslysosomebaicalin
Journal Article 2025-09-01 ✓ 1 Snippet Shang H, Dai X, Chen J, Xing C, Gao X, Cao H, Hu G, Li H, Hu M, Yang F.
In-Text Gene Mentions

…genes ( FAM134B,CCPG1, TEX264, LC3A, LC3B,…

Show Full Abstract

<h4>Background</h4>Copper (Cu) is a pervasive environmental pollutant with significant hepatotoxic effects in animals. The endoplasmic reticulum (ER) interacts closely with lysosomes to maintain intracellular homeostasis. However, the role and mechanism of ER-lysosome crosstalk in Cu-induced liver injury in ducks remains unclear. To investigate this, we established both an in vivo model of Cu-exposed ducks and an in vitro model of duck hepatocytes, and added baicalin (Ba) to further explore its protective effects.<h4>Results</h4>The results of this study demonstrated that exposure to Cu resulted in vacuolar degeneration and oxidative stress in duck hepatocytes, while ultrastructural observations revealed ER swelling and an increased number of autophagic lysosomes. Furthermore, Cu exposure significantly upregulated mRNA and protein levels related to ER stress, autophagy, and lysosomal membrane factors. It also markedly increased ER-lysosomal co-localization. Further experiments showed that knockdown of LAPTM4B significantly attenuated Cu-induced ER autophagy and reduced ER-lysosomal co-localization in hepatocytes. Molecular docking and molecular dynamics simulations confirmed that LAPTM4B has a stable binding site to Ba; in vitro experiments demonstrated that Ba could effectively alleviate Cu-induced ER-lysosome crosstalk in duck hepatocytes and reduce hepatocyte injury by targeting LAPTM4B; additionally, in vivo experiments showed that Ba significantly inhibits Cu-induced liver injury in ducks.<h4>Conclusions</h4>In summary, the present study demonstrates that Cu exposure disrupts ER-lysosomal crosstalk in duck liver, leading to ER-lysosomal damage and subsequent hepatocyte injury. In contrast, Ba alleviates this injury by selectively targeting LAPTM4B, ultimately attenuating Cu-induced hepatotoxicity.

Also flagged:Mitochondriaadenosine triphosphatemitochondriallocalizationoxygenorganelles
Journal Article 2025-09-01 No Snippets Li W, Gui Y, Guo C, Huang Y, Liu Y, Yu X, Zhang H, Wang J, Liu R, Mahaman YAR, Duan Q, Wang X.
Show Full Abstract

Mitochondria produce adenosine triphosphate (ATP), the main source of cellular energy. To maintain normal function, cells rely on a complex mitochondrial quality control (MQC) system that regulates mitochondrial homeostasis, including mitochondrial dynamics, mitochondrial dynamic localization, mitochondrial biogenesis, clearance of damaged mitochondria, oxygen radical scavenging, and mitochondrial protein quality control. The MQC system also involves coordination of other organelles, such as the endoplasmic reticulum, lysosomes, and peroxisomes. In this review, we discuss various ways by which the MQC system maintains mitochondrial homeostasis, highlight the relationships between these pathways, and characterize the life cycle of individual mitochondria under the MQC system.

Also flagged:CLN3 Diseaseneuronal ceroid lipofuscinosesneurodegenerative disordersCLN3subunit cmitochondrial ATP synthase
Journal Article 2025-09-01 No Snippets Simeon P, Venkatesan R, Hao X, Carmona AV, Daria S, Alnouti Y, Trippier PC.
Show Full Abstract

The neuronal ceroid lipofuscinoses (NCLs) are rare and fatal autosomal pediatric neurodegenerative disorders. The most prevalent subtype, CLN3, arises from a mutation in the CLN3 gene. Common phenotypic hallmarks include lipofuscin and subunit c of mitochondrial ATP synthase accumulation, mitochondrial dysfunction, and reduced Bcl-2 expression, however the underlying pathophysiology is not well understood. No effective treatment option exists. Herein, we report the synthesis and characterization of bicyclic analogues of the bioisosteric non-opioid analgesics Flupirtine and Retigabine, previously shown to exhibit neuroprotective effects. These analogues were strategically modified to prevent formation of toxic reactive diamine/diimine intermediates characteristic of the parent compounds. Novel 1<i>H</i>-benzo[<i>d</i>]imidazoles that do not incur this metabolic liability are reported that possess enhanced protective effects in a highly phenotypic CLN3 patient-derived induced pluripotent stem cell (iPSC) model. Selected lead compounds <b>9b</b> and <b>38b</b> afforded significant protective effect and reduced phenotypic hallmarks of CLN3 pathology while also possessing "drug-like" pharmacokinetics.

Also flagged:intraventricular hemorrhagebronchopulmonary dysplasianecrotizing enterocolitisductus arteriosusretinopathy of prematuritygestation
Journal Article 2025-09-01 No Snippets Bitar E, Lalitha R, Hicks M, Surak A, Hyderi A, Pepper D, Cheung PY, Kumaran K.
Show Full Abstract

ObjectivesTo validate Vasoactive-Ventilation-Renal (VVR) score in extremely low gestational age neonates (ELGANs) as a predictor of mortality and morbidity by assessing its association with clinical outcomes.Study DesignThis was a secondary analysis of data from a randomized controlled trial including neonates born 23<sup>0</sup>-28<sup>6</sup> weeks' gestation admitted to a Canadian tertiary-level neonatal intensive care unit between February 2019 and December 2021. VVR scores were measured at set intervals. Outcomes included mortality, intraventricular hemorrhage (IVH), bronchopulmonary dysplasia (BPD), necrotizing enterocolitis, patent ductus arteriosus, retinopathy of prematurity, mechanical ventilation duration, and length of hospital stay. Multivariate logistic regression analysis and receiver operating characteristic (ROC) curves were used to determine the association between VVR scores and clinical outcomes.ResultsData from 132 neonates were analyzed. The mean (SD) gestational age was 26.5 (1.5) weeks, and the mean (SD) birth weight was 933 (243) grams. A VVR score >48 was significantly associated with severe IVH (AOR: 5.8, 95% CI: 1.2-28.9, <i>p</i> = 0.03), BPD (AOR: 8.8, 95% CI: 1.1-72.4, <i>p</i> = 0.044), prolonged mechanical ventilation (>71 days) (AOR: 6.86, 95% CI: 1.6-30, <i>p</i> = 0.01), and extended hospital stay (>150 days) (AOR: 6.19, 95% CI: 1.4-26.4, <i>p</i> = 0.01). No significant associations were observed with mortality or other outcomes. ROC curves analysis demonstrated good predictive performance of VVR score at 7 days for these adverse outcomes.ConclusionThe VVR score at 7 days is a reliable predictor of significant adverse outcomes, including severe IVH and BPD, in ELGANs. Further studies in larger, diverse populations are warranted to confirm these findings.

Also flagged:Multiple myelomaPRC2NF-ĸBPolycomb Repressive Complex 2histone methyltransferasetumor
Journal Article 2025-09-01 No Snippets Deka K, Carter JM, Bahai A, Ang DA, Sim N, Chong HY, Lee GHB, Tan SM, Chng WJ, Kappei D, Li Y.
Show Full Abstract

Multiple myeloma (MM) is the second most common hematological malignancy that displays diverse genetic heterogeneity leading to treatment resistance. Recurrent mutations causing hyperactivation of the non-canonical NF-ĸB pathway are highly prevalent in relapsed, refractory MM patients, but the precise mechanisms driving chemoresistance are poorly understood. Here, we identify a long non-coding RNA termed PLUM, that is overexpressed in NF-ĸB mutant high-risk MM subtypes and patients who are refractory to VRd treatment regimen. Mechanistically, PLUM interacts with Polycomb Repressive Complex 2 to regulate its stability and histone methyltransferase activity, modulating the expression of tumor suppressor genes, FOXO3 and ZFP36, to activate the unfolded protein response (UPR). Importantly, disruption of PLUM-EZH2 interaction using steric antisense oligonucleotides re-sensitizes myeloma cells to drug treatment in vivo, correlating with the loss of PRC2 stability and H3K27 trimethylation activity. These findings indicate that PLUM facilitates formation of PRC2 complex and enhances EZH2 activity, modulating the myeloma epigenome to mediate chemoresistance. Hence, targeting PLUM-EZH2 interactions may represent a clinically potent strategy for the treatment of relapsed, refractory MM.

Also flagged:MAP3K13cisplatinpyroptosisbindingGastric cancerpathogenesis
Journal Article 2025-09-01 No Snippets Du K, Zhang X, Qin Y, Ma H, Bing C, Deng S, Chen Y, Qin J, Chang S, Xiao S, Peng L, Xie X, Feng X, Fu X, Wei Y, Fan X, Ashktorab H, Smoot D, Jin Z, Peng Y.
Show Full Abstract

Gastric cancer (GC) is one of the most common and lethal malignancies in developing countries, with particularly high prevalence in China. Circular RNAs (circRNAs) have garnered increasing attention for their roles in disease pathogenesis. While circRNAs can be translated, there have been few investigations into the biological functions of "translatable circRNAs" in the initiation and progression of gastric adenocarcinoma. In this study, we identified a circRNA, circMAP3K13, which inhibits the proliferation and migration of GC cells. CircMAP3K13 was found to encode a previously unreported 26 kDa protein, designated MAP3K13-232aa. Mechanistically, MAP3K13-232aa binds directly to the kinase domain of IKKα and enhances its activity, thereby promoting NF-κB signaling. This activation leads to upregulation of NLRP3 and increased cisplatin-induced pyroptosis in GC cells. Moreover, MAP3K13-232aa enhances pyroptosis and reduces tumorigenicity and metastasis in vivo. Taken together, both circMAP3K13 and its encoded protein MAP3K13-232aa represent potential therapeutic targets in GC.

Also flagged:amyloid betacognitive declineaginggene expressionsynapse
Journal Article 2025-09-01 No Snippets Wood JI, Dulewicz M, Szadziewska A, Weiner S, Ge J, Stringer K, Desai S, Fenson L, Piotrowska D, Brinkmalm G, Koutarapu S, Hajar HB, Blennow K, Zetterberg H, Cummings DM, Savas JN, Edwards FA, Hanrieder J.
Show Full Abstract

Understanding how amyloid beta (Aβ) plaques develop and lead to neurotoxicity in Alzheimer's disease remains a major challenge, particularly given the temporal delay and weak correlation between plaque deposition and cognitive decline. This study investigates how the evolving pathology of plaques affects the surrounding tissue, using a knock-in Aβ mouse model (App<sup>NL-F/NL-F</sup>). We combined mass spectrometry imaging with stable isotope labeling to timestamp Aβ plaques from the moment of their initial deposition, enabling us to track their aging spatially. By integrating spatial transcriptomics, we linked changes in gene expression to the age of the plaques, independent of the mice's chronological age or disease stage. Here we show that older plaques were associated with reduced expression of synaptic genes. Additionally, when correlated with structure-specific dyes, we show that plaque age positively correlated with structural maturation. These more compact and older plaques were linked to greater synapse loss and increased toxicity.

Also flagged:digestionstigmasterolestersfatty acidsterolstigmasterol esters
Journal Article 2025-09-01 No Snippets Rudzińska M, Grygier A, Olejnik A, Kowalska K, Igielska-Kalwat J, Kmiecik D, Cieślik-Boczula K.
Show Full Abstract

Conventional and PEGylated liposomes encapsulated with stigmasterol and its esters were prepared, and their stability and cytotoxicity during in vitro gastrointestinal digestion were determined. The release of stigmasterol and its oxidation products were analyzed using GC-FID. The cytotoxicity before and after digestion was assessed using human normal small intestinal HIEC-6 cells and colon mucosa CCD 841CoN cells. Both liposome PEGylation and the chemical structure of the encapsulated compounds affect the stability and cytotoxicity of the liposomes after gastrointestinal digestion. Esterification of stigmasterol had an effect on the encapsulation of stigmasterol in liposomes, especially PEGylated liposomes, but the level of fatty acid saturation had no significant influence. PEGylation of liposomes did not inhibit sterol oxidation, but in fact led to the formation of oxidation derivatives. Gastrointestinal digestion increased the cytotoxicity of liposomes with stigmasterol (L-St), but liposomes encapsulated with stigmasterol esters had lower cytotoxicity than did undigested liposomes. PEGylation of liposomes did not cause an increase in cytotoxicity to the small intestinal or colon mucosa cells. However, it should be highlighted that the cytotoxic effects of the digested PEGylated liposomes were considerable higher in colon CCD 841CoN cells than in small intestinal HIEC-6 cells.

SERPINC1
Also flagged:coagulationCOVID-19autoantibodyautoantibodiesCR1LELANE
Journal Article 2025-09-01 ✓ 5 Snippets Ambikan AT, Cederholm A, Rezene S, Aranda-Guillén M, Nordqvist H, Treutiger CJ, Lira-Junior R, Landegren N, Gupta S.
In-Text Gene Mentions

…V, Protein S,SERPINC1, Apo-H, PROC1, Prothrombin,…

…isms, including antithrombin (SERPINC1) and the protein…

…V, Protein S,SERPINC1, Apo-H, PROC1, and…

…V, Protein S,SERPINC1(antithrombin III), Apo-H…

…Protein C, andSERPINC1are linked to…

Show Full Abstract

Severe COVID-19 is characterized by immune-coagulation dysregulation, yet the contribution of related autoantibodies remains poorly understood. We investigated relationships between plasma autoantibody reactivities, whole-blood transcriptomics, plasma proteomics, and clinical laboratory parameters in a cohort of hospitalized COVID-19 patients. Transcriptomic analysis revealed that 42 curated coagulation and complement cascade genes were upregulated in severe cases compared to healthy controls, with 15 genes, including CR1L, ELANE, ITGA2B, ITGB3, VWF, TFPI, PROS1, MMRN1, and SELP (> 1.2 log2 fold-change), also significantly different from mild cases. Autoantibody profiling against eight coagulation-related proteins (ADAMTS13, Factor V, Protein S, SERPINC1, Apo-H, PROC1, Prothrombin, and PF4) showed reactivities below positivity thresholds across all groups. Using an exploratory approach, in severe cases, subthreshold autoantibody candidates (FDR < 0.25) showed negative correlation trends with select gene expressions and inflammatory markers (Factor V with IL-6 and CXCL10), suggesting potential disease-specific immunomodulatory associations. In contrast, while mild cases exhibited stronger gene-protein correlations, they showed limited associations with antigen reactivities or clinical laboratory parameters. Additionally, no correlations were observed between autoantibodies and platelet-counts or Fibrin-D-dimer levels. Age-associated increases in antigen reactivities were noted in severe disease, implying a role for immunosenescence. These findings support further investigation into the role of subthreshold autoantibody candidates in thromboinflammatory COVID-19 pathogenesis.

HTT
Also flagged:translationalbindingpalmitatelocalizationmembranesynaptic transmission
Journal Article 2025-09-01 ✓ 3 Snippets Shang J, Ding M, Zhou X.
In-Text Gene Mentions

…of wild-type huntingtin (HTT) protein, which acted…

…and distribution ofHTTare regulated by…

…activity to promoteHTTpalmitoylation.…

Show Full Abstract

S-palmitoylation, one reversible post-translational modification (PTM) involving the binding of palmitate to proteins, influences protein stability, localization and interactions. Through S-palmitoylation, proteins can be targeted to specific cellular compartments, form functional complexes, and participate in intricate signaling cascades. Organized and reversible S-palmitoylation process achieves remarkable roles in the precise orchestration of biological activities, including cell signaling, membrane trafficking, synaptic transmission and cellular immunity. S-palmitoylation has been implicated in the pathogenesis of diverse disorders including cancers, cardiovascular diseases, metabolic diseases, immunological diseases, infection diseases, nervous system and mental diseases. Altered S-palmitoylation of proteins changes the oncogenic function, synaptic localization, enzymatic activity and signaling transduction, potentially contributing to disease progression. Understanding and targeting S-palmitoylation pathways hold promise for therapeutic interventions in associated diseases. Collectively, S-palmitoylation is a key regulatory mechanism with significant implications for disease pathogenesis. Investigating the role of S-palmitoylation provides insights into diagnostic markers and potential therapeutic targets, highlighting the importance of ongoing research in understanding the broader implications of S-palmitoylation in health and disease.

PEBP1
Also flagged:Coxsackievirus B infectiontype 1 diabetesmitochondrialinfectioninterferonHLA
Journal Article 2025-09-01 ✓ 1 Snippet Veronese-Paniagua DA, Maestas MM, Hernandez-Rincon DC, Hinshaw KE, Ishahak M, Taylor JP, Tse HM, Millman JR.
In-Text Gene Mentions

…included CITED2 ,PEBP1, and CXXC5…

Show Full Abstract

Coxsackievirus B (CVB) is implicated as an environmental trigger for type 1 diabetes (T1D). While CVB impairs islet function and viability, its impact on individual primary human islet cell types remains unclear. Here, we use single-cell RNA sequencing and functional studies to show that CVB3 induces distinct cell-type-specific transcriptional and mitochondrial responses in human cadaveric islets. Contrary to prior claims, our analysis reveals no evidence of preferential viral tropism for β and ductal cells, instead demonstrating comparable infection rates across both endocrine and exocrine compartments. β, α, and ductal cells show the most robust transcriptional responses to infection, with ductal cells, not β cells, exhibiting the strongest interferon- and HLA-associated responses. Notably, the long non-coding MIR7-3HG modulates viral RNA expression, titer, apoptosis, and autophagy upon knockdown in stem-cell-derived islets. These findings challenge long-standing assumptions about islet-specific viral targeting and demonstrate cell-specific responses to CVB3 infection relevant to T1D.

Also flagged:gene expressionmethylationdemethylationhistonecomplexhistone modifications
Journal Article 2025-09-01 No Snippets Yuan L, Xiong Y, Zhang Y, Gu S, Lei Y.
Show Full Abstract

Epigenome editing is emerging as a transformative approach in clinical treatment, enabling precise modifications to gene expression without altering the underlying DNA sequence. The ongoing transition of epigenome editing techniques from foundational research to clinical applications highlights several key strategies. These include targeted DNA methylation/demethylation, histone modification, and transcriptional regulation. These approaches offer the potential for durable and reversible gene expression modulation, paving the way for precisely tailored therapies for genetic and complex diseases. Here, we review pioneering research, technological advancements, granted patents, and clinical trials that have been reported during the past decade. By synthesizing current research and development efforts, this review aims to provide insights into the promising landscape of epigenome editing and its potential to promote therapeutic interventions.

DCC
Also flagged:Extracellular VesiclesextracellularvesiclesCD63CD81CD9
Journal Article 2025-09-01 ✓ 1 Snippet Rodríguez de Lope MM, Sánchez-Pajares IR, Herranz E, López-Vázquez CM, González-Moro A, Rivera-Tenorio A, González-Sanz C, Sacristán S, Chicano-Gálvez E, de la Cuesta F.
In-Text Gene Mentions

…orthologue, TET8 fromM. polymorpha L .polymorpha L .,…

Show Full Abstract

Although the field of plant EVs (PEVs) is experiencing exponential growth, rigorous characterisation complying with MISEV guidelines has not been yet implemented due to the lack of bona fide reference markers. In this work, we have paved the way for the standardisation of PEV markers, providing the most profound proteomic data so far from apoplastic washing fluid-EVs, a sample enriched in genuine extracellular vesicles from plant tissue of two reference plant species: Arabidopsis thaliana (Arath-EVs) and Brassica oleracea (Braol-EVs). Besides, we analysed the protein content of the soluble fraction of the apoplast and calculated the enrichment of the potential markers studied in EVs. Additionally, we have conducted an exhaustive analysis of the proteomic data available so far from genuine EVs from any plant species, evaluating current potential markers, together with those found in our proteomic analyses. Our results provide evidence supporting the potential use of the following families as PEV markers: aquaporins, vacuolar-type ATPase complex subunits, some fasciclin-like arabinogalactan proteins (FLAs), tetraspanins, syntaxins, germin-like proteins and calreticulins. Next, we analysed the presence of orthologues and their degree of conservation throughout plant taxa, as well as in 2 reference species from the animal kingdom: human and mouse. Their degree of conservation was compared with that of current animal EVs: CD63, CD81 and CD9. Among the protein families with potential to be used as PEV markers, 2 were found to be plant-specific: FLAs and germin-like proteins. On the other hand, aquaporins and vacuolar-type ATPase complex subunits showed the greatest degree of conservation across plant and animal kingdoms. Our results provide key insights on several aspects of classical and novel protein identity markers for PEVs to assist in the selection of the best candidates for standardisation: (1) species-specific abundance, (2) specificity for PEVs and (3) conservation and plant specificity.

ZNFX1
Also flagged:Hepatic Encephalopathyneuropsychiatric disordercirrhosischronic liver diseaseammoniagene expression
Journal Article 2025-09-01 ✓ 2 Snippets Kim YK, Yeom S, Choi SY, Ryu Y, Jeong D, Jo D, Lee DH, Song J.
In-Text Gene Mentions

…for lncRNAs, includingZNFX1 Antisense RNA 1Antisense RNA 1…

ZNFX1 Antisense RNA 1Antisense RNA 1…

Show Full Abstract

<h4>Objectives</h4>Hepatic encephalopathy (HE) is a neuropsychiatric disorder associated with cirrhosis and chronic liver disease primarily driven by ammonia (NH3) toxicity, which leads to neuroinflammation and cognitive deficits. Recent studies have identified olfactory dysfunction as a potential early indicator of HE, linked to ammonia-induced neurotoxicity in the brain.<h4>Methods</h4>After confirming physiological alterations in olfactory cells induced by ammonia, we assessed gene expression changes in olfactory bulbs of bile duct ligation (BDL) mice as an HE mouse model. We systematically profiled diverse coding and noncoding RNAs (ncRNAs) associated with olfactory dysfunction in HE and analyzed the functional implications based on transcriptomic signatures. We also compared ammonia toxicity effects between the olfactory bulb and cerebral cortex in this animal model.<h4>Results</h4>Furthermore, we investigated the differential impacts on the olfactory bulb between HE and high-fat diet-induced models, two major paradigms of metabolic imbalance. We identified key RNAs commonly altered between the olfactory bulb and cerebral cortex of the HE model, as well as in olfactory bulbs across BDL and high-fat diet models.<h4>Conclusions</h4>Our results provide a transcriptomic resource for understanding the molecular landscape of HE-related olfactory dysfunction and may inform future studies aimed at functional validation and therapeutic exploration.

HTT
Also flagged:Neurodegenerative Diseaseneurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseamyotrophic lateral sclerosisHuntington's disease
Journal Article 2025-09-01 ✓ 2 Snippets Isik S, Osman S, Yeman-Kiyak B, Shamshir SRM, Sanchez NME.
In-Text Gene Mentions

…and the huntingtin (HTT) gene mutation in…

…stretch in theHTTprotein, leading to…

Show Full Abstract

<h4>Aim</h4>This review provides a systematic evaluation of 94 stem cell clinical trials to treat neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease.<h4>Methods</h4>Data were collected from using relevant search terms, focusing exclusively on stem cell therapy. Of the 8000+ participants in these trials, nearly 70% were enrolled in AD-related studies. Only three Phase 3 studies were conducted, and most trials were in the early phases (Phases 1 and 2). Mesenchymal stem cells, neural stem cells, induced pluripotent stem cells, and embryonic stem cells are used the most to treat neurodegenerative diseases. This review also explores the emerging fields of preclinical and clinical investigations of stem cell-derived exosome-based therapies for neurodegenerative diseases.<h4>Results</h4>Exosomes can cross the blood-brain barrier to deliver therapeutic molecules directly to the brain, offering a less invasive alternative to stem cell transplantation. Mesenchymal stem cell-derived exosomes, in particular, have demonstrated significant potential in preclinical models by reducing neuroinflammation, oxidative stress, and promoting neuronal regeneration. Additionally, recent advances in exosome engineering, including surface modifications, therapeutic agent loading, and transgenic modifications, have improved targeting, stability, blood-brain barrier delivery, and neural cell interactions, enabling targeted and effective treatment. Exosome-based therapies are in the preliminary phases of clinical investigation, with only three clinical trials.<h4>Conclusion</h4>Given the increasing interest in exosome therapy, clinical investigations are expected to increase. This growth will be driven by ongoing advancements in exosome technology, a deeper understanding of their therapeutic potential, and escalating demand for innovative treatment strategies for neurodegenerative diseases.

HTT
Also flagged:neurodegenerative disordermitochondrialHDgene expressionPI3KAkt
Journal Article 2025-09-01 ✓ 2 Snippets Bhosle PV, Wadher SJ.
In-Text Gene Mentions

…expansion in theHTTgene, leading to…

HTT

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder characterized by CAG repeat expansion in the HTT gene, leading to oxidative stress, mitochondrial dysfunction, and neuroinflammation. Conventional therapies offer only symptomatic relief with limited efficacy. This study aimed to explore the neuroprotective potential of <i>Mucuna pruriens</i> (MP) and <i>Boswellia serrata</i> (BS) through an integrative bioinformatics approach, targeting multiple pathological mechanisms implicated in HD. Phytoconstituents from MP and BS were selected based on pharmacokinetic properties, including drug-likeness and blood-brain barrier permeability. Differential gene expression analysis was performed using GEO datasets to identify HD-related genes. Target prediction, network pharmacology, protein-protein interaction (PPI) network construction, and pathway enrichment analyses were carried out. Key proteins were subjected to molecular docking using AutoDock Vina and stability was evaluated through molecular dynamics simulations. A total of 47 phytoconstituents were identified, associated with 1333 (MP) and 693 (BS) potential targets. Network pharmacology revealed the involvement of PI3K-Akt, MAPK, NF-kappa B, and neurotrophin signaling pathways. AKT1, MAPK1, and SLC6A3 emerged as central hub proteins. Molecular docking demonstrated strong binding affinities of levodopa, tyrosine, and phenylalanine with core HD-related proteins (AKT1, EGFR, and SLC6A3). Molecular dynamics simulations further confirmed complex stability, with RMSD values ranging between 1.8 and 3.2 Å across key ligand-protein pairs supporting their neuroprotective potential. This integrative bioinformatics analysis highlights that phytoconstituents from <i>Mucuna pruriens</i> and <i>Boswellia serrata</i> modulate key molecular pathways involved in HD pathogenesis. MP exhibited antioxidative and dopamine-enhancing effects, while BS showed significant anti-inflammatory effects. These findings suggest that MP and BS may serve as promising plant-based therapeutic candidates for HD, warranting further in vitro and in vivo validation.<h4>Supplementary information</h4>The online version contains supplementary material available at 10.1007/s40203-025-00398-2.

Also flagged:Autophagytissue homeostasisresponse to stressinfectionorganellemacroautophagy
Journal Article 2025-09-01 No Snippets Cadwell K, Abraham C, Bel S, Chauhan S, Coers J, Colombo MI, Davis JR, Hofius D, Nguyen HTT, Ogawa M, Roy CR, Shao F, Shizukuishi S, Stallings CL, Szczesna M, Taylor G, Thurston TL, Watson R, Wileman T, Xu Y, Zamboni DS.
Show Full Abstract

Autophagy is an evolutionarily conserved cellular process that is prominent during bacterial infections. In this review article, we discuss how direct pathogen clearance via xenophagy and regulation of inflammatory products represent dual functions of autophagy that coordinate an effective antimicrobial response. We detail the molecular mechanisms of xenophagy, including signals that indicate the presence of an intracellular pathogen and autophagy receptor-mediated cargo targeting, while highlighting pathogen counterstrategies, such as bacterial effector proteins that inhibit autophagy initiation or exploit autophagic membranes for replication. Pathways that are related to autophagy, including LC3-associated phagocytosis (LAP) and conjugation of ATG8 to single membranes (CASM), are expanding the role of autophagy in antimicrobial defense beyond traditional double-membrane autophagosomes. Examination of Crohn disease-associated genes links impaired autophagy to inflammation and defective bacterial handling. We propose emerging concepts, such as effector-triggered immunity, where autophagy inhibition by pathogens triggers inflammatory defenses and discusses the therapeutic potential of modulating autophagy in infectious and inflammatory diseases.

SOX6
Also flagged:metabolic disordersdiabetesosteoporosisNAD⁺-dependent deacetylasesglucosemetabolism
Journal Article 2025-09-01 ✓ 1 Snippet Ding Y, Gao Y, Sun J, Cai Z.
In-Text Gene Mentions

…cofactors SOX5 andSOX6.…

Show Full Abstract

Impaired clinical fracture healing remains a major challenge, with surgical treatment often insufficient in patients with metabolic disorders or comorbidities such as diabetes and osteoporosis. Recent advances in metabolomics have brought the Sirtuin protein family to the forefront of bone regeneration research. These NAD⁺-dependent deacetylases exhibit cell-specific expression and regulate critical processes in osteoblasts and osteoclasts, linking glucose metabolism with bone remodeling. Sirtuins influence key pathways such as Wnt/β-catenin, AMPK, and mTOR, offering novel insights into the mechanisms of fracture healing. Emerging pharmacological strategies targeting Sirtuins show promising results in preclinical models. This review highlights the potential of Sirtuin-based interventions as therapeutic targets in the metabolic regulation of bone repair.

ECI2
Also flagged:intervertebral disk degenerationmitochondrialmetabolismGene ExpressionWntNDUFA6
Journal Article 2025-09-01 ✓ 5 Snippets Lv J, Wang Z.
In-Text Gene Mentions

…, BDNF ,ECI2, ACO1 ,…

…, BDNF ,ECI2, COX4I1 ,…

…, ALDH7A1 ,ECI2, NDUFA6 ,…

…results indicated thatECI2plays an important…

…of IDD, whereasECI2is a key…

Show Full Abstract

Lower back pain caused by intervertebral disk degeneration (IDD) is a common problem among middle-aged and older adults. We aimed to identify novel diagnostic biomarkers of IDD and analyze the potential association between key genes and immune cell infiltration. We screened differentially expressed genes (DEGs) related to IDD and gene sets associated with mitochondrial energy metabolism using the Gene Expression Omnibus and GeneCards databases, respectively. Subsequently, we used multiple enrichment analysis methods to determine the biological functionalities of mitochondrial energy metabolism-related differentially expressed genes (MEMRDEGs). Key genes were selected using logistic regression analysis, a support vector machine algorithm, and least absolute shrinkage and selection operator regression analysis to construct an IDD diagnostic model. To obtain further insights, we examined the relationship between key genes and the presence of infiltrating immune cells. We screened 1304 DEGs that exhibited substantial differences in 20 pathways, including the Wnt signaling pathway, between the IDD and control groups. We identified 33 MEMRDEGs and selected 7 key genes (NDUFA6, YWHAZ, DLAT, BDNF, ECI2, ACO1, and ALDH7A1) to construct an IDD diagnostic model. Receiver operating characteristic curve analysis revealed that these genes exhibited high accuracy in assessing IDD risk, with BDNF and DLAT particularly distinguishing between the low- and high-risk IDD groups. Finally, using single-sample gene set enrichment analysis, we identified a relationship between IDD and immune infiltration, with most immune cells showing strong correlations. A significant positive relationship was found between ACO1 and the immune cells, known as immature dendritic cells. These results offer remarkable insights into the mechanisms underlying the occurrence and development of IDD, potentially identifying new opportunities for diagnosis and therapeutic intervention.

OLFM4
Also flagged:gastric cancerintestinal metaplasiagastric neoplasiaHelicobacter pylori infectiongastric lesionsgastric lesion
Journal Article 2025-09-01 ✓ 5 Snippets Jin Y, Li X, Cai B, Yang L, Zhao W, Xu H, Zhang Y, Liu Z, Pan K, Li W.
In-Text Gene Mentions

…subjects, such asOLFM4, PYCARD, TYMP, and…

…, TYMP ,OLFM4, and MYO1F…

…4 upregulated proteins (OLFM4, MYH9, ENO1, and…

…GSN, ENO1, andOLFM4) were consistently identified…

…Finally,OLFM4, a crucial…

Show Full Abstract

<h4>Objective</h4>The key molecular events signifying the <i>Helicobacter pylori</i>-induced gastric carcinogenesis process are largely unknown.<h4>Methods</h4>Bulk tissue-proteomics profiling were leveraged across multi-stage gastric lesions from Linqu (<i>n</i> = 166) and Beijing sets (<i>n</i> = 99) and single-cell transcriptomic profiling (<i>n</i> = 18) to decipher key molecular signatures of <i>H. pylori</i>-related gastric lesion progression and gastric cancer (GC) development. The association of key proteins association with gastric lesion progression and GC development were prospectively studied building on follow-up of the Linqu set and UK Biobank (<i>n</i> = 48,529).<h4>Results</h4>Concordant proteomics signatures associated with <i>H. pylori</i> infection and gastric carcinogenesis (ρ = 0.784, correlation <i>P</i> = 1.80 × 10<sup>-36</sup>) were identified. RNA expression of genes encoding 13 up- and 15 down-regulated key proteins displayed trending alterations in the transition from normal gastric epithelium to intestinal metaplasia, then to malignant cells. A 15-tissue protein panel integrating these signatures demonstrated potential for targeting individuals at high risk for progressing to gastric neoplasia (OR = 7.22, 95% CI: 1.31-39.72 for the high-score group). A 4-circulating protein panel may be used as non-invasive markers predicting the risk of GC development (hazard ratio = 3.73, 95% confidence interval: 1.63-8.54, high-risk <i>vs.</i> low-risk populations, area under the curve = 0.75).<h4>Conclusions</h4>Concordant proteomics signatures associated with <i>H. pylori</i> infection and gastric carcinogenesis were unveiled with potential as biomarkers for targeted prevention strategies.

SOX6
Also flagged:β-thalassemialuciferase
Journal Article 2025-09-01 ✓ 5 Snippets Yang F, Shi L, Su S, Li Y, Chen H, Liang Z, Pang L, Lai K.
In-Text Gene Mentions

…to directly regulateSOX6.…

SOX6downregulation was observed…

…was overexpressed, whileSOX6was upregulated following…

…the knockdown ofSOX6was sufficient to…

…ability to regulateSOX6, which allude to…

Show Full Abstract

<h4>Objective</h4>In patients with severe β-thalassemia, fetal hemoglobin (HbF) upregulation may provide an avenue to better therapeutic outcomes. The mechanisms that regulate the expression of HbF, however, are currently unclear. This study was developed with the goal of exploring biomarkers and molecular mechanisms associated with HbF expression to help inform the development of novel therapeutic strategies.<h4>Methods</h4>The GSE93973 dataset from the GEO database was used. These miRNA expression data were subjected to WGCNA, differential expression, and LASSO regression analyses to identify hub miRNAs. The knockdown and overexpression of selected hub miRNAs were performed in K-562 cells to clarify how they affect HbF expression.<h4>Results</h4>In the WGCNA analysis, the module most closely associated with HbF levels was the pink module. Bioinformatics analyses identified miR-19b-3p as the hub miRNA. When miR-19b-3p was overexpressed in K-562 cells, this resulted in HbF upregulation, whereas the opposite was evident when it was knocked down. Dual-luciferase reporter assays confirmed the ability of miR-19b-3p to directly regulate SOX6. SOX6 downregulation was observed when miR-19b-3p was overexpressed, while SOX6 was upregulated following miR-19b-3p knockdown. In rescue experiments, the knockdown of SOX6 was sufficient to partially abrogate the impact of miR-19b-3p knockdown on the expression of HbF.<h4>Conclusion</h4>These results highlight miR-19b-3p as a core miRNA associated with the expression of HbF in β-thalassemia through its ability to regulate SOX6, which allude to a novel mechanism of HbF induction and could provide new targets for increasing HbF in patients with β-thalssemia major.

DCC
Also flagged:iminesmacrocyclesaminesaldehydesiminebinding
Journal Article 2025-09-01 ✓ 1 Snippet Wu J, Greenfield JL.
In-Text Gene Mentions

…context of light-responsiveDCC, only recently have…

Show Full Abstract

The reversible covalent bond formation that underpins dynamic covalent chemistry (DCC) enables the construction of stimuli-responsive systems and the efficient assembly of complex architectures. While most DCC studies have focused on systems at thermodynamic equilibrium, there is growing interest in systems that operate away from equilibrium-either by shifting to a new free-energy landscape in response to a stimulus, or by accessing an out-of-equilibrium state following an energy input. Imine-based systems are especially attractive due to the accessibility of their building blocks and their dynamic behavior in both condensation and transimination reactions. These equilibria can be perturbed by chemical stimuli or light. While many modular systems combining imines with separate photoswitches have been studied in the context of light-responsive DCC, only recently have imine-based photoswitches-where light responsiveness is built directly into the dynamic covalent bond-emerged as a distinct strategy. In this perspective, we compare representative examples of both approaches, outline their respective strengths, and discuss key challenges and opportunities for advancing light-driven, out-of-equilibrium imine systems.

SOX6
Also flagged:somatostatinSSTneuropsychiatric disorderspsychiatric disordersparvalbuminPV
Journal Article 2025-09-01 ✓ 5 Snippets Bruzelius A, Stamouli CA, Hölldobler AL, Aretio-Medina C, Cepeda-Prado E, Sozzi E, Passarello GR, Nocera G, Giacomoni J, Olariu V, Rylander Ottosson D.
In-Text Gene Mentions

…for MGE (SOX6), pallium (…

…also positive forSOX6and pallial markers…

…MGE-specific genes (SOX6, LHX6 ,…

…GABAergic, MGE (specificallySOX6, and NXPH1…

…cells positive forSOX6and NXPH1 in…

Show Full Abstract

Cortical interneuron deficiencies, particularly involving the somatostatin (SST) subtypes, contribute to neurological and neuropsychiatric disorders. These interneurons are difficult to derive in vitro from human embryonic stem cells (hESCs) due to their late embryonic development and dependence on glial interaction. To this end, we developed a three-dimensional co-culture model of hESC-derived neurons, enabling long-term development, functional maturity, and neuron-glial interaction. Under these conditions, hESCs successfully differentiated into functional GABAergic interneurons expressing the SST gene and protein within 50 days. Single-nuclei RNA sequencing revealed transcripts for SST subclasses, including Martinotti, non-Martinotti, and long-projecting neurons, that have not yet been described for hESC cultures. Upon injection into forebrain organoids, the interneuron progenitors spread and functionally matured while retaining their SST subclass identities, suggesting cell-intrinsic fate specification. Our in vitro model provides a robust platform for studying human SST interneurons, offering new avenues for investigating their role in health and disease.

Also flagged:neurogenesistranscription factorbrain developmentneuropsychiatric disordersextracellularorganization
Journal Article 2025-09-01 No Snippets Scuderi S, Khouri-Farah N, Rauthan R, Natu A, Wang H, Nelson A, Jourdon A, Vaccarino FM.
Show Full Abstract

A complex assortment of neuronal cells contributes to distinct functional circuits in the human brain. Such diversity is imposed upon pluripotent stem cells by a patterning process that begins much before the start of neurogenesis. Neural tube patterning relies on morphogens-diffusible signals that regulate transcription factor networks in progenitor cells, guiding spatial and temporal identity formation. Studying early human patterning in vivo is limited by access to embryonic tissue. Recent advances in stem cell technologies, including brain organoids, brain-on-chip systems, and assembloids, allow to explore morphogen-driven neurodevelopment. In this review, we highlight key mechanisms of neural tube patterning and how they enable insights into human brain development and neuropsychiatric disorders.

HFE
Also flagged:IronMetabolismoxygenmitochondrialsynthesisheme
Journal Article 2025-09-01 ✓ 3 Snippets Testa U, Pelosi E, Castelli G.
In-Text Gene Mentions

…polymorphisms of theHFEgene (rs1800562, rs1799945…

…Hereditaryhemochromatosisprotein HFE…

…ditary hemochromatosis proteinHFE

Show Full Abstract

Iron is required for several vital biological processes in all human cells. In mammals, a considerable number of proteins are involved in iron metabolism and utilize iron in many essential cellular processes, such as oxygen transport, mitochondrial respiration, gene regulation, and DNA synthesis or repair. Iron metabolism is a complex system finely regulated at both systemic and cellular levels. It involves the development of specialized mechanisms for iron absorption, transport, recycling, storage, and export, and protection against toxic compounds that can be generated during iron redox cycling in the presence of oxygen. The erythropoietic compartment consumes the majority of iron to support the high demand for hemoglobin synthesis. A tightly regulated system enables efficient iron uptake by erythroid cells and its subsequent processing for the synthesis of large amounts of heme, which is then incorporated into hemoglobin. A bidirectional regulatory system between erythropoiesis and iron metabolism ensures precise coordination between the two processes. This regulation is often disrupted in various anemic conditions.

PRDX6
Also flagged:ethanolnucleustrichostatin Anicotinamidephosphatasephosphorylation
Journal Article 2025-09-01 ✓ 1 Snippet Hayden BL, Kelley O, Zientek K, Reddy AP, Wilmarth PA, Munds R, Montague MJ, Martinez MI, Wollstein G, Higham JP, Barron Arrambide AO, Danias J, Melin AD, David LL, Whitson JA.
In-Text Gene Mentions

…CRYGB, ALDH1A1, CRYGA,PRDX6, and FABP5 all…

Show Full Abstract

<h4>Purpose</h4>Proteomes of lens nuclei from young (4 years old) and old (15-16 years old) rhesus macaques (Macaca mulatta) were analyzed to determine similarity of the proteomic profile to that of human lenses, age-related differences in protein solubility, and association of various post-translational modifications with age and protein solubility.<h4>Methods</h4>Lens core proteins were separated into water-soluble and water-insoluble fractions using aqueous buffer and centrifugation. The water-insoluble fraction was solubilized using sodium dodecyl sulfate (SDS). Proteins were processed using S-trap columns, and peptide digests were analyzed using high-resolution, label-free data-dependent acquisition (DDA) proteomics. Open modification searches were performed using MSFragger to identify possible post-translational modifications (PTMs). The number of modified peptide tandem mass spectra confidently assigned to samples by age or solubility were compared to find PTMs with statistically significant count differences.<h4>Results</h4>The overall proteomic profile of rhesus macaque lenses was very similar to human lenses, consisting of 80.2% crystallins, 1.1% beaded filament proteins, and 18.7% other proteins. The crystallin fraction consisted of 27% alpha crystallins, 67.6% beta/gamma crystallins, and 5.4% taxon-specific psi crystallin. Glycolytic enzymes, beta/gamma crystallins, and a few glutathione-related enzymes were found to have age-related shifts to the water-insoluble fraction. There were significant differences in deamidation, dioxidation, carbamylation, carboxymethylation, and trioxidation based on age and/or solubility of proteins.<h4>Conclusions</h4>These data indicate a high level of conformity between rhesus macaque and human lens proteomes, and a few key differences. We identified several age-related differences in protein solubility and PTM that may contribute to lens pathology.

Also flagged:Alpha-1AntitrypsinDeficiencyPathogenesisAlpha-1 antitrypsin deficiencyAATD
Journal Article 2025-09-01 No Snippets Yang SR, Kim HR.
Show Full Abstract

Alpha-1 antitrypsin deficiency (AATD) represents a paradigmatic genetic disorder with well-characterized hepatic manifestations but relatively underexplored pulmonary implications. While liver involvement has been extensively reviewed, the underlying mechanisms of lung disease progression remain poorly understood, particularly regarding immunological pathways and inflammatory processes. The pathophysiology involves defective alpha-1 antitrypsin (AAT) production, including AAT variants that induce neutrophil elastase activity, causing progressive alveolar destruction and sustained inflammation, leading to emphysema, as one of the main components of chronic obstructive pulmonary disease (COPD). AATD and smoking represent major risk factors for COPD, the third leading cause of death worldwide at present. In AATD patients, neutrophils, which constitute the majority of circulating leukocytes, become dysregulated. Under normal conditions, cells perform essential functions, including phagocytosis and neutrophil extracellular trap formation (NETosis); in AATD, however, they accumulate excessively in alveolar spaces due to impaired elastase control. The accumulation of Z-AAT polymers within epithelial cells creates a pathological cycle, acting as chemoattractants that sustain pro-inflammatory responses and contribute to chronic obstructive pulmonary disease development. In addition, monocytes, representing a smaller fraction of leukocytes, migrate to inflammatory sites and differentiate into macrophages while secreting AAT with anti-inflammatory properties. However, in PiZZ patients, this protective mechanism fails, as polymer accumulation within cells reduces both AAT secretion and the number of protective human leukocyte antigen(HLA)-DR-monocyte subsets. In particular, macrophages demonstrate remarkable plasticity, switching between pro-inflammatory M1 (classically activated macrophages) and tissue-repairing M2 (alternatively activated macrophages) phenotypes based on environmental cues. In AATD, this adaptive capability becomes compromised due to intracellular polymer accumulation, leading to impaired phagocytic function and dysregulated cytokine production and ultimately perpetuating chronic inflammation and progressive tissue damage. Recent advances in induced pluripotent stem cell (iPSC) technology have facilitated alveolar epithelial cell (AEC) generation, in addition to the correction of AATD mutations through gene editing systems. Despite the limitations of AAT correction, iPSC-derived organoid models harboring AATD mutations can deliver important insights into disease pathophysiology, while gene editing approaches help demonstrate causality between specific mutations and observed phenotypes. Therefore, in this review, we investigated recent studies that can serve as tools for gene editing and drug development based on recently developed iPSC-related technologies to understand the pathogenesis of AATD.

DARS2
Also flagged:extracellularagingmetabolismlactateproteoglycansynthesis
Journal Article 2025-09-01 ✓ 1 Snippet Yang Y, Liu D, Ai Z, Gao X.
In-Text Gene Mentions

…ACAD9, ACAT2, COX20,DARS2, JAK2, KCNN4, LARS2,…

Show Full Abstract

Intervertebral disc degeneration (IVDD) is a common cause of neck, back, and low back pain, it is also a major global public health problem. Lactate is a metabolic product of intervertebral disc cells and is closely related to disc degeneration. Lactylation (Lac), driven by lactic acid, is associated with intervertebral disc degeneration, and targeting-related genes may provide new therapeutic directions for intervertebral disc degeneration. In this study, data from genome-wide association studies were combined with drugs associated with Lac accumulation and expression quantitative trait loci (eQTLs) associated with Lac to explore the relationship between Lac-related genes and disc degeneration. Lac-related genes from MSigDB, intervertebral disc degeneration genome-wide association studies data from FinnGen, and Cis-eQTL data from the eQTLGen consortium. The inverse variance weighting (IVW) method was primarily used for evaluation, and sensitivity analyses were conducted using weighted median, simple mode, and weighted mode, which supported the robustness of results consistent with the IVW direction. The Cochran Q test assessed instrumental variable heterogeneity (P > .05), and a posterior probability PP.H4 > 0.80 was considered strong evidence of co-localization. A total of 36 potential genes reached statistical significance (P < .05) in the IVW method, but 23 genes in all sensitivity analysis methods had the same effect direction as IVW, demonstrating high robustness. Bayesian co-localization analysis identified NFU1 (PP.H4 = 1.00, OR = 1.18 [1.13-1.24]) and NDUFA13 (PP.H4 = 0.90, OR = 0.81 [0.74-0.89]), indicating that these 2 genes share causal variants associated with the risk of IVDD. NFU1 is a strong risk factor for IVDD, so the main type of drug selected is an "inhibitor." NDUFA13 has a protective effect against IVDD, so the type of drug selected is an "agonist." There is a causal association between Lac and IVDD, and IVDD progression can be delayed by regulating the expression of Lac-related druggable genes.

SOX6
Also flagged:ZC3H13methylationesophageal squamous cell carcinoma tumorzinc fingergene expressionesophageal squamous cell carcinoma
Journal Article 2025-09-01 ✓ 1 Snippet Yan Q, Xu C, Gong L, Liang D, Yang J, Zheng Y, Wang J.
In-Text Gene Mentions

…turn, binds toSOX6, promoting the nuclear…

Show Full Abstract

<h4>Introduction</h4>ZC3H13 (zinc finger CCCH-type containing 13) is a member of the zinc finger protein family with regulatory roles in gene expression and represents a crucial m6A methyltransferase. However, the precise function of ZC3H13 in the esophageal squamous cell carcinoma tumor microenvironment (TME) remains incompletely understood. Our study primarily investigated the impact of ZC3H13 on m6A methylation modification in ESCC and explored the roles of ZC3H13 and M2 macrophages in ESCC.<h4>Methods</h4>We employed bioinformatics analysis to assess the function of ZC3H13 in ESCC. Quantification of ZC3H13, CCL5, CXCL8, and macrophage infiltration in clinical samples and cell line-derived xenograft (CDX) tumor models was conducted using real-time quantitative PCR (qRT-PCR), western blot (WB), immunohistochemistry (IHC), Immunofluorescence (IF), and Enzyme-linked immunosorbent assay (ELISA). The colorimetric method was utilized to detect m6A methylation in cells and tissues. Tumor proliferation, migration, and invasion were evaluated using CCK8, EdU staining, colony formation tests, transwell assays, and CDX models.<h4>Results</h4>We found that elevated ZC3H13 expression was positively correlated with m6A methylation modification in ESCC tumor tissue. ZC3H13 mutation led to abnormal nuclear metastasis of METTL14 and METTL3. Silencing ZC3H13 inhibited ESCC tumor growth and M2 macrophage infiltration in mice. ZC3H13 silencing also suppressed the expression of CCL5 and CXCL8 mRNA. M6A modification enhanced the stability of CXCL8 mRNA. ESCC tumors promoted the polarization of M0-M2 macrophages through the CXCL8-CXCR2 axis, which CXCR2 inhibitors or anti-CXCL8 antibodies could inhibit. Migration of M0 macrophages was facilitated by CCL5.<h4>Discussion</h4>Our findings elucidate the connection between ZC3H13-mediated m6A modification and M2 macrophage infiltration in the ESCC-TME, resulting in M2 macrophage polarization and increased M2 macrophage infiltration.

Also flagged:palmitoylationlipidpalmitoyl esterscysteinelocalizationmembrane
Journal Article 2025-09-01 No Snippets Chen R, Tang X, Wang Y, Wang B, Mao F.
Show Full Abstract

Protein palmitoylation is a reversible lipid modification in which palmitoyl esters are covalently attached to cysteine residues of proteins. It controls various cellular physiological processes and alters protein stability, conformation, localization, membrane binding, and interaction with other effector proteins. Palmitoylation is catalyzed by a group of zinc finger DHHC-containing proteins (ZDHHCs), while the acyl-protein thioesterase family mediates depalmitoylation. Emerging evidence suggests that palmitoylation is critical for inflammatory signaling pathways, where palmitoylation is particularly important in the membrane localization of inflammation-associated proteins. Notably, dysregulation of palmitoylation has been associated with a variety of inflammatory diseases. Here, we provide an overview of the regulatory mechanisms of palmitoylation, explore the emerging role of palmitoylation in inflammatory signaling pathways, and examine the link between dysregulated palmitoylation and the pathogenesis of inflammatory diseases, including inflammatory bowel disease, autoimmune diseases, metabolic dysfunction-associated steatohepatitis, sepsis, Alzheimer's disease, Parkinson's disease, and diabetes. Finally, we discuss some of the challenges and opportunities facing the field. Targeting palmitoylation or its associated enzymes serves as a novel therapeutic approach for the treatment of inflammatory diseases.

PRDX6HTT
Also flagged:TREM2Alzheimer's diseaseADimmune responsepathogenesisapolipoprotein E
Journal Article 2025-09-01 ✓ 2 Snippets Tsui JSM, Au DM, Uhm H, Wong WW, Lo RMN, Jiang Y, Ip FCF, Mok KY, Wong HY, Kwok TCY, Fu AKY, Ip NY.
In-Text Gene Mentions

…TDP43, PARK7, andHTT) were not altered…

…proteins SOD2 andPRDX6are involved in…

Show Full Abstract

<h4>Introduction</h4>Multiple TREM2 variants are associated with an increased risk of Alzheimer's disease (AD). TREM2 H157Y is the only variant located at the proteolytic cleavage site that enhances TREM2 protein shedding. While this variant is associated with increased AD risk predominantly in the Chinese population, its impact on AD pathology is largely unknown.<h4>Methods</h4>We conducted an in-depth study integrating clinical cases, neuroimaging data, and blood proteomic data.<h4>Results</h4>TREM2 H157Y variant carriers with AD exhibit more severe AD pathology, more severe neurodegeneration, and more rapid clinical progression. Cognitively normal individuals carrying the variant show changes in blood proteins that are associated with neurodegeneration and inflammation. Moreover, the TREM2 H157Y variant is associated with altered immune and vascular processes irrespective of disease state.<h4>Discussion</h4>These findings highlight the clinical implications of the TREM2 H157Y variant and the use of blood proteomic data to investigate the effects of genetic variants on disease-related endophenotypes.<h4>Highlights</h4>The TREM2 H157Y variant is associated with more rapid clinical progression of Alzheimer's disease only in the presence of the apolipoprotein E (APOE) ε4 allele. The TREM2 H157Y variant is associated with neurodegeneration, irrespective of disease state. The TREM2 H157Y variant is associated with altered immune and vascular processes, irrespective of disease state. Cognitively normal TREM2 H157Y carriers show altered disease-associated blood proteins related to peripheral immune response. Blood proteomic data can be used to study the impacts of disease-associated genetic variants on disease outcomes and biological processes involved in pathogenesis.

OLFM4
Also flagged:gene expressionobesityCD8immune responsespreeclampsiaautoimmune disorders
Journal Article 2025-09-01 ✓ 1 Snippet DeBolt CA, Yu H, Riis V, Ncube L, Horowitz A, Elovitz MA.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Problem</h4>Significant immunological shifts, systemically and at the maternal-fetal interface, are required for successful pregnancy. As immune perturbations are emerging as pivotal drivers of adverse maternal health, elucidating how normal pregnancy alters maternal systemic immunity is imperative.<h4>Methods</h4>From our prospectively enrolled cohort of Black women, peripheral blood samples were collected pre-pregnancy (V1) and in the second trimester (16-24 weeks, V2). Among those who became pregnant, 23 had available samples from both time points. RNA was extracted and subjected to bulk RNA sequencing, followed by differential gene expression analyses, immune cell-type deconvolution, and pathway enrichment analyses. Participants were stratified by pre-pregnancy obesity (body mass index ≥ 30 kg/m<sup>2</sup>) to examine its impact on pregnancy-induced immune changes.<h4>Results</h4>Pathway analyses revealed innate immune activation and increased neutrophil-driven inflammation during pregnancy. Significant increase in neutrophils and monocytes occurred during pregnancy, whereas naïve CD8+ T-cell and B-cell subsets were significantly decreased. Pre-pregnancy obesity amplified these changes, further increasing innate populations (gamma delta T cells, neutrophils) and decreasing adaptive populations (CD8 naïve T cells, B memory cells).<h4>Conclusion</h4>From individuals with uncomplicated pregnancies, we demonstrate dramatic immunological changes when transitioning from a non-pregnant to pregnant state. Intricate immune modulation, including changes in inflammatory mechanisms and immune cell dynamics were observed. Pre-pregnancy obesity enhances these inflammatory shifts, providing insights into potential mechanisms driving adverse pregnancy outcomes in obese women. Future studies investigating how these immunological shifts are required for optimal maternal health and/or may promote increased vulnerability to adverse pregnancy outcomes will create new opportunities to improve maternal outcomes.

Also flagged:skin cancerMelanomascyclobutane pyrimidinemelanoma8-oxoguaninescytosines
Journal Article 2025-09-01 No Snippets Jin SG, Johnson J, Kim PY, Pfeifer GP.
Show Full Abstract

UVB radiation (280-320 nm) from sunlight induces skin cancer through DNA damage-induced mutations. Melanomas carry mutational signatures associated with UVB-induced cyclobutane pyrimidine dimers (CPDs). However, there are several other melanoma signatures of unknown origin. To test if these signatures are linked to UVA, we exposed human melanocytes to UVA (340-400 nm) and to UVB for comparison. We mapped DNA damage in the form of CPDs or 8-oxoguanines (8-oxoG) genome-wide at base resolution. We then determined mutational patterns in single melanocyte cell clones by whole genome sequencing. Different from UVB, UVA induces CPDs more selectively at TT sequences resembling melanoma signature SBS7d. We did not observe rising CPD levels after cessation of radiation (dark CPDs). The UVA-induced CPDs were not mutagenic in the mutation analysis. 8-oxoG was present in melanocytes but did not substantially increase after UVA. G/C to T/A mutations were prominent in melanocyte single-cell clones with no major shift after UVA radiation. These mutations matched SBS18, a signature present in melanomas. Although UVA damages DNA, it has a surprisingly limited mutagenic effect on human melanocytes. However, the oxidative base lesions in melanocytes and their associated mutations may be linked to a subset of melanoma mutations.

SUDS3
Also flagged:translationalhistoneschromatinorganizationlysinescore histones
Journal Article 2025-09-01 ✓ 1 Snippet Alshehri A, Baker IM, English DM, Fairall L, Collins MO, Schwabe JWR, Cowley SM.
In-Text Gene Mentions

…core components (SIN3A,SUDS3, and SAP30) appear…

Show Full Abstract

Histone deacetylase 1 and 2 (HDAC1/2) regulate histone acetylation as catalytic and structural components of six unique multiprotein complex families: SIN3, NuRD, CoREST, MIDAC, MIER, and RERE. Co-immunoprecipitation of HDAC1-Flag followed by mass spectrometry revealed that 92% of HDAC1 in mouse embryonic stem cells resides in three complexes, NuRD (49%), CoREST (28%), and SIN3 (15%). We compared the structures of MTA1:HDAC1 and MIDEAS:HDAC1 to identify critical binding residues on the surface of HDAC1. Surprisingly, a single mutation, Y48E, disrupts binding to all complexes except SIN3. Rescue experiments performed with HDAC1-Y48E in HDAC1/2 double-knockout cells showed that retention of SIN3 binding alone is sufficient for cell viability. Gene expression and histone acetylation patterns were perturbed in both Y48E and a second mutant cell line, HDAC1-E63R, indicating that cells require a full repertoire of the HDAC1/2 complexes to regulate their transcriptome appropriately. Comparative analysis of MTA1/HDAC1 and SIN3B/HDAC2 structures confirmed the differential modes of HDAC1 recruitment, with Y48 interacting with ELM2/SANT domain-containing proteins, but not SIN3. The E63R mutation shows markedly reduced binding to NuRD and MiDAC complexes but retains some CoREST binding. We provide novel molecular insights into the abundance, co-factors and assemblies of this crucial family of chromatin modifying machines.

HFE
Also flagged:cancercardiovascular diseaseobesitycardiometabolic diseaseintellectual disabilitiesdevelopmental delay
Journal Article 2025-09-01 ✓ 1 Snippet Grech L, Grech CA, Spiteri J, Mintoff D, Pace NP.
In-Text Gene Mentions

…disease, and theHFEp.Cys282Tyr variant, associate…

Show Full Abstract

<h4>Background</h4>The identification of actionable secondary findings (SFs) through clinical exome sequencing has become increasingly relevant with the integration of genomics into routine healthcare. The frequency and spectrum of these findings vary across populations.<h4>Methods</h4>We analyzed exome sequencing data from 350 unrelated Maltese individuals, comprising 320 pseudonymised controls and 30 participants from the pilot sequencing phase of the national biobank DwarnaBio, to assess the prevalence of pathogenic or likely pathogenic (P/LP) variants in the ACMG SF v3.2 gene list. All samples underwent uniform sequencing, rigorous quality control, and variant interpretation according to ACMG/AMP guidelines.<h4>Results</h4>Actionable P/LP variants were identified in 12 individuals (3.4%) across autosomal dominant genes, predominantly associated with inherited cardiac conditions and cancer predisposition syndromes. These findings highlight the importance of including underrepresented populations in genomic research and emphasize the need to establish provisions for the return of clinically actionable results to biobank participants, supported by access to genetic counseling.<h4>Conclusion</h4>Our results advocate for the integration of population-specific genomic data into national precision medicine frameworks, particularly for small or isolated populations where tailored approaches to variant curation and clinical translation are required. This study provides the first baseline estimate of actionable SFs in the Maltese population and offers insights for advancing precision medicine frameworks.

Also flagged:hepatocellular carcinomaliver cancerchronic hepatitisinfectionchronic diseasegene expression
Journal Article 2025-09-01 No Snippets Wang T, Liu ZP.
Show Full Abstract

<h4>Motivation</h4>Early detection and timely intervention of hepatocellular carcinoma (HCC) are pivotal for improving patient prognosis. Current diagnostic approaches often detect HCC at later stages, thereby diminishing treatment efficacy. Recent advancements in high-throughput sequencing technology have vastly improved the identification of molecular markers via biological networks. However, existing methodologies frequently overlook the intricate gene interaction information in temporal gene regulatory networks. Therefore, our study proposes an algorithm model, getDNB, leveraging graph embedding technique (get) for anomaly detection in time-varying dynamic networks. The model aims to facilitate early HCC detection and propel precision medicine by recognizing dynamic network biomarker (DNB).<h4>Results</h4>We proposed the getDNB model, which utilizes graph convolutional networks for graph embedding, mapping high-dimensional gene regulatory networks to low-dimensional feature vector spaces. By calculating gene anomaly degrees through an outlier score, and using the minimum dominant set algorithm alongside with the shortest path algorithm, we discovered DNBs and their associated networks in HCC. The getDNB model successfully pinpointed 33 HCC DNBs, effectively differentiating various temporal stages of HCC progression, and demonstrated robustness across numerous real HCC datasets. Functional enrichment analysis unveiled that these DNBs play critical roles in HCC occurrence and development, outperforming widely used feature selection algorithms.<h4>Availability and implementation</h4>The source code and data can be found at https://github.com/zpliulab/getDNB.

TNFSF4
Also flagged:LIGHTIL-13IL-17tissue remodelingTNFSF14cytokine
Journal Article 2025-09-01 ✓ 3 Snippets Ghosh N, Gupta RK, Jung J, Fung K, Croft M.
In-Text Gene Mentions

…, IL1RL1 ,TNFSF4, TNFRSF4 ,…

…TNFSF15 , andTNFSF4, with top…

…IL32 , andTNFSF4( Fig. 5B,…

Show Full Abstract

Fibroblasts are structural cells primarily involved in tissue remodeling, but recent single-cell RNA sequencing (RNA-seq) transcriptomic data have highlighted their potential to display molecules linked to inflammation. The factors that drive such inflammatory transcriptional signatures found in patients are not clear. LIGHT (TNFSF14) is a cytokine that we previously suggested may be central to lung diseases exhibiting fibrosis and inflammation, including asthma and interstitial lung disease. With bulk RNA-seq, we then investigated the transcriptional activity of LIGHT in human pulmonary fibroblasts compared with interleukin (IL)-13 and IL-17, two other cytokines linked to lung disease. While all 3 cytokines individually induced unique and overlapping gene transcripts, when fibroblasts were stimulated with LIGHT and IL-13 they upregulated more inflammatory transcripts including CCL2, CCL26, CXCL2, CXCL3, CXCL5, CXCL6, IL32, CSF2, VCAM1, ICAM1, IL18R1, IL1RL1, TNFRSF12A, TNFRSF4, TNFRSF8, ITGA2, ITGA4, and ITGAV, and when stimulated with LIGHT and IL-17, inflammatory transcripts included CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL8, IL32, IL33, CSF2, TSLP, IL1A, IL6, IL18, VCAM1, ICAM1, IL18R1, IL1RL1, TNFSF4, TNFRSF4, TNFRSF8, ITGA2, ITGA4, and ITGAV. Furthermore, multiple cell cycle-related transcripts were induced with these combinations. Providing potential disease significance, portions of the fibroblast transcriptional signatures induced in vitro were found to be present in subsets of fibroblasts defined by single-cell RNA-seq isolated from patients with interstitial lung disease. This study therefore highlights the synergistic activities of LIGHT with other classical cytokines to regulate transcription in pulmonary fibroblasts and infers the involvement of LIGHT in shaping fibroblast phenotypes observed in chronic lung disease.

Also flagged:Immune checkpoint moleculessignal regulatory protein alphaHepatocellular carcinomamalignant tumor of the livermalignant tumorscancer
Journal Article 2025-09-01 No Snippets Zhang X, Chen DB, Zhang R, Chen P, She SP, Yang Y, Ren LY, Chen HS.
Show Full Abstract

Hepatocellular carcinoma (HCC) is a primary malignant tumor of the liver and one of the most common malignant tumors, as well as the third leading cause of cancer-related death. In recent years, immune checkpoint inhibitors have emerged as a key strategy in cancer treatment. However, anti-programmed cell death 1/programmed death ligand 1 therapies, one of the main immunotherapeutic approaches, only elicit a response in only approximately 20% of advanced HCC. This suggests that there may be other immune checkpoints playing important roles in HCC immunotherapy. Recent studies have highlighted Signal regulatory protein alpha (SIRPα) is a phagocytic checkpoint in macrophages and other immune cells, as a promising novel therapeutic target in tumor immunotherapy. This review summarizes current progress on SIRPα in HCC and identifies key challenges for future related research.

Also flagged:Hydroxyapatiteglutaraldehydevanadium-dependent chloroperoxidaseVCPOl -tyrosine decarboxylaseTDC
Journal Article 2025-09-01 No Snippets Gelati L, Gervasini A, Speranza G, Paradisi F.
Show Full Abstract

Greener and cheaper alternatives to petrol-based supports have been studied in recent years to implement biocatalysis in industrial processes exploiting enzyme immobilization. Among these, hydroxyapatite (HAP) represents a suitable candidate thanks to its structural stability, nontoxicity, large surface area, and ease of surface modification. As it can be sourced from waste, it also fulfills the circular economy principles. This work explored the use of HAP for covalent immobilization using three model enzymes: a vanadium-dependent chloroperoxidase from <i>Curvularia inaequalis</i> (<i>Ci</i>VCPO), an l-tyrosine decarboxylase from <i>Lactobacillus brevis</i> (<i>Lb</i>TDC), and an <i>R</i>-selective transaminase from <i>Thermomyces stellatus</i> (<i>Ts</i>RTA). Different strategies were tested, and derivatization with (3-aminopropyl)-triethoxysilane (APTES) followed by glutaraldehyde activation was found to be the most widely applicable. <i>Lb</i>TDC and <i>Ts</i>RTA immobilized through this strategy were tested in multiple reaction cycles to assess their stability and reusability, with promising results.

Also flagged:diabetesliver diseaseMetabolic dysfunction-associatedsteatotic liver diseaseobesitysugar
Journal Article 2025-09-01 No Snippets Zhang CY, Liu S, Yang M.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD) is featured by the accumulation of excessive fat in the liver. It is caused by many factors, such as overweight, obesity, diabetes, and high plasma levels of sugar, cholesterol, and triglycerides. MASLD is commonly associated with type 2 diabetes (T2D), which is characterized by a pathophysiological deficiency of insulin secretion due to impaired function of pancreatic β cells and insulin resistance. T2D has become a global pandemic that influences more than 21.7 million people worldwide. Pre-clinical and clinical studies have been performed to investigate molecular crosslinks between T2D and MASLD and their therapeutic strategies. Accumulating evidence has demonstrated that macrophages are cellular mediators that contribute to the progression of MASLD and T2D by impacting the resolution of inflammation. Different types of macrophages are involved in the pathogenesis of MASLD and T2D, including liver-resident macrophages or Kupffer cells, monocyte-derived macrophages, and adipose tissue macrophages. These macrophages secrete enzymes, chemokines, cytokines, as well as exosomes, to induce metabolic inflammation and insulin resistance, immune cell infiltration, and tissue injury. In this review, we provide a comprehensive summary of the molecular and cellular interactions between MASLD and T2D with a specific discussion of the critical roles of macrophages and inflammation. The underlying molecular mechanisms and the associated therapeutic targets and strategies are also reviewed.

Also flagged:Colorectal NeoplasiaPathogenesisColorectal cancerarachidonic acidtransportersEicosanoid
Journal Article 2025-09-01 No Snippets Feddersen UR, Hendel SK, Berner-Hansen VH, Veedfald S, Berner-Hansen M, Bindslev N.
Show Full Abstract

Colorectal cancer (CRC) is a major cause of cancer-related mortality, especially in the Western world, and its incidence is expected to increase in the years to come. Prevention and early detection are key strategies to improve CRC morbidity and mortality. Although pathogenesis is still not fully understood, several signaling pathways have been studied and some are associated with the development of colorectal neoplasia (CRN) and CRC. Further identification of individuals with an increased risk of developing CRN would allow optimization of surveillance programs and help guide pharmacological preventive strategies. This perspective review outlines signaling pathways, biomarkers, and related pharmacological targets potentially implicated in the pathogenesis of CRN. We present our research based on studies carried out in normal appearing colonic mucosa from patients with and without CRN. With a focus on arachidonic acid signaling pathways, and in contrast to many other studies on cell culture and CRN tissue samples, our research is based on fresh colonic biopsies from normal tissue and presents and documents alterations in the function, expression, and location of enzymes, receptors, and transporters potentially involved in CRN pathogenesis. Based on these findings, we suggest areas of focus for future research and drug development for prevention and maybe even treatment of CRN and CRC. Furthermore, based on our observations of the COX-1 enzyme, we also discuss the implications of this enzyme in the development of CRN.

SERPINC1
Also flagged:Pulmonary EmbolismFactor V LeidenPAI-1MTHFRthrombosesPE
Journal Article 2025-09-01 ✓ 1 Snippet Ivanova N.
In-Text Gene Mentions

…lants—including antithrombin (SERPINC1), protein C (PROC),…

Show Full Abstract

<b>Background and Clinical Significance:</b> Arterial and venous thromboses are typically distinct clinical entities, each governed by unique pathophysiological mechanisms. The concurrent manifestation of both, particularly in the setting of massive pulmonary embolism (PE), is exceptionally rare and poses significant diagnostic and therapeutic challenges. <b>Case Presentation:</b> This report describes a 61-year-old male with well-controlled hypertension and type 2 diabetes who developed extensive thromboses involving deep vein thrombosis (DVT) of the right popliteal vein, arterial thrombosis of the left iliac artery, and massive PE. The patient was initially managed conservatively, in accordance with the European Society of Cardiology (ESC) 2019 Guidelines for Acute PE, using unfractionated heparin (UFH), low-molecular-weight heparin, a direct oral anticoagulant (DOAC), and adjunctive therapy. This approach was chosen due to the absence of hemodynamic instability. However, given failed percutaneous revascularization and persistent arterial occlusion, surgical thromboendarterectomy (TEA) was ultimately required. Post hoc genetic testing was prompted by the complex presentation in the absence of classical provoking factors-such as trauma, surgery, malignancy, or antiphospholipid syndrome-consistent with recommendations for selective thrombophilia testing in atypical or severe cases. The analysis revealed four thrombophilia-associated polymorphisms: heterozygous Factor V Leiden (FVL; R506Q genotype), Plasminogen Activator Inhibitor-1 (PAI-1; 4G/5G genotype), Methylenetetrahydrofolate reductase (MTHFR; c.677C > T genotype), and homozygous Angiotensin-Converting Enzyme Insertion/Deletion (ACE I/D; DD genotype). <b>Conclusions:</b> While each variant has been individually associated with thrombotic risk, their co-occurrence in a single patient with simultaneous arterial and venous thromboses has not, to our knowledge, been previously documented. This case underscores the potential for gene-gene interactions to amplify thrombotic risk, even in the presence of variants traditionally considered to confer only modest to moderate risk. It highlights the need for a multidisciplinary approach and raises questions regarding pharmacogenetics, anticoagulation, and future research into cumulative genetic risk in complex thrombotic phenotypes.

DCC
Also flagged:axonalaxonssynapsedendritesaxonmossy
Journal Article 2025-09-01 ✓ 1 Snippet van Bruggen R, Manzanet Freyre K, Wang M, Tan Q.
In-Text Gene Mentions

…, Ephb1 ,Dcc, and Nrp1…

Show Full Abstract

Proper brain wiring relies on the precise distribution of axonal projections to specific subcellular domains of their target neurons. These spatially confined connections establish the anatomical foundation for neural circuit assembly. The mossy fiber (MF)-CA3 pathway in the hippocampus is an excellent system to study the mechanisms underlying lamina-specific connectivity. In rodents, MF projections develop postnatally and reach their mature configuration by the end of the second postnatal week. MF axons synapse on the proximal segments of the dendrites but avoid the somas of CA3 pyramidal neurons. As dentate gyrus granule neurons are continuously generated and integrated into the existing hippocampal circuit throughout the postnatal period and adulthood, the mechanisms that guide MF axons to achieve lamina-specific targeting of these later-born granule neurons remain unclear. Here, we show that deletion of the neurodevelopmental disorder-associated protein capicua (CIC) results in abnormal MF targeting in the mouse hippocampus. Notably, this defect emerges after the second postnatal week and persists into adulthood, distinguishing it from classical MF guidance defects, which typically manifest during the first postnatal week. We also demonstrate that this miswiring is due to CIC loss in dentate gyrus granule neurons rather than CA3 pyramidal neurons. Single-nucleus transcriptomics and trajectory analysis reveal a loss of a mature granule neuron subtype and dysregulation of axon guidance genes that are normally downregulated as granule neurons mature. Our findings uncover a previously unrecognized role for CIC in hippocampus development and offer insights into the regulation of lamina-specific MF connectivity in the postnatal brain.

Also flagged:polysometranslationalpolysomeseukaryotic initiation factor 1A domain containing 3ribosomeprotein synthesis
Journal Article 2025-09-01 No Snippets Ming H, Iyyappan R, Kakavand K, Dvoran M, Susor A, Jiang Z.
Show Full Abstract

Translational regulation plays a pivotal role during pre-implantation development. However, the mechanisms by which messenger RNAs (mRNAs) are selectively regulated over time, along with their dynamic utilization and fate during this period, remain largely unknown. Here, we performed fraction-resolved polysome profiling and characterized translational dynamics across oocytes and early embryo development. This approach allowed us to examine the changes in translation during pre-implantation development in high resolution and uncover previously unrecognized modes of translational selectivity. We observed a stage-specific delay in translation, characterized by the postponed recruitment of stored mRNAs-either unbound or associated with light ribosomal fractions-into actively translating polysomes (heavy fraction). Comparative analysis of translatome with proteomics, RNA N6-methyladenosine modifications, and mRNA features further revealed both coordinated and distinct regulatory mechanisms during pre-implantation development. Furthermore, we identified a eukaryotic initiation factor 1A domain containing 3, Eif1ad3, which is exclusively translated at the two-cell stage and is essential for embryonic development by regulating ribosome biogenesis and protein synthesis. Collectively, our study provides a valuable resource of spatiotemporal translational regulation in mammalian pre-implantation development and highlights a previously uncharacterized translation initiation factor critical for early embryos.

LRRC7
Also flagged:chromosomechromosomeschiasmacohesinchromatinPch2
Journal Article 2025-09-01 ✓ 2 Snippets Leon VA, Markowitz TE, Hong S, Raghavan AR, Heldrich J, Kim KP, Hochwagen A.
In-Text Gene Mentions

Condensinis recruited near…

Condensin

Show Full Abstract

Crossover recombination supports meiotic chromosome inheritance and fertility by establishing chiasmata between homologous chromosomes prior to the first meiotic division. In addition to the physical exchange of DNA mediated by meiotic recombination, chiasma formation also involves restructuring of the underlying chromosome axis, possibly to help with chiasma maturation or to resolve chromosomal interlocks. Here, we identify condensin as an important regulator of axis remodeling in S. cerevisiae. Condensin is recruited near sites of meiotic crossover designation by pro-crossover factors but is largely dispensable for DNA exchange. Instead, condensin helps to create discontinuities in the meiotic chromosome axis by promoting removal of cohesin. In addition, chromosomes of condensin mutants exhibit unusually common parallel chromatin clouds and experience a chromosomal buildup of the conserved axis remodeler Pch2. Consistent with an important role of axis restructuring at crossover sites, the canonical anaphase-bridge phenotype of condensin mutants is partly rescued by redirecting meiotic DNA repair to sister chromatids instead of homologous chromosomes, suggesting that crossover-associated axis reorganization is important for faithful meiotic chromosome segregation.

DCC
Also flagged:CHD1Lautismchromatintranscription factorsSOX2OTX2
Journal Article 2025-09-01 ✓ 4 Snippets Lemée MV, Loviglio MN, Ye T, Tilly P, Keime C, Weber C, Petrova A, Klein P, Morlet B, Wendling O, Jacobs H, Tharreau M, Geneviève D, Godin JD, Romier C, Duteil D, Golzio C.
In-Text Gene Mentions

…8/52 genes (DCC, DPP6, EBF3,…

…genes: CPLX2 ,DCC, EBF3 ,…

…, CPLX2 ,DCC, MDGA1 ,…

…pleiotropic genes (DCC, UNC5D ) with…

Show Full Abstract

Distal 1q21.1 deletions and duplications are associated with variable phenotypes including autism, head circumference and height defects. To elucidate which gene(s) are responsible for the 1q21.1 duplication/deletion-associated phenotypes, we performed gene manipulation in zebrafish and mice. We modeled 1q21.1 duplication by overexpressing the eight human protein-coding genes in zebrafish. We found that only overexpression of CHD1L led to macrocephaly and increased larval body length, whereas chd1l deletion caused opposite phenotypes. These mirrored phenotypes were also observed in mouse embryos. Transcriptomic, cistromic, and chromatin accessibility analyses of CHD1L knock-out hiPSC-derived neuronal progenitor cells revealed that CHD1L regulates the expression levels and chromatin accessibility of genes involved in neuronal differentiation and synaptogenesis, including autism genes. Moreover, we found that CHD1L favors telencephalon development during forebrain regionalization by facilitating chromatin accessibility to pioneer transcription factors, including SOX2 and OTX2, while simultaneously compacting chromatin through its interaction with the repressor NuRD complex. Overall, our data reveal a novel role for CHD1L as a master regulator of cell fate and its dosage imbalance contributes to the neuroanatomical and growth phenotypes associated with the 1q21.1 distal CNV.

HFE
Also flagged:Ironmetabolismovarian endometriosisinfertilityinfertileTRF
Journal Article 2025-09-01 ✓ 1 Snippet Huang L, Qin W, Su T, Pang H, Xie D, Liao J, Qin X.
In-Text Gene Mentions

…disorders, such ashemochromatosisor Wilson's disease;…

Show Full Abstract

<h4>Objectives</h4>This study investigates iron metabolism characteristics in patients with ovarian endometriosis (EMs) and infertility.<h4>Methods</h4>A case-control study was conducted involving 76 infertility patients treated at Baise People's Hospital from December 2023 to December 2024. Among them, 36 patients with ovarian EMs and infertility were included in the case group, whereas 40 infertile women without EMs constituted the control group. The indices of iron metabolism, including serum iron (SI), transferrin (TRF), soluble transferrin receptor (sTfR), unsaturated iron binding capacity (UIBC), total iron binding capacity (TIBC), and transferrin saturation (TS), were measured and compared between the two groups. Furthermore, the association between iron metabolism levels and the development and progression of EMs was systematically analyzed.<h4>Results</h4>The SI level was significantly higher in the study group than in the control group (p < 0.01). Levels of TRF, UIBC, and TIBC were significantly lower in the study group compared to the control group (p < 0.001). No significant differences were observed in sTfR or TS between the two groups (p > 0.05). Receiver operating characteristic curve analysis demonstrated that the combined assessment of SI, TRF, UIBC, and TIBC provided statistically significant diagnostic accuracy for differentiating between the two groups, with corresponding p values less than 0.01.<h4>Conclusion</h4>Abnormal iron metabolism is present in patients with EMs and infertility. Excessive iron accumulation may exacerbate disease progression and influence reproductive prognosis. Modulating iron metabolism could potentially serve as a novel strategy to improve the condition of EMs and pregnancy outcomes.

H4C8
Also flagged:lactylationLRP1intervertebral disc degenerationLactatelactic acidmethylation
Journal Article 2025-09-01 ✓ 1 Snippet Yang Y, Ai Z, Liu D, Gao X.
In-Text Gene Mentions

…of IVDD, andH4C8, SIRT1, H2AC6, and…

Show Full Abstract

Intervertebral disc degeneration (IVDD) causes neck, back and low back pain, and is a major global public health problem. Lactate, a metabolic product of disc cells, relates closely to degeneration. Lactylation, driven by lactic acid, associates with IVDD; targeting related genes may offer new therapies. This study aimed to identify causal lactylation-related genes in IVDD via multi-omics summary-based Mendelian randomization (SMR). In this study, data from a genome-wide association study (GWAS) were combined with methylation quantitative trait loci (mQTL) and expression quantitative trait loci (eQTL) to investigate the relationship between lactylation-related genes and disc degeneration. Lactylation-related genes from GeneCards, IVDD GWAS data from FinnGen, cis-eQTL data from eQTLGen Consortium, cis-mQTL data from SMR. SMR analysis and HEIDI tests were used to assess causality, and associations within mQTL-eQTL pathways were analyzed using multicohort data. Significance of results was determined using p_SMR < .05 and p_HEIDI > .01. At the gene expression level, 11 lactylation-related genes were identified, of which KAT5, CEACAM6, NR6A1, MRE11, LUC7L2, H2BC12, and RARG were negatively correlated with the risk of IVDD, and H4C8, SIRT1, H2AC6, and LRP1 were positively correlated with the risk of IVDD. At the DNA methylation level, 27 CpG sites near 14 genes were found to have a causal effect on IVDD, however, when combined with the causal effect of gene expression, only 11 CpG sites near 4 genes existed that had a causal effect. After integrating the multi-omics data between mQTL and eQTL, we identified 3 lactylation-related genes, KAT5, CEACAM6, and LRP1. cg01515074 methylation-induced upregulation of LRP1 increases degeneration risk, while cg12146864 methylation-mediated downregulation of LRP1 reduces this risk, collectively reinforcing the role of LRP1 as a key driver in IVDD pathogenesis. In this study, we identified lactylation-related genes that have a causal role in IVDD, mainly LRP1. The resulting study emphasizes the importance of LRP1 in the pathogenesis of IVDD, with the potential to be a therapeutic target. Integration of multi-omics data has provided new understanding in the molecular mechanisms of IVDD pathogenesis and new strategies for targeted therapy.

HFE
Also flagged:breast cancergoutcancerpathogenesisGene ExpressionMLX interacting protein
Journal Article 2025-09-01 ✓ 2 Snippets Zhang H, Huo X, Li J, Li N, Xiao W, Wang M, Zhao F, Zhao Y.
In-Text Gene Mentions

…GCKR, MLXIPL, MLXIP,HFE, and SLC2A9 demonstrate…

…GCKR, MLXIPL, MLXIP,HFE, and SLC2A9 exhibited…

Show Full Abstract

The association between gout and cancer risk has garnered significant interest, particularly in relation to breast cancer, which is the most prevalent cancer among women globally. Nevertheless, the coincidental link between gout and breast cancer, along with its underlying pathogenesis, remains inadequately elucidated. This study utilized publicly available genome-wide association study data from individuals of European ancestry, with sample sizes drawn from multiple genome-wide association study studies, covering genetic variations related to gout and breast cancer. Additionally, transcriptomic data analysis was conducted using datasets from the Cancer Genome Atlas (TCGA) and the Gene Expression Omnibus databases, with the TCGA database comprising 199 adjacent normal tissue samples and 1085 breast cancer tissue samples. Following a rigorous sequence of quality control procedures, we incorporated suitable instrumental variables that exhibited significant associations with the exposure (gout). Five algorithms, namely Mendelian randomization (MR) Egger, weighted median, inverse variance weighting, simple mode, and weighted mode, were employed to deduce the causal link between gout and breast cancer. Moreover, we evaluated the reliability of the MR analysis through heterogeneity and pleiotropy assessments. Subsequently, transcriptomic data analysis was conducted utilizing TCGA and Gene Expression Omnibus databases to explore the possible correlation between gout and breast cancer. MR analysis revealed a stochastic relationship between genetic predisposition to gout and a decreased risk of breast cancer in individuals of European descent (odds ratio: 0.83, 95% CI: 0.71-0.98, P = .031). Additionally, the sensitivity analysis underscored the strength and reliability of the present MR findings. A key gene (MLX interacting protein-like) was identified using lasso regression methods. The gene showed a strong predictive performance in survival prediction (P < .05). Our MR study offers evidence indicating that genetic variations linked to gout are causally correlated with a decreased risk of breast cancer in the European population. Furthermore, transcriptomic data analysis indicates that the key gout-associated gene, MLX interacting protein-like, is implicated and holds predictive significance in the pathogenesis of breast cancer.

Also flagged:Alendronic AciddiamonddiscHydroxyapatitecollagenCollagen Type I
Journal Article 2025-09-01 No Snippets Méndez Gonzáles MV, Estrella Hernandez K, Navarrette-Olvera K, Zavala Alonso NV, Escobar Garcia DM, Gutiérrez Sánchez M.
Show Full Abstract

<h4>Objective</h4>The present study aimed to evaluate the changes in the physicochemical properties of dentine after irrigation with a solution of 0.22% alendronic acid (AA) as a chelating agent compared to 17% ethylene-diaminetetraacetic acid (EDTA).<h4>Methods</h4>A total of 48 extracted premolars and molars that were intact, free of caries or cracks, without root canal treatment and restorations were collected. The roots were randomised into three groups (n=16): Group A: Distilled Water (dH2O); Group B: 17% EDTA, and Group C: 0.22% AA. Longitudinal sections of the dentine with a root of 1x1x10 mm were made with a diamond disc and a low-speed handpiece for bending tests (n=9). For morphological analysis, images were taken with a scanning electron microscope, crystallographic analysis with X-ray diffraction, and chemical analysis with Fourier Transform Infrared Spectroscopy (FTIR) and Vickers Hardness. For this purpose, cross-sections were made through the root using the Isomet to obtain 3 mm thick dentine discs (n=14). The samples were stored in dH2O for up to 24 h before use and dried at room temperature before exposure to chelating solutions for 1 h in a Stuart STR6D mixer at 50 rpm. For data comparison, the Kruskal-Wallis statistical test was used (α=0.05).<h4>Results</h4>The chelating solutions of EDTA and AA cause alterations in the physicochemical structure of dentine, attacking mainly the inorganic part (Hydroxyapatite), which was observed in the decrease in intensity of the peaks in the X-ray diffraction pattern of hydroxyapatite. This generated a greater exposure of the collagen fibres that were observed in SEM and the increase in the bands characteristic to Collagen Type I in the infrared spectrum at 1645, 1550, and 1240 cm-1 belonging to amide I (C=O), amide II (N-H) and amide III (C-N), significantly affecting its dentine hardness (p=0.001).<h4>Conclusion</h4>AA can be used as a chelating agent in the area of dentistry. It does not generate a significant demineralising effect that modifies the physicochemical properties of dentine, as observed with EDTA.

Also flagged:Cancerdeathsecretioncancerspancreatic cancersKaposi sarcoma
Journal Article 2025-09-01 No Snippets Zhao D, Wang Y.
Show Full Abstract

Cancer remains one of the leading causes of death worldwide. Despite various efforts to reduce cancer mortality, such as decreasing tobacco use, improving early detection and prevention methods, and enhancing cancer care and treatments, certain racial and ethnic groups continue to experience higher cancer incidence and mortality rates, along with shorter survival compared to other groups. Several factors, including socioeconomic status, environmental influences, diet, and behavior, contribute to these racial disparities. More importantly, scientists have identified a genetic basis for these observations, with a growing body of research highlighting microRNAs as significant players in cancer racial disparities. This review focuses on various types of microRNAs (such as epigenetically regulated, copy number altered, circulating, and exosomal) and microRNA single-nucleotide variations in the context of cancer-related racial disparities. Additionally, we have summarized the existing resources, including racial-specific model cell lines and cancer cohorts that include patients from diverse racial and ethnic backgrounds. Moreover, we provide here several key things to consider for future investigations. While many challenges remain, we aim to offer a balanced overview of this field to help scientists with varying expertise address these issues. This article is categorized under: RNA in Disease and Development > RNA in Disease.

HFE
Also flagged:Acute Ischemic StrokestrokestrokeshsCRPD‐dimerdeath
Journal Article 2025-09-01 ✓ 1 Snippet Mao H, Han G, Sha Y, Wu J, Tang M, Pan Z, Zhou L, Zhu Y, Ni J.
In-Text Gene Mentions

…lower proportion ofTOAST type 1 strokestype 1 strokes…

Show Full Abstract

<h4>Background</h4>Acute ischemic stroke (AIS) is a leading cause of mortality and disability worldwide, imposing a significant burden on patients and healthcare systems. Length of stay (LOS) is a critical metric for assessing hospital resource utilization and patient prognosis. Identifying characteristics of AIS patients with prolonged LOS is essential for optimizing resource allocation and improving patient management. This study aimed to use cluster analysis to profile AIS patients with long LOS in a comprehensive hospital and explore differences in characteristics across gender and age subgroups.<h4>Methods</h4>This single-center, retrospective cohort study included 664 patients admitted with AIS to Peking Union Medical College Hospital from June 2012 to September 2021. Data collected included demographics, admission NIHSS scores, stroke risk factors, etiologies, and diagnostic workups. Patients were clustered using the K-prototype method, a machine learning technique for subclassifying complex data, to differentiate between patients with long and short LOS. Statistical tests were used to identify significant differences between the clusters.<h4>Results</h4>Cluster analysis revealed that patients with longer LOS had a higher proportion of females (42.9% vs. 24.7%, p < 0.001) and were generally younger (52.3 vs. 65.4 years, p < 0.001). This group exhibited lower proportions of TOAST type 1 strokes (17.7% vs. 70.4%, p < 0.001), higher levels of hsCRP and D-dimer, and no significant difference in acute phase NIHSS scores. Notably, in-hospital strokes and admissions to non-neurological departments were more frequent in the long LOS group. Subgroup analysis by gender and age revealed that younger males and females shared similar characteristics with the overall long LOS group, including a higher incidence of non-neurological department admissions and higher D-dimer levels.<h4>Conclusions</h4>This study highlights the heterogeneity of AIS and the importance of etiological identification, particularly in younger and female patients. Our findings suggest that traditional factors like NIHSS scores may not fully capture the complexity of factors influencing LOS in these groups. Improved cross-departmental collaboration is crucial for better management of AIS patients.

CACNA1E
Also flagged:WWOXHIF1αcancercytoplasmbreast cancerglioblastoma
Journal Article 2025-09-01 ✓ 1 Snippet Baryła I, Hammouz RY, Maciejek K, Bednarek AK.
In-Text Gene Mentions

…as CACNA1B andCACNA1E, both of which…

Show Full Abstract

WWOX and HIF1α proteins are involved in cancer progression; their functions are closely related. WWOX binds HIF1α through its WW domains, sequestering it in the cytoplasm and inhibiting its transcriptional activity. This study evaluates the prognostic significance of the <i>WWOX</i>/<i>HIF1A</i> interaction across cancers, breast cancer subtypes, glioblastoma (GBM), low-grade glioma (LGG), and hepatocellular carcinoma (HCC) through gene expression and pathway analysis focused on metabolism, ECM, and epithelial-mesenchymal transition. In breast cancer, metabolic pathways correlated with good prognosis in basal subtypes. HER2 subtypes showed enrichment in DNA replication pathways. Luminal A subtypes showed favourable prognosis via TNF and PI3K/AKT signalling, while luminal B subtypes had poor prognosis tied to metabolic activity; genes associated with good prognosis mirrored those tied to poor prognosis in luminal A. In HCC, enhanced metabolic activity was associated with good prognosis. In contrast, poor prognosis involved TNF signalling and cytoskeleton-related pathways, indicating more aggressive tumour behaviour. In LGG, good prognosis was linked to metabolic and cAMP pathways, while poor outcomes involved TNF, cell cycle, apoptosis, and focal adhesion pathways. GBM showed similar patterns: metabolic and cAMP pathways indicated better outcomes, while NFKB, TNF, JAK-STAT, and PI3K/AKT pathways marked poor prognosis. These findings suggest the <i>WWOX</i>/<i>HIF1A</i> ratio is a robust prognostic marker and a possible guide for developing targeted treatments.

Also flagged:DialysisIgGantibodiesCOVID-19infectionantibody
Journal Article 2025-09-01 No Snippets Colavita F, Castilletti C, Matusali G, Accordini S, De Masi S, Da Cas R, Gianesini N, Baglio G, Francalancia M, Traversa G, Chiarotti F, Meschi S, Bianco E, Salomone M, Mele A, Messa P, Zoccali C, Menniti Ippolito F, The COVIDVaxDia Study Group.
Show Full Abstract

<b>Background:</b> COVID-19 vaccination and subsequent booster doses became critical components of public health strategies to control the pandemic and reduce disease severity, especially in fragile individuals. Among these, subjects undergoing dialysis represent one of the highly vulnerable populations. <b>Methods:</b> We conducted a multicenter case-control study among dialysis patients between March 2021 and May 2022 (study population n = 3264). We evaluated anti-S/RBD-IgG and anti-SARS-CoV-2 neutralizing antibodies before (T3) and after (T4) the third dose in individuals with a COVID-19 diagnosis after the third dose (cases) and in those who did not report infection (controls). <b>Results:</b> The study included 187 cases and 150 controls. Serological analysis showed a significant increase (<i>p</i> < 0.001) in anti-SARS-CoV-2 antibody levels after the third vaccine dose (from T3 to T4) in both groups. At T3, with the same number of days between the second dose and T3, the antibody levels detected were significantly lower in cases as compared to controls. At T4, we observed similar antibody titers in the two groups. Notably, the mean difference in time from the third dose to T4 was significantly greater in controls (73.0 days vs. 36.7, <i>p</i> < 0.001), suggesting a reduced antibody waning in controls. Accordingly, multivariate analysis showed that the risk of infection was considerably reduced by the pre-third-dose antibody levels. <b>Conclusions:</b> This study reinforces the critical role of the humoral response in preventing infections in the vulnerable population of dialysis patients. Regular monitoring of antibody levels and timely administration of booster doses are essential to optimize protection in this group.

TNFSF4
Also flagged:PSMB9TumorProteasome subunit beta type-9proteasome betaimmunoproteasomeimmune responses
Journal Article 2025-09-01 ✓ 1 Snippet Ma X, Zhu Q, Wu Z, Han W.
In-Text Gene Mentions

…functions, including IL2,TNFSF4, GZMA, CD27, CCL5,…

Show Full Abstract

Proteasome subunit beta type-9 (PSMB9), a member of the proteasome beta subunit family, encodes the pivotal β1i component of the immunoproteasome. PSMB9 plays a crucial role in antigen processing and presentation; however, its comprehensive role in orchestrating a tumor-immune landscape and regulating the anti-tumor immune responses remains unexplored. Here we investigated the context-dependent functions of PSMB9 by integrating multi-omics data from The Cancer Genome Atlas, Genotype-Tissue Expression database, Human Protein Atlas, Tumor Immunotherapy Gene Expression Resource, and multiple other databases. Moreover, we explored the predictive value of PSMB9 in multiple immunotherapy cohorts and investigated its functional relevance in CAR-T therapy using genome-scale CRISPR/Cas9 screening, gene knockout cell line in vitro, and clinical cohort validation. We found widespread dysregulation in PSMB9 across cancers, predominantly upregulated in most malignancies and associated with advanced pathological stages in specific contexts. PSMB9 was also broadly and negatively correlated with tumor stemness indices. Crucially, PSMB9 expression was robustly linked to anti-tumor immunity by being significantly correlated with immune-pathway activation (e.g., IFN response, cytokine signaling), immune regulatory and immune checkpoint gene expression, and enhanced infiltration of T cells across nearly all tumor types. Consequently, elevated PSMB9 predicted superior response to immune checkpoint inhibitors in multiple cohorts, showing comparable predictive power to established predictive signatures. Furthermore, CRISPR/Cas9 screening identified PSMB9 loss as a novel mechanism of resistance to CD19 CAR T cell therapy, with PSMB9-deficient tumor cells exhibiting a survival advantage under CAR-T pressure, supported by trends in clinical CAR-T outcomes. Our study uncovers PSMB9 as a previously unrecognized critical regulator of the tumor immune landscape in a pan-cancer scope, whose expression orchestrates key immune processes within the tumor microenvironment and serves as a potent biomarker for patient prognosis. Critically, we first established PSMB9 as a novel prognostic indicator for both checkpoint blockade and CAR-T cell therapies, highlighting its dual role as a crucial immune modulator and a promising biomarker for guiding T cell-based immunotherapy strategies across diverse human cancers.

SERPINC1
Also flagged:liver cirrhosisalbuminprothrombinInterleukin-8HBV liver cirrhosiscoagulation
Journal Article 2025-09-01 ✓ 1 Snippet Qin X, Chen J, Zhang HN, Du L, Ma Y, Li Y, Lu Y, Wang YT, Wu LF, Yu ZH, Hu MJ, Li LJ, Liao B, Li Z, Yang ZY, Li K, Yuan YF.
In-Text Gene Mentions

…function, PTTA andantithrombin-III(AT-III) were tested.…

Show Full Abstract

<h4>Background</h4>Large number of decompensated liver cirrhosis patients in China have been diagnosed with hepatitis B virus (HBV). Human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) can possibly cure decompensated liver cirrhosis because of their self-renewal and multidirectional differentiation potential.<h4>Aim</h4>To explore the safety and effect of treating liver cirrhosis with HBV by hUC-MSCs.<h4>Methods</h4>Twenty-four participants were recruited, divided into 3 groups, and injected with different amounts of hUC-MSCs <i>via</i> the peripheral vein. Therapy was administered 3 times. A 24-week follow-up examination of each patient's liver function, coagulation function, general condition, and immune system was performed. Adverse events were also recorded. A 2-year survival assessment was subsequently performed.<h4>Results</h4>Infusion therapy rapidly improved liver function. Serum albumin transiently increased on days 57 and 85 but returned to baseline by day 169, while prothrombin time activity demonstrated sustained improvement from day 29 through day 169. Interleukin-8 levels decreased persistently throughout treatment. All dosage groups achieved 100% 6-month survival; 2-year survival rates were 66.7% (low-dose), 100% (medium-dose), and 87.5% (high-dose). The interaction between dosage and efficacy was weak. Notably, the improvement in liver function was statistically significant and sustained for almost 3 months, suggesting clinically meaningful therapeutic durability.<h4>Conclusion</h4>hUC-MSCs can be considered a safe treatment for patients with decompensated liver cirrhosis associated with HBV. However, larger-scale randomized controlled trials are needed to prove its therapeutic effect.

HFE
Also flagged:colorectal cancercolorectal polypscoagulation syndromepolypcolonic polypscancer
Journal Article 2025-09-01 ✓ 5 Snippets Ji DH, Guan ZA.
In-Text Gene Mentions

…more frequent withHFE, particularly post-polypectom…

…CSP group, withHFEshowing intermediate recurrenc…

…the surgical method:HFEgroup ( n…

…ForHFE, using the Olympus…

…mm in theHFEgroup, 7.89 ±…

Show Full Abstract

<h4>Background</h4>Colorectal polypectomy is fundamental to the prevention of colorectal cancer, utilizing several endoscopic techniques. Robust comparative data regarding the efficacy and safety of these modalities in clinical practice are limited.<h4>Aim</h4>To evaluate and compare the efficacy and safety of three endoscopic polypectomy techniques, namely, high-frequency electroresection (HFE), cold snare polypectomy (CSP), and endoscopic mucosal resection (EMR), for the treatment of colonic polyps.<h4>Methods</h4>This single-center retrospective cohort study included adults who underwent endoscopic resection of pathologically confirmed colorectal polyps at Central Hospital Affiliated to Shandong First Medical University between January 2015 and December 2023. Patients were grouped by technique: HFE (<i>n</i> = 107), CSP (<i>n</i> = 106), and EMR (<i>n</i> = 108). Standardized preoperative, intraoperative, and postoperative protocols were applied. Outcome measures included resection status (<i>en bloc</i>, R0, R1, and Rx), adverse events (immediate/delayed bleeding, perforation, and post-polypectomy coagulation syndrome), postoperative pain (visual analog scale at 1, 3, and 5 hours), and 12-month recurrence rate.<h4>Results</h4>Baseline demographics and polyp characteristics, except for polyp diameter, were comparable among groups. CSP achieved the highest <i>en bloc</i> resection rate, whereas HFE had a higher R0 resection rate. Polyp diameter was largest in the EMR group. Procedure duration was shortest with HFE. Adverse reactions were more frequent with HFE, particularly post-polypectomy bleeding and delayed perforation, whereas CSP demonstrated a superior safety profile and the lowest incidence of complications. Postoperative pain diminished in all groups over time but was consistently low for CSP and EMR. Recurrence rates were significantly higher in the EMR group <i>vs</i> CSP group, with HFE showing intermediate recurrence.<h4>Conclusion</h4>CSP offers the best safety profile and lowest recurrence rate among patients undergoing endoscopic resection of colorectal polyps, whereas HFE confers a high R0 resection rate but increased risk of adverse events. EMR remains essential for large polyps despite elevated recurrence. Technique selection should be tailored according to polyp characteristics and patient risk factors to optimize outcomes.

Also flagged:porphyriasPorphyriametabolic disordershemebiosynthesisporphyrin
Journal Article 2025-09-01 No Snippets Zeng T, Huang SY, Chen JN, Pang JH, Chong YT, Li XH.
Show Full Abstract

Porphyria refers to a group of rare inherited metabolic disorders caused by enzymatic deficiencies in the heme biosynthesis pathway. These deficiencies lead to the pathological accumulation of neurotoxic porphyrin precursors, resulting in multisystem damage. Currently, there are no curative therapeutic interventions, and patients frequently experience severe morbidity or life-threatening complications. Among the most critical manifestations is protoporphyric liver disease, in which hepatotoxic porphyrins and their precursors drive progressive hepatic injury and cholestasis. Persistent elevation of these metabolites can lead to irreversible parenchymal damage, significantly affecting both quality of life and long-term prognosis. The clinical presentation of porphyria-associated liver injury is highly variable and often has an insidious onset. However, a subset of patients may experience rapid progression to acute liver failure or fulminant hepatic dysfunction. Diagnosis is based on clinical evaluation and is confirmed by genetic testing. Current treatment strategies are focused on symptom management while underlying disease mechanisms remain unaddressed, posing significant therapeutic challenges. This review summarizes the pathophysiology, clinical manifestations, and diagnostic approaches for porphyria-associated liver injury, highlighting emerging therapies with the potential to improve patient outcomes.

HFE
Also flagged:Albuminliver fibrosischronic hepatitis Chepatocellular carcinomaaspartate aminotransferasealanine aminotransferase
Journal Article 2025-09-01 ✓ 1 Snippet Ewid M, Sherif H, Saquib N, Alammari AM, Ismail AAM, Alkahlot MH, Ahmed ZT, Al-Zabidi FZM, Al Mutiri N.
In-Text Gene Mentions

…disorders, Wilson’s disease,hemochromatosis, and/or alcohol-related liver…

Show Full Abstract

<h4>Background</h4>The albumin-bilirubin (ALBI) score was developed as a prognostic tool for patients with hepatocellular carcinoma. However, its new role as an indicator of liver fibrosis in chronic hepatitis C virus (HCV) patients is under investigation.<h4>Aim</h4>To investigate the ALBI score as a non-invasive means of assessing the extent of liver fibrosis in chronic HCV patients.<h4>Methods</h4>We evaluated hospital records of 231 eligible chronic HCV patients from King Fahad Specialist Hospital in Buraydah, Saudi Arabia. Demographic/clinical data, liver function tests, non-invasive tests for liver fibrosis, and ALBI score/grades were evaluated before and two years after direct-acting antivirals (DAA) treatment.<h4>Results</h4>The median ALBI score improved from -2.51 to -2.62 after DAA treatment (<i>P</i> < 0.05). Additionally, the ALBI score improved irrespective of the level of fibrosis, with improvement more evident in patients with advanced fibrosis (-2.26 to -2.41, <i>P</i> < 0.05). The ALBI score showed significant positive correlation with non-invasive tests for liver fibrosis (aspartate aminotransferase/alanine aminotransferase ratio, aspartate aminotransferase to platelet ratio index, and fibrosis-4 index) at baseline and after DAA treatment (<i>P</i> < 0.05). Moreover, the receiver operating characteristic curve demonstrated ALBI score's ability to predict advanced fibrosis (F3, F4) [area under the curve = 0.76, (95% confidence interval: 0.70-0.81), <i>P</i> < 0.001, best cut-off value = -2.38 (sensitivity 60% and specificity 83%)].<h4>Conclusion</h4>The ALBI score appears to be a useful non-invasive marker for assessing liver fibrosis in chronic HCV patients and may serve as a valuable tool for monitoring hepatic function during and after DAA treatment.

Also flagged:degenerative diseasesosteoarthritistranslationalextracellulartype II collagenproteoglycans
Journal Article 2025-09-01 No Snippets Cong B, Zhang FH, Zhang HG.
Show Full Abstract

Articular cartilage damage caused by trauma or degenerative diseases such as osteoarthritis remains a major therapeutic challenge due to the tissue's limited regenerative capacity. Traditional surgical interventions-including microfracture, autologous chondrocyte implantation, and osteochondral grafting-often result in the formation of biomechanically inferior fibrocartilage and fail to restore long-term joint function. In contrast, stem cell-based strategies have emerged as a promising approach for regenerating hyaline-like cartilage by combining the biological potential of mesenchymal stem cells and induced pluripotent stem cells with advances in tissue engineering. This review synthesizes the current understanding of cartilage structure and repair limitations, evaluates the regenerative potential of various stem cell sources, and highlights engineering innovations such as bioactive scaffolds, controlled growth factor delivery, and three-dimensional bioprinting. We also examine key preclinical studies and early-phase clinical trials demonstrating the safety and efficacy of stem cell-based therapies. Finally, we explore future directions, including gene editing, exosome-based therapeutics, and personalized regenerative strategies, that may address remaining translational barriers. Collectively, stem cell-centered approaches offer a transformative avenue toward durable, functional cartilage repair and hold strong potential for clinical application.

Also flagged:photosynthesiswaterRubiscotriosecarboxylationchloroplast
Journal Article 2025-09-01 No Snippets Yin X.
Show Full Abstract

Determining relative limitations of stomatal, mesophyll, and biochemical components (l<sub>s</sub>, l<sub>m</sub>, and l<sub>b</sub>, respectively) to photosynthetic rate (A) can help understand leaf ecophysiology for specific growth conditions. The differential method has been widely applied to estimate the relative limitations in C<sub>3</sub> plants, first for comparing two contrasting growth conditions, but also increasingly for a single condition. In addition to the common practical issue that estimating mesophyll conductance is sensitive to measurement noise, the method has a theoretical feature when applied to photosynthesis for a single condition, that is, one of the three in-serial underlying parameters differs from the other two in nature. A new method was proposed, in which a coupled CO<sub>2</sub>-diffusion and photosynthesis model was fitted to data for A, using intercellular-CO<sub>2</sub> and ambient-air-CO<sub>2</sub> levels as input, respectively. From two parameter estimates from model-fitting, l<sub>s</sub>, l<sub>m</sub>, and l<sub>b</sub> can be calculated analytically, conditional on that l<sub>s</sub> + l<sub>m</sub> + l<sub>b</sub> = 100%. This method was illustrated using data sets for plants grown under various water, nitrogen, and temperature conditions. The theoretical feature caused the differential method to have a 50% higher estimate of l<sub>b</sub> and ~25% lower estimate of l<sub>s</sub> and l<sub>m</sub> than the new method. Such significant differences were interpreted to result from the differential method defining the limitations in terms of increments in A (dA), whereas the new method defines them in terms of A itself. The measurement noise-sensitive estimation of mesophyll conductance caused an average error of another ~8%. Common misuses and misinterpretations of the differential method were analyzed and discussed.

Also flagged:atopic dermatitisADinfectious dermatosesskin diseaseheat-related diseaseheat-related illnesses
Journal Article 2025-09-01 No Snippets Multani HK, Sraa KK, Abbas H, Gandhi S, San Juan LJ, Pan EH, Riedel F, Khan S.
Show Full Abstract

Climate change poses unique dermatologic risks to children due to immature skin barrier function, weakened immune systems, and dependence on caregivers. Under stable environmental conditions, pediatric skin maintains homeostasis through balanced barrier function, microbiome diversity, and immune regulation. The changing climate disrupts these protective mechanisms through rising temperatures, air pollution, ultraviolet (UV) radiation, and adverse weather conditions. Research demonstrates these environmental stressors exacerbate atopic dermatitis (AD), infectious dermatoses, and infestations, all while disproportionately affecting marginalized communities. Current clinical approaches often fail to address the climate-related dimensions of pediatric skin disease, relying on traditional therapies without environmental adaptation. Emerging solutions, such as climate-resilient skincare formulations, teledermatology, and community-based interventions, show promise for more effective management. This review examines the pathophysiological effects of climate change on pediatric skin, evaluates current and emerging care strategies, and identifies critical gaps in the literature. Challenges include limited pediatric-specific climate research, healthcare disparities in vulnerable populations, and inadequate integration of dermatologic concerns into climate policy. Despite these barriers, advances in preventive dermatology and community-based interventions offer opportunities to improve outcomes. Future progress will depend on interdisciplinary efforts to develop climate-adaptive skin care frameworks that protect children's health in a dynamic world.

SUDS3
Also flagged:KAT5PC4chromatinorganizationautophagyB-cell differentiation
Journal Article 2025-09-01 ✓ 1 Snippet Agrawal A, Sikder S, Singh S, Sharma RK, Pallaprolu N, Mitra K, Mondal S, Mukhopadhyay R, Sarkar J, Peraman R, Ravichandiran V, Kundu TK.
In-Text Gene Mentions

…wide range ofchromatin modifiermodifier proteins at…

Show Full Abstract

Human positive coactivator 4 (PC4) is a highly abundant non-histone chromatin protein involved in diverse cellular processes, including transcription regulation, genome organization, autophagy, B-cell differentiation, neurogenesis, DNA repair, etc. Most PC4 is phosphorylated in cells, which interacts with core histones and the linker histone H1 to confer the compact heterochromatin state of the genome. Knocking down PC4 at both cellular and organismal levels leads to significant chromatin decondensation, altered epigenetic landscape, enhanced autophagy, and increased DNA damage susceptibility. Here, we report that besides p300, PC4 also gets acetylated by DNA repair, facilitating lysine acetyltransferase KAT5 (Tip60) at a specific lysine residue (PC4K80) when the cells are subjected to DNA damage. The vulnerability of DNA in PC4 devoid cells was substantially reduced by reintroducing wild-type PC4 to the cells but not the mutant PC4 (PC4K80R), defective in KAT5-mediated acetylation. High-resolution microscopy techniques, including transmission electron microscopy and atomic force microscopy, are employed to visualize chromatin structural changes in response to DNA damage and repair in a Tip60-mediated PC4 acetylation-dependent manner. Presumably, KAT5-mediated acetylation of PC4 at K80 residue facilitates access to the damaged DNA by altering chromatin structures at damage sites, thus promoting DNA repair. This process could be highly significant both in cancer and in aging.

Also flagged:Congenital heart diseasemalformationsdiseasesTetralogy of fallotventricular septal defectatrial septal defect
Journal Article 2025-09-01 No Snippets Wang H, Chen X, Li Y, Xiao S, Teng T, Yang S, Wang K, Zhang M.
Show Full Abstract

Non-coding RNAs (ncRNAs) have emerged as pivotal regulators of gene expression, orchestrating embryonic development and disease pathogenesis. This review synthesizes current knowledge on the origin, biogenesis, and functional diversity of ncRNAs, with a focus on their regulatory crosstalk in congenital heart disease (CHD) and placental development. The fetal heart-placenta axis, a bidirectional signaling network essential for cardiogenesis and placental morphogenesis, is spatiotemporally modulated by ncRNAs through epigenetic and post-transcriptional mechanisms. Through precise regulation of cardiac cell differentiation, angiogenesis, and trophoblast invasion, ncRNAs maintain developmental homeostasis, whereas their dysregulation disrupts these processes, contributing to CHD pathogenesis and positioning them as promising biomarkers. Collectively, this review establishes ncRNAs as molecular bridges between the fetal heart-placenta axis and clinical translation, underscoring their dual utility as diagnostic biomarkers for CHD and modifiable targets to correct placental maldevelopment, thereby advancing precision therapies for congenital disorders.

TNFSF4
Also flagged:Methionyl-tRNA synthetase 1hepatocellular carcinomaAminoacyl-tRNA synthetasescancersgene expressionMARS1
Journal Article 2025-09-01 ✓ 1 Snippet Bu HY, Huang H, Li J, Huang ZB, Huang Y, Huang YK, Wang AM, Wu L, Yuan J, Wang RJ, Lu M, Yu SM, Yi PP, Chen YY, Jiang YP, Hu XW.
In-Text Gene Mentions

…, CD160 ,TNFSF4, CD274 ,…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a significant global health challenge with rising incidence rates and poor prognoses. Aminoacyl-tRNA synthetases (ARSs) are important regulators implicated in the occurrence and progression of several cancers. However, their specific function in HCC remains unclear, and <i>ARSs</i>-related prognostic factors for patient stratification are lacking.<h4>Aim</h4>To investigate the ARSs-related mechanisms of HCC and establish an effective prognostic risk model for stratifying patients with HCC.<h4>Methods</h4>We screened <i>ARSs</i> genes of interest using differential gene expression, mutation, and survival analysis. Western blot and Immunohistochemistry were used to analyze MARS1 expression in the liver tissues of patients with HCC. Functional studies, including CCK-8 cell viability assay, EdU cell proliferation assay, cell cycle assays, Transwell migration and invasion assays, and <i>in vivo</i> tumor xenograft models, were conducted to comprehensively elucidate the specific role of MARS1 in HCC. Moreover, the <i>MARS1</i>-related prognostic score (MRPS) was established by LASSO regression and Cox regression analysis in The Cancer Genome Atlas-HCC and GSE14520 cohorts. Patients' immunotherapy and chemotherapy responses were predicted by immunomicroenvironment and drug susceptibility analysis in both subgroups.<h4>Results</h4><i>MARS1</i> was selected as a target gene from a series of <i>ARSs</i> genes, with markedly higher expression observed in HCC tissues compared to adjacent non-cancerous tissues. Silencing <i>MARS1</i> considerably impeded the proliferation, migration, invasion, and tumorigenic abilities of HCC cells <i>in vitro</i> and <i>in vivo</i>. Moreover, high MRPSs were associated with poor overall survival, altered infiltration of T cells, macrophages, monocytes, elevated immune checkpoint expression (PD-L1, CTLA4, LAG3), and reduced drug sensitivity in HCC.<h4>Conclusion</h4>MARS1 promotes HCC development and represents a potential therapeutic target for HCC management. Furthermore, MRPS serves as an independent prognostic factor for survival and a predictor of tumor treatment response.

HFE
Also flagged:Pigmentationcolorationkeratinmelaninmelanin hyperpigmentationMH
Journal Article 2025-09-01 ✓ 1 Snippet Aseri AA, Khan SD, Alojem KD, Abusag HS.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>Physiological gingival pigmentation is considered aesthetically unappealing, and individuals diagnosed with it often want to reduce or remove the pigmentation. There are various techniques for depigmentation, with laser treatment considered the simplest, most reliable and most cost-effective option. This study assessed two different treatments for physiological gingival pigmentation.<h4>Materials and methods</h4>A total of 12 patients who had gingival pigmentation were randomly divided into a control group (treated with a bur) and a test group (treated with a laser). The same experienced periodontist performed all the procedures. Patient-reported outcomes of the treatments were obtained through a quality of life questionnaire adapted from Melzack's McGill pain questionnaire, which patients completed one day, one week and four weeks after therapy. Additionally, 15 experienced dentists assessed clinical photographs using a Likert scale to compare the clinical outcomes before and one month after the intervention.<h4>Results</h4>Patients were similarly satisfied with both laser and bur depigmentation treatments (54.17%, mean = 2.71, SD = 0.624; 50.0%, mean = 2.50, SD = 1.034, respectively). The patients' satisfaction results were non-significant (P > 0.05), except in terms of noticing an aesthetic change, which was significant (P < 0.05) in favor of the laser approach. The satisfaction rate was higher for laser treatment (84.44%, mean = 4.21) compared to bur depigmentation (78.67%, mean = 3.93). The results were statistically non-significant (P > 0.05). One month after treatment, four patients from the control group reported that the treatment met their expectations, while one participant said it exceeded expectations.<h4>Conclusion</h4>Within the limitations of this study, the findings suggested that laser treatment was slightly superior to bur treatment for managing gingival pigmentation.

HFE
Also flagged:SGLT2SGLT2iheart failureatrial highatrial fibrillationAF
Journal Article 2025-09-01 ✓ 1 Snippet Catrina BI, Negrea MO, Tanasescu C, Batar F, Bitea CI, Manitiu I.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Introduction</h4>Sodium-glucose cotransporter-2 inhibitors (SGLT2i) have demonstrated significant cardiovascular benefits beyond glycemic control, with emerging evidence suggesting antiarrhythmic effects. This prospective study aimed to establish a study protocol for a future trial assessing the impact of SGLT2i on arrhythmia burden in patients with implantable cardiac devices without heart failure with reduced ejection fraction (HFrEF) and to provide preliminary data on clinical trends.<h4>Methods</h4>Patients with cardiac implantable electrical devices (CIEDs) who underwent routine device interrogation were allocated to either SGLT2i treatment or standard care without SGLT2i based on clinical judgment and patient preference, grounded by existing evidence of potential anti-arrhythmic benefits. Arrhythmic events, including atrial high-rate episodes (AHRE), atrial fibrillation (AF) and non-sustained ventricular tachycardia (NSVT), were assessed at baseline and after a one-year follow-up. Levels of N-terminal pro b-type natriuretic peptide (NT-proBNP) or brain natriuretic peptide (BNP) were also evaluated.<h4>Results</h4>Seventeen patients completed follow-up (eight in the SGLT2i group, nine in the control group). The proportion of patients with arrhythmic events remained unchanged in the control group, whereas a trend toward reduced arrhythmic burden was observed in the SGLT2i group, albeit without achieving statistical significance. Additionally, three patients in the control group progressed to permanent AF, whereas no such progression was observed in the SGLT2i-treated group. BNP values showed a significant reduction in the SGLT2i group after treatment.<h4>Conclusions</h4>This study outlines a feasible protocol for CIED-based arrhythmia monitoring and provides preliminary evidence suggesting a potential antiarrhythmic effect of SGLT2i. Larger randomized controlled trials are needed to confirm these findings.

Abstract

Also flagged:ABCB11cholestasisdeathhereditary liver diseasebile acid transporterslocalization
Journal Article 2025-09-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

bioRxiv 2025-09-01 Preprint (No Snippets API) Wall I, Baptista A, Quist J, Rafique H, Li M, Ryan L, Verghese G, Marcotti S, Phillips TA, Owczarek C, Clausen S, Tramm T, Booker G, Mera A, Timbres J, King’s Health Partners Biobank, Sawyer E, Gillet C, Irshad S, Pinder S, Parsons M, Grigoriadis A.
Show Full Abstract

A major challenge in treating Triple-Negative Breast Cancer (TNBC) lies in its molecular, morphological and clinical heterogeneity, which hampers accurate prediction of responses to neoadjuvant treatment. To address this, we introduce SMART: Spatio-Molecular Atlas of Response Trajectories, a comprehensive, multimodal resource compiled from 129 TNBC samples across 89 patients, obtained before, during, and after neoadjuvant chemotherapy (NACT). SMART comprises of 5,096 high quality manually selected spatial transcriptomic profiles enriched for epithelial, immune, or stromal compartments; paralleled with histological annotations, imagebased network analysis and protein expression. Seven novel spatial epithelial archetypes (EAs), seven tumour-immune microenvironments (TIMEs) and their co-localisation patterns were defined, revealing an opposing prevalence of functionally divergent EAs between response groups and the prognostic significance of B-cell enriched TIMEs, in particular those surrounding histologically normal epithelium adjacent to the tumour. The SMART dataset and analytical tools are publicly available via the PharosAI platform, providing the research community with the most comprehensive, manually annotated spatio-molecular transcriptomics atlas of NACT-treated TNBC to date.

Research Square 2025-09-01 Preprint (No Snippets API) Jeong M, Woo H, Yun J, Kim J.
Show Full Abstract

<title>Abstract</title> <p>The prevalence of arthritis continues to increase, which has driven research on new therapeutic approaches. However, existing treatments often have limitations. Angiogenesis and pathological changes in the synovium are the key contributors to the early development of arthritis. Rebastinib, a tie-2 receptor inhibitor, blocks the activation of tie2-expressing macrophages, which are involved in angiogenesis. Although previous studies have highlighted the importance of angiogenesis in early arthritis, few have focused on targeting the tie-2 receptor to slow disease progression. In this study, we evaluated the effects of rebastinib encapsulated in pH-dependent liposomes in a rabbit model of surgically induced arthritis. Additionally, we investigated the efficacy of a pH-dependent liposomal formulation, developed using microfluidic technology for sustained drug release. The results demonstrated that rebastinib-loaded pH-dependent liposomes were stable and provided controlled release and rebastinib effectively inhibited the progression of early stage arthritis in this model. Statistical analyses were performed using SPSS software (IBM Corp., Armonk, NY, USA), and significance was assessed using one-way ANOVA. In conclusion, rebastinib encapsulated in pH-dependent liposomes holds promise as a potential therapeutic strategy for the treatment of early arthritis, offering both stability and efficacy in disease suppression.</p>

bioRxiv 2025-09-01 Preprint (No Snippets API) Iwata R, Gallego-Lopez IM, Erkol E, Limame R, Vandekeere A, Benac N, Turner-Bridger B, Planque M, Ditkowska M, Lein V, Maurinot F, Peredo N, Lamote J, Bonafina A, Vermeersch P, Nguyen L, Aerts S, Fendt S, Vanderhaeghen P.
Show Full Abstract

Developmental processes display temporal differences across species, leading to divergence in organ size and composition. In the cerebral cortex, neurons of diverse identities are generated sequentially through a temporal patterning mechanism conserved throughout mammals. This corticogenesis process is considerably prolonged in the human species, leading to increased brain size and complexity, but the underlying molecular mechanisms remain largely unknown. Here we found that human cortical progenitors displayed lower levels of fatty acid oxidation than their mouse counterparts, in line with their protracted pattern. Treatments that enhance mitochondrial fatty acid oxidation (FAO) accelerated the development of human cortical organoids, including faster progression of neural progenitor cell fate and precocious generation of late-born neurons and glia. FAO accelerated temporal patterning through increased Acetyl-CoA-dependent protein acetylation, including on specific histone transcriptional marks. Thus, species-specific metabolic rates regulate the turnover of post-translation modifications to set the scale of temporal gene regulatory networks of corticogenesis.

Authorea Preprints 2025-09-01 Preprint (No Snippets API) Leung WY, Hung ZG, Leung AW, Wong RM, KAN YLE, Frankie W, LAM GK, Ha SY, Chow TT.
Show Full Abstract

Juvenile xanthogranuloma(JXG) is a rare histiocytic disorder primarily affecting infants with self-limiting skin lesions. We present a severe case of a newborn who exhibited life-threatening multiorgan failure with systemic JXG involving the skin, bone marrow, liver and spleen. Notably, the placenta demonstrated infiltration by CD68+FXIIIa+ histiocytic cells and features of hemochromatosis. MRI of the patient revealed a novel finding of hepatic and pancreatic hemochromatosis in JXG. Our patient was salvaged with cytarabine and steroid-based chemotherapy and intensive care support. This case highlights the critical need for recognition of systemic JXG in neonates presenting with liver failure for timely intervention.