Gene Literature Dashboard

Viewing October 2025 — 864 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← September 2025 November 2025 →
DNAH10
Also flagged:UCHL3PACRGflagellaspermiogenesisAsthenoteratozoospermiamale infertility
Journal Article 2025-10-31 ✓ 5 Snippets Zheng R, Yan J, Wen Y, Wei Y, Zhi W, Tu C, Tan Y, Xu W.
In-Text Gene Mentions

DNAH10interacts with UCHL3-PACRG…

…heavy chain 10 (DNAH10), an inner dynein…

…mechanism through whichDNAH10contributes to this…

…we demonstrated thatDNAH10deficiency leads to…

…Additionally,DNAH10dysfunction leads to…

Show Full Abstract

Asthenoteratozoospermia is a common underlying cause of male infertility, with dynein dysfunction playing an important role in the aetiology of the condition. Dysfunction in certain dynein proteins has been implicated in asthenoteratozoospermia, while others exclusively induce asthenozoospermia in the absence of overt morphological abnormalities in the sperm. Dynein axonemal heavy chain 10 (DNAH10), an inner dynein arm heavy chain protein, was identified as being associated with asthenoteratozoospermia in our previous studies. However, the mechanism through which DNAH10 contributes to this condition remains unclear. In this study, we demonstrated that DNAH10 deficiency leads to abnormal morphology of the sperm head and flagella. Additionally, DNAH10 dysfunction leads to impaired manchette function and aberrant localisation of axonemal proteins. Mechanistically, ubiquitin carboxyl-terminal hydrolase L3 (UCHL3) binds to parkin co-regulated gene protein (PACRG) and stabilises it via deubiquitination. In this process, DNAH10 exerts a bridging effect, enhancing the interaction between the UCHL3-PACRG complex to facilitate their involvement in manchette function. Collectively, this study demonstrated the function of DNAH10 in intra-manchette transport, providing important guidance for genetic diagnosis and prognosis in patients with infertility.

RC3H1
Also flagged:Cancersolid tumourstumourextracellularCas9Regnase-1
Journal Article 2025-10-31 ✓ 5 Snippets Mirzaei F, Mosaffa Jahromi A, Molavi H, Kabelitz D, Kalantar K, Meri S.
In-Text Gene Mentions

…genes such asRoquin-1and Regnase-1 can…

…TargetingRoquin-1and Regnase-1: a…

Roquin-1(Rc3h1) and Regnase-1…

…Roquin-1 (Rc3h1) and Regnase-1 (also…

…In macrophagesRoquin-1regulates inflammatory mRNAs,…

Show Full Abstract

Solid tumours present major treatment obstacles because of their immunosuppressive microenvironment and poor response to traditional chimeric antigen receptor (CAR)-based immunotherapies. Recent advances in cellular engineering have introduced CAR-macrophages derived from induced pluripotent stem cells (CAR-iMacs) as a promising approach to get around these obstacles. CAR-iMacs are designed to attack tumours, but their phenotypic plasticity can cause them to transform into M2-like macrophages in the tumour environment (TME), where they may instead suppress immune responses and promote tumour progression and metastasis. Roquin-1 and Regnase-1 are RNA-binding proteins that act as negative regulators of inflammatory genes that contribute to the phenotypic plasticity of macrophages. This perspective highlights a novel approach to augmenting anti-tumour responses of CAR-iMacs by simultaneously knocking out Roquin-1 and Regnase-1 via CRISPR-Cas9 gene editing. This approach drives a shift from an immunosuppressive M2-like state to an M1 state, promoting sustained pro-inflammatory signalling, boosting phagocytic and cytotoxic capabilities within the tumour microenvironment. Addressing a serious constraint in conventional adoptive cell therapies, this dual-targeting platform could provide a potent and scalable immunotherapeutic treatment for solid malignancies.

Also flagged:glycosyl hydrolasedegradationglycosaminoglycanscell proliferationbindingcancer
Journal Article 2025-10-31 No Snippets Canini G, Saporiti S, Coppa C, Rossi M, Centola F, Arcovito A.
Show Full Abstract

Human β-glucuronidase (HGUSB), a key lysosomal glycosyl hydrolase for the degradation pathway of glycosaminoglycans (GAGs), plays a crucial role in cell proliferation and inflammation, making it a promising target for novel therapeutic strategies including antibody-drug conjugates (ADCs) with β-glucuronic linkers. In this study, molecular docking and molecular dynamics (MD) simulations were performed to investigate the conformational stability of HGUSB in complex with different ligands, including substrates, inhibitors, and β-glucuronic linkers. Our rationale approach includes the evaluation of commercial substrates and a known inhibitor with different binding stoichiometries to identify the most favorable configuration and the most stable conformation of the enzyme. Based on the binding mechanism of HGUSB to these well-known ligands, the interaction with commercial linkers was evaluated, providing a structural determination of the recognition mechanism between the enzyme and ADCs. MD simulations on HGUSB::Linker complexes revealed that the maleimide-containing hydrophilic β-glucuronide, exhibited the most stable binding making it the best fitting linker among those analyzed in this study. Overall, this study identifies the optimal binding configuration of the HGUSB enzyme for investigating small molecule interactions and, despite the endogenous homotetrameric assembly, justifies the use of a simplified monomeric model for the study of larger macromolecular complexes, like linker analysis, ensuring an efficient and accurate computational approach. These findings lay the groundwork for a rationale optimization of β-glucuronic linker-based ADCs, offering new perspectives for targeted cancer therapies.

Also flagged:DOT1LDisruptor of Telomeric Silencing 1-Likecancerhistone methyltransferasehistone H3methylation
Journal Article 2025-10-31 No Snippets Choi HJ, Nguyen MT, Kim B, Kim SH, Kim J, Lee JY, Park MK.
Show Full Abstract

Disruptor of Telomeric Silencing 1-Like (DOT1L) has emerged as a critical epigenetic regulator in cancer, primarily because of its role as the sole histone methyltransferase responsible for histone H3 at lysine 79 methylation. This modification affects transcriptional activation, DNA repair, and cell cycle progression. Its dysregulation is associated with both hematological and solid tumors. In Mixed-lineage leukemia (MLL)-rearranged leukemia, DOT1L maintains aberrant gene expression patterns at loci such as HOXA and MEIS1, supporting leukemic stem cell survival and driving oncogenesis. In solid tumors, DOT1L influences diverse processes, including epithelial-mesenchymal transition, angiogenesis, and cell cycle regulation, contributing to tumor growth and metastasis. Therapeutic strategies targeting DOT1L using inhibitors, such as EPZ-5676, have shown promise in preclinical and clinical studies, highlighting their potential as versatile targets for precision oncology. This review summarizes the recent findings on DOT1L's involvement in cancer development and its potential as a therapeutic target.

Also flagged:Colorectal CancerPIGRSMAD4IGF2MUC12PLA2G2A
Journal Article 2025-10-31 No Snippets Kakizaki F, Miyoshi H, Yamamoto T, Morimoto T, Matsubara H, Kitano S, Yamaura T, Maekawa H, Brown JB, Sato TS, Obama K, Sakai Y, Kawada K, Taketo MM.
Show Full Abstract

Based on mRNA Expression Profiles of 57 Patient-Derived Colorectal Cancer Stem-Like Cell (CRC-SC) Lines Compared With Normal Colonic Epithelial Stem-Like Cells (NCE-SCs), we Identified Five CRC Subtypes. The First Subtype of CRC-SCs Showed Markedly Increased Expression of MUC12, PIGR, PLA2G2A, SLC4A4, and ZG16, Which Were Barely Detectable in the Other Subtypes. Importantly, Their Expression Correlated With Favorable Outcomes in Both the Discovery Cohort and Independent Two Test Cohorts From Public Databases. The Remaining Four Subtypes Showed High Expression of DEFA6, BST2, MAGEA6, or IGF2 Compared With NCE-SCs. Although the Expression of Each Gene Individually Influenced Patient Outcomes, Additional Co-Expressed Genes Within Each Subtype Were Also Associated With Prognosis. Furthermore, Integrating the Five Subtype-Specific Signatures Produced a Practical Prognostic Indicator, Designated as the General Colorectal Cancer Signature (GCS), and Provided Individualized Predictive Signatures for Each Patient. The Clinical Significance of GCS Was Further Validated in a Novel Orthotopic Xenograft Mouse Model, Which Recapitulated Patient Outcomes: CRC-SCs With Low GCS Scores Developed Distinct Liver and Lung Metastases, Whereas Those With High Scores Did Not. Apparent Associations Were Observed Between Activating RAS/RAF Mutations and BST2 Expression, and Between the Absence of SMAD4 Mutation and IGF2 Expression, but These Had no Significant Impact on Patient Survival, Suggesting That Driver Gene Mutations May Not Directly Influence GCS. Collectively, Our Findings Provide a Comprehensive Overview of Clinically Relevant Molecular Subtypes of CRC-SCs, Representing the Current Landscape of CRC Molecular Expression Subtypes. They Also Enable Rapid, Low-Cost Outcome Prediction and Suggest Potential Targets for Therapeutics Development.

Also flagged:copperneurodegenerative diseasescytochrome c oxidasecancerAlzheimer'sParkinson's
Journal Article 2025-10-31 No Snippets Duan T, Mao H, Jiang X, Tian Y, Zhang J, Tan J.
Show Full Abstract

Copper is an important trace element in the human body and plays an essential role in cells, where it is involved in synthesizing copper‑dependent enzymes, including superoxide dismutase, cytochrome c oxidase, tyrosinase, lysyl oxidase, dopamine‑β‑hydroxylase and other related copper‑containing enzymes. Copper overload or deficiency affects cell activity, leading to the development of neurodegenerative diseases or cancer. Neurodegenerative diseases, including Alzheimer's, Parkinson's and Huntington's disease, as well as cancer, represent significant chronic health burdens. The complexity of their pathophysiological mechanisms, coupled with the limitations of current targeted therapies, complicates the development of effective treatments. This review provides a comprehensive overview of the current understanding of copper's regulatory mechanisms in health and disease, with particular emphasis on its roles in neurodegenerative disorders and cancer. Recent advances in copper‑targeted therapeutic strategies, including copper chelators, ionophores and copper‑based nanoparticles, were highlighted. Furthermore, the clinical potential, key challenges and future prospects of these interventions were assessed. By synthesizing recent preclinical and clinical evidence, this review aims to contribute novel perspectives for improving the treatment of copper‑associated diseases.

Also flagged:Neurodegenerative diseasesAlzheimer's diseaseParkinson's diseaseamyotrophic lateral sclerosispolyglutamine (polyQ) diseasesbehavioral
Journal Article 2025-10-31 No Snippets Minakawa EN, Owari K, Nogami N, Nakatani T, Koizumi M, Kawanobe A, Saga Y, Kudo M, Noguchi S, Hanakawa T, Hori Y, Numazawa H, Takeuchi T, Katakai Y, Saito R, Nagai Y, Saito Y, Tomioka I, Seki K.
Show Full Abstract

Neurodegenerative diseases, including polyglutamine diseases, remain a clinical challenge, partly because of limited animal models that recapitulate human disease. Here, we describe a second-generation transgenic marmoset model of spinocerebellar ataxia 3 (SCA3), a polyglutamine disease, which stably expresses expanded CAG repeats in ataxin 3 (ATXN3). All five offspring of the founder marmoset harbored the transgene with reduced transgene integration sites compared with the founder and without repeat instability or genetic mosaicism, offering improved construct validity. Three of the five marmosets developed progressive motor impairments that segregated into two distinct phenotypes - early onset with rapid progression and late onset with mild progression - accompanied by corresponding patterns in body weight gain and grip strength. Pathological analysis revealed cerebellar Purkinje cell loss, spinal cord neurodegeneration and widespread intranuclear inclusions. The severity of motor phenotypes correlated with transgene expression levels in disease-relevant brain regions, including the cerebellum and spinal cord. By overcoming the translational limitations of rodent systems, our second-generation model offers a powerful platform for investigating disease mechanisms and testing potential therapeutics, advancing the utility of transgenic marmosets as clinically relevant models of neurodegenerative diseases.

Also flagged:CarbonateApatiteSilver PhosphateOsteogenesisAntimicrobialjoint infections
Journal Article 2025-10-31 No Snippets Shimabukuro M, Miyake R, Okazaki M, Kishida R, Wang Z, Yukawa T, Maeda K, Marukawa E, Kawashita M.
Show Full Abstract

Antimicrobial resistance (AMR) is a growing global health concern, especially in the management of bone and joint infections. A bioresorbable scaffold comprising carbonate apatite and 0.4 wt % silver phosphate (Ag<sub>3</sub>PO<sub>4</sub>) (designated as CASP) was developed in this study to achieve simultaneous osteogenesis, scaffold resorption, and photoactivated antibacterial activity. The CASP scaffold exhibits intrinsic antibacterial activity within 1 h via Ag<sup>+</sup> ion release, which is further enhanced under visible light irradiation through the generation of reactive oxygen species generation. In vitro studies demonstrate that CASP scaffolds effectively suppress the growth of methicillin-resistant <i>Staphylococcus aureus</i> without compromising osteoblast viability, proliferation, differentiation, and calcification. In vivo implantation in rabbit femoral defects indicates that CASP scaffolds support robust bone regeneration and gradual scaffold resorption comparable to those of scaffolds without Ag<sub>3</sub>PO<sub>4</sub> while maintaining long-term antibacterial activity for at least 4 weeks postimplantation. Transient inflammatory responses observed early after implantation are detoxified over time, potentially through the in vivo sulfidation of released silver ions. The findings of this study highlight the potential of CASP scaffolds as promising candidates for nonantibiotic infection control and bone tissue regeneration via visible light-driven photocatalytic therapy, offering an effective strategy to combat AMR in orthopedic applications.

Also flagged:huntington's diseaseCas9HDimmune responses
Journal Article 2025-10-31 No Snippets Zaheer A, AboQuella NM, Wadan AS, Saad HA, Kumar D, Panjwani S, Rath S, Ahmed SI.
Show Full Abstract

CRISPR-Cas9 technology offers transformative potential in treating Huntington's Disease (HD) by directly addressing its genetic root causes. This manuscript explores the pathophysiological mechanisms of HD, characterized by toxic mutant huntingtin (mHTT) protein resulting from expanded CAG repeats in the HTT gene, and the challenges posed by current therapeutic limitations. We comprehensively review the mechanisms of CRISPR-based therapeutic strategies, including excision of expanded repeats, allele-specific targeting, and epigenome editing, highlighting their efficacy in preclinical studies using animal models and human iPSCs. Delivery methods, such as viral and non-viral vectors, are analysed for their role in optimizing therapeutic outcomes while minimizing off-target effects and immune responses. Ethical and safety considerations, especially regarding precision and long-term impacts, are critically examined alongside emerging strategies to enhance specificity. With ongoing clinical trials and advancements in delivery systems, CRISPR technology represents a paradigm shift in addressing HD and broader neurodegenerative conditions. This review underscores the promise of gene editing in overcoming existing barriers and paving the way for transformative therapeutic approaches.

Also flagged:acute kidney injuryCSKidney Diseasecongenital heart defectshypertensioncardiovascular diseases
Journal Article 2025-10-31 No Snippets Huang J, Zang H, Reichle G, Ku E, Afonso N, DeWitt AG, Kulkarni A, Plummer S, DiMaria K, Thielen J, Selewski DT, Alten J, Chan T.
Show Full Abstract

<h4>Objective</h4>Racial and ethnic disparities in neonatal postoperative outcomes are reported, but differences in cardiac surgery-associated acute kidney injury (CS-AKI) remain unexamined. We assessed racial/ethnic disparities in CS-AKI prevalence and outcomes in neonates undergoing congenital heart surgery.<h4>Design, setting, and patients</h4>Retrospective cohort of neonates across 22 centers (2015-2018) from the Pediatric Cardiac Critical Care Consortium and the Neonatal and Pediatric Heart and Renal Outcomes Network.<h4>Measurements</h4>Race/ethnicity (primary predictor) were categorized into eight groups; CS-AKI was defined using neonatal modified Kidney Disease: Improving Global Outcomes criteria as mild (stage 1), severe (≥ stage 2) and persistent (any stage beyond post-operative day [POD] 3). Outcomes included not achieving net negative fluid balance [FB], respiratory support duration, length of stay [LOS], and mortality. Multivariable regression models examining the association between race/ethnicity and outcomes were also constructed.<h4>Results</h4>Among 2,165 neonates (2% Asian, 18% Hispanic, 1% multi-racial, 0.3% Native American, 14% Non-Hispanic Black (NHB), 59% Non-Hispanic White (NHW), 5% other, and 0.2% Pacific Islander), CS-AKI prevalence (31% mild, 23% severe) did not differ across racial/ethnic groups. NHB neonates had lower birthweight and higher surgical complexity, while NHW neonates had higher private insurance rates. NHB neonates were less likely to not achieve a net negative FB until ≥ POD3 than NHW neonates, but no differences were found in respiratory support duration, hospital LOS, or mortality after multivariate adjustment. Non-white neonates with severe AKI had higher mortality but had similar clinical outcomes.<h4>Conclusions</h4>CS-AKI rates did not vary by race/ethnicity. Differences in fluid balance achievement were noted but no significant disparities were found in mortality, mechanical ventilation duration, or hospital LOS.

PEBP1
Also flagged:MAFGsepsisFerroptosisdeathferrous ionslipid
Journal Article 2025-10-31 ✓ 5 Snippets Du L, Lv S, He D, Chen X, Liu L, Song X, Zhang J, Qiao Z, Luo Y.
In-Text Gene Mentions

…KLF2, TXN, andPEBP1.…

…KLF2, TXN, andPEBP1(Fig. 4 D),…

…while KLF2 andPEBP1were downregulated (Fig.…

…evidence shows that,PEBP1, identified as one…

…via the hippocampalPEBP1/15-LOX/GPX4 pathway in the…

Show Full Abstract

Ferroptosis is a novel form of cell death induced by ferrous ions and lipid peroxidation. However, the mechanisms of ferroptosis-related genes (FRGs) in sepsis have not been studied thoroughly. We performed differential analysis using GSE65682, and the differentially expressed genes (DEGs) were intersected with FRGs to obtain the differentially expressed FRGs. We constructed a random forest model to explore characteristic FRGs for sepsis diagnosis using the training set and verified its predictive efficacy using the testing set. There are 43 differentially expressed FRGs and the top five FRGs in the model are MAFG, QSOX1, KLF2, TXN, and PEBP1. Meanwhile, three genes remained after the univariate Cox analysis, survival analysis and nomogram, but only MAFG was validated to be associated with sepsis prognosis. MAFG was selected as the most diagnostically and prognostically significant FRG based on the following evidence: (1) consistently significant overexpression across multiple datasets, (2) the highest MeanDecreaseGini score in the random forest model, (3) the largest hazard ratio in univariate Cox regression analysis, (4) a strong association with patient survival demonstrated by the nomogram, and (5) an AUC of 0.64 (p < 0.05) in GSE185263 in the ROC analysis for sepsis prognosis. Subsequently, TXN was predicted as a ferroptosis-related potential target for the transcription factor MAFG, and their elevation in sepsis was confirmed by RT-qPCR. Ultimately, we discovered that MAFG was mainly localized in monocytes by single-cell RNA-sequencing analysis, which was significantly upregulated in sepsis and non-survivors of sepsis. In this study, we identified MAFG as a potential candidate FRG related to the diagnosis and prognosis of sepsis, although further validation is required, which broadens novel insights into the therapeutic targets of sepsis and the role of ferroptosis in sepsis.

Also flagged:B7-H3Gliomamalignant tumorstumorcancersangiogenesis
Journal Article 2025-10-31 No Snippets Feng XL, Su G, Jia Q, Wu QH, Zhang ZC.
Show Full Abstract

Glioma is one of the most malignant tumors in the brain, with high tumor heterogeneity. Traditional treatment methods, such as surgery, radiotherapy and chemotherapy, face numerous challenges and still pose serious threats to human health. Therefore, it is urgent to explore new treatment directions. The immune checkpoint B7-H3 has attracted much attention due to its significant immunomodulatory function in various cancers. Studies have shown that it is highly expressed in glioma and lowly expressed in normal brain tissue. It not only has immunosuppressive function and induces immune escape in glioma, but also promotes the proliferation, migration and angiogenesis of glioma cells. Moreover, there are many immunotherapy strategies targeting B7-H3, such as monoclonal antibodies, antibody-drug conjugates (ADC) and chimeric antigen receptor T-cell (CAR-T) therapy. Therefore, B7-H3 is regarded as a potential target for glioma immunotherapy. This article systematically reviews the occurrence and development process of B7-H3 in glioma, changes in the immune microenvironment, and related treatment methods. Through analysis of several databases such as TCGA, CTPAC, HPA and GEPIA, this study explores the expression of B7-H3 in glioma, its correlation with prognosis and its correlation with the glioma immune microenvironment, providing a new research target for the diagnosis and treatment of glioma.

SOX6
Also flagged:PDneuron differentiationgestationChromiumCholinLHX2
Journal Article 2025-10-31 ✓ 1 Snippet Toh HSY, Xu L, Chen C, Yang P, Sun AX, Ouyang JF.
In-Text Gene Mentions

…as LMX1A andSOX6expressed by hNProg.…

Show Full Abstract

Protocols for deriving midbrain dopaminergic (mDA) neurons for Parkinson's disease (PD) modeling and therapy remain incompletely benchmarked against in vivo references. To establish transcriptomic standards, we generated an integrated human fetal whole-brain atlas and a midbrain subatlas. Whole-brain analysis revealed strong region-specific signatures, underscoring the need for global mapping before refined midbrain annotation. We implemented this two-tier strategy, BrainSTEM (Brain Single-cell Two tiEr Mapping), to systematically reassess published single-cell datasets of human midbrain culture models. BrainSTEM confirmed the presence of bona fide midbrain cell types ("on-target"), but also revealed substantial populations aligning with nonmidbrain regions ("off-target"), inflating reported mDA yields across protocols. This unbiased framework enables rigorous evaluation of differentiation outcomes, clarifies current limitations of midbrain-directed models, and provides a foundation for refining protocols toward more faithful in vitro systems for PD research and regenerative applications.

OLFM4DCC
Also flagged:mental illnessanxietydepressionCALYComplement Component 5C5
Journal Article 2025-10-31 ✓ 5 Snippets Ahn I, Chang S, Lee J, Choi SH, Han J, Kim Y.
In-Text Gene Mentions

…une‐related proteins includingOLFM4(Olfactomedin 4) (2.45),…

…genes such asDCC(clusters 13 [GABAergic…

…and downregulation ofDCC, HTR2C, TTR ,…

…expression and decreasedDCC, HTR2C, TTR ,…

…genes, such asDCC(neural migration and…

Show Full Abstract

Major depressive disorder (MDD) with atypical features accompanied by psychotic symptoms represents a severe and under-researched subtype of depression and severe mental illness, characterized by significant personal and social impact. This study aims to explore novel biomarkers through a precision medicine approach by combining clinical data, white blood cell (WBC) single-cell RNA sequencing (scRNA-seq), plasma proteomics, and brain organoid models to uncover immunological and neurological alterations in patients with this condition. Patients exhibited elevated stress, anxiety, depression, and increased WBC counts, although the difference in WBC count is not significant after adjusting for age. Plasma proteomic profiling identified an upregulation of proteins implicated in synaptic formation, including Doublecortin-Like Kinase 3 (DCLK3) and Calcyon (CALY), as well as immune-related proteins such as Complement Component 5 (C5). WBC scRNA-seq revealed significant neutrophil and monocyte transcriptomic alterations, suggesting increased inflammation and immune dysregulation. Patient-derived brain organoids display reduced growth and distinct gene expression patterns compared to controls, particularly under dexamethasone-induced stress conditions. Combining WBC scRNA-seq, plasma proteomics, and brain organoid models offers a novel framework for understanding the pathophysiology of psychiatric disorders, which is one of the most complex disorders.

Also flagged:obsessive-compulsive disordercapsuleepilepsyserotoninnucleusmania
Journal Article 2025-10-31 No Snippets Moses Lee A, Kist A, Alvarez J, Sellers KK, Khambhati AN, Sugrue LP, Reid LB, Kadlec K, Ray S, Fan JM, Allawala AB, Racine CA, Norbu T, Astudillo D, Tremblay-McGaw AG, Becker N, Verhein J, Alhourani A, Starr PA, Chang EF, Krystal AD.
Show Full Abstract

Deep brain stimulation has been used to treat severe, refractory obsessive-compulsive disorder (OCD) with variable outcomes across multiple anatomical targets. To overcome these limitations, we developed an invasive brain mapping paradigm in which electrodes were implanted across the OCD cortico-striato-thalamo-cortical circuit. We then performed extensive stimulation mapping during a multi-day inpatient stay to identify personalized therapeutic targets and characterize their downstream circuit effects. We found two targets within the right ventral capsule (VC) that acutely reduced OCD symptoms. Prolonged VC stimulation suppressed high frequency activity within the structurally and functionally connected orbitofrontal and cingulate cortex, which were identified to be cortical nodes encoding the severity of OCD symptoms. These VC sites were implanted for DBS and combined stimulation of these targets led to a rapid therapeutic response. This case provides the first proof-of-concept that invasive brain mapping can be used to guide a novel personalized, multi-site neuromodulation approach to treat refractory OCD.

Also flagged:CLN7endolysosomesstress granulesinfantileneuronal ceroid lipofuscinosisBatten disease
Journal Article 2025-10-31 No Snippets Sharaireh A, Guevara-Ferrer M, Ludlaim AM, Humphries JD, Phillips AM, Dowsey AW, Zhang Z, Counsell JR, Unwin RD, Mole SE, Rahim AA, McKay TR.
Show Full Abstract

Inherited biallelic mutations in the CLN7 gene result in the variant late infantile onset neuronal ceroid lipofuscinosis, a subtype of Batten disease (BD), a severe and fatal childhood neurodegenerative disease. Intriguingly, CLN7 genetic variants have also been associated with retinopathies, amyotrophic lateral sclerosis, and frontotemporal dementia. CLN7 encodes a transmembrane protein localizing to endolysosomal membranes with outward-facing chloride channel activity. Loss of CLN7 function results in cortical neurons accumulating swollen lipofuscin-containing lysosomes, leading to neuroinflammation and neurodegeneration. The molecular mechanisms underlying CLN7 BD neuropathology are not completely understood. We have generated iPSC lines from two CLN7 BD patients and age-matched unaffected controls to interrogate intracellular molecular phenotypes in iPSC-derived neural progenitor cells (iNPC). Taking a multi-omics approach we have identified disease-modified activities in endolysosomal transport in iNPC<sup>BD</sup> that lead to lysosomal dysfunction and decreased mitophagy, resulting in the accumulation of metabolically defective mitochondria. We further observe a breakdown in nuclear functions that centre on RNA processing and nuclear export, linking to CLN7 protein interactions at the stress granule. We have identified dual and distinct functions for CLN7, promoting cell survival during the cellular stress response. CLN7 loss of function in BD results in neuronal apoptosis.

CACNA1E
Also flagged:TDP-43KCNQ2amyotrophic lateral sclerosisALSfrontotemporal dementiacytoplasmic
Journal Article 2025-10-31 ✓ 2 Snippets Joseph BJ, Marshall KA, Harley P, Mann JR, Alessandrini F, Vanoye CG, Chi W, Prudencio M, Simkin D, Kao TT, Desai RR, Keuss MJ, Barattucci S, Zanovello M, Mehta PR, DeKeyser JM, Limone F, Lee J, Brown AL, Leyton-Jaimes MF, Nash LA, Juan IGS, Aronica E, Wainger BJ, Shah M, Goswami A, Shneider NA, Dickson DW, Burrone J, Zhang C, Wichterle H, Petrucelli L, Watts JK, George AL, Fratta P, Eggan K, Kiskinis E.
In-Text Gene Mentions

…voltage-gated calcium channelCACNA1E(Fig. 1b ,…

…TDP-43-dependent modulation ofCACNA1Erepresents the preferential…

Show Full Abstract

Motor neuron hyperexcitability is a broadly observed yet poorly understood feature of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Nuclear depletion and cytoplasmic aggregation of the RNA splicing protein TAR DNA-binding protein 43 (TDP-43) are observed in most ALS and FTD patients. Here we show that TDP-43 dysfunction causes mis-splicing of KCNQ2, which encodes a voltage-gated potassium channel (K<sub>v</sub>7.2) that regulates neuronal excitability. Using iPSC-derived neurons and postmortem ALS/FTD brain and spinal cord tissue we find widespread, disease-specific and TDP-43-specific skipping of an exon encoding the KCNQ2 pore domain. The mis-spliced mRNA escapes degradation and is translated into a nonfunctional protein with severely reduced ion conductance that aggregates in the endoplasmic reticulum and causes intrinsic hyperexcitability in ALS neuronal models. This event, which correlates with higher phosphorylated TDP-43 levels and earlier age of disease onset in patients, can be rescued by splice-modulating antisense oligonucleotides that dampen hyperexcitability in induced pluripotent stem cell cortical neurons and spinal motor neurons with TDP-43 depletion. Our work reveals that nuclear TDP-43 maintains the fidelity of KCNQ2 expression and function and provides a mechanistic link between established excitability disruption in ALS/FTD patients and TDP-43 dysfunction.

HFE
Also flagged:hepatic steatosissteatosismetabolic dysfunction-associatedsteatotic liver diseaseobesityProton
Journal Article 2025-10-31 ✓ 1 Snippet Xue L, Zhu Y, Cheng G, Han H, He N, Chen L, Ma Z, Ge H, Jiang D, He T, Shen R, Jiang W, Sun L, Zhang J, Cai X, Xu H, Ding H.
In-Text Gene Mentions

…autoimmune liver diseases,hemochromatosis, alcohol abuse more…

Show Full Abstract

<h4>Objectives</h4>To prospectively evaluate the diagnostic accuracy of ultrasound-derived fat fraction (UDFF) in quantifying hepatic steatosis, to establish and validate a dual-threshold UDFF classification system, and to investigate its efficacy for risk stratification in body mass index (BMI)-defined subgroups.<h4>Materials and methods</h4>This prospective multicenter study involved 790 suspected metabolic dysfunction-associated steatotic liver disease (MASLD) participants from April 2023 to November 2024 (derivation: n = 553; validation: n = 237). Liver biopsy histopathology (n = 342), MRI proton density fat fraction (MRI-PDFF) (n = 396), or proton magnetic resonance spectroscopy (<sup>1</sup>H-MRS) (n = 52) was used as the reference standard. UDFF was compared to noninvasive test Hepatic Steatosis Index (HSI) and Fatty Liver Index (FLI) using area under the curve (AUC). The diagnostic thresholds were optimized to maintain at least 90% sensitivity and specificity in stratifying hepatic steatosis severity. A two-step strategy of UDFF followed by HSI was used to rule in and rule out steatosis at BMI ≥ 23 kg/m<sup>2</sup> subgroup.<h4>Results</h4>UDFF demonstrated significant correlations with three reference standards (Spearman's ρ = 0.798-0.847). Comparing with HSI and FLI, UDFF showed higher AUC (0.933, 0.948, and 0.914, respectively) for assessing ≥ S1, ≥ S2 and S3. A clinically practical dual-threshold system effectively classified hepatic steatosis severity. A sequential UDFF/HSI strategy achieved a high positive predictive value (PPV = 95.8%) to rule in hepatic steatosis and lowered the proportion of indeterminate cases (from 18.0 to 7.6%) in patients with BMI ≥ 23 kg/m<sup>2</sup>.<h4>Conclusion</h4>UDFF is a highly effective noninvasive tool for quantifying hepatic steatosis. A sequential use of UDFF/HSI could improve hepatic steatosis detection in patients with BMI ≥ 23 kg/m<sup>2</sup>.<h4>Critical relevance statement</h4>The study proposed dual-threshold diagnostic criteria (sensitivity/specificity ≥ 90%) of UDFF for steatosis grading, and established a BMI-stratified risk stratification tool in multi-center cohorts, proving the efficacy of UDFF in noninvasively quantifying liver steatosis.<h4>Key points</h4>Early diagnosis of hepatic steatosis holds critical clinical significance. The study proposed dual-threshold ultrasound-derived fat fraction (UDFF) criteria and BMI-stratified steatosis risk prediction strategy. UDFF provided a non-invasive, accurate diagnostic alternative to liver biopsy and MRI.

TNFSF4
Also flagged:CancerMagnesiumHomeostasismetabolismANK3CNNM2
Journal Article 2025-10-31 ✓ 3 Snippets Qin Y, Yuan ZE, Yin, Zhang SY, Sun YC, Li W.
In-Text Gene Mentions

…ICOSLG, TNFSF15, TNFSF18,TNFSF4, NRP1, HHLA2, ADORA2A,…

…as TNFRSF13C, BTNL2,TNFSF4, TNFSF18, TMEM173, ENTPD1,…

…as TNFRSF13C, BTNL2,TNFSF4and so on,…

Show Full Abstract

<h4>Introduction</h4>Magnesium homeostasis is critical for cellular growth and metabolism, yet its pan-cancer implications remain poorly characterized. This study aims to comprehensively analyze magnesium homeostasis across 33 cancer types, exploring its role in tumorigenesis, immune regulation, and therapeutic potential. Key magnesium homeostasis-related genes (e.g., ANK3, CNNM2) were significantly downregulated in most tumors, correlating with improved prognosis. Magnesium homeostasis scores (MHS) were reduced in cancers and linked to lower tumor mutational burden (TMB), microsatellite instability (MSI), immune dysfunction, and checkpoint gene expression. Single-cell sequencing revealed elevated MHS in CD8 + T cells, suggesting immune modulation roles.<h4>Conclusion</h4>These findings highlight magnesium homeostasis as a regulator of tumor progression and immunity, with MHS serving as a prognostic biomarker. Targeting magnesium pathways may offer novel therapeutic strategies, warranting further clinical validation to advance personalized cancer therapies.

Also flagged:tofungal infectionageingImmunosenescenceAgingopportunistic infections
Journal Article 2025-10-31 No Snippets Kamroo A, Kakroudi MH, Sarmadian AJ, Firouzabadi A, Mousavi S, Yazdanpanah N, Saleki K, Rezaei N.
Show Full Abstract

Immunosenescence is the gradual deterioration in the functionality of the immune system that has various clinical manifestations, such as a weakened response to vaccination, higher susceptibility to viral/bacterial/fungal infection, and higher incidence rates regarding the ageing-based disorders. Conventionally used models, like animal or 2D models for unraveling the interactions between ageing and immunity are unable to depict the complexity of bodily environments. However, this major limitation can be addressed via using the organoid technology. For clarification, organoids are tissue-resembling 3D structures that are generated from stem cells; they have the major superiority of preserving the human physiology, multicellular intricateness, and the capability of dynamic interactions between the existing elements. Organoid-based technology has been applied for the study of different organ-specific immunosenescence, such as in the intestine, brain, liver, and skin. Besides, organoids offer the bright innovative future of senolytic CAR T lymphocytes and other regenerative-based therapies. This review narrates the cutting-edge application of organoids and the mechanisms involved in the detailed molecular processes of organ-specific immunosenescence.

Also flagged:methyluridinedinucleotidetrinucleotide55-methylcytosinemethyladenosine
Journal Article 2025-10-31 No Snippets Almusallam N, Khan S, Alarfaj FK, Ahmad N.
Show Full Abstract

<h4>Background</h4>The discovery of RNA 5-methyluridine (m5U) modifications is vital in computational biology due to their essential significance in different biological processes. This study presents a powerful predictor named 5-meth-Uri, which improves the overall accuracy of m5U modification predictions. The proposed method combines a composite of dinucleotide and trinucleotide-based auto-cross covariance with six physicochemical parameters to generate a feature vector. We select essential features using an unsupervised Principal Component Analysis (PCA) technique to enhance the model's efficiency. Finally, an intelligent computation Deep Neural Network (DNN) was utilized to classify RNA 5-methyluridine (m5U).<h4>Results</h4>The model's performance was evaluated on two benchmark datasets, namely mature mRNA and full transcript, using tenfold cross-validation and an independent test. The proposed model achieved an average accuracy of 95.13% and 97.36% on the training set and 95.73% and 96.51% on the independent test sets for the full transcript and mature mRNA datasets, respectively. 5-meth-Uri demonstrated around 7.15% and 3.98% higher accuracy on training data and 5.42% and 3.52% higher accuracy on independent samples for both datasets compared to existing models.<h4>Conclusions</h4>Its high accuracy and reliability make 5-meth-Uri a promising tool for researchers with potential biomedical and pharmaceutical applications.

OLFM4
Also flagged:L-GlutamateEGFRMEKERKmitochondrialmetabolism
Journal Article 2025-10-31 ✓ 2 Snippets Dou CX, Qu HZ, Qin YC, Wang XF, Zhou JY, Wang XQ, Yan HC.
In-Text Gene Mentions

…(Achaete scute-like 2),Olfm4(olfactomedin 4), Msi1…

…markers Lgr5 andOlfm4, proliferative cell marker…

Show Full Abstract

<h4>Background</h4>Intestinal stem cells (ISCs) sustain epithelial homeostasis through rapid mitochondrial metabolism, however, how they sense nutrient signals to regulate mitochondrial function remains unclear.<h4>Methods</h4>We examined the role of L-glutamate (Glu) in regulating cell mitochondrial biosynthesis using in vivo piglets, ex vivo porcine intestinal organoids (IOs), and in vitro IPEC-J2 cells.<h4>Results</h4>Glu enhanced jejunal development in weaned piglets. Isobaric tags for relative and absolute quantitation (iTRAQ) analysis revealed the significant enrichment of mitochondrial functions and activation of EGFR-MEK-ERK-mTFB2 signaling pathway in the jejunum. In vitro, 5 mM Glu promotes mitochondrial biosynthesis and potentiates the EGFR-MEK-ERK-mTFB2 axis. Whereas inhibition of EGFR with Osimertinib and silencing EGFR abolished these effects in IOs and IPEC-J2 cells. Colocalization and biochemical studies demonstrated interaction between Glu and EGFR in IOs.<h4>Conclusions</h4>Glu promotes mitochondrial biogenesis and ISC expansion by activating the EGFR-MEK-ERK-mTFB2 axis, highlighting a nutrient-sensing mechanism that couples energy availability to ISC function.

OLFM4
Also flagged:CBSstem cell homeostasisdeathcystathionine-β-synthasecell proliferationoxygen
Journal Article 2025-10-31 ✓ 5 Snippets Wu T, Zheng Z, Ren J, Yang Z, Zhang N, Guo K, Chen D, Gao M, Chen Y, Liang X, Wang Y, Chen W, Su Y, He J, Wang F.
In-Text Gene Mentions

…+ cells andOlfm4+ cells (an…

…Ki67 + andOlfm4+ cells within…

…the number ofOlfm4+ cells within…

…the number ofOlfm4+ cells or…

…the number ofOlfm4+ cells, Ki67…

Show Full Abstract

<h4>Background</h4>The cycling intestinal stem cells (ISCs) exhibit radiosensitivity, and their death or impaired regenerative capacity following irradiation may result in intestinal barrier dysfunction. The cystathionine-β-synthase (CBS)/H2S axis plays a critical role in regulating cell proliferation, reactive oxygen species scavenging, and the DNA damage response. However, it remains unclear whether the CBS/H2S axis modulates ISC homeostasis and tissue radiosensitivity.<h4>Methods</h4>Intestinal epithelium specific conditional CBS knockout mice were generated by crossing CBS<sup>fl/+</sup> mice with Villin-CreERT2 mice. CAGGCre-ER™ mice were crossed with CBS<sup>fl/fl</sup> mice to achieve CBS knockout in multiple tissues and cell types. The Lgr5-Tdtaomato-Flag mice were generated by CRISPR/Cas9 system. The CBS inhibitor AOAA or the H2S donor GYY4137 was used to treat mice or intestinal crypt organoids. Hematoxylin and eosin, immunohistochemistry, immunofluorescence, Western blot, qRT-PCR, et al. were employed to investigate the role of the CBS/H2S axis in ISCs homeostasis and radiation-induced intestinal damage.<h4>Results</h4>Lgr5 + ISCs and progenitor cells expressed higher levels of CBS than differentiated cells. The cecum and colon expressed significant higher CBS levels than the small intestine. Treatment with the H2S donor GYY4137 enhanced the proliferation of intestinal organoids in vitro, while inhibition of CBS by AOAA reduced this effect. Genetic knockout of CBS in the intestinal epithelium or global downregulation of CBS driven by CAGG-CreER™ in vivo did not affect ISC proliferation or differentiation under physiological conditions. Pharmacological regulation of the CBS/H2S axis in vitro failed to protect organoids from radiation-induced damage. Interestingly, administration of AOAA in vivo reduced radiation-induced atrophy of the intestinal mucosa. Furthermore, global downregulation of CBS significantly promoted ISC recovery after irradiation exposure. However, intestinal epithelium-specific CBS knockout did not confer radioprotective effects.<h4>Conclusions</h4>Our findings suggest that the CBS/H2S axis contributes to the regulation of ISC homeostasis and represents a potential target for radiation protection, mediated through the intervention of non-epithelial cells.

HFE
Also flagged:glucoseinsulinthoracic aortic aneurysmtype 2 diabetes mellitusAGERGLRX
Journal Article 2025-10-31 ✓ 5 Snippets Daria T, Iyer K, Alkhairo H, Kho PF, Suzuki K, Hatzikotoulas K, Southam L, Taylor HJ, Yin X, Mandla R, Huerta-Chagoya A, Rayner WN, Levin MG, Damrauer SM, Tsao PS, Priest JR, Klarin D, Pirruccello J, Echouffo Tcheugui JB, Tcheandjieu C.
In-Text Gene Mentions

…as TCF7L2, GCK,HFE, KHK, and AGER…

…and rs1800562 inHFE), nonsynonymous variants…

…, TCF7L2 ,HFE, ABCC8, and AGER…

…of GCK, CTSS,HFE, KHK, AGER, and…

…included TCF7L2, GCK,HFE, KHK, and AGER.…

Show Full Abstract

We investigate the relationship between glycemic traits-specifically type 2 diabetes mellitus, fasting glucose, fasting insulin, glycated hemoglobin, and 2-hour post-load glucose-and thoracic aortic morphology and diseases. The results indicate an inverse association between elevated glycemic traits and aortic morphology, as well as a reduced risk of thoracic aortic aneurysm. Genetic predictors related to beta-cell proinsulin mechanisms in type 2 diabetes mellitus drive these associations. Key genes such as AGER, GLRX, TCF7L2, and GCK are implicated, highlighting their potential as therapeutic targets for the prevention and treatment of thoracic aortic aneurysm, given their role in glycemic control medication.

FBXL4
Also flagged:CepharanthinemitophagyBNIP3ferroptosislung canceralkaloid
Journal Article 2025-10-31 ✓ 4 Snippets Li LG, Xu YH, Han N, Leng F, Hu J, Xu HZ, Huang H, Li TF, Chen X.
In-Text Gene Mentions

…through regulation ofFBXL4-BNIP3 drives ferroptosis lead…

…and thereby inhibitFBXL4, which attenuated the…

FBXL4-mediated BNIP3 activation pro…

…mitophagy by inhibitingFBXL4, ultimately driving ferroptos…

Show Full Abstract

Cepharanthine (Cep), a natural alkaloid from Stephania (Menispermaceae), exhibits broad-spectrum anti-cancer activity. In the present study, Cep was found to induce ferroptosis and mitophagy, for which the relationship and upstream targets remain unelucidated. Herein, the role of Cep in the induction of mitophagy was deeply investigated. Cep showed robust anti-lung cancer effects, as confirmed by decreased cell viability, elevated apoptosis, suppressed colony formation and inhibited growth of tumor grafts in Lewis cell-bearing mice. RNA-sequencing analysis revealed that Cep treatment significantly enriched differentially expressed genes (DEGs) in mitophagy and ferroptosis pathways, which were demonstrated in in vitro and in vivo experiments as well. In-depth investigations showed that inhibition of autophagy abolished Cep-mediated ferroptosis, but not vice versa. Moreover, genetic knockdown of BNIP3 dampened the mitophagy and ferroptosis of lung cancer cells induced by Cep. Additional data confirmed that Cep could bind to and thereby inhibit FBXL4, which attenuated the ubiquitination of BNIP3. FBXL4-mediated BNIP3 activation promoted the recruitment of LC3 to mitochondria and autophagic flux in the presence of Cep. Collectively, Our study elucidates a complete mechanistic pathway wherein Cep activates BNIP3-mediated mitophagy by inhibiting FBXL4, ultimately driving ferroptosis and offering a new therapeutic avenue for lung cancer.

DCC
Also flagged:magnesiumgestationsteroidssulfategestational diabetesmaternal hypertension
Journal Article 2025-10-31 ✓ 1 Snippet Katheria AC, Dorner RA, Grobman WA, Rysavy MA, Koo J, Wyckoff MH, Sandoval G, DeMauro SB, Das A, Lee HC, Cotten M, Calvo L, Saha S, Eunice Kennedy Schriver National Institute of Child Health and Human Development Neonatal Research Network.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Objective</h4>To identify prenatal risk factors associated with early cord clamping (ECC) in infants born extremely preterm (22-28 weeks) and to use these factors to predict which infants have the highest risk of ECC.<h4>Study design</h4>Stepwise logistic regression and classification and regression tree analysis were performed to identify variables most associated with ECC and to build a parsimonious model to identify infants born preterm who are at the highest risk of ECC.<h4>Results</h4>There were 12 622 infants eligible for analysis (ECC, n = 8465 vs deferred cord clamping [DCC], n = 4157). In the classification and regression tree model, center, lack of antenatal magnesium, cesarean delivery, lower gestational age, and antenatal hemorrhage, in that rank order, were the factors that contributed most to identifying which infants received ECC. Several additional factors were also statistically significant, including time to delivery after admission to the hospital as well as maternal race and ethnicity.<h4>Conclusions</h4>Our results suggest that there are multiple factors among extremely preterm pregnancies, including center, lack of antenatal magnesium, cesarean delivery, lower gestational age, and antenatal hemorrhage, that are associated with infants who are more likely to miss DCC. There are also differences in rates by maternal race and ethnicity in who receives DCC compared with ECC. Identifying these factors now can inform future research and encourage local and larger-scale quality improvement practice changes.

OLFM4
Also flagged:tumormetastatic cancersG1 phasecancersgene expressionchromosomes
Journal Article 2025-10-31 ✓ 1 Snippet Bai X, Lau BT, Sathe A, Grimes SM, Almeda-Nostine A, Ji HP.
In-Text Gene Mentions

…of TFF3 andOLFM4, which are…

Show Full Abstract

Cancers are characterized by genomic instability events such as aneuploidy, chromosomal arm imbalances, and segmental copy number changes. These genomic features frequently define different subclones within a tumor. Single-cell DNA sequencing (scDNA-seq) identifies these large-scale genomic alterations that define subclonal features. However, scDNA-seq does not provide biological phenotypic information on individual subclones. Single-cell RNA sequencing (scRNA-seq) offers biological information but is less accurate in discovering genomic instability events. We developed a computational framework, scAlign, for integrating scRNA-seq and scDNA-seq from the same specimen and define subclonal cellular phenotypes at the resolution of individual cells. Subclones were defined by aneuploidy and chromosomal arm imbalance among primary and metastatic cancers. Using the cells in the G0/G1 phase, the extensive cellular sampling from both assays characterized the subclonal architecture of these cancers. The scDNA-seq provided a ground truth for copy number-based subclones. From the scRNA-seq data, the epithelial cells in G0/G1 were identified and assigned to specific subclones by the scAlign based on gene dosage. Afterward, we determined the differential gene expression and biological pathway activities of specific clones. Overall, integrative multi-omics analysis of single-cell datasets is more informative than any individual genomic modality, provides deep insights into intratumoral heterogeneity and reveals subclonal biology. scAlign is available at https://github.com/XQBai/scAlign.

Also flagged:Type 2 DiabetesProstate Cancertype 2 diabetes mellitusBCRC2chromatid
Journal Article 2025-10-31 No Snippets Chen YT, Chang CF, Chen LC, Huang CY, Yu CC, Lin VC, Lu TL, Huang SP, Bao BY.
Show Full Abstract

<b>Background/Objective:</b> Biochemical recurrence (BCR) after radical prostatectomy (RP) for prostate cancer indicates disease progression. Although type 2 diabetes mellitus (T2D) shows a paradoxical association with prostate cancer risk, the prognostic role of T2D-related genetic variants remains unclear. <b>Methods:</b> We analyzed 113 common T2D susceptibility-related single-nucleotide polymorphisms (SNPs) in 644 Taiwanese men with localized prostate cancer (D'Amico risk classification: 12% low, 34% intermediate, and 54% high) treated with RP. Associations between SNPs and BCR were assessed using Cox regression, adjusting for key clinicopathological factors. Functional annotation was performed using HaploReg and FIVEx, while The Cancer Genome Atlas transcriptomic data were analyzed for C2 calcium-dependent domain-containing 4A (<i>C2CD4A</i>) expression. Gene set enrichment analysis (GSEA) and gene set variation analysis (GSVA) were applied to explore related biological pathways. <b>Results:</b><i>C2CD4A</i> SNP <i>rs4502156</i> was independently associated with a reduced risk of BCR (hazard ratio = 0.80, <i>p</i> = 0.035). The protective <i>C</i> allele correlated with higher <i>C2CD4A</i> expression. Low <i>C2CD4A</i> expression is associated with advanced pathological stages, higher Gleason scores, and disease progression. GSEA revealed negative enrichment of mitotic and chromatid segregation pathways in high-<i>C2CD4A</i>-expressing tumors, with E2F targets being the most suppressed. GSVA confirmed an inverse correlation between <i>C2CD4A</i> expression and E2F pathway activity, with <i>CDKN2C</i> as a co-expressed functional gene. <b>Conclusions:</b> The T2D-related variant <i>rs4502156</i> in <i>C2CD4A</i> independently predicts a lower risk of BCR, potentially via suppression of the E2F pathway, and may serve as a germline biomarker for postoperative risk stratification.

Also flagged:DepressionWateragingmood disordersdeuteriumgene expression
Journal Article 2025-10-31 No Snippets Costa-Nunes JP, Sitdikova K, Svirin E, de Munter J, Somlyai G, Gorlova A, Litavrin A, Arajyan GM, Nefedova Z, Lyundup A, Morozov S, Umriukhin A, Iliynskaya S, Chernopiatko A, Strekalova T.
Show Full Abstract

The study of molecular mechanisms underlying late-life depression (LLD) is increasingly important in light of population aging. To date, LLD-related molecular brain changes remain poorly understood. Furthermore, environmental factors such as climate change and geography contribute to LDD risks. One overlooked factor might be deuterium-a stable hydrogen isotope-whose concentration in drinking water can vary geographically (~90-155 ppm) and alter the incidence of mood disorders. Conversely, potential effects of natural variations in deuterium content in drinking water on LLD symptoms and brain gene expression remain unknown. We conducted Illumina gene expression profiling in the hippocampi and prefrontal cortexes of 18-month-old C57BL/6J mice, a model of LLD-like behaviors, compared to 3-month-old controls. Separately, aged mice were allowed to consume deuterium-depleted (DDW, ~90 ppm) or control (~140 ppm) water for 21 days and were studied for LLD-like behaviors and Illumina gene expression of the brain. Naïve old mice displayed ≥2-fold significant changes of 35 genes. Housing on DDW increased their hedonic sensitivity and novelty exploration, reduced helplessness, improved memory, and significantly altered brain expression of <i>Egr1</i>, <i>Per2</i>, <i>Homer1</i>, <i>Gadd45a</i>, and <i>Prdx4</i>, among others. These genes revealed significant alterations in several GO-BP and KEGG pathways implicated in inflammation, cellular stress, synaptic plasticity, emotionality, and regeneration. Additionally, we found that incubation of primary neuronal cultures in DDW-containing buffer ameliorated Ca<sup>2+</sup> influx and mitochondrial potential in a toxicity model, suggesting the involvement of mitochondrial mechanisms in the effects of decreased deuterium levels. Thus, aging induced profound brain molecular changes that may at least in part contribute to LLD pathophysiology. Reduced deuterium intake exerted modest but significant effects on LLD-related behaviors in aged mice, which can be attributed to, but not limited by ameliorated mitochondrial function and changes in brain gene expression.

SOX6
Also flagged:Thyroid eye diseaseautoimmune thyroid diseaseantibodiesthyroid-stimulating hormone receptorTSHRinsulin-like growth factor-1 receptor
Journal Article 2025-10-31 ✓ 5 Snippets Shin HA, Park M, Lee HJ, Moon JH, Banga JP, Lew H.
In-Text Gene Mentions

…and Eya1 andSox6were upregulated in…

…In contrast,Sox6expression in TED…

…the transcription factorsSox6and Nfix.…

…yofiber development, includingSox6, Nfix, Six1, and…

…of Six1, Eya1,Sox6, and Nfix expression…

Show Full Abstract

Thyroid eye disease (TED) is an autoinflammatory condition characterized by fibrosis in orbital fat and extraocular muscles, primarily driven by TSH receptor antibodies and inflammatory cytokines. While research has predominantly focused on the involvement of fat tissue, the understanding of myopathy in TED remains limited. This study developed a TED mouse model and isolated myoblasts from both control individuals and TED patients for analysis. Single-cell RNA sequencing was used to investigate myofiber type changes in TED and their alterations following treatment with human-derived mesenchymal stem cells. Key regulatory genes involved in myofiber differentiation and fibrosis in myofibroblasts were identified, and their expression balance was validated in myoblasts derived from both normal individuals and TED patients. Our analysis revealed a disease-associated shift in myofiber types and identified Six1 and Eya1 as central regulators of myofiber differentiation and fibrosis suppression. These regulatory effects were validated in primary myoblasts isolated from both control and TED patients. Collectively, our findings uncover a novel role for the Six1/Eya1 axis in modulating muscle remodeling and fibrosis in TED and provide a foundation for the development of targeted therapies for TED-associated myopathy.

Also flagged:Hyperuricemiauric acidadeninepotassium oxonatexanthine oxidaseNLRP3
Journal Article 2025-10-31 No Snippets Wei M, Hu Y, Zhang Z, Qiu L, Tao X, Wei H.
Show Full Abstract

<h4>Background</h4>Hyperuricemia (HUA), a metabolic disorder characterized by high serum uric acid (UA) level, presents a growing global health challenge.<h4>Method</h4>In this study, a stable murine model of HUA was established by orally administering adenine (100 mg/kg) and potassium oxonate (600 mg/kg) in C57BL/6J mice, resulting in significant elevation of serum UA and xanthine oxidase (XOD) activity, as well as renal pathological alterations. Given the anti-hyperuricemia potential of <i>Lactiplantibacillus plantarum</i> WLPL04, a strain from a human breast milk was evaluated.<h4>Conclusions</h4>Oral administration of <i>L. plantarum</i> WLPL04 significantly reduced serum UA level and XOD activity in a dose-dependent manner. Moreover, <i>L. plantarum</i> WLPL04 treatment enhanced UA excretion by upregulating <i>ABCG2</i> and downregulating <i>URAT1</i> and <i>GLUT9</i> expression. It ameliorated renal injury and suppressed inflammation via downregulation of the NLRP3 inflammasome pathway. 16S rRNA gene sequencing revealed that <i>L. plantarum</i> WLPL04 restored gut microbial diversity and promoted the enrichment of beneficial genera such as <i>Bacteroides,</i> which was negatively correlated with UA in serum, creatinine, and inflammatory cytokines. Moreover, transcript analysis revealed upregulation of purine salvage genes (<i>hpt</i> and <i>xpt</i>), suggesting enhanced salvage pathway recycling of purine bases and reduced urate production. Those findings suggest that <i>L. plantarum</i> WLPL04 exerted multi-targeted anti-hyperuricemia effects through coordinated regulation of host purine metabolism, urate transport, inflammation, and gut microbiota composition, providing a promising probiotic candidate for HUA management.

HFE
Also flagged:Metabolic Dysfunction-Associated Steatotic Liver DiseaseIPbicarbonatesulfatecalciummagnesium
Journal Article 2025-10-31 ✓ 1 Snippet Dallio M, Romeo M, Di Nardo F, Senese G, Silvestrin A, Coppola A, Napolitano C, Vaia P, Basile C, Martinelli G, Gregorio A, Federico A.
In-Text Gene Mentions

…[ 27 ],hemochromatosis, Wilson’s disease, or…

Show Full Abstract

<b>Background/Objectives</b>: Fonte Essenziale<sup>®</sup>, a mineral water rich in bicarbonate, sulfate, calcium, and magnesium, has shown potential in modulating the gut-liver axis and microbiota in hepatic steatosis. However, its long-term effects on intestinal permeability (IP), systemic inflammation (SI), and oxidative stress-key factors in Metabolic dysfunction-associated steatotic liver disease (MASLD)-remain unexplored. <b>Methods</b>: Eighty-seven MASLD patients were randomized into two groups: group A received Fonte Essenziale<sup>®</sup> (400 mL/day, fasting) plus a controlled nutritional regimen for 12 months, followed by a 6-month water washout; group B followed only the controlled nutritional regimen. IP markers, SI (IL-1β, IL-6, TNF-α), oxidative stress (dROMs/BAP), and clinical data (including Controlled Attenuation Parameter-CAP) were assessed at baseline (T0), 12 months (T12), and post-washout (T18). Baseline increased IP (in-IP) was defined by fecal zonulin > 110 ng/mL and serum LBPp > 10 µg/mL; improvement (im-IP) required normalization of both. A ≥30% CAP reduction indicated steatosis improvement. <b>Results</b>: Thirty-eight patients in group A and thirty-nine in group B completed the study. At T12, group A showed significant reductions in fecal zonulin (<i>p</i>: 0.0163) and serum LBPp (<i>p</i> < 0.0001), with increased occludin and claudin 1 (all <i>p</i> < 0.0001). Im-IP prevalence was higher in group A (<i>p</i>: 0.0037). Group A also showed significant reductions in IL-1β, TNF-α, IL-6, LPS, and dROM/BAP (all <i>p</i> < 0.05), especially among those with im-IP. CAP, insulin, and HDL levels improved significantly (all <i>p</i> < 0.0001). Multivariate analysis confirmed water intake (aOR: 2.185, <i>p</i>: 0.001) and im-IP achievement (aHR: 1.267, <i>p</i>: 0.021) as predictors of steatosis improvement. Benefits persisted at T18. <b>Conclusions</b>: Prolonged Fonte Essenziale<sup>®</sup> intake improved hepatic steatosis and MASLD outcomes by modulating IP, SI, and oxidative stress. This trial has been registered on clinicaltrials.gov (NCT07211113).

CACNA1E
Also flagged:cancerTWIST1vascular diseasesatherosclerosishypertensionTCF3
Journal Article 2025-10-31 ✓ 1 Snippet Dy DCM, Lehman T, Othon A, Rathod M, Polacheck WJ, Wirka R.
In-Text Gene Mentions

…subunits ( CACNA1B,CACNA1E), mitochondrial calcium…

Show Full Abstract

<h4>Introduction</h4>TWIST1, a bHLH transcription factor, regulates mesenchymal specification, differentiation, proliferation and migration during development and in diseases such as cancer. More recently, genome-wide association studies have identified TWIST1 as a causal gene that increases risk for multiple vascular diseases, including atherosclerosis and hypertension. However, its molecular role in the vascular wall remains unclear.<h4>Methods</h4>In this study, we interrogated how TWIST1 dimer composition and discrete TWIST1 domains affect SMC phenotype by expressing forced TWIST1 dimers or TWIST1 variants lacking specific domains, followed by bulk RNA sequencing and proliferation and migration assays in human coronary artery SMCs (HCASMCs).<h4>Results</h4>We found that TWIST1 homodimers had only modest transcriptomic effects but strongly promoted migration and proliferation-effects abolished by deletion of the TWIST1 N-terminus. Heterodimerization of TWIST1 with TCF3-encoded E proteins resulted in larger transcriptomic effects, promoting Rho/ROCK signaling and extracellular matrix production/organization, but had only modest effects on proliferation and no effect on migration. Deletion of the TWIST1 C-terminus resulted in a very large transcriptomic shift with predicted downregulation of angiotensin and Rho/ROCK signaling as well as ECM production/organization pathways, in a manner suggesting a dominant negative effect on TWIST1-E12 function. Comparison with single-cell RNA-seq data from human endarterectomy samples placed the function of these TWIST1 variants in a disease context and showed that deletion of the C-terminal domain prevented a modulated SMC phenotype.<h4>Discussion</h4>These studies demonstrate that TWIST1 influences different aspects of SMC phenotype independently via discrete domains and dimer composition, and link TWIST1 to key signaling pathways that influence SMC phenotype during disease.

Also flagged:membranecolorectal cancertumorpathogenesismethylationlocalization
Journal Article 2025-10-31 No Snippets Qiu Z, Liu W, Xu S.
Show Full Abstract

Cell membrane-camouflaged nanoparticles (CNPs) have emerged as promising multifunctional platforms for colorectal cancer therapy, integrating drug delivery, immunomodulation, photothermal ablation, and anti-inflammatory effects. This review highlights recent advances in CNP-based strategies, emphasizing their unique capacity to enhance tumor-targeting specificity, potentiate immunotherapeutic efficacy, and overcome the limitations of conventional treatments. We summarize diverse approaches employing immune cell or tumor cell membrane coatings, as well as hybrid systems that combine CNPs with chemotherapy, metabolic modulation, or photothermal therapy. Accumulating evidence demonstrates that CNPs can effectively remodel the tumor immune microenvironment, increase the bioavailability of hydrophobic drugs, and promote synergistic therapeutic outcomes. Despite these encouraging results, clinical translation remains constrained by challenges in biodegradability, biosafety, large-scale manufacturing, and cost. Ongoing clinical trials are evaluating the safety and therapeutic potential of CNP-based nanomedicines. Overall, this review underscores the transformative role of CNPs as a next-generation platform for precision and personalized therapy in colorectal cancer.

HFE
Also flagged:sarcopenialiver cirrhosiscirrhosisanxietydepressionascites
Journal Article 2025-10-31 ✓ 1 Snippet Bhagchandani D, Yadav A, Lamba M, Yadav N, Atam V, Yadav P.
In-Text Gene Mentions

…disorders such ashemochromatosis, Wilson’s disease, galactosem…

Show Full Abstract

Patients with liver cirrhosis experience a significantly reduced health-related quality of life (HRQoL) due to a multifaceted interaction of physiological, psychological, and social factors. Identifying these key determinants is crucial for enhancing care strategies and treatment outcomes. This study systematically explored the factors influencing both negative and positive aspects of HRQoL in patients with liver cirrhosis. A comprehensive literature search was performed across PubMed, Scopus, Embase, and Google Scholar, focusing on original research published since January 1, 2021. Studies involving sarcopenia in cirrhosis and its impact on HRQoL, including various subgroups and influencing factors, were included to ensure a wide-ranging analysis. The review identified multiple significant risk factors associated with poor HRQoL in cirrhotic patients. These included advanced age, female gender, lower socioeconomic status, low body mass index, and the presence of comorbid conditions such as anxiety and depression. Additionally, complications like ascites, hepatic encephalopathy, abnormal endoscopic findings, higher disease severity scores, sarcopenia, disturbed sleep, impaired sexual function, muscle cramps, and elevated levels of bilirubin, prothrombin time, and albumin-bilirubin ratio were linked to diminished HRQoL. On the other hand, interventions such as increased physical activity, liver transplantation, stem cell therapy, mindfulness practices, and the use of probiotics, rifaximin, and lactulose showed positive effects on HRQoL. These insights underscore the importance of adopting a comprehensive management approach for liver cirrhosis that addresses not only physical health but also psychological and social well-being. Future research should aim at developing targeted interventions to reduce the burden of these risk factors and promote overall quality of life in this patient population.

SOX6
Also flagged:Multiple MyelomatumorCRISPRCas9cancerSNHG6
Journal Article 2025-10-31 ✓ 3 Snippets Mhamedi EC, Hubé F, Alahari SK, Enguita FJ, Pardini B, Feinberg MW, Poliseno L, Armanios B, Jin J, Zhong XB, Sideris N, Bayraktar S, Castellano L, Santulli G, Jankauskas SS, Plewa WS, Conn SJ, Yang L, Shiu PKT, Kaushik A, Serganov A, Gentile M, Viglietto G, Amodio N, Mitić T, Caporali A.
In-Text Gene Mentions

…chanistically, they identifiedSOX6as a direct…

…miR-499-5p target; restoringSOX6levels or silencing…

…sEV release, orSOX6restoration may constitute…

Show Full Abstract

The field of non-coding RNA research is advancing at a breathtaking pace, continually uncovering new layers of regulatory complexity and functional diversity [...].

Also flagged:hydroxyapatitecollagenchewingbarium titanateoral diseasesmineralization
Journal Article 2025-10-31 No Snippets Kang W, Wang Y, Zhao D, Wang H, Xie S, Pan L.
Show Full Abstract

Teeth are the hardest organs in the human body. As mineralized structures, they possess a unique microstructure composed of orderly arranged piezoelectric materials such as hydroxyapatite crystals and collagen fibers. Teeth exhibit effective piezoelectric coefficients of approximately 1.2-1.6 pC/N. This inherent property enables teeth to function as natural piezoelectric sensors, converting routine mechanical stresses (e.g., chewing and biting forces, typically ranging from 22.4 to 68.3 kg) into localized electrical signals. This characteristic is of great importance in dentistry and materials science, offering new perspectives into a deeper understanding of the physiological functions and pathological mechanisms of teeth. Despite promising advances, challenges regarding the clinical translation, long-term stability, and biosafety of piezoelectric materials in the oral environment remain unresolved. This review highlights the biological functions of the piezoelectric properties of teeth, discusses recent applications and notable advancements of piezoelectric materials in dentistry, and outlines the challenges and research priorities for future clinical applications.

Also flagged:Pituitary adenylate cyclase-activating polypeptidePACAPbehavioralPAC1 receptorreverse transcriptioneating disorders
Journal Article 2025-10-31 No Snippets Nguyen HTT, Mai TN, Vu TTT, Nguyen TT.
Show Full Abstract

<h4>Background and aim</h4>Pituitary adenylate cyclase-activating polypeptide (PACAP) is a neuropeptide widely implicated in stress responses, appetite regulation, and emotional behavior. While PACAP has been linked to stress-induced appetite suppression, its role in circadian feeding and stress-related hyperphagia remains poorly defined. This study aimed to clarify the contribution of PACAP to circadian feeding behavior, chronic stress-induced hyperphagia, and emotional regulation in mice.<h4>Materials and methods</h4>Experiments were conducted using PACAP knockout (KO) and wild-type (WT) CD-1 mice. Acute and chronic restraint stress paradigms were applied, and food intake, body weight, and behavioral assays were recorded. Viral-mediated PACAP overexpression in the ventromedial hypothalamus (VMH) was performed using adeno-associated vectors. Emotional regulation was assessed through forced swim and tail suspension tests (TSTs). PAC1 receptor expression was quantified by reverse transcription and quantitative polymerase chain reaction.<h4>Results</h4>PACAP overexpression in the VMH significantly increased nocturnal feeding, demonstrating a circadian-specific effect on appetite regulation. Chronic restraint stress enhanced food intake in both PACAP KO and WT mice, whereas acute stress showed no effect, indicating that chronic stress-induced hyperphagia occurs independently of PACAP signaling. Behaviorally, PACAP-overexpressing mice exhibited reduced immobility in forced swim and TSTs, consistent with enhanced stress resilience and antidepressant-like effects. Importantly, PAC1 receptor expression remained stable throughout the diurnal cycle, suggesting that PACAP's modulatory effects are driven by neuropeptide availability rather than receptor fluctuations.<h4>Conclusion</h4>This study identifies PACAP in the VMH as a key modulator of circadian feeding and emotional behavior, while demonstrating its non-essential role in chronic stress-induced hyperphagia. The findings suggest that PACAP selectively integrates circadian and emotional signals to regulate feeding, independent of compensatory neuropeptide systems that mediate stress hyperphagia. These insights advance the understanding of neuropeptide regulation of energy balance and mood, with implications for stress-related eating disorders and anxiety.

Also flagged:replicative senescenceagingtelomeresegmentationreplicative agingsenescence
Journal Article 2025-10-31 No Snippets Kalashnikova DA, Romanov SE, Maksimov DA, Plokhikh IA, Epifanov RY, Mullyadjanov RI, Sidelnikov LO, Antoshina PA, Osipov YA, Shloma VV, Budilina AA, Samoylova EM, Baklaushev VP, Laktionov PP.
Show Full Abstract

<b>The aim of the study is</b> to analyze the manifestation of selected cellular senescence markers on the models of replicative senescence, stress-induced senescence, and chronological aging of human mesenchymal stem cells and to study the feasibility of predictive models for assessing the age and duration <i>in vitro</i> cultivation based on the transcriptomic data and investigation of cell morphology.<h4>Materials and methods</h4>In the study, the dynamics of expression of individual genes encoding key regulators of cellular aging across various models of cellular senescence, as well as telomere length were investigated by real-time PCR. The analysis of the high- throughput transcriptome sequencing datasets of mesenchymal stem cells from the donors of different ages has been performed. Using regression methods, predictive models based on transcriptomic data were developed to estimate chronological age and the duration of <i>in vitro</i> cultivation. Using microscopy methods and subsequent image analysis by machine-learning algorithms, morphological alterations associated with cellular senescence have been explored and segmentation neural network model has been created for extracting nuclear morphology parameters and classification of the cells based on the duration of cultivation <i>in vitro</i>.<h4>Results</h4><i>CDKN1A</i>, <i>LMNB1</i>, <i>HMGB2</i> genes demonstrated reproducible similar dynamics on the models of replicative or stress-induced senescence and chronological aging of mesenchymal stem cells. The expression profile of the senescence-associated inflammatory phenotype components was variable in different models of cell aging. The analysis of mesenchymal stem cell transcriptomes from the donors of various ages revealed considerable donor-dependent heterogeneity of the cells, which complicates the development of precise transcriptome data-based predictive models. Investigation of the changes in the telomere length has demonstrated its applicability for assessing the dynamics of replicative senescence <i>in vitro</i>. The developed segmentation neural network model allowed for detecting senescence-associated dynamics of nuclear morphology alterations in the process of replicative aging.

SOX6
Also flagged:CollagenGelatinbiodegradationCell proliferationreverse transcriptionsynthesis
Journal Article 2025-10-31 ✓ 1 Snippet Kisel AA, Isaeva EV, Beketov EE, Arguchinskaya NV, Gusarova VR, Yakimova AO, Demyashkin GA, Lagoda TS, Baranovsky DS, Klabukov ID, Ivanov SA, Shegay PV, Kaprin AD.
In-Text Gene Mentions

…with SOX5 andSOX6forming a chondrogenic…

Show Full Abstract

<b>The aim of the study</b> was to analyze the composition feasibility of the bioinks based on high-concentration collagen (40 mg/ml) and gelatin granules (6.25 mg/ml) for bioprinting of porous-structured hydrogel constructs using an extrusion 3D bioprinter.<h4>Materials and methods</h4>Bioprinting was performed on a 3D Invivo bioprinter (Rokit, South Korea). We assessed the filament continuity during extrusion, the changes in its thickness after test printing and incubation, as well as the biodegradation of prepared scaffolds. The hydrogel cytocompatibility was studied by the proliferation of adipose-derived stem cells (ADSCs) incorporated into the scaffolds. Flow cytometry was performed to determine the immunophenotype of ADSCs. Cell proliferation in the scaffold structure was studied <i>in vitro</i> during 28 days spectrophotometrically after adding PrestoBlue reagent. The expression of target genes was analyzed by quantitative reverse transcription polymerase chain reaction (RT-PCR) on day 21 of cultivation. We used the primers for mRNA encoding the synthesis of chondrogenic factors and metabolites (<i>ACAN</i>, <i>SOX9</i>, <i>COL1A1</i>, <i>COL2A1</i>), surface markers (<i>CD29</i>, <i>CD44</i>, <i>CD73</i>, <i>CD90</i>, <i>CD105</i>), as well as hypoxia (<i>HIF1A</i>), proliferation (<i>PCNA</i>), and apoptosis (<i>BCL2</i>, <i>BAX</i>) factors. The morphology of the scaffolds was studied on day 28 of culturing by light microscopy after fixing and staining the histological sections.<h4>Results</h4>The extrusion of the high concentration collagen-based hydrogel composition (40 mg/ml) and gelatin granules (6.25 mg/ml) during printing was stable, there was no filament breakage. When incubated in phosphate-buffered saline, the filament thickness of the hydrogel was statistically significantly higher than the scaffold thickness after printing. The degradation of the scaffolds from the hydrogel and gelatin in the solution of type I collagenase started earlier than the collagen scaffolds. The incubation in phosphate-buffered saline for 14 days resulted in less mass loss when drying the collagen scaffolds with gelatin granules. The cells isolated from human adipose tissue expressed surface markers characteristic of ADSCs. ADSCs proliferation and differentiation in chondrogenic direction were observed in both groups compared. The differences were in the spatial arrangement of the cells. In the collagen scaffolds the most cells were on the surface, while in the scaffolds from collagen and gelatin the cells were distributed throughout the whole volume. The 2<sup>-ΔΔCt</sup> quantitative reverse transcription polymerase chain reaction results showed the increased expression of the transcription factor <i>SOX9</i> by the cells in the collagen and gelatin scaffolds, as well as the decreased expression of the anti-apoptotic gene <i>BCL2</i> relative to the collagen scaffolds.<h4>Conclusion</h4>The present study suggested the bioink composition based on high concentration collagen (40 mg/ml) and gelatin granules (6.25 mg/ml) for bioprinting of porous-structured hydrogel constructs. The study showed hydrogel to be appropriate for printing and exhibited the properties of a porous material. The hydrogel provided the uniform distribution of ADSCs in the scaffold volume, contributing to their differentiation in the chondrogenic direction. Thus, the suggested bioink composition appears to be a promising material to be used in tissue engineering.

medRxiv 2025-10-31 Preprint (No Snippets API) Xiao S, Kaushik P, Du G, Liu B, Hosawi SB, Hastoy B, Argentieri MA, Winchester LM, Nevado-Holgado AJ, Kaddurah-Daouk R, Amin N, van Duijn C.
Show Full Abstract

That males and females age differently has been overlooked while developing aging clocks. Here, we developed a sex-specific metabolic aging clock in 390,941 individuals from the UK Biobank and integrated it with genetic, proteomic and epidemiological data to identify mechanisms accelerating/decelerating metabolic aging in males and females. Our findings reveal dysregulation of cholesterol metabolism, immune system, hemostasis, and cell growth, survival and apoptosis as common mechanisms accelerating metabolic aging in males and females, and upregulation of oxidative stress detoxification, cellular resilience and tissue integrity as common mechanisms decelerating metabolic aging. In females, a further dysregulation of carbohydrate/glucose metabolism, circadian rhythm and hormone metabolism accelerating metabolic aging is observed, while dysregulation of energy metabolism, cancer and longevity pathway is specifically observed in males. Among reproductive factors, late puberty and higher parity manifest as protective factors, decelerating metabolic aging in both sexes, and additionally childbirth at older age decelerating metabolic aging in women. Accelerated metabolic age strongly predicted morbidity and mortality in both sexes, except that the magnitude of association was several folds higher in males, and obesity explained most of the disease associations in females, suggesting that obesity influences metabolic aging and subsequent health outcomes differently in males and females. Consistent with the upregulation of molecular mechanisms involved in cancer in males, accelerated metabolic aging predicted several common cancers in males but not females. Our study provides novel insights into the biological mechanisms underlying aging and disease susceptibility in males and females, underscoring the importance of considering sex differences in healthcare strategies and public health policies.

bioRxiv 2025-10-31 Preprint (No Snippets API) Banerjee N, Ganguly M, Reyaz A, Mishra S, Dalal A, Guo X, Qiu X, Meyrath M, Palmer CB, Guo H, Song S, Sinha S, Roy N, Mukherjee D, Tiwari D, Yadav MK, Chevigne A, Robinson CV, Chen X, Banerjee R, Shukla AK.
Show Full Abstract

CXCR7, also known as atypical chemokine receptor 3 (ACKR3), is a naturally-biased, β-arrestin-coupled seven transmembrane receptor (7TMR) that lacks productive coupling with heterotrimeric G-proteins. Despite a critical involvement in cancer metastasis, cardiovascular pathophysiology, and inflammatory disorders, the molecular basis of non-canonical activation and functional divergence of CXCR7 remains elusive. Here, we present a complete landscape of CXCR7 activation using a series of cryo-EM structures, and discover an atypical activation mechanism that is distinct from prototypical GPCRs. CXCR7 is maintained in a basal conformation by a unique tripartite ionic-lock involving TM5-TM6, in contrast to a broadly conserved TM3-TM6 ionic-lock in GPCRs, which is disrupted upon receptor activation. Importantly, activation of CXCR7 results in a constricted pocket and distinct surface topology on the intracellular side compared to prototypical GPCRs. Serendipitously, we capture novel dimeric arrangements of CXCR7 with an inter-protomer stitching by a native phospholipid serving as a molecular glue, and identify previously unanticipated extrahelical allosteric sites on the receptor. Surprisingly, in an intermediate state structure of CXCR7, the second extracellular loop (ECL2) displays a self-blocking conformation, in stark contrast to ECL2-mediated self-activating mechanism reported recently for some orphan GPCRs. Finally, we unequivocally establish CXCR7 as an atypical opioid receptor via a large peptide library screening and structure elucidation in complex with distinct opioid peptides imparting full receptor activation. In summary, our study elucidates an atypical mechanism of CXCR7 activation, and establishes it as an alternative, non-canonical opioid receptor target with potential for novel pain therapeutics.

bioRxiv 2025-10-31 Preprint (No Snippets API) Phillip OA, Cyril Christophe Daniel Robert C, Leslie P, Elena B, Samuel HP, Luca S, Tobias G, Nikolaos P, Martinez VH, David P, Vanessa D, Lara N, Yanina BP, Victoria W, Asli BK, Idoia QU, Maria AJ, Jacob M, Anna K, Detlev A.
Show Full Abstract

Differential gene expression establishes the distinct physiology and morphology of cell types in an animal body. Single-cell sequencing and volume EM represent milestones toward the characterization of cell types, yet are difficult to combine for a comprehensive view on the cellular genotype-phenotype link. Here, we map a whole-body single-cell transcriptome into the PlatyBrowser, a multimodal cellular atlas for the marine annelid Platynereis dumerilii , and establish this combination uniquely for an entire animal. We learn that, in the 6-days-old worm, the majority of genes are tightly co-regulated to jointly implement one of eight major cellular morphotypes representing epidermis, gut, vasculature, myofibres, glia, motile cilia, glands, or neurons. Focusing on neurons, we uncover 14 families that by transcription factor identity, axonal projection, or sensory-secretory apparatus resemble conserved neuron types found in vertebrates, insects, or nematodes. We hypothesize that these existed in urbilaterian ancestors and represent the ancient core of nervous system centralization.

Research Square 2025-10-31 Preprint (No Snippets API) Huider F, milaneschi y, Pool R, Maciel B, Gordon S, Rietman ML, Kok A, Galesloot T, Mitchell B, Hart Lt, Rutters F, Blom M, Rhebergen D, Visser M, Brouwer I, Feskens E, Hartman C, Oldehinkel A, Bot M, de Geus E, Kiemeney L, Huisman M, Picavet HS, Verschuuren M, Martin N, Dolan C, Loo Hv, penninx b, Hottenga J, Boomsma D.
Show Full Abstract

<title>Abstract</title> <p>Harmonized phenotyping and diverse population-specific studies are crucial for advancing gene discovery in psychiatric genetics. We conducted a genome-wide association study (GWAS) of DSM-defined lifetime Major Depressive Disorder (MDD) in 64,941 participants (25.7% cases) from the Dutch BIObanks Netherlands Internet Collaboration (BIONIC) consortium. SNP-based heritability was estimated at 13.4%, exceeding recent global meta-analyses, with a high genetic correlation (r = 0.89) to the latest major depression GWAS by the Psychiatric Genetics Consortium (PGC-MD). We identified a novel genome-wide significant locus in PALMD (P = 3.26 × 10⁻⁸), that was confirmed by GWAS-by-subtraction. Polygenic scores (PGSs) based on BIONIC predicted MDD in UKBiobank, and PGSs from PGC-MD predicted into BIONIC, with within-family analyses indicating minimal confounding. Genetic causal inference revealed associations with over 30 phenotypes. Twin concordance for MDD increased with polygenic burden, reinforcing its genetic architecture. This study emphasizes the power of harmonized phenotyping and regional biobanks in uncovering the genetic architecture of MDD, highlighting the value of population-specific studies for improving risk prediction and advancing psychiatric genetics.</p>

Research Square 2025-10-31 Preprint (No Snippets API) Budhram-Mahadeo V, Phillips N, Sironen A, Holt M, Riera-Escamilla A, Conrad D.
Show Full Abstract

<title>Abstract</title> <p> Male infertility is rising globally, yet its causes remain unclear. This study identifies the transcription factor Brn-3b (POU4F2) as essential for spermatogenesis and sperm function. Brn-3b is highly expressed in mature spermatids and infertility in constitutive male Brn-3b knockout (KO) mice is characterised by structural and functional testicular changes such as reduced sperm counts, impaired motility and ultrastructural defects including disrupted acrosomes and defects in the mitochondria and flagella. RNA-seq analyses reveal significant changes in Brn-3b-dependent regulation of genes essential for sperm development, mitochondrial function, and microtubule-based movement. This was confirmed using qRT-PCR with reduced expression of associated genes e.g. <italic>Spata13</italic> , <italic>Dnah6</italic> , Cox7a1 and upregulation of genes linked to inflammation and ECM remodelling (e.g., <italic>Ptges</italic> , <italic>MMP2</italic> ). Human studies showing reduced Brn-3b in infertile men, e.g. with Klinefelter syndrome validated these findings. Exome sequencing identifying potentially deleterious variants in infertile men, suggest Brn-3b as a promising target for understanding and diagnosing male infertility. </p>

Also flagged:tumorCancertumorsangiogenesisβ-adrenergic receptortranslational
Journal Article 2025-10-30 No Snippets Liu QQ, Dong ZK, Wang YF, Jin WL.
Show Full Abstract

Cancer neuroscience, an emerging convergent discipline, offers novel insights into the dynamic interplay between the nervous system and cancer progression. Bidirectional signaling between the nervous system and tumors, particularly within the innervated tumor microenvironment (TME), modulates key cancer hallmarks, including proliferation, immune evasion, angiogenesis, and metastasis. Neural ablation shows heterogeneous outcomes depending on nerve subtype and tumor context, underscoring the importance of nerve-type-specific and context-dependent therapeutic approaches. These mechanistic advances are catalyzing novel therapeutic strategies that target neural-TME interactions through the integration of neuroscience and oncology. Here, we highlight recent progress in cancer neuroscience and propose revised therapeutic frameworks aimed at the neuro-innervated TME. These strategies employ interdisciplinary approaches, such as drug repurposing [β-adrenergic receptor (β-AR) blockers, antipsychotics, antidepressants], and nanotechnology-enabled targeted delivery. Both preclinical and clinical data support the potential of neural-targeted therapies to improve precision, circumvent drug resistance, and enhance clinical outcomes. By bridging neuroscience and oncology, this framework delineates a translational pathway for harnessing neural-tumor crosstalk, presenting a promising avenue for advancing cancer therapeutics and improving patient care.

Also flagged:PDglycoproteinsATPase phospholipid transporter 11BATP11BmyeloperoxidaseMPO
Journal Article 2025-10-30 No Snippets Zhao L, Hou C, Gao Y, Jin H, Liu CF, Li S, Ma J, Yang S.
Show Full Abstract

Parkinson's disease (PD) is a progressive neurodegenerative disorder lacking definitive diagnostic tests. To identify new diagnostic biomarkers, we employed glycoproteomics-mass spectrometry (MS) to investigate dynamic changes in protein <i>N</i>-glycosylation across the serum, urine, and saliva of PD patients. Our comparative analysis of differentially expressed glycoproteins (DEGs) between PD patients and healthy controls (HCs) revealed distinct patterns. Specifically, ATPase phospholipid transporter 11B (ATP11B) was significantly upregulated in the serum of PD patients, while urine and saliva showed an opposite trend. Other key findings included elevated myeloperoxidase (MPO) in urine and clusterin (CLU) in serum. Zinc-α-2-glycoprotein (AZGP1), detected in all three biofluids, displayed increased sialylation and core fucosylation in serum but decreased levels in the saliva and urine of PD patients, along with a distinct bifucosylation pattern in saliva. These glycoprotein expression changes were further validated using enzyme-linked immunoassay (ELISA). Pathway analysis indicated that these DEGs are primarily involved in inflammatory response, complement activation, and synaptic plasticity, suggesting that glycosylation dysregulation may contribute to PD progression by modulating neuroinflammation and protein homeostasis. This study represents the first comprehensive analysis of multibiofluid <i>N</i>-glycosylation in PD. The findings offer potential biomarkers and provide insights into the molecular mechanisms of the disease, which could ultimately inform early diagnosis and the development of targeted therapies.

Also flagged:ABCG2bindingwaterthrombin
Journal Article 2025-10-30 No Snippets Behera S, Gapsys V, de Groot BL.
Show Full Abstract

Accurate binding free energy prediction is vital for drug design, motivating the assessment of new force field models. Here, we evaluate the ABCG2 charge model with nonequilibrium alchemical free-energy simulations. GAFF2/ABCG2 achieves higher hydration free energy accuracy but does not outperform GAFF2/AM1-BCC for protein-ligand binding free energy. Both charge models exhibit comparable accuracy and compound ranking across targets, indicating that property-specific force field optimization does not guarantee improved related-property performance.

MMS22L
Also flagged:FIGNL1BRCA2RAD51Breast Cancer Gene 2nucleoproteinrecombinase
Journal Article 2025-10-30 ✓ 1 Snippet Kuthethur R, Vz SN, Sengodan SK, Fonseca C, Braunshier S, Nagar N, Acharya A, Wang X, Theil AF, Ibini O, Manolika EM, de Koning K, Dessapt J, Fradet-Turcotte A, Lebbink JHG, Kanaar R, Poluri KM, Sharan SK, Cejka P, Ray Chaudhuri A.
In-Text Gene Mentions

…identify that theMMS22L-TONSL complex interacts with…

Show Full Abstract

Homologous recombination (HR) deficiency upon Breast Cancer Gene 2 (BRCA2) loss arises from defects in the formation of RAD51 nucleoprotein filaments. We demonstrate that loss of the anti-recombinase Fidgetin Like 1 (FIGNL1) retains RAD51 loading at DNA double-stranded breaks (DSBs) in BRCA2-deficient cells, leading to genome stability, HR proficiency, and viability of BRCA2-deficient mouse embryonic stem cells. Mechanistically, we demonstrate that strand invasion and subsequent HR defects upon BRCA2 loss primarily arise from the unrestricted removal of RAD51 from DSB sites by FIGNL1, rather than from defective RAD51 loading. Furthermore, we identify that the MMS22L-TONSL complex interacts with FIGNL1 and is critical for HR in BRCA2/FIGNL1 double-deficient cells. These findings identify a pathway for tightly regulating RAD51 activity to promote efficient HR, offering insights into mechanisms of chemoresistance in BRCA2-deficient tumors.

Also flagged:regulationbindingchromatinmethylationHistoneTF
Journal Article 2025-10-30 No Snippets Kagda MS, Lam B, Litton C, Small C, Sloan CA, Spragins E, Tanaka F, Whaling I, Gabdank I, Youngworth I, Strattan JS, Hilton J, Jou J, Au J, Lee JW, Andreeva K, Graham K, Lin K, Simison M, Jolanki O, Sud P, Assis P, Adenekan P, Miyasato S, Zhong W, Luo Y, Myers Z, Cherry JM, Hitz BC.
Show Full Abstract

Spanning two decades, the collaborative ENCODE project aims to identify all the functional elements within human and mouse genomes. To best serve the scientific community, the comprehensive ENCODE data including results from 23,000+ functional genomics experiments, 800+ functional elements characterization experiments and 60,000+ results from integrative computational analyses are available on an open-access data-portal ( https://www.encodeproject.org/ ). The final phase of the project includes data from several novel assays aimed at characterization and validation of genomic elements. In addition to developing and maintaining the data portal, the Data Coordination Center (DCC) implemented and utilised uniform processing pipelines to generate uniformly processed data. Here we report recent updates to the data portal including a redesigned home page, an improved search interface, new custom-designed pages highlighting biologically related datasets and an enhanced cart interface for data visualisation plus user-friendly data download options. A summary of data generated using uniform processing pipelines is also provided.

HFE
Also flagged:curcuminliver fibrosisNAFLDHepatic fibrosiscirrhosisliver failure
Journal Article 2025-10-30 ✓ 1 Snippet Gerami H, Mozaffari-Khosravi H, Mansour A, Sohrabpour AA, Poustchi H, Hashemi Taheri AP, Jaafari MR, Jambarsang S, Khayyatzadeh SS.
In-Text Gene Mentions

…liver diseases likehemochromatosisor Wilson’s disease)…

Show Full Abstract

Hepatic fibrosis, resulting from chronic liver injury, can lead to cirrhosis and liver failure. Curcumin shows anti-fibrotic potential but has low bioavailability. This 16-week double-blind, randomized, placebo-controlled trial evaluated the effects of 80 mg/day nano-curcumin on liver fibrosis, steatosis, liver function test, and anthropometric parameters in 55 adults (30-70 years) with stage ≥ F2 NAFLD-induced fibrosis. Primary outcomes were liver fibrosis and steatosis assessed by FibroScan and FIB-4. Secondary outcomes included changes in liver function tests and anthropometric parameters including body composition. Both groups improved in fibrosis and steatosis, with no significant differences were found between them. The FIB-4 index decreased significantly in the nano-curcumin group (p = 0.022), but between-group differences were not significant (p = 0.135). ALT and AST significantly decreased in the nano-curcumin group (p < 0.001 and p = 0.004), with significant group differences (p < 0.05). GGT reduction was significant between groups after adjustment (p = 0.043), and LDH levels also decreased significantly in the nano-curcumin group (p < 0.001), with a significant between-group difference (p = 0.016). No statistically significant between-group differences were observed in anthropometric parameters. Nano-curcumin improved liver enzymes but showed no significant effect on fibrosis or steatosis compared to placebo. Further research is needed to confirm long-term benefits. Trial registration Iranian Registry of Clinical Trials IRCT20210427051098N2 (Available from: https://irct.behdasht.gov.ir ).

SOX6
Also flagged:melanomacancerNRASmethylationsingle-nucleustumour
Journal Article 2025-10-30 ✓ 1 Snippet Mucha M, Bühner S, Loßner M, Fincke VE, Reitsam NG, Dorn F, Lobbes D, Gastberger K, Schuster T, Dintner S, Schroeder C, Brecht IB, Schneider DT, Märkl B, Frühwald MC, Johann PD.
In-Text Gene Mentions

…as EYA1 andSOX6(cluster 0), ENO4…

Show Full Abstract

<h4>Background</h4>Cutaneous malignant melanoma is a common cancer in adults but extremely rare in young children, affecting fewer than one child per million each year in Europe. Because of its rarity, most treatments for children are adapted from adult therapies, despite possible biological differences. This study aimed to explore the molecular features of a rare and aggressive melanoma in a 16-month-old patient to understand disease progression and treatment resistance.<h4>Methods</h4>We studied the tumour and metastases of a patient with a melanoma carrying an NRAS mutation, who received chemotherapy and immune checkpoint inhibitor treatment. The patient died 10 months after diagnosis. We used DNA methylation analysis, single-nucleus RNA sequencing, and deep spatial transcriptomic profiling to examine genetic changes, gene activity, and their spatial distribution in both the primary tumour and lymph node metastases.<h4>Results</h4>Here, we show that the tumour displayed high genetic and transcriptomic diversity. We identified increases in MITF and BRAF gene copies as likely key drivers of the aggressive disease, which were not detected at diagnosis. We also found activation of biological pathways, including VEGFA and WNT signalling, and abnormal activity of several genes linked to immune therapy response, with marked variation between tumour regions.<h4>Conclusions</h4>This case demonstrates that paediatric melanoma can harbour complex and spatially variable molecular changes that contribute to rapid disease progression and treatment failure. Our findings support incorporating detailed spatial transcriptional profiling into clinical assessment to better guide therapy in rare paediatric cancers.

FBXL4CCPG1
Also flagged:autophagydegradationorganellesautophagy receptorstransmembranemembranes
Journal Article 2025-10-30 ✓ 4 Snippets Adriaenssens E, Martens S.
In-Text Gene Mentions

…2021 ), andCCPG1(Smith et al,…

…time by the SCF–FBXL4ubiquitin ligase complex,…

…SARs and the SCF–FBXL4ubiquitin ligase complex…

…FAM134B, FAM134C, andCCPG1, as well as…

Show Full Abstract

Selective autophagy ensures the targeted degradation of damaged or surplus cellular components, including organelles, thereby safeguarding cellular homeostasis. This process relies on selective autophagy receptors (SARs) that link specific cargo to the autophagy machinery. These receptors exist in two distinct forms: soluble SARs that are recruited to the cargo on demand, and transmembrane SARs that are stably embedded in the membranes of organelles they target. While both receptor types converge on the same autophagy core machinery, they differ in how they recognize cargo, are regulated, and recruit this machinery to the site of degradation. In this review, we explore the unique challenges and strategies associated with transmembrane SARs, including how their activity is suppressed under basal conditions and activated in response to stress. We compare their mode of action with that of soluble SARs, highlight key differences in kinase regulation, including the roles of TBK1, ULK1, CK2, and Src, and discuss emerging models of autophagy initiation. We further highlight fundamental principles of organelle-selective autophagy and identify open questions that will guide future research.

HTT
Also flagged:neurodegenerative disorderHDHuntingtonDiseasecytosineadenine
Journal Article 2025-10-30 ✓ 1 Snippet Estarellas M, Gomis C, Canals JM.
In-Text Gene Mentions

…the huntingtin (HTT) gene on…

Show Full Abstract

Huntington's disease (HD) is a fatal, inherited neurodegenerative disorder marked by the progressive and selective loss of spiny projection neurons (SPNs), resulting in a characteristic triad of motor, cognitive, and psychiatric symptoms. Despite ongoing research, no disease-modifying treatments are available, and existing therapies are limited to symptomatic relief. Stem cell-based approaches represent a promising avenue to restore striatal circuitry by replacing lost neurons and/or delivering trophic support to preserve the remaining neural tissue.In this review, we present a critical analysis of past and current clinical trials exploring cell-based therapies for HD. Early studies using human fetal tissue were hindered by sample heterogeneity and inconsistent outcomes, ultimately limiting their clinical applicability. More recent trials have shifted focus toward mesenchymal stem cells (MSCs), which are valued for their neuroprotective secretome but are not suitable for neuronal replacement. To address these limitations, human pluripotent stem cells (hPSCs) have emerged as a renewable and scalable source for the development of advanced therapy medicinal products (ATMPs). In vitro differentiation protocols mimic key developmental signaling pathways to generate striatal-like neural progenitor cells (NPCs). We review the cellular composition of these hPSC-derived ATMPs and summarize findings from preclinical transplantation studies, including data on graft survival, neuronal maturation, synaptic integration, and functional recovery. In addition, we discuss other emerging strategies such as direct neuronal reprogramming. Finally, we examine the major challenges that remain-such as ensuring graft safety, consistency, and regulatory compliance-and highlight the importance of international collaboration to overcome these barriers and accelerate clinical translation.

PCDH17
Also flagged:Renal cell carcinomarenal neoplasmsRCCmethylationmetabolismAQP1
Journal Article 2025-10-30 ✓ 1 Snippet Kelly JF, Samarska IV, Ramaekers B, Marcelissen T, van Roermund JG, Aarts MJB, Kerkhofs T, Hermans T, van Osch F, de Meyer T, Schouten LJ, Smits KM.
In-Text Gene Mentions

…such as thePCDH17/TCF21 methylation panel (AUC…

Show Full Abstract

<h4>Background</h4>Renal cell carcinoma (RCC) accounts for 90% of all renal neoplasms and is often incidentally detected through unrelated imaging procedures. Differentiating between benign and malignant renal masses remains challenging using imaging alone. Urinary biomarkers may aid in this distinction, yet none are currently implemented in the clinic. Moreover, a comprehensive overview of urinary diagnostic biomarkers for RCC is lacking. Therefore, we aimed to systematically review and summarize existing literature on potential urinary biomarkers with diagnostic properties for RCC.<h4>Methods</h4>PubMed, Scopus and Web of Science were used for the identification of eligible studies evaluating urinary biomarkers in adults with sporadic RCC which reported diagnostic properties compared to controls groups. Standardized data extraction was performed. Risk of bias of was assessed by using a modified STROBE 22-items checklist for observational studies.<h4>Results</h4>In total 136 articles were identified through database search, four via a previous review and 19 through cross-referencing. After screening, 46 articles were included, identifying 105 individual biomarkers: metabolites (n = 40), proteins (n = 29), miRNAs (n = 12), DNA methylation markers (n = 13) and others (n = 11). Additionally, 29 multi-biomarker panels were described. Promising diagnostic markers (AUC ≥ 0.80) included dysregulated energy metabolism markers, proteins AQP1 and PLIN2, and miRNAs; miR-122-5p, miR-15a and miR-30c, however validation is severely lacking.<h4>Conclusions</h4>Various urinary biomarkers for RCC show promising diagnostic potential. The diagnostic ability of multi-biomarker panels often exceeded those of individual markers. However, individual markers and panels require external validation before clinical implementation.<h4>Trial registration</h4>This systematic review was registered on PROSPERO (CRD42023474582), and was designed and written based on the PRISMA guidelines.

MLLT10
Also flagged:Acute promyelocytic leukemiaAMLPMLchromosomeRARAall-trans-retinoic acid
Journal Article 2025-10-30 ✓ 1 Snippet Zhong X, Cordeddu L, Gamboa-Cedeno A, Bengtzén S, Ekwall K, Lennartsson A, Lehmann S.
In-Text Gene Mentions

…be downregulated in KMT2A::MLLT10AML patients […

Show Full Abstract

<h4>Background</h4>Acute promyelocytic leukemia (APL) is a subtype of acute myeloid leukemia (AML), characterized by a fusion between the PML and RARA genes and by a block in the myeloid maturation at the promyelocytic stage.<h4>Methods</h4>This study investigates the epigenetic landscape of APL by integrating ChIP-seq data on eight histone modifications and RNA-seq in APL as well as non-APL AML. APL showed a distinct chromatin profile that differed from non-APL AML.<h4>Results</h4>We describe APL-specific changes in H3K27ac, H3K9me3, and H3K27me3 with impact on enhancer activity, repression of transposable elements, and Polycomb regulated gene repression. The APL-specific H3K27ac pattern identifies APL-specific enhancer and super-enhancer regions, including a subset of enhancers that are bound by the PML-RARA fusion protein. While chromatin bound specifically by PML-RARA were dominantly active, APL was also characterized by gain of APL-specific heterochromatin states with significant gains of H3K9me3 enriched lamina-associated domains and the transposable elements LINE, LTR, and SINE.<h4>Conclusion</h4>These findings suggest a unique enhancer and heterochromatin profile in APL, with implications for transcription regulation and treatment response. These findings offer novel insights into the pathogenesis of APL.

DNAH10
Also flagged:genetic disordersmale infertilityhereditary male infertilityTMF1subfertilityinfertility
Journal Article 2025-10-30 ✓ 5 Snippets Li K, Chen Y, Tang D, Sheng Y, Han X, Geng H, Zhang N, Duan Z, Wang G, Gao Y, Guo R, Hua R, Ding Z, Xu C, Shen Q, Yu Z, Song B, Lv M, Xu Y, Wu H, Wu J, Cao Y, He X.
In-Text Gene Mentions

…heavy chain 10,DNAH10: c.1436A>G; DNAH10…

…DNAH10 : c.1436A>G;DNAH10: c.8113G>A).…

…heterozygous NCSVs (DNAH10: c.1436A>G; DNAH10…

…DNAH10 : c.1436A>G;DNAH10: c.8113G>A) identified…

…exonic NCSV (DNAH10: c.12838G>A) led…

Show Full Abstract

Canonical splicing variants (±2) contribute significantly to genetic disorders, yet the clinical significance of non-canonical splicing variants (NCSVs) that occur outside of canonical splicing sites remains unknown in male infertility. A comprehensive evaluation of reported studies on hereditary male infertility revealed that the 2,404 pathogenic variants contained 120 canonical splicing variants and 32 NCSVs. Among the remaining 2,252 variants, the splicing variant analytical strategy identified 17 novel NCSVs that disrupt normal mRNA splicing from previously classified missense variants. This expands the contribution of NCSVs by 53.13% (17/32), with NCSVs accounting for 28.99% (49/169) of all the splicing variants. Moreover, thirteen positively validated NCSVs are identified in 12 of 718 idiopathic male infertility patients with negative results by conventional genetic analysis. The first pathogenic variant in the TATA element modulatory factor 1 (TMF1: c.2859+4A>G) results in TMF1 exon 14 skipping and decreased progressive sperm motility and morphological abnormalities in a patient with male infertility. Tmf1 NCSV knock-in mice recapitulated human phenotype, showing significantly decreased sperm count, motility, ultrastructural head defects, and subfertility. This study provides the first comprehensive landscape of NCSVs in male infertility, suggesting that NCSVs may constitute a hidden etiological factor for male infertility.

Also flagged:-19fentanylopioid overdosedeathopioid use disorderopioid
Journal Article 2025-10-30 No Snippets Chatterjee A, Chase RP, Chahine RA, Davis J, Dsouza N, Ellison S, Bagley SM, Fisher T, Glasgow L, Harris MTH, Huang TT, Holloway J, Lounsbury DW, Oga E, Asman K, Roberts SM, Sabounchi N, Surratt HL, Lines LM, Stadler HW, Taylor JL, Davis A.
Show Full Abstract

<h4>Introduction</h4>Evidence-based practices (EBPs) tailored to reduce opioid-related fatalities among minoritized populations may help reduce inequities, but research elucidating the relationship between local-level inequities in social determinants of health (SDH) and selection and implementation of tailored EBPs.<h4>Methods</h4>The HEALing Communities Study was a multisite, wait-listed, community-level cluster-randomized trial with the objective to reduce opioid overdose deaths. Community coalitions selected and partner organizations implemented EBP strategies to increase access to Overdose Education and Naloxone Distribution (OEND) and Medications for Opioid Use Disorder (MOUD). The research team utilized negative binomial and zero-inflated Poisson models to assess whether the relationship between (a) communities' need for tailored OEND and MOUD strategies, as indicated by opioid overdose death rates among minoritized groups; and (b) the selection, implementation, and reach of those strategies was moderated by local-level inequities in SDH, quantified by the Local Social Inequity in Drug Overdoses (LSI-DO) index. The analysis included data from 33 communities across four states.<h4>Results</h4>Eleven of 33 communities implemented tailored OEND and MOUD strategies. Adjusted analysis revealed that LSI-DO scores moderated the relationship between 2021 opioid overdose death rates among minoritized groups and the proportion of community-implemented tailored strategies (p = 0.015). The research team found no moderation for the number of strategies selected or number of individuals reached by EBPs.<h4>Conclusion</h4>Few communities selected EBPs tailored to minoritized populations. For those that did, higher local-level social inequity was associated with decreased implementation of tailored strategies. Continued research on how to address overdose inequities-and local-level social inequity-is vital. Findings highlight the need for policy approaches that pair overdose prevention strategies with investments to reduce local-level social inequities that impede equitable implementation.

PRDX6
Also flagged:peroxiredoxin 6bronchopulmonary dysplasiamesencephalic astrocyte-derived neurotrophic factorsecretionextracellularvesicles
Journal Article 2025-10-30 ✓ 5 Snippets Song H, Hao Q, Li J, Liu Y, Huo Z, Si R, Feng X, Zhou C, Cheng X.
In-Text Gene Mentions

…from peroxiredoxin 6 (PRDX6)-downregulated mesenchymal st…

…Nevertheless, whetherPRDX6participates in BPD…

…used to overexpressPRDX6in BMSCs.…

PRDX6-overexpressing BMSCs exhibite…

…< 0.05) inPRDX6-overexpressed BMSCs.…

Show Full Abstract

Bone marrow-derived mesenchymal stem cell (BMSCs) delivery is a promising therapeutic strategy for bronchopulmonary dysplasia (BPD); however, its efficacy remains suboptimal. Recent studies have reported that extracellular vesicles derived from peroxiredoxin 6 (PRDX6)-downregulated mesenchymal stem cells (MSCs) exhibit diminished anti-inflammatory and anti-oxidant effects through a paracrine mechanism. Nevertheless, whether PRDX6 participates in BPD progression via paracrine signaling remains unclear. Herein, rat BMSCs were first isolated and characterized. The GFP-labeled lentivirus was used to overexpress PRDX6 in BMSCs. PRDX6-overexpressing BMSCs exhibited improved proliferation and migration abilities. Notably, mesencephalic astrocyte-derived neurotrophic factor (MANF) secretion was significantly increased (∼2.5-fold, p < 0.05) in PRDX6-overexpressed BMSCs. Further mechanistic studies revealed that PRDX6 bound to MANF, reducing its endoplasmic reticulum retention by displacing glucose-regulated protein 78, thereby promoting MANF secretion. Silencing MANF expression markedly attenuated the effects of PRDX6 overexpression. PRDX6-modified BMSCs were delivered intratracheally into BPD rat model, which was established by exposing rats in 85 % oxygen for 21 days. PRDX6 overexpression enhanced BMSCs recruitment to injured lung tissues, and significantly reduced apoptosis, inflammation, vascular loss, and pulmonary arterial remodeling. Concurrently, MANF levels in lung tissues, bronchoalveolar lavage fluid, and serum were elevated post-administration. These results suggest that PRDX6-mediated MANF secretion in BMSCs may not only enhance their proliferative and migratory capacities but also directly protect against lung injury. These findings provide a new strategy for amplifying the in vivo efficacy of BMSCs delivery on BPD.

Also flagged:taupositronAlzheimer's diseaseADcognitive declinemetabolism
Journal Article 2025-10-30 No Snippets Gu SC, Sun QY, Liu HQ, Shen CY, Su H, Xie F, Ye Q.
Show Full Abstract

<h4>Background</h4>Tau neurofibrillary pathology is a hallmark of Alzheimer's disease (AD) and can be quantified in vivo using tau-selective positron emission tomography (tau PET). Tau PET signal closely correlates with cognitive decline and disease stage, yet the molecular networks underpinning tau accumulation remain incompletely defined.<h4>Methods</h4>We performed multi-omics integration of proteomics, transcriptomics, and tau PET standardized uptake value ratios (SUVRs), and clinical assessments data from cognitively normal and cognitively impaired individuals. Using Light Gradient Boosting Machine (LightGBM), two-way orthogonal partial least squares, and network-based approaches, we explored key tau-associated proteomic signatures and constructed protein-protein interaction (PPI) modules. Module activities were quantified by gene set variation analysis and related to tau PET and cognition.<h4>Results</h4>Among 60 regions, 15 tau PET imaging biomarkers were selected based on group differences, LightGBM importance, and cognitive relevance. Fifty key tau-associated proteins were identified and organized into four functional modules. PPI modules 1 (metabolic-cytoskeletal) and 3 (adhesion-nutrient sensing) exhibited strong associations with elevated tau PET uptake across selected cortical and limbic regions, as well as with cognitive impairment.<h4>Conclusion</h4>Distinct modules reflected regional tau PET burden and cognitive outcomes in AD, highlighting convergent disruptions in energy metabolism, cytoskeletal stability, and intercellular signaling.<h4>Highlights</h4>Integration of proteomics, transcriptomics, tau positron emission tomography (PET) imaging, and cognition in Alzheimer's disease.Fifteen key tau PET imaging biomarkers were prioritized.Fifty key tau-associated proteins were identified.Four distinct molecular networks contribute to regional tau pathology and cognition.Modules 1 (metabolic-cytoskeletal) and 3 (adhesion-nutrient sensing) strongly associated with tau PET burden and cognitive impairment.

Also flagged:caffeic acidalkylamideα-glucosidaseα-amylasediabetes
Journal Article 2025-10-30 No Snippets Kannan K, Sadhukhan S.
Show Full Abstract

Historically, natural products have been a primary source of new drugs and lead compounds. However, their direct application as therapeutic agents remains limited. Given the multifactorial nature of diabetes, therapeutic agents with multi-targeting properties offer a promising solution for effective management. Herein, we developed a library of seven lipophilic derivatives of caffeic acid (CA) and evaluated their multimodal antidiabetic activities. Among these, the most potent compound, CA14, showed an IC<sub>50</sub> of 1.94 μM, representing a 113-fold improvement over acarbose (IC<sub>50</sub> 219.70 μM). Further, compared to the parent compound CA (IC<sub>50</sub> 12 400 μM), CA14 was 6392 times more potent. Kinetic analysis revealed that CA14 acts as a competitive inhibitor of α-glucosidase. CA14 showed comparable α-amylase inhibition to that of acarbose, while CA showed no inhibition even at 500 μM. Additionally, CA14 exhibited antiglycation activity by inhibiting fructosamine and advanced glycation end products (AGEs). It also showed excellent antioxidant activity (IC<sub>50</sub> 13.98 μM), nearly twice as potent as Vitamin C. Notably, acarbose lacked any antioxidant activity. Intrinsic fluorescence quenching and FT-IR analyses further confirmed that CA14 disrupted substrate binding, reducing enzymatic activity. Of note, CA14 did not exhibit any significant cytotoxicity in 3T3-L1 fibroblasts, even at 50 μM. Molecular docking revealed good extent of interactions, while ADMET profiling predicted favorable druglikeness. CA14 was found to be stable under physiological conditions even after 10 days. In summary, CA derivatives demonstrated robust multifaceted antidiabetic potential by inhibiting α-glucosidase, α-amylase, and AGE formation, while also mitigating oxidative stress, which are key contributors to diabetes progression.

HFE
Also flagged:synthesiscarbon dotsIronAlzheimer'shydroxylcarboxyl
Journal Article 2025-10-30 ✓ 2 Snippets Srivastava S, Ali A, Kanika, Samadder P, Kumar B, Mishra AK, Khan MR, Ali N, Son YO, Khan R.
In-Text Gene Mentions

…as Alzheimer's andhemochromatosis.…

…health disorders, includinghemochromatosis, 2 hemosiderosis, 3…

Show Full Abstract

Iron (Fe) is an essential micronutrient for metabolic and physiological processes. Its dysregulation is associated with disorders such as Alzheimer's and hemochromatosis. Therefore, the development of cost-effective and selective probes for Fe(iii) detection is of significant clinical importance. In this study, fluorescent carbon dots derived from coconut coir (CCDs) were synthesized <i>via</i> a single-step hydrothermal method. The CCDs exhibited strong blue emission at 450 nm under 350 nm excitation and demonstrated selective fluorescence quenching in the presence of Fe(iii) ions, with a detection limit of 223.2 μM. HR-TEM revealed the particle size of CCDs ranged between 5.64 to 10 nm. XRD confirmed the crystalline nature. FTIR spectra indicated presence of hydroxyl and carboxyl groups contributing to dispersibility and surface passivation. Raman spectroscopy showed distinct D (1354 cm<sup>-1</sup>) and G (1582.61 cm<sup>-1</sup>) bands, characteristic of low-dimensional carbon nanostructures. Bioimaging and cytocompatibility studies in L929 fibroblast cells confirmed biocompatibility up to 500 μg mL<sup>-1</sup>. Collectively, these findings highlight the potential of CCDs as an effective fluorescent probe for Fe(iii) sensing and bioimaging applications in medical diagnostics. The CCDs were cytocompatible at concentrations up to 500 μg mL<sup>-1</sup>.

DARS2
Also flagged:liver fibrosisliverbindingproteinATF4TGFβ1
Journal Article 2025-10-30 ✓ 1 Snippet Yang S, Zhang H, Sun X, Chen Z, Nie Z, Li Y, Liu X, Kong Y, Wang Z, Zai W, Gao S, Chen W.
In-Text Gene Mentions

…aspartyl-tRNA synthetase 2 (DARS2) leads to mitochondrial…

Show Full Abstract

Hepatic stellate cells (HSCs) trans-differentiation into myofibroblasts is central to liver fibrosis. Integrated stress response (ISR) signaling, including metabolic stress, plays a critical role in this process. However, the precise role of ISR signaling in HSCs activation-whether detrimental or protective-remains unclear. Here we identified that the noncanonical cap-binding protein EIF3d-mediated ATF4 expression is significantly upregulated in HSCs from both patients and mouse models of fibrotic livers, with its levels positively correlating with the degree of fibrosis. EIF3d-ATF4 signaling was induced by TGFβ1 in HSCs and was demonstrated to be both necessary and sufficient for promoting HSC survival, proliferation, activation, and extracellular matrix (ECM) production. Furthermore, genetic and pharmacological inhibition of EIF3d-ATF4 effectively prevented TGFβ1-induced HSC activation by suppressing mitochondrial activity and glycolysis. Mechanistically, EIF3d-ATF4 overexpression drove ATF4-dependent S100P transcription, which facilitated metabolic reprogramming and upregulated fibrogenic markers. This EIF3d-ATF4-S100P axis promoted liver fibrosis by activating JNK and NLRP3 signaling in HSCs, thereby inducing HSC activation and conferring resistance to apoptosis. Importantly, mice with HSC-specific ATF4 deletion or treated with our innovative ISR antagonist, ERMT1, were protected from three distinct mouse fibrotic models. These findings underscore the role of the EIF3d-ATF4-S100P signaling axis in liver fibrosis progression and HSC activation, presenting it as a promising therapeutic target for managing liver fibrosis and cirrhosis.

ZNFX1
Also flagged:CMV infectionInterferonsIFNsIFNviral infectionshemophagocytic lymphohistiocytosis
Journal Article 2025-10-30 ✓ 3 Snippets Lohaibi RA, Mirza A, Goronfolah L, Obaid NB, Khojah A.
In-Text Gene Mentions

ZNFX1deficiency presenting as…

…nonsense variant inZNFX1(c.1928G>A, p.Trp643X).…

…genetic spectrum ofZNFX1deficiency and highlights…

Show Full Abstract

Interferons (IFNs) are essential cytokines in host defense, particularly against viral pathogens. Dysregulation of IFN signaling can result in increased susceptibility to viral infections, systemic inflammation. We report a 6-month-old male who presented with hemophagocytic lymphohistiocytosis (HLH) triggered by cytomegalovirus (CMV) infection. He was admitted to the Pediatric Intensive Care Unit due to fever and respiratory distress. Laboratory findings revealed pancytopenia, elevated inflammatory markers, and laboratory markers suggestive of HLH. Whole-exome sequencing revealed a novel homozygous nonsense variant in ZNFX1 (c.1928G>A, p.Trp643X). During subsequent hospitalization, he developed CMV reactivation, gastrointestinal symptoms, neurologic deterioration, and multiorgan dysfunction. Despite intensive supportive care and immunomodulation with anakinra and corticosteroids, the patient progressed to irreversible organ failure and died from respiratory failure. This case expands the clinical and genetic spectrum of ZNFX1 deficiency and highlights the importance of considering monogenic interferonopathies in children with severe viral infections, HLH, and unexplained systemic inflammation.

Also flagged:pathogenesisneurodegenerative diseasesprionchaperonesdegradationAggregation
Journal Article 2025-10-30 No Snippets Hu C, Lin M, Wang C, Zhang S.
Show Full Abstract

Protein aggregates are central to the pathogenesis of neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease. This comprehensive review explores the mechanisms of protein misfolding and aggregation, their prion-like propagation, and the critical role of oligomeric species in neurotoxicity. It further examines cellular clearance pathways, including the ubiquitin-proteasome system and autophagy, alongside the regulatory functions of molecular chaperones. The review also covers advanced diagnostic imaging and biomarker techniques, as well as emerging therapeutic strategies such as pharmacological agents, gene therapy, and immunotherapy. Controversies regarding the toxicity of aggregates and future directions, including novel degradation technologies and targeted therapeutic approaches, are discussed. By integrating current knowledge, this review aims to provide a broad yet detailed overview of the field, highlighting both established concepts and promising avenues for research and treatment.

Also flagged:Atherosclerosiscardiovascular diseaseschronic inflammatory disorderpolyunsaturated fatty acidscyclooxygenaseCOX
Journal Article 2025-10-30 No Snippets Chistyakov DV, Chistyakov VV, Sergeeva MG.
Show Full Abstract

Atherosclerosis, the principal pathology underlying cardiovascular diseases, is now recognized as a chronic inflammatory disorder of the arterial wall. This review focuses on the central role of oxylipins, a diverse family of bioactive lipids derived from polyunsaturated fatty acids (PUFAs), in the inflammatory processes driving atherosclerosis. We synthesize evidence that oxylipins produced via cyclooxygenase (COX), lipoxygenase (LOX), cytochrome P450 (CYP), anandamide (AEA) pathways and non-enzymatic transformations of PUFAs are pivotal modulators of vascular function, immune cell recruitment, and plaque stability. The balance between pro-inflammatory mediators and specialized pro-resolving mediators (SPMs) is critical; a shift towards inflammation underlies disease progression. Advances in lipidomics now enable comprehensive oxylipin profiling, revealing distinct signatures with significant diagnostic and prognostic potential for assessing coronary artery disease severity and predicting future cardiovascular events. Therapeutically, while current anti-inflammatory strategies target downstream pathways, this review highlights emerging approaches that modulate the oxylipin system directly. These include promoting SPMs synthesis through omega-3 supplementation, inhibiting pro-inflammatory leukotriene production, and preserving cardioprotective epoxyeicosatrienoic acids (EETs) via soluble epoxide hydrolase (sEH) inhibition. A deeper understanding of these complex oxylipin networks promises to yield novel biomarkers and targeted therapies designed to restore inflammatory homeostasis and combat atherosclerotic cardiovascular disease.

HFE
Also flagged:Hepatocellular Carcinomauncontrolled hypertensionAtezolizumabbevacizumabLiver cancercancer
Journal Article 2025-10-30 ✓ 1 Snippet Tran NH, Soefje SA, Rangarajan N, Krishnappa P, Wagner TE, Valerio SJ, Anderson R, Olson JC.
In-Text Gene Mentions

…C virus (HCV),hemochromatosis, and metabolic dysfunction-as…

Show Full Abstract

<b>Background:</b> Immunotherapy-based regimens have expanded the treatment landscape for unresectable hepatocellular carcinoma (uHCC); however, real-world data are limited. <b>Methods:</b> This retrospective, observational study used data from electronic medical records from Mayo Clinic sites across the United States. Patients with uHCC who initiated a first-line (1L) systemic therapy between June 2020-October 2022 with ≥2 follow-up visits were included. Treatment patterns, overall survival (OS), and post-index gastrointestinal (GI) bleeding were assessed by GI bleeding risk defined by Child-Pugh Class B or C, pre-index GI bleeding, uncontrolled hypertension, or significant varices and band ligation. <b>Results:</b> Of 186 included patients, 68.8% had GI bleeding risk and 31.2% did not. Atezolizumab plus bevacizumab was the most common 1L systemic therapy in patients with or without GI bleeding risk (72.7% and 29.3%, respectively). Median OS (95% confidence interval) with atezolizumab plus bevacizumab was 12.8 (8.0-19.3) months and not reached in patients with and without GI bleeding risk, respectively. OS rates with atezolizumab plus bevacizumab in patients with or without GI bleeding risk, respectively, were 52.3% and 70.6% at 12 months, 41.6% and 57.8% at 18 months, and 34.6% and 51.3% at 24 months. Post-index GI bleeding with atezolizumab plus bevacizumab occurred in 19.4% and 5.9% of patients with and without GI bleeding risk, respectively. <b>Conclusions:</b> During this study period, atezolizumab + bevacizumab was the most common 1L therapy for patients with uHCC, regardless of GI bleeding risk. OS rates with atezolizumab + bevacizumab were lower in patients with versus without GI bleeding risk. Findings highlight the unmet need for guidance on characteristics-driven treatment decisions.

Also flagged:neuroblastomaN-Myccell cycleMYCNMYC oncogenechromosome
Journal Article 2025-10-30 No Snippets Chen Y, Yang H, Xiao L, Yan N, Zhang M.
Show Full Abstract

<i>MYCN</i> amplification defines a highly aggressive subtype of neuroblastoma and is strongly associated with poor clinical outcomes. Due to the intrinsically disordered structure of the N-Myc protein, it remains largely undruggable. This review provides a comprehensive summary of the molecular regulatory network surrounding <i>MYCN</i>, including upstream pathways, key cofactors, and downstream effectors involved in cell cycle control, metabolic reprogramming, and ferroptosis. We further discuss the roles of epigenetic modulators, noncoding RNAs, and positive feedback loops in sustaining <i>MYCN</i>-driven oncogenic programs. Emerging therapeutic strategies such as PROTACs, metabolic inhibitors, immune-based approaches, and RNA-targeting technologies offer promising alternatives to direct <i>MYCN</i> inhibition. This review aims to provide a theoretical foundation for future development of precise and effective therapies targeting <i>MYCN</i>-amplified neuroblastoma.

HTT
Also flagged:agingage-related diseasescardiovascular diseasesneurodegenerative disordersADPD
Journal Article 2025-10-30 ✓ 1 Snippet Yu H, Feng T, Zhang C, Jiao Z, Fan W, Jiang R, Kong D, Li F.
In-Text Gene Mentions

…the huntingtin gene (HTT).…

Show Full Abstract

Aging is a multidimensional process regulated by the interplay of genetic and environmental factors, with epigenetic alterations serving as a central regulatory hub. Aberrant DNA methylation patterns, dysregulation of histone-modifying enzymes (e.g., SIRT1, EZH2), and non-coding RNA-mediated mechanisms collectively remodel gene expression networks, impacting critical pathways such as cellular senescence and mitochondrial homeostasis. This establishes an "environment-epigenome-disease" causal axis, closely associated with pathologies including β-amyloid deposition in Alzheimer's disease, atherosclerosis, immunosenescence, osteoporosis, sarcopenia, and tumorigenesis. Capitalizing on the reversible nature of epigenetic modifications, pharmacological epigenetics has emerged as a cutting-edge field for intervening in aging and age-related diseases. Targeting key epigenetic modifiers such as DNA methyltransferases and histone deacetylases enables the modulation of disease-associated epigenetic states, providing a promising avenue for therapeutic intervention in aging and age-related diseases. This review synthesizes the molecular mechanisms of epigenetic regulation in aging, their role in age-related diseases, and advances in pharmacological epigenetics-from basic research to clinical translation. It further situates key challenges such as target specificity, long-term safety, and tissue-specific delivery within a translational framework, aiming to inform strategies for the diagnosis and intervention of age-related conditions.

ZNF311
Also flagged:B-cell acute lymphoblastic leukemiaB-ALLALLBhematologicalacute lymphoblastic leukemia
Journal Article 2025-10-30 ✓ 1 Snippet Li L, Xiao H, Wu X, Tang Z, Khoury JD, Wang J, Wan S.
In-Text Gene Mentions

…subtype-specific expression ofZNF311, which is potentially…

Show Full Abstract

As the most common pediatric malignancy, B-cell acute lymphoblastic leukemia (B-ALL) has multiple distinct subtypes characterized by recurrent and sporadic somatic and germline genetic alterations. Identifying B-ALL subtypes can facilitate risk stratification and enable tailored therapeutic design. Existing methods for B-ALL subtyping primarily depend on immunophenotyping, cytogenetic tests, and genomic profiling, which can be costly, complicated, and laborious. To overcome these challenges, RanBALL (an ensemble random projection-based model for identifying B-ALL subtypes) is presented, an accurate and cost-effective model for B-ALL subtype identification. By leveraging random projection (RP) and ensemble learning, RanBALL can preserve patient-to-patient distances after dimension reduction and yield robustly accurate classification performance for B-ALL subtyping. Benchmarking results based on >1700 B-ALL patients demonstrate that RanBALL achieves remarkable performance (accuracy: 0.93, F1-score: 0.93, and Matthews correlation coefficient: 0.93), significantly outperforming state-of-the-art methods like ALLSorts in terms of all performance metrics. In addition, RanBALL performs better than t-SNE in terms of visualizing B-ALL subtype information. We believe RanBALL will facilitate the discovery of B-ALL subtype-specific marker genes and therapeutic targets to have consequential positive impacts on downstream risk stratification and tailored treatment design is believed. To extend its applicability and impacts, a Python-based RanBALL package is available at https://github.com/wan-mlab/RanBALL.

Also flagged:metabolismmetabolic diseaseTLRsNOD2IL-10inflammatory disorders
Journal Article 2025-10-30 No Snippets Dey P.
Show Full Abstract

This narrative review underscores the influence of host genetics in actively regulating gut microbiota composition and function, highlighting the distinctive advantages of intestine-specific conditional knockout (cKO) models in gut microbiome research. In contrast to whole-body knockouts or germ-free animals, these precision models, enabled by Cre-loxP technology, eliminate confounding systemic effects to elucidate how localized host genes within intestinal cells regulate the gut microbial ecology. The review identifies three fundamental host-driven regulatory mechanisms through the analysis of specific gene deletions: (1) barrier integrity (e.g., mucus and junction proteins), (2) immune defenses (e.g., antimicrobial peptides and glycan synthesis), and (3) metabolic signaling (e.g., bile acid receptors and glucose transporter). These pathways jointly impose microbial symbiosis, and their disruption leads to dysbiosis characterized by increased abundance of pathobionts (e.g., <i>Escherichia, Proteobacteria</i>), directly connecting host genetics to inflammatory and metabolic disorders. This host-centric viewpoint emphasizes the gut as an active regulator, rather than a passive microenvironment for the microbiota, providing significant insights for creating tailored therapeutics that focus on host pathways to restore microbial balance in disorders such as inflammatory bowel diseases.

Also flagged:cancertumorepithelial-mesenchymal transitionautophagyreverse transcriptionpolymerase
Journal Article 2025-10-30 No Snippets Singh DD, Yadav DK, Shin D.
Show Full Abstract

Drug resistance remains a significant challenge in achieving successful cancer treatment, often leading to disease recurrence and reduced patient survival. While traditional tissue biopsies provide valuable insights into tumor biology, they are invasive, infrequent, and may fail to capture the full complexity of tumor heterogeneity and dynamic molecular changes. In contrast, liquid biopsy has emerged as a minimally invasive, real-time approach for monitoring tumor evolution through the analysis of circulating biomarkers. Among these biomarkers, circular RNAs (circRNAs) - a distinct class of non-coding RNAs characterized by covalently closed-loop structures - have gained attention due to their remarkable stability, abundance in body fluids, and functional involvement in gene regulation. Increasing evidence supports the role of circRNAs in mediating drug resistance through mechanisms such as inhibition of apoptosis, epithelial-mesenchymal transition, autophagy, and drug efflux, largely via interactions with microRNAs or proteins. Advanced detection methods, including quantitative reverse transcription polymerase chain reaction, droplet digital polymerase chain reaction, and RNA sequencing, combined with computational tools, enable precise profiling of circRNAs in plasma or exosomes. CircRNA-based liquid biopsies offer a dynamic, non-invasive strategy for early detection of therapeutic resistance and may guide personalized treatment decisions. This review highlights the technological advancements, biological relevance, and clinical promise of circRNAs as circulating biomarkers, emphasizing their potential in precision oncology and future collaborative translational applications.

Also flagged:AMLchildhood leukemiaacute lymphoblastic leukemiaAcute myeloid leukemialeukemiaWT1
Journal Article 2025-10-30 No Snippets Huang L, Peng X, Shu W, Shi H, Xiao L, Liu T, Xiang Y, Guo Y, Guan X, Li J, Yu J.
Show Full Abstract

<b>Background:</b> Pediatric acute myeloid leukemia (pAML) is the second most common type of childhood leukemia, behind acute lymphoblastic leukemia. High-throughput technologies have enabled the identification of increasing molecular alterations linked to AML prognosis, revealing genomic heterogeneity among individual patients and providing clinically valuable diagnostic and prognostic information. This study systematically analyzed the correlation between high-frequency mutated genes and prognosis in pAML by performing whole-transcriptome sequencing (WTS) of bone marrow samples from newly diagnosed AML children in Southwest China and mapping their genetic profiles. <b>Methods:</b> pAML patients treated at the Department of Hematology and Oncology, Children's Hospital of Chongqing Medical University, from January 2015 to October 2024, were enrolled, and WTS was performed. The study described the frequency, pathogenicity classification, and risk stratification of mutation genes and fusion genes, and constructed a genetic landscape. For high-frequency pAML mutations, the impact on early induction remission rate (CR) and long-term event-free survival (EFS) was evaluated. <b>Results:</b> A total of 134 pediatric AML patients from Southwest China were included, with a male-to-female ratio of 74:60 and a median diagnosis age of 5.96 years. Based on pathogenicity classification using WTS, fusion genes were categorized into level 1, level 2, and level 3 genes, as well as mutation genes. The study identified five fusion genes of level 1, the most frequent being <i>RUNX1::RUNX1T1</i> (32/134, 23.88%), <i>KMT2A</i> rearrangements (29/134, 21.64%), and <i>CBFB::MYH11</i> (13/134, 9.7%). Sixteen mutation genes of level 1 were detected, seven of which recurred in over 5% of patients, including <i>NRAS</i> (31/134, 23.13%), <i>FLT3</i> (25/134, 18.66%), <i>KIT</i> (24/134, 17.91%), <i>CEBPA</i> (14/134, 10.45%), <i>WT1</i> (13/134, 9.7%), <i>KRAS</i> (11/134, 8.2%), and <i>PTPN11</i> (7/134, 5.22%). Sex-based analysis revealed that <i>PTPN11</i> mutations were significantly more frequent in males (9.45% vs. 0%, <i>p</i> = 0.023), as were <i>KIT</i> mutations (24.32% vs. 10.00%, <i>p</i> = 0.044). Risk-stratified analysis showed that <i>WT1</i> mutations (14.13% vs. 0%, <i>p</i> = 0.031) and <i>FLT3</i>-ITD mutations (13.19% vs. 0%, <i>p</i> = 0.042) were enriched in intermediate- and high-risk groups, whereas <i>CEBPA</i> (25.64% vs. 5.43%, <i>p</i> = 0.012), <i>KIT</i> (35.90% vs. 10.87%, <i>p</i> = 0.003), and <i>KIT</i>-E8 (20.51% vs. 1.10%, <i>p</i> < 0.001) mutations were more prevalent in low-risk groups. Prognostic analysis indicated that <i>PTPN11</i> and <i>KIT</i> mutations did not affect CR or EFS across sexes, nor did <i>WT1</i>, <i>CEBPA</i>, or <i>KIT</i> mutations influence outcomes by risk stratification. However, <i>FLT3</i>-ITD-positive patients had significantly lower CRs (χ<sup>2</sup> value = 11.965, <i>p</i> = 0.007), although EFS differences were nonsignificant. In contrast, <i>WT1</i> mutations were associated with inferior EFS compared to wild-type (<i>p</i> = 0.036). Furthermore, the univariate and multivariate Cox regression revealed consistent results with the above findings, indicating that <i>WT1</i> mutation was an independent adverse prognostic factor for EFS (HR = 2.400, 95% CI: 1.101-5.233, <i>p</i> = 0.028). The results of univariate and multivariate logistic regression analyses also confirmed that <i>FLT3</i>-ITD mutation was an independent predictor of initial treatment response in our cohort (OR = 10.699, 95% CI: 2.108-54.302, <i>p</i> = 0.004). <b>Conclusions:</b> This study delineated the genetic landscape of pAML in Southwest China and explored the prognostic value of gene fusions and mutations in early and long-term outcomes. These findings provide a foundation for understanding the genetic heterogeneity of pAML and offer evidence for the development of precision medicine approaches.

Also flagged:mycotoxinsdeoxynivalenolzearalenoneWntNotch-chain fatty acids
Journal Article 2025-10-30 No Snippets Huo W, Qiao Y, He X, Wang C, Li R, Che L, Li E.
Show Full Abstract

Mycotoxins are toxic secondary metabolites produced by filamentous fungi that contaminate agricultural commodities, posing risks to food safety, animal productivity, and human health. The gastrointestinal tract is the first and most critical site of exposure, where the intestinal epithelium functions as both a physical and immunological barrier against luminal toxins and pathogens. While extensive research has demonstrated that mycotoxins disrupt epithelial integrity through tight junction impairment, oxidative stress, apoptosis, and inflammation, their effects on the intestinal stem cell (ISC) compartment and epithelial regeneration remain insufficiently understood. This review integrates recent findings from in vivo, cell culture, and advanced 3D intestinal organoid and gut-on-chip models to elucidate how mycotoxins such as deoxynivalenol and zearalenone impair ISC proliferation, alter Wnt/Notch signaling, and compromise mucosal repair. We also discuss dose relevance, species differences, and the modulatory roles of the microbiome and short-chain fatty acids, as well as emerging evidence of additive or synergistic toxicity under co-exposure conditions. By bridging well-established mechanisms of barrier disruption with the emerging concept of ISC-driven regenerative failure, this review identifies a critical knowledge gap in mycotoxin toxicology and highlights the need for integrative models that link epithelial damage to impaired regeneration. Collectively, these insights advance understanding of mycotoxin-induced intestinal dysfunction and provide a foundation for developing nutritional, microbial, and pharmacological strategies to preserve gut integrity and repair.

HTT
Also flagged:central nervous systemCNSCNS diseasesgene silencingNeurodegenerative Diseasesdiseases
Journal Article 2025-10-30 ✓ 1 Snippet Huang Q, Wu W, Liu Y, Li W, Chen X, Yu S, Gong G, Shu H.
In-Text Gene Mentions

…(HD), silencing ofHTTor MSH3 genes…

Show Full Abstract

The treatment of central nervous system (CNS) diseases faces huge challenges, mainly due to the blood-brain barrier (BBB) restricting drug delivery, which leads to many potential treatment methods being unable to effectively reach the target area. In recent years, nasal administration has received extensive attention as a non-invasive drug delivery route because of its anatomical connection with the brain, enabling direct delivery to brain tissue. In particular, the siRNA delivery system based on nanocarriers has shown great promise in the treatment of CNS diseases due to its unique advantages in targeting gene silencing. This article reviews the latest research progress on nasal administration of siRNA nanocarriers, with a focus on the design strategies, administration mechanisms, in vivo and in vitro effects, and safety evaluations of different nanocarriers. The aim is to provide a systematic theoretical basis and future research directions for the application of siRNA nasal administration in the treatment of CNS diseases (see the abstract of the picture).

Also flagged:cancertumorbindingoncogenesnucleotidesgene silencing
Journal Article 2025-10-30 No Snippets Aranda-Lara L, Escudero-Castellanos A, Trujillo-Nolasco M, Morales-Avila E, Ocampo-García B, Oros-Pantoja R, Sánchez-Monroy V, Isaac-Olivé K.
Show Full Abstract

<b>Introduction</b>: Gene therapy using siRNA is a current area of research in oncology. Although siRNA formulations have not yet been approved for cancer therapy, numerous studies have demonstrated their therapeutic potential for tumor remission. <b>Objective</b>: To provide an overview of the formulations designed and developed to date based on synthetic siRNA for systemic administration to silence cancer genes. <b>Methodology</b>: A thorough search was conducted using the keywords "siRNA", "therapy", and "cancer", with further classification of the resulting works into the various topics addressed in this review. <b>Results</b>: This review encompasses a wide range of aspects, from the design of siRNA using bioinformatics tools to the primary cellular signals and mechanisms targeted for inhibition in cancer therapy. It describes the primary chemical modifications made to siRNA chains to enhance stability, improve bioavailability, and ensure their binding to nanocarrier systems. siRNA formulations ranging from simple conjugates with biomolecules and small molecules to organic, inorganic, and hybrid nanoparticles, which are examined focusing on their advantages and disadvantages. The significance of nanosystems in dual therapy, including siRNA, for developing personalized treatments that achieve better outcomes is emphasized. <b>Conclusions</b>: Personalized cancer therapy appears to be the preferred approach for oncological treatments. To progress, strategies need to be tailored to the patient's genetic profile. siRNA therapies provide a flexible platform for targeting and inhibiting critical oncogenes, enhancing the prospects of genomics-guided, patient-specific therapies.

Also flagged:FOXP3OX40forkhead box P3pathogenesisOX40LLeukemia
Journal Article 2025-10-30 No Snippets Mizuguchi M, Takahashi Y, Tanaka R, Imaizumi N, Yamashita A, Matsushita N, Fukushima T, Tanaka Y.
Show Full Abstract

Since forkhead box P3 (FOXP3) is a hallmark of regulatory T (Treg) cells, the expansion of FOXP3<sup>+</sup> adult T-cell leukemia/lymphoma (ATL) cells is believed to contribute to immune suppression and the pathogenesis of ATL. However, the mechanisms underlying the expansion of FOXP3<sup>+</sup> ATL cells remain unclear. OX40, a co-stimulatory molecule, is expressed in ATL cells, and OX40 signaling has been shown to promote the differentiation and proliferation of Treg cells in mouse models. To investigate the mechanisms driving the expansion of FOXP3<sup>+</sup> ATL cells, we examined the expression of OX40 and its ligand, OX40L. Our findings revealed that OX40 expression was elevated in patients with ATL and with a high frequency of FOXP3<sup>+</sup> ATL cells. Flow cytometric analysis of peripheral blood mononuclear cells (PBMCs) from patients with acute ATL cultured for 18 h demonstrated that FOXP3<sup>-</sup> and FOXP3<sup>+</sup> cells predominantly expressed OX40L and OX40, respectively. Furthermore, small interfering RNA-mediated FOXP3 knockdown in HTLV-1-infected cell lines increased OX40L expression. These results suggest that interactions between FOXP3<sup>-</sup> OX40L<sup>+</sup> cells and FOXP3<sup>+</sup> OX40<sup>+</sup> cells may promote the proliferation of FOXP3<sup>+</sup> ATL cells.

ZNFX1
Also flagged:cancertumorimmune responses5-fluorouracilpancreatic ductal adenocarcinomaPDAC
Journal Article 2025-10-30 ✓ 1 Snippet Tu X, Yu L, Zhao L, Qi X, Xu Y, Yan H.
In-Text Gene Mentions

…present, DDX58/RIG-I orZNFX1) feed into TRIF-TBK1/IKKε…

Show Full Abstract

The advancement of cancer immunotherapy has focused on developing therapies that not only target tumor progression but also enhance immune responses, which could potentially shift the balance within the tumor microenvironment (TME) to promote a more immune-competent environment and improve the effectiveness of antitumor immunotherapies. This study evaluates the internalization of single-stranded RNA origami (ssRNAOG) in coculture models mimicking the TME in vitro and the antitumor efficacy of the combination of ssRNAOG with 5-fluorouracil (5-FU) in pancreatic ductal adenocarcinoma (PDAC) models. The internalization of ssRNAOG triggers the TLR3 signaling pathway, leading to robust innate immune activation. Notably, ssRNAOG induces the overexpression of MHC class I protein on macrophages, which recruits NK cells into the TME. The combination of ssRNAOG and 5-FU significantly suppressed tumor cell colony formation in vitro, demonstrating a synergistic antiproliferative effect. Transcriptomic and proteomic analyses revealed a significant upregulation of inflammatory cytokines and the activation of NF-κB and STAT1, which are indicative of M1-like polarization in macrophages. In vivo administration of both ssRNAOG and 5-FU revealed a marked reduction in tumor burden and an extension of survival in mice bearing xenograft PDAC tumors. Immunohistochemistry revealed a shift in macrophage polarization toward the M1-like phenotype, which is associated with enhanced proinflammatory responses and reduced tumor proliferation. These findings indicate that ssRNAOG, as a potent modulator of the TME that can sensitize resistant tumors to chemotherapy, presents a novel immunotherapeutic strategy for PDAC.

HTT
Also flagged:gene expressionoligonucleotidesoligonucleotidebindingSCADN -
Journal Article 2025-10-30 ✓ 5 Snippets Kang M, Lin WH, Li Y, Xu F, Zhou X, Si C, Dai J, He J, Schacht I, Gan Z, Huang V, Li LC.
In-Text Gene Mentions

…targeting the mouseHttgene to generate…

…to generate Cy3-siHtt-ACO MOE18 ,…

…the ACO (Cy3-siHtt) was also…

…post administration, Cy3-siHtt-ACO MOE18 showed…

…control siRNA (Cy3-siHtt) was confined…

Show Full Abstract

Oligonucleotide therapeutics-including antisense oligonucleotides and duplex RNAs such as small interfering RNAs, small activating RNAs, and microRNAs-hold immense potential for treating both genetic and acquired diseases by modulating gene expression in a target-specific manner. However, effective delivery to extrahepatic tissues, particularly the central nervous system, remains a significant challenge. While <i>N</i>-Acetylgalactosamine conjugation has enabled liver-specific delivery of oligonucleotides leading to several approved siRNA drugs for hepatic indications, there remains a significant unmet need for effective treatment options in the CNS space. We have developed the smart chemistry-aided delivery platform that enables duplex RNA delivery by conjugating to an accessory oligonucleotide, which facilitates protein binding and promotes cellular uptake. Through extensive screening, we identified an optimal SCAD architecture that demonstrates enhanced cell-free protein binding and <i>in vitro</i> activity. In rodent models, local administration of SCAD-siRNA conjugates resulted in broad biodistribution throughout the CNS and sustained mRNA knockdown for over 5 months, with a favorable safety profile. The SCAD platform also exhibited efficient delivery to other extrahepatic tissues, including the eye, lung, and joint. The modular design of SCAD can be easily adapted to any duplex RNA, making it a powerful tool for advancing oligonucleotide therapeutics.

Also flagged:synthesisgraphiteGrapheneOxideGraphene oxidenitrogen
Journal Article 2025-10-30 No Snippets Montoro-Leal P, Morales-Benítez I, García-Mesa JC, Schmidt TC, López Guerrero MDM, Vereda Alonso EI.
Show Full Abstract

Graphene oxide (GO) is a nanomaterial with excellent physico-chemical properties widely used in a high variety of technological applications. However, conventional protocols for GO preparation rely on wet synthesis, involving extreme chemical conditions. Recently, mechanochemical synthesis has been postulated as a rapid and sustainable dry alternative for the preparation of new materials. In this work, an optimization of the mechanochemical synthesis of GO from graphite is carried out. To characterize the materials, transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-Ray photoelectron microscopy (XPS), elemental analysis, and nitrogen adsorption-desorption isotherms are employed. The GO synthesized via dry protocol (d-GO) and GO prepared via wet synthesis (w-GO) are coupled with magnetic nanoparticles (MNPs) to prepare magnetic graphene oxide sorbents (d-M@GO and w-M@GO). Subsequently, the adsorption properties of the prepared materials toward inorganic and organic pollutants are determined and compared. The results indicated excellent adsorption efficiency for d-M@GO, demonstrating the successful application of the mechanochemical method in magnetic sorbents preparation. To the best of the available knowledge, this is the first work to investigate the applicability of dry mechanochemical GO for the synthesis of a magnetic sorbent (d-M@GO) and its use toward emerging concern and priority pollutants (PFAS and metal ions).

Also flagged:Homoharringtonineacute myeloid leukemiaEWSR1AMLHHTcytoplasmic
Journal Article 2025-10-30 No Snippets Liu TT, Chen LT, Pei XY, Hu SN, Zhuo FF, Chen ZK, Liu Y, Wang JK, Zhang JC, Cao Q, Li L, Wang J, Wei TT, Han B, Tu PF, Zhao XY, Xue R, Zeng KW.
Show Full Abstract

Homoharringtonine (HHT) is widely used in combination regimens for acute myeloid leukemia (AML), yet its direct cellular targets remain undefined, limiting precision application. Here, we identified EWS RNA-binding protein 1 (EWSR1) as the primary target of HHT through chemical proteomics and biophysical validation. HHT bound the RNA recognition motif of EWSR1 with micromolar affinity, inducing an allosteric conformational switch that promoted oligomerization and liquid-liquid phase separation (LLPS). EWSR1 condensates selectively recruited the N<sup>6</sup>-methyladenosine (m<sup>6</sup>A) reader YTHDF2, forming cytoplasmic hubs where HHT disrupted YTHDF2-mRNA interactions. This sequestration attenuated m<sup>6</sup>A-mediated RNA decay, stabilizing key transcripts such as <i>TNFRSF1B</i> and <i>HMOX1</i>, and thereby impairing AML cell proliferation. Integrated transcriptomics and single-cell RNA-seq analyses revealed that <i>EWSR1</i> was markedly upregulated in AML, particularly in hematopoietic progenitor and myeloid subpopulations, and high <i>EWSR1</i> expression correlated with poor prognosis and enhanced HHT sensitivity. In vivo, the anti-leukemic efficacy of HHT was significantly diminished upon EWSR1 knockdown, demonstrating that EWSR1 was required for therapeutic response. Collectively, these findings uncover a phase separation-centric mechanism by which HHT exerts anti-AML activity, establish the EWSR1-YTHDF2-m<sup>6</sup>A <i>axis</i> as a critical regulator of leukemia progression, and position EWSR1 as both a functional target and a predictive biomarker for optimizing HHT-based therapies.

Also flagged:DNAJB12DNAJB14chaperonessecretionenvelope proteinsparticle morphogenesis
Journal Article 2025-10-30 No Snippets Angelo L, Boulon R, Labonté P.
Show Full Abstract

During chronic HBV infection, the massive secretion of HBV envelope proteins (HBsAg) as non-infectious subviral particles (SVPs) remains a significant challenge in achieving a functional cure. Despite this, the HBsAg folding process, essential for HBV and HDV particle morphogenesis, remains poorly understood. DNAJB12 and DNAJB14 are two recently identified co-chaperones implicated in transmembrane protein folding. Utilizing the nucleic acid polymer REP 2139 as a bait, we identified DNAJB12 as a REP 2139 interactor, and its knockdown impedes the morphogenesis and secretion of SVP and HBV virions. Conversely, DNAJB14, which did not interact with REP 2139, selectively impaired the morphogenesis of virions. Additionally, knockdowns of DNAJB12 and DNAJB14 hindered the production of infectious HDV. As DNAJB12 knockdown recapitulated REP 2139 antiviral effects observed in clinical trials, our findings highlight DNAJB12 as the potential primary target of REP 2139 and uncover functional roles for DNAJB12 and DNAJB14 in HBV and HDV life cycles.

HTT
Also flagged:movement disorderneurodegenerative diseasessegmentationataxia3SCA3
Journal Article 2025-10-29 ✓ 2 Snippets Banerjee A, Chatterjee M, Tan KJ, Tay S, Duan K, Andiappan AK, Howland SW, Aso Y, Aw SS.
In-Text Gene Mentions

…2000 ) and UAS-mutant-HTT[mutant expanded polyglutamine…

…of huntingtin (HTT), the causative…

Show Full Abstract

Tremor is a common movement disorder associated with several neurodegenerative diseases, yet its mechanisms are not well understood. Using a machine-learning method, Feature Learning-based Leg segmentation and Tracking (FLLIT), we previously characterised gait and tremor signatures in a Drosophila model for spinocerebellar ataxia 3 (SCA3) and found them to be analogous to those in human SCA3. Here, we carried out a functional screen for neuronal populations that underlie tremor and found that dysfunction of a specific population of neurons in the ventral nerve cord (VNC) is necessary and sufficient for tremor. Adult-onset expression of mutant ATXN3 in, or genetic hypo-activation of, these neurons led to tremor, indicating their important role in adult motor control. RNA-sequencing and functional experiments showed that dysfunction of GABAergic neurons, and not that of other neurotransmitter populations tested, causes tremor. Finally, we identified a small subset of ∼30 predominantly GABAergic neurons within the adult VNC that are essential for smooth walking. This study demonstrates that tremor in SCA3 flies arises from GABAergic dysfunction, and that FLLIT can be used to dissect motor control mechanisms.

Also flagged:ethylene glycolNorborneneacidhydroxylthioldegradation
Journal Article 2025-10-29 No Snippets Dimmitt NH, Lin CC.
Show Full Abstract

Poly(ethylene glycol) (PEG) hydrogels crosslinked by orthogonal thiol-norbornene click chemistry have emerged as an ideal platform for tissue engineering and drug delivery applications due to their rapid crosslinking kinetics and excellent biocompatibility. Norbornene-functionalized PEG (PEGNB) is routinely synthesized through the Steglich esterification of 5-norbornene-2-carboxylic acid with hydroxyl-terminated PEG. When crosslinked with thiol-bearing macromers, PEGNB hydrogels undergo slow hydrolytic degradation due to hydrolysis of ester bonds connecting a PEG backbone and a NB moiety. In prior work, we replaced the pungent and nauseous 5-norbornene-2-carboxylic acid with odorless carbic anhydride (CA) for synthesizing PEG-norbornene-carboxylate (PEGNB<sub>CA</sub>), a new macromer that could be readily photo-crosslinked into thiol-norbornene hydrogels with faster hydrolytic degradation than the PEGNB counterparts. In this contribution, we employed a modular approach to tune the hydrolytic degradation of PEGNB<sub>CA</sub> hydrogels over days to months. We first demonstrated the diverse crosslinking of PEGNB<sub>CA</sub> hydrogels using either photopolymerization or enzymatic crosslinking. We characterized the hydrolytic degradation of these hydrogels under different solution pH values and temperatures. <i>Via</i> adjusting crosslinker functionality and the ratio of fast-degrading PEGNB<sub>CA</sub> to slow-degrading PEGNB, tunable hydrolytic degradation of PEGNB<sub>CA</sub> hydrogels was achieved from under 2 days to over 3 months. Finally, we designed the highly tunable PEGNB<sub>CA</sub> hydrogels with varying mesh sizes, degradation rates, and covalent tethering of degradable linkers to afford long-term controlled release of model drugs.

ZNFX1
Also flagged:malenucleotideamino-acidCas9male sterilitysperm development
Journal Article 2025-10-29 ✓ 1 Snippet Li Y, Zou P, Zhao D, Zhang J, Zhang M, Song Z, Pei Y, Hu Z, Zuo Y.
In-Text Gene Mentions

…involving <i>syf1</i> and <i>ZNFX1</i>. Our findings suggest…

Show Full Abstract

The beet armyworm, <i>Spodoptera exigua</i>, is a significant agricultural pest managed primarily through chemical insecticides, which present environmental concerns and promote resistance. Genetics-based sterile insect technique (gSIT) provides an alternative by inducing male sterility without irradiation. In this study, we cloned the <i>S. exigua</i> boule gene (<i>Sebol</i>), a 741-nucleotide open reading frame encoding a 246-amino-acid protein with an RNA recognition motif. Phylogenetic analysis confirmed its conservation across Lepidoptera and high similarity to orthologs in <i>Spodoptera litura</i> and <i>Helicoverpa armigera</i>. <i>Sebol</i> is predominantly expressed in adult males, particularly in the testis. CRISPR/Cas9-mediated deletion of 190 bp in exon 1 generated a truncated Sebol protein, resulting in complete male sterility. Transcriptome analysis revealed 2069 differentially expressed genes associated with sperm development, with potential interactions involving <i>syf1</i> and <i>ZNFX1</i>. Our findings suggest that <i>Sebol</i> is crucial for spermatogenesis, making it a promising target for gSIT-based pest control.

CCPG1
Also flagged:ischemic strokepathogenesisTMEM55ACYP1B1PJA2MTPN
Journal Article 2025-10-29 ✓ 5 Snippets Zhang J, Liu C, Zhong W, Zhu M, Lin R, Wang L, Lei A.
In-Text Gene Mentions

…genes (comprising TMEM55A,CCPG1, CYP1B1, PJA2, MTPN,…

…signature genes (TMEM55A,CCPG1, CYP1B1, PJA2, MTPN,…

…0.805 for TMEM55A,CCPG1, CYP1B1, PJA2, MTPN,…

CCPG1presented the negative…

…demonstrated that BAZ2B,CCPG1, CYP1B1, DPYD, MTPN,…

Show Full Abstract

<h4>Objective</h4>Pyroptosis, apoptosis and necroptosis separately participate in the pathogenesis of ischemic stroke, but the implication of PANoptosis in this disease is still unexplored. This study conducted a comprehensive investigation on PANoptosis in ischemic stroke and glioma.<h4>Methods</h4>Four transcriptomic datasets of ischemic stroke: GSE16561, GSE58294, GSE22255, and GSE37587 were gathered. Consensus clustering analysis was implemented based upon PANoptosis genes. WGCNA was utilized for PANoptosis subtyping-related genes. Multiple well-established machine learning models were also built for feature gene selection. Moreover, survival and receiver operating characteristic (ROC) analysis was performed to evaluated the prognostic value of the feature genes in the glioma.<h4>Results</h4>Fifteen PANoptosis genes were aberrantly expressed in peripheral blood of ischemic stroke than that of controls. Based upon them, ischemic stroke was classified as two PANoptosis molecular subtypes, with heterogeneous molecular mechanisms, and immune cell infiltration. The PANoptosis molecular subtyping-related module genes were determined, and key genes were subsequently via distinct machine learning approaches. Among them, the SVM model had the lowest |residual|, and the AUC of 1 in diagnosing ischemic stroke. The feature genes in the SVM model were regarded as the key genes (comprising TMEM55A, CCPG1, CYP1B1, PJA2, MTPN, SCYL2, BAZ2B, and DPYD). Based upon them, the nomogram was established, which could accurately predict ischemic stroke risk. All of them were in relation to ischemic stroke-related signaling pathways, and immune cell infiltration. Transcription factors were predicted, which transcriptionally modulated them. Additionally, drugs that potentially targeted them were determined. Moreover, the expression and prognostic value of genes in glioma were evaluated in the The Human Protein Atlas (HPA) and The Cancer Genome Atlas database (TCGA). All genes showed a significant prognostic value except PJA2. The diagnostic and prognostic ROC analysis result indicated that BAZ2B can served as potential diagnostic and prognostic marker in glioma.<h4>Conclusion</h4>Altogether, this is the first study to characterize PANoptosis-based molecular subtypes, and diagnostic model for ischemic stroke, providing a promising avenue for patient risk prediction through a non-invasive method. Moreover, the BAZ2B genes could serve as predictive biomarkers in glioma, providing essential implications for patient prognosis.

ABT1
Also flagged:autismAutism Spectrum DisorderextracellularmethylationHMGN1BRWD1
Journal Article 2025-10-29 ✓ 4 Snippets Liao X, Long J, Wang X, Han K, Tang Z, Chen J, Zhang Y, Zhang H.
In-Text Gene Mentions

…of BRWD1 andABT1.…

…was identified asABT1.…

…the expression ofABT1(involved in basal…

…adjacent functional geneABT1(basic transcription initiatio…

Show Full Abstract

Autism Spectrum Disorder (ASD) involves a multi-system interaction mechanism among genetics, immunity, and gut microbiota, yet its regulatory network remains undefined. This study conducted a meta-analysis on Genome-Wide Association Study data from four independent ASD cohorts to identify potential genetic loci. By integrating Polygenic Priority Score, brain region, and brain cell eQTL enrichment analyses, and combining summary-data-based Mendelian Randomisation (SMR) analyses of brain cis-eQTL and mQTL, bidirectional Mendelian Randomisation analyses of 473 gut microbiota, and SMR analysis of blood eQTL, SNPs such as rs2735307 and rs989134 with significant multi-dimensional associations were identified. These loci exert cross-tissue regulatory effects by participating in gut microbiota regulation, involving immune pathways such as T cell receptor signal activation and neutrophil extracellular trap formation, as well as cis-regulating neurodevelopmental genes (HMGN1 and H3C9P), or synergistically influencing epigenetic methylation modifications to regulate the expression of BRWD1 and ABT1. The cross-scale evidence chain constructed in this study provides a theoretical foundation for precision medicine research in ASD, holding promise to advance the development of innovative therapeutic strategies.

Also flagged:infectionmagnesiumaluminumcarboxymethyl chitosanhydroxyapatitevancomycin
Journal Article 2025-10-29 No Snippets He J, Cheng X, Zhang S, Tao Y, Shi H.
Show Full Abstract

The study aims to develop a composite coating for magnesium aluminum alloy (MA) to improve its corrosion/infection resistance. MA was coated with carboxymethyl chitosan (CMCS) and nano-hydroxyapatite (HA) through electrophoretic deposition, followed by the deposition of vancomycin-loaded polymer nanoparticles to obtain the ternary composite coating alloy (VAN@PLGA/HA/CMCS-MA). In simulated body fluid (SBF), the average corrosion rate of the coating alloy was 0.27 ± 0.03 mg/cm<sup>-1</sup>/day<sup>-1</sup>, while maintaining a pH level of approximately 7.2, indicating that the composite coatings effectively mitigated erosion in SBF and ensured a stable physiological pH. In vitro antibacterial experiments showed that VAN@PLGA/HA/CMCS-MA exhibited enhanced antibacterial activity against staphylococcus aureus and enterococcus faecalis compared to single MA owing to sustained antibiotic release. Furthermore, the composite coating promoted alkaline phosphatase activity and induced extracellular Ca<sup>2+</sup> mineralization, suggesting good bone-promoting ability of the alloy. Finally, the biocompatibility studies confirmed that the composite coating could reduce mild toxicity of the alloy following corrosion, resulting in enhanced cell viability and reduced hemolysis rate. Overall, the ternary composite alloy coating delayed MA degradation and provided long-term effective corrosion/infection resistance.

HTT
Also flagged:HuntingtinHuntington's diseaselipidmetabolismApolipoprotein EAPOE
Journal Article 2025-10-29 ✓ 5 Snippets Fote GM, McClure NR, Bragg RM, McKnight J, Thompson LM, Carroll JB, Steffan JS.
In-Text Gene Mentions

…and loss ofHTTfunction as an…

…of APOE andHTTin cultured cells.…

…were increased withHTTKO in mouse…

…mouse liver, whileHTTKD in cell…

…CMA found withHTTKO may be…

Show Full Abstract

BackgroundThe HTT protein, mutated in Huntington's disease, is expressed throughout the body, and loss of HTT function as an autophagic scaffold may affect tissues and cellular processes. These processes include lipid metabolism potentially regulated upstream by Apolipoprotein E (APOE) and clearance of APOE itself.ObjectiveTo determine the impact of HTT reduction on autophagy and clearance of APOE in cell culture and in mouse liver <i>in vivo</i>.MethodsWestern blot analysis was performed on liver tissue from tamoxifen-treated mice with and without UBC-Cre expression, required for tamoxifen-induced HTT knockout (KO). siRNA was used to knockdown (KD) HTT in HepG2 immortalized liver cells.ResultsHTT KO in mouse liver reduces levels of LAMP2A, a protein essential for chaperone-mediated autophagy (CMA) which we previously found is required for optimal degradation of APOE and HTT in cultured cells. In turn, APOE levels were increased with HTT KO in mouse liver, while HTT KD in cell culture decreased levels of APOE.ConclusionsIn the context of liver tissue, reduced CMA may contribute to accumulation of APOE and autophagic cargo resulting from a loss of HTT function in autophagy. The extent to which macroautophagy is upregulated to cope with reduced CMA found with HTT KO may be tissue specific, which may relate to the selectivity of tissue pathogenesis observed in Huntington's disease where loss of normal HTT function may be involved. This study may help elucidate the consequences of systemic HTT reduction on autophagy in liver tissue.

ZNFX1
Also flagged:innate immunitypattern recognition receptorsimmune responsesimmune responseretinoic acid–inducible gene IRIG-I
Journal Article 2025-10-29 ✓ 5 Snippets Zheng R, Huang S, Kang Y, Gao J, Wu B, Miao Q, He J, Xie J.
In-Text Gene Mentions

ZNFX1has evolved to…

…MammalianZNFX1can interact with…

…remarkable over-expression ofZNFX1in bivalve and…

…the role ofZNFX1in the interaction…

…novel dsRNA receptorZNFX1in E. coioides…

Show Full Abstract

Zinc finger NFX1-type containing 1 (ZNFX1) has been established as a critical mediator of the antiviral response in mammals, functioning through dsRNA recognition and priority activation of the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) signaling pathway. However, the role of its fish ortholog, particularly in relation to aquatic virus interactions, remains elusive. The absence of the RIG-I homolog, a key pattern recognition receptor, in multiple Actinopterygii may compromise their innate antiviral immune responses. Here, ZNFX1 in Epinephelus coioides (EcZNFX1) is identified as an evolutionarily primitive, interferon (IFN)-stimulated dsRNA sensor that compensates for the absence of RIG-I in Actinopterygii. EcZNFX1 is rapidly upregulated by orange-spotted grouper nervous necrosis virus (OGNNV) infection and restricts viral replication in grouper brain-derived (GB) and spleen-derived (GS) cells after binding to viral dsRNA intermediates via its conserved P-loop NTPase domain. Notably, EcZNFX1 exerts a dual immunoregulatory role in modulating virus-induced inflammatory responses in diverse cellular contexts. In GB cells that are highly susceptible to OGNNV and have attenuated regenerative capacity, EcZNFX1 suppresses IFN-I/ISGs production and pyroptosis mediated by viral infection, thereby limiting neurotoxicity by precise tuning of the antiviral response. Conversely, in GS cells with stronger resistance to OGNNV, EcZNFX1 directly interacts with TBK1 to promote its phosphorylation and subsequent nuclear translocation of IRF3, activating a robust IFN-I signaling. Overall, this study elucidates that ZNFX1 is a compensatory receptor for dsRNA sensing in RIG-I-deficient teleost, which exerts context-dependent antiviral effects in cell-type-specific microenvironments, providing mechanistic insights for aquatic virus countermeasures.

B4GALT5
Also flagged:cancerantibodiescytotoxic T lymphocyte antigen-4programmed death protein 1PD-1programmed death-ligand 1
Journal Article 2025-10-29 ✓ 2 Snippets Cai M, Adam M, Duan X, Guo F, Zheng Y.
In-Text Gene Mentions

…_m1), St3gal2 (Mm00486123_m1),B4galt5(Mm00480147_m1), Sptlc2 (Mm004…

…including St3gal1, St3gal2,B4galt5, Sptlc2, and Ugcg,…

Show Full Abstract

RAC1<sup>A159V</sup> is a hotspot mutation associated with poor prognosis in several cancers. By gene editing, we generated endogenous homozygous and heterozygous RAC1<sup>A159V</sup> mutations, which result in up-regulated RAC1 activity and mammalian target of rapamycin (mTOR) signaling. RAC1<sup>A159V</sup> tumors grow faster than RAC1<sup>WT</sup> tumors in immune-proficient mice and are resistant to anti-programmed death protein 1 (PD1). Flow cytometry and scRNA-seq analyses reveal that RAC1<sup>A159V</sup> cells form "cold" tumors with an immunosuppressive microenvironment and reduced tumor-immune cell interactions. Mechanistically, RAC1<sup>A159V</sup> up-regulates glycosphingolipid biosynthesis to activate mTORC1 signaling in tumor cells, which in turn increases glycolysis, impairs key chemokine production, and decreases IFNGR1 expression of the tumor cells. mTORC1 inhibition by rapamycin resensitizes the RAC1<sup>A159V</sup> tumors to anti-PD1 treatment by reversing effects of RAC1<sup>A159V</sup> mutation. These results demonstrate a mechanism of RAC1<sup>A159V</sup>-driven immune evasion and suggest an approach of combining the targeting of RAC1-mTOR signaling with immune checkpoint inhibitor for the treatment of a type of immune-cold tumors.

BTN2A1
Also flagged:PD-L1tumorPD-1programmed death ligand 1programmed death 1cancer
Journal Article 2025-10-29 ✓ 2 Snippets King LA, Veth M, Roos M, Scheffer GL, Popovic MA, de Gruijl TD, van der Vliet HJ.
In-Text Gene Mentions

…which together withBTN2A1, triggers the T…

…to differences inBTN2A1/3A1, NKG2D and DNAM-1…

Show Full Abstract

<h4>Background</h4>Despite the notable success of programmed death ligand 1 (PD-L1)/programmed death 1 (PD-1) immune checkpoint blockade in cancer, resistance remains a substantial challenge. Combining immune checkpoint blockade with direct targeting of effector T cells to tumor cells might improve outcome for a broader spectrum of patients with cancer. Phosphoantigen-responsive Vγ9Vδ2-T cells are potent immune cells that play a pivotal role in tumor immunosurveillance and can coordinate downstream immune activity. Here, we explored whether a Vδ2 bispecific T cell engager (bsTCE) directed against PD-L1 could combine lysis of PD-L1<sup>+</sup> tumor cells with PD-L1 immune checkpoint blockade.<h4>Methods</h4>PD-L1 specific single domain antibodies (VHHs) were tested for binding to PD-L1 and their ability to interfere with PD-1 binding and function. One PD-L1 VHH was selected for fusion to a Vδ2-T cell receptor specific VHH (PD-L1xVδ2 bsTCE) and tested for its ability to activate Vγ9Vδ2-T cells and lyse melanoma cell lines, as well as patient-derived renal cell carcinoma (RCC) and metastatic melanoma cells. These patient-derived tumor suspensions were also used to explore effects on CD4<sup>+</sup> and CD8<sup>+</sup> T cells and myeloid cells. Infiltration of Vγ9Vδ2-T cells and tumor kill was tested in a three-dimensional tumor spheroid melanoma model.<h4>Results</h4>A PD-L1xVδ2 bsTCE was generated and shown to block PD-1 binding resulting in the release of PD-1<sup>+</sup> cells from PD-L1 mediated inhibition. The PD-L1xVδ2 bsTCE also mediated robust Vγ9Vδ2-T cell activation, efficient lysis of RCC and melanoma cell lines and/or patient-derived tumor cells, and infiltration of Vγ9Vδ2-T cells into a three-dimensional melanoma spheroid model. Of interest, exposure of co-cultures of Vγ9Vδ2-T cells and patient-derived tumor suspensions to the PD-L1xVδ2 bsTCE resulted in upregulation of activation markers on tumor-infiltrated CD4<sup>+</sup> and CD8<sup>+</sup> T cells and lysis of PD-L1<sup>+</sup> myeloid cells with a shift in the myeloid compartment from macrophage-like cells to more mature dendritic cells with costimulatory molecule expression.<h4>Conclusions</h4>A PD-L1xVδ2 bsTCE was generated that acts as PD-1/PD-L1 immune checkpoint inhibitor, enhances Vγ9Vδ2-T cell activation, infiltration and tumor lysis and reshapes the tumor microenvironment towards a more proinflammatory state. By targeting both PD-L1 expressing tumor and myeloid cells, it addresses key challenges of current therapies and thereby offers a promising novel therapeutic strategy.

SOX6
Also flagged:pathogenesisrespiratory diseaseschronic respiratory diseaseschronic lung diseasesrespiratory diseasechronic lung disease
Journal Article 2025-10-29 ✓ 1 Snippet Zhu M, Du L, Shi L, Ji C, Zhu C, Song C, Wu L, Zhu L, Lu J, Zhang Q, Wu F, Jin C, Mou Y, Li Q, Zhang J, Zhu M, Cai J, Zhang C, Fu Y, Gong L, Hang D, Dai J, Jiang Y, Jin G, Hu Z, Ma H, Cheng X, Shen H.
In-Text Gene Mentions

…epithelial cells (e.g.,SOX6, THRB ,…

Show Full Abstract

Lung structures are critical for gas exchange and contribute to the pathogenesis of respiratory diseases, exhibiting notable lobe-specific heterogeneity. To investigate their genetic basis, we apply a deep-learning AI system and Pyradiomics to define lobe-specific lung CT imaging phenotypes, conducting genome-wide analyses in 35,469 participants from the Lung Imaging Genomics Initiative in China. We identify 36 loci associated with voxel intensities and 138 loci linked to three-dimensional shape. Functional annotation reveals significant enrichment of relevant genes in pathways regulating early fetal lung development and loci enriched in fetal lung regulatory elements. Genetic correlations are identified between lung structures and chronic respiratory diseases as well as lung function, with a number of loci showing colocalization. Mendelian randomization analyses suggest a causal role of lung structures in chronic lung diseases and extrapulmonary traits. This study provides new insights into the genetic architecture of lung structures and their links to diverse clinical outcomes.

Also flagged:Transcription factorsgene expressionbindingRNA polymerasespolymeraseNELF
Journal Article 2025-10-29 No Snippets Mann R, Soota D, Das A, Podh NK, Mehta G, Notani D.
Show Full Abstract

Regulated pausing of RNA polymerase II (Pol II) is essential for enabling rapid and coordinated transcriptional responses to signalling cues. Pausing also contributes to the formation of nucleosome-free regions with the help of chromatin remodellers. However, if these nucleosome-free regions engage with transcription factors to stimulate the transcription potential of paused promoters is not known. In this study, we demonstrate that ligand-induced estrogen receptor-alpha (ERα) binding is stabilized at Pol II-paused sites. This stabilization results from an increased dwell time of ERα on chromatin, as revealed by single molecule tracking (SMT) experiments. Notably, short chromatin-associated RNAs generated by the paused Pol II contribute to enhancing ERα binding at paused promoters. We also observe that pausing increases H3K27ac levels, which primes paused promoters for robust transcriptional activation upon release. Collectively, these findings suggest that paused Pol II plays a central role in enhancing transcription factor binding through an RNA-dependent mechanism. This, in turn, results in a more vigorous transcriptional response following pausing release, thus contributing to the fine-tuning of ERα-mediated gene regulation.

TNFSF4
Also flagged:triple-negative breast cancertumorcell proliferationwound healingALCAMFAM129B
Journal Article 2025-10-29 ✓ 5 Snippets Yang Q, Cai X, Qian Y, Yang T, Xia W, Zhong M, Ye Z.
In-Text Gene Mentions

…(CD276, NRP1, TNFRSF4,TNFSF4or CTLA4).…

…NRP1, TNFRSF4 andTNFSF4presented remarkably higher…

…NRP1, TNFRSF4 orTNFSF4blockade.…

…(CD276, NRP1, TNFRSF4,TNFSF4, and CTLA4).…

…(CD276, NRP1, TNFRSF4,TNFSF4, and CTLA4), which…

Show Full Abstract

Exosomes play a crucial role in triple-negative breast cancer (TNBC), influencing various aspects of tumor progression. Given the importance of exosomes in TNBC biology, we proposed a novel exosome-based model that was critically implicated in TNBC. Bulk and single-cell transcriptomics and genetic mutations of TNBC patients were curated for our study. Characteristic exosome genes were selected via LASSO analysis, with subsequent construction of an exosome-based model. The effectiveness in estimating clinical outcomes and treatment responses was then evaluated and validated. MDA-MB-231 and MDA-MB-468 TNBC cells were transiently transfected with FAM129B siRNAs, and cell proliferation and migration were measured via EdU and wound healing assays. The study determined 7 characteristic exosome genes for TNBC: ALCAM, FAM129B, GNB2, KRT6A, PGK1, SERPINE1, and THY1, which were utilized for defining the exosome-based gene signature. It was proven that the signature accurately estimated patient prognosis, and functioned as an independent prognostic predictor. High-risk tumors owned shorter overall survival time, but were suitable for treatment with docetaxel and several small-molecule agents (MK-0752, BRD-K33199242, IC-87114, fumonisin B1, ilomastat, GW-788388, afobazole, and batimastat). High- and low-risk tumors presented the distinct genetic mutation characteristics. The characteristic exosome genes were specifically expressed in the TNBC microenvironment components, indicating their involvement in modulating the microenvironment. High-risk individuals were inferred to better respond to immune checkpoint blockade (CD276, NRP1, TNFRSF4, TNFSF4 or CTLA4). Experimentally, inhibition of FAM129B effectively attenuated proliferative and aggressive phenotypes of TNBC cells. Collectively, our findings proposed the exosome-based gene signature for accurate estimation of clinical outcomes and assisting in individually tailoring therapies in TNBC as well as discovered FAM129B as a potential therapeutic target.

Also flagged:MUC1methylationTET3CholangiocarcinomaCCTET1
Journal Article 2025-10-29 No Snippets Yokoyama S, Kitazono I, Higashi M, Matsuo K, Hamada T, Kirishima M, Noguchi H, Tasaki T, Murakami M, Akahane T, Furukawa T, Ohtsuka T, Sugimoto T, Tanimoto A.
Show Full Abstract

Cholangiocarcinoma (CC) is a highly lethal malignancy that urgently requires reliable prognostic biomarkers. Although MUC1 expression and promoter methylation have been implicated in CC, the clinical significance of promoter methylation pattern composition, beyond average methylation levels, remains unclear. Here, we investigated the relationship between MUC1 promoter methylation heterogeneity, MUC1 mRNA expression, and prognosis in CC. We analyzed bisulfite amplicon sequencing data and mRNA expression of MUC1, DNA methylation-related enzymes (TET1, TET2, TET3, Dnmt1, and Dnmt3a), and tumor microenvironment stress markers in 131 CC tissues. In the neoplastic region, high MUC1 mRNA expression was associated with poor overall survival (HR = 0.131, 95% CI: 0.02 to 0.95, p = 0.042) and correlated with the abundance of completely unmethylated promoter patterns (r = 0.386, p < 0.001). Among the enzymes analyzed, only TET3 expression significantly correlated with the abundance of completely unmethylated patterns in the neoplastic region (Cohen's f<sup>2</sup> = 0.108, p = 0.009), suggesting a potential region-specific regulatory association. We visualized beta-diversity in methylation pattern composition using t-SNE and classified samples into two groups based on a linear decision boundary in the t-SNE space. This classification stratified prognosis independently of clinical factors (HR = 0.291, 95% CI: 0.06 to 0.94, p = 0.037; multivariate p = 0.021). These findings propose a novel, composition-based epigenetic stratification framework in CC, revealing that MUC1 promoter methylation pattern structure-rather than average methylation level-has prognostic relevance. Our results highlight the potential of pattern-resolved methylation profiling in the development of clinically applicable epigenetic biomarkers.

Also flagged:histonekinetochore proteinCENP-TCENP-Wbindingkinetochore
Journal Article 2025-10-29 No Snippets Sankaranarayanan SR, Ulmer J, Mørch A, Ali-Ahmad A, Sekulić N, Sekulić N, Drinnenberg IA.
Show Full Abstract

The histone-fold domain (HFD) is a conserved protein interaction module that requires stabilization through a handshake interaction with an HFD partner. All HFD proteins known to date form obligate dimers to shield the extensive hydrophobic residues along the HFD. Here, we find that the lepidopteran kinetochore protein CENP-T is soluble as a monomer. We attribute this stability to a structural rearrangement, which leads to the repositioning of the HFD helix α3. This brings a conserved two-helical extension closer to the histone fold, where it takes over the position and function of the CENP-T partner CENP-W. This change has no effect on the DNA-binding ability of the lepidopteran CENP-T. Our analysis suggests that the monomeric HFD originated in the last common ancestor of insects, with a possible second independent origin in Acariformes, both of which lack CENP-W. Our study highlights an unexpected structural variation in a protein module as conserved and optimized as the HFD, providing a unique perspective on the evolution of protein structure and the forces driving it.

NEGR1
Also flagged:Gene Expressionparaformaldehydeethanolsodiumcitrateformamide
Journal Article 2025-10-29 ✓ 1 Snippet Lázár E, Mauron R, Andrusivová Ž, Foyer J, He M, Larsson L, Shakari N, Salas SM, Avenel C, Sariyar S, Hansen JN, Vicari M, Czarnewski P, Braun E, Li X, Bergmann O, Sylvén C, Lundberg E, Linnarsson S, Nilsson M, Sundström E, Adameyko I, Lundeberg J.
In-Text Gene Mentions

…specific markers (NEGR1, ALCAM ,…

Show Full Abstract

Heart development relies on topologically orchestrated cellular transitions and interactions, many of which remain poorly characterized in humans. Here, we combined unbiased spatial and single-cell transcriptomics with imaging-based validation across postconceptional weeks 5.5 to 14 to uncover the molecular landscape of human early cardiogenesis. We present a high-resolution transcriptomic map of the developing human heart, revealing the spatial arrangements of 31 coarse-grained and 72 fine-grained cell states organized into distinct functional niches. Our findings illuminate key insights into the formation of the cardiac pacemaker-conduction system, heart valves and atrial septum, and uncover unexpected diversity among cardiac mesenchymal cells. We also trace the emergence of autonomic innervation and provide the first spatial account of chromaffin cells in the fetal heart. Our study, supported by an open-access spatially centric interactive viewer, offers a unique resource to explore the cellular and molecular blueprint of human heart development, offering links to genetic causes of heart disease.

HFE
Also flagged:complement-related proteinssteatotic liver diseasesteatohepatitissteatosisALTAST
Journal Article 2025-10-29 ✓ 1 Snippet Shao L, Zhang B, Liu J, Lyu Z, Zhang W, Yang W, Fu J, Wu W, Zhong X, Li J, Shi J.
In-Text Gene Mentions

…an evaluation ofhemochromatosis, fatty liver and…

Show Full Abstract

<h4>Background</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) affects a quarter of the population. Although multiple studies have investigated the mechanisms underlying steatohepatitis and MASLD progression, little attention has been paid to milder cases, particularly those with normal enzyme levels. Our objective was to evaluate the molecular events in patients with MASLD and normal enzyme levels.<h4>Methods</h4>We performed a proteomic analysis on serum samples from 83 healthy controls and 50 patients with MASLD. The major findings were then validated in serum samples from 35 controls and 60 patients with MASLD and normal liver enzyme levels (MASLD-NLE), as well as a male mouse model with metabolic dysfunction-associated liver steatosis and normal liver enzymes (mice-NLE) induced by a high-fat diet (HFD).<h4>Results</h4>Despite having normal enzyme levels, patients with MASLD-NLE exhibited significantly higher levels of ALT, AST, γGGT, hs-CRP, uric acid and creatine compared to controls. Serum proteomics indicated elevated complement-related proteins in patients with MASLD-NLE, evidenced by elevated protein levels of C3 and CFH in both cases using different cutoffs for normal ALT levels. C3 and CFH also showed positive correlations with γGGT, hs-CRP, ALT, and uric acid levels. Additionally, the elevation of C3 and CFH was confirmed in another set of human serum samples, as well as in serum and liver samples of mice-NLE using ELISA.<h4>Conclusions</h4>Our study provides novel evidence that the complement system is already activated in patients with MASLD-NLE, potentially offering new avenues for treating MASLD at an early stage.

Also flagged:Type 2 diabetes mellitusInsulin resistancecognitive declinevisual impairmenthypertensiondyslipidemia
Journal Article 2025-10-29 No Snippets Dong PTX, Nguyen TT, Duong HTT, Nguyen TTT, Le AV, Nguyen AKT, Nguyen CT, Pham VTT.
Show Full Abstract

BACKGROUND: Elderly patients with type 2 diabetes mellitus (T2DM) often face complex healthcare needs due to comorbidities and polypharmacy, increasing the risk of poor glycemic control and drug-related problems. Comprehensive Clinical Pharmacy Services (CPS) aim to optimize medication management and improve adherence, addressing these challenges effectively. METHODS: This prospective, single-center implementation study was conducted in the outpatient clinic of the Department of Endocrinology – Diabetes of a tertiary care hospital in Vietnam. Elderly patients aged ≥ 60 years with a diagnosis of T2DM for at least one year and an HbA1c level ≥ 8% were included. A trained clinical pharmacist provided a structured CPS intervention, including Medication Therapy Management (MTM) and collaborative goal-setting. The impact of pharmacy services was assessed through the number of Drug-Related Problems (DRPs) identified and resolved in prescriptions and patient medication use behaviors, improvements in HbA1C levels, as well as the satisfaction of both physicians and patients with the services provided by pharmacists. RESULTS: Among 210 patients (mean age 73.5 years; 71% male), the baseline median HbA1c was 8.6% (IQR: 8.2–9.13), with 90.5% experiencing polypharmacy. A total of 231 DRPs were identified, primarily patient-related (66.2%), including unintentional misuse (28.6%) and intentional non-adherence (14.7%). DRPs related to prescribing included inappropriate drug (21.2%) and dose selection (12.6%). Of 78 pharmacist interventions, 93.5% were fully accepted or partially accepted by physicians; 100.0% were deemed clinically significant (potential Adverse Drug Event Score - pADE ≥ 0.1). Following CPS, 22.9% of patients achieved individualized HbA1c targets (p < 0.05), while the proportion of patients with HbA1c ≥ 8.5% declined from 49.2% to 32.2%. Patient and physician satisfaction with CPS was high (95.2% and 100%, respectively), though only 46.3% of patients expressed willingness to pay for services. CONCLUSION: Comprehensive CPS has a significant positive impact on quality use of medicine in elderly outpatients with T2DM. These services should be formally integrated into routine diabetes care to optimize outcomes and reduce healthcare utilization in this population.

Also flagged:lung adenocarcinomaRac2lactylationtumorimmune responsesimmunometabolism
Journal Article 2025-10-29 No Snippets Yi Y, Xu W, Yu H, Luo Y, Zeng F, Luo D, Zeng Z, Xiong L, Huang L, Cai J, Liu A.
Show Full Abstract

<h4>Purpose</h4>Tumor Metabolic Behavior modulates the immunosuppressive microenvironment through multiple pathways, thereby compromising anti-tumor immune responses. To date, there have been limited studies assessing the role of metabolic plasticity or immunometabolism in the tumor microenvironment (TME) during metastasis. Notably, emerging evidence suggests the presence of an immunosuppressive niche in brain metastases. This research aims to delineate distinct metabolic signatures in brain metastatic, investigate the impact of tumor-associated glycolysis on the development of brain metastases in lung adenocarcinoma, and characterize the lactylation regulation in this immunosuppressive microenvironment.<h4>Methods</h4>The GSE131907 and GSE198291 datasets were retrieved for bioinformatic analysis. Combined with the results of proteomic and transcriptomic sequencing conducted on the lung adenocarcinoma brain metastasis model, differentially expressed signaling pathways were systematically identified through KEGG and GO functional annotations. A multimodal approach encompassing immunohistochemical (IHC) staining, immunofluorescence (IF) imaging, enzyme-linked immunosorbent assay (ELISA) quantification, and co-immunoprecipitation (Co-IP) assays was employed to experimentally validate the characteristics of the immunosuppressive microenvironment and the levels of tumor lactate/lactylation. Rescue experiments were performed by adding a lactylation-specific inhibitor (LDHi) or an H3K18la site-specific inhibitor. Finally, immunohistochemical staining was used to verify the expression level of H3K18la in clinical samples.<h4>Results</h4>A total of 86,215 cells were extracted from the GSE131907 dataset, and the metabolic profiles of different cell types were analyzed. The results showed that glycolysis plays a dominant role in tumor cell metabolism. Further analysis revealed that early-stage primary lesions exhibit an inflammatory response signature, while advanced-stage primary lesions and brain metastatic lesions display an immunosuppressive signature. Elevated glycolytic flux showed a significant positive correlation with both the progression of brain metastasis and the immune evasion capacity of brain metastatic lesions. Pathological evaluation of tumor tissues from the LLC-BM (Lewis Lung Cancer Brain Metastasis) model confirmed its immunosuppressive characteristics. Additionally, obvious hypoxia was observed in the tumor tissues, accompanied by intratumoral vascular malformation and dysfunction. Significant lactate accumulation was present in the tumor microenvironment of LLC-BM tumors, and prominent lactylation modifications were detected in the tumor regions. In this model, Rac2 was identified as a potential core mediator of lactylation modification in macrophages, promoting the M2 polarization of macrophages. Meanwhile, CD40, TNFSF13 and CCL22 were identified as key immunoregulatory factors regulated by lactylation signaling. Notably, H3K18la was significantly highly expressed in lung cancer brain metastatic lesion samples.<h4>Conclusions</h4>The glycolytic pathway plays a critical role in the metabolic reprogramming of tumor cells during lung adenocarcinoma brain metastasis. Tumor glycolysis is closely associated with lung cancer progression, brain metastasis, and immune evasion. The Rac2 could be affected by lactylation, and then facilitate the formation of an immunosuppressive tumor microenvironment by induce the M2 polarization of macrophages.

HFE
Also flagged:ironagingmethylationheart diseaserespiratory diseasechronic diseases
Journal Article 2025-10-29 ✓ 1 Snippet Zhao JJ, Zhang J, Li S, Wang Q, Mo Q, Yu H.
In-Text Gene Mentions

…from anemia orhemochromatosismechanisms.…

Show Full Abstract

<h4>Background</h4>Iron homeostasis is essential for fundamental biological processes, yet its impact on epigenetic aging and mortality remains poorly understood. This study aimed to investigate associations between dietary iron intake and DNA methylation (DNAm) aging markers and to determine whether these epigenetic signatures mediate iron's effects on mortality outcomes.<h4>Methods</h4>We analyzed data from 2,398 adults aged ≥ 50 years in the National Health and Nutrition Examination Survey (1999-2002) with up to 20 years of mortality follow-up. Dietary iron intake was assessed through 24-h recall interviews. DNA methylation was profiled using the Illumina Infinium MethylationEPIC BeadChip. We employed multiple linear regression to identify iron-responsive DNAm features, Cox proportional hazards models to assess mortality associations, and formal mediation analyses to quantify epigenetic pathways.<h4>Results</h4>Higher dietary iron intake was significantly associated with favorable epigenetic profiles, particularly with reduced levels of mortality-predictive DNAm markers GrimAge2Mort (β = -0.079, FDR = 0.00022), CRPMort (β = -0.072, FDR = 0.0037), and B2MMort (β = -0.057, FDR = 0.042). These iron-responsive DNAm features strongly predicted all-cause mortality (HRs per SD increase: 1.34, 1.21, and 1.08, respectively; all p < 0.05) and cause-specific mortality. Higher iron intake was directly associated with reduced risk of all-cause mortality (HR = 0.93 per SD increase, 95% CI 0.87-0.99), heart disease mortality (HR = 0.87, 95% CI 0.78-0.97), and respiratory disease mortality (HR = 0.72, 95% CI 0.56-0.93). Mediation analyses revealed that GrimAge2Mort mediated 22.7% of iron's protective effect on all-cause mortality and 14.7% on heart disease mortality.<h4>Conclusions</h4>This study establishes dietary iron as a modifiable determinant of epigenetic aging and mortality risk in older adults, with epigenetic recalibration mediating a substantial proportion of iron's protective effects. These findings suggest optimizing iron intake may represent a promising nutritional strategy to promote healthy aging.

OLFM4
Also flagged:protein synthesislocalizationRNA-binding proteinsdigestionlumenRNA-Binding-Proteins
Journal Article 2025-10-29 ✓ 1 Snippet Lee M, Acar IE, Eletto D, Adivarahan S, Mhamedi F, Handler K, Lee J, Vinzoni EG, Aguilar G, Moor AE.
In-Text Gene Mentions

…cell markers (i.e.,Olfm4, Sox9, Sox4, Igfbp4,…

Show Full Abstract

<h4>Background</h4>Subcellular RNA localization is crucial for the spatio-temporal control of protein synthesis and underlies key processes during development, homeostasis, and disease. In epithelial cells, RNA can localize asymmetrically along the apico-basal axis. Yet, the localization of most transcripts as well as the diversity of patterns that they adopt remains unexplored.<h4>Results</h4>Here, we use APEX-seq for proximity labeling and MERFISH for spatial transcriptomics to map subcellular transcript localization in intestinal organoids and tissue from adult mice. Many transcripts present localization bias, often localizing in granular structures. We uncover intrinsic and environmental factors that influence the formation of these patterns. Additionally, we identify translation-dependent and -independent localization patterns and pinpoint the role of 3' untranslated regions and RNA-binding proteins.<h4>Conclusions</h4>This subcellular RNA atlas presents a detailed resource for understanding intestinal physiology.

Also flagged:amino acidscarbonwaterpolysilazanesilicahydrofluoric acid
Journal Article 2025-10-29 No Snippets Xiong B, Breitfeld M, Dittrich PS.
Show Full Abstract

Arrays of pico-to-microliter droplets, organized on a surface, enable chemical and biological workflows at high throughput. Here, a platform employing two-layer droplets is presented to enable flexible manipulation of the droplets' microenvironment for dynamic biological cultivation. Arrays of 6784 agarose droplets (≈2.0 nL per droplet) encapsulating and immobilizing bacterial cells are generated. After that, aqueous droplets (≈3.7 nL) with a defined composition are deposited atop to form a thin liquid layer surrounding the agarose droplets. Chemical exchange between the two layers is extremely fast (equilibrium within 15 s for fluorescein). Moreover, the aqueous layer can be removed, opening the possibility to extract substances from the agarose droplets. Indeed, repeated addition and aspiration of a buffer successfully remove dyes or drugs previously added to the agarose droplets. Therefore, antibiotic drug testing can be performed under both static and transient exposure profiles. The latter reveals that bacterial responses such as bacterial killing and resuscitation are both heterogeneous at the single-cell level. Last, it is exemplified how such droplet manipulation strategy can also be use in long-term experimentation, where medium replenishment, performed at 12-h intervals during a 72-h experiment, enables the cultivation of a slow-growing microorganism in nanoliter droplets.

PRDX6
Also flagged:Cysteinecysteinespeptides-nitrosylationlocalizationpathogenesis
Journal Article 2025-10-29 ✓ 2 Snippets Lilla S, Atkinson S, Radau S, Bailey UM, Deshmukh AS, van der Reest J, Kirkpatrick J, MacVicar T, Zanivan S.
In-Text Gene Mentions

…cysteine 47 ofPrdx6, 15 which is…

…as GAPDH andPRDX6.…

Show Full Abstract

Cysteine oxidative modifications are critical signaling events regulating cellular functions, but their low abundance and dynamic nature pose technical challenges. We developed the SICyLIA-TMT workflow, which sequentially labels reduced and reversibly oxidized cysteines with light and heavy iodoacetamide (IAA) within the same sample. The inclusion of tandem mass tags (TMTs) enables simultaneous quantification of oxidative modification dynamics and protein levels across multiple conditions using micrograms of material. To improve the detection of low-abundance oxidized cysteines, a dedicated TMT channel serves as a carrier for heavy IAA-labeled peptides (SICyLIA-cTMT), enhancing quantification and enabling precise stoichiometry calculations. We demonstrate the workflow's applicability to cultured cells and full organs under stress. SICyLIA-cTMT achieves unprecedented depth and accuracy in redox proteome analysis while reducing mass spectrometry time. Combining SICyLIA-TMT with latest mass spectrometry technologies further halves the acquisition time without compromising coverage, improving throughput and enabling comprehensive studies of oxidative signaling.

Also flagged:TBK1TANK-binding kinase 1IkappaB kinaseprotein kinasesinnate immunityautophagy
Journal Article 2025-10-29 No Snippets Smeyers J, Oses-Prieto JA, Yadanar L, Wang M, Iadarola M, Lu S, Wang KS, Watanabe TH, Debnath J, Burlingame AL, Mordes DA.
Show Full Abstract

Loss-of-function variants in TBK1, encoding a protein kinase, are strongly associated with familial amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). However, how haploinsufficiency for TBK1 leads to age-related neurodegeneration remains unresolved. Here, we utilize sets of isogenic induced pluripotent stem cells (iPSCs) with loss of TBK1 or loss of optineurin (OPTN) for quantitative global proteomics and phospho-proteomics in both stem cells and excitatory neurons. We found that TBK1 sustains the abundance and phosphorylation of its interacting adapter proteins, AZI2/NAP1, TANK, and TBKBP1/SINTBAD. Moreover, TBK1 regulates the phosphorylation of endo-lysosomal proteins, such as GABARAPL2, the late-endosome GTPase RAB7A, and selective autophagy cargo receptor proteins-including novel phospho-sites in p62/SQSTM1-in neurons. Finally, we provide a census of the phospho-proteome in nascent human neurons for further studies. Overall, TBK1 serves as a point of convergence in ALS/FTD-linked endo-lysosomal networks that act in a cell-autonomous manner to maintain protein homeostasis in neurons.

SERPINC1
Also flagged:Byssogenesissecretiontyrosinase-like proteinlow affinity immunoglobulin epsilon Fc receptorO-methyltransferasemetabolism
Journal Article 2025-10-29 ✓ 5 Snippets Zhen X, Chen Y, Zhang W, Li Y, Li L, Qi H, Zhang S.
In-Text Gene Mentions

…was annotated asantithrombin-III.…

…Antithrombin III (ATIII; MG516730.1 ) is…

…anticoagulant role ofATIIIappears unrelated to…

…Thus, musselATIIIhomologs might regulate…

…protease regulation (e.g.,antithrombin-III-like).…

Show Full Abstract

Mussels' byssus and their adhesion ability play a crucial role in their attachment and artificial cultivation of mussels. In this study, transcriptomic and proteomic analyses were performed to identify byssogenesis-associated genes in the Mediterranean mussel <i>Mytilus galloprovincialis</i> Lamarck, 1819, seeking to advance our knowledge of the molecular basis of byssal secretion in mussels. Transcriptomic analysis identified 1742 and 1498 differentially expressed genes in the foot tissue of <i>M. galloprovincialis</i> at 9 h and 24 h post-byssal ablation, respectively. Meanwhile, proteomic analysis revealed 1254 and 484 differentially expressed proteins at the same two time points. Integrated analysis identified 121 genes differentially expressed at both transcript and protein levels. Among these genes, 44 were significantly upregulated, and they may constitute high-confidence gene sets associated with mussel byssogenesis. Notably, they included genes encoding tyrosinase-like protein, low affinity immunoglobulin epsilon Fc receptor, and O-methyltransferase MdmC. They were enriched in KEGG pathways, including metabolism of amino acids, lipid metabolism, nucleotide metabolism, and immune system. Quantitative real-time PCR was performed on seven selected genes, confirming that their expression patterns were consistent with those observed in transcriptomic and proteomic sequencing. This study provides novel data and insights for understanding the molecular basis involved in byssus development of <i>M. galloprovincialis</i>.

Also flagged:SynthesisGold nanoparticleshyaluronic acidphotonthiolsulfonic acid
Journal Article 2025-10-29 No Snippets Parfenova LV, Alibaeva EI, Gil'fanova GU, Galimshina ZR, Mescheryakova ES, Khalilov LM, Sergeev SN, Penkov NV, Subrahmanyam C.
Show Full Abstract

Gold nanoparticles (AuNPs) are of significant interest due to their unique properties and applications in biomedicine. While hyaluronic acid (HA) has been used to modify pre-formed AuNPs, its thiolated derivative (HA-SH) has been less explored for the direct synthesis and stabilization of AuNPs. This study investigates the use of thiolated hyaluronic acid as a key component in the synthesis of AuNPs. A series of HA-AuNPs (<b>HA-AuNP1-4</b>) were synthesized by reacting HA-SH with HAuCl<sub>4</sub> at different mass ratios. The resulting nanoparticles were characterized using UV-Vis spectroscopy, scanning/transmission electron microscopy (SEM/STEM), X-ray photoelectron spectroscopy (XPS), photon cross-correlation spectroscopy (PCCS), and zeta potential measurements. The chemical transformations of the thiol ligand were studied using NMR spectroscopy. The morphologies and sizes of AuNPs depended on the HA-SH-to-HAuCl<sub>4</sub> ratio, ranging from icosahedral and triangular particles (≥146 nm) to quasi-spherical particles with a bimodal distribution (6-7 nm and 45-60 nm). XPS confirmed the presence of metallic gold (Au<sup>0</sup>) and a Au-S bond, while NMR and XPS revealed the partial oxidation of thiol groups to sulfonic acid. Zeta potential measurements showed that lower HAuCl<sub>4</sub> concentrations resulted in higher negative charge (up to -41.5 mV), enhancing colloidal stability. This work demonstrates a versatile approach to the synthesis of hyaluronic acid-based gold nanomaterials with tunable properties for potential biomedical applications.

Also flagged:Calcium Phosphateshydroxyapatitemineralapatitecalcium phosphatesynthesis
Journal Article 2025-10-29 No Snippets Sadlik J, Kosińska E, Niziołek K, Urbaniak MM, Sobczak-Kupiec A, Słota D.
Show Full Abstract

Calcium phosphates, including hydroxyapatite, are widely used biomaterials in bone tissue regeneration due to their bioactivity, osteoconductivity, and similarity to the mineral phase of bone. In this study, various apatite calcium phosphate powders were synthesized using three precipitation methods, with controlled pH conditions and reagent ratios, to assess the effect of the synthesis method on their physicochemical and biological properties. Elemental composition (Ca/P ratio), FT-IR spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM) coupled with EDS, and particle size measurements were used to determine the structure, morphology, and stoichiometry of the obtained powders. The results indicated that the synthesis method and pH significantly affect the phase composition of the material, particle size, and Ca/P ratio, which directly influence their solubility and bioactivity. Microbiological tests, NF-κB transcription factor activation, metabolic activity, and cell compatibility of mouse L929 fibroblasts and human hFOB 1.19 osteoblasts showed good biological tolerance of the obtained powders and no cytotoxic effects. The results confirm that a properly selected synthesis method allows for the control of material properties, which is crucial for applications in bone tissue engineering. The materials show potential for use as bioactive components in bone-related biomaterials.

OLFM4
Also flagged:TumourOSCCperiodontitisepithelial-to-mesenchymal transitionimmune responsecell-cycling
Journal Article 2025-10-29 ✓ 3 Snippets Starska-Kowarska K.
In-Text Gene Mentions

…by olfactomedin 4 (OLFM4), which may serve…

…gingipain proteases controlOLFM4function by activating…

…lls, including olfactomedin-4,OLFM4, hepatocyte growth factor…

Show Full Abstract

(1) Background: Oral squamous cell carcinoma (OSCC) is the most common type of head and neck malignancy worldwide. Despite the prevalence of modern diagnostic and prognostic techniques, late diagnosis and resistance to treatment still result in a low 5-year survival rate, high recurrence rate, and frequent malignant metastases. Increasing evidence indicates that bacteria of the oral microbiome, such as the Gram-negative anaerobic <i>Porphyromonas gingivalis</i>, may play a crucial role in the initiation and development of OSCC by inducing periodontitis. Indeed, epithelial-to-mesenchymal transition (EMT) and dysregulated immune response have been attributed to the activity of a dysbiotic microbiota. This comprehensive review examines the influence of <i>P. gingivalis</i> on oral carcinogenesis and progression, which has been associated with tumour microenvironment remodelling and the dysregulation of key signalling pathways related to epithelial-to-mesenchymal transition (EMT), cell-cycling, autophagy, and apoptosis. (2) Methods: The article reviews current literature on the possible role of <i>P. gingivalis</i> and induced dysbiosis, periodontitis and a pro-inflammatory environment as key mechanisms driving neoplastic epithelial changes and chemoresistance to anticancer agents in patients with OSCC; the research corpus was acquired from the Pub-Med/Medline/EMBASE/Cochrane Library databases. (3) Results: The identification of virulence factors and key mechanisms used by <i>P. gingivalis</i> to promote the development and progression of OSCC may support traditional diagnostic methods and factors related to treatment response and prevention of OSCC. (4) Conclusions: Emerging evidence suggests a possible association between periodontal bacteria and oral carcinogenesis. <i>P. gingivalis</i> may be an important potential target for future strategies aimed at treating oral cancer.

TNFSF4
Also flagged:Gastric CancertumorStomach Adenocarcinomalocalizationwound healingASCL2
Journal Article 2025-10-29 ✓ 1 Snippet Gong Z, Wang W, He Y, Zhou J, Yang Q, Feng A, Huang Z, Pan J, Li Y, Yuan X, Ma M.
In-Text Gene Mentions

…with VTCN1 (B7-H4),TNFSF4(OX40L), TNFSF18 (GITRL),…

Show Full Abstract

<b>Background:</b> We aimed to identify key molecular drivers of gastric cancer progression and poor prognosis by integrating multi-omics analyses with experimental validation. <b>Methods:</b> Single-cell RNA-seq data were clustered to delineate major cell types. InferCNV identified tumor epithelial cells, and reclustering revealed a malignant subset with poor prognosis. The overlap between subset markers and The Cancer Genome Atlas Stomach Adenocarcinoma (TCGA-STAD) upregulated differentially expressed genes (DEGs) was modeled with univariate, LASSO-, and multivariate Cox to derive a prognostic signature. Patients were stratified according to signature scores, and group differences in survival and immunologic features were compared. Spatial transcriptomics defined the localization patterns of key signature genes. In vitro functional assays (CCK-8, colony formation, EdU incorporation, flow cytometry, Transwell migration and invasion, and wound healing) confirmed the pivotal role of SRI. <b>Results:</b> Reclustering of tumor epithelial cells yielded seven subsets (C0-C6), with C5 displaying marked malignant features and correlating with poor prognosis in multiple cohorts. Intersecting 208 genes yielded a five-gene signature (ASCL2, REPIN1, CXCL3, TMEM176A, SRI). The signature stratified patients into high- and low-risk groups. The high-risk cohort exhibited significantly poorer survival, distinct immune-infiltration patterns, elevated immune-evasion scores, and a reduced predicted response to immunotherapy. Single-cell and spatial transcriptomics localized TMEM176A to fibroblasts and SRI to the tumor epithelium. Finally, in vitro knockdown of SRI inhibited tumor cell proliferation, migration and invasion. <b>Conclusions:</b> Our multi-omics approach identified a malignant epithelial subset, C5, and a five-gene signature that stratifies gastric cancer prognosis and immune response. Functional assays showed that SRI knockdown impairs tumor cell growth, migration and invasion.

SERPINC1
Also flagged:Neurodegenerative Disordersearly-onset cognitive declinecognitive impairmentdementiacognitive declineDepression
Journal Article 2025-10-29 ✓ 1 Snippet Hosseini AA, Shao B, Lee AR, Dhillon P, Junaid K, Gran B, Sellars P, Sargisson H, Jung J, Mukaetova-Ladinska EB.
In-Text Gene Mentions

…revealed significantly lowerACE-IIIscores and higher…

Show Full Abstract

<h4>Introduction</h4>Dementia presents with significant heterogeneity across age groups, particularly in early-onset cognitive decline (EOCD), which poses diagnostic and management challenges. The Cognitive and Neuroimaging for Neurodegenerative Disorders (CogNID) study aims to characterise clinical, cognitive, neuroimaging, and biomarker features across a diverse cohort of individuals with cognitive impairment, with a focus on diagnostic complexity, biomarker utility, and mortality.<h4>Methods</h4>Out of 680 study participants within this prospective cohort enrolled from the real-world clinics within the National Health Service, who consented to take part in the study, we analysed data from 429. Individuals were recruited between December 2018 and November 2024 from the Memory Clinics, including the early-onset dementia service and associated services. Participants underwent structured cognitive assessments, neuroimaging (MRI/CT), and Cerebrospinal fluid (CSF) biomarker evaluation, where available. Diagnoses were made by multidisciplinary consensus. Group comparisons were conducted between early-onset (EOCD, <65 years) and late-onset cognitive decline (LOCD, ≥65 years).<h4>Results</h4>Of the 429 participants, 349 (81.4%) had EOCD and 80 (18.6%) had LOCD. The mean age was 60.05 years, with no significant difference in sex or ethnicity across groups. Depression and anxiety were common (29.6%), as were cardiovascular risk factors. Lumbar punctures were more frequently performed in EOCD (p = 0.03), with 36.4% of tested participants demonstrating biomarker profiles consistent with Alzheimer's disease (A+T+). Functional cognitive disorder (FCD) was more common in EOCD (22.3% vs. 5.0%, p < 0.001). Subgroup analysis revealed significantly lower ACE-III scores and higher pathological CSF findings in Alzheimer's disease versus FCD. Mortality was higher in the LOCD group (11.3% vs. 4.6%, p = 0.03).<h4>Conclusion</h4>The CogNID study highlights the clinical and diagnostic heterogeneity of individuals with cognitive impairment, particularly in younger adults. Incorporating neuroimaging and CSF biomarkers into routine clinical pathways enhances diagnostic precision and reveals distinct phenotypic profiles between EOCD and LOCD. These findings underscore the need for harmonised diagnostic protocols, broader biomarker accessibility, and inclusive recruitment strategies in dementia research and clinical services.

Also flagged:mitochondrialdeathGene ExpressionPdk4YrdcBcl2l11
Journal Article 2025-10-29 No Snippets Hu Y, Huang J, Min X, Zhao Y, Wang J, Liu H, Shi K, Li W, Li W.
Show Full Abstract

<h4>Background</h4>Severe ischemia-reperfusion (II/R) injury of the intestines is a leading cause of death and disability. According to earlier research, modulating mitochondrial function is the primary mechanism by which II/R injury is ameliorated. In order to further molecular diagnostics and discover possible treatment targets, it is essential to find biomarkers of mitochondria in II/R injury.<h4>Methods</h4>The datasets GSE96733 and GSE37013, along with mitochondrial-related genes (MRGs), were obtained from the Gene Expression Omnibus (GEO) database and MitoCarta3.0, respectively. GSE96733 conducted differential expression gene (DEGs) analysis and weighted gene co-expression network analysis (WGCNA) module screening. In order to find MRGs that were expressed differently, we got their intersection (DEMRGs) and gene enrichment analysis was carried out. The hub genes were screened using machine learning approaches, protein-protein interaction (PPI) network analysis, and Molecular Complex Detection (MCODE). A nomogram was developed for diagnostic evaluation. Furthermore, the relationship between hub gene expression profiles and immune infiltration landscapes was interrogated through immune cell infiltration analysis. The expression patterns of the hub genes were further validated in the II/R injury model through dataset validation and qRT-PCR assays. The procedure concluded in a gene-related hub network, DSigDB prediction of prospective therapeutic compounds, and molecular docking simulations of the drugs' binding affinity with important target proteins.<h4>Results</h4>Hub genes have been found in five different DEMRGs: Pdk4, Yrdc, Bcl2l11, Bcl2a1d and Pmaip1. The nomogram model was beneficial for diagnosis. Dendritic cells (DC) and M2 macrophages are strongly linked to the 5 Hub genes, according to immune cell infiltration research. Afterwards, the regulatory network showed that hub genes and miRNAs had a complicated connection. Additionally, securinine and ABT-737 were anticipated to be possible therapeutic agents for II/R injury. The validation results for the four hub genes (Pdk4, Yrdc, Bcl2l11, and Pmaip1), obtained from both independent datasets and qRT-PCR, were consistent with the initial bioinformatics analysis.<h4>Conclusion</h4>Pdk4, Yrdc, Bcl2l11, and Pmaip1 have been identified as hub genes closely associated with mitochondrial function in eraly II/R injury, thereby providing a theoretical basis for the diagnosis and treatment of eraly II/R injury.

TNFSF4
Also flagged:HMGB3cold tumorCD4CD8gene expressionTumor
Journal Article 2025-10-29 ✓ 5 Snippets Tang M, Huang T, Zhang W, Wang C, Pan R, Zhao Y.
In-Text Gene Mentions

…function of HMGB3,TNFSF4, and CORO2A in…

…model, including HMGB3,TNFSF4, CORO2A, SOCS3, TACR1…

…CORO2A , andTNFSF4exhibited significant upregula…

…high-expression group ofTNFSF4.…

…( HMGB3 ,TNFSF4, CORO2A ),…

Show Full Abstract

<h4>Background</h4>Breast cancer (BC) is clinically defined as a cold tumor due to its low immunogenicity, which is usually insensitive to immunosuppressive agents. Herein, we investigated the predictive potential of novel immune-related genes (IRGs) in BC, with the objective of more effectively guiding the immunotherapy for patients with BC.<h4>Methods</h4>The least absolute shrinkage and selection operator (LASSO) regression analysis was used to conduct the BC prognostic model based on IRGs, and univariate/multivariate Cox proportional hazards models were employed to establish the BC predictive nomograms. Then, we investigated the expression patterns of these IRGs utilizing The Cancer Genome Atlas (TCGA) database. Moreover, we also performed correlation analyses between IRGs and multiple immune features, including infiltration of immune cells, immune checkpoint members, and immune therapy response.<h4>Results</h4>In our study, six IRGs were finally identified to construct the BC prognostic model, including <i>HMGB3, TNFSF4, CORO2A, SOCS3, TACR1</i>, and <i>FREM1</i>. This model exhibited excellent predictive performance, with area under the curve (AUC) values of 0.676, 0.646, and 0.621 for the 1-, 3-, and 5-year timeframes, respectively. Analysis of expression profiles indicated that <i>HMGB3</i>, <i>CORO2A</i>, and <i>TNFSF4</i> exhibited significant upregulation in BC tissues, displaying strong correlations with diminished overall survival. The three overexpressed genes showed statistically significant correlations with multiple important immune cells, including Tregs, macrophages, and CD4+/CD8+ T cells. Notably, distinct patterns of integrating gene expression and immune infiltration significantly affected the clinical outcomes of BC patients. These upregulated genes demonstrated significant co-expression patterns with key immune checkpoint regulators, suggesting close immunomodulatory interactions in BC. The Tumor Immune Dysfunctional and Exclusion (TIDE) scores were lower in the high-expression groups of <i>HMGB3</i> and <i>CORO2A</i>, whereas the TIDE score was higher in the high-expression group of <i>TNFSF4</i>.<h4>Conclusions</h4>This prognostic model reliably assessed risk for BC patients, providing critical guidance for precision oncology protocols and dynamic surveillance of disease progression.

CSE1L
Also flagged:cervical cancerp53tumorCervical squamous cell carcinomaSMYD2E4F1
Journal Article 2025-10-29 ✓ 1 Snippet Wu Z, Zhang J, Sun B, Wu Y, Wang N, Li C.
In-Text Gene Mentions

…, CHEK2 ,CSE1L, PPP1R13L ,…

Show Full Abstract

<h4>Background</h4>Cervical squamous cell carcinoma (CESC) poses significant health risks, contributing to high mortality rates and economic burdens, particularly in developing countries. The p53 signaling pathway plays a crucial role in the initiation, progression, and treatment response of CESC. This study explored the role of <i>SMYD2</i> among genes related to the p53 regulatory pathway in CESC.<h4>Methods</h4>A prognostic model for p53 regulatory pathway-related genes was established by performing least absolute shrinkage and selection operator (LASSO) regression analysis on the training cohort from The Cancer Genome Atlas (TCGA) dataset. By amalgamating the risk scores generated by the model with clinical characteristics, a nomogram was developed to assist in predicting overall survival (OS). In addition, we examined various associations concerning pathway enrichment, treatment modalities, immune cell infiltration, and the prognostic model itself. The functional role of the <i>SMYD2</i> gene was assessed through Gene Ontology (GO) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Gene Set Enrichment Analysis (GSEA). Furthermore, we conducted a comprehensive evaluation of the relationship between <i>SMYD2</i> expression and an array of clinical parameters, including tumor (T), lymph node (N), and metastasis (M) stages, age, and tissue type, utilizing data from the TCGA database. Employing the "rms" R package, we constructed a nomogram model that integrates clinical features with levels of <i>SMYD2</i> expression. Additionally, immunohistochemical assessments were performed on samples from 30 cervical cancer patients to analyze the expression of <i>SMYD2</i>.<h4>Results</h4>We established a prognostic model that encompasses six genes: <i>SMYD2</i>, <i>E4F1</i>, <i>FBXO11</i>, <i>HIPK2</i>, <i>KAT2B</i>, and <i>TP53</i>. The relationships between the alterations in the expression of these genes and patient survival outcomes were validated using Kaplan-Meier survival analysis. Among the six selected prognostic genes, we found that increased <i>SMYD2</i> expression is linked to advanced T and M stages, higher clinical staging, diverse histological types, and poor prognosis. A nomogram was created to integrate <i>SMYD2</i> expression with clinical factors to forecast the OS probabilities of patients at the 1-, 3-, and 5-year marks. Furthermore, immunohistochemical evaluations disclosed that in a cohort of 33 cases, the expression levels of <i>SMYD2</i> in cervical cancer tissues were significantly greater than those observed in adjacent non-cancerous tissues.<h4>Conclusions</h4>This study elucidates specific features associated with the p53 regulatory pathway, particularly <i>SMYD2</i>, and its relationship with the onset and progression of CESC. Furthermore, <i>SMYD2</i> may serve as a prognostic biomarker for individuals diagnosed with CESC, offering new insights for the development of clinical treatment strategies.

TNFSF4
Also flagged:sodiumdeathmembranedepolarization-associated geneslung adenocarcinoma
Journal Article 2025-10-29 ✓ 1 Snippet Shi Y, Qu X, Liu D, Zhang H, Wang S, Song J, Wang L, Wang W.
In-Text Gene Mentions

…, TNFRSF9 ,TNFSF4, TNFSF9 ,…

Show Full Abstract

<h4>Background</h4>Recent studies have identified a novel cell death mechanism, termed sodium death, triggered by sustained activation of <i>TRPM4</i> ion channels. Prolonged <i>TRPM4</i> channel activity results in excessive sodium ion influx and membrane depolarization, ultimately inducing necrotic cell death. However, the role of sodium death-associated genes (NECSOs) in lung adenocarcinoma (LUAD) remains poorly understood. We used NECSOs to construct a prognostic model of LUAD for prognostic prediction and to explore the features of sodium overload-induced cell death in single cells.<h4>Methods</h4>This study conducted a comprehensive analysis of The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases to investigate <i>TRPM4</i>, a NECSO identified in the literature. Through co-expression analysis, 40 NECSOs were identified. Using the AddModuleScore enrichment algorithm, sodium death scores were calculated for distinct cell clusters and categorized into high- and low-score groups. Differentially expressed genes (DEGs) between these groups were subjected to weighted gene co-expression network analysis (WGCNA) to identify gene modules associated with LUAD. Subsequent differential expression and univariate Cox regression analyses were performed on genes within these modules. Consensus clustering analysis was employed to characterize molecular subtypes, while least absolute shrinkage and selection operator (LASSO) regression was used to develop a prognostic model based on NECSOs. Multiple immune infiltration scoring algorithms and cellular communication analyses were applied to evaluate the relationship between sodium overload (NECSO) and the tumor microenvironment (TME), with the aim of identifying potential therapeutic targets for LUAD.<h4>Results</h4>Single-cell and bulk transcriptome analyses identified 126 NECSOs, of which 28 were differentially expressed between tumor and normal tissues. Among these, 14 genes were significantly associated with overall survival (OS). Pseudotime analysis of epithelial cells revealed that risk-associated genes were predominantly upregulated in later stages, whereas protective genes exhibited reduced expression over time. Eight genes were selected to construct a prognostic signature for NECSOs. Patients in the low-NECSOs group demonstrated significantly better prognosis compared to those in the high-NECSOs group. Cellular communication analysis indicated that epithelial cells with elevated NECSOs expression exhibited enhanced activity in the epidermal growth factor (EGF), Midkine (MK), and COMPLEMENT signaling pathways.<h4>Conclusions</h4>The prognostic model developed from NECSOs enables robust survival prediction for LUAD patients and provides insights into the immune landscape of LUAD. Notably, epithelial cells with higher NECSOs scores displayed a greater propensity for transformation into tumor cells, highlighting their potential as therapeutic targets.

PEBP1
Also flagged:programmed cell deathlung cancerhomeostasistumorLUADlung adenocarcinoma
Journal Article 2025-10-29 ✓ 5 Snippets Li Z, Fu C, Chen J, Ji W, Ma Z.
In-Text Gene Mentions

…, CIDEB ,PEBP1, RNF5 ,…

…teintech, Wuhan, China), anti-PEBP1(1:1,000 dilution, catalog…

…including CIDEB ,PEBP1, RNF5 ,…

…expression levels ofPEBP1, BTK, and ADRB2,…

…of BTK andPEBP1was decreased (…

Show Full Abstract

<h4>Background</h4>Lung adenocarcinoma (LUAD) is a major subtype of lung cancer with a 5-year survival rate of less than 20%. While immunotherapy has revolutionized cancer treatment, only 10-20% of cases show durable responses to immune checkpoint blockade. Thus, developing accurate methods to predict prognosis and response to immune checkpoint inhibitors (ICIs) is crucial. Programmed cell death (PCD) plays a significant role in maintaining tissue homeostasis and responding to various physiological or pathological conditions. Increasing evidence suggests that PCD is involved in tumor initiation, development, prognosis, and response to immunotherapy. To provide reliable LUAD clinical tools, we developed an immune-related programmed cell death signature (IRPCDS) and validated its ability to predict prognosis and ICI response for precision medicine.<h4>Methods</h4>In this study, we integrated 18 PCD signatures to develop an IRPCDS. We employed 10 machine learning algorithms and 101 algorithm combinations to assess the performance of the IRPCDS. The signature was validated across multiple cohorts to ensure its robustness in predicting clinical outcomes for LUAD patients.<h4>Results</h4>The IRPCDS demonstrated strong performance in predicting the clinical prognosis of LUAD patients, effectively stratifying them into different risk groups for targeted interventions. Notably, the IRPCDS outperformed traditional clinicopathological factors and previously published 52 signatures in predicting overall survival (OS). Patients classified in the low-risk group exhibited high levels of immune infiltration and favorable responses to ICIs, while those in the high-risk group showed a higher overall mutation burden and an increased frequency of mutations in driver genes associated with LUAD. Additionally, we validated the expression of the IRPCDS genes at both the transcriptional and protein levels across multiple datasets and clinical specimens.<h4>Conclusions</h4>The IRPCDS serves as a robust and promising tool for enhancing clinical outcomes and precision medicine for individual LUAD patients. By integrating PCD signatures, this approach provides valuable insights into the prognostic landscape of LUAD, paving the way for more effective immunotherapeutic strategies.

VSIG10
Also flagged:immune responsesDC3Flt3CD123DCCD14
Journal Article 2025-10-29 ✓ 1 Snippet Baillou A, Auray G, Brito F, Botos M, Huber A, Summerfield A, Talker SC.
In-Text Gene Mentions

…T-cell responses (VSIG10, CD200 )…

Show Full Abstract

Dendritic cells (DC) are professional antigen presenting cells playing a major role in orchestrating adaptative immune responses. To adapt to various immune challenges, such as different classes of pathogens, specialized subsets of DC have evolved across species. To date, DC are classified as conventional DC (cDC1, cDC2) and plasmacytoid DC (pDC), with the more recent addition of DC3 and transitional DC (tDC) that were discovered in human and mouse thanks to high-dimensional phenotyping and single-cell sequencing technologies. Here, by combining flow cytometry and RNA-seq on the bulk- and single-cell level, we identified the porcine equivalent of tDC in blood as CD14<sup>-</sup>CADM1<sup>-</sup>CD172a<sup>+</sup>CD4<sup>-</sup> cells expressing both Flt3 and CD123 (IL-3RA). This new subset forms a well-defined cluster when mapped onto scRNA-seq data of enriched DC and shares transcriptomic features and abundance with porcine blood cDC2 and pDC. Moreover, we describe putative porcine DC3 as transcriptionally overlapping cells in-between cDC2 and monocytes. With the core functions of tDC and DC3 remaining to be elucidated, our datasets provide a valuable resource for cross-species research on DC heterogeneity in various lymphoid and non-lymphoid tissues.

PRDX6
Also flagged:FLAD1Hepatocellular carcinomacancermitochondrial-relatedcopper
Journal Article 2025-10-29 ✓ 2 Snippets Zhu P, Mou L, Lu Y, Pu Z, Guo C.
In-Text Gene Mentions

…GRHPR, HTRA2, PAICS,PRDX6, SPTLC2, TXNRD1, UQCRH)…

…FLAD1, HTRA2, PAICS,PRDX6, SPTLC2, TXNRD1, and…

Show Full Abstract

Hepatocellular carcinoma (HCC) remains one of the leading causes of cancer-related mortality worldwide, characterized by increasing incidence rates and challenging prognoses. This study integrates single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics to unravel the complex molecular and structural landscape of HCC, focusing on the identification of mitochondrial-related genes (MitRGs) and their pivotal role in disease progression. Utilizing scRNA-seq and bulk RNA-seq data, we performed a comprehensive differential expression analysis to highlight MitRGs. A modeling approach using 92 combinations of nine machine learning algorithms was applied, producing a predictive model with good performance. Among the genes analyzed, FLAD1 emerged as significantly upregulated in HCC tissues, correlating with advanced disease stages and poorer patient outcomes, and exhibited exceptional diagnostic accuracy with an AUC of 0.962. Functional enrichment analyses revealed that high FLAD1 expression is involved in crucial biological processes like copper ion detoxification and heme complex assembly. Interaction networks further elucidated the connection between FLAD1 and critical HCC pathways, with its expression levels negatively correlated with key immune effector cells such as CD8+ T cells and DCs. Spatial transcriptomics analysis provided a structural basis for this immune exclusion, demonstrating that an intact tumor capsule can function as a physical barrier that fosters an immune-exempt microenvironment. This analysis also validated FLAD1 upregulation within the spatial context of the tumor. Additionally, DNA methylation analysis indicated a hypomethylation pattern in the FLAD1 promoter region, likely contributing to its overexpression in HCC. Validation of FLAD1 protein levels in an in-house cohort via Western blotting further confirmed these findings. Collectively, our integrative study highlights the utility of MitRGs as potential biomarkers and positions FLAD1 as a dual prognostic and therapeutic target linked to the structural and immune landscape of HCC.

Also flagged:type 2 diabeteschronic diseaseinsulinglucosecollagenbone formation
Journal Article 2025-10-29 No Snippets Simon M, Uppuganti S, Nyman JS, Zysset P.
Show Full Abstract

Type 2 diabetes (T2D) is a chronic disease leading to an elevated glucose level in the blood and increased fracture risk. Because T2D individuals tend to have normal to higher areal bone mineral density (aBMD) than healthy individuals, their fracture risk is often underestimated. As an alternative, high-resolution peripheral quantitative computed tomography (HR-pQCT) is an attractive tool to investigate bone morphology in vivo and estimate fracture risk. Based on HR-pQCT scans, bone strength can be estimated using micro finite element ( μ FE) analysis or homogenized finite element (hFE) analysis. While μ FE is computationally expensive, hFE provides an accurate estimation of bone mechanical properties within reasonable efforts. However, the hFE scheme is based on relationships between the local fabric (anisotropy) and elasticity. These relationships have been shown to hold for healthy controls as well as in the case of osteogenesis imperfecta. Nevertheless, whether these relationships are also valid for T2D-diagnosed patients remains unclear. Therefore, the present work aims to compare fabric-elasticity relationships between T2D and non-diabetic controls. The present study collected 56 trabecular bone cores from the femoral head of 28 T2D and 28 control donors. These cadaveric samples were scanned in a micro-CT system at an isotropic 14.8 μ m voxel size. Three cubic regions of interest (ROIs) were selected in each scan. The resolution of these ROIs was coarsened by a factor of 4, mimicking clinical HR-pQCT resolution, and the ROIs were subsequently segmented. Standard morphometric parameters were computed from the segmented ROIs using medtool (v4.8; Dr. Pahr Ingenieurs e.U., Pfaffstätten, Austria). Additionally, their fabric tensor and their apparent stiffness tensors were computed. The ROIs were compared between T2D and control regarding their morphometric and mechanical properties. Finally, ROIs were matched between T2D and control for bone volume fraction ( ρ ) and degree of anisotropy (DA). The matched dataset allowed the comparison of fabric-elasticity relationships between T2D and control samples. No significant difference was observed between T2D and control samples, both regarding their morphology and their mechanical properties. Specifically, fabric-elasticity relationships were shown to hold for both the control and the T2D groups. A comparison of the resulting exponents related to ρ and DA has highlighted different trends but no important difference between T2D and control samples. In conclusion, trabecular bone architecture was similar between T2D and non-T2D donors. Additionally, fabric-elasticity relationships, i.e. morphology-mechanical relationships, are also similar between donors with and without diabetes. Accordingly, HR-pQCT-based hFE analysis could also be used for estimating the bone mechanical properties of T2D patients and for their fracture risk assessment.

POU3F2
Also flagged:chromosomeantiviral responsecancerundifferentiated embryonal sarcoma of the liverembryonal tumortriple negative breast cancer
Journal Article 2025-10-29 ✓ 4 Snippets Underwood MT, Devarapalli V, Jinesh GG, Lockhart JH, Napoli M, Mtchedlidze N, Flores ER, Brohl AS.
In-Text Gene Mentions

…GC, R: CTCCTTAATGTCACGCACGAT);POU3F2(OCT7) (F: GTGTTCTCGCAGACCACCA…

POU3F2and ADAM12 primers…

…(also known asPOU3F2) [ 28 ],…

…significant overexpression ofPOU3F2and repression of…

Show Full Abstract

<b>Background/Objectives:</b> Hepatocellular carcinoma (HCC) is one of the world's deadliest cancers; however, the mechanisms that contribute to its aggressiveness are poorly understood. In the recent literature, overexpression of the Chromosome 19 MicroRNA Cluster (C19MC) has been associated with an aggressive phenotype and unfavorable prognosis in HCC. However, the molecular consequences of C19MC overexpression in HCC remain poorly understood. <b>Methods</b>: Here, we created a constitutive C19MC-overexpressing HCC model and used two different CRISPR-engineered C19MC-overexpressing HCC models to analyze phenotype and transcriptomic changes. <b>Results</b>: We observed that C19MC overexpression induces cancer stem cell (CSC) phenotypic features in vitro and analyzed transcriptomic changes in genes correlating with stemness, such as NFκB and EMT. <b>Conclusions</b>: C19MC induces changes in HCC that are consistent with stemness and aggression, which provides a better understanding of why C19MC could be a biomarker of poor prognosis.

Research Square 2025-10-29 Preprint (No Snippets API) Griffioen G, Hildalgo N, Sorjonen K, Andersson M, Tangen Ä, Chin L, Lundberg J, Halldin C, Bölte S, Borg J.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> Currently, we lack a clear understanding of the biological mechanisms underlying the different symptom domains of autism, and no approved pharmacological treatments are available. Autism is defined by social communication (SC) difficulties and non-social symptoms, including inflexible, repetitive and restrictive behaviours (RRB) and sensory reactivity. These symptom domains might disperse different biological constructs. Understanding the distinct biological underpinnings of autism symptoms is essential for advancing targeted, precision-based treatments. In our previous work we found correlations between social cognition and serotonin transporter (5-HTT) availability, and here we study other symptom domains in relation to 5-HTT availability in the brain. <bold>Results</bold> Fifteen participants diagnosed with autism and fourteen matched control subjects underwent positron emission tomography (PET) with the radioligand [ <sup>11</sup> C]MADAM which binds to 5-HTT. 5-HTT availability did not correlate to any of our RRB-related measures of behavioural flexibility (cognitive tests (Delis-Kaplan Executive Function System verbal fluency and the Tower) and self-rating scales (Social Social Responsiveness Scale and Autism Spectrum Quotient subscales), and our behavioural flexibility index based on three personality tests). However, in a smaller subsample, we found negative correlations between sensory reactivity (as measured by Sensory Reactivity Test in the Autism Spectrum scale) and 5-HTT binding in most cortical brain regions. <bold>Conclusions</bold> 5-HTT may be less important for RRBs than for SC and sensory symptoms. Further studies investigating the biology of distinct autism symptoms are warranted to aid the development of precision medicine. </p>

bioRxiv 2025-10-29 Preprint (No Snippets API) Kövér B, Willis TL, Sherwin O, Kaufman-Cook J, Kemkem Y, Vazquez Segoviano M, Lodge EJ, Zamojski M, Mendelev N, Zhang Z, Smith GR, Bernard DJ, Lu H, Sealfon SC, Ruf-Zamojski F, Andoniadou CL.
Show Full Abstract

<h4>Summary</h4> Previous single-cell profiling studies of the pituitary gland have yielded minimally reproducible insights largely due to their low statistical power and methodological inconsistencies. To address this problem, we generated a uniformly pre-processed Consensus Pituitary Atlas (CPA) using all existing mouse pituitary single-cell datasets (267 biological replicates, >1.1 million high-quality cells). The CPA revealed novel cell typing and lineage markers, including low-expression transcripts that previous analyses could not detect. The scale of the CPA enabled the development of machine learning models to automate and standardize cell type annotation and doublet identification for future studies. Leveraging the curated metadata, we identified sex-biased and age-dependent gene expression patterns at cell type resolution. To identify drivers of cell fates, first we determined consensus cell communication patterns. Secondly, we used RNA-sequencing and chromatin accessibility data to identify transcription factors associated with cell fates across modalities. The epitome platform acts as an interface with the CPA, allowing streamlined user-friendly analyses. <h4>Highlights</h4> Uniform processing of 267 mouse pituitary single-cell datasets (>1.1M cells) The statistical power enabled cell type, sex- and age-specific marker discovery Machine learning models facilitate doublet detection and cell typing in new datasets epitome platform provides programming-free data access and visualizations

DCC
Also flagged:synaptogenesisgap junctionsshakinginnexingap junctionFrazzled receptor
Journal Article 2025-10-28 ✓ 5 Snippets Lopez J, Boerner J, Robbins K, Pena RFO, Murphey R.
In-Text Gene Mentions

…ss-of-function (LOF) Frazzled/DCCmutants disrupt synaptogenesis…

…Frazzled/DCCRegulates Gap Junction…

…broadly known as Frazzled/DCC( Hedgecock et…

…its human homologs,DCCand neogenin (…

…its vertebrate homologsDCCand neogenin are…

Show Full Abstract

Loss-of-function (LOF) Frazzled/DCC mutants disrupt synaptogenesis in the Giant Fiber (GF) System of <i>Drosophila</i> We observed weaker physiology in LOF male and female specimens, characterized by longer latencies and reduced response frequencies between the GFs and the motor neurons. These physiological phenotypes are linked to a loss of gap junctions in the GFs, specifically the loss of the shaking-B(neural+16) isoform of innexin in the presynaptic terminal. We present evidence of Frazzled's role in gap junction regulation by utilizing the UAS-GAL4 system in <i>Drosophila</i> to rescue mutant phenotypes. Expression of various UAS-Frazzled constructs in a Frazzled LOF background was used to dissect the role of different parts of the Frazzled receptor in the assembly of electrical synapses. Expressing Frazzled's intracellular domain in Frazzled LOF mutants rescued axon pathfinding and synaptogenesis. This is supported by the complementary result that Frazzled fails to rescue synaptic function when the transcriptional activation domain is disrupted, as shown by the deletion of the highly conserved intracellular P3 domain or by a construct with a point mutation in the highly conserved P3 domain known to be required for transcriptional activation. A computational model clarifies the role of gap junctions and the function of the GF System. The present work shows how various domains of a guidance molecule regulate synaptogenesis through the regulation of synaptic components.

HTT
Also flagged:tumor suppressor proteindeubiquitinasemalignant mesotheliomauveal melanomaThioflavin Tbinding
Journal Article 2025-10-28 ✓ 1 Snippet Hsiao LC, Puri S, Sriramoju MK, Wang YS, Lee TN, Wang LH, Hsu SD.
In-Text Gene Mentions

…in p53, huntingtin (Htt) proteins, ataxin‐3, and…

Show Full Abstract

BRCA1-associated protein-1 (BAP1) is a tumor suppressor protein that regulates DNA transcription through its deubiquitinase activity. Cancer-associated missense mutations within its ubiquitin C-terminal hydrolase (UCH) domain result in structural destabilization and aggregation, contributing to various malignancies such as malignant mesothelioma and uveal melanoma. In this study, we investigated the aggregation mechanisms of highly destabilized BAP1-UCH variants, including N78S, C91W, F81V, and G128R, using Thioflavin T (ThT) binding assays and AmyloFit analysis. Our results reveal that all BAP1-UCH variants follow a secondary nucleation-dominated aggregation model, exhibiting strong concentration dependence and significantly higher aggregation rates, which may be responsible for their impaired nuclear import, leading to increased cytosolic retention. These findings provide critical insights into how specific mutations in BAP1 drive aggregation and compromise its tumor-suppressing functions inside the nucleus, thereby contributing to cancer progression.

HFE
Also flagged:BRCA1BRCA2hereditary breast and ovarian cancer syndromeMUTYHhereditary hemochromatosisas
Journal Article 2025-10-28 ✓ 1 Snippet O'Daniel JM, Kobelka C, Foss K, Foreman AKM, Milko LV.
In-Text Gene Mentions

HFE

Show Full Abstract

AbstractDirect-to-consumer genetic testing has become increasingly popular, offering individuals easy access to genetic data without the involvement of health care professionals. However, as availability grows, clinicians face challenges in interpreting and integrating this information into clinical care. This review provides insights for health professionals about the evolving landscape of direct-to-consumer genetic testing, with a focus on test offerings, limitations, challenges, and ethical concerns. It also highlights issues that can arise with direct-to-consumer genetic testing in the pediatric setting. Clinicians can play a pivotal role in guiding patients and families through the complexities of direct-to-consumer genetic testing, ensuring that decisions are informed and risks are minimized.

Also flagged:tumorgynecological cancersblock copolymersmethacrylic aciddiethylene glycol5-fluorouracil
Journal Article 2025-10-28 No Snippets Nunziata G, Limiti E, Aramini D, Nava M, Moretti L, Rainer A, Sponchioni M, Rossi F.
Show Full Abstract

The development of smart nanocarriers capable of responding to tumor-specific stimuli represents a promising strategy for improving therapeutic selectivity in oncology. In this work, we present a class of dual-responsive polymeric nanoparticles (NPs) engineered for precision drug delivery in gynecological cancers. Amphiphilic block copolymers of the type P(MAA)-<i>b</i>-P(EG<sub>2</sub>MA-<i>co</i>-NIPAM) integrating pH-responsive methacrylic acid (MAA) and thermoresponsive diethylene glycol methyl ether methacrylate (EG<sub>2</sub>MA) and <i>N</i>-isopropylacrylamide (NIPAM) units were synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization. Fine-tuning of the lower critical solution temperature (LCST) was achieved by modulating the ratio between NIPAM and EG<sub>2</sub>MA, yielding copolymers with cloud points within the physiologically relevant range of 30-40 °C. The resulting NPs exhibited sharp and reversible swelling/shrinking behavior in response to pH and temperature stimuli, with sizes below 182 nm and narrow polydispersity indexes. The core-shell architecture was stabilized by a dodecyl-functionalized chain transfer agent, ensuring efficient self-assembly and robust encapsulation of both hydrophilic and hydrophobic drugs. Drug release studies with 5-fluorouracil (5-FU) and the drug-mimetic fluorescein isothiocyanate (FITC) confirmed a marked temperature-triggered release above the LCST and enhanced diffusion in mildly acidic conditions (pH < 6), characteristic of solid tumors. Cellular studies on HeLa and ovarian adenocarcinoma OVCA433 lines revealed rapid internalization, high biocompatibility, and a significant increase in therapeutic efficacy of 5-FU when delivered via NPs, compared to the free drug. These findings highlight the potential of the dual-responsive nanoplatform for targeted and controlled delivery in the treatment of cervical and ovarian cancers.

HTT
Also flagged:neurodegenerative disorderHDbehavioralsegmentationHuntington's diseaseHuntingtin
Journal Article 2025-10-28 ✓ 5 Snippets Nateghi B, Lala Bouali M, Bouredji Z, Argaw A, Jayash SN, Farquharson C, Frenette J, Hébert SS.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene, located on…

…tract in theHTTprotein.…

…of the mutantHTTprotein (mHTT), forming…

…the role ofHTTin the brain,…

…of the mutantHTTgene.…

Show Full Abstract

<b>Background</b>: Huntington's disease (HD) is a progressive neurodegenerative disorder primarily affecting the central nervous system (CNS). However, emerging evidence suggests that peripheral tissues, including skeletal muscle and bone, also undergo pathological changes contributing to disease burden. <b>Objective</b>: To characterize musculoskeletal impairments in the zQ175 knock-in (KI) mouse model of HD, through integrated behavioral, biomechanical, and imaging analyses. <b>Methods</b>: Motor function was assessed using grip strength, rotarod, and open field testing. <i>Ex vivo</i> contractility of the extensor digitorum longus (EDL) and Soleus (Sol) muscles was measured. Muscle fiber cross-sectional area (CSA) was quantified using semi-automated segmentation. Bone microarchitecture was analyzed using high-resolution micro-computed tomography (μCT). <b>Results</b>: Six-month-old homozygous zQ175 mice exhibited significantly reduced muscle strength and impaired contractile properties in both the EDL and Soleus muscles compared to wild-type (WT) controls. µCT analysis revealed decreased trabecular bone volume and alterations in bone structure. <b>Conclusions</b>: These findings provide a comprehensive musculoskeletal phenotyping of zQ175 mice, revealing early-onset muscle atrophy and skeletal fragility. Our study highlights the importance of targeting peripheral manifestations in HD and establishes zQ175 KI mice as a valuable additional model for investigating systemic disease mechanisms.

Also flagged:LRRK2synapsedopaminedeathPDLeucine-Rich Repeat Kinase 2
Journal Article 2025-10-28 No Snippets Masotti B, Tombesi G, Parisiadou L, Greggio E.
Show Full Abstract

Parkinson's disease (PD) is a multisystem disorder presenting motor and non-motor symptoms. Motor dysfunction is the most debilitating, caused by the degeneration of dopamine-producing neurons. Increasing evidence indicates that synapse demise occurs years before neuronal death. Yet, the early synaptic dysfunctions in PD remain poorly understood. Leucine-Rich Repeat Kinase 2 (LRRK2), a serine/threonine kinase and GTPase relevant for both familial and sporadic forms of PD, has been increasingly associated with synaptic processes. These include the phosphorylation of key synaptic proteins and interactions with cytoskeletal components. Brain-derived neurotrophic factor (BDNF) and glial-derived neurotrophic factor (GDNF) are fundamental for synapse maturation, maintenance, and plasticity. Recent findings indicate that neurotrophic signaling is impaired in PD. In this review, we critically discuss the significance of identifying and clarifying the early molecular events leading to synaptic dysfunction in PD. We examine how mutant LRRK2 affects these processes and the relationship between LRRK2 and BDNF signaling from both mechanistic and therapeutic perspectives.

TRIM38
Also flagged:TBPL1breast cancerCas9deathcancerTATA-box binding protein
Journal Article 2025-10-28 ✓ 1 Snippet Mishal R, Meléndez-Zajgla J, Rueda-Zarazúa B, Labra-Barrios ML, Castañón-Sánchez CA, Uribe Carvajal S, Padierna-Mota L, Hernández-Hernández JM, Leon-Avila G, Pérez Rangel A, Hernández-Martínez E, Angeles-Morales EB, Albalawi IK, Luna-Arias JP.
In-Text Gene Mentions

…MIR210HG , andTRIM38.…

Show Full Abstract

Breast cancer is the leading cause of death among women globally. Several genes have been found to be transcriptionally dysregulated in cancer, according to recent studies. TATA-box binding protein (TBP) and its two paralogs, TBPL1 and TBPL2, play roles in human transcription. The TBPL1 gene is implicated in colorectal carcinomas by suppressing the expression of miR-18a. However, its function in breast cancer remains undisclosed. TBPL1 is distantly related to TBP and possesses a 40% similarity with TBP's core domain. In the present study, we explored the potential role of the TBPL1 gene in transcriptome regulation by knocking out the TBPL1 gene through the CRISPR/Cas9 method. Following the knockout of the TBPL1 gene, we examined the gene transcription patterns and compared them to wild-type cell lines. We observed disparate signatures of upregulated and downregulated genes in wild-type and mutated conditions. Healthy breast MCF-12F, and T47D, SKBR3, and MDA-MB-231 breast cancer cell lines were assessed, as these cancer cells exhibit overexpression of the TBPL1 gene. Next-generation sequencing data revealed distinct marker genes regulated by the TBPL1 gene and their potential involvement in cell migration, proliferation, anti-apoptosis, and metastasis. Additionally, we also discovered novel lncRNAs implicated in the transcriptome analysis of the TBPL1 knocked-out gene. Our investigation indicated that this gene might affect varied stages of breast cancer cell lines' cellular properties, such as cell duplication, morphology, and growth. It might also contribute to tumor formation in more aggressive cell lines like MDA-MB-231 in vivo.

SERPINC1
Also flagged:amlodipinehypertensiondementiaatenololcoagulationYKL-40
Journal Article 2025-10-28 ✓ 2 Snippets Smets NG, Tijms BM, de Vos J, Piersma SR, Pham TV, Jiménez CR, Bakker ENTP, Naessens DMP.
In-Text Gene Mentions

…SERPINA3L, SERPINA6, andSERPINC1were all diminished…

SERPINC1, or antithrombin III,…

Show Full Abstract

Midlife hypertension has been identified as a risk factor for the development of dementia, however, the underlying mechanism of this correlation remains unclear. In this study, we analyzed cerebrospinal fluid (CSF) samples from spontaneously hypertensive rats (SHR) that had been treated with either amlodipine or atenolol for one year and compared these to normotensive Wistar Kyoto rats (WKY). Mass spectrometry-based proteomic analysis of the CSF samples was conducted to identify both the impact of hypertension as well as antihypertensive treatment on CSF proteomics. Both systolic and diastolic blood pressure were increased in hypertensive rats, and both medications lowered blood pressure compared to untreated SHR rats. The analysis of the CSF proteome revealed that hypertension resulted in alterations to processes associated with the development of the central nervous system, inflammation and blood coagulation. The latter included proteins such as YKL-40, KNG1, DAG1, and members of the Serpin family. Amlodipine treatment resulted in changes to proteins involved in gas transport (including CA2, HBB, and HBA1), whereas atenolol treatment led to changes in the complement and coagulation cascade (including CFH, KNG1, APOE, and AHSG). A comparison of the two antihypertensive treatments revealed alterations in pathways associated with cell adhesion, central nervous system development, and vascular development. These findings show that hypertension and long-term treatment with antihypertensive medications elicit distinct effects on the CSF proteome.

Also flagged:genetic diseasesamino acidIGF1RLHCGRTAC3Rsexual precocity
Journal Article 2025-10-28 No Snippets Marcuzzi O, Calcaterra F, Olivera LH, Arizmendi A, Henry MRJM, Cardoso DC, Echeverri AML, Liron JP, Fernández ME, Andrade de Oliveira DA, Giovambattista G.
Show Full Abstract

The combined use of NGS technologies with bioinformatics tools has significantly advanced research by enabling comprehensive analyses of entire genomes, specific genomic regions of interest, and transcriptomes. Targeted NGS methods, which focus on smaller genome fractions, are widely used to study genetic diseases, epigenetic modifications, microbiomes, and environmental DNA, among other applications. This study aimed to develop a roadmap for detecting and selecting polymorphisms in candidate genes by integrating amplicon NGS-Target techniques with bioinformatics analyses. Sixty-eight genes associated with the hypothalamic-pituitary-gonadal (HPG) axis were selected to develop the amplicon NGS assay, comprising 730 regions that cover a total of 136,274 bp. This method was used to sequence 75 Guzerat cattle, a dual-purpose breed from Brazil, renowned for their high rusticity and adaptability. This Zebu cattle exhibit certain limitations, such as delayed puberty onset, which can reduce reproductive efficiency. Using the GATK protocol a total of 2,600 SNPs and 1,615 indels were detected. A series of consecutive filtering steps (maf, the detection of non-synonymous substitution, phylogenetic amino acid conservation, and biochemical properties) were used, resulting in a subset of 30 candidate SNPs. Then, these polymorphisms were analysed using bioinformatic tools (SIFT, PANTHER, PolyPhen2, and MutPred), identifying 5 SNPs with high effect on the protein. Their structure and stability were estimated using AlphaFold and DDMut. Finally, 3 candidate polymorphisms (IGF1R, LHCGR, TAC3R) with potentially significant effects on the protein remained to be validated through dynamic simulations or in vitro and in vivo experimental assays.

CA10
Also flagged:VSX2retinal degenerative diseasesenhanced green fluorescent proteinTNFRSF1Bretinal disordersblindness
Journal Article 2025-10-28 ✓ 1 Snippet Zheng D, Wang Y, Guan Y, Xu P, Xie B, Gao G, Yu X, Peng F, Xiang M, Zhong X.
In-Text Gene Mentions

…, VSX1 ,CA10, and GRIK1…

Show Full Abstract

<h4>Background</h4>The lack of understanding of the molecular and cellular characteristics of human retinal progenitor cells (RPCs) has hindered their application in cell therapy for retinal degenerative diseases. This study aims to employ retinal organoids (ROs) derived from a VSX2-enhanced green fluorescent protein (eGFP) reporter human induced pluripotent stem cell (hiPSC) line for positive selection of human RPCs, investigate their features, and facilitate their applications.<h4>Methods</h4>hiPSCs were differentiated into three-dimensional ROs following established protocols. The fidelity of the VSX2-eGFP reporter was confirmed through immunostaining. Fluorescence-activated cell sorting was employed to select VSX2-eGFP-positive (+) cells at distinct developmental stages, followed by bulk RNA sequencing (RNA-seq) analysis to assess their transcriptome profile. Immunostaining and flow cytometry were utilized to validate the identity of VSX2-eGFP+ cells and potential cluster of differentiation (CD) biomarkers for identifying human RPCs.<h4>Results</h4>hiPSCs were successfully differentiated into ROs containing abundant RPCs. The spatiotemporal activity of the VSX2-eGFP reporter recapitulated the dynamic expression of endogenous VSX2 protein. Compared to VSX2-eGFP-negative (-) cells, VSX2-eGFP+ cells mainly exhibited characteristics of RPCs at early stages of retinal development and of bipolar cells at late stages. RNA-seq analysis revealed transcriptional heterogeneity within VSX2-eGFP+ cells across four distinct developmental stages. Moreover, the dynamic expression of 394 known CD biomarkers in VSX2-eGFP+ cells at distinct developmental stages was analyzed herein for the first time. One CD biomarker, TNFRSF1B, which has never been reported to be expressed in RPCs, was found to be highly expressed in RPCs at the early stages and might serve as a candidate CD biomarker for sorting RPCs.<h4>Conclusions</h4>This study provides valuable insights into the molecular and cellular characteristics of human RPCs, especially their expression profiles of CD biomarkers, laying a foundation for research on retinal development and the clinical translation of hiPSC-derived RPCs.

Also flagged:proteasevesicular diseasechymotrypsindegradation3Cimmune responses
Journal Article 2025-10-28 No Snippets Zhou H, Wang M, Xin Z, Li Y, Liu F.
Show Full Abstract

Senecavirus A (SVA) is an emerging virus, classified into the family <i>Picornaviridae</i>. It causes a severe vesicular disease in pigs. SVA 3C protein, a nonstructural protein, in itself is a protease (3C<sup>pro</sup>), harboring the typical chymotrypsin-like fold with an S1 subsite. As a protease, 3C<sup>pro</sup> plays a dual role in the replicative cycle of SVA. On the one hand, 3C<sup>pro</sup> cleaves the viral polyprotein stepwise to generate different proteins. On the other hand, 3C<sup>pro</sup> can specifically degrade a variety of host factors. The degradation of host factors may impair one or even more signaling pathways, making SVA not only efficiently propagate in cells but also ingeniously evade the host's immune responses. Herein, we systematically reviewed SVA 3C<sup>pro</sup> involved in its structural characteristics, enzymatic properties, and more importantly its functions in cleaving the viral polyprotein and host proteins, aiming to provide a theoretical insight into the development of SVA-related antivirals.

Also flagged:bindingergosterolmembranerimocidin Afungal diseasessoil-borne diseases
Journal Article 2025-10-28 No Snippets Nguyen HTT, Nguyen LTT, Park AR, Nguyen VT, Dang QL, Kim JC.
Show Full Abstract

<i>Fusarium oxysporum</i> f. sp. <i>cucumerinum</i>, the causal agent of cucumber fusarium wilt, along with <i>Rhizoctonia solani</i> AG-4 and <i>Pythium ultimum</i>-that causes cucumber damping-off-are soil-borne fungal and Oomycetes pathogens responsible for significant economic losses in agriculture. In this study, the culture filtrate of <i>Streptomyces</i> sp. JCK-6116, isolated from soil, exhibited strong inhibitory activity against the mycelial growth of multiple phytopathogenic fungi in a 96-well microtiter plate assay. In the dual culture assay, JCK-6116 inhibited the growth of 20 species of plant pathogenic fungi and Oomycetes, suggesting a wide antifungal spectrum. Three active compounds-rimocidin A, B, and C-were isolated from JCK-6116 and identified. These rimocidins exhibited antifungal effects against fungi by binding to ergosterol in the fungal membrane. However, none of the compounds exhibited anti-oomycete activity against the tested Oomycetes strains. Among the three compounds, rimocidin A demonstrated the strongest antifungal activity with minimum inhibitory concentration values ranging from 1.25-10 μg/ml. Furthermore, the culture broth of JCK-6116, at 10-fold dilution, effectively suppressed fusarium wilt and the two damping-off diseases in cucumber. Its butanol extract was also effective against the two fungal diseases but showed no activity against <i>P. ultimum</i> damping-off disease. These findings indicate that the culture broth contains metabolites with anti-oomycete activity. This study demonstrates that <i>Streptomyces</i> sp. JCK-6116 has significant potential as a biological control agent for managing soil-borne diseases caused by fungi and Oomycetes.

PRDX6
Also flagged:Ischemic Strokestrokesecretionneurogenesiswound healingExtracellular
Journal Article 2025-10-28 ✓ 2 Snippets Chang C, Wang Y, Liang X, Wang R, Bao X.
In-Text Gene Mentions

…(Park7), peroxiredoxin 6 (Prdx6), Jun proto‐oncogene (Jun),…

…Additionally, Park7,Prdx6, and Jun in…

Show Full Abstract

Extracellular vesicles (EVs) can cross the blood-brain barrier and enter the systemic circulation, potentially acting as peripheral biomarkers of stroke neuropathology. Here, we investigated alterations in EV RNA cargoes extracted from rat brain and plasma before and after stroke induction via middle cerebral artery occlusion and subsequent human neural stem cells (hNSCs) transplantation. EV RNA coexpression profiles were assessed, and digital source tracking was used to determine EV origin. The therapeutic effects of intra-arterial delivery of hNSCs on ischemic rat brains were quantified, focusing on functional recovery, resolution of ischemic lesions, and the microenvironment. Stroke induced distinct EV secretion patterns, with a notable increase in EV secretion from non-neuronal cells. hNSCs transplantation caused minimal immune rejection and transplanted cells survived in the brain for over a week. Stem cell-derived EVs were detected in peripheral blood, indicating prolonged systemic distribution after transplantation. Gene regulatory network analyses identified specific EV miRNAs that play crucial roles in neurogenesis, wound healing, angiogenesis, and blood-brain barrier integrity. An integrated analysis of EV RNAs in brain and plasma samples revealed that stroke increased correlations in RNA expression between brain and plasma and that hNSCs transplantation reversed the effect. Brain- and plasma-derived EVs carry similar molecular information after stroke, suggesting that plasma-derived EV RNAs reflect stroke pathophysiology. Intra-arterial transplantation of hNSCs improved outcomes after stroke in rats, by promoting endogenous neurogenesis and maintaining blood-brain barrier integrity. The identified EV miRNAs provided a new mechanism by which hNSCs transplantation regulates neural regeneration through the miR-204-5p/EFNB3 axis.

Also flagged:Thyroid CancerPathogenesisendocrine malignancydifferentiated thyroid carcinomasanaplastic thyroid cancercancer
Journal Article 2025-10-28 No Snippets Li YD, Ye QY, Chen YX, Hu XR.
Show Full Abstract

Thyroid cancer is the most common endocrine malignancy, with incidence rising steadily worldwide. Although most cases are differentiated thyroid carcinomas with excellent prognosis, a small subset, such as anaplastic thyroid cancer, demonstrates aggressive behavior and poor survival outcomes. Recent decades have witnessed a transformation in thyroid cancer diagnostics and management, driven by improvements in high-resolution ultrasound, fine-needle aspiration biopsy, molecular profiling, and standardized risk stratification systems such as the Thyroid Imaging Reporting and Data System. Despite these advances, overdiagnosis and overtreatment remain key clinical challenges. Accurate risk stratification and management strategies are critical, especially for distinguishing indolent nodules from aggressive subtypes. This review provides a comprehensive overview of thyroid cancer pathogenesis, clinicopathological classification, diagnostic approaches, and evolving therapeutic strategies, ranging from active surveillance to targeted and immunotherapy-based treatments. By integrating molecular diagnostics with conventional parameters, the article underscores how precision medicine can reduce treatment burden, improve outcomes, and guide personalized care. This review offers valuable insight into the biological complexity of thyroid cancer and highlights the need for continued refinement of diagnostic criteria and therapeutic frameworks in clinical practice.

HTT
Also flagged:executive dysfunctionepisodic memory impairmentmemory deficitsmemory impairmentsHDneurofilament light chain
Journal Article 2025-10-28 ✓ 1 Snippet Martinez-Horta S, Quevedo-García A, Puig-Davi A, Sampedro F, Oltra-Cucarella J, Pérez-Pérez J, Franch-Martí C, Olmedo-Saura G, Rivas-Asensio E, Vazquez-Oliver A, Pérez-Carasol L, Horta-Barba A, Pagonabarraga J, Kulisevsky J.
In-Text Gene Mentions

…1 of theHTTgene on chromosome…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is primarily associated with executive dysfunction, but episodic memory impairment is also present. Traditionally, these memory deficits have been attributed to retrieval difficulties linked to fronto-striatal dysfunction, rather than to disruptions in encoding or consolidation processes. However, the specific nature and diversity of memory impairments in HD remain underexplored.<h4>Objective</h4>To characterize the profile of episodic memory impairment in HD, identify distinct cognitive phenotypes, and examine their clinical, neuroanatomical, and biomarker correlates.<h4>Methods</h4>We assessed episodic memory in HD patients and healthy controls using the Free and Cued Selective Reminding Test (FCSRT), complemented by Item-Specific Deficit Approach (ISDA) indices to quantify encoding, consolidation, and retrieval deficits. Structural MRI was used to identify gray matter volume correlates, and plasma neurofilament light chain (NfL) was measured as a marker of neuroaxonal injury.<h4>Results</h4>Compared to controls, HD patients showed marked impairments in free recall with preserved cued recall, suggesting predominant retrieval deficits. However, nearly one-third of patients exhibited global impairments across all FCSRT components, mainly driven by consolidation deficits consistent with medial temporal lobe dysfunction. This subgroup also showed worse cognitive and functional performance and significant atrophy in the hippocampus, entorhinal cortex, and parahippocampal gyrus.<h4>Conclusion</h4>Episodic memory dysfunction in HD is heterogeneous and includes both retrieval-related and consolidation-driven profiles. These profiles reflect distinct neurodegenerative patterns, emphasizing the importance of cognitive subtyping for improving clinical characterization and biomarker development in HD.

Also flagged:NLRP3Depressioncardiovascular diseaseCVDinflammatory responsespathogenesis
Journal Article 2025-10-28 No Snippets Chen C, Zhang S, Sheng M, Shao W.
Show Full Abstract

Depression and cardiovascular disease (CVD) frequently coexist, significantly impacting patient prognosis and quality of life. Research indicates that inflammatory responses play a crucial role in the pathogenesis of both conditions. The NLRP3 inflammasome, a key inflammatory signaling platform of the innate immune system, mediates the maturation and release of IL-1β and IL-18 and induces pyroptosis, playing a significant role in both depression and CVD. To explore the mechanisms and therapeutic potential of the NLRP3 inflammasome in the comorbidity of depression and CVD, we systematically reviewed recent literature. Our focus was on its activation pathways, expression changes in animal models and clinical samples, and intervention studies. The results indicate that NLRP3 inflammasome is persistently activated in patients with both depression and CVD, and this activation correlates with disease severity. Furthermore, various pharmaceutical drugs and natural compounds have demonstrated synergistic effects by inhibiting the NLRP3 inflammasome pathway. In conclusion, the NLRP3 inflammasome represents a critical molecular mechanism linking depression and CVD, as well as a potential target for combined therapeutic strategies. This area holds significant research and clinical translational value.

PRDX6
Also flagged:Dsuppathogenesisoxygendeathdamage suppressor proteinDNA-binding protein
Journal Article 2025-10-28 ✓ 4 Snippets Shaba E, Ricci C, Vantaggiato L, Paolocci MF, Regoli T, Miedviedieva K, Brunetti J, Ciccone V, Cecchin C, Donnini S, Marzocchi C, Landi C, Cantara S.
In-Text Gene Mentions

…PRDX1, PRDX3, andPRDX6, reflecting a regulation…

…(PRDX1, 3, andPRDX6).…

…the other hand,PRDX6assists in repairing…

…of PRDX1 andPRDX6.…

Show Full Abstract

Ischemia/reperfusion injury (IRI) is a common damage due to the restoration of blood flow following an ischemic injury. Its pathogenesis is mainly linked to the production of reactive oxygen species (ROS), which sustain cell damage and promote cell death. The tardigrade damage suppressor protein (Dsup) is a DNA-binding protein that enables tardigrades to tolerate stress conditions, including oxidative stress. We investigated the ability of the Dsup to protect human cells from IRI, using an in vitro model of hypoxia and reoxygenation. We exposed HEK293TT cells transfected with the Dsup to hypoxic injury and analyzed cell viability, oxidative stress, expression of antioxidant proteins using functional assays, and a proteomic approach to dissect the molecular mechanisms modulated by the Dsup. Dsup expression significantly enhanced cell survival following hypoxia-reoxygenation and markedly reduced intracellular ROS levels. Proteomic and Western blot analyses revealed a significant upregulation of antioxidant enzymes in Dsup-expressing cells. Furthermore, the Dsup modulated autophagy and key stress-related pathways, including the MAPK cascade. This study demonstrates that the Dsup protects human cells from IRI by reducing oxidative stress and modulating key cytoprotective pathways. Our results establish the Dsup as a promising candidate for future therapeutic applications against IRI, meriting further exploration in in vivo models.

Also flagged:amino acidglutamineasparagineserineglycineamyloid proteins
Journal Article 2025-10-28 No Snippets Galkin AP, Mitkevich VA, Makarov AA, Valina AA, Sysoev EI.
Show Full Abstract

In recent years, amyloid proteins that perform vital functions in the brain have been characterized. The question of why some amyloids are neurotoxic while others are harmless remains open. Here, we provide a brief overview of pathological and functional brain amyloids and present a comparative analysis of their amino acid sequences based on the percentage of hydrophobic and charged residues, as well as their enrichment in glutamine, asparagine, serine, and glycine. We demonstrate that pathological and functional brain amyloid proteins, along with their amyloidogenic fragments, do not differ in amino acid composition, contrary to previous assumptions. The ability of an amyloid to cause toxicity can instead be explained by the concept of "available targets". Evidence from studies of pathological amyloids demonstrate that their toxicity is determined not only by a loss of function but also by aberrant interactions with specific targets, such as PrP<sup>C</sup> or mitochondrial membranes. Binding to these targets triggers pathological cascades that ultimately lead to cell death. In contrast, such targets are inaccessible to functional amyloids, either because of localized translation and protein sequestration within specialized cellular structures, or because their interactions with physiological partners prevent binding to dangerous targets.

MLLT10
Also flagged:oncogenesacute leukemiaacute myeloid leukemiaAMLB-lymphoblastic leukemiaALL
Journal Article 2025-10-28 ✓ 1 Snippet Ok CY, Tang G, Loghavi S, Hu S, Wei Q, Quesada AE, Routbort MJ, Kanagal-Shamanna R, Yin CC, Sarami I, Garces S, Agarwal NK, Luthra R, Fang H, Jelloul FZ, Bryan J, Medeiros LJ, Patel KP, Toruner GA.
In-Text Gene Mentions

…MEF2D , andMLLT10, were concordant…

Show Full Abstract

<b>Background/Objectives:</b> Gene rearrangements involving oncogenes are major drivers in acute leukemia, influencing disease classification, prognosis, and therapeutic decision-making. Targeted RNA sequencing (RNA-Seq) panels capable of detecting intergenic and intragenic fusions across multiple genes are increasingly used in diagnostic settings. However, comparative evaluation with orthogonal technologies remains limited. <b>Material and Methods</b>: We compared the performance of a 108-gene anchored multiplex PCR (AMP)-based RNA-Seq panel with that of Optical Genome Mapping (OGM) in 467 acute leukemia cases. The cohort included 360 cases of acute myeloid leukemia (AML), 89 B-lymphoblastic leukemia (B-ALL), 12 T-lymphoblastic leukemia (T-ALL), and 6 cases of mixed phenotype acute leukemia (MPAL). <b>Results:</b> Results of both methods were concordant in 175 (74.7%) of 234 detected gene/rearrangement fusions. The concordance rate varied significantly across different leukemia types, ranging from 80.2% in B-ALL to 41.7% in T-ALL (<i>p</i> < 0.001) OGM uniquely detected 37 of 234 (15.8%) clinically relevant rearrangements, whereas RNA-Seq exclusively identified 22 of 234 (9.4%). Enhancer-hijacking lesions, including <i>MECOM</i> and <i>BCL11B</i> rearrangements, <i>CDK6::MNX1</i>, and <i>IGH</i> rearrangements, had a markedly lower concordance (20.6%) compared with all other aberrations (93.1%) (<i>p</i> < 0.001). Conversely, some gene fusions arising from intrachromosomal deletions were interpreted by OGM as simple deletions rather than rearrangements or fusions. <b>Conclusions:</b> Targeted RNA-Seq was effective for detecting chimeric fusion transcripts and showed slightly better performance in identifying fusions resulting from deletions. However, OGM was effective for detecting enhancer-hijacking events that do not generate fusion transcripts. Both methods are complementary for the workup of acute leukemia cases.

Also flagged:Zincmetabolic disorderobesitytranslationalinsulin resistancelipid
Journal Article 2025-10-28 No Snippets Taslim NA, Graciela AM, Harbuwono DS, Syauki AY, Anthony AN, Ashari N, Aman AM, Tjandrawinata RR, Hardinsyah H, Bukhari A, Nurkolis F.
Show Full Abstract

<b>Background</b>: Obesity is a multifactorial metabolic disorder influenced not only by excessive caloric intake but also by micronutrient imbalances such as zinc deficiency. Emerging evidence suggests that zinc regulates microRNA (miRNA) biogenesis and expression, linking nutritional status to metabolic regulation. <b>Objective</b>: This review delineates the molecular interplay between zinc and miRNAs in obesity, emphasizing the mechanistic, clinical, and translational relevance of zinc-sensitive miRNAs in adipogenesis, insulin resistance, inflammation, and oxidative stress. <b>Results</b>: Zinc deficiency alters miRNA expression profiles associated with metabolic dysregulation. Key miRNAs-miR-21, miR-34a, miR-122, and miR-144-3p-are consistently modulated by zinc status, influencing inflammation, lipid metabolism, and insulin signaling. Zinc repletion restores several miRNAs (e.g., miR-10b, miR-155, miR-145), suggesting reversibility, while excessive zinc may upregulate miR-144-3p and exacerbate oxidative stress. Circulating and exosomal miRNAs show promise as dynamic biomarkers for zinc intervention efficacy. <b>Methods</b>: A literature search was performed in 4 databases up to August 2025 using keywords related to zinc, miRNAs, and obesity. Eligible studies included both preclinical and human research evaluating zinc status or supplementation and miRNA expression in metabolic contexts. <b>Conclusion</b>: Maintaining optimal zinc levels may normalize miRNA expression and improve insulin sensitivity. The "zinc-miRNA axis" represents a novel frontier for precision nutrition in obesity management.

HFE
Also flagged:Ammoniumironmetabolismnitratenitrogenous compoundscarbohydrate
Journal Article 2025-10-28 ✓ 5 Snippets Versola JJN, Reich HG, Rodriguez IB.
In-Text Gene Mentions

…Separate samples of about 10 million Symbiodiniaceae cells were collected for each late exponential phases per treatment (day 16 for HFe treatments and day 18 for LFe treatments of S. microadriaticum , and; day 14 forHFetreatments and day 16 for LFe treatments of C. goreaui ).…

HFeconditions reflect species-specific physiological responses to nutrient availability ( Supplementary Table S3 ).…

…Across all treatments, Fe availability played a critical role in influencing growth rates, with both species exhibiting significantly higher growth rates underHFeconditions compared to LFe conditions ( p < 2 × 10 −16 , 3-way ANOVA).…

…In S. microadriaticum , the highest growth rates were observed inHFeconditions, confirming the positive role of Fe in supporting cellular growth ( Table 1 ).…

…Notably, under NH 4 + -rich conditions, growth rates in LFe conditions were comparable to those observed inHFeconditions, suggesting that NH 4 + supplementation partially alleviated the effects of Fe limitation in S. microadriaticum .…

Show Full Abstract

Nutrient exchanges promote the success of symbioses among reef-building corals, endosymbiotic dinoflagellates (Family: Symbiodiniaceae), and their microbial symbionts. Nutrient dynamics has considerable implications on the metabolism and proliferation of the coral holobiont, with nutrient limitation known to increase the susceptibility of corals to bleaching by disrupting the host-symbiont nutrient exchange. This study examines how two Symbiodiniaceae species, <i>Symbiodinium microadriaticum</i> RT 362 and <i>Cladocopium goreaui</i> RT 152, respond to varying iron (Fe) availability, nitrate (NO<sub>3</sub> <sup>-</sup>), and ammonium (NH<sub>4</sub> <sup>+</sup>) in batch cultures. Under Fe limitation, phytoplankton growth is reduced when relying on NO₃<sup>-</sup> due to the higher Fe requirement for nitrate assimilation enzymes, whereas NH<sub>4</sub> <sup>+</sup> uptake is more efficient as it bypasses these Fe-dependent processes. Symbiodiniaceae utilize these nitrogenous compounds to fuel their metabolic processes, with an advantage in using NH<sub>4</sub> <sup>+</sup> due to its greater energy efficiency and lower Fe requirement. Due to its role as cofactor of enzymes, Fe is crucial for nitrate reduction and chlorophyll synthesis, NH<sub>4</sub> <sup>+</sup> assimilation remains effective even under low Fe conditions. The study reveals that in <i>S. microadriaticum</i> and <i>C. goreaui</i>, chlorophyll production, closely linked to Fe availability, and significantly influences carbohydrate and lipid synthesis, with both species boosting protein and carotenoid production under low Fe conditions. Chlorophyll and the other photosynthetic macromolecule product concentrations continue to increase with NH<sub>4</sub> <sup>+</sup> as the N source, even under low Fe conditions. These findings offer critical insights into how these species adapt to varying environmental conditions, improving our understanding of coral resilience.

Also flagged:bladder fibrosisspinal cord injuryNBpolymerasecollagenchromosomes
Journal Article 2025-10-28 No Snippets Ruan J, Ou T, Cui X, Yan H, Cui B, Shang Z.
Show Full Abstract

<h4>Background</h4>Neurogenic bladder (NB) following spinal cord injury (SCI) is a debilitating complication characterized by bladder fibrosis and structural remodeling. Non-coding RNAs (ncRNAs) are emerging regulators of fibrotic processes, yet their roles in SCI-induced NB remain unexplored. This study aimed to delineate the dynamic ncRNA-messenger RNA (mRNA) regulatory landscape in SCI-associated NB using transcriptomic profiling, identifying potential biomarkers and therapeutic targets.<h4>Methods</h4>Twenty female Wistar rats underwent complete T10-T11 spinal cord transection (SCI groups, n=15) or laminectomy-only (NC group, n=5). Bladder tissues were harvested at 1, 2, and 4 weeks post-SCI. Next-generation sequencing (NGS) analyzed mRNA, long non-coding RNA (lncRNA), and microRNA (miRNA) expression. Differentially expressed genes/mRNAs/lncRNAs/miRNAs (DEGs/DEMs/DELs/DEMIs) were identified (|log2FC|>1, P<0.05), and lncRNA-miRNA-mRNA competing endogenous RNA (ceRNA) networks were constructed. Functional enrichment and quantitative real-time polymerase chain reaction (qPCR) validation were performed to confirm key findings.<h4>Results</h4>Histopathology confirmed progressive bladder fibrosis, with collagen deposition increasing from 7.3% (NC) to 34.6% at 4 weeks post-SCI (P<0.001). NGS revealed 3,255/3,449/884 DEMs, 904/870/278 DELs, and 229/77/127 DEMIs in SCI-1/2/3 <i>vs.</i> NC, respectively. Temporal analysis identified 420 shared DEMs and 102 DELs, with lncRNAs enriched on chromosomes 1 and 7. The ceRNA networks implicated transforming growth factor-beta (TGF-β), calcium, and interleukin-17 (IL-17) signaling pathways in fibrosis. Notably, miR-21-5p showed progressive upregulation, while miR-139-5p decreased, correlating with ROCK2-mediated detrusor overactivity (DO). Functional enrichment highlighted inflammatory response and extracellular matrix reorganization as dominant processes. qPCR validated 12 candidate DEGs, including PVT1 and miR-21-5p, aligning with sequencing data.<h4>Conclusions</h4>This first comprehensive transcriptomic atlas of SCI-induced NB uncovers dynamic ncRNA-mRNA networks driving fibrosis through TGF-β and inflammatory pathways. The identified dysregulated ncRNAs and their target genes provide novel biomarkers for early NB diagnosis and potential therapeutic entry points. Our findings establish a foundation for developing ncRNA-targeted strategies to mitigate bladder remodeling post-SCI, addressing a critical unmet need in neuro-urology.

TNFSF4BTN2A2BTN2A1
Also flagged:metabolismtumorslung adenocarcinomaLUADBCL3KLF3
Journal Article 2025-10-28 ✓ 5 Snippets Liu H, Liu Y, Dai Y, Zhang L, Long M.
In-Text Gene Mentions
⭐ same-sentence co-mention

…, BTLA ,BTN2A1, BTN2A2 , HLA…

⭐ same-sentence co-mention

…BTLA , BTN2A1,BTN2A2, HLA -…

…levels of TDO2,TNFSF4, TNFSF18, and CD276…

…Higher expression ofBTN2A1/2, BTNL9, CD160, CD40LG,…

…TNFRSF18, TNFRSF9, andTNFSF4were found in…

Show Full Abstract

<h4>Background</h4>Cellular metabolic irregularities are intricately associated with the initiation and progression of tumors. Emerging evidence suggests that interactions between intratumoral microbiomes and host mediate this process. However, a comprehensive understanding of the role of metabolism-related intratumoral microbes (MRIMs) in lung adenocarcinoma (LUAD) is still lacking. This study aimed to investigate the characteristics and prognostic significance of MRIMs, as well as elucidate their potential implications in relation to the microenvironment in LUAD.<h4>Methods</h4>Integrated analyses were conducted using accessible datasets of the microbiome, bulk and single-cell transcriptomes. Spearman's coefficient between metabolic activity score and microbial abundance was used to identify MRIMs. An unsupervised clustering approach was utilized to distinguish the MRIMs-featured subtypes in LUAD samples. The Scissor algorithm was executed to select the cell subpopulations featured by MRIMs, and the underlying regulatory network in MRIMs-featured cells was explored. Additionally, a prognostic signature based on the microbial abundance of MRIMs was developed, and comprehensive analyses were subsequently carried out to reveal the correlation between MRIMs and LUAD microenvironment.<h4>Results</h4>Ten microbial species were identified as MRIMs, enabling the classification of LUAD samples into two distinct subtypes that showed significantly associated with clinical features and survival outcomes. The scRNA-seq analysis revealed notable differences in T cells, ciliated cells, mast cells, endothelial cells, and fibroblasts between MRIM+ and MRIM- subpopulations. BCL3, KLF3, and NFKB2 were the regulons in the regulatory network of MRIM-featured cells. Additionally, a microbial prognostic-predictive signature was established comprising <i>Succinimonas</i>, <i>Collimonas</i>, and <i>Marichromatium</i>, which also exhibited potential for indicating immunotherapeutic benefit and predicting drug sensitivity to cisplatin, cytarabine, pyrimethamine, olaparib, bicalutamide and vorinostat in LUAD treatment.<h4>Conclusions</h4>This study identified intratumoral microbes associated with metabolism, revealed distinct subtypes and their roles in LUAD, and established a predictive signature for the prognosis and therapeutic responsiveness of LUAD.

Also flagged:cancerReplicationchromosomalCINcell growthgene expression
Journal Article 2025-10-28 No Snippets Jungk P, Kschischo M.
Show Full Abstract

Replication stress (RS) is a major driver of genomic instability and cancer development through impaired DNA replication that can lead to chromosomal instability (CIN). Although RS is mechanistically linked to CIN, its relationship with cellular proliferation is complex. Depending on the context, RS can either promote or suppress cell growth. Existing RS gene expression signatures overlook this complexity, relying on the overexpression of oncogenes such as <i>MYC</i>, which introduces a proliferation bias. To disentangle genuine RS from confounding cell cycle and proliferation transcriptional profiles, we developed and validated a novel gene expression signature that accurately predicts RS independently of oncogene activity. This tumorigenic RS signature (TRSS) captures RS-related transcriptional changes across diverse cellular contexts, enabling a more robust and proliferation-independent measure of RS in both experimental and clinical samples. Applying our signature to patient data, we discovered a link between RS and the non-homologous end-joining (NHEJ) DNA repair pathway. Specifically, we observed that <i>MSH2</i> and <i>MSH6</i> - core components of mismatch repair - are associated with elevated RS and may indicate a shift toward NHEJ-mediated repair under stress conditions. Our study provides a refined approach to quantify RS and sheds light on its broader impact on DNA repair network dynamics.

Also flagged:Chronic rhinosinusitisnasal polypschronic inflammatory diseasepathogenesisgene expressionlipid
Journal Article 2025-10-28 No Snippets Tsai YJ, Shieh JM, Ma MC, Wu WB.
Show Full Abstract

Chronic rhinosinusitis without nasal polyps (CRSsNP) is a chronic inflammatory disease that lacks a clear pathogenesis/pathophysiology. While large studies focused on elucidating the pathophysiology of CRS with NPs (CRSwNP), this study aimed to use a systemic evaluation approach to identify the redox gene expression profile, its association with oxidative damage in CRSsNP, and the differences between CRSsNP and -wNP. The expression of 84 redox genes was analyzed using real-time PCR array in control and CRSsNP nasal mucosae. Changes in the mRNA and protein levels of these redox differentially expressed genes (DEGs) were verified using a customized real-time PCR array, RT-PCR, and Western blotting in an additional 18 patients. 4-Hydroxynonenal (lipid peroxidation) and 3-nitrotyrosine (protein nitrosylation) expression, representing oxidative stress (OxS) and nitrosative stress (NsS) status, were examined using immunohistochemistry. We found 27 DEGs (24 upregulated and 3 downregulated) in CRSsNP. AKR1C2, GCLM, GPX2, NOS2, and NQO1 were upregulated and LPO was downregulated more than 4-fold. These changes led to a substantial increase in OxS in CRSsNP nasal mucosa. In a comparison of the currently identified 27 DEGs with the 23 previously reported CRSwNP genes, there were 16 unique redox DEGs expressed between CRSsNP and -wNP. A String protein interaction network analysis revealed that CRSsNP possessed "an adaptive antioxidant defense signature", while CRSwNP showed "a pro-inflammatory and -oxidant pathway". Collectively, we systemically performed transcriptomic analysis to profile OxS-related genes in CRSsNP and highlighted the unique redox gene sets and pathway differences between CRSsNP and -wNP.

DCC
Also flagged:MitochondrialAlveolar echinococcosisAEparasitic diseaseInfectionmembrane
Journal Article 2025-10-28 ✓ 1 Snippet Yang Z, Zhang Y, Zhang T, Hou J, Tian M, Huang D, Jiang Y, Sun L, Wei P, Ma Y.
In-Text Gene Mentions

…mouse model, 6–8-week-oldC57BL/six micemice (purchased from…

Show Full Abstract

Alveolar echinococcosis (AE) is a fatal foodborne parasitic disease caused by the larvae of <i>Echinococcus multilocularis</i>. The disease primarily affects the liver. Previous studies have found that Kupffer cells have an immune protective effect, but in the late stages of AE, they are associated with parasite immune escape. The present study analyzed the effects of <i>Echinococcus multilocularis</i> protoscoleces (PSCs) infection on the mitochondrial morphology and function of macrophages, as well as their phagocytic function and apoptosis. Infection with PSCs has been shown to result in the fragmentation of the macrophage mitochondrial network, the impairment of mitochondrial membrane potential, the elevation of mitochondrial reactive oxygen species, and the reduction in mitochondrial DNA copy number. This cascade of events, consequent to the infection, has been demonstrated to promote the apoptosis of macrophages and impair their phagocytic function. Inhibiting mitochondrial fission during PSCs infection has been shown to mitigate mitochondrial dysfunction, suppress macrophage apoptosis, and enhance macrophage phagocytic function. This discovery provides insights into improving macrophage function during the progression of AE.

HTT
Also flagged:LIG1bindingHDligaseDNA ligase 1ribonucleotides
Journal Article 2025-10-28 ✓ 2 Snippets Ratcliffe J, Lerner CE, Balu K, Chatterjee S, Lee KM, Caglayan M.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene leads to…

…region of theHTTgene leads to…

Show Full Abstract

DNA ligase 1 (LIG1) joins broken strand breaks and seals Okazaki fragments during DNA repair and replication. Huntington's disease (HD)-associated mutation in the <i>LIG1</i> gene, K845N, is associated with delayed symptom onset and predicted to suppress CAG repeat expansion. Yet, how this mutation impacts faithful nick sealing and efficient DNA binding by LIG1 remains unknown. Here, using biochemical analyses, X-ray crystallography, and total internal reflection fluorescence (TIRF) microscopy, we characterized the LIG1 HD-associated K845N variant at biochemical, structural, and single-molecule levels. Our results showed significantly reduced ligation efficiency for nick substrates containing noncanonical mismatches and diminished mutagenic end-joining of damaged DNA, while LIG1 K845N variant exhibits a lack of discrimination against nicks containing 3'-ribonucleotides when compared with the wild-type enzyme. Furthermore, our structures provided an atomic insight into differences in the distances between functional groups of K/N845 and DNA ends, demonstrating similar conformation at the ligase active site. Finally, our single-molecule measurements revealed that the K845N variant binds less frequently to nick, suggesting diminished affinity. Overall, our findings contribute to understanding the mechanism by which LIG1 searches for nick sites on DNA and ensures fidelity to maintain genome stability at the final ligation step in normal versus HD-associated states.

Also flagged:nucleotidechromosomesdegradationTelomereagingcell division
Journal Article 2025-10-28 No Snippets Lau ZC, Naaz A, Muniasamy U, Lim XY, Gurung RL, Oguz G, Ramasamy A, Koh WP, Sorokin VA, Dorajoo R.
Show Full Abstract

<h4>Objective</h4>Shortened telomere length (TL) in blood cells has been associated with atherosclerotic coronary artery disease (CAD). However, the mechanistic pathways underlying TL attrition in arterial wall tissues of patients with CAD remain unclear.<h4>Methods</h4>TL was measured using quantitative polymerase chain reaction in blood granulocytes and matched arterial wall tissues from 155 Chinese men with CAD. RNA sequencing was performed in 34 patients to profile the arterial wall tissue transcriptome. These patients were dichotomized according to the median TL of either arterial wall tissues or granulocytes, and differential gene expression was examined with respect to TL.<h4>Results</h4>No significant correlation was observed between TLs of arterial wall tissues and granulocytes (R=0.107, <i>p</i>=0.19). We identified 10 significant differentially expressed genes (DEGs) associated with TL attrition in arterial wall tissues (false discovery rate [FDR] <0.045), including upregulation of <i>ADRA2A</i> (FDR=0.043), a gene encoding an adrenergic receptor implicated in vasoconstriction of atherosclerotic coronary arteries. Gene-set enrichment analysis also revealed positive enrichment of the vasoconstriction pathway (FDR=0.012) in association with TL attrition at the arterial wall tissue. However, these 10 DEGs were not associated with TL attrition in granulocytes. Instead, TL attrition in granulocytes was linked to negative enrichment of ATP synthesis pathways, potentially reflecting mitochondrial dysfunction.<h4>Conclusion</h4>Our findings suggest that distinct pathway dysfunctions may underlie TL attrition in atherosclerotic arterial walls versus granulocytes, indicating that TL attrition in these compartments could contribute to CAD pathogenesis through different mechanisms.

Also flagged:obesitymetabolic disorderslipidextracellularvesiclesremodeling
Journal Article 2025-10-27 No Snippets Son Y, Choi C, Lee J, Park G, Hong KY, Sun W, Lee MO, Lee YH.
Show Full Abstract

Adipose tissue is a dynamic immunometabolic organ whose cellular heterogeneity and functional plasticity are central to systemic energy balance and metabolic regulation. Disruption of immune-adipocyte interactions is closely linked to the development of obesity and related metabolic disorders. In this review, we summarize current advances in understanding of the immune landscape in adipose tissue, with an emphasis on the distinct roles of immune cell subsets. Recent approaches including global and single-cell transcriptomic analysis, spatial profiling, and lineage tracing have expanded our ability to characterize these populations. We further highlight mechanisms through which immune cells influence adipocyte turnover, lipid handling, and thermogenesis, as well as reciprocal signals from adipocytes such as cytokines, lipid mediators, extracellular vesicles, and nutrient exchange. This bidirectional crosstalk governs adipose tissue remodeling and determines the occurrence of metabolic homeostasis or dysfunction. Finally, we provide perspectives into the ways in which these interactions may guide the identification of novel therapeutic targets for obesity and metabolic disease.

MMS22L
Also flagged:gene expressionhistonetranscriptional regulatorsmetabolismagingACTN3
Journal Article 2025-10-27 ✓ 1 Snippet El Haddouchi A, Marrouh A, Kartti S, El Fahime E, Boutayeb S, Chagar Y, Baudot C, Belyamani L, Eljaoudi R, Dakka T.
In-Text Gene Mentions

…T allele ofMMS22L(rs9320823), the C…

Show Full Abstract

Recent advances in sports genomics and epigenetics have significantly enhanced our understanding of the biological underpinnings of sprint, strength, and power performance. While genetic predisposition influences muscle fiber composition, contractile speed, and neuromuscular efficiency, epigenetic mechanisms are increasingly recognized for their role in modulating gene expression in response to training and environmental stimuli. In this narrative review, we synthesize current findings on key genetic variants, including polymorphisms in <i>ACTN3</i> (R577X), <i>ACE</i>, and <i>AMPD1</i>, which have been associated with muscle hypertrophy, anaerobic capacity, and explosive strength. Genome-wide association studies (GWAS) and candidate gene approaches have identified over 150 polymorphisms relevant to power-oriented sports, with <i>ACTN3</i> R577X emerging as a strong predictor of sprinting ability. However, interindividual variability in performance cannot be explained by genetics alone. Epigenetic modifications-such as DNA methylation, histone acetylation, and microRNA (miRNA) activity-regulate skeletal muscle plasticity, recovery, and adaptation. Notably, miRNAs act as key post-transcriptional regulators, influencing pathways involved in oxidative metabolism and neuromuscular remodeling. Furthermore, telomere biology has emerged as a complementary factor, with telomere length serving as a biomarker of biological aging and regenerative capacity, particularly relevant to high-intensity, power-based sports. By integrating genomics, epigenomics, and transcriptomics, this narrative review provides a comprehensive framework for understanding the complex biology of elite athletic performance and highlights future directions for personalized training and talent identification in sport science.

VRK2
Also flagged:cocainechromosomesbehavioralCocaine use disorderSubstance Abusecocaine dependence
Journal Article 2025-10-27 ✓ 5 Snippets Schoenrock SA, Gaines CH, Kumar P, Khan S, Farrington J, Ferris MT, de Villena FP, Valdar W, Bubier JA, Tarantino LM.
In-Text Gene Mentions

…SNPs inVrk2, Clhc1 and…

…Clhc1, Il9r andVrk2.…

…behavioral phenotypes, butVrk2has the strongest…

…AVrk2SNP (rs13466583) in…

Vrk2is a serine/threonine…

Show Full Abstract

<h4>Rationale</h4>Cocaine use disorder (CUD) is a significant health concern that has devastating impacts on affected individuals and society. There are currently no approved therapies to treat CUD due, in part, to significant gaps in our knowledge about the underlying factors that increase risk. Individual genetic differences contribute to CUD risk. Identifying specific genetic mechanisms that increase risk could reveal novel targets for treatment and prevention.<h4>Objectives</h4>We identified two Collaborative Cross (CC) strains, CC004/TauUncJ (CC004) and CC041/TauUncJ (CC041), that differ significantly for locomotor response and self-administration of cocaine. In the current study, we used mapping crosses generated from both strains to identify genetic loci that are associated with behavioral responses to cocaine.<h4>Results</h4>We bred mice from the low (CC041) and high (CC004) responding strains to C57BL/6NJ mice to produce two F2 populations and identify genetic loci that influence locomotor response to cocaine. We identified three significant loci on chromosomes 7, 11 and 14 in the CC041 F2 mapping cross that collectively explain 14% of the phenotypic variance for locomotor response to cocaine. Bioinformatic analyses identified multiple genes on chromosomes 7 and 11 that are genetically plausible, have functional relevance and are suitable for further exploration.<h4>Conclusions</h4>Genetically defined and phenotypically divergent mouse strains are a useful tool for identifying candidate genes that influence behavioral responses to psychostimulants. Functional and mechanistic analyses of these genes could provide insights into biological processes that increase risk for CUD.

SOX6
Also flagged:cancertumormetabolismWntTCFPYGL
Journal Article 2025-10-27 ✓ 1 Snippet Liu Q, Lei Y, Liu Z, Han J.
In-Text Gene Mentions

…, TMEM238L ,SOX6, SMAD7 ,…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is a leading cause of global cancer-related mortality, necessitating the identification of novel therapeutic targets. Integrating genetic and transcriptomic data may reveal key molecular drivers of CRC progression and treatment opportunities.<h4>Methods</h4>We performed a multiomics analysis combining genome-wide association study (GWAS) data (p < 1e-6) and RNA-seq data from the TCGA. Differential expression analysis (Limma) identified 24 consistently dysregulated genes (17 mRNAs, 7 lncRNAs) in CRC. Survival analysis was used to evaluate their prognostic impact on overall survival (OS), relapse-free survival (RFS), and post progression survival (PPS). Drug‒gene interactions were explored via Enrichr, and virtual screening (PubChem) prioritized high-affinity compounds that target PYGL, a metabolic regulator.<h4>Results</h4>Integration of GWAS and RNA-seq revealed that 24 CRC-associated genes, including PYGL, SMAD7, and TCF7L2, are involved in tumor metabolism and Wnt/TCF signaling. Survival analysis revealed that five genes (CDKN2B, BOC, METRNL, etc.) were significantly correlated with OS, RFS, and PPS. Ten small-molecule candidates targeting PYGL exhibited high binding affinity, suggesting their therapeutic potential.<h4>Conclusion</h4>This study identified CRC-linked genes through GWASs and transcriptomics, highlighting their prognostic and druggable relevance. Computational drug repurposing pinpoints PYGL inhibitors as promising candidates, offering a translational framework for CRC therapy development.

OLFM4
Also flagged:chronic diseasesagingsaponinbile acidsursodeoxycholic acidFXR
Journal Article 2025-10-27 ✓ 5 Snippets Liu M, Sun J, Jia Z, Cui Y, Zhu X, Wang Z, Sun H, Liu B, Shi Y.
In-Text Gene Mentions

…and Olfactomedin 4 (OLFM4)‐positive ISCs in the…

…in Ki67‐positive andOLFM4‐positive cell numbers followi…

…quantitative analysis ofOLFM4‐positive cells further confir…

…for Ki67 andOLFM4further confirmed that…

…proliferative cells andOLFM4‐positive ISCs in each…

Show Full Abstract

Aging is recognized as a significant risk factor for chronic diseases. The decline in intestinal stem cells function is a critical contributor to intestinal aging, resulting in impaired intestinal homeostasis and increased vulnerability to age-related diseases. Medicago sativa L. (alfalfa) saponin are plant-derived bioactive compounds that are shown to have benefits in regulating oxidative stress and gut microbiota. However, the potential of alfalfa saponin (AS) to modulate intestinal aging and enhance intestinal stemness to maintain homeostasis remains insufficiently explored. In this study, the effects of AS on intestinal stemness in naturally aged mice and its underlying mechanisms involving gut microbiota regulation are examined. Antibiotic-mediated depletion of intestinal bacteria and fecal microbiota transplantation are employed to determine the specific role of the gut microbiota in mediating the effects of AS. Comprehensive multi-omics analyses revealed that AS significantly increased the abundance of Lactobacillus intestinalis (L. intestinalis). Notably, L. intestinalis is found to possess bile acids metabolic capabilities, producing ursodeoxycholic acid, which functions as an FXR antagonist to activate the Wnt signaling pathway and enhance intestinal stemness, thereby supporting intestinal homeostasis. These findings are validated in both intestinal organoids and naturally aged mice models. This study provides the first identification of a complete functional axis by which the metabolites of AS and L. intestinalis modulate intestinal stemness to mitigate intestinal aging, offering insights for the development of innovative natural product-based therapeutic strategies to promote healthy aging.

HTT
Also flagged:Huntington diseaseHDneurodegenerative diseaseHuntingtincell homeostasischaperones
Journal Article 2025-10-27 ✓ 4 Snippets Rusmini P, Mina F, Valenza M, Vitali M, Ferrari V, Tedesco B, Casarotto E, Cozzi M, Chierichetti M, Mohamed A, Pramaggiore P, Cornaggia L, Milioto C, Brodnanova M, Magdalena R, Koshal P, Piccolella M, Cristofani R, Galbiati M, Crippa V, Poletti A.
In-Text Gene Mentions

HTTis an evolutionarily…

…have the mouseHttexon 1 replaced…

…by the humanHTTexon 1 sequence…

…EGFP-LGALS3 and theHTTproteins and then…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion (polyQ) in the Huntingtin protein (muHTT), which makes it prone to misfolding and aggregation. muHTT aggregates sequester a wide variety of proteins essential for cell homeostasis, including chaperones and transcription factors, and their depletion may contribute to HD pathogenesis. Lysosomes are the main hubs for degradative and signaling activities in cells, and their functionality is crucial for cell homeostasis, especially for neurons. Different forms of cellular stresses, including proteotoxic stresses, can alter lysosome integrity and induce lysosomal membrane permeabilization (LMP). Damaged lysosomes are recognized by galectins, in particular galectin-3 (LGALS3) with activation of the lysosome quality control (LQC) system responsible for repairing, degrading, or replacing leaky lysosomes. The system is transcriptionally regulated by the transcription factors EB and E3 (TFEB and TFE3, respectively). Using HD mouse and cell models, we demonstrated that TFEB and TFE3 are sequestered in muHTT aggregates, and muHTT proteins associates with LMP triggering the translocation of LGALS3 to the lumen of lysosomes, with a close relation between polyQ size and severity of these events. Moreover, we demonstrated that TFEB and TFE3 silencing or overexpression modulate muHTT aggregation. TFEB and TFE3 knockdown worsens muHTT aggregation, while their overexpression reduces muHTT inclusions and concurrently reduces LGALS3 accumulation via lysophagy and lysosome replacement. Our findings suggest that both TFEB and TFE3 are implicated in HD, and their sequestration in muHTT inclusions increase the vulnerability of neurons to lysosome injury, altering LQC and contributing to disease pathogenesis. In physiologial conditions, lysosome membrane permeabilization occurs and activates TFEB and TFE3 triggering a response to induce lysophagy and lysosome biogenesis. In HD, muHTT sequesters TFEB and TFE3 into inclusions and the reduced TFEB/TFE3 bioavailability prevents the activation of lysophagy and leading to the accumulation of damaged lysosomes. Created in BioRender.

HTT
Also flagged:MLH1MLH3MSH2MSH3synthesisPCNA
Journal Article 2025-10-27 ✓ 1 Snippet Senoussi I, Mengoli V, Cerana A, Rinaldi A, Marco A, Reginato G, Moro SG, Acharya A, Roy M, Jayachandran A, Cannavo E, Ceppi I, Cejka P.
In-Text Gene Mentions

…repeats in theHTTgene 4 –…

Show Full Abstract

Triplet repeat expansion underlies multiple pathologies, including Huntington's disease, often arising in somatic non-dividing tissues such as the brain. Despite identification of genetic modifiers, mechanistic insights remain limited. Using purified human proteins, we show that MutLγ (MLH1-MLH3), stimulated by MutSβ (MSH2-MSH3), incises DNA opposite an extrahelical loop on the 5' side. This activity, with a moderate sequence preference, generates DNA nicks enabling Polδ-mediated displacement synthesis with the loop as a template, leading to expansion. PCNA confines these MutLγ incisions near the loop. FAN1, instead, preferentially targets the looped strand. RFC-PCNA stimulate and direct FAN1 nuclease to the 3' boundary of the loop while restricting its exonuclease activity. No pre-existing nick is required. Following FAN1-RFC-PCNA action, Polδ removes the loop and resynthesizes DNA, causing contraction. FAN1 also directly inhibits MutLγ, preventing its activation by MutSβ. Our study illuminates both repeat expansion and contraction mechanisms and reveals the protective function of FAN1.

STAU1
Also flagged:p53deathneurodegenerative diseaseRNA-binding proteinsRBPneurological disorders
Journal Article 2025-10-27 ✓ 5 Snippets Gandelman M, Paul S, Figueroa KP, Sundrud J, Dansithong W, Scoles DR, Pulst SM.
In-Text Gene Mentions

…TargetingSTAU1prevents p53 apoptotic…

…the RBP STAUFEN-1 (STAU1) protein successfully prevent…

STAU1is pathologically overabundant…

…showed that loweringSTAU1levels mitigates these…

…baseline overabundance ofSTAU1and activation of…

Show Full Abstract

Stress responses and neuronal death mediated by the p53 pathway play a central role in the progression of neurodegenerative disease, constituting a common target to extend neuronal function and survival. Interaction of p53 and its signaling network with RNA-binding proteins (RBPs) helps fine-tune its activation and the resulting cell fates. Preclinical therapeutics based on depletion of the RBP STAUFEN-1 (STAU1) protein successfully prevent neurodegeneration, however, the specific mechanisms are not fully understood. STAU1 is pathologically overabundant in multiple neurological disorders and contributes to neurodegeneration by exacerbating autophagy dysfunction, endoplasmic reticulum stress, and RNA-protein condensate accumulation. We previously showed that lowering STAU1 levels mitigates these disease-related features and prevents neuronal death in animal models of amyotrophic lateral sclerosis/frontotemporal dementia (ALS/FTD) and spinocerebellar ataxia type 2 (SCA2). Here, we show by combined transcriptomic and functional analyses that STAU1 reduction results in the inhibition of apoptosis through the p53 pathway. In both proliferating and post-mitotic cell types-human iPSC-derived neurons, mouse cortical neurons, SH-SY5Y cells, and fibroblasts-STAU1 reduction effectively prevented p53-mediated apoptosis and DNA damage induced by Nutlin-3 and etoposide. Further examination in C9orf72-expanded patient-derived fibroblasts and a C9orf72 mouse model of ALS/FTD, which exhibit baseline overabundance of STAU1 and activation of the p53 pathway, confirmed that STAU1 reduction also prevented p53-driven pro-apoptotic signaling. These findings establish STAU1 as a novel modulator of DNA damage and p53-dependent apoptosis, suggesting that targeting STAU1 could be a promising approach to prevent neurodegeneration in ALS/FTD.

Also flagged:visionsleepRNPCHSdeath
Journal Article 2025-10-27 No Snippets Lan Y, Kan M, Cao B, Rao C, Zhou M, Zhou P.
Show Full Abstract

Addressing the challenges of energy imbalance and the difficulty in optimizing cluster head selection in clustering protocols for wireless sensor networks (WSNs), this paper proposes a clustering protocol based on an improved zebra optimization algorithm (IZOACP). The method systematically solves the NP-hard problem of cluster head selection by integrating the zebra optimization algorithm (ZOA), Gaussian mutation strategy, and opposition-based learning mechanism, while optimizing the clustering process based on four key metrics: node residual energy, network density, intra-cluster distance, and communication delay. To further enhance data transmission efficiency, a dynamic adaptive inter-cluster routing mechanism is designed, which achieves path dynamic balancing based on node distance, residual energy, and load status. Experimental results demonstrate that, compared to the LEACH, DMaOWOA, and ARSH-FATI-CHS protocols, IZOACP significantly outperforms the comparison schemes in key metrics such as network lifespan (improved by 97.56%), throughput (improved by 93.88%), and transmission delay (reduced by 10.12%). These results validate its superiority in energy consumption control, topology stability, and large-scale monitoring scenarios, providing an efficient and reliable clustering optimization framework for WSN information monitoring systems.

HTT
Also flagged:cancertuberculosisneurological disordersinfectious diseasesprotein degradationmethylation
Journal Article 2025-10-27 ✓ 1 Snippet Adav SS, Ng KW.
In-Text Gene Mentions

…disease by Huntingtin (Htt) aggregates.…

Show Full Abstract

Hair specimens are vital in precision medicine, forensics and environmental monitoring owing to their ability to retain biochemical data over time. Their noninvasive collection and long-term storage suitability make them ideal for diagnostics and investigations, offering historical insights into health and exposure records. In medicine, hair analysis provides a long-term biochemical profile, aiding in monitoring health conditions, nutritional deficiencies, toxin exposure and treatment efficacy. Advances in mass spectrometry, chromatography and spectroscopy have expanded their applications to cancer diagnostics, tuberculosis, HIV, neurological disorders and mental health assessments. In forensic science, the resistance of hair to decomposition and its ability to absorb substances help identify individuals, detect drug use and reconstruct crime scenes. Omics techniques such as genomics, proteomics and metabolomics enhance forensic accuracy by enabling precise substance detection and timeline reconstruction. Despite its potential, challenges such as hair growth variability, contamination and lack of standardized techniques limit the current impact of hair analysis. Addressing these issues could advance its role in diagnostics and forensic investigations. This review explores recent advancements and applications of hair analysis in precision medicine, infectious diseases, mental health, stress assessment and forensic science.

HFE
Also flagged:sodium-glucose cotransporter 2type 2 diabetesnonalcoholic fatty liver diseasetype 2 diabetes mellitusNAFLDchronic liver disorders
Journal Article 2025-10-27 ✓ 1 Snippet Naguib R, Aleyeidi N, Naguib H.
In-Text Gene Mentions

…viral hepatitis, orhemochromatosis.…

Show Full Abstract

Sodium-glucose cotransporter 2 inhibitors (SGLT2is) are a novel group of oral medications used to treat type 2 diabetes mellitus (T2DM). Nonalcoholic fatty liver disease (NAFLD), a complication of T2DM, is now recognized as one of the most frequent causes of chronic liver disorders. We aimed to investigate the effects of SGLT2is on hepatic function and glucose homeostasis in patients with T2DM and comorbid NAFLD. To our knowledge, this is the first study in the Arab region to compare the effects of SGLT2is and other antidiabetic medications and to evaluate the outcomes after a 6-month follow-up period in this patient cohort. This cohort study involved 100 patients with T2DM. The patients were divided equally into two groups. The exposed group comprised 50 patients receiving any of the SGLT2is (empagliflozin or dapagliflozin); the non-exposed group comprised 50 patients taking any other oral antidiabetic medication (other than glucagon-like peptide-1 receptor agonists or SGLT2is). The outcomes investigated were glycemic control, hepatic function, and liver fibrosis parameters, investigated at baseline and after 6 months. Significant improvements in glycemic control, hepatic function, and fibrosis parameters were observed in the SGLT2i group after 6 months, as evidenced by laboratory and clinical data (p < 0.001). Significant improvements were observed in hemoglobin A1c, Fibrosis-4 index, gamma-glutamyl transferase level, alanine aminotransferase level, and NAFLD fibrosis score (p < 0.05). The findings indicate that 6 months of SGLT2i therapy improved fibrosis and glucose homeostasis in patients with T2DM and NAFLD. Therefore, SGLT2is are effective therapeutic agents in this patient population.

HFE
Also flagged:GLP-1 receptorGLP-1GIP receptorglucose-dependent insulinotropic polypeptideGIPreceptor
Journal Article 2025-10-27 ✓ 1 Snippet Tamilwanan S, Aziz Z, Rong LY, Bitar AN, Zarzour RHA, Alshehade SA.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis), studies of participants…

Show Full Abstract

BACKGROUND: Metabolic dysfunction-associated fatty liver disease (MAFLD) affects up to 30% of the global population, yet effective pharmacological treatments remain limited. This systematic review and meta-analysis evaluated the efficacy of GLP-1 receptor agonists and dual GLP-1/glucose-dependent insulinotropic polypeptide (GIP) receptor agonists in managing MAFLD. METHODS: We systematically searched PubMed/MEDLINE, Cochrane CENTRAL, Web of Science, and Scopus, through July 2025. Randomised controlled trials (RCTs) assessing GLP-1 receptor agonists or dual GLP-1/GIP GIP receptor Agonists in managing MAFLD patients were included. Primary outcomes included liver fat content, liver enzymes, and glycemic parameters. Meta-analyses were performed with subgroup analyses by receptor target, treatment duration, control type, and age. In addition, implementing a formal GRADE evaluation framework. RESULTS: Twenty-six trials involving 3,453 participants were included. GLP-1 receptor agonists significantly reduced liver fat content (MD: -3.37%, 95% CI: -4.98 to -1.76, p < 0.001), ALT levels (SMD: -0.47, 95% CI: -0.73 to -0.22, p < 0.001), and AST levels (SMD: -0.29, 95% CI: -0.53 to -0.05, p < 0.05). Significant improvements were observed in HbA1c (SMD: -0.67, 95% CI: -0.99 to -0.34, p < 0.001), fasting glucose (MD: -0.60 mmol/L, 95% CI: -0.92 to -0.27, p < 0.001), HOMA-IR (SMD: -0.34, 95% CI: -0.66 to -0.02, p < 0.05), and total cholesterol (MD: -0.23 mmol/L, 95% CI: -0.30 to -0.15, p < 0.001). Liver stiffness showed no significant improvement (MD: -0.12 kPa, 95% CI: -0.75 to 0.50, p = 0.70). Dual GLP-1/GIP agonists demonstrated superior efficacy compared to mono GLP-1 agonists for reducing liver fat (MD: -7.15, 95% CI: -10.23 to -4.07, p < 0.001 versus MD: -2.44, 95% CI: -4.18 to -0.71, p < 0.01), representing a 2.9-fold greater effect. Long-term treatment (lasting over 48 weeks) demonstrated enhanced benefits across all outcomes. Overall, changes in body weight were not significant (MD: -1.51 kg, 95% CI: -4.07 to 1.06, p = 0.25). CONCLUSIONS: This meta-analysis provides evidence for the effectiveness of GLP-1 receptor agonists in managing MAFLD, with dual GLP-1/GIP agonists demonstrating superior hepatic benefits. Long-term therapy (lasting more than 48 weeks) is necessary for optimal outcomes. These findings support clinical implementation, particularly for patients with concurrent diabetes or obesity, positioning dual agonists as promising advancements in treatment.

DCC
Also flagged:bronchopulmonary dysplasiagestationintraventricular hemorrhagenecrotizing enterocolitisNECchronic lung disease
Journal Article 2025-10-27 ✓ 1 Snippet Ge J, Wang C, Lin H, Bai G, Xu Y, Shi L, Ma X, Chen Z.
In-Text Gene Mentions

…(Table 4 ),DCCwas identified as…

Show Full Abstract

<h4>Purpose</h4>To assess the incidence of bronchopulmonary dysplasia in preterm infants born at < 32 weeks of gestation who received delayed cord clamping rather than early cord clamping.<h4>Methods</h4>During this multicenter, prospective, observational cohort study, data of 1283 infants born at < 32 weeks of gestation who received umbilical cord management between January 1, 2020 and December 31, 2021, were collected from 26 tertiary referral neonatal intensive care units in China. The primary outcome was bronchopulmonary dysplasia.<h4>Results</h4>A total of 440 infants (34.3%) received delayed cord clamping. The bronchopulmonary dysplasia rates were 32.5% and 55.6% for infants who received delayed cord clamping and those who received early cord clamping, respectively. After adjusting for potential confounders, the delayed cord clamping group had a lower risk of bronchopulmonary dysplasia (odds ratio [OR], 0.47; 95% confidence interval [CI], 0.35-0.62; P < 0.001). No significant difference in the severity of bronchopulmonary dysplasia was observed between groups (P = 0.09). A subgroup analysis of 227 infants born at < 28 weeks of gestation revealed that 65 (28.6%) received delayed cord clamping, and that 40 (61.5%) of these 65 infants experienced bronchopulmonary dysplasia. After adjusting for potential confounders, the risk of bronchopulmonary dysplasia for the delayed cord clamping group was not decreased (OR, 0.65; 95% CI, 0.30-1.41; P = 0.28).<h4>Conclusion</h4>Delayed cord clamping independently decreased the risk of bronchopulmonary dysplasia in infants born at < 32 weeks of gestation with moderate-to-severe respiratory distress; however, for those born at < 28 weeks of gestation, this benefit was not observed.

Also flagged:GlioblastomaGBMbrain tumortumortemozolomideATP-binding cassette (ABC) drug efflux transporters
Journal Article 2025-10-27 No Snippets Estabillo LL, Skaga E, Halldorsson S, Vik-Mo EO, Sandberg CJ.
Show Full Abstract

BACKGROUND: Understanding the complex molecular mechanisms driving drug resistance in glioblastoma (GBM) is crucial to develop effective therapeutic strategies. While prior studies have identified resistance mechanisms tied to specific drugs or pathways, a multi-modal molecular analysis of resistance across a range of drug classes is lacking. METHODS: We identified highly drug-resistant (n = 5) and drug-sensitive (n = 4) cultures from a cohort of 32 patient-derived glioblastoma stem cell (GSC) cultures screened against a broad panel of ~ 500 anti-cancer drugs. To elucidate the key drivers of drug resistance, we performed integrative profiling of stemness, differentiation capacity, global gene expression, mutation profiles, and DNA methylation patterns between the two groups. RESULTS: Despite heterogeneous gene expression profiles, drug-resistant GSCs showed consistent upregulation of ATP-binding cassette (ABC) drug efflux transporters, stemness, and extracellular matrix (ECM)-related genes. Compared to drug-sensitive GSCs, drug-resistant GSCs exhibited more pronounced stem-like properties and reduced differentiation capacity. Notably, genes linked to axonogenesis displayed significant CpG island hypomethylation in drug-resistant GSCs. CONCLUSIONS: This study suggests a pivotal role for GSC plasticity, stemness maintenance, and ECM-mediated drug evasion in GBM treatment resistance. Our findings highlight the adaptive and dynamic nature of resistance mechanisms in GSCs, emphasizing the need for comprehensive molecular insights to inform targeted therapeutic strategies in GBM.

Also flagged:taunucleusneurofibrillary tanglecognitive impairmentmild cognitive impairmentAD
Journal Article 2025-10-27 No Snippets Kara B, Beck JS, Fu Z, Hickey SL, Kanaan NM, Mufson EJ, Ginsberg SD, Counts SE.
Show Full Abstract

Soluble tau oligomeric assemblies display neurotoxic properties and may provide a pathogenic link between neurofibrillary tangle evolution and selective neuronal vulnerability in Alzheimer's disease (AD). However, the precise molecular and cellular pathways mediating tau oligomer toxicity are unclear. We combined single-neuron laser capture microdissection with custom microarrays to investigate differences in the molecular signatures of basal forebrain neurons within the nucleus basalis of Meynert (nbM) labeled for p75<sup>NTR</sup>, a cholinergic cell marker, or dual-labeled for p75<sup>NTR</sup> and TOC1, a tau oligomer marker. Tissue was obtained postmortem from Rush Religious Orders Study participants who died with an antemortem clinical diagnosis of no cognitive impairment (NCI), mild cognitive impairment (MCI), or mild/moderate AD. Using clinical diagnosis as a covariate to isolate tau oligomer-specific mechanisms, we identified 140 differentially expressed genes (DEGs) in p75<sup>NTR</sup> + /TOC1 + cholinergic nbM neurons compared to p75<sup>NTR</sup> + /TOC1- neurons. STRING interactome and pathway analysis revealed that downregulated genes were associated with pre- and postsynaptic function, with additional enrichment in glutamate and acetylcholine signaling. By contrast, upregulated genes related to cellular stress responses and apoptosis were clustered with a subset of downregulated DEGs regulating mitochondrial metabolism and redox function, indicative of bioenergetic failure. Weighted gene co-expression correlation network analysis of the entire dataset revealed only two significantly correlated modules, which were either negatively correlated with the presence of TOC1 and enriched for synaptic signaling or positively correlated with TOC1 and enriched for cellular responses to hypoxia. These data show with single-neuron resolution that oligomeric tau formation in vulnerable cholinergic nbM neurons, even prior to MCI, is associated with the dysregulation of multiple classes of genes driving cell/mitochondrial stress and synaptic imbalances, which may be amenable for disease-modifying therapeutic approaches.

Also flagged:xerostomiaxerophthalmiaRoSSAantibodiesLa
Journal Article 2025-10-27 No Snippets Valim V, Tatiyama Miyamoto S, Reis de Oliveira F, Vieira Serrano É, Caldas Dos Santos L, de Almeida Pernambuco R, Appenzeller S, Markus J, Augusto Tanure L, Lemos Lopes ML, Coradin R, César Pinheiro A, Hax V, Zanchett Fedrigo A, Euzébio Ribeiro SL, Gatz Capobianco K, Sant'Ana Petterle G, Pugliesi A, Cerqueira Calderaro D, Libardi Lira Machado KL, Toche Dos Santos PR, de Carvalho Sacilotto N, de Senna Migueletto AM, Ustárroz Cantali D, de Souza Barbosa V, Maia Marzola M, Melani Rocha E, Machado Xavier R, Fernandes Moça Trevisani V.
Show Full Abstract

Cohort studies are essential for elucidating disease progression, guiding research priorities, and identifying gaps in diagnosis and treatment. This manuscript presents the protocol and preliminary findings of the Brazilian Registry on Sjögren’s Disease (BRAS), a national, prospective cohort supported by the Brazilian Society of Rheumatology (SBR). BRAS aims to collect comprehensive data on patients with Sjögren’s Disease (SjD) who meet the 2002 AECG and/or 2016 ACR-EULAR classification criteria, fostering high-quality research initiatives. Data collection is conducted via REDCap and includes demographic, laboratory, and clinical parameters such as disease activity (ESSDAI), damage (SSDDI), comorbidities, cardiovascular risk (Framingham score), labial salivary gland biopsy, salivary gland ultrasound, and therapeutic approaches. Patient-reported outcome measures (PROMs) include ESSPRI, PROFAD, HADS, ESE, IPAQ-SF, and EQ-5D. To date, 1,082 patients have been enrolled (mean age 55.3 ± 13.3 years; 96.6% women). Major findings include xerostomia (93%), xerophthalmia (92%), positive lip biopsy (83.6%), anti-Ro/SSA antibodies (77%), anti-La/SSB (43%), systemic manifestations (71.3%, ESSDAI 4.8 ± 5.8), and organ damage (86.9%, SSDDI 2.3 ± 1.6). Average disease duration was 7 ± 6.3 years with a diagnostic delay of 3.7 years. Treatments included corticosteroids (18%), hydroxychloroquine (46%), immunosuppressants (38%), and rituximab (6.5%). Common comorbidities were hypertension (34.9%), obesity (30.2%), dyslipidemia (29.7%), fibromyalgia (26%), osteoarthritis (24%), hypothyroidism (23.6%), diabetes (12.9%), and cancer (12.7%). Patients reported high symptom burden (ESSPRI 5.4 ± 2.4), anxiety (48%), depression (40%), low quality of life (63.6 ± 22.2), and insufficient physical activity (only 32.7% exercised regularly). Findings highlight the need for a multidisciplinary care program. The findings reveal diagnostic delays, limited healthcare access, high symptom burden, systemic involvement, poor mental health and highlight the need for a multidisciplinary care program. The next phase involves establishing a biorepository for biological samples. Clinical trial number Not applicable.

Also flagged:infectious diseasespost-infective fatigue syndromeinfectious mononucleosisCOVID-19infectionsupper respiratory tract infections
Journal Article 2025-10-27 No Snippets Raijmakers RPH, Lund Berven L, Keijmel SP, Rodrigo C, Wyller VBB, Katz BZ, Buchwald D, Evans RA, Gérardin P, Knoop H, Prins M, Stavem K, Stiansen-Sonerud T, Taylor R, Valencia Arroyo BM, Wensaas KA, Selvakumar JP, van den Wijngaard C, Lloyd AR, Sandler CX.
Show Full Abstract

<h4>Background</h4>The pathophysiology of post-infective fatigue syndromes (PIFS), including Long COVID, is unknown. This systematic review and meta-analysis aimed to investigate if PIFS is associated with persistent immune activation.<h4>Methods</h4>PubMed, EMBASE, and Web of Science were searched for terms related to infection, fatigue, persistent symptoms, and immunological markers.<h4>Population</h4>adults and adolescents; Exposure: documented acute infection; Comparator: those who developed PIFS vs. recovered controls from the same exposure; and Outcomes: immunological biomarkers. Studies which documented acute infection, applied diagnostic criteria for PIFS, and assayed circulating immunologic markers were eligible.<h4>Findings</h4>From 14,985 studies screened, 30 articles were included (n = 5102 participants; 833 PIFS/PIFS-like cases, n = 4269 recovered control participants) with many studies excluded by inadequate quality in eligibility criteria. The meta-analysis (11 studies; n = 413 PIFS cases, analysed with random-effects models) showed PIFS cases had increased: white cell counts at 3-6 months (Cohen's d: 0.41, 95% CI 0.09-0.74); and circulating levels of RANTES and TNFα at 6-12 months (Cohen's d: 0.45 [95% CI 0.16-0.73] and 0.30 [95% CI 0.04-0.57], respectively) compared to controls recovered from the same exposure.<h4>Interpretation</h4>These findings provide cautious support for persistent immune activation in PIFS, but warrant further replication. Future studies should include better documentation of acute infection and PIFS case characterisation.<h4>Funding</h4>ARL is supported by a National Health and Medical Research Council Practitioner Fellowship (Grant 1041897). CXS is supported by a Cancer Institute New South Wales Early Career Fellowship (2021/ECF1310). BZK is supported by the National Institute of Allergy and Infectious Diseases (AI 105781). RAE is supported by the National Institute for Health and Care.

Also flagged:hemophilia Ahemophiliaarthropathyzinc finger nucleasemeganucleasetranscription activator-like endonuclease
Journal Article 2025-10-27 No Snippets VandenDriessche T, Janssens M, Chuah MK.
Show Full Abstract

The first gene therapy products for hemophilia A and B have recently been approved by the regulatory authorities. Although this is an important milestone for people with hemophilia, there is still a need to further improve on the efficacy, safety, and stability of expression and to ultimately include pediatric patients before the onset of arthropathy and other complications caused by uncontrolled bleeding. To overcome some of the limitations of conventional gene therapy strategies, gene editing is currently being explored in preclinical studies. Gene editing allows for targeted modifications of the human genome with unprecedented specificity based on zinc finger nuclease, meganuclease, transcription activator-like endonuclease, or clustered regularly interspaced short palindromic repeats (CRISPR) technologies that induce double-strand DNA breaks (DSB). Next-generation gene editing strategies, such as those dependent on CRISPR-derived base or prime editors, allow targeted genetic modification independent of the induction of DSBs, offering a potential safer alternative. Sustained efficacy and production of factor VIII or factor IX can be achieved after gene editing in patient-derived cells or in adult or newborn hemophilia A or B mouse models. These preclinical studies pave the way toward phase I/II clinical trials in patients with severe hemophilia. The potential risk of undesired off-target modifications of the human genome and adverse immune reactions, and the need for efficient delivery of the gene editing components, need to be rigorously addressed before the promise of gene editing for hemophilia can ultimately be fulfilled.

Also flagged:Endoplasmic ReticulumCancertumormetabolismimmune responsesEndoplasmic
Journal Article 2025-10-27 No Snippets Yu X, Li W, Sun S, Li J.
Show Full Abstract

Endoplasmic reticulum (ER) stress plays a pivotal role in tumor progression. As research in tumor biology advances, the relationship between ER stress and tumor initiation, development, and immune regulation has increasingly attracted attention. ER stress activates the unfolded protein response (UPR), thereby affecting key processes in tumor cells, including metabolism, proliferation, invasion, metastasis, and drug resistance. Moreover, it modulates tumor immune responses by regulating the functions of immune cells within the tumor microenvironment. This review consolidates the concept of ER stress as a central signaling hub that dictates cell fate and extensively remodels the tumor ecosystem. From a clinical perspective, this understanding provides a strong rationale for therapeutically targeting the UPR, suggesting that combining ER stress modulators with immunotherapy represents a promising strategy to overcome therapeutic resistance and improve patient outcomes.

TNFSF4
Also flagged:ferroptosistumorgynecological cancerdeathironcancer
Journal Article 2025-10-27 ✓ 1 Snippet Murakami H, Wang J, Yu H.
In-Text Gene Mentions

…TNFRSF8, TNFSF15, andTNFSF4between the two…

Show Full Abstract

<h4>Background</h4>Endometrial cancer (EC) is the most common gynecological cancer. Ferroptosis is a novel type of programmed cell death that is dependent on iron, and mounting evidence suggests that ferroptosis plays an important role in cancer. Long non-coding RNAs (lncRNAs) are known to regulate ferroptosis; however, little is known about the involvement of ferroptosis-related lncRNAs (FerlncRNAs) in EC. This study aimed to determine a FerlncRNA-based prognostic signature associated with the overall survival (OS) and clinicopathological characteristics of patients with EC.<h4>Methods</h4>Tumor transcriptomes and corresponding clinical data from patients with EC were downloaded from The Cancer Genome Atlas (TCGA) database, and the ferroptosis database, FerrDb, was used to identify ferroptosis-related genes (FRGs) (mRNAs). FerlncRNAs in EC were selected based on their correlations with FRGs. Univariate, multivariate, and least absolute shrinkage and selection operator (LASSO) Cox regression analyses were conducted to construct a prognostic model based on the FerlncRNAs signature. The EC patients were grouped into high- and low-risk categories based on the prognostic model risk score. Kaplan-Meier (K-M) survival analysis and time-dependent receiver operating characteristic (ROC) curves were used to evaluate the prognostic value of the risk scores. A predictive nomogram was then established. Gene set enrichment analysis (GSEA) was performed to explore the enriched pathways in the two risk groups. Finally, we compared the proportion of infiltrating immune cells and the expression of potential immune checkpoints between the two groups to understand the tumor immunological microenvironment associated with signature FerlncRNAs.<h4>Results</h4>We constructed a FerlncRNAs model to predict the prognosis of patients with EC. K-M analysis demonstrated that patients in the high-risk group had a worse OS. According to the ROC curves, our prognostic model had a better ability to predict the prognosis of patients with EC than other clinical factors. Moreover, the predictive nomogram suggested that our model could offer an independent prognostic evaluation with high accuracy. GSEA identified several enriched pathways in both groups. Finally, the immune microenvironment, including the infiltrating immune cells and immune checkpoints, showed several differences between the two groups.<h4>Conclusions</h4>This study revealed that a prognostic model based on 10 ferroptosis-related lncRNAs is useful for predicting the prognosis of patients with EC. Our findings provide novel directions for prognostic assessments, immunotherapies, and targeted treatments of EC.

CCPG1
Also flagged:melanomaskin tumorlocalizationEPS15L1HGSCo-localization
Journal Article 2025-10-27 ✓ 1 Snippet Xing J, Yang M, Chen M, Tao R.
In-Text Gene Mentions

…HGS, KEL andCCPG1may be associated…

Show Full Abstract

<h4>Background</h4>Cutaneous melanoma (CM) is a highly lethal skin tumor. Some patients respond poorly to existing therapies, and developing new targeted therapies remains challenging.<h4>Methods</h4>We combined the results of eQTLs, pQTLs, and genome-wide association study (GWAS) to identify potential causal effects of two target genes on CM, based on multi-omics Mendelian randomization (MR). Sensitivity analysis, co-localization analysis, and inverse MR analysis were also employed to verify the robustness of this causal relationship. Multi-omics data were then applied to explore the expression patterns of immune infiltration of the target genes and construct nomogram models.<h4>Results</h4>The results showed that the gene prediction levels of EPS15L1 and HGS were associated with an increased risk of CM. Co-localization analysis revealed significant horizontal pleiotropy of the target gene, and reverse MR showed unidirectional causality of the targets. Multi-omics analysis comprehensively demonstrated the expression regulation pattern of the target genes in the CM immune-environment and identified interactions between EPS15L1 (Q9UBC2) and HGS (O14964) and doxorubicin, demonstrating the potential for drug application. The validity of the targets was further verified by molecular biology experiments.<h4>Conclusion</h4>This study provides robust genetic and therapeutic evidence for targeting EPS15L1 and HGS in CM treatment.

Also flagged:bacterial infectioninfectioninfectionsmembranepolymerstumors
Journal Article 2025-10-27 No Snippets Fu YN, Yang J, Huang L, Liu F, Bu F, Kang X, Li G, Ren Q, Moriarty TF, Wang X.
Show Full Abstract

Multidrug-resistant (MDR) bacterial infections have emerged as a significant threat to global public health, with antibiotic resistance mechanisms-such as alterations in bacterial membrane permeability-substantially limiting therapeutic options and exacerbating infection persistence. In this study, we developed a novel self-carrier nanodrug formulation by directly assembling antibiotic tobramycin (Tob) and antimicrobial borneol 4-formylbenzoate (BF) into Tob-BF nanodrugs (TBN) <i>via</i> dynamic Schiff base linkages, without the need for additional adjuvants. The resultant TBN exhibits minimal bactericidal activity under physiological conditions but undergoes decomposition and activation specifically within the microenvironment of bacterial infections. Confocal microscopy analysis demonstrates that TBN is preferentially taken up and accumulates intracellularly in multidrug-resistant <i>Staphylococcus aureus</i> (MDRSA) to a greater extent than either Tob or BF alone. In both <i>in vitro</i> and <i>in vivo</i> assays, TBN outperforms Tob, BF, and physically mixed Tob + BF (with equal dose to TBN) in terms of antibacterial efficacy, particularly in promoting the recovery of xenograft infection with MDRSA in mice. Collectively, these findings highlight the potential of our self-carrier nanodrug platform, which integrates two distinct antibacterial agents, as an innovative and effective strategy to overcome tobramycin resistance in MDRSA and eliminate MDRSA infections.

HTT
Also flagged:medulloblastomabrain tumorcentral nervous systemtumorcell cycle checkpointssynaptogenesis
Journal Article 2025-10-27 ✓ 4 Snippets Le K, Voskamp S, Sharma V, Nelson J, Agarwal V.
In-Text Gene Mentions

…beta-estradiol, TP53 ,HTT, TBX3 ,…

…1.851), huntingtin (HTT; z-score 1.795),…

…Lastly,HTT, the gene…

HTTmay influence Wnt/β-catenin…

Show Full Abstract

<h4>Background</h4>Medulloblastoma is the most common malignant brain tumor of childhood, accounting for 25% of pediatric central nervous system (CNS) neoplasms. Although the cause of medulloblastoma is unclear, recent findings have contributed to treatment guidelines that emphasize the extent of disease, tumor resection margins, and age of onset. This study synthesizes available evidence to provide further insight into associated genetic markers and associated pathways that may be leveraged for individualized therapy.<h4>Methods</h4>The Search Tag Analyze Resource for NCBI's Gene Expression Omnibus (STARGEO) was utilized to identify 480 medulloblastoma tumor samples and 62 healthy adult and pediatric cerebellum samples. Pathway analysis was conducted using Ingenuity Pathway Analysis (IPA) and restricted to genes with a statistically significant difference (P<0.05) between medulloblastoma and control and an absolute experimental log ratio greater than 0.2.<h4>Results</h4>Overall, 4,142 genes met the inclusion criteria. Genes previously described in the context of medulloblastoma, such as <i>SOX11</i>, <i>TBR1</i>, <i>VSNL1</i>, <i>PVALB</i>, as well as novel gene targets such as <i>LHX2</i>, <i>UBE2C</i> and <i>HEPACAM</i> were among the differentially expressed genes identified. The top canonical pathways associated with medulloblastoma were cell cycle checkpoints, synaptogenesis signaling and pathway, mitotic metaphase and anaphase, glutaminergic receptor signaling pathway, and mitotic prophase. The top upstream regulators were beta-estradiol, <i>TP53</i>, <i>HTT</i>, <i>TBX3</i>, and <i>TGFB1</i>. Some of the diseases and biological functions predicted as activated with medulloblastoma based on the differential genetic expression include motor dysfunction or movement disorder and cell proliferation of tumor cell lines, whereas those predicted as inhibited include coordination and misalignment of chromosomes.<h4>Conclusions</h4>Utilizing STARGEO is an effective method for leveraging genomics metadata to highlight novel and previously described pathways and regulators associated with medulloblastoma. By providing an enhanced understanding of the pathophysiology of medulloblastoma, this study provides a framework for future validation studies-the next step toward identifying target genes and biomarkers for screening, prognostication, and targeted treatment for medulloblastoma.

Also flagged:transplantimmune responsesextracellularadaptive immunityinfectioninflammatory responses
Journal Article 2025-10-27 No Snippets Yu S, Zhang M, Dou Z, Tian B, Lu J.
Show Full Abstract

Organ transplantation is an effective treatment for end-stage organ failure, but rejection remains a major obstacle to transplant success. Neutrophils play a key role in organ transplant rejection, participating not only in early immune responses but also exacerbating graft injury through mechanisms such as the release of neutrophil extracellular traps (NETs). Therefore, in-depth exploration of the immunological role of neutrophils in transplant rejection and their interactions with other immune cells is highly important. This article reviews the latest research progress on the mechanisms of action of neutrophils in transplant rejection and their impact on grafts while also assessing the clinical application prospects of immunosuppressive strategies targeting neutrophils and NETs. By integrating current basic and clinical research findings, this article aims to provide theoretical support and new research directions for the diagnosis and treatment of neutrophil-related rejection, with the goal of improving organ transplant success rates and patient quality of life.

HFE
Also flagged:Budd Chiari syndromeascitesBudd-Chiari syndromevascular liver diseaseconstrictive pericarditisright heart failure
Journal Article 2025-10-27 ✓ 2 Snippets Ali Bakry AH, Bashir A, Almuqbil N, Alamin A, Fadulelmulla IA, ALMansour AGM, Omer AM, Bairam HH, Sulieman A, Hamd ZY.
In-Text Gene Mentions

…congestive heart failure,hemochromatosis, biliary atresia, congenital…

…errors of metabolism,hemochromatosisand drug-induced hepatitis…

Show Full Abstract

<h4>Purpose</h4>Different hospitals in Sudan detected a rare condition of liver vascular abnormalities characterized by vascular outflow impairment. The study aimed to describe the common radiological features of Budd Chiari syndrome and determine which feature is most frequently employed to characterize this condition during imaging techniques, primarily contrast-enhanced computed tomography (CECT) scans.<h4>Materials and methods</h4>The study was conducted between March 2023 and June 2024 at Kuwaiti Specialized Hospital (KSH) and other diagnostic centers using a liver protocol on a CT machine (Optima 520 GE-CT machine, 16 slices). The study was a retrospective, cross-sectional, and review-based analysis of a rare study type carried out to characterize the state of BCS in Sudan; the CT scan's findings on the liver, HVs, IVC, and abdomen were carefully assessed. The age range of the 61 patients who underwent a successful triphasic CT abdomen for the liver was 2-78 years.<h4>Results</h4>The findings indicate that: the majority of patients 57.4% were male, the most common age groups were 39-52 years old, and the mean age at diagnosis was 45 years. BCS is primarily caused by hepatic veins (HVs) thrombosis, which is observed in 18.03% of cases, and HVs are not seen in 55.73% of cases. Liver parenchymal enhancement appears heterogenous in 27.87%, while heterogeneously enlarged liver was seen in 24.59%, and cirrhotic in 14.75% of BCS patients. In comparison, 59.01 percent of BCS patients arrived without varices. Varices were observed in the splenorenal and gastroesophageal regions in 37.7% of cases. Ascites accounted for the majority of BCS complications 73.77%, with SM vein blockage and squeezed duodenum accounting for 3.27% of each complication. The likelihood of developing ascites increases with age, and it is most common in patients between the ages of 39 and 52 years. Patient age had the greatest effect on the development of ascites.<h4>Conclusion</h4>The common features of BCS as revealed by contrast-enhanced CT of the liver are non-visible HVs, venous occlusion at either level of HVs or IVC, caudate lobe enlargement, heterogenous, normal or enlarged liver, collateral venous varices at the splenorenal and gastroesophageal region, and ascites.

HFE
Also flagged:Metabolic DysfunctionSteatotic Liver DiseaseSarcopenialiver diseasesmetabolic dysfunction-associated steatotic liver diseasesteatosis
Journal Article 2025-10-27 ✓ 1 Snippet Almeida NS, Rocha R, Daltro C, Cotrim HP.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis), hypothyroidism, pregnant an…

Show Full Abstract

<b>Background</b>: Sarcopenia is a clinical condition linked to various liver diseases, including metabolic dysfunction-associated steatotic liver disease (MASLD). MASLD includes a spectrum from steatosis to steatohepatitis, which may progress to fibrosis, cirrhosis, and hepatocellular carcinoma. The influence of dietary habits and nutrient intake on MASLD and its progression is well-established. However, the association between dietary consumption and sarcopenia in MASLD patients remains underexplored. This study evaluated whether there is an association between sarcopenia and habitual food consumption in MASLD patients. <b>Methods:</b> A cross-sectional study was conducted with outpatients diagnosed with MASLD. Sarcopenia was defined based on the 2019 EWGSOP2 criteria. Dietary intake was assessed using three 24 h recalls per patient, with intrapersonal variance corrected using the Multiple Source Method (MSM) software (Version 1.0.1). Steatosis was diagnosed via upper abdominal ultrasound, and the Fibrosis-4 Index (FIB-4) was used to assess hepatic fibrosis. <b>Results:</b> MASLD patients (<i>n</i> = 76) were evaluated. The mean age was 52.9 (SD, 12.0) years, and 75.0% were female. Two had sarcopenia, and 27.6% (<i>n</i> = 21) had probable sarcopenia (characterized by low muscle strength only). Among probable sarcopenia, F1-F2 were observed in 61.9%, and 23.8% had indeterminate FIB-4 grades. Calcium intake was lower among patients with probable sarcopenia than those no sarcopenia (<i>p</i> = 0.04). <b>Conclusions:</b> In these MASLD patients, only two patients were diagnosed with sarcopenia, and around a third had probable sarcopenia. The majority of MASLD patients with lower calcium, energy, and protein intake, but only lower calcium intake in those with probable sarcopenia.

PRDX6
Also flagged:GAPDHPeriodontitisPDinflammatory diseaseglyceraldehyde-3-phosphate dehydrogenasecytoplasmic
Journal Article 2025-10-27 ✓ 1 Snippet Bellei E, Bergamini S, Salvatori R, Bertoldi C.
In-Text Gene Mentions

…tase (SOD2), peroxiredoxin-6 (PRDX6), protein S100-A9, heat…

Show Full Abstract

Periodontitis (PD) is a multifactorial, progressive inflammatory disease affecting the teeth-supporting tissues, characterized by an imbalance of the oral microbiota and the presence of bacterial biofilms leading to host response. Nowadays, reliable biochemical markers for early and objective diagnosis, and for predicting disease progression, are still lacking. Our previous proteomic investigations revealed the significant overexpression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in periodontal pocket tissue, gingival crevicular fluid (GCF), and tooth-surface-collected material (TSCM) from PD patients in comparison to periodontally healthy controls, proposing it as a possible biomarker of PD. This study aimed to evaluate the expression of GAPDH in saliva, a more accessible, non-invasive, and clinically relevant oral sample. The whole saliva was analyzed by a preliminary mass spectrometry-based proteomic approach, identifying significantly increased levels of GAPDH also in salivary samples from periodontal-affected subjects. These data were further validated by enzyme-linked-immunosorbent assay (ELISA). Additionally, protein-protein interaction networks were generated through the Human Protein Atlas database, using different datasets (OpenCell, IntAct, and BioGRID). Bioinformatic analysis provided noteworthy GAPDH-associated networks potentially relevant to periodontal pathology. The scientific significance of this study lies in the detection of salivary GAPDH as a novel strategy to advance periodontal clinical diagnostics from the perspective of a non-invasive screening test. In correlation with other protein markers, salivary GAPDH could constitute a promising set of distinctive and predictive targets to enhance early diagnosis of PD, disease monitoring, and treatment planning in periodontology.

HFE
Also flagged:COVID-19liver fibrosishyaluronic acidcytokeratin 18cardiovascular diseasessteatosis
Journal Article 2025-10-27 ✓ 1 Snippet Vanaga I, Kolesova O, Kolesovs A, Radzina M, Putrins DS, Egle J, Laivacuma S, Storozenko J, Viksna L.
In-Text Gene Mentions

…fection, autoimmune hepatitis,hemochromatosis, Wilson’s disease, and…

Show Full Abstract

<b>Objectives:</b> This study aimed to assess the dynamics of liver tests (LT) and detect signs of liver fibrosis and steatosis 2.5 years after the first COVID-19 episode in patients without pre-existing liver-related conditions. <b>Methods:</b> The study included 65 adult patients hospitalized with COVID-19 (including 18 with severe or critical illness) in 2020. After 2.5 years, in addition to regular LT, liver health status was assessed by the FIB-4 index, hyaluronic acid, cytokeratin 18 fragment M30 (serum, ELISA), cardiometabolic risk factors, and the multiparametric ultrasound examination. <b>Results:</b> LT abnormalities in the acute COVID-19 period were observed more frequently (<i>p</i> = 0.036) in patients with severe or critical COVID-19 (83%) than in patients with non-severe COVID-19 (55%). LT dynamics in 2.5 years showed an improvement of liver health status in most patients (<i>p</i> = 0.006). Persistent LT abnormalities were associated with LT abnormalities during hospitalization (<i>p</i> = 0.021). After 2.5 years, the presence of cardiometabolic risk factors and signs of liver fibrosis were associated with the severity of the first COVID-19 episode. However, regression analyses did not support disease severity as a predictor for LT abnormalities and liver stiffness. The latter was predicted by cardiovascular diseases in the anamnesis. <b>Conclusions:</b> In most patients, LT normalized despite potential risk factors. Simultaneously, in some patients, signs of liver fibrosis after COVID-19 might be stimulated by COVID-19-related metabolic dysfunction and the presence of cardiovascular diseases.

VRK2
Also flagged:Methylationimmune responsesCOVID-19type I interferonsinflammatory responsesmethylations
Journal Article 2025-10-27 ✓ 2 Snippets Govender M, Das J, Hopkins FR, Svanberg C, Nordgren J, Hagbom M, Klingström J, Nilsdotter-Augustinsson Å, Yong YK, Velu V, Raju S, Sjöwall J, Shankar EM, Nyström S, Larsson M.
In-Text Gene Mentions

…ROCK1, IFNGR1, CFAP61,VRK2, and C6orf138 and…

…ROCK1, IFNGR1, CFAP61,VRK2, and C6orf138 (…

Show Full Abstract

SARS-CoV-2 infection remains a global health concern, with its impact on host immune responses not fully understood. In a case-control study, we examined how COVID-19 affects DNA methylation patterns in the upper respiratory airway of hospitalized individuals. DNA methylation arrays were performed on nasopharyngeal samples at inclusion/hospitalization and 6 weeks post-inclusion. We found a distinct DNA methylation pattern in COVID-19 patients compared to healthy controls, identifying 510,099 differentially methylated CpGs. Within the transcription start sites (TSSs) and gene body, COVID-19 patients displayed a higher number of genes/CpGs with elevated methylation levels. Enrichment analysis of TSS-methylated genes revealed effects of SARS-CoV-2 on genes associated with type I interferons, anti-viral and inflammatory responses, and immune functions. Some CpG methylations were transient, and normalized at group level by 6 weeks post-inclusion. Several IFN-regulated genes, including OAS1, OAS3, IFIT3, and MX1, were identified. Among the top regulators were IL17A and ERK1/2, both involved in inflammatory processes. Networks nodes included IGF1 and EGF, associated with processes including tissue repair and activation of immune responses. Overall, our data suggests that COVID-19 can impact the upper airway by modifying gene methylation patterns. This could have implications for conditioning of the airways, how individuals respond to future airway infections, and therapeutic interventions.

Also flagged:Oral squamous cell carcinomaOSCCoral canceroralalcoholpapillomavirus
Journal Article 2025-10-27 No Snippets Lee J, Roh JL.
Show Full Abstract

Ferroptosis, an iron-dependent form of regulated cell death characterized by lipid peroxidation, has emerged as a pivotal vulnerability in oral squamous cell carcinoma (OSCC). This review provides an overview of ferroptosis mechanisms and their implications for OSCC pathobiology and therapy. OSCC cells exhibit heightened reliance on anti-ferroptotic defenses such as GPX4, SLC7A11, FSP1, and Nrf2, and disrupting these pathways suppresses tumor growth and restores sensitivity to chemotherapy, radiotherapy, and immunotherapy. Genetic and epigenetic regulators, including p53, PER1, circ_0000140, and STARD4-AS1, critically modulate ferroptotic sensitivity, while metabolic enzymes such as ACSL4, LPCAT3, and TPI1 link ferroptosis to cellular plasticity and resistance. Preclinical studies highlight the promise of small-molecule inhibitors, repurposed agents (e.g., sorafenib, artesunate, trifluoperazine), natural compounds (e.g., piperlongumine, Evodia lepta, quercetin), and nanomedicine platforms for targeted ferroptosis induction. We further address ferroptosis within the tumor microenvironment, highlighting its immunogenic and context-dependent dual roles, and summarize genomic and transcriptomic evidence linking ferroptosis-related genes to patient prognosis. Beyond cancer, ferroptosis also contributes to non-malignant oral diseases, including pulpitis, periodontitis, and infection-associated inflammation, where inhibitors may protect tissues. Despite these advances, clinical translation is constrained by the lack of safe ferroptosis inducers and validated biomarkers. Future research should focus on developing pharmacologically viable GPX4 inhibitors, refining biomarker-driven patient stratification, and designing multimodal regimens that combine ferroptosis induction with standard therapies while preserving immune and tissue integrity. Ferroptosis therefore represents both a mechanistic framework and a translational opportunity to reshape oral oncology and broader oral disease management.

TNFSF4
Also flagged:colorectal cancerGene ExpressionTGF-β-valproic acidcyclosporine
Journal Article 2025-10-27 ✓ 1 Snippet Chen X, Zhou Y, Li H, Guo W, Li S, Zhang Z, Tang Q.
In-Text Gene Mentions

…SIGLEC15, NPR1, LAIR1,TNFSF4, ADORA2A, CD276, TNFSF14,…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) represents a huge global health challenge characterized by significant morbidity and mortality. The urgent need to identify biomarkers through integrative validation research to enhance diagnostic accuracy and prognostic stratification has prompted the exploration of immune and prognostic genes. This study aimed to systematically identify differentially expressed genes (DEGs) associated with both immunity and prognosis in CRC, validate their clinical significance, and construct a reliable prognostic model.<h4>Methods</h4>This research sought to identify DEGs associated with immunity and prognosis in CRC. We examined clinical and RNA sequencing data from 698 CRC patients obtained from The Cancer Genome Atlas (TCGA). Utilizing the Xiantao Academic Platform, we conducted differential expression analysis and identified hub genes associated with immunity and prognosis through Least Absolute Shrinkage and Selection Operator (LASSO) and Cox regression analyses, alongside five machine learning algorithms to construct a prognostic model. The hub genes were validated using the Gene Expression Omnibus (GEO) database, molecular docking, molecular dynamics simulation, single-cell and spatial transcription analyses.<h4>Results</h4>LASSO and Cox regression analyses, along with five machine learning algorithms, were employed to identify significant genes linked to immunity and prognosis, yielding three hub genes: <i>ULBP2</i>, <i>INHBB</i>, and <i>STC2</i>. Validation of these genes in the GEO dataset GSE21815 demonstrated significant diagnostic performance, with area under the curve (AUC) values of 0.908, 0.742, and 0.934, respectively. A prognostic model integrating clinical factors and hub genes was developed, demonstrating high predictive accuracy for 1-, 3-, and 5-year survival rates. Further analysis revealed significant enrichment in the TGF-β signaling pathway and natural killer cell-mediated cytotoxicity, as evidenced by Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. The single-sample Gene Set Enrichment Analysis (ssGSEA)-based immune infiltration analysis revealed immune infiltration differences between groups with high and low immune phenotype scores. Molecular docking and dynamics simulations revealed valproic acid, cyclosporine, and genistein as potential therapeutic compounds with strong binding affinities to the hub genes. Single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics provided insights into hub gene expression patterns and interactions within the tumor microenvironment.<h4>Conclusions</h4>This comprehensive study highlights the potential of <i>ULBP2</i>, <i>INHBB</i>, and <i>STC2</i> as promising biomarkers for CRC, emphasizing their roles in regulating tumor progression and immune responses. Future studies should focus on targeted therapeutic strategies that utilize these biomarkers to enhance treatment efficacy and patient prognosis.

TNFSF4
Also flagged:chaperonemicrotubulehepatocellular carcinomatumorGene Expressionsorafenib
Journal Article 2025-10-27 ✓ 1 Snippet Zhang X, Li P, Zhao H.
In-Text Gene Mentions

…, CD86 ,TNFSF4, HAVCR2 ,…

Show Full Abstract

<h4>Background</h4>CCT4 is a key molecular chaperone and its dysfunction may impair actin or microtubule assembly, potentially driving hepatocellular carcinoma (HCC) progression. However, its roles in multiple cell types and tumor microenvironment infiltration in HCC remain unclear. This study aimed to investigate the biological functions of <i>CCT4</i> in HCC by integrating single-cell and bulk transcriptomic data.<h4>Methods</h4><i>CCT4</i> expression in HCC was analyzed using The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases. Functional analyses were conducted via Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Gene Set Enrichment Analysis (GSEA). Furthermore, Cox regression analysis and nomogram construction were employed to assess patient prognosis. Immune infiltration was evaluated with CIBERSORT, and drug sensitivity was tested using the CellMiner database. Hepatocyte features were analyzed using single-cell RNA-seq tools, including Cellular Trajectory Reconstruction Analysis using gene Counts and Expression (CytoTRACE) for stemness and CellChat for cell-cell communication.<h4>Results</h4><i>CCT4</i> showed significant overexpression in HCC tissues and was associated with clinical features such as age and tumor node metastasis (TNM) stage. Functional analyses linked co-expression genes of <i>CCT4</i> to ribosomal biogenesis and protein folding. Cox regression and nomograms confirmed <i>CCT4</i> as an independent prognostic factor for HCC. Correlations with nine immune cell types were observed through immune infiltration analysis. Drug sensitivity analysis revealed that HCC patients with high expression of <i>CCT4</i> were resistant to sorafenib and other drugs. Single-cell analysis revealed that elevated <i>CCT4</i> expression was enriched in pro-metastatic hepatocyte clusters, associated with increased hepatocyte proportions and poor differentiation, with weakened T/natural killer (NK) cell interactions in tumors.<h4>Conclusions</h4><i>CCT4</i> is overexpressed in HCC, linked to poor prognosis, and may drive tumor progression via pro-metastatic hepatocyte dedifferentiation and immune shifts.

SERPINC1
Also flagged:Cognitive ImpairmentType 2 Diabetesageingobesitydementiacognition
Journal Article 2025-10-27 ✓ 2 Snippets Chatterjee S, Bhattacharjee R, Maiti A, Mondal M, Hait S, Dubey S.
In-Text Gene Mentions

…scores (p=0.040), lowerACE-IIItotal scores (p=0.049)…

…its inherent limitations,ACE-IIIremains one of…

Show Full Abstract

With an ageing global population, the triad of type 2 diabetes (T2D), obesity and dementia poses a growing public health challenge. India harbours a notable proportion of younger patients with T2D with a non-obese or lean phenotype. However, data remain scarce on the impact of adiposity on cognition in T2D, particularly when assessed using a comprehensive, culturally and linguistically adaptable cognitive battery in a cohort free from major confounding factors. The aim of this study is to examine the relationship between various anthropometric indices and cognitive performance in patients with T2D. This cross-sectional observational study was conducted at the diabetic clinic of a tertiary hospital from 2022 to 2024. Eligible participants were patients with T2D aged 20-60 years with at least primary education. Exclusion criteria included non-T2D diagnosis, inability to communicate in Bengali and conditions known to impair cognition. A total of 125 patients with T2D were recruited. Demographics, diabetes-related variables and anthropometric measurements were recorded. Cognitive function was assessed using the Bengali version of the Addenbrooke's Cognitive Examination (ACE-III). Statistical analysis was performed using Jeffreys' Amazing Statistics Program (v.0.19). ACE-III total scores showed significant positive correlations with height, weight and neck circumference (NC) (p<0.001 for each). Attention was positively associated with height, weight, NC, neck-height ratio (NHR) and negatively with weight-adjusted waist index (WWI) (p<0.05 for all). Memory correlated positively with height and weight (p<0.05 for both). Language was positively related to height, weight and NC (p<0.05 for all) and negatively to WWI (p=0.011). Visuospatial ability positively correlated with height, weight, waist circumference (WC), hip circumference (HC), NC and NHR (p<0.05 for all). Lean patients with T2D had significantly lower visuospatial scores (p=0.040), lower ACE-III total scores (p=0.049) and a greater prevalence of cognitive impairment (p=0.032). In multiple linear regression, height (p=0.014) and HC (p=0.024) were independent predictors of ACE-III total score. This is the first Indian study to evaluate the association between anthropometric measures and cognition in T2D. Cognitive impairment and dementia were more prevalent in lean than in obese patients with T2D. Future studies incorporating imaging-based body composition analysis are warranted to identify modifiable anthropometric risk factors for cognitive decline in T2D.

Also flagged:galactosepolysuccinimidehydroxyapatitedoxorubicinliver cancerpolyethylene glycol
Journal Article 2025-10-27 No Snippets Gao J, Zhang W, Wang Q, Cao J, Zhu Y, Liu G, Jia Y, Yu F.
Show Full Abstract

To mitigate the adverse effects of doxorubicin (DOX) during the treatment of liver cancer, this study aimed to develop a novel DOX-encapsulated active-targeted nanodelivery system. The auxiliary materials hydroxyapatite (HAP), polysuccinimide (PSI), galactose-modified polyethylene glycol (Gal-PEG), PSI covalently linked with three different mole ratios of polyethylene glycol (PEG-PSIs), and galactose covalently linked with PEG-PSIs (Gal-PSIs) were synthesized and structurally characterized. The Box-Behnken and Three-Level Factorial Design response surface methodologies were employed to optimize the formulations and synthesis protocols for DOX@HAP/PSI (DOX@DC, where DC denotes the drug carrier), DOX@PEG-DCs, and DOX@Gal-DCs. The in vitro drug release and in vivo tissue distribution of each formulation were examined. Furthermore, in vitro studies were conducted to examine the effects of these formulations on the proliferation, apoptosis, and migration of Huh-7 liver cancer cells. The formulations and synthesis protocols for different DOX-based preparations were optimized. All nanoparticles gradually released DOX at pH levels >5, with the release rate increasing with the pH value. Among the tested formulations, DOX@Gal-DC20 (mole ratio of Gal-PEG to PSI = 1:20) showed the best hepatic targeting in mice in vivo. Furthermore, in vitro pharmacodynamic experiments indicated that Gal-DC20 had low cytotoxicity, could be taken up by cancer cells, and could significantly inhibit the proliferation of Huh-7 cells. Hemolysis experiments confirmed that none of the prepared formulations induced hemolysis. The novel nanodelivery system established in the study (DOX@Gal-DC) is simple to prepare and shows significant hepatic targeting.

DCC
Also flagged:oxygenblood vesselVascular diseasesvenous disordersdysfunctionthrombosis
Journal Article 2025-10-27 ✓ 1 Snippet Jiang X, Hu L, Lai J, Ge S, Chen H, Yang X, Lin X.
In-Text Gene Mentions

…They explored Rebastinib (DCC-2036), a potent and…

Show Full Abstract

The vascular system plays a crucial role in maintaining homeostasis, ensuring the supply of oxygen and nutrients to tissues, while facilitating the removal of metabolic waste. Additionally, it contributes to immune defense, temperature regulation, and the transport of hormones and signaling molecules. Vascular anomaly (VA) arises due to developmental abnormalities or functional defects in the vessels. This review describes venous malformations (VM), a rare disorder predominantly caused by somatic mutations. Advances in recent research have substantially improved our understanding of the molecular mechanisms underlying these malformations, largely through the identification of their genetic origins and the study of animal models and endothelial cells derived from patients. Most of the somatic mutations associated with venous malformations affect genes within oncogenic growth factor signaling pathways, making it possible to repurpose certain cancer therapies to treat these VAs. This article summarizes the key molecular findings and explores emerging therapeutic strategies aimed at novel targets.

OLFM4
Also flagged:SepsisAcute Kidney Injuryrenal dysfunctionTLRNF-κBcytokine
Journal Article 2025-10-27 ✓ 3 Snippets Zhang Z, Sheng M, Bao Y, Tang C.
In-Text Gene Mentions

…Bcl-2 dysregulation andOLFM4; and emerging processes…

…Biomarkers like urinaryOLFM4, DKK3, NGAL, and…

…proteins and olfactomedin-4 (OLFM4), contribute to renal…

Show Full Abstract

Sepsis-associated acute kidney injury (SA-AKI) is a prevalent and life-threatening complication in critically ill children, contributing to high mortality rates (up to 30%) and long-term renal dysfunction in pediatric intensive care units. This review synthesizes recent advances in the signalling pathways underlying SA-AKI, emphasizing pediatric-specific mechanisms, biomarkers, and therapeutic targets. This review covers inflammatory cascades via TLR/NF-κB leading to cytokine storms (IL-6, TNF-α); apoptosis and necrosis involving mitochondrial Bcl-2 dysregulation and OLFM4; and emerging processes like pyroptosis (NF-κB-mediated), metabolic reprogramming (choline deficiency and Nrf2-mitophagy), and novel routes such as cGAS-STING and TGF-β signalling. Biomarkers like urinary OLFM4, DKK3, NGAL, and serum suPAR, alanine, and Penkid enable early diagnosis and risk stratification, with models like PERSEVERE-II enhancing prognostic accuracy. Therapeutic strategies include fluid optimization, renal replacement therapies (CRRT, SLED-f), and pathway-targeted interventions such as choline supplementation, oXiris for cytokine removal, Humanin for immunomodulation, and investigational cGAS-STING inhibitors. Despite progress, challenges persist in translating animal models to pediatric trials and addressing heterogeneity. Integrating multi-omics and precision medicine holds promise for improving outcomes, underscoring the need for multicenter studies in children.

Also flagged:DDR4
Journal Article 2025-10-27 No Snippets Qin B, Qin H, Fang C, Zhao L, Poechmueller P.
Show Full Abstract

This paper presents the design of a Delay-Locked Loop (DLL) with a simple architecture and a wide input clock duty cycle range. The design is tailored to meet the increasing data rate and stringent clock requirements of modern semiconductor chips, with particular applicability to dynamic random-access memory (DRAM) systems. The structure features two Bang-Bang Phase Detectors (BBPDs) to adjust the rising and falling edges of the divided clock. Implemented using a 65 nm CMOS process, the design was verified through simulation. At a working frequency of 3.2 GHz, the input clock duty cycle range spans from 18% to 72%, with a maximum output clock duty cycle error of just 0.6%, a peak-to-peak jitter of 15.73 ps, and a power consumption of 12.7 mW.

Also flagged:transposition of the great arteriespersistent pulmonary hypertensioncongenital heart diseaseoxygenhypertensionventricular septal defect
Journal Article 2025-10-27 No Snippets Weeda JA, Te Pas AB, Nagy Z, Kovács GH, Szabó M, Leipold G, Baik-Schneditz N, Schwaberger B, Heiring C, Malchau Carlsen EL, Haak MC, Blom NA, Hooper SB, Dekker J, van der Palen RLF.
Show Full Abstract

At birth, major circulatory and pulmonary adaptations are required for a successful foetal-to-neonatal transition. In newborns with transposition of the great arteries (TGA), this transition is often impaired, leading to severe hypoxemia. This may also result in persistent pulmonary hypertension of the newborn (PPHN), worsening hypoxemia, and increasing the risk of urgent invasive interventions after birth. Physiological-based cord clamping (PBCC), delaying cord clamping until after lung aeration and ventilation are established, promotes a more stable circulatory transition and has shown benefits in both preterm and term neonates. PBCC may also provide advantages in infants with congenital heart disease. In TGA, combining PBCC with early supplemental oxygen may reduce the incidence and severity of PPHN, decrease related complications, and minimize the need for invasive interventions. To evaluate the feasibility, safety, and clinical outcomes of the stabilisation approach, we have initiated a stepwise quality improvement initiative comprising 2 sequential studies. Study phase 1, a single-centre study at Leiden University Medical Centre will assess feasibility, protocol adherence, and safety. Study phase 2, an observational cohort study across multiple European centres will evaluate clinical outcomes, focusing on incidence and severity of PPHN and the need for urgent interventions. All TGA newborns will be stabilised with an intact umbilical cord while receiving 2 L/min nasal high flow (fraction of inspired oxygen 1.0) as supplemental oxygen. Cord clamping will occur once the infant is considered stable, defined as a heart rate >100 bpm and preductal SpO<sub>2</sub> >75% with supplemental oxygen. This study will inform guidelines for delivery room management and early preoperative care in TGA newborns.

RC3H1
Also flagged:transcription factorCD8CCR7CD4interferonIFN
Journal Article 2025-10-27 ✓ 1 Snippet Zhao JF, Zhen C, Wang YY, Zhou MJ, Sun YB, Huang HH, Jiao YM, Song JW, Fan X, Zhang X, Jiang TJ, Zhang C, Wang FS.
In-Text Gene Mentions

…, TGFBR2 ,RC3H1, PSMB10 ,…

Show Full Abstract

<h4>Background</h4>Immunometabolism plays a vital role in the immunopathogenesis of people living with human immunodeficiency virus type 1 (HIV-1) (PLWH). However, the precise relationship between metabolic profiles and T-cell dysfunction in this population remains unclear. This study aimed to investigate the metabolic reprogramming and underlying mechanisms contributing to T-cell dysfunction in PLWH, highlighting potential pathogenic mechanisms during chronic HIV-1 infection.<h4>Methods</h4>This study re-analyzed single-cell RNA sequencing data from the Genome Sequence Archive of the Beijing Institute of Genomics Data Center, Chinese Academy of Sciences. The dataset comprised samples from healthy donors (HD), HIV-1-infected treatment-naive patients (TN), and patients undergoing antiviral therapy. Various analytical approaches-including functional analysis, transcription factor analysis, network analysis, and enrichment analysis-were performed to assess T-cell functional and metabolic characteristics, as well as to identify potential targets within metabolic-epigenetic or non-epigenetic regulatory axes involved in T-cell dysfunction.<h4>Results</h4>By analyzing the transcriptional profiles, a total of 58,752 CD4<sup>+</sup> T cells and 68,907 CD8<sup>+</sup> T cells were identified and annotated. Among these, the naive subset CD8-CCR7 was significantly reduced in TN patients compared to HD (<i>P</i> < 0.05), whereas CD4-CCR7 showed a decreasing trend. Conversely, the effector subset CD8<sup>+</sup> activated effector/memory T cells (CD8-EMRA) were significantly increased in TN patients (<i>P</i> < 0.05), while cytolytic CD4<sup>+</sup> T cells (CD4-CTL) displayed an increasing trend. ART did not effectively reverse these alterations. Additionally, naive subsets and CD8-EMRA cells were associated with disease progression. Further analysis revealed that naive subsets exhibited hyper-activation and increased differentiation, whereas effector subsets showed excessive activation and a strong interferon (IFN) response in PLWH compared to HD (<i>P</i> < 0.05). Intriguingly, we observed substantial metabolic alterations linked to immune dysfunction within the four T-cell subsets. Specifically, elevated levels of the methyltransferases absent, small, or homeotic-like 1 (<i>ASH1L</i>) and SET domain containing 1B (<i>SETD1B</i>) may have promoted the differentiation and exhaustion of the CD4-CCR7 subset via the ASH1L/SETD1B-H3K4me3-FOXP1 axis. These enzymes were also associated with the exhaustion of CD8-CCR7 cells in TN patients through ASH1L/SETD1B-H3K4me3 axis. Additionally, isocitrate dehydrogenase 2 (IDH2)-mediated production of α-ketoglutarate (α-KG) may have contributed to the dysfunction of CD8-CCR7 cells by activating Janus kinase (JAK)-signal transducer and activator of transcription (STAT)3-dependent interferon signaling during HIV-1 infection. Conversely, increased activity of SET domain containing 2 methyltransferase was closely linked to hyperactivation, a strong type I interferon response, and cellular senescence in CD4-CTL cells from TN patients. Furthermore, heightened expression of solute carrier family 7 member 5 correlated with exhaustion of effector subsets in TN individuals. The IDH2-STAT1 axis may have also played a crucial role in driving the over-activation and exhaustion of CD8-EMRA cells through interferon signaling pathways.<h4>Conclusion</h4>These findings indicate that amino acid- and IDH2-related metabolism may contribute to the dysfunction of both naive and effector subsets by metabolic-epigenetic or non-epigenetic regulatory axes in PLWH.

Research Square 2025-10-27 Preprint (No Snippets API) Ngo HTT, Vu HA, Doan TTP, Dang M, Ho PTH, Nguyen DD.
Show Full Abstract

<title>Abstract</title> <p> Background: Telomerase reverse transcriptase ( <italic>TERT</italic> ) promoter mutation is among the most frequent genetic alterations in hepatocellular carcinoma (HCC), closely associated with tumor initiation, progression, and early recurrence; however, its prognostic role remains unclear. This study aimed to investigate the prevalence of <italic>TERT</italic> promoter mutations in HCC and evaluate their association with early recurrence, with emphasis on clinicopathological subgroup differences.. <h4>Materials and Methods:</h4> We retrospectively analyzed 108 patients with histologically confirmed HCC who underwent curative hepatectomy. <italic>TERT</italic> promoter mutations were identified via Sanger sequencing. The risk of early recurrence, defined as tumor relapse within 24 months after surgery, was assessed using Cox proportional hazards models, including subgroup analyses. <h4>Results:</h4> <italic>TERT</italic> promoter mutations were present in 45.4% of patients. While not predictive of early recurrence in the overall cohort (HR = 1.39; 95% CI: 0.76–2.56; p = 0.282), mutation status was significantly associated with reduced RFS in specific subgroups: patients <60 years (HR = 3.45; 95% CI: 1.22–9.82; p = 0.020), males (HR = 2.03; 95% CI: 1.02–4.02; p = 0.043), and those with high mitotic activity (HR = 3.60; 95% CI: 1.01–12.80; p = 0.047).. <h4>Conclusion:</h4> Although <italic>TERT</italic> promoter mutations did not predict early recurrence in the overall cohort, they were significantly associated with poorer recurrence-free survival in defined clinical and pathological subgroups. These findings suggest the context-dependent prognostic value of TERT promoter mutations and may support their potential role in individualized risk stratification following curative resection in HCC. </p>

bioRxiv 2025-10-27 Preprint (No Snippets API) Giuliani S, Chhatbar K, Wear M, Guy J, Mathieson T, Burdett H, George L, Alston G, Spanos C, McHugh T, Kelly D, Pantier R, Bird A.
Show Full Abstract

Spalt-like (SALL) proteins are C2H2 zinc-finger transcription factors important for embryogenesis, with mutations in SALL1 and SALL4 causing rare congenital disorders Townes-Brocks and Okihiro syndromes, respectively. While SALL proteins are known to associate with one another, the biological significance of the resulting complexes is unknown. Here we define a conserved glutamine-rich region that mediates SALL1/4 homo- and heterotetramerisation and find that complex formation is indispensable for DNA binding. Modelling a patient mutation that abolishes SALL4 multimerisation led to gene misregulation and, in mice, embryonic lethality, therefore phenocopying a complete Sall4 knockout. Furthermore, a common disease-causing SALL1 truncation, which retains multimerisation but lacks DNA-binding domains, sequesters SALL4 into heterotetramers that are defective in DNA binding, thereby providing a mechanistic explanation for the dominant-negative effects of many Townes-Brocks mutations. Together, our findings establish tetramerisation as a prerequisite for SALL function, linking complex formation to developmental gene regulation and human disease.

bioRxiv 2025-10-27 Preprint (No Snippets API) Capelastegui F, Dholakia V, Tully DC, Goldhill DH.
Show Full Abstract

Avian influenza viruses (AIVs) are a global public health risk; human infection is typically associated with high mortality. While the relationship between several mammalian adaptive mutations and host factors have been described, it is unknown whether additional uncharacterised mutations lead to adaptation. Here, we combine phylogenetic analysis and complementary experimental methods to quantify the impact of novel mutations that emerge at the avian-mammal interface. We constructed phylogenetic trees of mammalian and avian influenza sequences for the polymerase (PA, PB1, PB2) and nucleoprotein (NP) segments and identified potential avian to mammal spillover events. We found >6500 mutations across the polymerase and NP, including known signatures of mammalian adaptation such as PB2 E627K and D701N which occurred independently in mammals 143 and 56 times respectively. We selected 95 mutations which were mostly undescribed and emerged independently multiple times in a range of species and subtypes. Using a minigenome assay in an avian H5N1 backbone to measure the effect of these mutations in human cells we identified PA P28S, NP I425V and G485R as novel mutations leading to polymerase adaptation. In addition, to determine the mechanism of adaptive mutations, we measured polymerase activity in cells lacking a key host factor, ANP32, and cells overexpressing host restriction factors MxA and BTN3A3. Our combined approach revealed novel mammalian adaptive mutations and demonstrated the benefit of combining phylogenetic and molecular approaches in validating novel adaptive mutations.

HTT
Also flagged:AsparagineGlutamineamino-acidamideα-synuclein
Journal Article 2025-10-26 ✓ 1 Snippet Torricella F, Clore GM, Tugarinov V.
In-Text Gene Mentions

…7-residue glutamine repeat,htt<sup>ex1</sup>Q<sub>7</sub>.…

Show Full Abstract

Complete degeneracy of aliphatic <sup>13</sup>C chemical shifts of the same type of amino-acid residues precludes unambiguous NMR assignments of asparagine (Asn) and glutamine (Gln) carboxamide NH<sub>2</sub> groups in intrinsically disordered proteins with conventional techniques. Here, a pair of triple-resonance NMR experiments is described that correlate the <sup>1</sup>H/<sup>15</sup>N chemical shifts of Asn and Gln carboxamide NH<sub>2</sub> groups with the backbone amide <sup>15</sup>N chemical shifts of the same and the next residue. These experiments exploit a by far superior dispersion of backbone amide <sup>15</sup>N chemical shifts, and permit unambiguous assignments of all Asn/Gln side-chain NH<sub>2</sub> groups in the intrinsically disordered protein α-synuclein and the majority of Gln NH<sub>2</sub> groups in the disordered huntington exon-1 protein with a 7-residue glutamine repeat, htt<sup>ex1</sup>Q<sub>7</sub>.

Also flagged:surgical site infectionsbiofilm formationinfectionbacteremiainfective endocarditisCarbonate apatite
Journal Article 2025-10-26 No Snippets Xiao L, Abe GL, Sasaki JI, Kitagawa H, Tsuboi R, Kohno T, Imazato S.
Show Full Abstract

Surgical site infections remain a critical concern in dental and orthopedic procedures. To combat surgical site infections, gentamicin-loaded carbonate apatite (GM-CAp) granules, a novel antibacterial biomimetic bone substitute is developed. GM-CAp granules rapidly release the loaded gentamicin, leading to swift suppression of bacteria and proactive prevention of infection. In vitro studies validate the bactericidal effects of GM-CAp granules against a spectrum of odontogenic bacteria. In vivo investigations confirm the effectiveness of GM-CAp in suppressing Staphylococcus aureus infection, mitigating inflammation, especially neutrophil recruitment, and stimulating bone regeneration. Transcriptomic analysis reveals that early-stage neutrophil dynamics may influence the inflammatory milieu and subsequent bone healing in the infected bone defect following CAp or GM-CAp implantation. Overall, GM-CAp granules represent a potential strategy for combating surgical site infections and increasing the success rate of bone healing in dental and orthopedic surgeries. Additionally, it is proposed that the status of early postoperative neutrophil recruitment may serve as a potential parameter for evaluating the antimicrobial efficacy of biomaterials.

HTT
Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disorderbehavioralGFPDARPP-32
Journal Article 2025-10-26 ✓ 1 Snippet Huang L, Tang Y, Wang Y, Tan Y, Lei W, Deng X, Luo Y.
In-Text Gene Mentions

…expansion in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG repeat expansion in the HTT gene. Existing toxin-induced and genetic models provide important insights, but none fully replicate the progressive pathology of HD. An AAV9-mediated striatal mouse model expressing mutant HTT with 82 CAG repeats was established to reproduce hallmark neuropathological changes and behavioral deficits. Male C57BL/6 mice received bilateral intrastriatal injections of AAV9-HTT-82Q or control AAV9-GFP. Behavioral performance was assessed by rotarod, balance beam, open field, and Y-maze tests. Neuropathology was examined with HE/Nissl staining, TUNEL assay, and immunofluorescence for mHTT, DARPP-32, GFAP, and Iba1. AAV9-82Q mice exhibited progressive motor coordination deficits on the rotarod from Week 4 and impaired beam traversal from Week 18. Open field testing revealed persistent hyperactivity from Week 8, while anxiety-like and cognitive measures showed only mild, non-significant trends. Histological analysis demonstrated extensive mHTT aggregation in the striatum, accompanied by neuronal pyknosis, vacuolization, and significant loss of Nissl-positive neurons. TUNEL staining confirmed increased apoptosis. Immunofluorescence further revealed selective reduction of DARPP-32+ medium spiny neurons, along with marked astrogliosis and microgliosis, indicating robust neurodegeneration and inflammatory responses. The AAV9-82Q model induces adult-onset, progressive HD-like pathology with early motor impairments, neuronal loss, and glial activation. It complements existing models and provides a reproducible platform for mechanistic studies and preclinical therapeutic evaluation.

SOX6
Also flagged:bone tumorsgiant cell tumor of boneosteosarcomatumorextracellularcartilage formation
Journal Article 2025-10-26 ✓ 1 Snippet Wang J, Xu Y, Zheng A, Zhu X, Tao B, Sun T, Zheng L, Chen Z.
In-Text Gene Mentions

…operating factors (e.g., Sox5/Sox6) stabilize the chondrocyte…

Show Full Abstract

Tumor-derived osteochondral defects (OCDs) pose significant clinical challenges, necessitating integrated strategies for local tumor ablation while preserving the regenerative niche and enabling coordinated cartilage and subchondral bone repair. Herein, we introduce a spatiotemporal microneedle (MN) platform that synergistically combines protoporphyrin IX (PpIX)-mediated sonodynamic therapy (SDT) for precise tumor eradication with chondral organoid (CO)-driven regeneration, leveraging differential mechanical cues for lineage-specific guidance. COs were engineered from bone marrow stem cells (BMSCs) via agarose microwells, yielding uniform aggregates that matured into hyaline-like phenotypes over 30 days and demonstrated superior resilience to oxidative stress compared to monolayer BMSCs, as evidenced by reduced ROS accumulation, preserved proliferation, and modulated inflammatory/antioxidant pathways. MN was fabricated from gelatin methacryloyl (GelMA) in a bilayer architecture: stiff, discrete 10 %GelMA tips to facilitate penetration and promote osteogenesis, and a softer, monolithic 5 %GelMA base to enhance chondrogenesis. PpIX and COs were co-encapsulated for targeted delivery. <i>In vitro</i>, MN(+PpIX) under ultrasound induced robust ROS generation, apoptosis, and proliferation inhibition in giant cell tumor of bone (GCTB) cells via NF-κB modulation. <i>In vivo</i>, in a subcutaneous GCTB xenograft model, MN-mediated SDT significantly reduced tumor volume and enhanced apoptosis. In a rabbit knee OCD model, MN(+PpIX/CO) achieved superior integrated osteochondral repair, with improved bone volume fraction, trabecular thickness, Safranin O/H&E histology, and higher O'Driscoll/ICRS scores compared to controls. Biosafety was confirmed by normal major-organ histology and serum chemistry at 12 weeks. This platform innovatively sequences SDT and regeneration, using stiffness gradients to guide CO fate, offering a minimally invasive solution for tumor-associated OCDs.

Also flagged:Metalsynthesiselectronsoxygennitrogenwound healing
Journal Article 2025-10-26 No Snippets Jung EY, Shin BJ, Suleiman HO, Tae HS, Park CS.
Show Full Abstract

This review presents recent advancements in cold atmospheric pressure (AP) plasma (CAP) processes for the synthesis and surface treatment of polymer films and metal nanoparticles (NPs) in biomedical applications. We discuss the properties and applications of atmospheric pressure plasma (APP) processes, including dielectric barrier discharge (DBD) and plasma jet methods, highlighting their effectiveness in controlling surface characteristics such as wettability and functionalization.

bioRxiv 2025-10-26 Preprint (No Snippets API) Danics L, Muralidharan C, Varga Á, Rezeli M, Gil J, Abbas AA, Pap Á, Park AS, Cserhalmi M, Sőth Á, Jamniczky D, Zsoldos R, Barker RA, Róna G, Drouin-Ouellet J, Markó Varga G, Darula Z, Pircs K.
Show Full Abstract

<h4>ABSTRACT</h4> Huntington’s disease (HD) is a fatal neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin ( HTT ) gene. Although transcriptomic and proteomic changes have been characterized in patient-derived neurons, the contribution of post-translational modifications (PTMs), such as phosphorylation, remains poorly understood. Here, we present the first phosphoproteomic analysis by mass spectrometry (P-MS) of human induced neurons (iNs) directly reprogrammed from HD patient fibroblasts. We identified 177 phosphopeptides with significantly altered abundance in HD-iNs, mapping to phosphoproteins associated with key signaling pathways known to be affected in HD, such as splicing and autophagy. By integrating P-MS data with previously published proteomic and transcriptomic data from the same donors, we identified distinct subsets of ON-OFF phosphopeptides that exhibited a complete loss of phosphorylation in either HD- or Ctrl-iNs, without corresponding changes at the RNA or protein level. An exception was MXRA8, previously described in glial cells as a mediator of blood-brain barrier integrity and astrocyte-mediated neuroinflammation. This protein showed increased protein abundance despite the absence of phosphorylation in HD- iNs, suggesting a compensatory mechanism - a pattern also observed in human post mortem cortical HD tissue. Additionally, MXRA8 showed altered protein-protein interactions with lysosomal and metabolic regulators in HD-iNs, highlighting its potential role in autophagy impairment as well as in neurovascular dysfunction. These findings uncover a distinct layer of post-translational dysregulation in HD, suggesting that phospho-switch proteins such as MXRA8 may be candidate effectors of pathology and thus site-specific phosphorylation loss may contribute to impaired signaling and proteostasis in human HD neurons.

Also flagged:carbonnitridescarbon nanotubescarbon dotsdeoxyribonucleic acidlipid
Journal Article 2025-10-25 No Snippets Ramezani Farani M, Zandi A, Shojaeian F, Zhang M, Khorsandi D, Mollarasouli F, Alipourfard I, Farahani A, Choi YJ, Kang H, Huh YS.
Show Full Abstract

Carbon-based nanomaterials (CBNs), including graphene oxide (GO), carbon nanospheres (CNSs), carbon nitrides (CNs), carbon nanotubes (CNTs), carbon dots (CDs), nanoporous carbon, and nanocomposites, possess exceptional thermal, mechanical, electrical, and optical properties with highly versatile surface chemistries. Their tunable size, shape, and surface functionalities facilitate strong π-π interactions and semiconductor-like behavior, enabling efficient light absorption and intimate biomolecular interfacing. These attributes have positioned CBNs as leading candidates in biomedical engineering, inspiring biomimetic designs that integrate organic and inorganic functions within unified architectures. This review highlights recent advances in the use of CBNs for next-generation biosensing and theranostics. Approaches such as physicochemical engineering, deoxyribonucleic acid (DNA) origami templating, peptide- or enzyme-assisted assembly, polysaccharide anchoring, and lipid modification have enhanced their biocompatibility, selectivity, and catalytic activity. Innovations in fluorescence switching, aptamer-CNT photophysics, and spacer-controlled energy transfer enable ultra-sensitive detection of metal ions, metabolites, neurotransmitters, pathogens, drugs, and cancer biomarkers. Furthermore, integrated CBN-based platforms, including field-effect transistors and laser-scribed graphene electrodes, demonstrate capabilities for single-virus or single-cell diagnostics and responsive therapeutic intervention. Finally, translational challenges related to scalable synthesis, biosafety, regulatory harmonization, and public acceptance are discussed, and interdisciplinary strategies combining flexible electronics, organ-on-chip models, and AI-guided design to advance clinical translation of CBN-enabled precision diagnostics and personalized theranostics are proposed.

HFE
Also flagged:TransferrinFerritiniron
Journal Article 2025-10-25 ✓ 5 Snippets Milman NT, Ellervik C.
In-Text Gene Mentions

…Ferritin in TreatingHFE-Hemochromatosis?…

…Ferritin in Treating HFE-Hemochromatosis?…

…InHFE-hemochromatosis, transferrin …

…In HFE-hemochromatosis, transferrin saturation (TSAT…

…monitoring patients withhemochromatosis.…

Show Full Abstract

In HFE-hemochromatosis, transferrin saturation (TSAT) indirectly reflects plasma non-transferrin-bound iron (NTBI), which drives iron overload and tissue damage. TSAT above ~75% suggests harmful NTBI levels. Despite its clinical relevance, NTBI remains understudied due to the limitations of current assays. High TSAT levels persist during maintenance therapy, yet some guidelines omit TSAT monitoring, though it correlates with symptoms like fatigue and joint pain. Monitoring TSAT may improve outcomes. Randomized trials comparing ferritin-only versus ferritin-plus-TSAT-guided treatment are needed. Consideration should be given to approaches that minimize plasma NTBI in managing and monitoring patients with hemochromatosis. Until reliable NTBI testing has been established, TSAT should be included in the management of HFE-hemochromatosis.

LRRC7
Also flagged:centromerecentromereschromatinkinetochoremonocentromereschromosome
Journal Article 2025-10-25 ✓ 1 Snippet Corless S, Thangavel G, Erhardt S.
In-Text Gene Mentions

…et al. 2023Condensinco-localised with cohesin…

Show Full Abstract

Centromeres have been the focus of extensive research for almost a century, so it may come as a surprise that a consistent definition and nomenclature for these structures remains elusive. In recent times, centromeric chromatin is most frequently defined by the presence of nucleosomes containing the H3 variant CENP-A and is typically synonymous with the site of the inner-kinetochore. However, crucial mammalian centromere proteins including CENP-B and INCENP have well defined distributions that show very little overlap with CENP-A. Additional protein localisations spanning the primary constriction or forming a band below CENP-A chromatin have been reported. Together, these observations suggest a complex and multi-layered chromatin organisation that is not well served by the canonical dichotomy of 'centromeric' and 'pericentromeric' chromatin. Strikingly, this is not a new observation but was made soon after the discovery of CENP proteins, including in a 1991 publication titled 'When is the centromere not a kinetochore?'. Here we revisit this question, which has become more pertinent following technical innovations in long-read sequencing and super-resolution microscopy. We present a model of centromere organisation for monocentromeres that incorporates additional complexity. We then use this model to reconceptualise diverse centromere forms in other eukaryotes including regional centromeres, holocentromeres and centromeres that lack key proteins including CENP-A. In this way, we hope to move towards a unified understanding of centromeric chromatin.

Also flagged:FerroptosisCancerdeathtumourslipidiron
Journal Article 2025-10-25 No Snippets Szwed M, Poczta-Krawczyk A, Bukowski K, Marczak A.
Show Full Abstract

Ferroptosis, an iron-dependent form of regulated cell death, is increasingly leveraged in nanomedicine to sensitise tumours and overcome drug resistance. Driven by the Fenton reaction, ferroptosis results in lipid peroxidation through elevated intracellular iron levels and excessive production of reactive oxygen species (ROS). In this review, we outline the molecular markers of ferroptosis and define the criteria necessary to attribute ferroptosis induction to nanoparticles (NPs). We emphasise the importance of distinguishing targeted ferroptosis from non-specific ROS-mediated nanotoxicity and other types of programmed cell death. This distinction requires the use of lipophilic radical-trapping antioxidants (eg, ferrostatin-1, liproxstatin-1), iron chelators, and evidence implicating glutathione peroxidase 4 (GPX4) or the system Xc<sup>-</sup> antiporter. Morphology is considered supportive but non-diagnostic, requiring converging evidence from both biochemical and genetic sources. We then compare various nanosystems designed to induce ferroptosis, such as iron-based nanoparticles, lipid nanocarriers, light-triggered nanoparticles, and magnetically induced nanocarriers, highlighting mechanistic patterns, efficacy determinants, and common pitfalls that often occur during biological investigations. Finally, we discuss translational challenges, including tumour microenvironment heterogeneity, NP protein corona dynamics, clearance and off-target effects. We aim to provide a framework that links NP design to ferroptotic mechanisms and clinically relevant outcomes, offering clear criteria and priorities for future research.

DCCPTGIS
Also flagged:Pulmonary Arterial HypertensionPDE5cyclic nucleotidephosphodiesterasescyclicnucleotide
Journal Article 2025-10-25 ✓ 2 Snippets Wang L, Fischmeister R, Manoury B.
In-Text Gene Mentions

…bind to theprostaglandin I, IP receptorI, IP receptor,…

…cGMP-activated protein kinasePTGIS PGI 2PGI 2 synthase…

Show Full Abstract

Pulmonary arterial hypertension (PAH) is a fatal disease with no cure. Until recently, most specific therapies for PAH had aimed at enhancing cyclic nucleotide (cAMP and cGMP) pathways, taking advantage of the vasorelaxant and antiproliferative properties of these key intracellular messengers. This process can be achieved by inhibiting phosphodiesterases (PDEs), which are intracellular enzymes responsible for cyclic nucleotide degradation. To date, only inhibitors of PDE type 5 (PDE5) have been approved for the treatment of PAH. Because the PDE superfamily comprises 11 families that encompass many variants, substantial experimental investigation has been conducted to assess the relevance of inhibiting other PDE families, aiming to offer therapeutic alternatives. This review synthesizes the main research work conducted on in vivo or ex vivo models, as well as on biological resources from patients. It helps provide evidence for the expression of PDE isoforms in the lung vasculature, as well as the efficacy and limitations of various pharmacological compounds tested for inhibiting pathological processes ongoing in the disease. Perspectives and suggestions for future research orientation are proposed.

PRDX6
Also flagged:disulfidedeathgynecological tumorsNicotinamide Adenine Dinucleotide Phosphatecystineactin cytoskeletal proteins
Journal Article 2025-10-25 ✓ 1 Snippet Ailun G, Dalai T, Daite R, Du C.
In-Text Gene Mentions

…and lncRNAs (e.g.,PRDX6-AS1, EMSLR) correlate with…

Show Full Abstract

Disulfidptosis is a novel Nicotinamide Adenine Dinucleotide Phosphate (NADPH) deficiency-driven cell death pathway characterized by cystine overload and aberrant disulfide bond formation in actin cytoskeletal proteins, distinct from apoptosis, ferroptosis, and other programmed cell death modalities. In gynecological tumors (ovarian, cervical, and endometrial cancers), this process is orchestrated by dysregulated SLC7A11 expression, impaired thioredoxin system function, and Rac-WRC-Arp2/3-mediated actin network collapse. Bioinformatic analyses of The Cancer Genome Atlas (TCGA)/Gene Expression Omnibus (GEO) datasets have revealed that disulfidptosis-related genes (e.g., SLC7A11, GYS1, NCKAP1) and lncRNAs (e.g., PRDX6-AS1, EMSLR) correlate with patient prognosis, chemoresistance, and tumor immune microenvironment (TME) remodeling. Therapeutic strategies to induce disulfidptosis include glucose deprivation to limit NADPH supply, inhibition of NADPH-generating enzymes (e.g., G6PD inhibition), and nanodelivery systems (e.g., FeOOH@Fe-Ap@Au) that synchronize disulfidptosis with ferroptosis. Preliminary evidence proposes that disulfidptosis inducers may synergize with immune checkpoint inhibitors (ICIs) through TME modulation, though experimental validation remains ongoing. Beyond malignancies, disulfidptosis-related pathways have been implicated in endometriosis, where disulfidptosis-related genes (DRGs; e.g., PDLIM1, ACTB) regulate ectopic lesion progression via immune-metabolic crosstalk. This review comprehensively summarizes the molecular mechanisms, disease associations, and translational potential of disulfidptosis in gynecological disorders, proposing targeted therapeutic paradigms and future research directions.

PRDX6
Also flagged:transcription factorFOXM1Peroxiredoxin1disulfidecysteinescancers
Journal Article 2025-10-25 ✓ 1 Snippet Li Z, Tan G, Wu S, Guo H, Pei C, Xu Z, Chen Y, Yu L, Huang M, Tan Y.
In-Text Gene Mentions

PRDX6

Show Full Abstract

The oxidative modification of proteins induced by hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) results in the formation of disulfide bond between two cysteines and affects protein conformation and biological function. Transcription factor FOXM1 participates in the development and progression of cancers and its levels are upregulated by the oxidative stress of H<sub>2</sub>O<sub>2</sub>-treated condition. In this study, we found that Peroxiredoxin-1 (PRDX1), one of the most H<sub>2</sub>O<sub>2</sub>-reactive antioxidant enzymes, interacted with FOXM1 and led to its oxidation under H<sub>2</sub>O<sub>2</sub> stimulation through generating an intermolecular disulfide bond with FOXM1 C539, which was subsequently transferred to form an intramolecular disulfide bond between C167 and C175 in the oxidized FOXM1. The PRDX1-mediated oxidative modification enhanced the protein stability and transcriptional activity of FOXM1, which stimulated the transcription of FOXM1 target gene X-ray cross-complementing protein 1 (XRCC1) and improved the repair of H<sub>2</sub>O<sub>2</sub>-induced DNA damage in cancer cells. The disruption of PRDX1-mediated FOXM1 oxidation impaired the colony formation ability of cancer cells <i>in vitro</i> and the growth and DNA damage repair ability of cancer cells <i>in vivo</i>. The analysis of The Cancer Genome Atlas (TCGA) breast cancer patient data confirmed that PRDX1 and FOXM1 together facilitated clinical cancer progression. Overall, we established an H<sub>2</sub>O<sub>2</sub>-PRDX1-FOXM1 oxidation pathway that likely contribute to the development and progression of cancers.

Also flagged:Brain arteriovenous malformationsAVMangiogenesisKRASBRAFMAPK21
Journal Article 2025-10-25 No Snippets Wazhi K, Lam FC, Guru S, Hori YS, AbuReesh D, Shoemaker L, Park DJ, Chang SD.
Show Full Abstract

Brain arteriovenous malformations (bAVMs) consist of a tangled nidus of abnormal dilated vessels characterized by direct connections between arteries and veins that lack an intervening capillary bed, creating a high-to-low flow pressure system that is predisposed to spontaneous hemorrhage with significant associated neurologic morbidity and mortality. Treatment options for bAVMs include the following: surgical resection, intravascular embolization to obliterate blood flow through the AVM, and radiosurgery. Understanding the molecular mechanisms of bAVM formation and factors that predispose it to hemorrhage can lead to novel treatments that can improve the prognosis for patients. This review summarizes emerging insights into the complex and dynamic molecular mechanisms of bAVMs. Dysregulation in key VEGF, TGF-β/BMP9/10-ENG-ALK1-SMAD4, Notch, and MAPK/ERK signaling pathways drive abnormal angiogenesis in both syndromic and sporadic forms, with KRAS/BRAF/MAPK21 mutations specifically linked to the latter. Advances in bAVM-induced animal models have corroborated many of the genetic profiles found in humans, and they continue to provide novel insights into bAVM mechanisms. Collectively, these mechanistic findings are guiding translational advances, with targeted therapies and liquid biopsy approaches emerging as avenues for precision treatment and improved patient outcomes.

Also flagged:Gastrointestinalgastric varicescirrhosisportal hypertensionesophageal varicesbutyl
Journal Article 2025-10-24 No Snippets Phuong DLC, Van TT, Thanh HT, Ha UT, Anh TNV, Minh TD, Duy QV.
Show Full Abstract

Endoscopic injection of a cyanoacrylate-lipiodol mixture is widely regarded as the first-line treatment for gastrointestinal bleeding secondary to ruptured gastric varices. Although generally effective, this technique carries the risk of rare but potentially life-threatening complications, including pulmonary glue embolism and interstitial pneumonitis. We present the case of a 65-year-old woman with cirrhosis who presented with hematemesis and melena and underwent endoscopic cyanoacrylate-lipiodol injection for bleeding gastroesophageal varices. Within 24 hours, she developed a persistent fever and bilateral crackles. Chest X-ray, CT imaging, and bronchoscopy findings were consistent with glue-induced pneumonitis. Corticosteroid therapy resulted in rapid clinical and radiological improvement. This case highlights the importance of recognising pulmonary complications following cyanoacrylate injection for gastric varices and underscores the need for prompt diagnosis and appropriate management to mitigate morbidity.

Also flagged:SilicosisChronic pulmonary inflammationsilicapathogenesisinflammationIL-1α
Journal Article 2025-10-24 No Snippets Zhou JW, Bai Y, Guo JQ, Li YY, Liu YF, Liang C, Xing YR, Guo HL, Qi TX, Wu J, Hu D.
Show Full Abstract

Phosphatase and tensin homolog (PTEN) is a critical inhibitor of the PI3K/AKT signaling pathway, yet its direct upstream regulators remain poorly defined. In this study, we investigated the role of peroxiredoxin 4 (PRDX4) in alveolar macrophages (AMs) activation and pulmonary fibrosis. Analyses of lung tissues from silicosis patients by transcriptomic and histological analyses revealed that PRDX4 is selectively upregulated in AMs and positively correlated with profibrotic and inflammatory gene expression. Consistent results were observed in silicosis model mice, where PRDX4 expression co-localized with the macrophage marker F4/80 and correlated with fibrotic indicators. Functional studies demonstrated that macrophage-specific silencing of PRDX4 using adeno-associated virus improved lung function and reduced inflammatory infiltration and fibrosis. PRDX4 upregulation aberrantly activated AMs and promoted epithelial-mesenchymal transition and fibroblast-myofibroblast transition. Mechanistically, PRDX4 enhanced AKT/NF-κB signaling with minimal effects on PI3K. Biochemical interaction assays further demonstrated that oligomeric PRDX4 disrupted PTEN homodimer formation, with mutational analyses identifying Cys124 and Cys245 as essential residues. Notably, Conoidin A alleviated crystalline silica-induced fibrosis in mice, with its therapeutic effect likely mediated by disrupting PRDX4 oligomerization. These findings identify PRDX4 as a novel upstream regulator of PTEN, establish a mechanistic PRDX4-PTEN axis in macrophage activation, and highlight PRDX4 as a promising therapeutic target for idiopathic pulmonary fibrosis and silicosis-associated fibrosis.

Also flagged:perylene diimideNorbornadienesNorbornadienePeryleneDiimideimide
Journal Article 2025-10-24 No Snippets Pintér S, Strassner NM, Krappmann D, Schulze EJ, Hirsch A.
Show Full Abstract

The norbornadiene/quadricyclane (NBD/QC) photoswitch is a promising candidate for molecular solar energy storage. Isomerization to the energy-storing, metastable QC occurs upon UV light irradiation, while the back-switching can be triggered in various ways. However, inducing complete, on-demand energy release across multiple switching cycles remains a significant challenge in molecular solar thermal (MOST) research. We demonstrate the implementation of perylene diimide (PDI) as covalently connected, photoactive redox-catalyst to enable NBD regeneration upon 475 nm irradiation. We investigated the NBD/QC interconversion of several imide- and ortho-connected NBD-PDI hybrids upon irradiation at 310 nm and 475 nm, revealing that the connection position on PDI only minimally affects the interconversion efficiency. Concentration-dependent studies identified an alternative intermolecular back-isomerization mechanism in addition to the previously known intramolecular pathway, for which adequate flexibility of the linker proved crucial for effective back-isomerization to NBD. This study advances the exclusively photoinduced isomerization of the NBD/QC system within novel NBD-PDI dyads, establishing a framework for the targeted manipulation of NBD hybrids with potential application in energy storage. The presented switches operate independently, without the need for further additives to facilitate interconversion, which renders them promising candidates for molecular solar energy storage research.

Also flagged:movement disordersdevelopmental encephalopathiesepilepsyMDintellectual disabilityepileptic encephalopathy
Journal Article 2025-10-24 No Snippets Caputo D, Solazzi R, Castellotti B, Panteghini C, Sciacca FL, Visani E, Freri E, Ragona F, Canafoglia L, Zibordi F, Zorzi G, Gandelli S, Gellera C, Franceschetti S, Nardocci N, Granata T.
Show Full Abstract

<h4>Objective</h4>Conditions presenting with both epilepsy and movement disorders (EPIMDs) range from relatively benign cases to severe developmental encephalopathies. However, the full clinical and genetic spectrum still needs to be better defined. The aim of this study is to describe the presentation of EPIMDs in pediatric patients with known genetic etiologies, correlating these features with age at onset and underlying pathological mechanisms to identify patterns that could improve patient management.<h4>Methods</h4>We retrospectively analyzed the clinical records of pediatric patients who underwent genetic testing for EPIMDs at our institution between 2009 and 2022. Genetic testing included single-gene Sanger sequencing, multigene next-generation sequencing panels targeting epilepsy and/or MDs, and array comparative genome hybridization. Demographic, clinical, and electroencephalography (EEG) data were collected. Statistical analyses were conducted using multivariate and cluster analyses.<h4>Results</h4>A total of 97 subjects were included. The mean age ± SD at epilepsy onset was 3.6 ± 4.4 years, whereas the mean age at MD onset was 5.2 ± 4.9 years. Based on the mechanism of genetic dysfunction, we identified six groups: transportopathies (n = 18), synaptopathies (n = 11), channelopathies (n = 18), metabolic disorders (n = 15), intracellular trafficking defects (n = 8), and unknown/complex function disorders (n = 27). Cluster analysis identified three distinct groups: (1) early-onset epilepsy and paroxysmal MDs with normal intelligence quotient (IQ) and mild intellectual disability, associated with transportopathies (n = 38); (2) early-onset epilepsy with dystonia and myoclonus, low IQ, and developmental and epileptic encephalopathy, associated with channelopathies (n = 31); (3) epilepsy onset between 1 and 5 years of age with developmental delay, parkinsonism, and low IQ, associated with metabolic etiology (n = 26).<h4>Significance</h4>Our study demonstrates that, despite the phenotypic and genetic pleiotropy observed in EPIMDs, a precise characterization of semiological and cognitive features remains essential to support variant interpretation and to refine the diagnostic process and patient management in these rare conditions.

HFE
Also flagged:Liver FibrosisType 2 diabetesaminotransferasesSteatotic Liver DiseasesteatosisLiver disease
Journal Article 2025-10-24 ✓ 1 Snippet Saïd O, Doblas S, Paradis V, Bedossa P, Valla D, Laouénan C, Castera L, Van Beers BE, Garteiser P.
In-Text Gene Mentions

…viral hepatitis, orhemochromatosiswere excluded.…

Show Full Abstract

<h4>Background</h4>In patients with metabolic dysfunction-associated steatotic liver disease (MASLD), non-Gaussian diffusion-weighted imaging (DWI) has been proposed for the diagnosis of liver fibrosis, but its measurement is partially confounded by steatosis. We therefore asked whether a fat-corrected approach could improve fibrosis assessment.<h4>Purpose</h4>To evaluate the diagnostic performance of non-Gaussian diffusion coefficients for the assessment of fibrosis in MASLD patients with a method accounting for intravoxel fat.<h4>Study type</h4>Prospective single-center cross-sectional study.<h4>Population</h4>A total of 289 participants with Type 2 diabetes, hepatic steatosis, and elevated aminotransferases were enrolled from October 2018 to June 2021. Among them, 222 participants (mean age 59 ± 10 years; 149 men) underwent liver biopsy and MRI and were included in the final analysis.<h4>Field strength/sequence</h4>3 T, DWI using spin-echo echo-planar imaging, MR elastography (MRE) using gradient echo sequence and fat fraction imaging using a multiple gradient echoes sequence.<h4>Assessment</h4>Diffusion coefficients were estimated using two non-Gaussian models: a shifted apparent diffusion coefficient (sADC) and a non-linear least squares fit (ngADC), both computed without and with intravoxel fat correction (corr) using fat fraction on PDFF. Fibrosis was staged histologically. Quantitative parameters were compared across fibrosis stages. Diagnostic performance for F0 versus ≥ F1 was evaluated and compared to liver stiffness on MRE.<h4>Statistical tests</h4>Group comparisons used Kruskal-Wallis tests (α = 0.05), and diagnostic performance was assessed via receiver operating characteristic (ROC) curve analysis with 95% confidence intervals, with p < 0.05 considered statistically significant.<h4>Results</h4>ngADC<sub>corr</sub> was significantly different between fibrosis stages (Kruskal-Wallis p < 0.05). ROC curve analysis indicated comparable performance in discriminating fibrosis stages F0 versus F1-F4 for ngADC<sub>corr</sub> and stiffness (AUC = 0.66, 95% CI: [0.59, 0.7], p < 0.05 and 0.68 [0.62, 0.74], p < 0.05, respectively).<h4>Data conclusion</h4>Fit-based non-Gaussian DWI with fat correction could potentially be used with similar diagnostic accuracy as MRE for detecting fibrosis in patients with MASLD.<h4>Evidence level</h4>3.<h4>Technical efficacy</h4>Stage 2.

RC3H1
Also flagged:Thyroid cancercancerslymph node metastasisgene expressioncancerepithelial-mesenchymal transition
Journal Article 2025-10-24 ✓ 1 Snippet Peres KC, Bezerra ML, Marson LA, Santos MP, Matos AHB, Dus-Ilnicka I, Rabi LT, Tincani AJ, Tincani PC, Bufalo NE, Geraldo MV, Ward LS.
In-Text Gene Mentions

…, FXR1 ,RC3H1, ANKRD52 ,…

Show Full Abstract

Thyroid cancer remains one of the most prevalent cancers worldwide, with lymph node metastasis (LNM) playing a critical role in determining patient prognosis and treatment. MicroRNAs (miRNAs) are essential post-transcriptional regulators of gene expression and have been implicated in cancer progression, particularly in epithelial-mesenchymal transition (EMT). This study aimed to identify miRNAs involved in the lymph node metastatic process in thyroid cancer and to evaluate their potential as therapeutic targets. RNA-seq datasets from Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) were used to identify dysregulated miRNAs in LNM from papillary and medullary thyroid carcinoma (PTC and MTC). The candidate miRNAs were transfected in thyroid carcinoma cell lines, TPC-1 and BCPAP, followed by quantification of target genes and analysis of cell migration and invasion assays in vitro. Three miRNAs miR-199a-5p, miR-199a-3p, and miR-148a-5p were identified as downregulated in thyroid cancer with LNM. Transfection of TPC-1 and BCPAP cells with mimetics reduced cell migration and invasion. Additionally, these miRNAs modulated the expression of EMT-related genes, particularly in BCPAP cells. Our results indicate that miR-199a-3p, miR-199a-5p, and miR-148a-5p are involved in key metastatic processes, suggesting their relevance as potential biomarkers and/or therapeutic targets for thyroid tumors. Further in vivo validation and clinical studies are required to explore their translational applications.

SERPINC1
Also flagged:seleniumcardiometabolic disorderslipidselenoproteinsglutathione peroxidases 1GPX1
Journal Article 2025-10-24 ✓ 1 Snippet Shimada BK, Watanabe M, Apo Takayama NK, Soares AG, Hallam KA, Rivers OS, Ewell K, Santiago PJD, Swanson SM, Toh P, Alfulaij N, Berry MJ, Seale LA.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

Dietary selenium (Se) deficiency elevates the risk of cardiometabolic disorders driven by excessive caloric dietary intake. A high-fat diet leads to redox imbalance and elevates lipid deposits in the heart regardless of sex. Selenium maintains redox homeostasis by regulating the levels of antioxidant selenoproteins, such as glutathione peroxidases 1 and 4 (GPX1,4) and thioredoxin reductases 1 and 2. Se-dependent tissues such as the heart have a recycling mechanism to maintain selenoprotein synthesis, especially when Se is limiting, carried out by the enzyme selenocysteine lyase (SCLY). Despite being highly reliant on Se to function properly, it remains unclear if SCLY is required to modulate Se and selenoprotein synthesis in the heart, particularly in obesity. In this study, we analyzed cardiomyocyte (CM) function and molecular modifications in the hearts of male and female whole body <i>Scly</i> knockout (<i>Scly</i> KO) mice fed a Se-deficient, obesogenic diet. We found sex-specific differences demonstrating that the loss of SCLY activity is more detrimental to the hearts of female mice on an obesogenic diet than in male mice, due to reduced glutathione (GSH) peroxidase 1 and 4 expression and decreased circulating Se levels. In addition, overall GPX activity and total GSH levels in <i>Scly</i> KO female hearts resulted in significantly reduced CM contractility. In summary, the loss of <i>Scly</i>, coupled with Se deficiency and a high-fat diet reduces the ability of the GSH system to mitigate oxidative stress in female hearts, increasing redox imbalances that favor the establishment of cardiometabolic disorders.<b>NEW & NOTEWORTHY</b> Global loss of selenocysteine lyase controls the glutathione system in the heart, impacting glutathione peroxidase protein levels and activity, and glutathione levels in a mouse model of obesity. Loss of selenocysteine lyase and selenomethionine deficiency impacts cardiomyocyte function and selenoproteins in a sexually dimorphic nature, with females being affected more than males when mice are on a high-fat diet.

SERPINC1
Also flagged:cirrhosissepsisthromboplastincoagulation disorderstoinfection
Journal Article 2025-10-24 ✓ 1 Snippet Phuong Linh TQ, Nhan NT, Thuan LM, Phuong LT.
In-Text Gene Mentions

…as antithrombin III (ATIII), protein C, protein…

Show Full Abstract

This study aimed to establish the correlation between activated partial thromboplastin time (aPTT) in seconds and ratio, first derivative peak (Max1), second derivative peak (Max2), second derivative minimum peak (Min2), and delta-OD of clot waveform analysis in patients diagnosed with cirrhosis, sepsis, and a control group. The study involved a series of cases using the Bayesian ANOVA model with Bayes factor (BF) estimated using the Markov Chain Monte Carlo sampling method with 2 chains. Each chain consisted of 10 000 repetitions and started 5 000 times to predict the variables aPTT (s), aPTT (ratio), Max1, Max2, Min2, and delta-OD respectively across the 3 study groups. The model used was variable ~ stage - 1. This analysis illustrates the adjustment of the posterior proportion for multiple testing by setting the prior probability of the initial hypothesis to 0.5 for all comparisons. There is insufficient evidence that aPTT (s), aPTT (ratio), and Min2 differ between the study groups (0 < BF < 3). There is compelling evidence for the Max1 value in both the sepsis group and the control group (BF10 = 44.042). Additionally, between the sepsis group and the cirrhosis group, there is substantial evidence for the Max1 value (BF10 = 5.842). Moreover, there is convincing evidence for the Max2 value in the sepsis group compared to the control group (BF10 = 38.782). There is almost confirmatory evidence that the delta-OD value in the sepsis group is higher than that in the control group (BF10 = 1251.781). Finally, there is convincing evidence that the sepsis group has a higher delta-OD value than the cirrhosis group (BF10 = 35.555). The Max1, Max2, and delta-OD indices effectively reflect coagulation disorders in patients with cirrhosis and sepsis, even when the aPTT test results are within normal limits.

Also flagged:alkenylamidesynthesis-Acyloxyl alkenyl amidesestersamino
Journal Article 2025-10-24 No Snippets Cao S, Guo H, Zhong Z, Chen D, Song W, Liu Y, Wan JP.
Show Full Abstract

β-Acyloxyl alkenyl amides (AAAs) are vinylogous esters with high activity toward acylation reactions. However, only one synthetic procedure consisting of five independent operation steps involving highly sensitive amino alkynone intermediate is available for their synthesis to date, depressing rigidly the application of AAAs in peptide synthesis and expanded acylation reactions. Herein, by combining consecutive trifold defluorination, acyl migration, and multicomponent reactions, a considerably simpler one-step protocol has been established for AAA synthesis with the α-trifluoromethyl ketones, amines, and carboxylic acids/amino acids as starting materials using Cs<sub>2</sub>CO<sub>3</sub> as the only promoter. The resulting AAAs have been verified with excellent performance in the synthesis of esters, amides, and peptides. In all investigated examples of peptide synthesis, no racemization or epimerization has been observed, documenting the high application potential of AAAs as a complementary option in peptide synthesis and other related acylation reactions.

Also flagged:brain injuriesgene expressionACEACTN3AMPD1VDR
Journal Article 2025-10-24 No Snippets Marrouh A, El Haddouchi A, Kartti S, El Fahime E, Boutayeb S, Chagar Y, Baudot C, Belyamani L, Dakka T, Eljaoudi R.
Show Full Abstract

Understanding how genetic and epigenetic factors influence predisposition, susceptibility, protection, severity, and recovery potential in sports-related muscle, bone, and brain injuries is gaining increasing attention, as these injuries represent a major concern for athletes' health and performance. This narrative review explores the role of specific genetic variants, such as those in <i>ACE, ACTN3, AMPD1, VDR,</i> and <i>APOE</i>, in predisposing athletes to injury. In parallel, the emerging role of microRNAs, including miR-21, miR-133a, miR-208a, and miR-214 in regulating gene expression related to muscle regeneration, inflammation, and neuroprotection, is highlighted. These small noncoding RNAs are influenced by environmental stimuli such as sports activity and training, and may serve as promising biomarkers for injury risk and recovery. This review is based on a narrative approach, involving targeted literature searches in databases such as PubMed, Scopus, and Web of Science, with no restrictions on language or publication date. Articles were selected based on relevance using predefined keywords and were categorized by injury type (muscular, bone, and concussion-related). However, several limitations remain, including population heterogeneity, small sample sizes, and the lack of functional validation of identified variants, which currently limits their clinical application. Ethical considerations surrounding the use of genetic data in athletes also need to be addressed. In the future, better integration of multiomic data could support the development of personalized and ethically sound strategies for injury prevention and athlete care.

Also flagged:brain infarctionsgene expressionatherosclerosismyocardial infarctionstrokelipid
Journal Article 2025-10-24 No Snippets Wang J, Li Y, Wang H, Meng Q, Li P, Wang Y, Wang K, Yang S.
Show Full Abstract

MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play critical roles in various cellular processes. Increasing evidence suggests that miRNAs are involved in the development and progression of atherosclerosis, which is the leading cause of myocardial infarction and stroke. These molecules influence key pathological mechanisms, including lipid metabolism, endothelial dysfunction, vascular inflammation, and plaque stability. This review summarizes the role of miRNAs in atherosclerosis-induced cardiac and cerebral infarction and explores their potential as therapeutic targets. We discuss emerging miRNA-based interventions, such as miRNA mimics and inhibitors, which offer promising strategies for disease prevention and treatment. Understanding the regulatory functions of miRNAs in cardiovascular and cerebrovascular events may provide new insights for developing innovative therapies aimed at reducing the burden of atherosclerosis-related diseases.

HFE
Also flagged:alcoholliver diseasegastrointestinal cancergastrointestinal tract cancersmetabolic dysfunction-associated steatotic liver diseasesteatotic liver disease
Journal Article 2025-10-24 ✓ 1 Snippet Im SG, Shin CM, Han K, Jung JH, Choi J, Jo H, Lee HK, Jin EH, Kang SJ, Lim JH, Choi YJ, Lee DH.
In-Text Gene Mentions

…veno-occlusive disease (I82),hemochromatosis(E83.1), Wilson’s disease…

Show Full Abstract

We investigated the relationship between incidence of gastrointestinal tract cancers, metabolic dysfunction-associated steatotic liver disease (MASLD), and alcohol-related steatotic liver disease in diabetic population. A nationwide cohort of 2,616,828 individuals with diabetes under Korean National Health Insurance Service from 2015 to 2016 was divided into four subgroups: no steatosis (group 1), MASLD alone (group 2), MASLD with heavy alcohol intake (group 3), and alcoholic liver disease (group 4). We used fatty liver index to assess the probability of hepatic steatosis using cutoff scores of 30 and 60. We analyzed incidences of esophageal, stomach, colorectal, biliary, and pancreatic cancers until 2022. Compared with group 1 (reference), group 2 showed increased hazard ratios for stomach, colorectal, and biliary cancers, with a decreased hazard ratio for esophageal cancer (adjusted hazard ratio [95% confidence interval]: 1.10 [1.06-1.13], 1.13 [1.10-1.16], 1.10 [1.05-1.16], 0.88 [0.79-0.97], respectively). Probability of hepatic steatosis was positively correlated with all gastrointestinal tract cancers except esophageal cancer in non-drinkers, but only with stomach, colorectal, and biliary cancers in mild drinkers (p<sub>trend</sub> < 0.001). In conclusion, MASLD increases gastrointestinal tract cancer risk, except esophageal cancer, in diabetic population. For non or mild drinkers, probability of hepatic steatosis serves as a predictor of gastrointestinal tract cancer risk.

Also flagged:lipidTNF-αCOX-2short-chain fatty acidsfermentationshort-chain fatty acid
Journal Article 2025-10-24 No Snippets Tan M, Ceylani T, Gurbanov R, Keskin S, Keskin S, Acikgoz E, Sağır E, Teker HT.
Show Full Abstract

This study investigated the impact of intermittent fasting (IF) on older rats by administering plasma from 12-month-old male Sprague Dawley rats subjected to 35 days of IF, with 18-hour fasting intervals followed by 6-hour feeding periods. Over this period, 0.5 ml of plasma was transferred bi-daily to 24-month-old male rats, totaling 15 infusions. Infrared spectroscopy-based qualitative and quantitative analyses revealed significant changes in lipid, protein, and nucleic acid profiles, varying by tissue type and fasting regimen. Histological examination showed structural enhancements in the ileum and colon, along with reduced inflammatory markers TNF-α and COX-2, particularly with IF plasma. Additionally, plasma transfer markedly improved gut microbiota composition, increasing alpha diversity and adjusting the Firmicutes to Bacteroidetes ratio. High-Performance Liquid Chromatography results indicated elevated levels of key cecal short-chain fatty acids, suggesting enhanced gut health. These findings highlight the potential of plasma from intermittently fasting rats in modulating biomolecular profiles, intestinal tissue structure, gut microbiota, and SCFA production, offering integrated insights into intestinal health improvements.

NEGR1
Also flagged:behavioralgene expressionkeratoconusallergyextracellularorganization
Journal Article 2025-10-24 ✓ 2 Snippets Du K, Peng R, Xiao G, Qu Y, Han L, Hong J.
In-Text Gene Mentions

…TAC1 , andNEGR1), as well…

…of TAC1 andNEGR1was validated using…

Show Full Abstract

This study aimed to characterize transcriptomic alterations and the effects of demographic and behavioral risk factors on disease-associated gene expression patterns in late-stage keratoconus (KC). Corneal stromal tissues from 31 KC patients and four normal donors underwent bulk RNA sequencing. Differentially expressed genes (DEGs) and weighted gene co-expression network analysis (WGCNA) were used to identify key molecular changes. Subgroup analyses based on sex, allergy status, eye rubbing intensity (ERI), body mass index (BMI), and childhood socioeconomic status (SES) were conducted using gene set enrichment analysis (GSEA) and WGCNA. Key genes from WGCNA modules were validated by quantitative real-time PCR (qRT-PCR) and three public transcriptomic datasets. Enrichment analyses based on the 4469 identified DEGs (Padj < 0.05) revealed suppression of extracellular matrix (ECM) organization, axon guidance, synaptic signaling, and immune activity (Padj < 0.05). Subgroup GSEA demonstrated that high ERI correlated with ECM pathways, elevated BMI correlated with mitochondrial dysfunction, and low childhood SES correlated with upregulated mitochondrial metabolism and immune activation (Padj < 0.05). Chromatin regulation and antioxidant activity were enriched in females (Padj < 0.05). No transcriptomic associations were detected for allergy status. WGCNA revealed ERI-related modules involving Wnt and PI3K-Akt signaling and SES-related modules implicating cholinergic synapse and axon guidance pathways (Padj < 0.05). Validation using qRT-PCR and public datasets confirmed the downregulation of all 15 selected genes in KC (Padj < 0.05). qRT-PCR also confirmed differential expression of five subgroup-associated genes across KC subgroups (P < 0.05). These findings emphasize the neural-immune-stromal axis dysregulation in KC and elucidate the contribution of common risk factors to disease progression.

HFE
Also flagged:cirrhosismetabolic-associated steatohepatitisviral hepatitishyponatremiavitamin D deficiencychronic liver disease
Journal Article 2025-10-24 ✓ 1 Snippet Rahaoui M, Fakhrddine A, Elmqaddem O, Koulali H, Zazour A, Ismaili Z, Kharrasse G.
In-Text Gene Mentions

…in patients withouthemochromatosis[ 11 ].…

Show Full Abstract

INTRODUCTION: Cirrhosis is a major cause of morbidity and mortality worldwide [1]. While serum ferritin is recognized as a marker of liver injury and inflammation, its prognostic value for cirrhosis-related complications is not well established. We investigated whether serum ferritin levels could predict complications in cirrhotic patients. MATERIALS AND METHODS: In this retrospective observational cohort study, which included both descriptive and analytical components, serum ferritin levels were measured in adult cirrhotic patients admitted to the gastroenterology department of a University Hospital Center between March 2017 and March 2024. The normal reference range was defined as 22–275 ng/mL for men and 4.63–204 ng/mL for women. Patients were monitored for the occurrence of complications over a one-year period. Statistical analyses were performed to assess the association between serum ferritin levels and complications, and to determine whether elevated ferritin was an independent predictor of adverse outcomes. RESULTS: The study included 200 cirrhotic patients (111 females and 89 males) with a mean age of 58,06 ± 15.21 years (range: 19–95). The most common etiologies were metabolic-associated steatohepatitis (MASH) (49.7%) and viral hepatitis (19%). Serum ferritin levels were significantly higher in decompensated patients compared to compensated patients (173 ± 295.22 ng/mL vs. 121.32 ± 251.98 ng/mL). During one-year follow-up, 68.5% of patients with elevated ferritin levels developed complications, compared to 27.7% of those with normal ferritin levels. Serum ferritin levels were significantly higher in Child-Pugh B patients (424.9 ng/mL) compared to Child-Pugh A (74.8 ng/mL, p = 0.002). Receiver operating characteristic (ROC) curve analysis demonstrated that serum ferritin has moderate discriminative power in predicting the occurrence of complications in cirrhotic patients (AUC = 0.670). Elevated ferritin (≥ 45 ng/mL) was associated with a significantly increased risk of complications (p < 0.001). Multivariate analysis revealed the following predictors of hepatic decompensation: elevated serum ferritin (aOR 5.76, 95% CI 2.08–15.90, p = 0.001), hyponatremia (aOR 0.39, 95% CI 0.18–0.85, p = 0.017), and vitamin D deficiency (aOR 6.52, 95% CI 1.86–22.92, p = 0.003). These findings highlight the complex and multifactorial nature of hepatic decompensation and support the inclusion of serum ferritin in a comprehensive prognostic assessment. CONCLUSION: Elevated serum ferritin levels are independently associated with an increased risk of complications in cirrhotic patients. Given its wide availability and low cost, serum ferritin may serve as a simple prognostic biomarker to guide risk assessment and optimize clinical management in this population.

HFE
Also flagged:prurituschronic kidney diseasesleepUremic pruritusxerosisopioid receptor
Journal Article 2025-10-24 ✓ 1 Snippet Yu W, He J, Bao Z, Li Z, Zhang C, Xie J, Ren H, Huang X, Xu T.
In-Text Gene Mentions

…after phlebotomy inhemochromatosispatients with high…

Show Full Abstract

PURPOSE: To evaluate the occurrence of uremic pruritus among peritoneal dialysis (PD) patients and explore its correlation with serum iron levels. METHODS: A cross-sectional study was carried out on 189 PD patients at a single center in China. The severity of pruritus was assessed through the validated 5-D Itch Scale questionnaire. The relationship between clinical factors and pruritus was examined using multivariate logistic regression, restricted cubic spline analysis, piecewise regression, and cluster analysis of iron metabolism patterns. RESULTS: Moderate/severe pruritus affected 27.5% of participants, mainly on lower limbs (52.9%) and back (46.6%). Serum iron was significantly higher in the moderate/severe pruritus group (18.43 ± 8.50 vs. 15.84 ± 6.09 µmol/L, p = 0.029). After adjustments, each standard deviation increase in serum iron corresponded to higher odds of moderate/severe pruritus (odds ratio (OR) = 1.45, 95% confidence interval (CI):1.03–2.08, p = 0.037). Analysis revealed a threshold association(p = 0.043) with an inflection point at 13.7µmol/L, above which each unit increase in serum iron raised pruritus odds by 10% (OR = 1.10, 95%CI:1.03–1.18, p = 0.006). Cluster analysis identified that patients with high transferrin saturation (TSAT), moderate ferritin, and high serum iron had the highest pruritus prevalence (52.8%). CONCLUSION: In PD patients, we identified a threshold effect of serum iron on uremic pruritus. Iron levels above 13.7 µmol/L independently worsened pruritus, especially in patients with high TSAT, moderate ferritin, and high serum iron, where prevalence reached 52.8%. These findings highlight the importance of assessing iron status and personalized management.

SUDS3
Also flagged:Follicular lymphomatumorlymphomaFLrituximablactate dehydrogenase
Journal Article 2025-10-24 ✓ 1 Snippet Li RC, Tang W, Zhang HL, Wang XH, Sun R, Wang N, Xu TY, Chen SY, Feng Y, Shen R, Wang L, Cheng S, Xu PP, Yi HM, Dong L, Zheng Z, Zhao WL.
In-Text Gene Mentions

…HIST1H1C encodeslinker histoneshistones, which act…

Show Full Abstract

<h4>Background</h4>Follicular lymphoma (FL) represents the most common subtype of indolent non-Hodgkin's lymphoma. Extranodal involvement (ENI) indicates a poor clinical outcome in patients who received rituximab-based immunochemotherapy. Recent studies indicate that genetic alterations and tumor microenvironment dysregulation drive extranodal dissemination and lymphoma progression. However, the molecular mechanisms underlying ENI in FL remain to be fully elucidated.<h4>Methods</h4>Aiming to investigate the influence of oncogenic mutations and tumor microenvironment alterations on ENI in FL, the clinical features of 501 patients with newly diagnosed FL receiving rituximab-based therapy were analyzed, with DNA and RNA sequencing performed on 403 and 175 patients, respectively.<h4>Results</h4>Multiple ENI was observed in 120 (24%) patients and was significantly related to advanced Ann Arbor stage, decreased hemoglobin, elevated lactate dehydrogenase, elevated beta-2 microglobulin, lymph nodes ≥ 5 sites, lymph nodes > 6 cm, and high risk of progression of disease within 2 years (POD24). Increased KMT2D, CREBBP, CARD11, and STAT6 mutations, as well as downregulation of immune-associated pathways and alterations in lipid metabolism, were associated with multiple ENI. In the rituximab plus chemotherapy (R-chemo) cohort (n = 344), involvement of bone marrow, lung, liver, bones, and kidney/adrenal glands were unfavorable predictors of progression-free survival (PFS), with involvement of liver and kidney/adrenal glands as unfavorable predictors of overall survival (OS). However, in the rituximab plus lenalidomide immunotherapy (R2) cohort (n = 157), no ENI site showed a significant difference in PFS and OS.<h4>Conclusions</h4>Negative prognostic impact of multiple ENI upon R-chemo therapy could be overcome by R2 therapy in FL. Better understanding of the biological behavior of multiple ENI could provide a potential clinical rationale for future mechanism-based therapy of FL.

DCC
Also flagged:triple-negative breast cancertumortyrosine kinasenon-receptor tyrosine kinasehematopoietic cell kinaseHCK
Journal Article 2025-10-24 ✓ 5 Snippets Liang Y, Zeng Q, Xiao M, Li P, He R, Chen Z, Liu J, Cao J, Li J, Yin L, Zhong J, Chen X, Feng J, He J, Chen X, Zu X, Shen Y.
In-Text Gene Mentions

DCC-2036induces repolarization of…

…tyrosine kinase inhibitorDCC-2036could induce repolarization…

DCC-2036 targets the HCK-AKT/mTOR…

…Ib/2 clinical study,DCC-2036was combined with…

…has found thatDCC-2036 can target AXL/MET…

Show Full Abstract

Therapies for triple-negative breast cancer (TNBC) still need innovative approaches, while repolarizing tumor-associated macrophages (TAMs) may offer a breakthrough in the targeted therapy and immunotherapy of TNBC. In this study, our group found that the small-molecule tyrosine kinase inhibitor DCC-2036 could induce repolarization of TAMs from M2 to M1 type and enhance anti-tumor CD8<sup>+</sup> T cell immunity in TNBC. Mechanistically, targeting inhibition of the non-receptor tyrosine kinase hematopoietic cell kinase (HCK) in TAMs regulated the downstream phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT)-mammalian target of rapamycin (mTOR)-glutamine synthetase (GS)-HIF1α signaling pathway, leading to a reprogramming of TAM metabolism from oxidative phosphorylation to glycolysis. This metabolic shift repolarized TAMs to the M1 phenotype, resulting in a decrease in interleukin (IL)-10 secretion, which enhanced the immune response of anti-tumor CD8<sup>+</sup> T cells and increased the sensitivity of TNBC to immune checkpoint blockade therapy. This project uncovers a previously unrecognized anti-tumor mechanism of DCC-2036 and proposes a combination strategy that utilizes DCC-2036 alongside immune checkpoint inhibitors to improve TNBC immunotherapy.

HFE
Also flagged:tuberculosishypoglycemiaTBprimary adrenal insufficiencyglucocorticoidadrenal crisis
Journal Article 2025-10-24 ✓ 1 Snippet Haleem A, Ashraf S, Tarique D, Zohair M, Singh A, Ayalew BD.
In-Text Gene Mentions

…infiltrative disorders likehemochromatosisor sarcoidosis […

Show Full Abstract

An adrenal crisis should be considered in children with a history of tuberculosis who present with shock, hypoglycemia, and hyperpigmentation. Even years after successful treatment, TB can cause irreversible adrenal damage leading to primary adrenal insufficiency. Early recognition and prompt glucocorticoid replacement are lifesaving. Routine screening in high-risk patients may prevent delayed diagnosis and fatal outcomes.

HFE
Also flagged:HepatitisLangerhans Cell HistiocytosisanemiatransaminasesAlkaline Phosphatasealbumin
Journal Article 2025-10-24 ✓ 1 Snippet Neupane D, Banjade RR, Joshi D, Awasthi PR, Mishra S.
In-Text Gene Mentions

…bowel disease, orhemochromatosis.…

Show Full Abstract

Langerhans cell histiocytosis (LCH) is a rare neoplastic disorder involving abnormal proliferation of dendritic cells, with clinical presentations ranging from isolated lesions to life-threatening multisystem involvement. This case report describes a 26-month-old girl who presented with progressive jaundice, fever, hepatomegaly, pruritic scalp rashes with greasy scales, and maculopapular to papulocrusted skin lesions. Laboratory findings revealed severe anemia, elevated inflammatory markers, high bilirubin levels, elevated transaminases, markedly increased GGT (Gamma-Glutamyl Transferase) and ALP (Alkaline Phosphatase) levels, suggestive of cholestatic injury, along with low albumin and a reversed albumin-to-globulin ratio. A provisional diagnosis of high-risk multisystem LCH was made, and a skin biopsy was performed, demonstrating characteristic histiocytic infiltration with immunopositivity for CD1a and S-100, thereby confirming the diagnosis. She was initiated on chemotherapy with vinblastine in combination with prednisolone at a referred center and demonstrated a favorable clinical response. This case underscores the diagnostic challenges of Langerhans cell histiocytosis, particularly in resource-limited settings, and highlights the importance of looking beyond common diagnoses, such as acute viral hepatitis, when the clinical presentation does not fully align. Careful recognition of systemic features, especially involvement of the liver and skin, combined with early skin biopsy and a multidisciplinary approach, is essential for timely diagnosis and effective management of rare conditions like high-risk multisystem LCH.

POU3F2
Also flagged:Prostate cancerPCacancerandrogen receptorARneuroendocrine prostate cancer
Journal Article 2025-10-24 ✓ 1 Snippet Wang Y, Wang Y.
In-Text Gene Mentions

…n adenocarcinoma; ASCL1, BRN2/POU3F2, FOXA2, ONECUT2 in…

Show Full Abstract

Treatment-induced neuroendocrine prostate cancer (NEPC) represents a lethal evolution of prostate adenocarcinoma under androgen receptor pathway inhibition, posing a significant clinical challenge. In a recent landmark study, Wang et al<i>.</i> introduced an innovative internal Z-score based approach to comprehensively characterize the transcription factor (TF) landscape in prostate cancer progression, uncovering distinct TF profiles associated with adenocarcinoma and NEPC lineages. Notably, the study proposes a three-phase model of NEPC transdifferentiation-comprising de-differentiation, dormancy, and re-differentiation-revealing dynamic shifts in TF expression that underpin lineage plasticity and therapeutic resistance. This commentary critically evaluates the methodological advancements, the functional significance of the identified TF signatures, and the broader implications of these findings for developing novel therapeutic strategies. By delineating the molecular events driving the transition from androgen receptor (AR)-dependent adenocarcinoma to treatment-resistant NEPC, this work underscores the potential of targeting early and dormant phases of transdifferentiation to improve patient outcomes.

Also flagged:distal cholangiocarcinomaER
Journal Article 2025-10-24 No Snippets Lee I, Seo Y, Choi GW, Chae YS, Yun WG, Han Y, Jung HS, Cho YJ, Kwon W, Jang JY, Park JS.
Show Full Abstract

<h4>Background</h4>Distal cholangiocarcinoma (DCC) has poor prognosis, with >50% affected patients experiencing early recurrence (ER) within 12 months after curative-intent surgery. This retrospective study analyzed ER characteristics, survival outcomes, and risk factors of DCC.<h4>Methods</h4>We categorized 519 patients with DCC who underwent curative-intent surgery at Seoul National University Hospital (2008-2023) into ER (n=115) and non-ER (n=404) groups. Primary endpoints were ER and overall survival (OS). We compared OS between ER and an additional non-curative reference cohort (R2/M1, n=53). Cutoffs for continuous variables were derived using the receiver operating characteristic (ROC) curve/Youden.<h4>Results</h4>Median OS and recurrence-free survival were 53.6 and 52.4 months, respectively. Independent ER predictors were preoperative CA19-9 of >70 U/mL (hazard ratio [HR], 1.58), BMI of ≤21.0 kg/m² (HR, 2.04) or >25.0 kg/m² (HR 1.81), LNR of >15% (HR, 2.01), and postoperative CA19-9 of >37 U/mL (HR, 1.71). OS was similar between ER and R2/M1 groups (16.8 vs 15.6 months; p=0.998). In subgroup analyses stratified by ER status, adjuvant chemotherapy (including 5-FU), radiotherapy, and concurrent chemoradiotherapy were not associated with improved OS.<h4>Conclusion</h4>ER after curative-intent resection has outcomes comparable to non-curative disease, supporting risk-adapted staging and evaluation of neoadjuvant strategies for high-risk patients.

TNFSF4
Also flagged:FCGR2Atumorgene expressioncell proliferationhepatocellular carcinomaliver cancer
Journal Article 2025-10-24 ✓ 1 Snippet Zhong D, Liang Y, Yan H, Chen X, Chen Y, Ma S, Su Y, Wang F, Chen X, Yang Q, Leng Z, Wang M, Huang X.
In-Text Gene Mentions

…Specifically,TNFSF4, TNFSF14, and IDO2…

Show Full Abstract

<h4>Background</h4>The immunosuppressive nature of the HCC tumor microenvironment limits the effectiveness of current immunotherapeutic strategies. Identifying key immune-related regulators is essential for improving patient stratification and therapeutic outcomes.<h4>Methods</h4>Transcriptomic data from TCGA and GEO datasets were integrated to screen IRDEGs. Functional enrichment, co-expression, and PPI network analyses were performed to explore the biological context. Consensus clustering based on hub gene expression was used to define immune-related molecular subtypes. Immune infiltration characteristics, immune checkpoint expression, TIDE and IPS scores, and predicted immunotherapy responses were compared. FCGR2A expression was validated in clinical HCC tissues by immunohistochemistry and western blotting. <i>In vitro</i> assays evaluated the effects of FCGR2A knockdown on HCC cell proliferation, migration, and invasion.<h4>Results</h4>A total of 21 IRDEGs were identified, among which FCGR2A was consistently upregulated and associated with poor prognosis. Enrichment analysis indicated significant involvement in immune activation and inflammatory signaling pathways. PPI network analysis identified nine hub genes, including FCGR2A. Consensus clustering revealed two distinct immune-related molecular subtypes with marked differences in immune infiltration patterns, immune checkpoint profiles, TIDE and IPS scores. GSEA demonstrated subtype-specific activation of antigen processing, T cell signaling, and inflammatory pathways. Experimental validation confirmed elevated FCGR2A expression in HCC tissues. Functional assays showed that FCGR2A knockdown significantly inhibited HCC cell proliferation, migration, and invasion.<h4>Conclusions</h4>FCGR2A acts as both a prognostic biomarker and an immune regulatory hub in HCC, anchoring a broader gene network that defines immune subtypes and predicts therapeutic responsiveness. Incorporating FCGR2A-based stratification may optimize immunotherapeutic strategies for HCC.

HTT
Also flagged:ProteostasislipidNeurodegenerative disordersagingpolyQ disorders spinocerebellar ataxia types 2extracellular
Journal Article 2025-10-24 ✓ 1 Snippet Pereira Sena P, Friedrich L, Villarreal A, Fath F, Sopco L, Hernández-Guillamon M, Saraiva-Pereira ML, Britton G, Weber JJ, Schmidt T.
In-Text Gene Mentions

…lowering the mutantHTTprotein ( https://www.clinical…

Show Full Abstract

Neurodegenerative disorders pose an increasing burden in the aging society. These conditions share several molecular pathomechanisms, some of which may offer opportunities for therapeutic intervention. In this review, we explore a representative selection of sporadic and hereditary neurodegenerative diseases-namely Alzheimer's disease, cerebral amyloid angiopathy, and the polyQ disorders spinocerebellar ataxia types 2 and 3, as well as Huntington's disease-which all feature the accumulation of intra- or extracellular protein deposits as a hallmark. We place particular emphasis on dysregulations in proteostasis-underlying the formation of these aggregates-and the less commonly addressed disturbances in lipid metabolism. By highlighting potential mechanistic links across different classes of neurodegenerative diseases, we aim to provide new insights that may guide the identification of shared druggable targets and the development of broad-spectrum therapeutic strategies.

Also flagged:eye developmenteye diseasesglaucomaretinal degenerationcorneal disordersocular diseases
Journal Article 2025-10-24 No Snippets Li Q, Feng Y, Zhu X.
Show Full Abstract

Model organisms have played a pivotal role in ophthalmic research, providing essential platforms to investigate eye development, regeneration mechanisms, and disease pathology. Recent advancements in gene editing technologies and experimental methodologies have enabled the successful simulation of various human eye diseases, including glaucoma, retinal degeneration, and corneal disorders in model systems. These models have significantly advanced the understanding of the molecular and cellular mechanisms underlying ocular diseases and facilitated the screening and validation of potential therapeutic agents. <i>Xenopus laevis</i> (<i>X. laevis</i>) has emerged as an ideal system for developmental biology research due to its rapid embryonic development, transparent embryos, and ease of observation and manipulation. Its fully sequenced genome allows precise genetic modifications, including gene knockout, knock-in, and expression regulation studies. In ophthalmic research, <i>X. laevis</i> is widely used for studying eye development, disease modeling, and ocular structure. Its accessible embryonic stages and well-characterized eye development make it a valuable model for retinal disease investigations. This review systematically summarizes the applications, construction methods, and research significance of <i>X. laevis</i> models in eye development, disease modeling, and drug screening. It provides an in-depth perspective on the utility of <i>X. laevis</i> in foundational ophthalmic research, offering insights to guide future studies.

SERPINC1
Also flagged:lymphangiogenesisvenous thromboembolismcardiovascular disorderLymphangiogenesis-related genescoagulationMYC
Journal Article 2025-10-24 ✓ 1 Snippet Lin Y, Wu J, Wang P, Lin X, Yang H.
In-Text Gene Mentions

…agulation-related genes (e.g.,SERPINC1, PROC) through defective…

Show Full Abstract

<h4>Background</h4>Venous thromboembolism (VTE), a life-threatening cardiovascular disorder, involves complex interactions between thrombosis and immune dysregulation. Lymphangiogenesis-related genes (LRGs) may directly induce thrombosis by regulating endothelial function, the coagulation cascade, or inflammatory signaling pathways. This research was intended to uncover LRG-associated key genes and elucidate their molecular mechanisms in VTE.<h4>Methods</h4>Transcriptomic datasets from public databases were analyzed to identify differentially expressed genes (DEGs) between VTE and control samples. Subsequently, candidate genes were screened by overlapping the DEGs with LRGs obtained from the literature. Functional analysis was then performed on candidate genes. Machine learning algorithms and expression validation were employed to refine key genes. Moreover, gene set enrichment analysis (GSEA), immune infiltration, and regulatory and disease-gene-drug network analyses were performed. Finally, key genes' expression levels were validated via real-time quantitative polymerase chain reaction (RT-qPCR).<h4>Results</h4>To sum up, 810 DEGs were identified, of which 30 DEGs were selected as candidate genes. Machine learning and expression validation prioritized MYC and NTAN1 as key genes. Functional analysis revealed their enrichment in spliceosome, oxidative phosphorylation, and immune-related pathways. MYC and NTAN1 correlated with regulatory T cells and M2 macrophages. Furthermore, the microRNA (miRNA)-mRNA-transcription factor (TF) network identified MYC as a hub regulated by hsa-miR-449c-5p and JUN. Disease-gene-drug network highlighted cisplatin and olaparib as potential MYC-targeted therapy. RT-qPCR confirmed MYC downregulation and NTAN1 upregulation in VTE (<i>p</i> < 0.05), consistent with the bioinformatics results.<h4>Conclusion</h4>This study identified MYC and NTAN1 as pivotal regulators of VTE, bridging thrombotic progression with immune-metabolic dysregulation. The findings provided novel insights into key genes and immunomodulatory therapies for VTE.

HFE
Also flagged:Metabolic-associated fatty liver diseasechronic liver diseaseobesityinsulin resistancehepatic steatosistype 2 diabetes
Journal Article 2025-10-24 ✓ 1 Snippet Zacharakis G, Alyami H, Alrasheed T, Almutairi NS, Gomaa Shehab GM, Elbqry MG, Ali Alotni M.
In-Text Gene Mentions

…Wilson’s disease, andhemochromatosis), use of steatogenic…

Show Full Abstract

<h4>Background</h4>Metabolic-associated fatty liver disease (MAFLD) is a leading cause of chronic liver disease worldwide, which is closely linked to poor dietary habits, obesity, and metabolic dysfunction. The Global Diet Quality Score (GDQS) and Prime Diet Quality Score (PDQS) are newly developed tools for assessing diet quality across diverse populations. However, evidence on their relationship with MAFLD remains limited. This study aimed to investigate the association between GDQS and PDQS and the odds of MAFLD using a case-control design.<h4>Methods</h4>We conducted a case-control investigation at Prince Sattam bin Abdulaziz University Hospital, Al-Kharj, Saudi Arabia, with participant enrollment from February 2023 to January 2025. The study cohort consisted of 225 cases and 225 controls. Dietary intake was assessed using a semi-quantitative food frequency questionnaire to calculate GDQS and PDQS. Cases and controls were matched by age (±3 years). An unconditional logistic regression analysis was performed to estimate odds ratios (ORs) and 95% confidence intervals (CIs).<h4>Results</h4>Cases had lower GDQS and PDQS compared to controls (<i>p</i> < 0.001), with a higher consumption of refined grains and sugar-sweetened beverages and a lower intake of fruits, vegetables, and legumes. Each 1-SD increase in the GDQS and PDQS was associated with approximately 40% lower odds of MAFLD (OR = 0.61; 95% CI: 0.47, 0.79 and OR = 0.60; 95% CI: 0.46, 0.79, respectively).<h4>Conclusion</h4>Higher GDQS and PDQS scores are associated with reduced MAFLD risk, suggesting that improving diet quality could be a key strategy for MAFLD prevention in clinical and public health settings.

Also flagged:synthesistriacylglycerolscaprylic acidlinoleic acid:2lipase
Journal Article 2025-10-24 No Snippets Park J, Lee J, Kim J, Chang PS.
Show Full Abstract

Medium- and long-chain triacylglycerols (MLCTs) offer rapid energy release and essential nutritional benefits, making them valuable in functional foods. In this study, MLCTs containing caprylic acid (C8:0; C) and linoleic acid (C18:2; L) were synthesized via a chemoenzymatic strategy combining lipase-catalyzed reactions and Steglich esterification. Four distinct MLCT congeners-CCL, CLC, LLC, and LCL-were obtained with yields of 52-67% (asymmetrical) and 71-84% (symmetrical), and purified using preparative HPLC (> 98%). The resulting compounds were structurally characterized by HPLC-ESI-MS and <sup>13</sup>C NMR spectroscopy. HPLC-ESI-MS confirmed the expected mass-to-charge values for the [M + NH₄]⁺ adducts: 624.6 for CCL/CLC and 760.6 for LLC/LCL. <sup>13</sup>C NMR analysis verified molecular symmetry; asymmetric TAGs showed three carbonyl signals (e.g., 173.30, 173.26, 172.88 ppm for CCL), while symmetric forms showed two signals. These results confirm the successful synthesis and structural integrity of MLCTs with defined fatty acid positioning for functional lipid applications.

PCDH17
Also flagged:CancerGenisteinHSD17B1gastric adenocarcinomaGAbinding
Journal Article 2025-10-24 ✓ 1 Snippet Wang X, Zhang J, Jiang J, Wang Y.
In-Text Gene Mentions

…molecular markers likePCDH17and SOX2 […

Show Full Abstract

Genistein has anti-cancer effects, but its molecular targets in gastric adenocarcinoma (GA) are unclear. This study used single-cell RNA sequencing (scRNA-seq) and spatial transcriptomics (ST) to explore genistein's "drug-gene-cell" interactions in GA. GA- and genistein-related target genes were retrieved and intersected with differentially expressed genes identified from bulk transcriptomic data. Machine learning screened candidates, and survival analysis assessed prognosis. Molecular docking with genistein validated key genes, with molecular dynamics assessing binding stability. <i>HSD17B1</i>, <i>EZH2</i>, <i>CCNB1</i>, <i>CCNB2</i>, <i>CDKN2A</i>, and <i>IGFBP6</i> were identified as key candidate genes with prognostic value for GA. Specifically, samples in the <i>IGFBP6</i> high-expression group were associated with higher survival probability, whereas the opposite trend was observed for the other five genes. In addition, HSD17B1 was genistein's main target in GA treatment, showing a strong binding affinity with genistein (binding energy of -8.1 kcal/mol). scRNA-seq analysis indicated that <i>HSD17B1</i> was predominantly expressed in epithelial cells and was significantly involved during their malignant transformation (confirmed by ST). This study identified <i>HSD17B1</i> as a critical target gene for genistein in GA treatment, emphasizing its roles in the malignant transformation of epithelial cells, thus providing a theoretical foundation for understanding the therapeutic mechanism of genistein in GA.

Also flagged:ChitosanNeurodegenerative Diseasesdementiadeathbiopolymercognitive impairment
Journal Article 2025-10-24 No Snippets Gomes ACC, Almeida A, Freire CSR, Ferreira BL.
Show Full Abstract

According to the World Health Organization, Alzheimer's disease and other forms of dementia were the seventh leading cause of death in 2021. The prevalence of these disorders is predictable to increase with life expectancy, and their control is hampered by several factors, including late diagnosis due to the lack of specific biomarkers and the absence of disease-modifying treatments, as currently available therapies can only lighten some of the symptoms. Nanotechnology could be the key to overcoming some of the limitations associated with neurodegenerative diseases, as nanomaterials have excellent properties compared to their bulk counterparts and can be used as drug delivery systems, diagnostic tools and platforms for tissue regeneration. Chitosan is a biopolymer with numerous properties that impart it with great potential for biomedical applications, in particular its ability to cross the blood-brain barrier and its versatility in nanoscale design. In this context, the aim of this review is to provide an in-depth analysis of the latest developments and future opportunities for chitosan (nano)formulations for the treatment and management of neurodegenerative diseases.

Also flagged:signal transductiongene expressionautophagychronic liver diseasesnon-alcoholic fatty liver diseaseNAFLD
Journal Article 2025-10-24 No Snippets Qiu X, Tian H, Gao Y, Wang J, Bao Z, Qiu N, Zhang F, Zhang Z, Wang F, Zheng S, Shao J.
Show Full Abstract

Liquid-liquid phase separation (LLPS) is a cellular process driven by multivalent interactions, forming dynamic biomolecular condensates containing proteins, RNAs, and other molecules. LLPS plays a pivotal role in processes such as signal transduction, gene expression, autophagy, and cellular stress responses. The dysregulation of LLPS is linked to chronic liver diseases (CLDs), particularly non-alcoholic fatty liver disease (NAFLD), liver fibrosis, and hepatocellular carcinoma (HCC). LLPS profoundly mediates the pathological evolution of these diseases by regulating key mechanisms, including lipid metabolism, inflammatory responses, and cell death. This review highlights the central role of LLPS in NAFLD progression, liver fibrosis, and HCC transformation. Furthermore, it evaluates the feasibility of targeting LLPS as a therapeutic strategy, proposing innovative approaches such as small-molecule inhibitors, protein modification regulators, and RNA interference to restore LLPS homeostasis. These strategies hold the potential to mitigate disease progression and prevent the transition to fibrosis and liver cancer.

Also flagged:Proteasesynthesispeptidedimethyl sulfoxidepeptide oligomersproteases
Journal Article 2025-10-24 No Snippets Pan X, Wu Q, Xia B.
Show Full Abstract

Sub-zero preservation is essential in biomedical fields like tissue engineering, gene therapy, and transplantation. Traditional cryoprotectants like dimethyl sulfoxide are toxic and can alter cell epigenetics, necessitating safer alternatives. Herein, an enzymatic synthesis of antifreeze peptide oligomers (AFPOs) using protease-catalyzed polymerization is introduced. Employing proteases as catalysts, AFPOs were synthesized by condensing <i>L</i>-alanyl-alanyl-threonine (<i>L</i>-AAT) as a model monomer, and this method was extended to produce two additional sequences, poly(<i>L</i>-alanyl-threonine-alanyl) (<i>L</i>-PATA) and poly(<i>L</i>-threonine-alanyl-alanyl) (<i>L</i>-PTAA). Notably, using <i>L-</i>alanyl-threonyl-alanine (<i>L</i>-ATA) as the monomer, a degree of polymerization up to 14 was achieved. Although identical amino acid compositions were shared by all AFPOs, measurable antifreeze activity was exhibited only by <i>L</i>-PTAA, indicating that monomer sequence-and thus detailed backbone architecture-rather than composition alone governs antifreeze performance. Excellent antifreezing properties were demonstrated by <i>L</i>-PTAA, marking it as safe, sustainable alternatives to conventional cryoprotectants. These findings highlight the effectiveness of enzymatic synthesis methods for producing functional AFPOs.

HFE
Also flagged:ferroportinSLC40A1ironexporterferroportin diseaseFD
Journal Article 2025-10-24 ✓ 5 Snippets Troppmair MR, Ricci A, Scarlini S, Pelucchi S, Porto G, Busti F, Sanchez M, Weissensteiner H, Schönherr S, Forer L, Kronenberg F, Pammer LM, Kremser C, Henninger B, Junior Lima Santos PC, An P, Wang F, De Gobbi M, Unal S, Noriyuki Y, Ishikawa T, Drakesmith H, Tilg H, Bardou-Jacquet E, Girelli D, Piperno A, Pietrangelo A, Corradini E, Schaefer B, Zoller H.
In-Text Gene Mentions

…disease and SLC40A1-relatedhemochromatosis- Results from…

…from the EASL non-HFEregistry.…

…(FD) from SLC40A1-relatedhemochromatosis(SLC40A1-HC), which are…

…compare outcomes withHFE-related hemochromatosis (HFE-…

…outcomes with HFE-relatedhemochromatosis(HFE-HC).<h4>Methods</h4>The i…

Show Full Abstract

<h4>Background & aims</h4>Pathogenic variants in the cellular iron exporter ferroportin (SLC40A1) cause hepatic and splenic iron overload. Low to normal transferrin saturation (TSAT) and iron accumulation in Kupffer cells with high splenic iron distinguish ferroportin disease (FD) from SLC40A1-related hemochromatosis (SLC40A1-HC), which are both caused by variants in SLC40A1. The aim of our study was to describe pathogenic mutations in SLC40A1, phenotypic variability in affected patients and compare outcomes with HFE-related hemochromatosis (HFE-HC).<h4>Methods</h4>The international EASL non-HFE hemochromatosis patient registry prospectively collected clinical, radiological, biochemical, and genetic data for 95 patients with SLC40A1 variants from six centers. Additionally, 363 patients were identified by a systematic literature review. As a comparator, 603 patients diagnosed with HFE-HC were included.<h4>Results</h4>The FD phenotype presented in 65.5% of affected individuals. Patients with FD were younger at diagnosis and more often female than those with SLC40A1-HC. SLC40A1 variants were associated with higher hepatic and splenic iron concentrations compared to the HFE-HC group. Variability in phenotypic presentation was high among patients with SLC40A1 variants, and a genotype-to-phenotype correlation could only explain a small proportion of this variation. Variants that directly affect the metal binding site in ferroportin more likely presented with high TSAT. Patients with the SLC40A1-HC phenotype (TSAT >45%) had a higher risk of fibrosis. Life expectancy was similar between patients with SLC40A1 variants and matched patients with HFE-HC. Most individuals with SLC40A1 variants (73.2%) received regular phlebotomies, which were not associated with differences in life expectancy.<h4>Conclusions</h4>Mutations in SLC40A1 cause a highly variable disease spectrum with hepatic and splenic iron overload. Fibrosis risk is higher in patients with elevated TSAT.<h4>Impact and implications</h4>Clinical management of individuals with SLC40A1 variants has largely been extrapolated from HFE-related hemochromatosis despite fundamental pathophysiological differences. Our study provides detailed phenotypic characterization that supports diagnosis and distinction of these rare iron overload disorders. Long-term follow-up shows preserved life expectancy, unaffected by phlebotomy, underscoring the need to critically assess phlebotomy on an individualized basis. Patients with SLC40A1-related hemochromatosis (transferrin saturation >45%) had a higher prevalence of chronic liver disease than those with ferroportin disease, suggesting that elevated transferrin saturation and hepatic iron drive disease progression, which can guide risk stratification and clinical decision making.<h4>Clinical trial number</h4>Not applicable.

Also flagged:Neurodegenerative DiseasesAmyloid-βTaualpha-synucleinCRISPRneurodegenerative disorders
Journal Article 2025-10-24 No Snippets Waqar Z, Sethi P, Jain D, Singh K, Alsaidan OA, Alzarea SI, Gupta JK, Saxena S, Sharma MC.
Show Full Abstract

Neurodegenerative diseases, including Alzheimer's and Parkinson's disease, are characterized by the pathological aggregation of proteins such as amyloid-β, tau, and alpha-synuclein. These hallmark proteins play central roles in disease progression and represent promising targets for therapeutic intervention. Advances in precision medicine, driven by genomic technologies such as CRISPR-Cas systems, RNA-based therapies, and high-throughput sequencing, have enabled the development of tailored strategies to modulate these pathological pathways. This review examines the integration of genomic approaches in targeting amyloid-β, tau, and alpha-synuclein, emphasizing their potential to mitigate disease progression and improve patient outcomes. We highlight current progress in preclinical and clinical studies, discuss challenges associated with translating these therapies into clinical practice, and explore future directions for achieving therapeutic precision in neurodegenerative disorders. By examining the interplay of genetic, molecular, and therapeutic innovations, this review underscores the transformative potential of genomic medicine in addressing the unmet needs of neurodegenerative disease treatment.

bioRxiv 2025-10-24 Preprint (No Snippets API) Schlegelmilch K, Hollek V, Hooper S, Giangreco G, Bailey S, Macfarlane S, Carminati A, Bowes A, Strohbuecker S, Shum B, Turajlic S, Fu X, Sahai E.
Show Full Abstract

Resistance to targeted therapies develops in the majority of patients, with numerous different mechanisms having been documented. This is frequently linked to intra-tumour heterogeneity and cancer cells transitioning into different states. In this study, we demonstrate cooperativity between co-occurring resistant states in a single tumour. Using BRAF mutant melanoma as a paradigm, we generate three different resistant states within a single model and demonstrate that they have varying differentiation states, capacities to migrate, and have very few common additional therapeutic vulnerabilities. Through a combination of experiments, including using Cre-mediated recombination to generate heterogeneity in existing tumours, and in silico modelling, we show that intra-tumour heterogeneity is the most favoured state for therapy resistant tumours. This is under-pinned by signalling between different melanoma states, with YAP1 active cells providing supporting signals for other cells but inhibiting their own proliferation. Optimal disease control requires targeting both the YAP1 active cell state and the inter-cellular communication networks. We identify the histone demethylase inhibitor GSK-J4 as being particularly effective in targeting both features of resistant tumours, and demonstrate its ability to control melanoma with multiple concurrent resistance mechanisms.

medRxiv 2025-10-24 Preprint (No Snippets API) Trelle AN, Cody KA, Nguyen TT, Winer JR, Weiss S, Sai I, Channappa D, Mendiola J, Al-Rajhi A, Raghuraman K, Sha SJ, Wilson EN, Wyss-Coray T, Wagner AD, Maecker HT, Mormino EC.
Show Full Abstract

<h4>Background</h4> Multianalyte plasma proteomic panels that can accurately detect initial AD pathology in preclinical populations and simultaneously measure related biological processes relevant for disease risk are critical for advancing early detection and prognosis. <h4>Methods</h4> Using the NULISAseq CNS panel, we measured plasma from 193 clinically unimpaired (CU) older adults enrolled in the Stanford Aging and Memory Study (SAMS). We evaluated correspondence of core AD-relevant biomarkers Aβ42, Aβ40, pTau217, pTau181, GFAP, NfL, Aβ42/Aβ40, and pTau217/Aβ42 measured using NULISAseq and established Lumipulse immunoassays. ROC curve analyses compared the accuracy of these biomarkers for detecting Lumipulse CSF Aβ-positivity across platforms. Linear models were applied across 124 NULISAseq proteins to examine associations with common AD risk factors, including age, female sex, and APOE- ε4, as well as with biomarkers CSF Aβ42/Aβ40 and pTau181, 18F-PI2620 Tau PET, and memory. Fold change differences in NULISAseq proteins as a function of CSF Aβ (A+) and pTau181 (T+) status were examined using Wilcoxon rank-sum tests. <h4>Results</h4> Moderate to high correlations were observed between NULISAseq and Lumipulse AD plasma biomarkers. Across platforms, plasma pTau217/Aβ42 exhibited the highest performance in discriminating CSF A+ (NULISAseq AUC: 0.940, 95%CI: 0.885-0.995; Lumipulse AUC: 0.907, 95%CI: 0.849-0.966). Age and sex were associated with differential expression of NULISAseq targets linked to neurodegeneration, microglial activation, and inflammation. CSF A+ was associated with fold change differences in Aβ42, pTau217, pTau231, pTau181, and GFAP, while CSF T+ was additionally associated with increases in TREM1, TIMP3, SAA1, and S100A12. When stratified by AT groups, A+T-exhibited lower Aβ42 and elevated pTau217 compared to A-T-, whereas A+T+ exhibited elevated pTau231 and pTau181 compared to A+T-. Temporal cortex tau was positively associated with NULISAseq pTau217, pTau231, pTau181, and pTau217/Aβ42. Memory function was negatively associated with pTau isoforms and PRDX6, YWHAZ, ENO2, ARSA, CHI3L1, CXCL8, and FCN2. These associations remained when controlling for pTau217 and restricting to A-CU, suggesting these targets may represent AD-independent biological pathways relevant for memory function. <h4>Conclusions</h4> NULISAseq immunoassay-based multiplexing accurately detects AD pathology among CU older adults and identifies multiple biological pathways related to early biomarker abnormality and memory function that may become dysregulated in preclinical AD.

Also flagged:translation initiationbindingG protein-coupled receptorsGPCRsextracellularG-protein coupled receptor 143
Journal Article 2025-10-23 No Snippets Zhang J, Humphreys IR, Pei J, Kim J, Choi C, Yuan R, Durham J, Liu S, Choi HJ, Baek M, Baker D, Cong Q.
Show Full Abstract

Protein-protein interactions (PPIs) are essential for biological function. Coevolutionary analysis and deep-learning (DL)-based protein structure prediction have enabled comprehensive PPI identification in bacteria and yeast, but these approaches have had limited success for the more complex human proteome. We overcame this challenge by enhancing the coevolutionary signals with sevenfold-deeper multiple sequence alignments harvested from 30 petabytes of unassembled genomic data and developing a new DL network trained on augmented datasets of domain-domain interactions from 200 million predicted protein structures. We systematically screened 200 million human protein pairs and predicted 17,849 interactions with an expected precision of 90%, of which 3631 interactions were not identified in previous experimental screens. Three-dimensional models of these predicted interactions provide numerous hypotheses about protein function and mechanisms of human diseases.

NEGR1
Also flagged:menopausemineralosteoporosismenarcheestrogenRERE
Journal Article 2025-10-23 ✓ 1 Snippet Lei B, He L, Qu Y, Wu X, Qiu L, Tang M, Zhang L, Zou Y, Song X, Yang B, Wang W, Sun L, Wang L, Xu J, Chen Y, Wang S, Cai S, Fan M, Li J, Zhang B, Jiang X, Jia Y.
In-Text Gene Mentions

…CTPS1 , andNEGR1) ( 12…

Show Full Abstract

<h4>Objective</h4>While the phenotypic associations of menstrual traits, such as age at menarche (AAM) and age at natural menopause (ANM), with bone mineral density (BMD) have been well observed, the understanding of their shared genetic mechanisms is lacking. We aimed to systematically explore the underlying genetic basis connecting AAM and ANM with BMD.<h4>Methods</h4>We performed a large-scale genome-wide cross-trait analysis by leveraging summary statistics from the hitherto largest genome-wide association studies conducted among the European population for AAM (n = 556,124), ANM (n = 201,323), and heel estimated BMD (eBMD, n = 426,824), a robust validated predictor of osteoporosis risk.<h4>Results</h4>We identified significant genetic correlations for eBMD with both AAM (r g = -0.082, P = 1.83 × 10-8) and ANM (r g = 0.044, P = 0.007). Cross-trait meta-analysis yielded 203 AAM-eBMD shared loci, of which 3 were novel and 77 ANM-eBMD shared loci, of which two were novel. Gene-based analysis revealed 409 AAM-eBMD shared genes and 179 ANM-eBMD shared genes. Mendelian randomization demonstrated that genetically predicted later AAM (β = -0.054, 95% CI = -0.069 to -0.040, P = 6.08 × 10-14) and genetically predicted earlier ANM (β = 0.010, 95% CI = 0.004-0.017, P = 0.003) were significantly associated with decreased levels of eBMD. No evidence of reverse causality was found.<h4>Conclusion</h4>Our work provides evidence in support of a substantial shared genetic basis and causal relationships between menstrual traits and BMD. The findings could be instrumental in developing risk stratification strategies and formulating novel pharmaceutical interventions for osteoporosis.<h4>Strengths and limitations of the study</h4>Genome-wide cross-trait design provided insights into the shared genetic basis and biological mechanisms underlying the phenotypic associations between AAM, ANM, and eBMD. The adoption of the hitherto largest GWAS summary statistics ensured statistical power. The genetic data were exclusively from European ancestry, limiting the generalizability of our results. Current findings are primarily derived from bioinformatic analyses and interpreted based on existing, incomplete biological knowledge of the SNPs and genes.

Also flagged:Neuromuscular Diseasedistal muscle atrophyoculopharyngodistal myopathyOPDMLRP12neuromuscular disorders
Journal Article 2025-10-23 No Snippets Iguchi Y, Tsujikawa K, Murakami A, Kume K, Nakazawa Y, Oso T, Nishio Y, Matsuo K, Fukami Y, Araki K, Ogi T, Kawakami H, Katsuno M.
Show Full Abstract

This study describes a family of patients with distal muscle atrophy and oculopharyngodistal myopathy (OPDM). Patients with distal muscle atrophy exhibited slowly progressive distal-predominant muscle weakness without ptosis, ophthalmoplegia, or facial weakness. Long-read sequencing confirmed the presence of intermediate and pathogenic CGG repeat expansions in LRP12 in the patients with distal muscle atrophy and OPDM, respectively. This family demonstrated a similar phenotype-genotype correlation dependent on the LRP12 repeat length, as in a previous study, but the case with intermediate repeats could not be classified into a single etiology, even after comprehensive electrophysiological assessments and muscle biopsy.

TNFSF4
Also flagged:CaPpenicillinstreptomycinpuromycinblasticidinhSTEAP1
Journal Article 2025-10-23 ✓ 1 Snippet Sasaki K, Bhatia V, Asano Y, Bakhtiari J, Kaur P, Wang C, Matsuo T, Dubois O, Chiu PC, Gun D, Singh C, Panagi I, Noblecourt L, Nikolaidi M, Chong T, Javier G, Priceman SJ, Chapuis AG, Lee JK, Ishihara J.
In-Text Gene Mentions

…, Cd40 andTnfsf4in the CBD-IL-12…

Show Full Abstract

Immunosuppressive microenvironments, the lack of immune infiltration, and antigen heterogeneity pose challenges for chimaeric antigen receptor (CAR)-T cell therapies applied to solid tumours. Previously, CAR-T cells were armoured with immunostimulatory molecules, such as interleukin 12 (IL-12), to overcome this issue, but faced high toxicity. Here we show that collagen-binding domain-fused IL-12 (CBD-IL-12) secreted from CAR-T cells to target human six transmembrane epithelial antigen of prostate 1 (STEAP1) is retained within murine prostate tumours. This leads to high intratumoural interferon-γ levels, without hepatotoxicity and infiltration of T cells into non-target organs compared with unmodified IL-12. Both innate and adaptive immune compartments are activated and recognize diverse tumour antigens after CBD-IL-12-armoured CAR-T cell treatment. A combination of CBD-IL-12-armoured CAR-T cells and immune checkpoint inhibitors eradicated large tumours in an established prostate cancer mouse model. In addition, human CBD-IL-12-armoured CAR-T cells showed potent anti-tumour efficacy in a 22Rv1 xenograft while reducing circulating IL-12 levels compared with unmodified IL-12-armoured CAR-T cells. CBD fusion to potent payloads for CAR-T therapy may remove obstacles to their clinical translation towards elimination of solid tumours.

Also flagged:Efferocytosisapoptotic cell clearancepathogenesisautoimmune diseasestumorscancer
Journal Article 2025-10-23 No Snippets Li G, Xu J, Tian X, Xiao J, Long J, Chen Y, Shen W, Zhao S.
Show Full Abstract

Efferocytosis, the process of apoptotic cell clearance, is a fundamental biological mechanism for maintaining tissue homeostasis. However, its role in disease pathogenesis is often oversimplified, neglecting a critical knowledge gap: how the single process could drive opposing pathological outcomes. This review provides a comprehensive analysis centered on the functional duality of efferocytosis. By synthesizing evidence across a spectrum of human pathologies-from atherosclerosis and neurodegeneration to cancer-we establish a core paradigm: impaired efferocytosis is a central pathogenic driver in chronic inflammatory and autoimmune diseases, leading to unresolved inflammation. Conversely, the hijacking of efferocytosis by tumors fosters an immunosuppressive microenvironment, facilitating immune evasion. This dichotomy presents a significant therapeutic conundrum, as enhancing efferocytosis benefits inflammatory conditions but exacerbates cancer. By dissecting these context-dependent mechanisms, we argue that the future of efferocytosis-based medicine hinges on developing targeted, disease-specific strategies to safely harness this powerful biological process.

PTGIS
Also flagged:myogenesisinjuriestissue morphogenesisextracellularorganizationlarge T antigen
Journal Article 2025-10-23 ✓ 1 Snippet Ayan B, Chen G, Jain I, Chen S, Chiang G, Hu C, Reyes R, Oropeza BP, Huang NF.
In-Text Gene Mentions

…prostaglandin pathway (Ptgis, Ptgs1 ,…

Show Full Abstract

Traumatic muscle injuries associated with volumetric muscle loss (VML) are characterized by muscle loss beyond intrinsic regeneration capacity, leading to permanent functional impairment. Experimental therapies to augment muscle regeneration, such as cell injection, are limited by low cell transplantation capacity, whereas conventional engineered muscle tissue transplants lack geometric customization to conform to the shape of the muscle defect. Here, a facile approach to engineer scaffold-free high-density muscle tissues in customizable geometric shapes and sizes with high cell viability and integration potential is developed. Using a facile mold-based approach to engineer scaffold-free modular units, transcriptional profiling is performed to uncover the role of pre-formed cell-cell interactions within scaffold-free muscle bioconstructs on myogenesis, an the efficacy of muscle bioconstructs in a mouse model of VML is then evaluated. RNA sequencing revealed that pre-formed cell-cell interactions supported myogenic pathways related to muscle contraction and myofibril assembly, unlike dissociated monodisperse cells. This work further demonstrates the therapeutic efficacy of 3D rectangular solid-shaped scaffold-free transplants in improving muscle function and vascular regeneration. Finally, toward clinical translation, the feasibility of this technology to integrate with medical imaging and artificial intelligence-driven customized bioconstruct design and assembly for intraoperative use is illustrated.

MLLT10
Also flagged:Acute myeloid leukemiaAMLpediatric leukemiaKMT2AMLLMLLT3
Journal Article 2025-10-23 ✓ 3 Snippets Shoji K, Yoshida K, Iyoda S, Ishikawa M, Tanaka M, Nobe M, Saito N, Shino Y, Nannya Y, Yamato G, Tsujimoto S, Shiba N, Hayashi Y, Shiozawa Y, Shiraishi Y, Chiba K, Okada A, Tanaka H, Miyano S, Koga Y, Goto H, Terui K, Ito E, Kiyokawa N, Tomizawa D, Taga T, Moritake H, Tawa A, Takita J, Nishikori M, Adachi S, Ogawa S, Matsuo H.
In-Text Gene Mentions

…S2 ), while KMT2A::MLLT10, KMT2A::ELL ,…

…ypes, KMT2A::MLLT3 and KMT2A::MLLT10, infants had…

…10⁴/μL), KMT2A::MLLT3, KMT2A::MLLT10, KMT2A::ELL, KMT2A::MLLT4, KM…

Show Full Abstract

Driver mutations in KMT2A-rearranged (KMT2A-r) have been identified in acute myeloid leukemia (AML); however, age-related differences in their frequency and prognostic factors remain unclear. In this study, we report age-specific mutation profiles and outcomes in pediatric patients with KMT2A-r AML. In 239 cases of KMT2A-r AML, infants (<1 year, N= 59) showed a significantly higher event-free survival (EFS) and overall survival (OS) compared with children (≥1 year, N=180). Conversely, in 538 cases of non-KMT2A-r AML, infants exhibited a significantly lower EFS and OS than children. KMT2A::MLLT4 was only detected in children with KMT2A-r AML and was associated with a poor prognosis. In KMT2A-r AML, mutations in signaling pathway genes, such as KRAS, were frequently detected in infants and children. However, the frequency of non-signaling pathway mutations was significantly higher in children. Moreover, non-signaling pathway mutations had no significant effect on the prognosis in infants and children, whereas KRAS mutations were associated with poor prognosis in both groups. Multivariate analysis identified older age, a high white blood cell count, KMT2A::MLLT4, and KRAS mutations as independent adverse prognostic factors for both EFS and OS. These age-specific mutation profiles suggest distinct disease mechanisms across age groups and may help to refine risk stratification and treatment strategies for pediatric KMT2A-r AML.

Also flagged:cancersarcomakinasetumorsarcomasgastrointestinal stromal tumor sarcomas
Journal Article 2025-10-23 No Snippets Nakata E, Ninomiya K, Osone T, Ennishi D, Tomida S, Fujiwara T, Kunisada T, Futagawa M, Hirasawa A, Toyooka S, Ozaki T.
Show Full Abstract

Next-generation sequencing-based comprehensive cancer genomic profiling is promising in cancer management; however, most studies rely on tumor-only DNA panels from single institutions. In 2023, Japan introduced an insurance-covered cancer genomic profiling test-the GenMine TOP Cancer Genome Profiling System-a dual DNA-RNA panel with matched tumor-normal testing. This study evaluated its utility compared to a conventional DNA-only test (FoundationOne CDx) in managing sarcoma patients using a nationwide genetic profiling database provided by the Center for Cancer Genomics and Advanced Therapeutics. This study included 1046 patients registered between August 2023 and October 2024. The dual DNA-RNA test identified significantly more fusion genes (20.3% vs. 7.4%, p < 0.001) and therapeutically targetable kinase fusions (3.5% vs. 1.2%, p = 0.019) than the DNA-only test. Among patients with translocation-related sarcomas, histology-specific fusion genes were identified in 77.5% using the dual panel, compared to 40.0% with the DNA-only panel (p < 0.001). In non-gastrointestinal stromal tumor sarcomas, the dual test showed a trend toward higher rates of genotype-matched therapy (4.3% vs. 2.6%, p = 0.25) and a significantly higher rate of molecular targeted therapy (4.3% vs. 1.5%, p = 0.03). Additionally, 5.7% of patients had pathogenic germline variants identified through tumor-normal matched analysis. These findings suggest that a dual DNA-RNA panel with matched tumor-normal testing may improve diagnostic accuracy and inform treatment decisions in the routine clinical management of sarcoma.

MLLT10
Also flagged:myeloid neoplasmshematologic neoplasmsautoimmune diseasesTP53P53MPO
Journal Article 2025-10-23 ✓ 1 Snippet Soliman DS, Fareed S, Chandra P, Akiki S, El-Omri H, Ibrahim F, Yassin M, El Kourashy SA, Al-Sabbagh A, Al-Kuwari E.
In-Text Gene Mentions

…, MECOM ,MLLT10, MRTFA ,…

Show Full Abstract

Post cytotoxic myeloid neoplasms signify a heterogenous pool of poorly understood hematologic neoplasms with unfortunate survival and ineffective therapies. There is a lack of consensus on prognostic indicators, primarily due to the heterogenous disease spectrum encompassing different pathological, cytogenomic and original disease variables. This retrospective, single-center study over 10 years duration on MN-pCT cases diagnosed at NCCCR, a member of Hamad Medical Corporation. The study aimed to analyze clinicopathologic and cytogenomic characteristics, identify key prognostic predictors, and assess their impact on mortality through univariate and multivariate analyses. We identified 42 MN-pCT patients, noting a 31.7% prevalence of autoimmune diseases as primary condition, which is higher than previously reported. TP53 was the most frequently mutated gene, found in 28.6% of tested cases. Significant determinants of a shorter latency period included prior exposure to alkylating agents and TP53 positivity (by NGS or IHC) (P < 0.05). Younger patients (≤ 50 years) exhibited longer survival (P = 0.018). Poor prognostic markers included dyserythropoiesis (P = 0.045), MPO downregulation (P = 0.026), mutated TP53 (NGS/IHC) (P = 0.004), and failure to achieve CR (P = 0.002). Multivariate Cox regression identified both a latency period of ≥ 5 years and TP53 positivity (detected by either NGS or IHC) as statistically significant independent factors associated with reduced overall survival (P < 0.05). It is important to highlight that P53 mutation by NGS was a common parameter identified by the multivariate analysis that adversely impacted both MN-Pct survival and OS. This study stands as a significant contribution to our understanding of the clinicopathologic characteristics and prognostic predictors of MN-pCT in MENA region. It also underscores the existence of adverse prognostic factors, extending beyond the genetic influences and emphasizing the necessity of recognizing it as a distinct entity in the future classification systems.

DCC
Also flagged:Cas9dpy-10hatchingsynthesischromatinembryogenesis
Journal Article 2025-10-23 ✓ 4 Snippets Li Y, Gao Y, Ma J, Gao Y, Tang J, Yang R, Wang J, Zhou W, Zhang H, Shao W, Liu Z, Zhao Z, Liu X.
In-Text Gene Mentions

…Dosage Compensation Complex (DCC) onto numerous cis…

…of the tenDCCsubunits and its…

…that divergence inDCCsubunits or associated…

…any, contribution ofDCCgenes to hybrid…

Show Full Abstract

Zygotic reproductive isolation frequently initiates with hybrid incompatibility in the heterogametic sex, such as males in XX/XY systems. The genetic basis of hybrid male incompatibility has long remained elusive. Here, we show that crosses of <i>Caenorhabditis nigoni</i> males with <i>C. briggsae</i> females result in insufficient expression of <i>Cbr-xol-1</i>, an X-linked master switch responsible for intimately linked sex determination and dosage compensation pathways, consequently triggering aberrant X-chromosome repression in males, and ultimately leading to embryonic inviability. In contrast, male embryos from the reciprocal cross maintain normal expression level of <i>C. nigoni xol-1</i> genes, consistent with their viability. We further demonstrate that the cis-regulatory regions of <i>Cbr-xol-1</i> and <i>Cni-xol-1</i> have functionally diverged. Finally, X transcription is also aberrantly repressed in lethal hybrid male embryos from crosses between gonochoristic species <i>C. latens</i> and <i>C. remanei</i>. Our results suggest an evolutionary scenario in which incompatibility of the dosage compensation system leads to reproductive isolation.

B4GALT5
Also flagged:glycosyltransferaseGlucosepenicillinstreptomycinNotchbinding
Journal Article 2025-10-23 ✓ 2 Snippets Tsukamoto Y, Aoki K, Kama Y, Hosokawa H, Saiki W, Tsukamoto N, Kato K, Hosokawa Y, Sato R, Uesugi N, Fujita Y, Fukazawa K, Funada D, Suzuki F, Kurebayashi Y, Urata Y, Uchiyama S, Wang W, Minami A, Takahashi T, Tiemeyer M, Narimatsu Y, Okajima T, Takeuchi H.
In-Text Gene Mentions

…while DKO ofB4GALT5and B4GALT6 did…

…they were inB4GALT5- and B4GALT6 -deficient…

Show Full Abstract

Three types of <i>O</i>-linked glycosylation-<i>O</i>-glucose, <i>O</i>-fucose, and <i>O</i>-<i>N</i>-acetylglucosamine- are crucial for the function of Notch receptors, which regulate critical cell fate determination processes in a wide variety of contexts. <i>O</i>-Glucose glycans are transferred to serine residues located between the first and second conserved cysteines within the epidermal growth factor-like (EGF) repeats in the Notch extracellular domain. Previously, <i>O</i>-glucose glycans were shown to be extended to a trisaccharide structure with two xyloses via α1-3 linkages. Our recent studies, however, indicated that the <i>O</i>-glucose glycan on NOTCH1 EGF10 can be extended by hexose and Neu5Ac. Here, we demonstrated that this hexose- and Neu5Ac-extended glycan has a 3'-sialyllactose-like structure synthesized by specific members of two isoenzyme families, B4GALT1 and ST3GAL4. Using mass spectrometry, we identified this modification exclusively on NOTCH1 EGF10 and the analogous NOTCH3 EGF9 domain, with no detection in any other EGF domains in NOTCH1, NOTCH2, and NOTCH3. Sequence comparison and mutagenesis experiments identified one amino acid at position -2 of the fourth cysteine (C<sup>4</sup>-2) in the EGF domain as crucial for the galactose elongation of <i>O</i>-glucose glycans. We further demonstrated that this site-specific elongation of <i>O</i>-glucose on NOTCH1 EGF10 significantly impacts ligand binding and signal transduction of NOTCH1. In the context of early T cell development, the C<sup>4</sup>-2 mutants NOTCH1 A396Y and A396F enhance T cell differentiation through DLL1- and DLL4-dependent NOTCH1 signaling. Our findings contribute to the understanding of the intricate regulatory mechanisms of Notch receptor function mediated by distinct positions and structures of <i>O</i>-glycans.

Also flagged:polypeptidepolypeptidesdegradationneurodegenerative disordersmetabolic syndromescancer
Journal Article 2025-10-23 No Snippets Kuzu OF, Granerud LJT, Saatcioglu F.
Show Full Abstract

Protein folding is a fundamental process ensuring that polypeptide chains acquire the correct three-dimensional structures required for biological function. This complex journey from nascent polypeptides to mature proteins is tightly regulated by the cellular proteostasis network-an integrated system of molecular chaperones, folding enzymes, and degradation machineries. Disruptions in this network lead to dysproteostasis, a pathological state implicated in a growing list of human diseases, including neurodegenerative disorders, metabolic syndromes, and cancer. In this review, we provide a comprehensive and multidimensional analysis of protein folding biology, tracing its evolution from early theoretical foundations to cutting-edge biophysical and computational techniques that now permit near-atomic-resolution modeling of folding dynamics. We explore the historical progression of protein folding research, including landmark discoveries of secondary structure, chaperone biology, and energy landscape theory. We detail the roles of key molecular chaperones across cytosolic, mitochondrial, and endoplasmic reticulum compartments, emphasizing their collaborative actions in protein folding and quality control. We also discuss the multifactorial causes of protein misfolding-from genetic mutations to aging and oxidative stress-and examine the pathological consequences, paying special attention to diseases characterized by toxic protein aggregation and loss of proteome fidelity. We then examine therapeutic innovations targeting proteostasis, including chaperone modulators, proteostasis pathway inhibitors, and emerging strategies to increase proteome resilience. By consolidating insights at the molecular, cellular, and systems levels, this review underscores the central role of protein folding homeostasis in health and disease and highlights novel opportunities for therapeutic intervention through the modulation of the proteostasis network.

Also flagged:gene expressionchromatinTAF11AHRLEMD3VRTN
Journal Article 2025-10-23 No Snippets Fang S, Guo C, Liu H, Wang Y, Tan C, Wu Z, Zhao Y, Hu X, Yang R.
Show Full Abstract

<h4>Background</h4>The historical importation of Chinese pigs into Western countries has facilitated the introduction of Chinese haplotypes into European pig breeds, thereby shaping their genetic diversity and phenotypic traits. However, the genetic and biological implications of this introgression remain poorly understood.<h4>Results</h4>Based on SNP chip and resequencing data, we confirmed significant genetic introgression from Chinese pigs into commercial European lines. The genetic origins of the introgressed segments predominantly derive from Southern Chinese domestic pigs (CSDP), with additional contributions from other populations, such as Eastern Chinese domestic pigs (CEDP). Our study demonstrates that the selection pressure for Chinese pig introgression was stronger in Duroc pigs compared to the Large White and Landrace breeds. Based on ancestral haplotypes from CEDP and CSDP, we conducted a genome-wide association study (GWAS) and identified 10 quantitative trait loci (QTLs), five of which were not identified in previous studies or using SNPs. Expression genome-wide association studies (eGWAS) based on these introgressed haplotypes, using gene expression profiles from the duodenum, liver, and muscle tissues in the Duroc population, revealed eGWAS signals that were enriched near transcript start sites. By integrating GWAS signals for loin muscle depth with eGWAS signals in muscle tissue, we confirmed that a region 300 Kb from TAF11, which is enriched with open chromatin regions and encompasses a super-enhancer located within the same topologically associating domain as TAF11, was associated with both TAF11 expression and loin muscle depth, highlighting the profound influence of Chinese introgression.<h4>Conclusions</h4>These findings offer valuable insights into the genetic influences of Chinese pig introgression on the Duroc breed, as well as the molecular basis for its effects on economically important traits in Duroc pigs.

Also flagged:SOD1amyotrophic lateral sclerosisALSC9orf72neurodegenerative diseasesmultifocal motor neuropathy
Journal Article 2025-10-23 No Snippets Theunissen F, Flynn L, Iacoangeli A, Al Khleifat A, Al-Chalabi A, Giordano JJ, Strømme M, Akkari PA.
Show Full Abstract

With the disease modifying therapy Qalsody (tofersen) which targets the RNA product of the SOD1 gene, having been shown effective in amyotrophic lateral sclerosis (ALS), the present perspective seeks to explore progress towards the implementation of precision medicine principles in ALS drug development. We address the advances in our understanding of the complex genetic architecture of ALS, including the varying models of genetic contribution to disease, and the importance of understanding population genetics and genetic testing when considering patient selection for clinical studies. Additionally, we discuss the advances in long-read whole-genome sequencing technology and how this method can improve streamlined genetic testing and our understanding of the genetic heterogeneity in ALS. We highlight the recent advances in omics-data for understanding ALS patient sub-groups and how this knowledge should be applied to pre-clinical drug development in a proposed patient profiling workflow, particularly for gene targeted therapies. Finally, we summarise key ethical considerations that are pertinent to equitable care for patients, as we enter the era of precision medicine to treat ALS.

TNFSF4
Also flagged:NOL11malignant tumorsNucleolar protein 11ribosomalbiosynthesisGene Expression
Journal Article 2025-10-23 ✓ 1 Snippet Li Z, Fu Y, Wei Y, Zhu Y, Han B, Guo M, Yang J, Xu L, Ye Z, Dong F.
In-Text Gene Mentions

…with CD276 andTNFSF4, while demonstrating inverse…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is one of the most common aggressive malignant tumors worldwide with poor clinical outcomes and high mortality rates, highlighting the pressing need to identify reliable biomarkers. Nucleolar protein 11 (NOL11), as an essential element for ribosomal biosynthesis, has been implicated in the development and progression of various diseases. However, the potential role of NOL11 in HCC remains elusive.<h4>Methods</h4>The expression level of NOL11 was investigated by The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) databases, and the correlation between NOL11 and the clinical characteristics was analyzed. Furthermore, spatial-temporal expression patterns of NOL11 were delineated based on single-cell and spatial transcriptomics. Cox regression and ROC analyses were performed to evaluate the prognostic and diagnostic value of NOL11. Additionally, Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), and gene set enrichment analysis (GSEA) were conducted to elucidate the functional pathways and potential mechanisms associated with NOL11. The association of NOL11 with immune infiltration was also explored using single-sample Gene Set Enrichment Analysis (ssGSEA). The integrated bioinformatics analysis was utilized to identify the drug sensitivity, and further drug validation was employed via molecular docking. Finally, the biological function of NOL11 was validated through in vitro experiments.<h4>Results</h4>The expression of NOL11 was significantly upregulated in HCC, especially in tumor cells. Elevated NOL11 levels closely correlated with worse clinicopathological features, poor prognosis, and immune infiltration. Functional enrichment analysis revealed NOL11's potential involvement in multiple cancer-associated signaling pathways, including the cell cycle, DNA replication, and cell metabolism. Furthermore, we found that common chemotherapy drugs, such as gemcitabine, trametinib, and paclitaxel were sensitive to the expression of NOL11 and exhibited a strong molecular combination with NOL11. Lastly, NOL11 knockdown suppressed the proliferation, migration, and invasion of HCC cells.<h4>Conclusion</h4>Our findings suggest that NOL11 is a promising diagnostic and prognostic biomarker for HCC, providing new insights into the treatment decisions for HCC patients.

SOX6
Also flagged:TGF-βWntMAPKgrowth differentiation factor fiveGdf5Prg4
Journal Article 2025-10-23 ✓ 1 Snippet Raj S, Cutia T, Menghini S, Alemany-Ribes M, Cai J, Young M, Jachim SK, Capellini TD, Craft AM.
In-Text Gene Mentions

…(expressing Sox5 ,Sox6, and Sox9…

Show Full Abstract

The initiation of synovial joint development and subsequent differentiation of progenitor cells toward anatomically and functionally distinct joint tissues are not well understood, despite being highly relevant to joint health and disease. We generated a dual reporter mouse embryonic stem cell (mESC) line to quantify cells expressing growth differentiation factor five (Gdf5), an early marker of joint formation, and Prg4, a lubricating proteoglycan found in joint tissues. Transforming growth factor β (TGF-β) signaling was necessary and sufficient for the induction of Gdf5-RFP and Prg4-GFP. Inhibition of either Wnt or MAPK signaling significantly increased the induction of Gdf5-RFP, while activation of either pathway prohibited this induction. Single cell transcriptomics demonstrated the chondrogenic identity of Gdf5+ cells in in vitro cultures and in mouse embryonic limb buds. We validated the roles of these signaling pathways in joint-specific ex vivo limb bud cultures. Thus, this in vitro model enhances our understanding of joint development and offers new insights into potential therapeutic approaches for joint disorders.

Also flagged:attention-deficit/hyperactivity disorderADHDneurodevelopmental disorderpathogenesissleepmyelination
Journal Article 2025-10-23 No Snippets Zou P, Huang Z, Zong X, Zhang Q.
Show Full Abstract

Attention-Deficit/Hyperactivity Disorder (ADHD), a common neurodevelopmental disorder in childhood, often persists into adulthood, affecting around 500 million adults globally. While genetic factors play a significant role, recent studies have highlighted the contribution of environmental factors to ADHD pathogenesis. Early Life Adversity (ELA), through the impact of chronic stress, disrupts critical neurodevelopmental processes, leading to alterations in brain networks involved in attention. Viewing ADHD through ELA-shaped neurodevelopment reframes the disorder from a largely inherited liability to a partly preventable, stress-programmable phenotype, prioritizing early detection and mechanistic interventions across sensitive periods. Drawing on extensive human clinical research and advancements in ELA animal models, this review critically examines the evidence linking ELA and adult ADHD. The findings indicate that ELA significantly contributes to the persistence of ADHD and increases vulnerability to the disorder. Mechanistic insights suggest that ELA is associated with hypothalamic-pituitary-adrenal axis dysregulation, aberrant epigenetic modifications, sleep disturbances, oxidative stress, neuroinflammation, and disrupted myelination. These processes may interact synergistically, creating cascading effects that exacerbate adult ADHD pathology. This review also summarizes potential therapeutic strategies targeting these underlying mechanisms. Further research in this field is essential to enhance ELA intervention strategies and alleviate the burden of ADHD and its associated comorbidities.

SOX6
Also flagged:TBcalciummanganesehyaluronic acidsodium alginatehydrogen
Journal Article 2025-10-23 ✓ 1 Snippet Zhuang P, Chen L, Zhang Y, Yang W, Chen Y, Wu L, Xiang L, Wang Z, Rosenholm JM, Zuo G, Ye T, Zhang H, Cui W.
In-Text Gene Mentions

…differentiation, such asSox6, Smad3, and Snai2,…

Show Full Abstract

A solid-liquid interface lubrication system composed of tissue and synovial fluid ensures the physiological functions of the tendon-bone (TB). However, after the TB tears, stress concentration and friction disrupt the solid-liquid interface lubrication of the TB and disturb its healing. Herein, solid-liquid interface lubrication hydrogels (MnCaP/HS) are constructed by encapsulating ion-coordinated calcium manganese phosphate microgels into covalent/ionic-cross-linked hyaluronic acid/sodium alginate dual networks. Solid lubrication interfaces are thus formed at the damaged TB through surface hydrogen bonding and ionic toughening and continuously release the biolubrication components into tissue fluid for rolling lubrication layers and liquid lubrication films. This long-lasting lubricating property and MnCaP synergistically improve the immune-regenerative microenvironment of the TB. In vitro, MnCaP/HS increases the toughness by 600% and reduces the friction coefficient at the solid-liquid interface by 60% compared with those of the phosphate-buffered saline group. Moreover, it releases metal ions to promote the anti-inflammation of macrophages and the cartilage-bone gradient differentiation of bone marrow mesenchymal stem cells. In vivo, the maximum load and stiffness of tendons in the MnCaP/HS group increase by 102% and 75%, respectively while exerting long-lasting anti-inflammation to inhibit scarring and complete microstructural reconstruction. Thus, MnCaP/HS provides new solutions for TB reconstruction by providing long-lasting lubrication and a regenerative microenvironment.

DARS2
Also flagged:Motor Neuron DiseaseMotor neuron diseasesneurological disorderspathogenesisRYR1ryanodine receptor 1
Journal Article 2025-10-23 ✓ 1 Snippet Posa A, Kornhuber M.
In-Text Gene Mentions

…CYP7B1, DAG1, DAO,DARS2, DCAF8, DCTN1, DDHD1,…

Show Full Abstract

Motor neuron diseases (MND) are a group of rare, often severe, and life-limiting progressive neurological disorders that primarily affect motor neurons, resulting in muscle weakness and loss of essential muscle functions. Genetic defects play a significant role in MND, contributing to their pathogenesis and progression. The Department of Neurology at Martin Luther University Halle (Germany) followed a male patient with slowly progressive muscle loss, muscle weakness, and muscle pain in the proximal upper arm and shoulder muscles over a period of 10 years and collected clinical, electrophysiological, neuroradiological, laboratory, and genetic data. Clinical neurological and electrophysiological diagnostics clearly indicated MND. A detailed genetic analysis resulted in the first description of an in-frame mutation (heterozygous, c.5691_5693delGGA) in the <i>RYR1</i> gene (ryanodine receptor 1), which is unknown in MND or <i>RYR1</i>-related neuromuscular disorders. Mutations in <i>RYR1</i> are associated with various motor disabilities due to muscle weakness. The specific role of <i>RYR1</i> mutations in the genetic pathogenesis of MND has never been described before and is currently unknown. This case is the first of its kind demonstrating a <i>RYR1</i> mutation in MND, broadening the spectrum of pathogenetic causes of MND.

Also flagged:serine/threonine kinaseosteosarcomadegradationdisulfidenanoparticledithiothreitol
Journal Article 2025-10-23 No Snippets Shi X, Wang R, Zhang Z, Wang Z, Xu W, Shi X, Geng Z.
Show Full Abstract

<h4>Introduction</h4>SGI-1776 represents the first serine/threonine kinase inhibitor to be utilized in the treatment of osteosarcoma. It is severely restricted by poor aqueous solubility, short degradation half-life and severe side effect.<h4>Methods</h4>A polymeric prodrug is prepared by covalently embedding SGI-1776 into mPEG-<i>b</i>-P(N-(2-hydroxypropyl) methylacrylamide) carrier via GSH-responsive disulfide bond. The chemical composition and assembly properties of the conjugate are characterized.<h4>Results</h4>The loading capacity of SGI1776 in the conjugate is 22%. The conjugate displays a typical spherical nanoparticle with diameters around 150-260 nm. Cumulative release amounts of SGI1776 can be detected to be 52.9% at the concentration dithiothreitol of 20 mM at 24 h. The hemolysis rate is about 2.35% even when the concentration increases up to 1,000 mg/L. The value of IC50 is about 18.8 μg SGI1776 equiv. per mL for 143b cells.<h4>Discussion</h4>The conjugate is more likely to induce apoptosis and can be blocked 143b cells in the S cycle phase. The maximum plasma concentration of the conjugate is attained 0.52 ± 0.092 μg/mL at 4 ± 0 h after the oral administration. The conjugate exhibits better lysosomal escape ability, biocompatibility.

Also flagged:CD4CD25FOXP3tumorsecretionIL-10
Journal Article 2025-10-23 No Snippets Guo R, Wang Y, Sun J, Li Y, Bie Z, Li X.
Show Full Abstract

<h4>Objective</h4>Regulatory T cells (Tregs) play a pivotal role in tumor immune evasion, and strategies to overcome their immunosuppressive activity are urgently needed. This study investigates the immunomodulatory effects of microwave ablation (MWA) on TNFRSF4+ Tregs, focusing on the OX40L/TNFRSF4 signaling axis as a potential therapeutic target.<h4>Methods</h4>TNFRSF4+ Tregs were isolated from C57BL/6 mice and subjected to MWA-mimetic thermal stress. <i>In vitro</i> functional assays and <i>in vivo</i> LLC xenograft models were employed, with OX40 agonist intervention. Molecular mechanisms were analyzed via RT-qPCR, Western blot, and immunohistochemistry. The balance of tumor-infiltrating immune cells was quantified by multi-color flow cytometry.<h4>Results</h4>MWA induced three key effects: (1) Phenotypic shift: decreased CTLA-4+ (P<0.0001) Treg subsets, but increased OX40L+ (P<0.01) in LLC cells; (2) Functional impairment: reduced Treg-mediated support for LLC proliferation, migration, and invasion; (3) Enhanced CD8+ T cell cytotoxicity. <i>In vivo</i>, MWA reshaped the tumor microenvironment by significantly increasing the intratumoral CD8+/Treg ratio (P<0.001), indicating a shift toward an anti-tumor inflammatory state. Mechanistically, MWA suppressed NF-κB/IκBα/TRAF6 signaling, and these effects were amplified by an OX40 agonist, suggesting the pathway is potentially OX40L-dependent.<h4>Conclusion</h4>This study demonstrates that MWA disrupts Treg immunosuppression, likely by activating OX40L/TNFRSF4 signaling, and favorably alters the balance of effector to suppressor cells, providing a novel rationale for combining thermal ablation with OX40-targeted immunotherapies in cancer treatment.

HTT
Also flagged:cDNAreovirushepatic hemorrhageNDRV infectionimmunosuppressioninfections
Journal Article 2025-10-23 ✓ 2 Snippets Liu C, Kang Q, Wang X, Zeng F, Huang Y, Yang Y, Geng R, Liao J, Luo X, Yan Z, Yin L, Cao S, Chen F, Zhang H, Peng O, Cao Y.
In-Text Gene Mentions

…both gamma- anddelta-coronaviruseshave been detected…

…interspecies transmission ofdelta-coronavirusesfrom birds to…

Show Full Abstract

<h4>Introduction</h4>Ducks rank among the most important sources of animal protein globally, yet hepatic and splenic hemorrhage and necrosis in Muscovy ducks present a critical challenge to the poultry industry. The causes behind such diseases are often multifaceted, involving both established and newly emerging pathogens.<h4>Methods</h4>In this study, we leveraged metatranscriptomic sequencing to profile the intestinal viral communities of healthy and diseased Muscovy ducks from a Guangdong Province farm that experienced a hepatic and splenic hemorrhage in June 2024.<h4>Results</h4>Our findings revealed marked differences in viral community profiles between the two groups, with the diseased cohort exhibiting higher α-diversity. Taxonomic analyses across multiple levels uncovered significant variations in viral composition, including shifts in phylums like Uroviricota and families such as Demerecviridae. At the genus and species levels, several bacteriophages and eukaryotic viruses displayed differential abundance. Notably, Avian orthoreovirus was detected exclusively in diseased ducks, with a specific novel duck reovirus (NDRV) validated via RT-qPCR as a potential contributor to hepatic and splenic pathogenesis. In contrast, known pathogens such as Duck hepatitis A virus (DHAV) and Fowl adenovirus serotype 4 (FAdV-4) were not detected.<h4>Discussion</h4>This study constitutes the first comprehensive analysis of the Muscovy duck gut virome, highlighting NDRV as a potential causative agent and emphasizing the utility of metatranscriptomics in pathogen discovery.

Also flagged:benign paroxysmal positional vertigoBPPVcanalithiasiscupulolithiasiscarbonatethiazide
Journal Article 2025-10-23 No Snippets Han DG.
Show Full Abstract

Benign paroxysmal positional vertigo (BPPV) arises from detachment of otoconia-calcium carbonate (CaCO<sub>3</sub>) crystals embedded in a protein matrix-whose stability depends on endolymph ionic composition and <i>pH</i>. Age-related calcium metabolism, acid-base imbalance, and hormonal factors can impair otoconia integrity, yet, to our knowledge, no prior quantitative model integrates these biochemical parameters to predict BPPV risk. Beyond the established mechanical mechanisms of canalithiasis and cupulolithiasis, we introduce a parsimonious biochemical model in which the endolymphatic saturation index (Ω), governed by <i>pH</i> and ionized calcium [<i>Ca</i> <sup>2+</sup>], delineates an otoconia stability-dissolution boundary (Ω≈1) and complements the mechanical framework. Using carbonate-equilibrium chemistry and the CaCO<sub>3</sub> solubility product (<i>K</i> <sub><i>sp</i></sub> ), we compute Ω and derive the critical calcium concentration <i>C</i> <sub><i>crit</i></sub> (<i>pH</i>) at Ω = 1. A logistic mapping of ΔC=Ccrit(pH)-[Ca2+] yields a dimensionless relative-risk score. Systemic and environmental states are represented as shifts in <i>pH</i> and [<i>Ca</i> <sup>2+</sup>], and a synthetic cohort (<i>N</i> = 10,000) visualizes <i>pH</i>[<i>Ca</i> <sup>2+</sup>] risk contours and the Ω = 1 boundary. States with Ω>1 (supersaturation) predict otoconia stability, whereas Ω < 1 (undersaturation) predicts dissolution; hyperventilation and thiazide diuretics tend to increase Ω, while metabolic acidosis, hypoventilation, and loop diuretics reduce it; acetazolamide (carbonic-anhydrase inhibition) typically induces metabolic acidosis and therefore lowers Ω. The combination of low <i>pH</i> and reduced [<i>Ca</i> <sup>2+</sup>] markedly expands the Ω < 1 dissolution-prone domain, with the Ω = 1 contour acting as a dynamic equilibrium sensitive to small biochemical changes. In simulations, the risk distribution was right-skewed (mean <i>R</i>≈0.78; 80% with <i>R</i>>0.68). Because direct endolymph sampling is impractical, we propose serum ionized calcium together with blood-gas-derived pH/HCO3-/pCO2 as non-invasive surrogates for relative-risk inference (a blood-based Ω proxy), not one-to-one estimators of absolute vestibular chemistry. This deterministic, two-input minimal framework is hypothesis-generating and complementary to the mechanical model; prospective, surrogate-based calibration and robustness testing (to <i>C</i> <sub><i>T</i></sub> , ionic strength/activity coefficients, <i>K</i> <sub><i>sp</i></sub> , and temperature) are required before clinical use.

CACNA1E
Also flagged:Gene ExpressionCisplatinmetabolismtranslationallower-grade gliomaNeurotoxicity
Journal Article 2025-10-23 ✓ 5 Snippets Torres-Pineda O, Morgado-Valle C, Chi-Castañeda D, López-Meraz ML, Rodríguez-Razón CM, Macías-Carballo M, Beltrán-Parrazal L.
In-Text Gene Mentions

…, GRIA4 ,CACNA1E, and ADORA2A…

…channels such asCACNA1E.…

…, GRIA4 ,CACNA1E, and CDK4…

…calcium channel subunitCACNA1E, indicates a…

…, GRIA4 ,CACNA1E; HSPB1 within…

Show Full Abstract

Cisplatin is a widely used antineoplastic agent whose therapeutic efficacy is often limited by its adverse effects on the central nervous system. In this exploratory study, we characterized the transcriptomic impact of a cumulative cisplatin regimen on the male Wistar rat brain using microarray technology. Differentially expressed genes were identified, and their functional roles were investigated through enrichment analyses (KEGG) and Gene Ontology (GO), and the construction of protein-protein interaction (PPI) networks. Our results revealed significant alterations in pathways related to synaptic signaling, neuroplasticity, and cellular metabolism. To generate translational hypotheses, these findings were subsequently correlated in silico with public human lower-grade glioma (LGG) datasets, which suggested a potential association between key cisplatin-regulated genes and clinical prognosis and immune cell infiltration patterns. This manuscript does not include RT-qPCR (or Western blot) validation; results should be interpreted as hypothesis-generating and require orthogonal confirmation. These findings provide a comprehensive transcriptomic map of cisplatin-induced neurotoxicity, offering novel insights into its underlying molecular mechanisms and identifying a rich set of candidate targets for future neuroprotective strategies.

VRK2
Also flagged:SchizophreniacomplexautoantigensAmino acidenolasepathogenesis
Journal Article 2025-10-23 ✓ 5 Snippets Cano JF, Bernal-Valencia MA, Vargas-Acevedo P, Mejía-Salgado G, Sánchez A, Correa-Jiménez O, Múnera M, de-la-Torre A.
In-Text Gene Mentions

…kinase 2 (VRK2), and dihydropyrimidine…

…from the autoantigensVRK2and DPYD were…

…UniProt: Q05329 ),VRK2(Serine/threonine-protein kina…

…Q05329 ), VRK2 (Serine/threonine-protein kinase VRK2kinase VRK2 ,…

…ForVRK2(UniProt: Q86Y07 ),…

Show Full Abstract

Schizophrenia is a complex disorder influenced by genetic, neurobiological, and environmental factors, with increasing evidence implicating immune dysregulation. This study examined potential molecular mimicry between autoantigens associated with schizophrenia and proteins from <i>Toxoplasma gondii</i>, a parasite previously linked to the disorder. Amino acid sequences of schizophrenia-related autoantigens were retrieved from databases (AAgAtlas, PubMed), and homologous sequences were searched within the <i>T. gondii</i> proteome. Sequence identity was evaluated, and conserved B-cell epitopes were predicted using three-dimensional structures from the Protein Data Bank or models generated in Swiss-Model, followed by epitope mapping with ElliPro. Five autoantigens-gamma-enolase (<i>ENO2</i>), thyroid peroxidase (<i>TPO</i>), glutamic acid decarboxylase 65 kDa isoform (<i>GAD65</i>), serine/threonine-protein kinase 2 (<i>VRK2</i>), and dihydropyrimidine dehydrogenase [NADP(+)] (<i>DPYD</i>)-showed similarities with <i>T. gondii</i> proteins. Among them, enolase exhibited the highest homology, with identities up to 65%. These findings provide preliminary evidence of shared antigenic features between the parasite and schizophrenia-related autoantigens. Such mimicry could contribute to disease mechanisms by triggering autoimmune responses in genetically susceptible individuals, supporting the hypothesis that <i>T. gondii</i> infection may influence schizophrenia pathogenesis. Nonetheless, the results are based exclusively on in silico analyses, and experimental validation will be required to confirm potential cross-reactivity.

Also flagged:waterglucosemethylationiodineglycogens-Glucan
Journal Article 2025-10-23 No Snippets Bilan MI, Argunov DA, Torgov VI, Dmitrenok AS, Trung DT, Pham TD, Cao HTT, Usov AI, Nifantiev NE.
Show Full Abstract

A water-soluble high-molecular neutral polysaccharide (<b>NP</b>) was isolated from the eggs of the sea urchin <i>Tripneustes gratilla</i>. The formation of glucose only upon the treatment of <b>NP</b> by amyloglucosidase and the value of its optical rotation [α]<sub>D</sub> +233.5 (c 0.2, water) confirmed its belonging to the family of α-d-glucans. According to the results of NMR spectroscopy and methylation analysis, the chains of <b>NP</b> are built up of non-reducing terminal, 4-linked and 4,6-disubstituted glucose residues at a ratio of 1:8:1. A branched structure with an average linear chain length of about five glucose residues was calculated from the spectrum of iodine complex. Contrary to the previously published structure of branched α-d-glucan from the sea urchin <i>Strongylocentrotus nudus</i> bearing single glucose units as branches, the polysaccharide <b>NP</b> contains oligosaccharide branches at position 6, which was confirmed by NMR data. Hence, <b>NP</b> has a glycogen-like structure with a rather high degree of branching, which markedly exceeds that of usual mammalian or fungal glycogens.

CACNA1E
Also flagged:CYNwaterdetoxificationlipidmetabolismdegradation
Journal Article 2025-10-23 ✓ 1 Snippet Borja RF, Plata-Calzado C, Diez-Quijada L, Puerto M.
In-Text Gene Mentions

…, BMP7 ,CACNA1E, CACNA1G ,…

Show Full Abstract

Cylindrospermopsin (CYN) is a potent cyanotoxin that poses a significant risk to human and animal health. Due to its occurrence in drinking water and food, as well as its ability to bioaccumulate in aquatic organisms and plants irrigated with contaminated water, the oral route is an important exposure pathway. However, data gaps in the current toxicological data for CYN jeopardize the establishment of health guidance values. In this context, mechanistic data and a deeper knowledge of CYN's mode of action and its adverse outcome pathways are priorities for risk assessment. In recent years, omics techniques have enabled important advances in the comprehensive characterization of the molecular toxicity of CYN. In vitro studies have mainly focused on liver and kidney models, while in vivo studies have mostly used aquatic organisms. These studies have shown effects at both the transcriptional and protein levels on various signaling pathways related to detoxification, DNA damage, apoptosis, cell survival, and lipid metabolism, among others. However, studies using lipidomic, metabolomic, or microbiomic techniques are limited to date. Nevertheless, a recent study suggests that CYN may also induce gut dysbiosis, which would further extend its toxicological profile. This review emphasizes the need to further expand the use of omics approaches to accurately assess the risks associated with the consumption of CYN-contaminated foods.

Also flagged:Obesitybehavioralsynthesistranslationalendocrine disordersMC4R
Journal Article 2025-10-23 No Snippets Farzand A, Rohin MAK, Awan SJ, Ahmad AMR, Akram H, Saleem T, Imran MM.
Show Full Abstract

Obesity is a highly complex, multifactorial disease influenced by dynamic interactions among genetic, epigenetic, environmental, and behavioral determinants that explicitly position genetics as the core. While advances in multi-omic integration have revolutionized our understanding of adiposity pathways, translation into personalized clinical nutrition remains a critical challenge. This review systematically consolidates emerging insights into the molecular and nutrigenomic architecture of obesity by integrating data from large-scale GWAS, functional epigenomics, nutrigenetic interactions, and microbiome-mediated metabolic programming. The primary aim is to systematically organize and synthesize recent genetic and genomic findings in obesity, while also highlighting how these discoveries can be contextualized within precision nutrition frameworks. A comprehensive literature search was conducted across PubMed, Scopus, and Web of Science up to July 2024 using MeSH terms, nutrigenomic-specific queries, and multi-omics filters. Eligible studies were classified into five domains: monogenic obesity, polygenic GWAS findings, epigenomic regulation, nutrigenomic signatures, and gut microbiome contributions. Over 127 candidate genes and 253 QTLs have been implicated in obesity susceptibility. Monogenic variants (e.g., <i>LEP</i>, <i>LEPR</i>, <i>MC4R</i>, <i>POMC</i>, <i>PCSK1</i>) explain rare, early-onset phenotypes, while <i>FTO</i> (polygenic) and <i>MC4R</i> (monogenic mutations as well as common polygenic variants) represent major loci across populations. Epigenetic mechanisms, dietary composition, physical activity, and microbial diversity significantly recalibrate obesity trajectories. Integration of genomics, functional epigenomics, precision nutrigenomics, and microbiome science presents transformative opportunities for personalized obesity interventions. However, translation into evidence-based clinical nutrition remains limited, emphasizing the need for functional validation, cross-ancestry mapping, and AI-driven precision frameworks. Specifically, this review systematically identifies and integrates evidence from genomics, epigenomics, nutrigenomics, and microbiome studies published between 2000 and 2024, applying structured inclusion/exclusion criteria and narrative synthesis to highlight translational pathways for precision nutrition.

POU3F2
Also flagged:Dravet syndromedevelopmental epileptic encephalopathyDEEneurodevelopmental genetic disordersSCN1Aneurodevelopmental disorders
Journal Article 2025-10-23 ✓ 1 Snippet Turpin-Moreno I, Modrego A, Martí-Sarrias A, García-González L, Ortega-Gasco A, Haeb AC, Pareja R, Soriano J, Ruiz N, Peñuelas-Haro I, Espinet E, Navarro A, Tornero D, Lao O, Acosta S.
In-Text Gene Mentions

…upper layers (POU3F2and SATB2 )…

Show Full Abstract

Dravet syndrome (DS) is a developmental epileptic encephalopathy (DEE) driven by pathogenic variants in the <i>SCN1A</i> gene. Brain organoids (BOs) have emerged as reliable models for neurodevelopmental genetic disorders, reproducing human brain developmental milestones and rising as a promising drug testing tool. Here, we determined the underlying molecular DS pathophysiology affecting neuronal connectivity, revealing an early onset excitatory-inhibitory imbalance in maturing DS organoid circuitry. However, neuronal circuitry modeling in BOs remains hampered by the notorious inter- and intra-organoid variability. Thus, leveraging deep learning (DL), we developed ImPheNet, a predictive tool grounded in BO live imaging datasets, to overcome the limitations of the intrinsic BOs variability. ImPheNet accurately classified healthy and DS phenotypes at early onset stages, revealing differences between genotypes and upon antiseizure drug exposure. Altogether, our DL-predictive live imaging strategy, ImPheNet, emerges as a powerful tool to accelerate DEEs research and advance toward treatment discovery in a time- and cost-efficient manner.

CDK5RAP1
Also flagged:refractorycorticosteroidalcoholhyperlipidemiametabolismpathogenesis
Journal Article 2025-10-23 ✓ 1 Snippet Wang L, Meng H, Zhou H, Shou Z, Chen L, Huang X, Bai Z, Chen C.
In-Text Gene Mentions

…LIPT1, ATP7A, andCDK5RAP1were upregulated in…

Show Full Abstract

<h4>Introduction</h4>Osteonecrosis of the Femoral Head (ONFH) is one of the common refractory diseases. However, the role of cuproptosis in ONFH pathogenesis remains unexplored. This study aimed to investigate the potential relationship between cuproptosis and ONFH.<h4>Methods</h4>ONFH-related datasets were obtained from the Gene Expression Omnibus (GEO) database, and cuproptosis-related genes in the GSE123568 dataset were identified through differential expression analysis. To further discover potential cuproptosis-related biomarkers, Least Absolute Shrinkage and Selection Operator (LASSO) regression analysis and Support Vector Machine (SVM) analysis were conducted. The Receiver Operating Characteristic (ROC) curve analysis was used to explore the diagnostic value of cuproptosis-related biomarkers. The summary Statistics-based Mendelian Randomization (SMR) algorithm was used to investigate the causal relationship between the related genes and ONFH. The immune infiltration analysis was conducted to assess the effect of immune cells on ONFH. Subsequently, the GSE74089 and GSE89587 datasets were used to validate gene expression levels and predict the lncRNA-miRNA-mRNA network. Finally, quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was employed to validate the expression of these genes.<h4>Results</h4>The study showed that the upregulation of <i>PDHB</i>, a cuproptosis-related biomarker, may contribute to the development of ONFH. Additionally, immune cells were found to play a crucial role in ONFH, and PDHB showed a significant association with various immune cells. Furthermore, the study identified the existence of the <i>MIR22HG</i>/<i>let-7c-5p</i>/<i>PDHB</i> regulatory pathway, which may play a critical role in ONFH through cuproptosis.<h4>Discussion</h4>This study discovered a cuproptosis-related regulating pathway, MIR22HG/let-7c-5p/PDHB. This can provide new insights into the treatment of ONFH. However, further experimental validation is needed.<h4>Conclusion</h4><i>PDHB</i>, identified as a cuproptosis-related biomarker, can induce ONFH through cuproptosis. <i>PDHB</i> also contributes to the pathogenesis and progression of ONFH by influencing immune cell function. This is most likely mediated through the regulatory interaction between <i>MIR22HG, let-7c-5p,</i> and <i>PDHB</i>.

bioRxiv 2025-10-23 Preprint (No Snippets API) Fan Z, Wang L, Li Z, Ren T, Tan B, Pu W, Wu W, Xiong J, Cheng L, Kong J, Luo B, Yang Z, Tong C, Zhang Z.
Show Full Abstract

Spiders exhibited diverse and intricate web-building behaviors, which represent a classic model for studying the evolution of complex traits. The funnel-web, a sheet-like web with a retreat tube, has evolved independently in several spider lineages, especially in the families Agelenidae and Macrothelidae. This repeated emergence of a complex behavior offers an example of this funnel-web building behavioral convergence. Here, we present a chromosome-level genome assembly of the agelenid spider Tamgrinia laticeps, along with annotated genomes of another agelenid spider Eratigena atrica, and a macrothelid Orientothele yani which convergently evolved funnel-web building behavior. Comparative genomic analysis of 15 spider species with diverse web-types revealed convergent signatures associated with funnel-web construction. Hundreds of genes tended to experience convergent shift in selective pressure, convergent positive section, and harbored convergent amino acid substitutions. These genes are associated with synaptic transmission (e.g., SLC6A3, Gabbr1, SNAP25), neuromuscular coordination (e.g., ine, VAChT), and behavioral regulation (e.g., Crtc1, Lrrc7). Notably, we detected identical convergent amino acid changes in VAChT and ine across all three funnel-web builders. Our findings demonstrate that convergent evolution of web architecture is linked to nervous system evolution, providing genomic insights into the basis of behavioral convergence.

SOX6
Also flagged:gene expressionSmg5degradationRNA-binding proteinHnrnplmyelin
Journal Article 2025-10-22 ✓ 1 Snippet Jiang M, Li C, Xie B, Li T, Dai ZM, Qiu M.
In-Text Gene Mentions

Sox6

Show Full Abstract

Nonsense-mediated mRNA decay (NMD) is a conserved RNA surveillance mechanism that degrades transcripts with premature termination codons (PTCs) and fine-tunes gene expression by targeting RNA transcripts with other NMD inducing features. This study demonstrates that conditional knock-out of <i>Smg5</i>, a key NMD component, in oligodendrocyte lineage cells disrupts the degradation of PTC-containing transcripts, including aberrant variants of the RNA-binding protein <i>Hnrnpl</i> The loss of SMG5 in both sexes of mice impaired oligodendrocyte differentiation, reduced myelin gene expression, and led to thinner myelin sheaths and compromised motor function in mice. Mechanistically, HNRNPL was shown to regulate the alternative splicing of myelin-associated genes <i>Mag</i> and <i>Nfasc</i> and promote oligodendrocyte differentiation. These findings reveal that SMG5-mediated NMD ensures RNA processing fidelity essential for proper oligodendrocyte development and CNS myelination.

HFE
Also flagged:WNTcancercell proliferationtumorstumorPORCN
Journal Article 2025-10-22 ✓ 1 Snippet Liang J, Pan Y, Yang J, Zeng D, Li J.
In-Text Gene Mentions

…organs, including SLC39A8,HFE, and ABO […

Show Full Abstract

The WNT signaling pathway, a fundamental molecular network regulating cell proliferation, differentiation, and stemness, plays a critical role in tumorigenesis, cancer progression, and therapeutic resistance. Given its crucial regulatory roles in tumors, WNT signaling pathway has been identified as effective targets for cancer treatment. However, the current clinical efficacy of WNT signaling pathway-targeted anti-tumor therapies remains suboptimal. Based on research investigating the role of WNT signaling pathway in cancer, we systematically discuss the molecular mechanisms of WNT signaling in cancer (including both canonical and non-canonical signaling pathways), the role of WNT signaling in different cancer types, highlighting distinct potential therapeutic approaches targeting WNT signaling. We also comprehensively review innovative strategies targeting WNT signaling, including Porcupine (PORCN) inhibitors, Tankyrase (TNKS) inhibitor, Frizzled (FZD)-targeted monoclonal antibodies, β-catenin/TCF transcriptional complex inhibitors, and natural bioactive compounds and drug repositioning etc., critically evaluating their preclinical efficacy and limitations. We emphasize the need for and challenges in developing WNT-targeted therapies including refining the specificity of WNT signaling pathway-targeted therapies, developing biomarkers for patient selection, and exploring synergies between WNT inhibitors and other therapeutic modalities such as immune checkpoint blockers. These advances aim to enable personalized precision therapy and revolutionize cancer treatment paradigms in the future.

Also flagged:methylerythritol phosphateelectron transferelectronsmethylfluoride2
Journal Article 2025-10-22 No Snippets Witjaksono C, Herrscher V, Jobelius H, Noël N, Massicot F, Vasse JL, Behr JB, Seemann M.
Show Full Abstract

IspG (also known as GcpE) is a key [4Fe-4S] metalloenzyme that catalyzes the penultimate step of the methylerythritol phosphate (MEP) pathway, a well-established target for the development of new antimicrobials. This oxygen-sensitive enzyme mediates the reductive dehydroxylation of 2-C-methyl-d-erythritol 2,4-cyclodiphosphate (MEcPP) to (E)-4-hydroxy-3-methylbut-2-en-1-yl diphosphate (HMBPP), requiring electron transfer proteins to deliver two electrons needed for catalysis. To probe the mechanism of IspG and access new mechanism-based inhibitors, we synthesized a substrate analogue, monofluoromethyl-d-erythritol cyclodiphosphate, in which the natural methyl group of MEcPP is replaced by a CH<sub>2</sub>F group. This analogue proved to be a potent inhibitor of IspG. This study also demonstrates that electron capture is a prerequisite for inhibition and that the inhibitor leads to fluoride release in the IspG-catalyzed reaction. Together, these results provide further support for the involvement of a carbanionic intermediate in the IspG mechanism.

FBXL4
Also flagged:Insomniasleep disorderasleepsleepcardiovascular diseasemetabolic disorders
Journal Article 2025-10-22 ✓ 1 Snippet Ren Q, Gu M, Fan X.
In-Text Gene Mentions

F-Box and leucine-rich repeat protein 3and leucine-rich repeat…

Show Full Abstract

<h4>Background</h4>Insomnia, affecting 30-40% of the global population, is a debilitating sleep disorder linked to significant health risks, including cardiovascular disease, metabolic syndrome, and neurodegeneration. Emerging evidence implicates dysregulation of circadian clock genes as a core molecular mechanism underlying its pathophysiology.<h4>Methods and results</h4>This review synthesizes current knowledge on how core clock genes regulate the sleep-wake cycle <i>via</i> transcription-translation feedback loops, incorporating recent insights into regulatory layers such as SUMOylation. We discuss how genetic polymorphisms and epigenetic modifications disrupt circadian rhythmicity, predisposing individuals to insomnia. The molecular pathways linking clock dysfunction to insomnia encompass dysregulation of neurotransmitter systems (melatonin, serotonin, GABA, dopamine), metabolic imbalance, neuroinflammation, mitochondrial oxidative stress, and altered synaptic plasticity. Chronic circadian misalignment, often driven by aberrant light exposure, exacerbates these disruptions.<h4>Therapeutic implications</h4>Targeting circadian pathways presents novel therapeutic avenues. Melatonin receptor agonists facilitate sleep initiation and phase alignment; synthetic REV-ERBα/β ligands enhance circadian amplitude; dopaminergic modulators address hyperarousal; and GABAergic drugs restore inhibitory balance. Notably, Traditional Chinese Medicine formulations exhibit multi-pathway regulatory effects on clock gene expression. However, treatment efficacy varies across insomnia subtypes, and challenges regarding pharmacokinetics and long-term safety remain.<h4>Conclusion</h4>Dysfunctional circadian clock genes are pivotal in insomnia pathogenesis <i>via</i> interconnected molecular pathways. Future research should focus on biomarker-driven, personalized chronotherapies targeting these genes and their downstream effects to improve clinical outcomes.

CSE1L
Also flagged:cancerscervical cancerHPV infectionmajor capsid protein L1minor capsid protein L2L1
Journal Article 2025-10-22 ✓ 1 Snippet Woo TT, Takeo Y, Harwood MC, Houck ET, DiMaio D, Tsai B.
In-Text Gene Mentions

…family (including XPO1,CSE1L, XPOT, XPO4, XPO5,…

Show Full Abstract

During human papillomavirus (HPV) entry, the virus exploits COPI-dependent retrograde transport to cross the Golgi apparatus before reaching the nucleus to cause infection. How HPV enters the nucleus after exiting the Golgi is unclear, although mitotic nuclear envelope breakdown (NEB) appears important. Here, we show that importin-7 (IPO7), a nuclear pore import receptor, is present at the Golgi and promotes HPV infection. IPO7 knockdown inhibits infection and causes HPV to accumulate in the Golgi without reaching mitotic chromosomes, demonstrating that IPO7 promotes Golgi-to-nucleus transport of HPV. Golgi-to-nucleus transport of a cellular cargo also requires IPO7, suggesting that HPV hijacks a preexisting pathway for nuclear entry. Furthermore, the C-terminal nuclear localization sequence of HPV L2 protein, which overlaps its cell-penetrating peptide sequence, binds IPO7 directly in a COPI-dependent virus trafficking step. Together, these data identify a role for an importin in HPV infection and suggest that the canonical nuclear pore import machinery plays an unanticipated role in NEB-dependent nuclear entry.

LRRC7
Also flagged:LRRC8ANMDA receptorsynapses-methyl-d-aspartate receptorNMDAR
Journal Article 2025-10-22 ✓ 1 Snippet Deng M, Chen SR, Zhou MH, Zhang J, Huang Y, Chen H, Benavides F, Sah R, Pan HL.
In-Text Gene Mentions

leucine-rich repeat-containing protein 8

Show Full Abstract

Amplification of nociceptive transmission due to aberrant <i>N</i>-methyl-d-aspartate receptor (NMDAR) hyperactivity in the spinal cord is a key characteristic of neuropathic pain. However, under normal conditions, both presynaptic and postsynaptic NMDARs in the spinal dorsal horn are largely inactive. The mechanisms restraining synaptic NMDAR activity remain enigmatic. Leucine-rich repeat-containing protein 8A (LRRC8A or SWELL1) is an essential component of volume-regulated anion channels typically involved in regulating cell volume. Here, we report that LRRC8A was highly expressed in dorsal root ganglion (DRG) and spinal dorsal horn neurons of rats. Nerve injury persistently reduced LRRC8A expression in the DRG. siRNA-mediated <i>Lrrc8a</i> knockdown in rats or conditional <i>Lrrc8a</i> knockout in DRG neurons in mice consistently caused a pain hypersensitivity phenotype that was readily reversed by NMDAR antagonists. Correspondingly, <i>Lrrc8a</i> knockdown or conditional <i>Lrrc8a</i> knockout in DRG neurons markedly augmented synaptic localization and activity of NMDARs in the spinal cord. LRRC8A interacted with NMDARs in both rat and human spinal cord tissues primarily through its C-terminal LRR domain, restricting the synaptic trafficking and activity of NMDARs. Furthermore, <i>Lrrc8a<sup>ebo/ebo</sup></i> mutant mice, which lack the LRR domain, exhibited NMDAR-dependent pain hypersensitivity and synaptic NMDAR hyperactivity in the spinal cord. Additionally, intrathecal <i>Lrrc8a</i> gene delivery eliminated nerve injury-induced pain hypersensitivity and synaptic NMDAR hyperactivity in rats. These findings reveal that LRRC8A physically interacts with NMDARs and constitutively restricts their synaptic expression in the spinal cord. Reduced LRRC8A-NMDAR interactions increase synaptic expression of "unleashed" NMDARs, contributing to NMDAR hyperactivity and neuropathic pain in rodent models.

SOX6
Also flagged:stem cell differentiationglucagoninsulindiabetesgene expressiontranslational
Journal Article 2025-10-22 ✓ 1 Snippet Yang K, Spitzer H, Sterr M, Hrovatin K, de la O S, Zhang X, Setyono ESA, Ud-Dean M, Walzthoeni T, Flisikowski K, Flisikowska T, Schnieke A, Scheibner K, Wells JM, Sneddon JB, Kessler B, Wolf E, Kemter E, Theis FJ, Lickert H.
In-Text Gene Mentions

…the top TFsSOX6and SOX9 of…

Show Full Abstract

Human pancreas development remains incompletely characterized due to restricted sample access. We investigate whether pigs resemble humans in pancreas development, offering a complementary large-animal model. As pig pancreas organogenesis is unexplored, we first annotate developmental hallmarks throughout its 114-day gestation. Building on this, we construct a pig single-cell multiome pancreas atlas across all trimesters. Cross-species comparisons reveal pigs resemble humans more closely than mice in developmental tempo, epigenetic and transcriptional regulation, and gene regulatory networks. This further extends to progenitor dynamics and endocrine fate acquisition. Transcription factors regulated by NEUROG3, the endocrine master regulator, are over 50% conserved between pig and human, many being validated in human stem cell models. Notably, we uncover that during embryonic development, emerging beta-cell heterogeneity coincides with a species-conserved primed endocrine cell (PEC) population alongside NEUROG3-expressing cells. Overall, our work lays the foundation for comparative investigations and offers unprecedented insights into evolutionarily conserved pancreas organogenesis mechanisms across animal models.

Also flagged:BRD4neuroblastomabindingBRD4 receptorBromodomain-containing protein 4cancer
Journal Article 2025-10-22 No Snippets Ali I, Almostafa M, Abbas F, Younis NS, Khan AA, Yahya G.
Show Full Abstract

BRD4 ("Bromodomain-containing protein 4"), a recognized gene regulator, is an attractive target for therapeutic development, particularly for the management of neuroblastoma. An integrated pharmacoinformatic strategy for the development of new BRD4 inhibitors is examined in this research. Pharmacophores were used to digitally screen five databases, and the current study aims to determine the best binding modes by docking the screened hits to the BRD4 active site. Using the BRD4 protein co-crystal ligand (73B) (PDB ID: 4BJX) as a template, pharmacophore hypotheses were produced. Five databases were subjected to a pharmacophore-based virtual screening process, and 1089 hits that satisfied the screening requirements were selected for docking against the BRD4 receptor by using the SP module of the Glide tool. The top ten docked compounds with the highest binding affinities, ranging from - 9.623 to - 8.894 kcal/mol, were selected. Further, the biological activity and ADMET analysis revealed that the selected compounds have values that fall in the acceptable range. The protein-ligand complexes' stability was verified by performing molecular dynamics (MD) simulations of the binding positions of the top two compounds against the BRD4 receptor. The stability and binding free energies of the compounds indicate that these compounds may function as lead compounds to affect the biological activity of BRD4 in the in vitro studies.

Also flagged:calmodulinCaMriluzolecalciumcytoplasmiccardiopathies
Journal Article 2025-10-22 No Snippets Baltasar-Marchueta M, López N, Alicante S, Barbolla I, Garcia Ibarluzea M, Ramis R, Salomon AM, Muguruza-Montero A, Nuñez Viadero E, Leonardo A, Arrasate S, Sotomayor N, Montemore MM, Villarroel A, Bergara A, Lete E, González-Díaz H.
Show Full Abstract

Recently, numerous models have been developed to predict drug interactions with molecules. However, integrating diverse data sources and improving the accuracy of biological activity predictions remains a challenge. This work proposes a novel solution that addresses these limitations. Here, we have developed a machine learning model to predict the efficacy of different assays and drugs for diseases related to calmodulin. To achieve this, we have compiled a comprehensive data set including commercialized drugs and experimental compounds targeting CaM complexes. The IFPTML-XGB model achieved high predictive performance, with a test accuracy of 89.1% and a sensitivity of 89.0%, demonstrating its robustness for assay efficacy prediction. We have used the IFPTML modeling technique to identify key factors influencing these activities. We have also synthesized novel riluzole derivatives and have tested them both experimentally and computationally. Biological assays and molecular docking studies have been performed to provide a molecular-scale picture of the molecule-CaM interaction. To validate the model's utility, we tested it on these derivatives. We have found that the model correctly predicts which derivatives were the most bioactive, indicating that this framework can be used to identify promising candidates for new drug formulations. This research not only improves our understanding of CaM-related diseases, but also provides an effective framework for developing new treatments based on predictive modeling.

ECI2
Also flagged:membranestriglycerideslocalizationlipidsynthesismetabolic syndrome
Journal Article 2025-10-22 ✓ 1 Snippet Pannala VR, Balik-Meisner MR, Mav D, Phadke DP, Scholl EH, Shah RR, Casey W, Auerbach SS, Wallqvist A.
In-Text Gene Mentions

…oxidation, such asEci2, Crat ,…

Show Full Abstract

Fenofibrate, a peroxisome proliferator-activated receptor α (PPARα) agonist, is widely prescribed to treat hyperlipidemia and has therapeutic potential in liver and kidney diseases. However, fenofibrate is also associated with adverse effects, including elevated creatinine and liver and kidney toxicity, although the underlying mechanisms remain unclear. In addition, how fenofibrate regulates lipid metabolism differently in the liver and kidney is not well understood. Therefore, in this study, we investigated the dose-dependent effects of fenofibrate on liver and kidney metabolism in rats, with a focus on PPARα activation and potential mechanisms contributing to organ-specific toxicity. We used high-throughput transcriptomic data from 5-day rat in vivo studies, where rats were exposed to fenofibrate, and performed pathway enrichment, injury module, and detailed individual gene comparison analyses to investigate how liver and kidney metabolism were differentially altered between the two organs. Fenofibrate exposure significantly increased liver but not kidney weights and caused larger perturbations in the liver compared to the kidney transcriptome, with the majority of the changes related to PPARα regulation. Interestingly, our study revealed that the PPARα and RXRα genes are differentially regulated between the liver and kidney. In addition, we identified several differences between them in cellular and mitochondrial fatty acid transport, lipoprotein metabolism, fatty acid oxidation, branched-chain amino acid degradation, and glucose metabolism pathways. Furthermore, we identified transcriptomic inflection points at which the changes in the PPARα-mediated regulation of lipid metabolism switched from beneficial to deleterious as the fenofibrate concentration increased leading to liver injury, providing potential mechanisms of toxicity.

SERPINC1
Also flagged:hypertensiondiabetescardiovascular diseaseosteoarthritiscognitive declinecognitive impairment
Journal Article 2025-10-22 ✓ 1 Snippet Céspedes Gómez N, Chen Y, Kouchaki S, Heydari M, Cairns A, Sierra Marín SD, Capstick A, Somers J, Harris K, Goh WWB, Walsh C, True J, Balazikova O, Nilforooshan R, Barnaghi P.
In-Text Gene Mentions

…(Table 4 ),ACE-IIIat baseline, PHQ-9,…

Show Full Abstract

The growing ageing population and prevalence of comorbidities pose significant healthcare challenges, from increasing hospitalisations to dementia risk. Healthcare systems primarily treat single conditions, overlooking the complex interplay of chronic diseases. Advances in wearable technology and remote healthcare monitoring technologies offer opportunities to enhance management of comorbidities and early intervention to improve healthcare outcomes. This study presents the RESILIENT dataset, a collection of physiological, sleep, and mental health assessment data conducted as part of an ageing-related comorbidities and dementia study. The RESILIENT study has developed a digital platform to integrate data from wearable devices and in-home monitoring technologies to track physiological, sleep, and cognitive patterns. The validation analysis using the Resilient data highlights correlations between cognitive function, mental health, physical activity, and sleep, aligning with existing literature. By leveraging this dataset, researchers can develop predictive models for early detection and personalised interventions aimed at reducing unplanned hospital admissions and improving health outcomes. The study provides technical foundations and pilot validation for constructing virtual wards to support and complement healthcare services.

HTT
Also flagged:COVID-19encephalitismemory problemspsychological disordersdepressionanxiety
Journal Article 2025-10-22 ✓ 1 Snippet Bhide K, Slavikova M, Talpasova L, Kuckova K, Klempa B, Tyagi P, Bhide M.
In-Text Gene Mentions

…, GDNF-AS ,HTT-AS , LOXL1-AS1 ,…

Show Full Abstract

COVID-19 causes a wide range of complications in the central nervous system, including encephalitis and other neurological symptoms such as memory problems, psychological disorders, depression, and anxiety. We present comprehensive data on the changes in gene expression levels in astrocytes infected with the Delta or Omicron variants of SARS-CoV-2. In RNA-seq data, we found 346 genes that were significantly evoked (197 up- and 149 down-regulated) in astrocytes challenged with the Omicron variant, compared to 341 evoked genes (215 up- and 126 down-regulated) in the Delta variant. A surprisingly large number of genes were exclusively evoked by Delta (82 up- and 48 downregulated) and Omicron variants (65 up and 60 downregulated). Numerous pathways, including those pertaining to the neuronal system, metabolism, response to viral infection, signal transduction, cytokine signaling, and homeostasis, were dysregulated in infected astrocytes. In this report we have dissected major pathways that are related to pathogen recognition, integrity of the BBB and glia limitans, and neurological disorders that could lead to neurological symptoms listed above. Our findings also reveal dysregulation of a large number of non-coding RNAs. The data presented here may help us better understand the role of astrocytes in the neurological disorders seen in COVID-19 patients.

Also flagged:infectioninfectionsalcohol-19behavioralhealthcare-associated infections
Journal Article 2025-10-22 No Snippets Meschiari M, Segala FV, Gallerani A, Di Gennaro F, Esposito N, Tanzilli P, Prozzo A, Pan A, Lupi MG, Brambilla P, Cibelli DC, Carretta A, Boni S, Pontali E, Del Borgo C, Parente A, Marchetti GC, Onorato L, Monari C, Coppola N, Camaioni C, Rossomando AM, Parrella R, Scaglione V, Cattelan A, Abbott M, Pipitone G, Iaria C, Mularoni A, Campanella O, Tosti A, Francisci D, Mazzotta E, Coladonato S, Pogliaghi M, Falcone M, Andreoni M, Vitale P, Spalliera I, Sarmati L, Cicalini S, Oliva A, Mastroianni C, Lichtner M, Di Bari S, Soddu A, Bellu S, Fanelli C, Fontana Del Vecchio R, Franco A, Montrucchio C, Audagnotto S, Di Vincenzo A, Murri R, Ricchizzi E, Mussini C, INSIEME Study Group.
Show Full Abstract

We aim to assess the state-of-the-art of Infection Prevention and Control (IPC) practices and their results in Italian healthcare facilities 6 years after the kick-off of the new National Plan for the Control of Antibiotic Resistance (PNCAR). This was a multicenter, cross-sectional, observational study conducted between January 1st, and December 31st, 2023, among Italian hospitals. Survey questions were readapted from the WHO IPC assessment framework (IPCAF), PNCAR and INSIEME group proposals, resulting in 155 questions grouped into six sections: IPC program, surveillance, control activities for healthcare-associated infections, antimicrobial stewardship (AMS) strategies, IPC training and education, and monitoring indicators. Thirty-eight acute care Hospitals completed the survey (response rate: 30%): 26.3% of hospitals did not define an annual program and 34.2% an AMS task force. Periodic microbiology reports were available for 57.9%, hospital alcohol-based hand rubs consumption per 1000 bed-days in 42.1% and defined daily dose of antimicrobials per 100 bed-days in 55.3% hospitals with a significant difference between Northern and Southern regions (90.9% vs 22.2%; P = 0.006). Active monitoring of hand hygiene and contact isolation compliance was implemented in only half of the hospitals. Structured HAI surveillance systems were implemented in fewer than 20% of hospitals. Components on IPC implementation activity, such as no-touch sanitizing systems, checklist for environmental cleaning, informatic flags, bundles for pathogens revealed the lowest score. The appropriateness of antibiotic therapy prescribing was assessed in 73.7% of facilities. Only 42.1% of hospitals had budget goals. This survey provides a baseline assessment and identifies key barriers to the implementation of IPC programs across Italian acute care hospitals. The findings highlight priority areas for intervention and will inform the next phase of the INSIEME project, which aims to develop and implement tailored strategies that address the specific needs of healthcare workers and institutions nationwide.

PRDX6
Also flagged:nucleusagingorganizationHematoxylinsegmentationgene expression
Journal Article 2025-10-22 ✓ 1 Snippet Daly AC, Cambuli F, Äijö T, Lötstedt B, Marjanovic ND, Fernandez S, Kuksenko O, Smith-Erb M, Domovic D, Van Wittenberghe N, Drokhlyansky E, Griffin GK, Phatnani H, Bonneau R, Regev A, Vickovic S.
In-Text Gene Mentions

…expression, such asPrdx6(goblet cells 58…

Show Full Abstract

Tissue structure and molecular circuitry in the colon can be profoundly impacted by systemic age-related effects but many of the underlying molecular cues remain unclear. Here, we build a cellular and spatial atlas of the colon across three anatomical regions and 11 age groups, encompassing ~1,500 mouse gut tissues profiled by spatial transcriptomics and ~400,000 single nucleus RNA-sequencing profiles. We develop a computational framework, cSplotch, which learns a hierarchical Bayesian model of spatially resolved cellular expression associated with age, tissue region and sex by leveraging histological features to share information across tissue samples and data modalities. Using this model, we identify cellular and molecular gradients along the adult colonic tract and across the main crypt axis and multicellular programs associated with aging in the large intestine. Our multimodal framework for the investigation of cell and tissue organization can aid in the understanding of cellular roles in tissue-level pathology.

ECI2
Also flagged:metabolic diseaselipidfatty acidacylcarnitinemitochondrialnucleus
Journal Article 2025-10-22 ✓ 2 Snippets Lopez K, Baker MR, Chen Q, Alves-Bezerra M, Ersoy B, Toth JG, Reddy SS, Taki F, Sciortino R, Cohen DE, Gross S, Toth M.
In-Text Gene Mentions

…FAs for degradation,Eci2(enoyl-CoA delta isomerase…

…, Acaa2, Decr1,Eci2, Hadh, Acaa1b…

Show Full Abstract

Profound social and economic changes in recent generations have led to reduced physical activity and increased calorie intake, leading to a higher incidence of metabolic disease. These effects may propagate across generations, amplifying the impact on descendants. Here we found that limited physical activity of dams brought about increased liver weight and lipid accumulation in the male offspring on a moderate fat calorie western-like diet from weaning to adulthood, while maternal voluntary exercise on running wheels during the postpartum period was sufficient to prevent the development of the phenotype in the otherwise sedentary offspring. Elevated fatty acid (FA) and reduced acylcarnitine levels in the liver of offspring of exercising mothers suggested increased FA flux for oxidation that, with elevated mitochondrial β-oxidation, indicated a maternally programmed mechanism to cope with increased fat calories. Finally, single-nucleus transcriptional profiling indicated dysregulated lipid metabolism in hepatocytes and upregulation of phagocytosis-related genes in Kupffer cells/macrophages and minimal response in stellate cells, indicating a moderate liver damage in the offspring of sedentary but not exercising mothers. A similar combination of maternal sedentary lifestyle and increased fat calorie intake from childhood could contribute to the increased incidence of obesity and NAFLD in recent generations.

UNC13C
Also flagged:Unc13a/borganizationUNC13APolymeraseReverse transcriptionSynthesis
Journal Article 2025-10-22 ✓ 2 Snippets Asadollahi R, Ahmad A, Boonsawat P, Shahanoor Hinzen J, Lohse M, Bouazza-Arostegui B, Sun S, Utesch T, Sommer JD, Ilic D, Padmanarayana M, Fischermanns K, Ranjan M, Boll M, Ka C, Piton A, Mattioli F, Isidor B, Õunap K, Reinson K, Wojcik MH, Marshall CR, Mercimek-Andrews S, Matsumoto N, Miyake N, Stephan BO, Honjo RS, Bertola DR, Kim CA, Yusupov R, Mefford HC, Christodoulou J, Lee J, Heath O, Brown NJ, Baker N, Stark Z, Delatycki M, Lake NJ, Zeidler S, Zuurbier L, Maas SM, de Kruiff CC, Rajabi F, Rodan LH, Coury SA, Platzer K, Oppermann H, Abou Jamra R, Beblo S, Maxton C, Śmigiel R, Underhill H, Dubbs H, Rosen A, Helbig KL, Helbig I, Ruggiero SM, Fitzgerald MP, Kraemer D, Prada CE, Tenney J, Jayakar P, Redon S, Lefranc J, Uguen K, Race S, Efthymiou S, Maroofian R, Houlden H, Coppens S, Deconinck N, Ashokkumar B, Varalakshmi P, Gowda K VR, Eghbal F, Ghayoor Karimiani E, Heidari M, Neidhardt J, Owczarek-Lipska M, Korenke GC, Bamshad MJ, Campeau PM, Lehman A, Hendon LG, Wentzensen IM, Monaghan KG, Chen Y, Szuto A, Cohn RD, Au PYB, Hübner C, Boschann F, Manickam K, Koboldt DC, Rad A, Oprea G, Bachman KK, Seeley AH, Agolini E, Terracciano A, Carmelo P, Bupp C, Grysko B, Rein-Rothschild A, Ben Zeev B, Margolin A, Morrison J, Dagli A, Stolerman E, Louie RJ, Washington C, Stevens SJC, Heijligers M, Alkuraya FS, Lisfeld J, Neu A, Paoli Monteiro F, Santos Pessoa AL, Camelo-Filho AE, Kok F, Koeberl D, Riley K, Burglen L, Doummar D, Héron B, Mignot C, Keren B, Charles P, Nava C, Bernhard FP, Kühn AA, Thoms S, Morrie RD, Mekhoubad S, Green EM, Barmada SJ, Gitler AD, Jahn O, Rhee JS, Rosenmund C, Mitkovski M, Sticht H, Sun H, Le Gac G, Taschenberger H, Brose N, Dittman JS, Rauch A, Lipstein N.
In-Text Gene Mentions

…UNC13B andUNC13Care expressed alongside…

…of the cerebellum (UNC13C) and of the…

Show Full Abstract

The UNC13A gene encodes a presynaptic protein that is crucial for setting the strength and dynamics of information transfer between neurons. Here we describe a neurodevelopmental syndrome caused by germline coding or splice-site variants in UNC13A. The syndrome presents with variable degrees of developmental delay and intellectual disability, seizures of different types, tremor and dyskinetic movements and, in some cases, death in early childhood. Using assays with expression of UNC13A variants in mouse hippocampal neurons and in Caenorhabditis elegans, we identify three mechanisms of pathogenicity, including reduction in synaptic strength caused by reduced UNC13A protein expression, increased neurotransmission caused by UNC13A gain-of-function and impaired regulation of neurotransmission by second messenger signalling. Based on a strong genotype-phenotype-functional correlation, we classify three UNC13A syndrome subtypes (types A-C). We conclude that the precise regulation of neurotransmitter release by UNC13A is critical for human nervous system function.

Also flagged:Lamin Achromatintransposaselamin A/CheterochromatinA-type lamin
Journal Article 2025-10-22 No Snippets Jabre S, Cherchame E, Pinzón N, Lemerle E, Bitoun M, Coirault C.
Show Full Abstract

<h4>Background</h4>Skeletal muscle nuclei (myonuclei) are subjected to high mechanical stress which plays a critical role in muscle tissue integrity and plasticity. Here we investigated the role of lamin A/C in dampening the effects of acute mechanical stretch on chromatin states and its downstream effects on gene expression.<h4>Methods</h4>We studied control and lamin A/C-deficient human myotubes both at baseline and following a mechanical stress mimicking acute muscle exercise. Chromatin accessibility and transcriptional responses were assessed using ATAC-seq (assay for transposase-accessible chromatin with sequencing) and RNA-seq, respectively.<h4>Results</h4>We found that stretch-induced nuclear deformations in lamin A/C-deficient myotubes but not in controls, and was associated with a widespread increase in chromatin accessibility, mainly affecting promoter regions. Concordantly, mechanical stress also increased the levels of H3K4me3 euchromatin marks and decreased heterochromatin-associated H3K27me3 in A-type lamin-deficient myotubes. Additionally, mechanical stress led to the downregulation of transcriptional pathways involved in histone deacetylation, DNA methylation, and muscle differentiation, while pathways related to cytokine activity, extracellular matrix organization, and cell adhesion were upregulated.<h4>Conclusions</h4>Overall, lamin A/C deficiency amplifies the chromatin response to mechanical stress, leading to enhanced promoter accessibility and activation of stress DNA damage-related gene pathways. These findings underscore the role of lamin A/C in maintaining chromatin stability under mechanical strain.

Also flagged:hydroxidedry eye diseaseoxygenNLRP3pyroptosisinflammatory response
Journal Article 2025-10-22 No Snippets Chu D, Hu T, Cui H, Yang L, Li Z, Tan C, Li J.
Show Full Abstract

Chronic inflammation serves as a prominent contributor to the progression of dry eye disease (DED). Reactive oxygen species (ROS) and the downstream NLRP3 inflammasome mediate pyroptosis, which induces the inflammatory response by releasing several inflammatory factors. Therefore, targeting pyroptosis represents a promising therapeutic strategy for controlling inflammation in DED. Herein, we report the amorphous layered double hydroxide (a-LDH)-based nano-enzyme eye drops (Needs) for DED. The a-LDH exhibits superior hydroxyl radicals (·OH) and superoxide anions (·O<sub>2</sub><sup>-</sup>) scavenging capabilities, which are 1.77 times and 1.20 times that of the crystalline ZnCuAl-LDH, and 3.38 times and 1.43 times that of conventional CeO<sub>2</sub>, respectively. The augmented performance stems from the synergistic effect of Cu<sup>+</sup>/Cu<sup>2+</sup> redox couples facilitating electron shuttling for radical disproportionation and oxygen vacancies serving as both preferential adsorption sites and active catalytic domains for ROS breakdown. More importantly, the a-LDH efficiently scavenges excess ROS, inhibits NLRP3/Caspase-1/GSDMD signaling axis-mediated pyroptosis and N-GSDMD-induced mitochondrial damage. In vivo assays indicate that the Needs reduce the expression of pro-inflammatory cytokines, reverse corneal epithelial defects, restore goblet cell density, and tear secretion in mice DED model. Our findings provide valuable insights into the underlying mechanisms and potential therapeutic strategies of LDH-based nano-enzymes for DED.

NEGR1
Also flagged:metabolic syndromeobesityinsulin resistancedyslipidemianucleuscell
Journal Article 2025-10-22 ✓ 5 Snippets Jia H, Liu D.
In-Text Gene Mentions

…sole receptor-ligand pairNEGR1-NEGR1 playing a role…

…le receptor-ligand pair NEGR1-NEGR1playing a role…

…signal intensity ofNEGR1is the most…

…of MetS, theNEGR1gene is of…

NEGR1was initially identified…

Show Full Abstract

<h4>Background</h4>Metabolic syndrome (MetS) is characterized by obesity, insulin resistance, and dyslipidemia with adipose tissue inflammation, yet its cellular heterogeneity and intercellular interactions remain poorly understood. We analyzed single-nucleus RNA sequencing data from subcutaneous adipose tissue of 84 individuals with MetS from the METSIM cohort, characterizing cell composition, inter-individual variation, adipocyte progenitor differentiation, and cell-cell communication networks.<h4>Methods</h4>We performed single-nucleus RNA sequencing on subcutaneous adipose tissue samples from 84 individuals with MetS. Clustering analysis was used to define cell types and subpopulations, inter-individual variation in cell composition was assessed, pseudotime trajectory analysis reconstructed adipocyte precursor differentiation pathways, and ligand-receptor interaction analysis mapped intercellular communication networks.<h4>Results</h4>We identified 12 distinct cell types in MetS adipose tissue and discovered two patient subgroups with differential enrichment of adipocytes/progenitors versus immune cells, suggesting subtypes of MetS with distinct adipose profiles. Pseudotime analysis revealed two adipocyte progenitor subpopulations with altered differentiation trajectories. Cell-cell communication analysis identified WNT signaling from progenitors to adipocytes as a potential differentiation driver, with extracellular matrix pathways mediating progenitor-adipocyte interactions.<h4>Conclusion</h4>This comprehensive single-cell atlas of MetS adipose tissue reveals previously unrecognized cellular heterogeneity and differentiation dynamics, offering new insights into MetS pathogenesis and highlighting potential therapeutic targets.

Also flagged:TDP-43RNA-binding proteinRBPneurodegenerative diseaseslocalizationmetabolism
Journal Article 2025-10-22 No Snippets Liu B, Chen X, Wang J, Chen J, Zhao B, Jin X, Jiang M, Wang J, Liao W, Yang B, Geng X.
Show Full Abstract

TDP-43, a multifaceted RNA-binding protein (RBP), has emerged as a key regulator in neurodegenerative diseases. Yet, its underlying mechanisms of action across other diseases remain unclear. This review covers TDP-43’s structural domains, its pathology in neurodegenerative diseases, and its liquid-liquid phase separation (LLPS) properties, where the disease pathology and LLPS together drive its aggregate-forming behavior. This review then focuses on the nucleocytoplasmic shuttling mechanisms of TDP-43, analyzing their role in governing its subcellular localization and functional diversity. The review further summarizes how TDP-43 modulates cellular metabolism (encompassing lipid, glucose, and ATP homeostasis) and cell death pathways in neurological disorders, cancer, and immunity. Finally, this review highlights unresolved questions, including the putative role of TDP-43 as an RBP in post-transcriptional RNA modification and the regulatory networks controlling its expression, thereby providing directions for clinical diagnosis and treatment of TDP-43-associated diseases.

Also flagged:chromosomegene expressionFGF5BMPR1Breproductiontranslational
Journal Article 2025-10-22 No Snippets Han M, Rong Y, Ma B, Wang X, Ao X, Shang F, Su R, Wang R, Zhang Y.
Show Full Abstract

Sheep and goats, among the earliest domesticated animals, hold significant historical importance in Chinese animal husbandry. The rapid advancement of modern biotechnology has rendered genome wide association studies (GWAS) and selection signature analyses have become indispensable tools in livestock genetic research. This review summarizes recent progress in the application of these methods to sheep and goat breeding in China, analyzes existing challenges in the research, and suggests potential research strategies. GWAS and selection signature analyses have identified key genomic regions associated with agronomically important traits. Genes such as LHX2, FGF12 and Notch3 are associated with hair follicle growth and development, while RBM11, SMARCA5 and GAB1 are linked to body size in sheep. Additionally, BMPRIB has been identified as a determinant of reproductive performance and growth rate in both sheep and goats. Despite progress, several challenges remain, including incomplete reference genomes, insufficient phenotypic data, inadequate algorithms, and a lack of functional validation and practical application of findings. Future work must prioritize genomic refinement, the integration of multi-omics, and the development of algorithm. Enhanced international collaboration is crucial to deciphering the genetic basis of key traits, thereby advancing global industry. These initiatives will enable highly precise breeding strategies. Through precise identification and selection of individuals with desirable genetic traits, breeders can significantly enhance the efficiency of genetic improvement. Using Hua sheep 50k chip as an example, it effectively identifies individuals with superior reproductive genes (such as BMPRIB) at an early stage, increases the lambing rate by 27.7%, accelerates the propagation of high-quality breeding groups, provides a large number of breeding sheep with excellent genetic traits for the global sheep industry, and improve the overall quality of germplasm. This will ultimately enhance the sustainable development of global sheep and goat production.

Also flagged:Desferrioxamine mesylatechitosanDesferrioxamineironthalassemiapolyethylene oxide
Journal Article 2025-10-22 No Snippets Wimalasiri AKDVK, Kalansuriya P, Espósito BP, Pereira TA, Zhao Y, Godevithana JC, Siriwardana K, Mohotti M, Lacerda E.
Show Full Abstract

Desferrioxamine (DFO) is a clinically established iron chelator used to manage iron overload in transfusion-dependent thalassemia patients. Despite its efficacy, DFO's poor cellular permeability and burst release profile limit its application to subcutaneous administration, precluding its use as an oral formulation. To address these limitations, DFO was encapsulated in a nanocomposite matrix composed of chitosan (CTS), polyethylene oxide (PEO), ethyl cellulose (EC), and tripolyphosphate (TPP). The resulting nanocomposites were comprehensively characterized using scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), particle size analysis (PSA), and Fourier-transform infrared spectroscopy (FT-IR). The <i>in vitro</i> evaluation assessed drug release behavior at physiological pH, intestinal pH, and cellular uptake in HeLa cell lines. Among the tested formulations, DFO_PEO_EC_CTS_TPP_1 exhibited the highest drug loading capacity (285.56 ± 0.04 mg g<sup>-1</sup>), entrapment efficiency (85.67 ± 13.35%), and antioxidant activity. Drug release kinetics were best described by the Peppas-Sahlin model (<i>R</i> <sup>2</sup> = 0.9999), indicating a Case II relaxation-controlled mechanism, supporting a sustained release profile. Blood compatibility was confirmed through Wilks' Lambda test, comparing coagulation parameters (APTT, PT) and complement levels (C3) between control and treated samples, including Fe(iii)-DFO_PEO_EC_CTS_TPP_1 at 0.5 mg mL<sup>-1</sup> and 37 °C. No statistically significant differences were observed (<i>e.g.</i>, PT, <i>p</i> = 0.052), confirming the hemocompatibility of the formulation. The MTT cytotoxicity assay for the optimal formulation yielded an IC<sub>50</sub> value of 29.9 ± 5 μM, indicating acceptable cytocompatibility. Furthermore, the formulation demonstrated enhanced DFO permeability across cell membranes and sustained drug release over time. In conclusion, encapsulation of DFO within the PEO_EC_CTS_TPP nanocomposite matrix presents a promising strategy to overcome the limitations of native DFO, offering improved cell permeability, biocompatibility, and controlled release, potentially advancing it toward more effective therapeutic applications.

HTT
Also flagged:genetic neurodegenerative disordercognitive declineHDchoreamild cognitive impairmentautosomal dominant neurodegenerative disease
Journal Article 2025-10-22 ✓ 4 Snippets Petraitytė G, van Rijswijk J, Liguore WA, McBride JL, Verhoye M, Bertoglio D, Weiss AR, Adhikari MH.
In-Text Gene Mentions

…the huntingtin (HTT) gene.…

…of the humanHTTgene and an…

…fragment of humanHTTgene.…

…retain their naturalHTTgenes, which may…

Show Full Abstract

Huntington's disease (HD) is a genetic neurodegenerative disorder caused by expanded CAG repeats in the huntingtin gene which produce a mutant huntingtin (mHTT) protein that contributes to progressive striatal, cortical, and white-matter atrophy, resulting in motor dysfunction and cognitive decline. Recently, a non-human primate (NHP) model of HD was developed via stereotaxic delivery of an adeno-associated viral vector expressing 85 CAG repeats (85Q) into the striatum. This model recapitulates several neuropathological changes and symptoms observed in people with HD (PwHD) including chorea and mild cognitive impairment. A previous longitudinal, multimodal MRI investigation in this model revealed volumetric and resting-state functional connectivity (rs-FC) changes compared to controls, in key regions involved in HD, over the course of 30 months. We aimed to study longitudinal changes in structural connectivity (SC), obtained from diffusion MRI scans from the same animals, comparing the 85Q animals to the control (Buffer) group. Additionally, going beyond the correlative rs-FC analyses, we investigated changes in causal, inter-regional functional interactions by estimating effective connectivity (EC) from rs functional MRI scans, constrained to strong structural connections. We found that the SC between basal ganglia regions and the cortex was reduced in the 85Q primates compared to the Buffer group at 14-months post virus injection, aligning with the pathological process observed in PwHD at later stages of the disease. EC from the caudate and putamen to the motor cortex was significantly reduced in the 85Q animals as early as 3-months post-injection providing novel insights into early alterations in causal functional interactions.

HFE
Also flagged:metalloproteaseironNramp1degradationDICER1antibodies
Journal Article 2025-10-22 ✓ 2 Snippets Samanta S, Banerjee S, Datta R.
In-Text Gene Mentions

…tary hemochromatosis protein (HFE), which signals through…

…of Hjv andHfe, key activators…

Show Full Abstract

Micronutrient sequestration is a powerful host defense mechanism against intracellular pathogens. A key player in this is Nramp1, which effluxes iron from phagolysosomes thereby depriving the engulfed pathogens of this essential element. Leishmania major counters this by triggering hepcidin-mediated proteasomal degradation of Nramp1. Interestingly, L. major conditioned media induced hepcidin expression and Nramp1 degradation even in uninfected macrophages, resulting in enhanced endo/lysosomal iron levels. This finding suggested that a parasite-derived secretory factor was driving the effect, ultimately leading to the identification of the Leishmania metalloprotease GP63 as the mediator of Nramp1 degradation. Conditioned medium from the GP63 knockout strain (LmGP63<sup>-/-</sup>) failed to upregulate hepcidin or degrade Nramp1. Further experiments using conditioned medium from both the wild type and LmGP63<sup>-/-</sup> strain revealed that GP63 depletes macrophage DICER1, impairing maturation of miR-122, a negative regulator of hepcidin. Consistent with these in vitro results, the LmGP63<sup>-/-</sup> strain, unlike its wild type counterpart, was unable to deplete DICER1, induce hepcidin expression or suppress Nramp1 in infected BALB/c mice. Collectively, we uncover a novel role for L. major-secreted GP63 in targeting the host DICER1/miR-122 axis to trigger hepcidin expression and Nramp1 degradation, facilitating iron acquisition by the parasite.

SOX6
Also flagged:OsteoarthritisOAdegenerative joint disordercartilagedegradationaging
Journal Article 2025-10-22 ✓ 2 Snippets Yu Y, Ji Z, Xu H, Ma M, Li S, Yin Z, Du Y, Li H, Liu S, Qian W.
In-Text Gene Mentions

…of SOX5 andSOX6, which together form…

…Although SOX5 andSOX6lack intrinsic transactivation…

Show Full Abstract

<h4>Background</h4>Chondrocyte senescence significantly impairs extracellular matrix (ECM) synthesis and accelerates cartilage degradation, driving osteoarthritis (OA) progression. Although gene therapies targeting senescent chondrocytes are promising for OA, developing strategies that simultaneously rejuvenate cartilage function and precisely modulate the inflammatory microenvironment remains challenging.<h4>Methods</h4>We developed an optimized lipid nanoparticle (LNP)-based delivery platform for the efficient co-delivery of transcription factors SOX5 and SOX9 mRNAs into chondrocytes. The physicochemical properties and biosafety of the formulations were systematically characterized. Additionally, the therapeutic efficacy of these formulations was evaluated in senescent chondrocyte cultures and an ACLT-induced osteoarthritis (OA) rat model.<h4>Results</h4>The synergistic action of SOX5 and SOX9 markedly enhanced anabolic signaling, promoting synthesis of critical cartilage ECM components (type II collagen and aggrecan). The combination also reduced inflammation-mediated matrix degradation in vitro and in vivo. In a rat OA model, this optimized LNP-mediated co-delivery substantially improved cartilage regeneration, suppressed joint inflammation, and restored joint function compared to single-gene treatment or untreated controls.<h4>Conclusion</h4>This work provides an advanced, synergistic mRNA therapeutic approach employing optimized LNPs to alleviate chondrocyte senescence and stimulate cartilage regeneration, representing a promising strategy for OA intervention.

Also flagged:HP infectioncardiovascular diseasesHPHelicobacter pyloriHP) infectiongastric adenocarcinoma
Journal Article 2025-10-22 No Snippets Kato I, Canzian F, Rizzato C, Rodriguez A, Torres J.
Show Full Abstract

<h4>Background</h4><i>Helicobacter pylori</i> (HP) infection has been linked to nearly 90 different health conditions, including gastric malignant and premalignant lesions. Recently, Mendelian randomization (MR) has gained popularity to overcome limitations in observational studies. This review aims to compile MR studies on the causal relationship between HP infection and health outcomes, systematically assess the quality of individual studies, evaluate the overall evidence in comparison with other existing data, and identify common strengths and weaknesses in order to guide future research directions on HP-associated health outcomes.<h4>Materials and methods</h4>Eligible studies were identified from the two major biomedical literature databases, PubMed and Embase. After removing overlaps, we found 33 unique records published by July 10, 2024. Among those, 16 were qualified for full-text review as original research papers presenting MR analysis with HP infection as the primary exposure of interest.<h4>Results</h4>Among the 16 studies, one was one-sample MR study and the rest 2-sample MR studies. All except one were conducted on individuals of European descent. Health outcomes studied include four metabolic conditions, four cardiovascular diseases (CVDs), five gastrointestinal conditions, and three other miscellaneous conditions. All used genome-wide association study (GWAS) data on HP serology to select instrumental variants, ranging from 1 to 84. Nine out of 16 studies concluded that HP had a causal association with the disease of their interest. However, not all papers fully examined whether MR key assumptions were met and there are inaccurate descriptions and misinterpretations in many papers. In addition, there are inconsistencies between studies, depending on the choice of exposure GWAS from which instrumental variants were chosen.<h4>Conclusions</h4>Overall, published MR studies concerning HP infection and various health outcomes to date are limited in their quality/integrity. The results from HP eradication trials completed or in progress may help address the causality of some of the health outcomes with high incidence rates. In addition, MR studies in non-European populations with higher HP prevalence are warranted.

TNFSF4
Also flagged:CRISP3epithelial mesenchymal transitioncancerepithelial-mesenchymal transitionpathogenesisGene Expression
Journal Article 2025-10-22 ✓ 1 Snippet Ren Y, Li Y, Wang Z, Cui Y, Xing Z, Zhang Y, Cao N, Yu Y, Guo Y, Li X.
In-Text Gene Mentions

…LGALS3, CEACAM1, andTNFSF4in modulating BC…

Show Full Abstract

<h4>Introduction</h4>Breast cancer (BC) remains a widespread malignancy and ranks as the second leading cause of cancer-related mortality among women worldwide. Hypoxia, epithelial-mesenchymal transition (EMT), and immune-related processes have been increasingly recognized as critical contributors to BC pathogenesis. However, a prognostic model integrating hypoxia-, EMT-, and immune-related genes (HEMTIRGs) to predict BC outcomes has not yet been established.<h4>Methods</h4>Gene expression datasets of BC patients were obtained from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO). Prognostic genes were identified using Least Absolute Shrinkage and Selection Operator (LASSO) Cox regression analysis. A prognostic model was developed based on these genes. Immune infiltration was assessed using CIBERSORT and ssGSEA analyses. Immunotherapy response was predicted using the tumor immune dysfunction and exclusion (TIDE) algorithm. Functional roles of HEMTIRGs in BC malignancy were validated through <i>in vitro</i> experiments.<h4>Results</h4>In this study, four HEMTIRGs (PAX7, DCD, CRISP3, and FGG) were identified and used to develop a prognostic model. Patients were stratified into high- and low-risk groups based on median risk scores. A nomogram based on this model accurately predicted overall survival (OS), consistent with the observed outcomes. Notably, patients in the high-risk group exhibited increased immune cell infiltration but a lower predicted response to immunotherapy. Immunohistochemistry (IHC) further confirmed that HEMTIRGs expression levels were strongly associated with breast cancer, with CRISP3 showing the most pronounced upregulation. <i>In vitro</i> functional assays demonstrated that CRISP3 promoted malignant phenotypes of breast cancer cells under hypoxic conditions through activation of the IL-17/AKT signaling pathway.<h4>Conclusion</h4>This study establishes a novel HEMTIRGs-based prognostic model for BC, offering a robust tool for predicting patient prognosis and immunotherapy efficacy. Additionally, our findings provide new insights into BC pathogenesis, highlighting potential therapeutic targets.

Also flagged:-ST segment elevation acute coronary syndrome-ST-segment elevation acute coronary syndromenon-ST-elevation myocardial infarctionacute coronary syndromeaging
Journal Article 2025-10-22 No Snippets Trinh HV, Nguyen DV, Do LD, Le BT, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>Data on the prognostic value of myocardial strain in patients with non-ST-segment elevation acute coronary syndrome (NSTE-ACS) from low- and middle-income countries remain scarce. This study aimed to evaluate the prognostic significance of left ventricular myocardial strain in patients with NSTE-ACS after successful percutaneous coronary intervention (PCI) in Vietnam.<h4>Methods</h4>In this prospective cohort study, consecutive patients diagnosed with NSTE-ACS and treated with PCI underwent conventional and speckle-tracking echocardiography within 24 h post-PCI to assess myocardial function, including global longitudinal strain (GLS), global circumferential strain (GCS), and global radial strain (GRS). Patients were followed for 12 months. The association between echocardiographic parameters and major adverse cardiovascular events (MACE) was analyzed using Kaplan-Meier survival curves and Cox proportional hazards models. Prognostic performance was assessed using receiver operating characteristic (ROC) curves, area under the curve (AUC), and other diagnostic indices.<h4>Results</h4>A total of 127 patients were included (mean age 65.5 ± 10.5 years; 71.3% male). During 12 months of follow-up, 26 patients (20.5%) experienced MACE. The MACE group had significantly impaired GLS, GCS, and GRS compared with the event-free group (all <i>p</i> < 0.0001). In multivariable analysis, only higher (less negative) GLS remained an independent predictor of MACE (HR: 1.62; 95% CI: 1.26-2.08; <i>p</i> < 0.001). GLS demonstrated the strongest prognostic performance among echocardiographic variables, with an AUC of 0.967 (95% CI: 0.941-0.994). At the optimal cutoff, an GLS ≥ -16% demonstrated a sensitivity of 100% (95% CI: 86.8-100) and a specificity of 85.1% (95% CI: 76.7-91.4).<h4>Conclusion</h4>In patients with NSTE-ACS, post-PCI GLS, GCS, and GRS were significantly more impaired in those who developed MACE compared with the event-free group, indicating underlying cardiac dysfunction or myocardial injury. Among these parameters, GLS emerged as an independent predictor of MACE after PCI and may serve as a valuable tool for identifying high-risk patients.

Also flagged:Cervical cancerPeptidecancerdeathpeptideslactoferricin B
Journal Article 2025-10-22 No Snippets Ardila-Chantré N, Barragán-Cárdenas AC, Reyes-Calderón JE, Franco-Zambrano DS, Matta-Orjuela EA, Rivera-Monroy JE, Muñoz-Sáez E, Carabaña-García C, Parra-Giraldo CM, Fierro-Medina R, Rivera-Monroy ZJ, García-Castañeda JE.
Show Full Abstract

This study focuses on the chimeric peptide KKWQWK-Ahx-RLLRRLLR and its interaction with cancer cells, specifically HPV18-positive cervical cancer HeLa and Ca Ski cells. The main objective of this study was to understand the mode of action of this chimera related to its cytotoxic activity, as well as the internalization processes and the type of cell death induced. For this purpose, several in vitro and in vivo assays were performed, showing that the uptake of the chimera is not energy-dependent and could involve a passive transport process. The results suggested that chimera internalization can be mediated by a specific interaction of the peptide with molecules on the cell membrane. The cytotoxic effect of the chimera in cervical cancer cells causes severe morphological changes, including rounding, shrinking, and vacuole formation. It was also determined that the chimera primarily induces early and late apoptosis in HeLa cells, without causing necrosis, and activates caspases 3 and 7. The chimera was localized in both the cytoplasm and the nucleus of the cancer cells, suggesting that the peptide could interact with intracellular targets. In conclusion, this study provides a broader understanding of the mechanism of action of the KKWQWK-Ahx-RLLRRLLR chimera on cancer cells, highlighting its ability to induce a fast, selective, and significantly cytotoxic effect in cervical cancer cells, which involves cell death through the apoptotic pathway. The toxicity assays in <i>Galleria mellonella</i> and zebra fish showed that the chimera is safe and can be considered for preclinical studies. This study demonstrated that the chemical binding of two sequences with low activity produces a chimeric entity with enhanced cytotoxic activity capable of cellular internalization and inducement of apoptosis.

Also flagged:MitochondrialMitochondriaorganellesphosphorylationDNA polymerase gammaTwinkle helicase
Journal Article 2025-10-22 No Snippets Somai S, Aloh CH, King DE, Copeland WC.
Show Full Abstract

Mitochondria are vital for cellular energy production, as these organelles generate most of the cellular energy required for various metabolic processes. Mitochondria contain their own circular DNA, which is present in multiple copies and is exclusively maternally inherited. Cellular energy in the form of adenosine 5'-triphosphate is produced via oxidative phosphorylation and involves the coordinated expression of genes encoded by both the nuclear and mitochondrial genomes. Mitochondrial DNA itself is replicated by a dedicated set of nuclear-encoded proteins composed of the DNA polymerase gamma, the Twinkle helicase, the mitochondrial single-stranded DNA binding protein, as well as several accessory factors. Mutations in these genes, as well as in the genes involved in nucleotide metabolism, are associated with a spectrum of mitochondrial disorders that can affect individuals from infancy to old age. Additionally, mitochondrial disease can arise as a result of point mutations, deletions, or depletion in the mitochondrial DNA or in genes involved in mitochondrial transcription, replication, maintenance, and repair. Although a cure for mitochondrial diseases is currently elusive, several treatment options have been explored. In this review, we explore the molecular insights of the core mitochondrial replisome proteins that have aided our understanding of mitochondrial diseases and influenced current therapies.

Also flagged:Immune-Related ProteinsIRF1IRF5IRF8IRF4IRF7
Journal Article 2025-10-22 No Snippets Yan Y, Liu T, He X, Mu M, Yang Z.
Show Full Abstract

Bats are natural reservoirs for diverse viruses, yet they rarely develop disease, suggesting unique antiviral adaptations. In this study, we performed a comprehensive genome-wide analysis in the common vampire bat (<i>Desmodus rotundus</i>), integrating comparative genomics, functional annotation, microRNA (miRNA) discovery, target prediction, and network-based analyses. Comparative genomic analysis revealed that <i>Phyllostomus discolor</i> exhibits the highest protein homology (97.4%) with <i>D. rotundus</i>. Alignment of interferon regulatory factors (IRFs) indicated strong conservation of IRF1, IRF5, and IRF8, while IRF4 and IRF7 showed divergence, reflecting bat-specific modulation of interferon signaling. Functional annotation of previously uncharacterized proteins identified immune-related elements, including toll-like receptor 4, syncytin-1, and endogenous retroviral sequences, highlighting the integration of viral components into host immunity. We further identified 19 novel miRNAs in <i>D. rotundus</i>, with high-confidence target genes such as <i>SOD2</i>, <i>TRIM28</i>, and <i>FGFR1</i> involved in antiviral defense, apoptosis regulation, and oxidative stress response. Functional enrichment analyses revealed processes associated with wound healing, apoptosis suppression, infection response, and longevity. Network entropy analysis highlighted central regulatory hubs, including <i>MYC</i>, <i>BCL2</i>, and <i>KIF1B</i>, influencing cell cycle, survival, and immune balance. Collectively, these results demonstrate that <i>D. rotundus</i> employs an integrated regulatory network combining conserved immune factors, lineage-specific gene divergence, and miRNA-mediated fine-tuning to achieve viral tolerance without pathology. This study expands our understanding of bat antiviral biology and provides candidate molecular targets for future functional and translational research.

SERPINC1
Also flagged:CoagulationNeuroendocrine Tumoursvenous thromboembolismcancerSimple Summary Neuroendocrine tumoursmalignant neoplasms
Journal Article 2025-10-22 ✓ 1 Snippet Wójcik-Giertuga M, Malczewska-Herman A, Orzeł A, Kos-Kudła B.
In-Text Gene Mentions

…D-dimer PLT PlateletsAT-III Antithrombin-IIIAntithrombin-III TF Tissue…

Show Full Abstract

The incidence of venous thromboembolism (VTE) markedly increases mortality in cancer patients, potentially by as much as fourfold [...].

Also flagged:FerroptosisSensorineuralHearingLossirondeath
Journal Article 2025-10-22 No Snippets Liu H, Chu X, Liao M, Wang J, Zhang H, Han L.
Show Full Abstract

Ferroptosis, an iron-dependent form of regulated cell death, is emerging as a critical pathogenic mechanism and a highly promising therapeutic target in sensorineural hearing loss (SNHL). The irreversible loss of auditory hair cells, the hallmark of SNHL, creates an urgent need for novel therapeutic strategies. This review provides a translational perspective on ferroptosis, connecting its core molecular machinery to tangible opportunities for otoprotection. We systematically analyze three key targetable nodes: the iron metabolic pathways that fuel the process; the lipid peroxidation machinery that executes membrane damage; and the collapse of the System Xc<sup>-</sup>-GSH-GPX4 antioxidant axis. By framing the disease mechanism through these actionable targets, we highlight a clear rationale for developing new hearing preservation therapies. We conclude by surveying the most promising pharmacological approaches, including iron chelators, radical-trapping antioxidants, and bioactive natural products, offering a strategic roadmap for future drug discovery in audiology.

Also flagged:lysozymemyoglobinphotoactive yellow proteinPYPThermolysinmetalloprotease
Journal Article 2025-10-22 No Snippets Schmidt C, Lorenzen K, Schulz J, Han H.
Show Full Abstract

The development of serial crystallography (SX), including serial synchrotron crystallography (SSX) at synchrotron sources and serial femtosecond crystallography (SFX) at X-ray free-electron lasers (XFELs), has facilitated the collection of high-resolution diffraction data from micron-sized crystals, providing unique insights into the structures and dynamics of biomolecules at room temperature. Standard samples are essential for the commissioning of new XFEL instruments and the validation of experimental setups. In this review, we summarize currently used standard proteins and describe representative microcrystal preparation workflows for four widely adopted models, lysozyme, myoglobin, iq-mEmerald, and photoactive yellow protein (PYP), drawing on established methodologies and accumulated experience from their applications at the European XFEL. By consolidating existing knowledge and integrating protocols that have been systematically refined and optimized through our experimental efforts, this review aims to provide practical guidance for the serial crystallography community, thereby enhancing reproducibility and ensuring consistent experimental performance across facilities.

OLFM4
Also flagged:digestionSctGcgGhrlSstNts
Journal Article 2025-10-21 ✓ 2 Snippets Jiménez S, Blot F, Meunier A, Kapoor R, Schreiber V, Giethlen C, Ghimire S, Mahe MM, Molina N, De Arcangelis A, Gradwohl G.
In-Text Gene Mentions

…genes, such asOLFM4, which, although a…

…stem cell markerOLFM4( van der…

Show Full Abstract

Enteroendocrine cells (EECs) are rare intestinal epithelial cells producing multiple hormones that regulate essential aspects of digestion and energy. EEC subtypes, their hormone repertoire and differentiation mechanisms from intestinal stem cells have been characterized in the adult intestine. Although EECs must be functional from birth because their absence leads to severe intestinal malabsorption in newborns, the processes that determine their subtype specification during development remain largely unknown. We used mouse embryos, human pluripotent stem cell-derived intestinal organoid models and single-cell transcriptomics to characterize EEC lineages and dynamics during development. Our findings demonstrate that in both mice and humans, the majority of EECs are specified during development through similar differentiation trajectories to those observed in the adult intestine. This suggests that EEC subtype specification occurs independently of fully organized crypt-villus structures and stimulation by diet or microbiota. However, the emergence of certain EEC subtypes depends on tissue maturation. Finally, our integrative approach infers lineage-specific regulators dynamically, identifying new candidates controlling EEC differentiation in the developing human gut.

PRDX6
Also flagged:S. Aureus InfectionlipoproteinBLPtranslationalStaphylococcus aureus infectiongene expression
Journal Article 2025-10-21 ✓ 5 Snippets Wan Y, Hong Y, Ji X, Xiang J, Liu J, Liang L, Ren M, Chen W, Xu T, Li Z, Shi T, Jiang Y, Liang H, Liu J.
In-Text Gene Mentions

…The upregulated genes in Mta (C5) included Clec4e , Slc7a11 ,Prdx6, Prdx1 , Cxcl2 , etc.,…

…Although the present study did not conduct direct parallel experiments to compare BLP‐ and LPS‐induced trained immunity, integrated analysis of transcriptomic datasets has revealed that in comparison with LPS‐trained macrophages, BLP‐trained macrophages predominantly display superior antioxidant defenses and ferroptosis resistance, characterized by significant upregulation of core antioxidant genes, including Sod2 ,Prdx6, Hmox1 , etc.,…

PRDX6‐positivecells (C5 subset) and MARCO‐positive cells (C7 subset) were sorted into collection tubes containing complete DMEM medium with 20% fetal bovine serum, respectively.…

…The results showed that the number of cells withhigh expression of PRDX6, CLEC4E, MARCO, and CLEC4A1, as well as the intensity of expression, were significantly increased and enhanced in BLP‐trained macrophages compared with naive cells.…

…Based on this, we defined thePRDX6‐high‐expressioncell population (≈30%) and the MARCO‐high‐expression cell population (≈30%) as C5 and C7 macrophages, respectively (Figure 4F , Figure S4C,D , Supporting Information), and isolated these two cell populations by FACSan sorting for further detection.…

Show Full Abstract

Tolerance to bacterial lipoprotein (BLP) is an evolved protective mechanism characterized by an enhanced resistance of BLP-trained macrophages to microbial infection. However, the underlying mechanisms are not fully understood, and their potential for translational clinical application needs further evaluation. In the present study, through single-cell RNA sequencing (scRNA-seq), transcriptomic profiles in both naïve and BLP-trained bone marrow-derived macrophages (BMDMs) during Staphylococcus aureus infection are analyzed, and 13 distinct BMDM subpopulations are identified. Notably, BLP-trained tolerance initiates the emergence of two novel BMDM subpopulations, C5 and C7, characterized by increased antibacterial gene expression and enhanced anti-inflammatory and antioxidative stress abilities. Moreover, BLP-trained BMDMs demonstrate activation of the NRF2 signaling pathway, thereby augmenting an antioxidative stress response and mitigating oxidative stress-induced cell damage and ferroptosis, while undergoing metabolic reprogramming characterized by enhanced glycolysis and oxidative phosphorylation pathways, together with increased anti-inflammatory metabolites. Critically, in vivo adoptive transfer of BLP-trained BMDMs protects mice against sepsis-associated lethality by attenuating systemic inflammatory response, accelerating bacterial clearance, and alleviating organ damage. Collectively, the present study presents a single-cell atlas of murine BMDMs at rest and under S. aureus infection following BLP training, which reveals novel mechanisms of BLP training-altered macrophage immunity and identifies macrophage subpopulations responsible for an enhanced resistance to infection, thus offering new preventive and therapeutic strategies for sepsis.

HMGN4
Also flagged:Chromatingene expressioncardiac diseasedilated cardiomyopathycardiomyopathyHMGN3
Journal Article 2025-10-21 ✓ 2 Snippets Geng X, Pradeep R, Porter R, García-Gutiérrez L, Xie M, Wende AR, Zhang J, Cobo I, Nguyen T, Rosa-Garrido M.
In-Text Gene Mentions

…HMGN1, HMGN2, HMGN3,HMGN4, and HMGN5—which are…

HMGN4serves as a…

Show Full Abstract

Chromatin structure plays a central role in regulating gene expression and maintaining cellular identity, yet the structural factors driving these processes in cardiac disease remain poorly defined. To investigate whether these factors can distinguish healthy from diseased cardiac cell populations, we generated a comprehensive list of chromatin structural genes based on an extensive literature review. Applying this list to a published single-nuclei RNA sequencing dataset from human hearts with and without dilated cardiomyopathy (DCM), we found that chromatin structural gene expression effectively stratified cardiomyocyte and fibroblast populations by disease status. Diseased cardiomyocytes exhibited reduced expression of contractile genes and increased expression of cardiomyopathy markers, while fibroblasts showed enhanced activation signatures. Among these factors, HMGN3 emerged as a candidate of interest, showing consistent downregulation in cardiomyocytes from DCM human patients, as well as in mouse (pressure overload) and pig (myocardial infarction) models of heart failure. Functional studies in AC16 cells revealed that HMGN3 depletion promoted apoptosis, induced significant changes in gene expression, and reorganized chromatin structure by altering the distribution of the H3K27ac histone mark. These findings identify HMGN3 as a potential regulator of chromatin architecture in diseased cardiomyocytes, highlight the utility of chromatin structural changes in distinguishing pathological cardiac states, and reinforce the role of chromatin organization in shaping the cardiac phenotype.

SUDS3
Also flagged:Linker histoneagingnucleosomeschromatindoxycyclinenucleosome
Journal Article 2025-10-21 ✓ 1 Snippet Karatepe K, Mafra de Faria B, Zhang J, Chen X, Pinto H, Fyodorov D, Sefik E, Willcockson MA, Flavell RA, Skoultchi AI, Guo S.
In-Text Gene Mentions

…fate bifurcation bylinker histoneshistones in the…

Show Full Abstract

Myeloid-biased differentiation of multipotent hematopoietic stem and progenitor cells (HSPCs) occurs with aging or exhaustion. The molecular mechanism(s) responsible for this fate bias remain unclear. Here, we report that linker histone regulates HSPC fate choice at the lymphoid versus myeloid bifurcation. Linker histones package nucleosomes and compact chromatin. HSPCs expressing a doxycycline (dox)-inducible H1.0 transgene favor the lymphoid fate, display strengthened nucleosome organization, and reduced chromatin accessibility at subsets of genomic regions. The genomic regions showing reduced chromatin accessibility host many known marker genes of myeloid-biased HSCs. The transcription factor <i>Hlf</i> is located in one of the most differentially closed regions, whose chromatin accessibility and gene expression are reduced in H1.0<sup>high</sup> HSPCs. Failure to reduce <i>Hlf</i> expression in multipotential HSPCs abrogates the H1.0-endowed lymphoid potential. Furthermore, HSPCs display aspartyl protease-dependent H1.0 decreases, especially in response to interferon alpha (IFNα). Aspartyl protease inhibitors preserve endogenous H1.0 levels and promote the lymphoid fate of wild type HSPCs. Thus, our work elucidates a molecular scenario of how myeloid bias arises and uncovers a point of intervention for correcting myeloid skewed hematopoiesis.

UNC13C
Also flagged:chronic diseasesobesitycancerheart failuresarcopeniachronic disease
Journal Article 2025-10-21 ✓ 3 Snippets Pruzinsky E, Batmanov K, Medeiros DM, Sulon SM, Sullivan BP, Sakamoto T, Leone TC, Khurana TS, Kelly DP.
In-Text Gene Mentions

…, Zmynd8 ,Unc13c, Wnt16 ,…

…, Bdnf ,Unc13c, Slc16a7 ,…

…Bdnf , andUnc13cwas confirmed in…

Show Full Abstract

Poor skeletal muscle fitness contributes to many chronic disease states, including obesity, heart failure, primary muscle disorders, and age-related sarcopenia. Receptor-interacting protein 140 (RIP140) is a striated muscle-enriched nuclear receptor coregulator known to suppress mitochondrial oxidative capacity. To investigate the role of RIP140 in skeletal muscle, striated muscle-specific RIP140-deficient (strNrip1-/-) mice were generated and characterized. strNrip1-/- mice displayed an enhanced endurance performance phenotype. RNA-sequence (RNA-seq) analysis of glycolytic fast-twitch muscle from strNrip1-/- mice identified a broad array of differentially upregulated metabolic and structural muscle genes known to be induced by endurance training, including pathways involved in mitochondrial biogenesis and respiration, fatty acid oxidation, slow muscle fiber type, and angiogenesis. In addition, muscle RIP140 deficiency induced expansive neuromuscular junction (NMJ) remodeling. Integration of RNA-seq results with CUT&RUN analysis of strNrip1-/- myotubes identified Wnt16 as a candidate effector for the NMJ biogenesis in RIP140-deficient skeletal myotubes. We conclude that RIP140 serves as a physiological "rheostat" for a broad coordinated network of metabolic and structural genes involved in skeletal muscle fitness.

Also flagged:agingintervertebral discwaterextracellularcollagensproteoglycans
Journal Article 2025-10-21 No Snippets Kaneda G, Zila L, Wechsler JT, Shafi K, Cheema K, Bae H, Kim SD, Tuchman A, Li D, Sheyn D.
Show Full Abstract

Chronic lower back pain (LBP) is the leading cause of disability worldwide. Due to its close relationship with intervertebral disc (IVD) degeneration (IVDD), research has historically focused more on understanding the mechanism behind IVDD while clinical efforts prioritize pain management. More recently, there has been a shift toward understanding LBP as a distinct pathological entity. This review synthesizes current knowledge on discogenic LBP, combining known pathophysiology, molecular mechanisms, risk factors, diagnostic challenges, and available experimental models. IVDD is a complex, multifactorial process involving biochemical, mechanical, and inflammatory changes within the disc, leading to structural breakdown and potential discogenic pain. Key mechanisms include extracellular matrix degradation, upregulation of inflammatory mediators, immune cell infiltration, and aberrant nerve and vascular ingrowth. However, not all cases of IVDD result in LBP, highlighting the need for further investigation into the cellular, molecular, and biomechanical factors contributing to symptom development. Current diagnostic tools and experimental models for studying discogenic LBP remain limited, impeding the development of targeted treatments. Existing therapies primarily focus on symptom management rather than addressing underlying disease mechanisms.

SERPINC1
Also flagged:endothelial protein C receptorprotein C receptorPROCRcoagulationthrombophiliaF2
Journal Article 2025-10-21 ✓ 5 Snippets Unar A, Durante-Mangoni E.
In-Text Gene Mentions

…F5, THBD, andSERPINC1, suggesting its central…

…notable proteins includedSERPINC1(antithrombin), with 703…

…proteins studied includedSERPINC1, ADAMTS13, F2, PLG,…

…CFH, PROS1, F3,SERPINC1, F5, F2, and…

…in coagulation, whereasSERPINC1scored 0.924, supporting…

Show Full Abstract

The protein C receptor (PROCR) plays a crucial role in regulating coagulation and maintaining vascular integrity. Mutations in PROCR gene have been associated with thrombophilia and coagulation abnormalities. This study aimed to identify, characterize, and functionally analyze pathogenic nonsynonymous single nucleotide polymorphisms (nsSNPs) in PROCR via an integrative computational approach. Text mining revealed that PROCR is frequently associated with thrombophilia, highlighting its role in coagulation regulation. Protein‒protein interaction analysis revealed strong interactions between PROCR and key coagulation proteins, including F2, F5, THBD, and SERPINC1, suggesting its central role in the coagulation cascade. Functional predictions were generated using SIFT, PolyPhen-2, PROVEAN, and FATHMM, with further scoring by REVEL, ClinPred, and CADD. Structural and stability assessments were conducted using HOPE, I-Mutant2.0, MUpro, and AlphaFold substitution modeling. Evolutionary conservation was analyzed via PhyloP, PhastCons, GERP++, and ConSurf to assess residue functional importance. Posttranslational modifications (PTMs) were investigated using MusiteDeep, PhosphoSitePlus, and SwissPalm. Human Phenotype Ontology (HPO) mapping was used to explore clinical correlations. Six variants N64T, F93L, R113C, P145L, R173H, and R236W were consistently predicted to be deleterious. F93L showed the highest AlphaFold pathogenicity score (0.97), indicating significant structural disruption. N64T, P145L, and R173H were highly conserved residues, supporting functional relevance. PTM analysis revealed that N64T overlapped with a validated N-glycosylation site, whereas R113C, R173H, and R236W affected phosphorylation and ubiquitination. Structural modeling revealed disruptions in protein folding, secondary structure, aggregation potential, and chaperone-binding capacity. HPO mapping associated several variants with coagulation disorders, cardiovascular dysfunction, and systemic phenotypes. This analysis highlights PROCR variants with predicted structural and regulatory disruption. Variants F93L, N64T, and R236W may increase thrombophilia risk by impairing EPCR function and interactions with coagulation factors. These findings support using computational pipelines to prioritize functionally relevant nsSNPs and provide basis for future experimental validation and personalized risk assessment in thrombotic disorders.

RC3H1
Also flagged:CD3IL-7IL-15CD4CD25CD127
Journal Article 2025-10-21 ✓ 5 Snippets Goudy L, Ha A, Borah AA, Umhoefer JM, Chow L, Tran C, Winters A, Talbot A, Hernandez R, Li Z, Subramanya S, Arab A, Kale N, Lee JHJ, Muldoon JJ, Liu C, Schmidt R, Santangelo P, Carnevale J, Eyquem J, Shy BR, Marson A, Gilbert LA.
In-Text Gene Mentions

…, PTPN2 ,RC3H1, SUV39H1 and…

…, RASA2 ,RC3H1or SUV39H1 ).…

…35 ),RC3H1(Roquin 1) 36…

…, PTPN2 ,RC3H1and SUV39H1 ,…

…FAS andRC3H1were the sole…

Show Full Abstract

Targeted epigenetic engineering of gene expression in cell therapies would allow programming of desirable phenotypes without many of the challenges and safety risks associated with double-strand break-based genetic editing approaches. Here, we develop an all-RNA platform for efficient, durable and multiplexed epigenetic programming in primary human T cells, stably turning endogenous genes off or on using CRISPRoff and CRISPRon epigenetic editors. We achieve epigenetic programming of diverse targeted genomic elements without the need for sustained expression of CRISPR systems. CRISPRoff-mediated gene silencing is maintained through numerous cell divisions, T cell stimulations and in vivo adoptive transfer, avoiding cytotoxicity or chromosomal abnormalities inherent to multiplexed Cas9-mediated genome editing. Lastly, we successfully combined genetic and epigenetic engineering using orthogonal CRISPR Cas12a-dCas9 systems for targeted chimeric antigen receptor (CAR) knock-in and CRISPRoff silencing of therapeutically relevant genes to improve preclinical CAR-T cell-mediated in vivo tumor control and survival.

HTT
Also flagged:S-adenosylmethionine-IVbindingglutamine synthetaseBRIL 7ankyrin repeat proteinsamino acid
Journal Article 2025-10-21 ✓ 4 Snippets Camille S, Irène D, Anke S, Anand K, Magali M, Alexey R.
In-Text Gene Mentions

…5–18 of theHttprotein as a…

…turn of theHttmotif, while two…

…turns of theHttlinker.…

…residues 5–18 ofHtt30 (Fig. 1…

Show Full Abstract

Electron cryo-microscopy (Cryo-EM) has traditionally been used for structural determination of proteins larger than 50 kDa. Recently, various approaches, such as fusion to a scaffold or the use of DARPins-cages, have been developed to extend its application to smaller proteins. In this study, we determined the structure of the small protein target kRasG12C by fusing it to the coiled-coil motif APH<sub>2</sub>, which is targeted by several nanobodies. This method enabled us to achieve a structure with atomic details at a resolution of 3.7 Å. The kRasG12C structure was bound to the inhibitor drug MRTX849 and GDP, both clearly visible in the density map. This method is advantageous due to its ease of setup and applicability to other targets. Additionally, we investigated several other techniques that can be applied to small proteins, regardless of the presence of a terminal helix. These advancements demonstrate the potential of cryo-EM for detailed structural analysis of a wide range of protein targets, extending cryo-EM application for drug discovery.

CACNA1E
Also flagged:immune responseinfectious diseaseschromosomenucleotideSAAALP
Journal Article 2025-10-21 ✓ 2 Snippets Pallotti S, Garcia AFR, Deiana G, Antonini M, Zhou J, Sun H, Renieri C, Napolioni V.
In-Text Gene Mentions

…189 ], andCACNA1E[ 190 ].…

…201 ] ,CACNA1E[ 190 ]…

Show Full Abstract

<h4>Background</h4>The species Capra hircus encompasses numerous breeds that exhibit a high level of phenotypic and genetic variability, resulting from environmental adaptation and artificial selection for meat, milk, and fiber production. Today, the global domestic goat population is steadily increasing, primarily due to their ability to adapt to harsh environments. Their worldwide distribution offers the opportunity to study how different environmental conditions and farming systems have shaped the goat genome. In this work, 194 whole-genome sequencing data sets from wild, feral, and domestic goats have been used to detect Runs of Homozygosity (ROH) and study Extended Haplotype Homozygosity (EHH) to identify the so-called 'Signatures of Selection' that uniquely characterize each goat population.<h4>Results</h4>Common signals of selection have been identified in CCSER1 and ADAMTSL3, two genes associated with body development, which were under selection in feral and wild goats, and in Angora and Boer breeds, respectively. Similarly, both feral and cashmere breeds exhibited selection signals in PCDH15, a gene linked to environmental adaptation. Selection in wild and feral goats was primarily observed at loci related to environmental adaptation and immune response. Moreover, selection signals related to productive traits such as milk and meat production were still detectable in feral populations. The Angora goat genome showed selective pressure mainly targeting efficient reproduction and body development, with relatively low pressure related to environmental adaptation. The four cashmere breeds studied displayed selection signals predominantly in genes involved in environmental adaptation, immune response, and hair follicle biology. Several signatures of selection related to environmental adaptation were also observed in both meat- and milk-producing goats, as well as in genes associated with reproduction, milk, and meat production.<h4>Conclusion</h4>These findings suggest that, despite long-term domestication, natural and environmental selection have shaped the goat genome more than artificial selection. Identifying genes linked to adaptation and fitness is vital for future livestock production amid climate change. Our study highlights genetic loci related to environmental adaptation and disease resistance, offering a foundation for targeted breeding and conservation strategies to enhance resilience and sustainability in goat populations.

SERPINC1
Also flagged:multiple myelomacoagulationcoagulation-relatedhematologicalplasma cell dyscrasiasmonoclonal gammopathy of undetermined significance
Journal Article 2025-10-21 ✓ 4 Snippets Cutler S, Trottier AM, Liwski R, Quinn J, Gaston D, Veinotte R, Pierre JS, White D, Forward N, De La Torre A, Elnenaei M.
In-Text Gene Mentions

…KLKB1, SERPINA10, SERPIND1,SERPINC1, PROC, PROZ, and…

…PROC, PROS1, PROZ,SERPINC1, SERPINA6, SERPINCA10, SERPIN…

…(PROC, PROZ, PROS1,SERPINC1, SERPIND1, SERPINA10), along…

…low expression ofSERPINC1in MM cells…

Show Full Abstract

<h4>Background</h4>Multiple myeloma (MM), the second most prevalent hematological malignancy, carries high morbidity with variability in clinical progression among patients. This necessitates accurate risk stratification for effective therapy and life planning. While extensively genomically and transcriptomically characterized, MM remains modestly studied from a proteomic perspective. As proteomics is a closer measure of phenotype than genomic and transcriptomic assessments, addressing this gap in the literature may yield new insights into disease biology and novel biomarkers.<h4>Methods</h4>Herein, we applied a new sample preparation approach for mass-spectrometry based proteomics to bone marrow interstitial fluid (BMIF) from patients with MM or its precursors.<h4>Results</h4>We achieved deep coverage of the proteome, identifying > 11,000 protein groups (PGs) across our cohort, with an average of ~ 8900 PGs per sample. Of these, 194 PGs were significantly associated with overall survival (OS). These survival-associated PGs were enriched for those involved in coagulation, and clustering newly diagnosed MM (NDMM) based on coagulation-related proteins revealed three distinct groups characterised by globally high, medium, and low intensity of coagulation-related proteins. The group with low intensity of coagulation-related PGs had significantly reduced OS (log-rank p = 0.00078). Clustering was independent of measured clinical covariates, including chemotherapeutic regimens used, Revised International Staging System (R-ISS stage), International Normalised Ratio (INR), and age, among others.<h4>Conclusion</h4>Our findings support the value of fluid-based proteomic assessment of MM and suggest that coagulation-related PGs could serve as valuable novel biomarkers for risk stratification in multiple myeloma, warranting further investigation into this area.

Also flagged:zoonotic diseasezoonotic diseasesinfectious diseasesaviansecretionszoonotic
Journal Article 2025-10-21 No Snippets Nguyen HTT, Lindahl JF, Lâm S, Nguyen-Viet H, Dang-Xuan S, Unger F, Ling J, Lundkvist Å, Lee HS, Bett B.
Show Full Abstract

<h4>Background</h4>Wildlife farming and trade in Southeast Asia contribute to the growing threat of zoonotic diseases. Despite the diversity of species farmed and the varying levels of risk they may pose, biosecurity practices among wildlife farmers remain underexplored. This study aimed to assess the knowledge, attitudes, and practices (KAP) of wildlife farmers in Vietnam to inform targeted interventions for zoonotic risk reduction.<h4>Method</h4>A mixed-methods study was conducted among 210 wildlife farmers who raised bats, bamboo rats, civets, and wild boars in Lao Cai and Dong Nai provinces, Vietnam, between October 2023 and March 2024. Quantitative data were collected via structured questionnaires, and qualitative insights were obtained through 30 key informant interviews and two focus group discussions. Linear mixed-effects regression and thematic analysis were applied to explore KAP scores and associated factors.<h4>Results</h4>Wildlife farmers demonstrated relatively high knowledge (mean score: 10.1/13, 77.7%), positive attitudes (mean score: 41.3/50, 82.6%), and moderate preventive practices (mean score: 14.1/30, 47.0%). Farmers with college or above education had higher knowledge scores (Estimated marginal mean (EMM) = 11.8; 95% confidence interval (CI): 10.2-12.8) compared to those with no formal education (EMM = 7.8; 95% CI: 4.0-11.1). Farmers solely engaged in wildlife farming had lower attitude scores (EMM = 41.7; 95% CI: 37.8-45.0) than farmers who also worked as government employees (EMM = 46.1; 95% CI: 43.3-48.2). Farming bats (EMM = 8.5; 95% CI: 5.8-11.4) had lower practice scores compared to farming civets (EMM = 15.8; 95% CI: 13.0-18.6), and farmers consumed wild meat had lower practice score (EMM = 12.3; 95% CI: 9.5-15.2) than those did not (EMM = 14.5; 95% CI: 11.9-17.0). Qualitative findings revealed that many farmers normalised risky practices, prioritised convenience and personal experience over disease knowledge, and avoided reporting illnesses due to mistrust in veterinary authorities and fear of negative consequences.<h4>Conclusion</h4>This study highlights low risk perception and gaps between knowledge and practices among wildlife farmers, underscoring the urgent need for One Health interventions that promote low-cost preventive measures, build trust with authorities, and deliver targeted health education for reducing zoonotic risks.

ECI2
Also flagged:Metabolic dysfunction-associated steatotic liver diseasenon-alcoholic fatty liver diseasetype 2 diabetescardiovascular diseaseobesityovernutrition
Journal Article 2025-10-21 ✓ 1 Snippet Yadav AK, Harris-Kawano A, Saxena R, Jiang G, Ji J, Gao H, Kua KL, Morral N.
In-Text Gene Mentions

…, Decr1 ,Eci2, Hmgcs2 ).…

Show Full Abstract

<h4>Background</h4>The escalating prevalence of metabolic dysfunction-associated steatotic liver disease (MASLD) is closely linked to rising obesity rates. Maternal obesity (MO) is associated with increased susceptibility to metabolic disorders, including MASLD, in the offspring. This elevated risk could be a consequence of epigenetic modifications established during fetal development, a period highly sensitive to the maternal diet. H3K9me3, a hallmark of heterochromatin, plays a vital role in development by silencing gene programs dispensable for differentiated cell types. This study investigated how MO influences gene expression and chromatin architecture in male and female offspring liver, in early postnatal live and upon sexual maturity.<h4>Methods</h4>Female mice were fed a Western-style diet or a control diet before and throughout pregnancy and lactation. The offspring were weaned at 3 weeks and subsequently transitioned to a standard chow diet for 5 weeks.<h4>Results</h4>At 3 weeks, the liver transcriptomes of control offspring were similar between sexes. However, MO disrupted hepatic gene expression in both sexes, leading to the dysregulation of hundreds of genes and alterations in H3K9me3 binding patterns. By 8 weeks, as the mice reached sexual maturity, control offspring showed considerable sex-based gene expression divergence, with over 1,800 genes showing differential expression. These genes were predominantly involved in immune response regulation, cell adhesion and extracellular matrix organization, xenobiotic and glutathione-mediated detoxification, cholesterol metabolism, and lipid partitioning. Furthermore, thousands of differentially bound H3K9me3 peaks were observed between the 3- and 8-week time points. A significant fraction of these peaks were located on the X chromosome in females, suggesting a role in X inactivation. Remarkably, MO offspring displayed incomplete normalization of gene expression, H3K9me3 profiles, and hepatic lipid classes by week 8, underscoring the long-term impact of maternal diet on the genomic and metabolic landscape.<h4>Conclusions</h4>Collectively, this study highlights inherent sex differences in liver gene expression, and suggests that H3K9me3 plays a role in establishing sex-specific liver function during sexual maturation. Moreover, MO disrupts these patterns, which are not fully corrected by 5 weeks of postnatal dietary normalization.

Also flagged:KMT2Aacute myeloid leukemiaRASAMLMLLT3ELL
Journal Article 2025-10-21 No Snippets Chen L, Li J, Zhu Y, Weng X, Huang Y, Zhao L, Yang G, Huang T, An R, Liu Z, Xu X, Chen Y, Huang Q, Wang K, Zhang S.
Show Full Abstract

KMT2A-altered acute myeloid leukemia (AML) comprises rearrangements (KMT2A-r), partial tandem duplications (KMT2A-PTD), and dual alterations (KMT2A-r/PTD). In this study of 125 patients, these subgroups exhibited distinct molecular profiles: KMT2A-r cases were enriched in RAS pathway mutations, whereas KMT2A-PTD showed a higher burden of epigenetic alterations. Although overall survival (OS) and event-free survival (EFS) did not differ significantly between subgroups, prognosis was strongly influenced by fusion partners. MLLT3/ELL-rearranged cases showed superior outcomes, but concurrent KMT2A-PTD abrogated this survival advantage, AFDN and other fusions showed poor outcomes. We therefore propose a revised three-tier risk model integrating fusion partner and PTD status, which significantly stratified patient outcomes. The intermediate-risk group (MLLT3/ELL without PTD) had a 3-year OS of 78.1%, compared to 50.5% in the high-risk group (all PTD), and 34.9% in the very high-risk group (other KMT2A-r) (P = 0.044). For EFS, the rates were 71.0%, 40.1%, and 24.9%, respectively (P = 0.003). Allogeneic hematopoietic cell transplantation significantly improved survival, with 3-year OS rates of 75.2% in transplant recipients versus 22.5% in non-transplanted patients (P < 0.001), particularly in high-risk groups and when performed in first complete remission. These findings support the use of molecularly guided, risk-adapted therapy in KMT2A-altered AML.

BTN2A1
Also flagged:dementiabutyrophilin subfamily 3 member A2Apolipoprotein Etriggering receptor expressedAlzheimer's diseasevascular dementia
Journal Article 2025-10-21 ✓ 4 Snippets Salih AM, Salatzki J, Wang Y, Akilu T, Maldonado C, Husain M, Neubauer S, Topiwala A, Altmann A, Raisi-Estabragh Z.
In-Text Gene Mentions

…2 member A1 (BTN2A1), higher levels of…

…Higher IL1A, CD1C,BTN2A1, and complement component…

…HigherBTN2A1levels were linked…

…Mutations in theBTN2A1gene have been…

Show Full Abstract

<h4>Introduction</h4>Dementia is a rising global health challenge. Advances in large-scale proteomics and genetic databases have enabled high-throughput screening approaches to uncover novel mechanistic pathways and therapeutic targets.<h4>Methods</h4>This study used a Mendelian randomization framework to examine genetic associations of 2172 plasma proteins (UK Biobank, <i>n</i> = 54,219) with: (1) dementia subtypes (FinnGen, <i>n</i> = 429,209), including Alzheimer's disease (<i>n</i> = 12,348), vascular dementia (<i>n</i> = 2667), and Parkinson's disease dementia (<i>n</i> = 589); and (2) global neuroimaging markers (UK Biobank), including white matter hyperintensities (<i>n</i> = 42,310), fractional anisotropy (<i>n</i> = 17,663), and mean diffusivity (<i>n</i> = 17,467).<h4>Result</h4>Multiple potential causal protein-outcome relationships were identified, corroborating known associations (e.g., apolipoprotein E, synaptosomal-associated protein 25) and uncovering more novel proteins (e.g., butyrophilin subfamily 3 member A2, granzyme A, contactin-2, and trefoil factor 3) potentially involved in dementia disease processes.<h4>Discussion</h4>The identified proteins have diverse functions spanning immune regulation, cellular proliferation, neuronal stability, and neuroinflammation. The findings increase our understanding of disease processes governing cognitive health and highlight candidate proteins with potential as new disease biomarkers or therapeutic targets.<h4>Highlights</h4>We used Mendelian randomization to link 2172 plasma proteins to dementia and brain imaging traits.Apolipoprotein E, triggering receptor expressed on myeloid cells 2, and Fc receptor-like 3 showed protective associations across dementia subtypes.Butyrophilin subfamily 3 member A2, granzyme A, contactin-2, and trefoil factor 3 were uncovered as novel dementia-associated proteins.Immune, metabolic, and vascular pathways were implicated in the etiology of dementia.

HTT
Also flagged:CytosineAdenineGuanineHuntington's diseaseHDchromosome
Journal Article 2025-10-21 ✓ 1 Snippet Winquist RJ, Church B.
In-Text Gene Mentions

…in the huntingtin (HTT) gene, specifically expansion…

Show Full Abstract

Huntington's Disease (HD) became the first disease mapped to a single chromosome and associated with mutations in the huntingtin (HTT) gene, specifically expansions in the trinucleotide cytosine-adenine-guanine (CAG) within exon 1. The onset and progression of disease has been linked, inversely, to the inherited CAG repeat length in the mutated allele but also to an ongoing somatic expansion. However, HD remains an unmet medical need. A rational but not yet successful therapeutic approach has been to inhibit the mutant HTT mRNA/protein although recent trials have shown signs of early promise. Somatic expansion of the CAG repeat length, beyond the inherited length, has been associated with hastening the onset of symptoms compared to that predicted from the germline length. Targeting somatic CAG repeat expansion as a therapeutic has been challenging due to several factors including difficulty in modeling this phenomenon preclinically, capturing somatic expansion in post-mortem brain tissue from HD patients and the relative lack of specific targets. Moreover, more recent GWAS data also show that many of the gene loci which influence either age of onset or clinical landmarks exhibit complexity such as cell-specific effects, influence of non-canonical sequences and a lack of concordance between affecting somatic expansion and clinical landmarks. This complicates identifying appropriate targets for drug discovery programs including the DNA mismatch repair proteins. After briefly reviewing the approaches targeting the mutant HTT we will discuss possible paths forward to adjudicate the clinical data on somatic expansion with a focus on next steps for drug discovery.

HTT
Also flagged:proteasomeHuntington's diseaseHDautosomal dominant neurodegenerative diseasepolyglutamineHuntington's chorea
Journal Article 2025-10-21 ✓ 5 Snippets Gotmanova NN, Bobik TV, Kriachkov VA, Ezhov AA, Bacheva AV.
In-Text Gene Mentions

…the overexpressed full-lengthHttvariants via proteasome…

…(CAG) in theHTTgene.…

…the huntingtin protein (Htt).…

…proteotoxicity of mutantHtt(mHtt) results from…

…short-termed overexpression ofHtt/mHtt has been demonstrated…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a pathological mutation that results in the abnormal expansion of more than 37 consecutive trinucleotide repeats (CAG) in the HTT gene. These repeats encode the polyglutamine tract (polyQ tract) in the huntingtin protein (Htt). Progressive lethal Huntington's chorea is characterized by impaired motor activity and marked cerebral atrophy. The disease affects neurons in specific areas of the central nervous system, mainly GABAergic neurons in the striatum and cortex. It is believed that the neuron-specific proteotoxicity of mutant Htt (mHtt) results from its conformational instability and tendency to aggregate due to elongation of the polyQ-tract. However, recent structural findings challenge these assumptions. To elucidate some key aspects of the molecular mechanisms of HD, we describe the transient expression of full-length normal or mutant huntingtin in HEK293T eukaryotic cells, and options of isolation and purification of huntingtin variants according to the optimized procedure. The short-termed overexpression of Htt/mHtt has been demonstrated to be associated with elevated proteasome and non-proteasome caspase activity, and change in subunit expression. The cellular response to mHtt production manifested primarily as an increase in β1, β5i and in less extent β1i subunits as well as 11Sαβ expression, as observed through both Western blot and RT-qPCR. The microscopy study also revealed an enhancement in the β1i subunit content in HEK293T cells overexpressed Htt and especially mHtt suggesting an immunoproteasome activation.

Also flagged:NanospheresTumorMetastasisruthenium complexesplatinumarginine
Journal Article 2025-10-21 No Snippets Zhu D, Hu B, Zhang L, Gao D, Ni M, Lu Y, Wang Y.
Show Full Abstract

<h4>Background</h4>The clinical translation of ruthenium complexes as alternatives to platinum-based drugs is hindered by insufficient tumor targeting and limited therapeutic efficacy. Although nanodrug delivery systems (NDDS) offer potential solutions, existing Ru platforms often fail to integrate multi-modal therapeutic mechanisms effectively. This study aimed to construct a tumor-targeted Ru-Au nanoplatform, KKS-Ru@AuNPs, that synergizes Ru-based chemotherapy with photothermal therapy (PTT) to suppress tumor growth and metastasis simultaneously.<h4>Methods</h4>The KKS-Ru@AuNPs system was developed by conjugating arginine-glycine-aspartic acid peptide-modified Ru complexes with Au nanospheres. The nanoscale properties of KKS-Ru@AuNPs were characterized utilizing transmission electron microscopy and nanoparticle size-measuring techniques. The photothermal performance of the KKS-Ru@AuNP system was assessed using near-infrared irradiation assays utilizing an infrared thermal imaging device. Additionally, anti-tumor efficacy was evaluated in an A549 xenograft mouse model, and tumor-targeting efficiency was quantified by inductively coupled plasma mass spectrometry (ICP-MS).<h4>Results</h4>The KKS-Ru@AuNPs exhibited nanospherical morphology, with nanospheres having a diameter of ~75 nm. Compared with AuNPs, KKS-Ru@AuNPs exhibited enhanced stability and superior photothermal conversion efficiency. Under in vitro conditions with irradiation using an 808 nm laser, the KKS-Ru@AuNPs exhibited significantly enhanced cytotoxic effects. In vivo studies revealed that KKS-Ru@AuNPs achieve greater tumor accumulation than that achieved by AuNPs. The synergistic therapeutic effect of KKS-Ru@AuNPs was evidenced by an 84.6% reduction in tumor weight and a 46% decrease in the number of lung metastatic nodules.<h4>Conclusion</h4>This study established a Ru-based NDDS by integrating active targeting, chemotherapy, and PTT into a single platform, overcoming the limitations of conventional monotherapeutic approaches. However, challenges persist in terms of long-term biosafety due to hepatic Au accumulation and tumor heterogeneity-dependent targeting efficiency. Future studies should focus on degradable carrier designs and multi-omics mechanistic analysis to promote clinical applicability of Ru-based NDDSs.

Also flagged:Cancerscervical canceroropharyngealextracellularvesiclesglycolytic enzymes
Journal Article 2025-10-21 No Snippets Cakir MO, Selek M, Yilmaz B, Ozdogan M, Ashrafi GH.
Show Full Abstract

<h4>Background/objectives</h4>Human papillomavirus (HPV) is the main causative agent of cervical cancer and contributes to a significant proportion of other anogenital and oropharyngeal malignancies. The need for better biomarkers and therapeutic approaches in HPV-associated cancers has drawn attention to exosomes, small extracellular vesicles known for their stability, biomolecule transport capabilities, and role in cell-to-cell communication.<h4>Methods</h4>This review comprehensively evaluates recent literature on the diagnostic, prognostic, and therapeutic applications of small extracellular vesicles, particularly exosomes, in HPV-related cancers. It analyzes findings on exosomal nucleic acids, proteins, and long non-coding RNAs, as well as engineered exosome-based therapies.<h4>Results</h4>Exosomal miRNAs (e.g., miR-204-5p, miR-99a-5p, miR-21), proteins (e.g., glycolytic enzymes, HSP90), and lncRNAs (e.g., HOTAIR, DLEU1) have emerged as promising biomarkers for disease detection and monitoring. Exosomal cargo actively participates in HPV-related tumor progression. For example, miRNAs such as miR-21 and miR-146a modulate immune cell polarization and inflammatory signaling, while lncRNAs like HOTAIR promote oncogenic transcriptional programs. Exosomal proteins including HSP90 and ANXA1 facilitate extracellular matrix remodeling and immune evasion, thereby influencing tumor growth and metastasis. In HPV-positive head and neck and cervical cancers, exosomal cargo reflects HPV status, tumor progression, and treatment response. Therapeutic studies demonstrate the utility of exosomes in vaccine delivery, immune modulation, and drug delivery systems, including the use of PROTACs. However, clinical translation faces barriers including isolation protocol standardization, biomarker validation, and scalable production.<h4>Conclusions</h4>Exosomes hold great promise for integration into diagnostic and therapeutic workflows for HPV-related cancers. Future research should focus on resolving standardization issues, validating biomarkers in diverse cohorts, and optimizing engineered exosome platforms for targeted therapy.

Also flagged:OxygenDeathApoptosisFerroptosisParaptosismetabolism
Journal Article 2025-10-21 No Snippets Sendtner N, Seitz R, Brandl N, Müller M, Gülow K.
Show Full Abstract

Reactive oxygen species (ROS) are versatile determinants of cell fate, tipping the balance between survival and death. By exceeding critical thresholds or perturbing compartment-specific signaling, ROS can initiate, modulate, or suppress regulated cell death (RCD). Importantly, their influence extends across the full spectrum of currently characterized RCD modalities. 19 distinct forms of cell death-including both long-established and recently described entities-are shaped by ROS, either as triggers, modulators, or inhibitors. Beyond pathway-specific effects, ROS promote crosstalk between death programs, enabling switches from one mode to another and determining whether outcomes are inflammatory or non-inflammatory. By systematically integrating 19 RCD types, the unifying role of ROS emerges as both gatekeeper and connector of diverse death pathways. Such a comprehensive perspective underscores the centrality of redox imbalance in cell fate control and highlights its broader implications for inflammation and disease.

DCC
Also flagged:BCR-ABLhydrogentyrosine kinaseBCRABLRebastinib
Journal Article 2025-10-21 ✓ 1 Snippet Rocha KML, Nascimento ÉCM, Martins JBL.
In-Text Gene Mentions

…complex with rebastinib (DCC-2036) [ 46 ].…

Show Full Abstract

Considering the relevance of hydrogen bonds and other intermolecular interactions in regulating the activity of the tyrosine kinase class of enzymes, an in-depth electronic structure study of these forces in the context of the BCR-ABL protein was performed through full optimizations using the ONIOM method. Rebastinib and ponatinib were docked to the target enzyme using AutoDock Vina to provide starting-point geometries, which were then optimized through ONIOM calculations. This study evaluated Frontier Molecular Orbitals (FMOs) and Bond-Critical Points (BCPs) located in the sites of interactions formed with accessible residues, such as Glu286, Met318, and Asp381. Ponatinib's ONIOM-optimized structure was shown to not only form and preserve prominent interactions, which were shown to be significantly stronger than those formed by rebastinib, but also to be associated with a significant increase in the HOMO (Highest Occupied Molecular Orbital)-LUMO (Lowest Unoccupied Molecular Orbital) gap, indicating its potential to hinder catalytic activity by providing higher chemical stability when compared to rebastinib.

PRDX6
Also flagged:mitochondrialtype 2 diabetesinsulin resistancetype 2 diabetes mellitussynthesiscitrate synthase
Journal Article 2025-10-21 ✓ 2 Snippets Zhu W, Zhou Z, Sun J, Si J.
In-Text Gene Mentions

…of PRDX2 orPRDX6—consistent with their baselin…

…cytosolic PRDX2 andPRDX6in T2DM means…

Show Full Abstract

<h4>Background</h4>Skeletal muscle mitochondrial dysfunction is a key driver of insulin resistance and disease progression in type 2 diabetes mellitus (T2DM), while exercise training has shown potential to improve mitochondrial function. However, existing studies focus on single exercise modalities, lack systematic synthesis of mitochondrial mechanisms, and exhibit conflicting results, highlighting the need for a comprehensive meta-analysis.<h4>Methods</h4>Systematic searches were conducted in PubMed, Web of Science, and Scopus for studies involving T2DM patients (≥40 years) with exercise as the primary intervention and mitochondrial outcomes. Methodological quality was assessed via the TESTEX scale, with meta-analysis performed using Stata 17.0.<h4>Results</h4>A total of 18 studies (394 participants, 272 in training groups) were included. Exercise significantly enhanced mitochondrial oxidative capacity (SMD = 0.61, 95% CI [0.30, 0.92], driven by citrate synthase [CS] and COX-II), antioxidant capacity (SMD = 1.18, 95% CI [0.50, 1.86], mainly via SOD2), and fusion marker MFN2 (SMD = 0.96, 95% CI [0.63, 1.29]). It tended to increase mitochondrial content (SMD = 0.50, <i>p</i> = 0.091) but with no significant mtDNA/PGC-1α changes. Effective modalities included long-term moderate aerobic training, short-term HIIT, and long-term resistance/combined training. Antidiabetic medications' potential interference was underassessed.<h4>Conclusion</h4>Moderate-to-high intensity exercise selectively improves skeletal muscle mitochondrial function in T2DM, particularly oxidative capacity (via CS/COX-II), antioxidant capacity (via SOD2), and mitochondrial fusion (via MFN2). The effect on mitochondrial content is non-significant, and the influence of antidiabetic medications requires further investigation.<h4>Systematic review registration</h4>Identifier CRD42024579581.

Also flagged:FerrihydriteTungstenmontmorilloniteironAdsorptionmetals
Journal Article 2025-10-21 No Snippets Peng Y, Zheng X, Chen M.
Show Full Abstract

Tungsten (W), a transition element, is widely used across industries such as metallurgy, electronics, and military, but its mining and smelting have led to significant environmental concerns due to its accumulation in soil. This study aimed to develop an effective and environmentally friendly method to remediate W-contaminated soil using ferrihydrite-modified montmorillonite, a composite material with enhanced adsorption capacity. The main objectives were to assess the impact of iron loading on the material properties and adsorption efficiency, evaluate its stabilizing effects on W in soil, and examine its influence on the soil microbial community. The results demonstrated that the introduction of ferrihydrite significantly increased the surface area and porosity of montmorillonite, improving its capacity to adsorb W. W extracted by EDTA from the treated soil decreased by 53.13-89.88%, indicating that modified montmorillonite facilitated the transformation of exchangeable W into more stable forms, such as Fe/Mn fractions. The soil pH and organic content increased post-treatment, and the microbial community diversity was restored, with a more stable structure observed. Adsorption experiments confirmed that W adsorption followed the Langmuir and pseudo-second-order models, with Fe-OH groups playing a key role in the process. The modification did not induce redox changes in W, suggesting minimal ecological disruption. This study concluded that ferrihydrite-modified montmorillonite is a promising approach for W-contaminated soil remediation, offering high stabilization efficiency and low ecological risk, making it a sustainable solution for addressing heavy metal pollution.

SOX6
Also flagged:Sickle Cell Diseasehereditary hemoglobinopathyβ-globinhemoglobin Schronic hemolytic anemiahydroxyurea
Journal Article 2025-10-21 ✓ 1 Snippet Duesberg MS, Schiller G.
In-Text Gene Mentions

…HbF, including ZBTB7A,SOX6, KLF1, and ZNF410,…

Show Full Abstract

Sickle cell disease (SCD) is a hereditary hemoglobinopathy caused by a point mutation in the β-globin gene, leading to the production of hemoglobin S and resulting in chronic hemolytic anemia, vaso-occlusion, and progressive organ damage. Affecting millions globally, with the highest prevalence in sub-Saharan Africa and other low-resource settings, SCD remains a major public health challenge. Current therapies, including hydroxyurea, L-glutamine, crizanlizumab, and transfusions, primarily offer symptomatic relief but do not correct the underlying genetic defect. Hematopoietic stem cell transplantation remains the only established cure but is limited by donor availability and associated risks. Recent advances in gene therapy have transformed the therapeutic landscape of SCD, offering curative potential through techniques such as lentiviral vector-mediated gene addition and CRISPR/Cas9 gene editing. These approaches aim to restore normal hemoglobin production or reactivate fetal hemoglobin expression. While clinical trial outcomes are encouraging, with reduced vaso-occlusive crises and transfusion independence, major challenges remain, including high costs, need for myeloablative conditioning, and limited access in high-burden regions. This review explores the evolution of SCD treatment, evaluates the promise and limitations of emerging gene therapies, and highlights the urgent need for equitable access to these transformative technologies.

HFE
Also flagged:Hereditary HyperferritinemiaCataract Syndromehyperferritinemiainfectionsautoimmune disordershemophagocytic lymphohistiocytosis
Journal Article 2025-10-21 ✓ 5 Snippets Hemanna A, Sidlow R.
In-Text Gene Mentions

…variants in theHFEgene.…

…variant of theHFEgene) and cataract…

…variant of theHFEgene, contrasting with…

…who ruled outHFEgene mutations […

…variant of theHFEgene.…

Show Full Abstract

The differential diagnosis for hyperferritinemia is wide, including malignancy, infections, autoimmune disorders, hemophagocytic lymphohistiocytosis, hyperthyroidism, chronic kidney disease, and, most commonly, iron overload. As an acute-phase reactant, ferritin is usually elevated due to secondary causes. In rare circumstances, however, ferritin levels may be primarily elevated due to a genetic cause. We report a case of a three-year-old male patient with incidentally detected hyperferritinemia who was found to harbor the c.-168G>T mutation in the FTL gene, confirming hereditary hyperferritinemia-cataract syndrome (HHCS). This case is distinguished by a unique four-generation family history of early-onset cataracts and elevated ferritin levels, underscoring the hereditary and novel nature of this disorder.

bioRxiv 2025-10-21 Preprint (No Snippets API) Huang B, Xin W, Zhang W, Gao W, Hu Y, Liu Y, Su Q, Zhou Q.
Show Full Abstract

γδ T cells express T cell receptors (TCRs) composed of paired γ and δ chains. The Vγ9Vδ2 T cells are the main subpopulation of γδ T cells in human peripheral blood, which responds to phosphoantigens (pAgs) through butyrophilins (BTN) molecules, such as BTN3A1/2/3 and BTN2A1. Antibodies targeting BTN3As, such as ICT01, can activate Vγ9Vδ2 T cells independently of pAgs, although the underlying mechanism remains poorly characterized. In this study, we reveal the molecular basis of ICT01-mediated Vγ9Vδ2 T cell activation using structural, biochemical, and cellular analyses. ICT01 binds to a unique region in the extracellular domain of BTN3As, destabilizing the BTN2A1-BTN3As interface and facilitating Vγ9Vδ2 TCR engagement, ultimately resulting in activation of Vγ9Vδ2 T cells. Our findings provide insights into the mechanism by which agonist antibodies induce γδ T cell activation and provide guide strategies for developing BTN-targeted immunotherapies.

Also flagged:strokedeathhemorrhagic strokehypertensionhyperlipidemiadiabetes
Journal Article 2025-10-20 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

HFE
Also flagged:ALDH2deathlipidferroptosisacute myocardial infarctionacetaldehyde dehydrogenase 2
Journal Article 2025-10-20 ✓ 1 Snippet Chen X, Yu X, Zhong S, Sha P, Li R, Xu X, Liang N, Zhang L, Li L, Zhang J, Zhou M, Lv T, Ma H, Wang Y, Ye Y, Yin C, Chen S, Tian J, Sun A, Wang W, Yan D, Yang HT, Huang H, Li P, Yin H.
In-Text Gene Mentions

…chronic blood transfusions,hemochromatosis, or other disorders…

Show Full Abstract

<h4>Background</h4>As an iron-dependent form of regulated cell death caused by lipid peroxidation, ferroptosis has been implicated in ischemic injury, but the underlying mechanisms in acute myocardial infarction (AMI) remain poorly defined. ALDH2 (acetaldehyde dehydrogenase 2) catalyzes detoxification of lipid aldehydes derived from lipid peroxidation and acetaldehydes from alcohol consumption. The Glu504Lys polymorphism of ALDH2 (rs671, ALDH2*2), affecting ≈40% of East Asians, is associated with increased risk of myocardial infarction (MI). This study aims to investigate the role of ALDH2*2 and ferroptosis in AMI.<h4>Methods</h4>A Chinese cohort of 177 patients with acute heart failure with ALDH2 wild type and ALDH2*2 was enrolled. The MI mouse model of left anterior descending coronary artery ligation was conducted on wild-type and ALDH2*2 mice and mice with cardiomyocyte-specific knockdown of eIF3E (eukaryotic translation initiation factor 3 subunit E) by adeno-associated virus. The lipid peroxidation products were measured by mass spectrometry-based lipidomics and metabolomics in human plasma, mouse serum samples, mouse heart tissues, and primary cardiac myocytes.<h4>Results</h4>Human ALDH2*2 carriers exhibit more severe heart failure after AMI with features of ferroptosis in plasma, as seen through lipidomic analysis, characterized by increased bioactive lipids and decreased antioxidants, such as coenzyme Q10 and BH4 (tetrahydrobiopterin). Similar features were observed in MI mouse models of ALDH2*2, whereas ferroptosis inhibition by Fer-1 significantly improved heart function and reversed ferroptosis markers. Importantly, ALDH2*2 significantly decreased ALDH2 protein levels, whereas ferroptosis-related markers, including TFRC (transferrin receptor) and ACSL4 (acyl-coenzyme A synthetase long-chain family member 4) were notably upregulated in the infarct heart tissues. Mechanistically, ALDH2 physically interacts with the eIF3 complex via the eIF3E factor, which prevents eIF3E-eIF4G1 (eukaryotic initiation factor 4G)-mRNA assembly. The ALDH2*2 variant causes ALDH2 deficiency, disrupting its interaction with the eIF3 complex by releasing the bound eIF3E to assemble an eIF3E-eIF4G1-mRNA ternary complex, thereby driving selective translation of mRNAs (eg, TFRC, ACSL4, and UAP1) containing the GAGGACR (R represents A/G) motif to promote ferroptosis. Consistently, cardiomyocyte-specific eIF3E knockdown restored ALDH2*2 cardiac function by attenuating ferroptosis in MI.<h4>Conclusions</h4>ALDH2*2 aggravates acute heart failure after MI by promoting the selective translation of mRNAs containing the GAGGACR motif, thereby driving cardiomyocyte ferroptosis. Targeting ferroptosis represents a potential therapeutic option for mitigating MI injury, especially for ALDH2*2 carriers.

VRK2
Also flagged:VRK1Small Cell Neuroendocrine CarcinomaSmall cell neuroendocrine carcinoma of the cervixcervical cancercervical carcinomastumor
Journal Article 2025-10-20 ✓ 5 Snippets Kobayashi M, Nakagawa S, Ishii Y, Kamei Y, Kanda M, Masuda T, Kakuda M, Hiramatsu K, Iwamiya T, Egawa-Takata T, Matsuzaki S, Uematsu H, Onuma K, Inoue M, Ueda Y, Kimura T, Kodama M.
In-Text Gene Mentions

VRK2, another member of…

…For VRK1,VRK2, and cytochrome c…

…lethal target inVRK2‐deficient nervous system canc…

…characterized by lowVRK2expression (Figure S15…

…VRK1 andVRK2are paralogous genes…

Show Full Abstract

Small cell neuroendocrine carcinoma of the cervix (SCNEC) is classified as a high-grade neuroendocrine carcinoma with a worse prognosis than other major histological types of cervical cancer. Identifying novel therapeutic targets based on its molecular characteristics is highly desirable but challenging due to the rarity of SCNEC and the resulting lack of research resources. In this study, we identified vaccinia-related kinase 1 (VRK1) as a potential therapeutic target for SCNEC. VRK1 was prioritized based on our previously reported proteomic analysis of patient-derived organoids. Immunohistochemistry of patient samples consistently revealed high VRK1 expression in SCNEC, as opposed to its variable expression in other cervical carcinomas. Although VRK1 knockdown in SCNEC had only a limited effect on cell proliferation in two-dimensional cultures, it significantly suppressed cell proliferation in three-dimensional cultures and inhibited xenograft tumor growth in vivo. Gene set enrichment analysis of RNA-sequencing data from mouse xenograft models demonstrated that VRK1 is associated with mitochondrial-related pathways. Furthermore, under oxidative stress conditions, VRK1 knockdown resulted in a reduction of mitochondrial membrane potential, an indicator of mitochondrial integrity, and decreased expression of cytochrome c oxidase subunit IV (COX IV), a nuclear-encoded subunit of cytochrome c oxidase, the terminal enzyme complex of the mitochondrial respiratory chain. These findings suggest that VRK1 knockdown indirectly impaired mitochondrial function. Collectively, these anti-tumor effects highlight VRK1 as a promising therapeutic target for SCNEC.

MLLT10
Also flagged:B-cell lymphoblastic acute leukemiaoncogenesT-cell acute lymphoblastic leukemiaALLgene expressionCDKN2A
Journal Article 2025-10-20 ✓ 4 Snippets Zheng J, Wang Y, Li Z, Xiao P, Lu J, Liu H, Hu Y, Wu S, Li B, Gao L, Ji Q, He H, Wang Y, Li J, Chen N, Meng L, Tian Y, Li Y, Xiao S, Hu S.
In-Text Gene Mentions

…KMT2A::MLLT10, PAX5::FBRS ,…

…years (patient 2), KMT2A::MLLT10gene fusion (patient…

…who had a KMT2A::MLLT10rearrangement, a known…

…, BCR::ABL1 , KMT2A::MLLT10, and PAX5::FBRS…

Show Full Abstract

T-cell receptor (TCR) loci undergo complex V(D)J rearrangements during T-cell maturation. However, errors in this process can cause TCR promoters and enhancers to aberrantly fuse with oncogenes, leading to their overexpression and the development of T-cell acute lymphoblastic leukemia (T-ALL). Unexpectedly, in a retrospective study of 97 pediatric B-ALL cases, all diagnosed according to WHO criteria at a single institution, we identified a subgroup of B-ALL harboring TCR fusion. These fusions involved diverse partner genes, including LINC01656, TBC1D10B, TCL1A/TCL1B, CDKN2A, CEBPB/G, and AHI1. Patients with TCR fusions showed a gene expression profile enriched in hematopoietic stem cell (HSC) signatures and frequently carried other adverse genomic markers, such as CDKN2A/B alterations and RAS pathway activation. Clinically, TCR-rearranged B-ALL patients were associated with increased risk (P = 0.005) and had higher minimal residual disease (MRD) at day 19 (P = 0.034), and may benefit from MRD-based risk-directed therapy. Our study highlights frequent TCR fusions in B-ALL, suggesting a stem cell-derived leukemia with potential differentiation into both B-cell and T-cell lineages.

KLHL20
Also flagged:KLHL35cancercolorectal cancerKelch-Like Family Member 35tumorcell cycle
Journal Article 2025-10-20 ✓ 1 Snippet Qin R, Duan Y, Bao S, Wang H, Zhou J, Fan X, Li X, Li G, Hu J.
In-Text Gene Mentions

…23 ]; similarly,KLHL20-targeting agents destabilize …

Show Full Abstract

This study investigates the expression patterns and clinical relevance of KLHL35 (Kelch-Like Family Member 35) across various cancer types, with a focus on colorectal cancer. Comprehensive analysis of RNA sequencing data from The Cancer Genome Atlas (TCGA) and protein expression data from the Human Protein Atlas (HPA) revealed significant overexpression of KLHL35 in 13 tumor types, including colorectal cancer. Increased KLHL35 expression was associated with poor clinical outcomes, including overall survival (OS), progression-free interval (PFI), and disease-specific survival (DSS). Receiver operating characteristic (ROC) curve analysis suggested promising but exploratory diagnostic value for KLHL35, with area under the curve (AUC) values exceeding 0.9 in colorectal cancer. Functional enrichment analyses suggested potential associations between KLHL35 and cell cycle/apoptosis pathways, while immune infiltration correlations hinted at a possible role in immune microenvironment remodeling. In vitro assays confirmed KLHL35’s role in promoting cancer cell proliferation, invasion, and migration. These findings suggest that KLHL35 could serve as a valuable diagnostic and prognostic biomarker and a potential therapeutic target, particularly in colorectal cancer. While these findings nominate KLHL35 as a candidate for therapeutic targeting, further mechanistic studies are required to validate its function.”

OLFM4
Also flagged:gene expressionchromatinISPpro-inflammatory cytokinesstem cell differentiationinflammatory bowel disease
Journal Article 2025-10-20 ✓ 5 Snippets Karakasheva TA, Martinez CM, Zhou Y, Qui J, Chen XE, Soto GE, Nettleford SK, Hix OT, Roach DM, Laguerta AM, Thadi A, Edwards RM, Aleynick D, Weinbrom S, Borodyanskaya E, Pickering OH, Fulton M, Chen CH, Peterson IV, Hagen EB, Yannuzzi IP, Haider Z, Cramer Z, Conrad MA, Li N, Bewtra M, Uzun Y, Tan K, Kelsen JR, Minn AJ, Lengner CJ, Hamilton KE.
In-Text Gene Mentions

…early progenitors (9004),OLFM4+ REG1A +…

…secretory progenitors (2115),OLFM4- REG1A +…

…secretory progenitors (947),OLFM4- REG1A +…

…genes consistent withOLFM4- REG1A +…

…ISPs originate fromOLFM4- REG1A +…

Show Full Abstract

<h4>Background & aims</h4>Defining consequential differences in intestinal epithelial stem cells in healthy humans vs those with inflammatory bowel disease (Crohn's disease and ulcerative colitis) is essential for the development of much needed therapies to restore the epithelial barrier and maintain its fidelity.<h4>Methods</h4>We used single-cell transcriptomic and epigenomic approaches in matched patient tissues and organoids to investigate epithelial gene expression and function in children with no pathological diagnosis in the lower gastrointestinal tract and healthy adults compared with those with Crohn's disease.<h4>Results</h4>We identify an inflammatory secretory progenitor (ISP) cell state present almost exclusively in patients with Crohn's disease compared with healthy subjects. ISPs exhibit gene expression profiles consistent with normal secretory progenitor cells but concomitantly express a suite of distinguishing pro-inflammatory genes. Mechanistically, ISPs exhibit open chromatin at ISP gene loci. Although ISP-specific genes are not expressed in intestinal stem cells, their chromatin is accessible in Crohn's disease stem cells, suggesting that ISP genes are epigenetically poised in stem cells and subsequently transcriptionally activated in ISPs in the presence of inflammatory stimuli. Consistently, Crohn's disease colonoids exhibit sustained ISP gene expression that can be elicited further with pro-inflammatory cytokines or via co-culture with pro-inflammatory macrophages.<h4>Conclusions</h4>We have defined differences in the epithelial stem and progenitor compartment of patients with Crohn's disease that suggest aberrant stem cell differentiation and inflammatory gene expression arise and persist during disease.

DNAH10
Also flagged:Infertilitymale infertilityoligozoospermiaasthenozoospermiasperm dysfunction infertilityDNAJB13
Journal Article 2025-10-20 ✓ 1 Snippet Khan MR, Shah AA, Al Smadi MA, Ludwig N, Fischer U, Abdul-Khaliq H, Meese E, Abu-Halima M.
In-Text Gene Mentions

…, DNAH9 ,DNAH10, DNAH11 ,…

Show Full Abstract

Infertility affects approximately 15% of couples globally, with male factors contributing to nearly 50% of cases. However, the genetic basis of male infertility, particularly idiopathic forms, remains poorly understood. In this study, we performed whole-genome sequencing (WGS) on eight normozoospermic men and nine men with oligozoospermia, asthenozoospermia, or both, followed by Sanger sequencing for validation. Comparative analysis revealed a higher burden of genomic variants in the sperm dysfunction infertility group (SDIG) than in the normozoospermic group (NG). Several nonsynonymous missense variants were exclusively identified in SDIG, including DNAJB13 (p.Ile159Asn), MNS1 (p.Asp217Asn), DNAH6 (p.Ser2210Leu), HYDIN (p.Gly901Ala, p.Arg568Trp), DNAH7 (p.Arg1486His, p.Gly171Arg, p.Ser2368Phe), DNAH17 (p.Ala3135Val), and CATSPER1 (p.Arg558Trp). These variants are predicted to affect protein structure, stability, or interactions, and were classified as variants of uncertain significance. Moreover, several variants were classified as likely pathogenic: a frameshift mutation in DNAH2 (p.Lys1414ArgfsTer29) likely resulting in a truncated protein, a missense mutation in CFAP61 (p.Arg568Trp) predicted to impair protein function, and two nonsense mutations in FSIP2 (p.Gln5809Ter and p.Cys8Ter) introducing premature stop codons. These alterations implicate key components of sperm flagellar function and motility. Our findings reveal novel and potentially deleterious genetic variants associated with male infertility, offering new insights into its molecular underpinnings and informing future diagnostic and therapeutic approaches.

DARS2PRDX6
Also flagged:mitochondrialMitochondriaPDmitochondria-associatedα-synucleinThy1
Journal Article 2025-10-20 ✓ 2 Snippets Morais LH, Stiles L, Freeman M, Oguienko AD, Hoang JD, Ji J, Jones J, Quan B, Devine J, Bois JS, Chou TF, Trinh J, Picard M, Gradinaru V, Mazmanian SK.
In-Text Gene Mentions

…synthetases such asDARS2(aspartyl-tRNA synthetase 2,…

…(thioredoxin reductase 1),PRDX6(peroxiredoxin 6), TXNRD2…

Show Full Abstract

The pathophysiology of Parkinson's disease (PD) involves gene-environment interactions that impair various cellular processes including mitochondrial dysfunction. Mitochondria-associated mutations increase PD risk, respiration is altered in the PD brain, and mitochondria-damaging toxicants cause PD-like motor and gastrointestinal symptoms in animal models. The gut microbiome is altered in PD, representing an environmental risk, however a relationship between mitochondrial function and the microbiome in PD has not been previously established. Herein, we discover that dysregulation of mitochondria-associated genes and hyperactive striatal mitochondria are induced by the microbiome in α-synuclein-overexpressing (Thy1-ASO) mice. Thy1-ASO mice elaborate increased reactive oxygen species in the striatum whereas germ-free counterparts express increased oxygen scavenging proteins. Indeed, treatment with an antioxidant drug improves motor performance in Thy1-ASO mice and blocking oxidant scavenging in germ-free mice enhances motor deficits in an α-synuclein dependent manner. Thus, the gut microbiome promotes motor symptoms in a mouse model of PD via increased mitochondrial respiration and oxidative stress in the brain.

OLFM4
Also flagged:GvLFLT3ITD16S rDNALgr516S rRNA
Journal Article 2025-10-20 ✓ 3 Snippets Göttert S, Thiele Orberg E, Fan K, Heinrich P, Matthe DM, Khalid O, Klostermeier L, Suriano C, Strieder N, Gebhard C, Vonbrunn E, Mamilos A, Hirsch D, Meedt E, Kleigrewe K, Hiergeist A, Schwarz A, Gläsner J, Ghimire S, Joachim L, Voll F, Neuhaus K, Janssen KP, Perl M, Pielmeier F, Ruland J, Kreutz M, Weber D, Schmidl C, Köhler N, Tschurtschenthaler M, Hoffmann P, Edinger M, Wolff D, Bassermann F, Rehli M, Haller D, Evert M, Hildner K, Büttner-Herold M, Herr W, Gessner A, Heidegger S, Holler E, Poeck H.
In-Text Gene Mentions

…markers Lgr5 andOlfm4as well as…

…markers Lgr5 andOlfm4(Fig. S4D ),…

…markers Lgr5 andOlfm4(ISC-II).…

Show Full Abstract

Changes in the intestinal microbiome and microbiota-derived metabolites predict clinical outcomes after allogeneic hematopoietic stem cell transplantation (allo-HSCT). Here, we report that desaminotyrosine (DAT), a product of bacterial flavonoid metabolism, correlates with improved overall survival and reduced relapse rates in patients receiving allo-HSCT. In preclinical mouse models, treatment with synthetic DAT prevents graft-versus-host disease by protecting the intestinal barrier and promoting intestinal regeneration and contributes to graft-vs.-leukemia responses. DAT´s beneficial effects on intestinal regeneration remain effective despite broad-spectrum antibiotics-induced dysbiosis, also when administered by fecal microbiota transfer with flavonoid-degrading F. plautii. Mechanistically, DAT promotes mTORC1-dependent activation and proliferation of intestinal stem cells, with concomitant engagement of the innate immune receptor STING required to mitigate metabolic stress and maintain an undifferentiated stem cell state independently of type-I interferon responses. Additionally, DAT can skew T cells towards an effector phenotype to modulate graft-versus-leukemia responses. Our data uncover DAT's dual, tissue- and immune-modulating properties and underscore its potential in precision microbiome-based therapies to improve tissue regeneration and minimize immune-mediated side effects.

OLFM4
Also flagged:Reticulophagy receptorFAM134CFAM134ER-phagy receptorsendoplasmic reticulumRETREG3
Journal Article 2025-10-20 ✓ 1 Snippet Gu S, Zhang H, Cao J, He Z, Wu J, Liu X, Zheng M, Liu T, Zhao B, Xu P, Sun Q, Jin J, Lin X, Yu Y, Han J, Feng XH.
In-Text Gene Mentions

…of Lgr5 andOlfm4(being associated with…

Show Full Abstract

FAM134/RETREG family members are ER-phagy receptors that maintain cellular homeostasis by regulating endoplasmic reticulum turnover. However, possible non-ER-phagy functions of FAM134 proteins remain elusive. Here, we show that RETREG3/FAM134C functions as a selective autophagy receptor for the type I BMP receptor (BMPRIA/ALK3) and recruits BMPRIA into LC3-containing autophagosomes for subsequent degradation. FAM134C-induced degradation diminishes the availability of BMP receptors and thus the strength of BMP signaling. Inhibition of autophagy through chemical means or knockdown of key autophagy regulators, ATG5 or Beclin-1, prevents BMPR1A degradation. Additionally, disruption of the putative LC3-interacting region (LIR) motif in FAM134C completely abolishes its interaction with LC3, thereby impeding its ability to degrade BMPR1A. Moreover, FAM134C-deficient mice exhibit enhanced BMP responses in the intestines, which affects intestinal crypt regeneration. Our findings suggest that FAM134C acts as a specific receptor that controls BMP signaling through the autophagic degradation of the type I BMP receptor, independent of its canonical role in ER-phagy.

Also flagged:infectionsepsisgenitourinary infectionrespiratory infectionsbloodstream infectionsfocal infections
Journal Article 2025-10-20 No Snippets Ardura-Garcia C, Hopkins J, Lee SJ, Waithira N, Painter C, Ling CL, Roberts T, Miliya T, Obeng-Nkrumah N, Opintan JA, Abbeyquaye EP, Hamers RL, Saharman YR, Sinto R, Karyanti MR, Ibrahim RF, Akech SO, Duangnouvong A, Choumlivong K, Feasey NA, Kululanga D, Lissauer S, Karkey A, Kunwar N, Erakhaiwu JE, Okeke IN, Adebiyi I, Oduola AB, Ogunbosi BO, Tongo OO, Ude IA, Aboderin O, Adeyemo AT, Edward SS, Osagie U, Nguyen Thi H, Thach PN, Giang TV, Hoang Thi LH, Trinh HT, van Doorn HR, Ashley EA, Turner P.
Show Full Abstract

<h4>Background</h4>Blood culture (BC) in children has relatively low diagnostic yield and high contamination rates, limiting cost-effectiveness. We aimed to determine readily available baseline characteristics to identify hospitalised children with a likelihood of higher diagnostic yield in low- and middle-income countries.<h4>Methods</h4>We used data from ACORN2, a prospective clinical surveillance network including 19 hospitals across Africa and Asia. We included participants <18 years, hospitalised for a suspected infection, prescribed parenteral antibiotics and with a BC sample. Sociodemographic and clinical data were recorded for each infection episode and linked to routine microbiology data. We described true pathogen (non-contaminant) BC positivity proportion and performed mixed-effects logistic regression, with study site and patient as the random effect, to identify factors associated with BC positivity.<h4>Results</h4>Of the 26 407 paediatric infection episodes, 17 815 (67%) had a BC sample and 15 384 were included in the analysis. BC results were: true pathogens in 689 (4.5%), contaminants in 1399 (9%) and uncertain pathogens in 143 (0.9%). In the multivariable model, factors associated with a positive BC were age (29 days-12-month-olds OR 1.33, 95% CI 1.06 to 1.66 and 5-18 year-olds OR 1.62, 95% CI 1.30 to 2.01 vs 1-4 year-olds), number of clinical severity signs (OR 1.29, 95% CI 1.18 to 1.40 per one sign) and hospital acquired infection (OR 3.05, 95% CI 2.30 to 4.06 vs community-acquired). Suspected diagnosis of sepsis (OR 2.09, 95% CI 1.67 to 2.61), gastrointestinal/abdominal (OR 2.36, 95% CI 1.78 to 3.13), skin and soft tissue or bone (OR 3.64, 95% CI 2.57 to 5.14) and genitourinary infection (OR 2.22, 95% CI 1.39 to 3.56) were more likely to have a positive BC, compared with respiratory infections.<h4>Conclusion</h4>We confirmed the low BC yield among hospitalised children. We identified groups for which diagnostic stewardship efforts to increase BC uptake should be prioritised and others in which it could be limited in times of financial or logistic constraints.

HTT
Also flagged:nucleotidesDRD2ANKK1COMTtemporomandibular disorderTemporomandibular disorders
Journal Article 2025-10-20 ✓ 5 Snippets Pozza OA, Bertoli FMP, Topolski F, Spada PP, Gabardo MCL, Souza JF, Küchler EC, Brancher JA.
In-Text Gene Mentions

…DRD2, COMT, and5-HTTgenes that may…

…COMT , and5-HTTgenes with temporomandibular…

…COMT , and5-HTTgenes that may…

…Serotonin Transporter gene (5-HTT), and to investigate…

…that SNPs in5-HTTwere associated with…

Show Full Abstract

<h4>Background</h4>Temporomandibular disorders (TMDs) comprise a heterogeneous group of musculoskeletal conditions affecting the temporomandibular joint, masticatory muscles, and associated structures. Growing evidence highlights the role of genetic predisposition as a significant contributor to TMD.<h4>Aim</h4>This study aimed to investigate genetic aspects involved in TMDs etiology.<h4>Methodology</h4>A cross-sectional study was conducted with 249 adolescents, of whom 149 were affected by TMD. Genomic DNA was extracted from buccal cells, and single nucleotide polymorphisms (SNPs) in DRD2 (rs6275 and rs6276), ANKK1 (rs1800497), COMT (rs6269 and rs4818), and 5-HTT genes (rs3813034 and 1042173) were analyzed. Allelic and genotypic distribution, haplotype, and diplotype analysis were performed using PLINK software version 1.06. Multifactor dimensionality reduction (MDR) was applied to identify SNP-SNP interactions and generate an interaction graph.<h4>Results</h4>In total, three possible single-locus allele combinations were obtained for haplotype and diplotype analyses (rs6275|rs6276 in DRD2, rs6269|rs4818 in COMT and rs3813034|rs1042173 in 5-HTT), but no associations with TMD were observed (p>0.05). However, MDR analysis for gene-gene interactions revealed a synergistic relationship between rs6275 (DRD2), rs6269 (COMT), and rs1042173 (5-HTT) that predisposes to TMD (p=0.050).<h4>Conclusion</h4>MDR analysis suggests a possible synergistic interaction among SNPs in the DRD2, COMT, and 5-HTT genes that may contribute to TMD susceptibility in adolescents.

Also flagged:Alpha-centractinhistidine methyltransferasemethylationhistidineβ-actintranslational
Journal Article 2025-10-20 No Snippets Witecka A, Emmel P, Ślusarczyk K, Kamińska JZ, Zaród M, Ishikawa T, Drożak J.
Show Full Abstract

<h4>Background</h4>The SETD3 enzyme, a protein histidine methyltransferase, catalyzes the Nτ-methylation of the histidine 73 residue in β-actin. This post-translational modification is important for maintaining cytoskeleton integrity, and actin remains the only known substrate of this methyltransferase to date. However, SETD3 was also postulated to play a role in the regulation of processes that are not directly related to actin homeostasis, such as cell cycle control and response to hypoxic conditions. These findings suggest that actin may not be the sole substrate of SETD3 methyltransferase. Here, we demonstrate that SETD3 methylates additional proteins in human cells, and α-centractin (ACTR1A) may be one of them.<h4>Methods</h4>Three different human SETD3 knockout cell lines (HAP1, HeLa, HEK293T) were generated with the CRISPR/Cas9 method and used as a source of SETD3 substrates. Fluorography was used to detect the SETD3-dependent methylation of proteins present in cell lysates, while the TurboID biotin ligase proximity labeling technique was used to isolate proteins that interact with SETD3. The molecular identity of the proteins was determined by mass spectrometry and the activity of recombinant SETD3 towards potential substrates was tested using a radiochemical assay.<h4>Results</h4>Fluorography revealed that SETD3 methylates at least five novel proteins besides β-actin in HAP1 cells. TurboID proximity labeling identified α-centractin, a key dynactin subunit, as an SETD3 interactor and an <i>in vitro</i> methylation target, suggesting that SETD3 potentially regulates not only actin cytoskeleton dynamics but also dynein-mediated intracellular transport.

Also flagged:Biliary Tract CancersCCgall bladder cancertumorstumormetastatic disease
Journal Article 2025-10-20 No Snippets Olson CR, Aitken GL, Spinrad MW, Glazer ES.
Show Full Abstract

Cholangiocarcinoma (CC) is a rare and aggressive malignancy that arises from the epithelial cells (cholangiocytes) of the biliary tree. Biliary tract cancers (BTC) include both CC and gall bladder cancer. Surgical resection is considered the only curative treatment. Recently, however, a fundamental shift in the understanding of the molecular profiles of these tumors has led to a molecular-targeted approach with improved survival rates in some patients with these tumors. In patients with local or limited regional disease, neoadjuvant therapies offer a way to downstage tumors, assess tumor biology, potentially achieve R0 resection, and potentially prevent both locoregional and distant recurrence by treating occult micrometastatic disease. Because BTC are rare and surgery is the standard of care for patients with non-metastatic disease, there is very little data evaluating neoadjuvant strategies in resectable disease. Immunotherapies and molecularly targeted agents originally developed for advanced disease in the adjuvant or palliative settings are now being considered for neoadjuvant use. This review aims to summarize the data and provide a rationale for the role of neoadjuvant treatment in patients with resectable BTC. While there is no high-level evidence, studies show that neoadjuvant therapy that incorporates targeted treatments and immunotherapies under multidisciplinary oversight benefits select patients and is a valuable tool in the treatment of BTC. We favor molecular testing to guide neoadjuvant therapy for patients with BTC, when feasible, to prevent unnecessary operations and minimize the risk of recurrence or metastasis.

DNAH10
Also flagged:G protein-coupled receptortissue developmenthormonesecretionlipidmetabolism
Journal Article 2025-10-20 ✓ 1 Snippet Liu W, Ma S, Lu Q, Tang S, Mamat N, Wang Y, Hong W, Hu X, Wu C, Fu X.
In-Text Gene Mentions

…( DNAH9 andDNAH10) were enriched…

Show Full Abstract

Reproductive and growth traits are key economic traits in sheep. This study aims to identify key single nucleotide polymorphisms (SNPs) and candidate genes associated with reproductive and growth traits in Tianmu polytocous sheep through a genome-wide association study (GWAS). The findings are expected to provide both a theoretical foundation for molecular breeding in this breed and novel insights into the genetic basis of ovine reproductive and growth performance. This study took 483 adult Tianmu polytocous ewes as the research subjects, collected their lambing records, measured their phenotypic values of growth traits (3 weight and 11 body size traits), and collected their blood samples for whole-genome resequencing to identify SNPs in the Tianmu polytocous sheep genome. The results identified a total of 9,499,019 (3× coverage) and 27,413,216 (30× coverage) high-quality SNPs in the Tianmu polytocous sheep genome. Subsequently, the association analysis between SNPs and reproductive and growth traits was conducted using a mixed linear model. A total of 92, 66, 18, 28, 6, 42, 3, 3, 6, 1, 12, 3, 22, 8, 6, and 3 SNPs were found associated with litter size at first parity, litter size at second parity, litter size at third parity, litter size at fourth parity, birth weight, weaning weight, body height, withers height, body length, head length, head width, cannon bone circumference, forelimb height, chest girth, chest depth, and withers width, respectively. Further, based on SNP annotation, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis, candidate genes associated with the reproductive and growth traits were identified. Among these genes, 11 <i>LOC</i>, <i>DEPTOR</i>, <i>GNG12</i>, <i>GRM7</i>, <i>PTH</i>, <i>PTH2R</i>, <i>WWOX</i>, <i>INHA</i>, and <i>NRG3</i> are candidate genes associated with litter size at first parity or litter size at third parity. These genes are involved in the G protein-coupled receptor signaling pathway, G protein-coupled receptor activity, ovarian tissue development, and hormone secretion. Additionally, <i>TFRC</i> and <i>NTN1</i> are candidate genes associated with birth weight, while five <i>UGT1A</i> and <i>CASR</i> are candidate genes associated with weaning weight. These candidate genes are primarily involved in lipid metabolism. Finally, the following genes were identified as candidates associated with specific traits: <i>DLG2</i>, <i>TMEM126A</i>, and <i>TMEM126B</i> with body height; <i>DSCAM</i> and <i>SCN8A</i> with body length; <i>BARX1</i> with cannon bone circumference; four <i>LOC</i> genes with forelimb height; <i>EPHA4</i> with chest depth; and <i>MRS2</i> with withers width.

Also flagged:Peptidegene expressionDORcAMP-dependent protein kinasescircadian rhythmsβ-casomorphin-10
Journal Article 2025-10-20 No Snippets Fukunaga M, Watanabe S, Orihara K, Yamamoto N.
Show Full Abstract

<b>Background:</b> β-casomorphin-10 (CM-10), a peptide fragment derived from milk casein with the sequence YPFPGPIPNS, has demonstrated notable anxiolytic activity in BALB/c mice. Yet, its cellular responses and mechanistic pathways remain largely uncharacterized. <b>Methods:</b> We performed RNA-seq analysis to profile gene expression changes in δ-opioid receptor-expressing HEK293 cells (DOR-HEK), comparing CM-10-treated and untreated conditions. <b>Results:</b> CM-10 exposure led to differential expression of 1714 genes in DOR-HEK cells, with 34 upregulated (>1.4-fold) (1.9%) and 1680 downregulated (<0.71-fold) (98.1%), based on a predicted <i>p</i>-value threshold of <0.05. Notably, we identified 10 clusters that were associated with reduced cyclic AMP (cAMP) in DOR-HEK cells following CM-10 treatment. These clusters particularly involved genes related to regulatory subunits of cAMP-dependent protein kinases, such as <i>PRKAR2A</i>, cAMP-responsive element-binding pathway, circadian rhythms, such as <i>CLOCK</i>, <i>ARNT1</i>, <i>CRY2</i>, <i>PER1</i>, and <i>PER2</i>, and anxiety and depression, such as <i>NOTCH1</i>, <i>NOTCH2</i> and <i>ANK2</i>. A network with these selected genes was confirmed by STRING analysis. <b>Conclusions:</b> These findings indicate that CM-10 may activate DOR-mediated signaling by suppressing cAMP levels, implicating a distinct molecular cascade in HEK293 cells.

HTT
Also flagged:glycogen synthase kinase-3 betaGSK3βserine/threonine kinaseautophagyneurodegenerative diseasesALS
Journal Article 2025-10-20 ✓ 1 Snippet Alhassan HH, Janiyani K, Surti M, Adnan M, Patel M.
In-Text Gene Mentions

…repeat within theHTTgene.…

Show Full Abstract

Glycogen Synthase Kinase-3 Beta (GSK3β), a multifunctional serine/threonine kinase, plays a central role in cellular signaling pathways and autophagy regulation, processes critical to neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease and Amyotrophic Lateral Sclerosis (ALS). Dysregulation of autophagy leads to the toxic accumulation of misfolded proteins and damaged organelles, contributing to neuronal loss in these disorders. This review explores the mechanistic interplay between GSK3β and autophagy, highlighting its modulation through key pathways, including mTOR, AMPK and Bcl-2 and its direct impact on autophagy-related proteins such as Beclin-1 and LC3. This review systematically discusses the disease-specific roles of GSK3β in autophagy dysregulation and protein aggregation, providing evidence from recent studies on neurodegenerative models. Additionally, therapeutic approaches targeting GSK3β are evaluated, including preclinical and clinical trials of GSK3β inhibitors and combination therapies with autophagy modulators, emphasizing their potential for improving neuroprotection and cellular homeostasis. Despite its promise, challenges such as off-target effects and pathway complexity remain significant. This review highlights the importance of GSK3β as both a therapeutic target and a biomarker, offering avenues for future research into selective GSK3β modulators that enhance autophagy and mitigate ND progression.

RC3H1
Also flagged:AntibodyimmunoglobulinB-cell differentiationcytokineantigen presentationimmune responses
Journal Article 2025-10-20 ✓ 1 Snippet Almada L, Gazzoni YN, Beccaria CG, Fiocca Vernengo F, Boccardo S, Gorosito Serrán M, Trivedi A, Vinuesa CG, Robson SC, Acosta Rodríguez EV, Gaya M, Montes CL, Gruppi A.
In-Text Gene Mentions

…family member, roquin (Rc3h1), which produces a…

Show Full Abstract

CD39 is an ectoenzyme in immune cells that regulates purinergic signaling by converting extracellular ATP into adenosine (ADO). Although first described on EBV-transformed B cells, CD39's role in humoral immunity remains unclear. Using murine infection models and human samples, we confirm and extend previous findings showing that high CD39 expression identifies antibody-secreting cells (ASC) across differentiation stages, including ASC derived from memory B cells, and in various tissues, regardless of the infection phase. CD39 was resistant to enzymatic digestion, facilitating ASC identification in processed tissues. We found that while CD39 was not essential for B-cell differentiation into ASC, it remained functionally active as an ectoenzyme. ASC as well as germinal center (GC) B cells expressed ADO receptors, making them responsive to ADO signaling. Consistently, systemic ADO administration impaired GC reactions without altering the ASC number in infected mice. However, <i>in vitro</i>, ADO reduces antibody production both in ASC and in B cells undergoing differentiation and also impairs the differentiation of activated B cells. Finally, B cell-specific CD39 deficiency increased GC B-cell frequencies in infected mice, likely due to reduced ADO levels. These findings highlight the relevance of the purinergic pathway in B-cell biology.

DNAH10
Also flagged:organellesNRG1methylationtumorcolorectal cancerdeoxycytidine
Journal Article 2025-10-20 ✓ 1 Snippet Cheng J, Chen N, Yin Q, Zheng Z, Chen X, Zhu X, Wan Y, Wang N, Luo S, Zhang C, Liu G, Chen W, Luo R.
In-Text Gene Mentions

…were AHNAK2 andDNAH10, accounting for 28%…

Show Full Abstract

<h4>Background</h4>The dysfunction of membraneless organelles (MLOs) has been implicated in tumorigenesis and progression by aberrant liquid-liquid phase separation (LLPS). However, the role of MLOs in the prognosis and tumor immune microenvironment (TIME) of colorectal cancer (CRC) remains unclear.<h4>Method</h4>We integrated transcriptomic data of MLO-related genes to identify distinct CRC subtypes and constructed a prognostic risk score termed MPRS. Then, we systematically demonstrated the characteristics of MPRS based on multi-omics analyses. We further assessed NRG1's LLPS possibility, prognostic significance, and its correlation with methylation through comprehensive analysis and <i>in vitro</i> experiment.<h4>Results</h4>A prognostic signature called MPRS associated with prognosis, tumor ecotypes, genomic alterations, TIME patterns, immunotherapy responses, chemotherapy sensitivity in CRC patients. NRG1, identified as the most important MPRS gene with high predicted LLPS propensity-was significantly downregulated in CRC tissues and correlated with prognosis. Promoter methylation was found to be a crucial mechanism underlying NRG1 downregulation, which could be rescued by 5-Aza-2-deoxycytidine (Aza) treatment. The qRT-PCR, IHC and Aza treatment were utilized for <i>in vitro</i> validation.<h4>Conclusion</h4>Our integrated multi-omics analysis constructed the MPRS model to delineate CRC tumor ecology and identified NRG1 as a methylation biomarker with predicted phase-separation propensity, with potential therapeutic implications that warrant prospective validation.

Also flagged:iron deficiencycancerIronmetabolismoxygentumor
Journal Article 2025-10-20 No Snippets Lin L, Yin X, Guan Y.
Show Full Abstract

Iron is a vital micronutrient in many biological functions, including DNA metabolism, oxygen transport, and cellular energy generation. In this context, it is intimately linked to cancer biology. However, although many studies have comprehensively investigated and reviewed the effects of excess iron on tumor initiation and progression, the potential interrelations of iron deficiency with tumors have been largely neglected and need to be better defined. Recent studies have highlighted the complex relationship between iron deficiency and tumor biology. Iron deficiency in specific tumor types can promote tumor progression through activation of hypoxic responses, metabolic reprogramming, and suppression of the immune response, as well as inhibit tumor growth by limiting tumor cell proliferation, among other mechanisms. This review aims to systematically explore the dual mechanisms of iron deficiency in tumors, its specific effects in different tumor types, its impact on tumor metabolism, immune responses, and therapy, and its prospects as a potential therapeutic target. Furthermore, the potential of iron metabolism markers in tumor diagnosis and prognosis is discussed. By synthesizing existing evidence, this paper comprehensively explains how iron deficiency affects tumorigenesis and identifies future research and clinical practice directions.

Also flagged:curcuminwound healingchitosanpolyethylene glycolendothelial cell migrationangiogenesis
Journal Article 2025-10-20 No Snippets Li S, Li Y, Chen Y, Guo J, Zou Q, Ding Q.
Show Full Abstract

Wounds, a major complication in orthopedic-related diseases, present significant challenges for orthopedic surgeons due to impaired healing driven by vascular dysfunction, oxidative stress, and chronic inflammation. This study introduces an injectable, self-healing, pH-responsive hydrogel system delivering curcumin-preconditioned mesenchymal stem cell (MSC)-derived exosomes (Cur-Exos) to enhance diabetic wound repair, offering a cell-free therapeutic strategy with applications in orthopedic regenerative medicine. The hydrogel, formed through dynamic cross-linking of amphoteric chitosan and multi-armed polyethylene glycol, exhibits antibacterial properties and degrades selectively in the acidic microenvironment (pH 4.5-6.5) of diabetic wounds. Loaded with Cur-Exos, it enables controlled release of bioactive molecules, leveraging the enhanced antioxidant, anti-inflammatory, and pro-angiogenic properties of exosomes from curcumin-preconditioned MSCs. <i>In vitro</i>, Cur-Exo@Gel exhibited excellent biocompatibility, promoted endothelial cell migration, and enhanced angiogenesis, while reducing oxidative stress. It also modulated macrophage polarization by decreasing pro-inflammatory M1 markers (iNOS) via the upregulation of Iκβ-α and reduced p65 phosphorylation, fostering an anti-inflammatory microenvironment. The hydrogel's inherent antibacterial properties (>50% reduction in <i>Escherichia coli</i> and <i>Staphylococcus aureus</i>, <i>p</i> < 0.05) further mitigate infection risks that are critical in orthopedic wounds. <i>In vivo</i>, in a diabetic rat full-thickness skin defect model, Cur-Exo@Gel significantly reduced wound areas, with enhanced epithelial migration and collagen deposition. These findings highlight Cur-Exo@Gel as a promising cell-free therapeutic strategy for accelerating chronic orthopedic wound repair, offering novel insights for regenerative orthopedics.

Also flagged:Cas9RAD52Nup93biotinrecombinaseFlp
Journal Article 2025-10-20 No Snippets Skryabin BV, Braun DA, Kaiser H, Gubar L, Seeger B, Khanam T, Stegemann A, Pavenstädt H, Rozhdestvensky TS.
Show Full Abstract

CRISPR-Cas9-mediated genome editing is a powerful method for generating animal disease models, but efficiency of homology-directed repair (HDR) remains a major challenge. To generate conditional knockout (cKO) mouse model of <i>Nup93</i>, we tested strategies to improve HDR precision by injecting CRISPR-Cas9 components into over 2,000 zygotes, producing 270 founders. Our experiments revealed several critical factors. Denaturation of long 5'-monophosphorylated double-stranded DNA (dsDNA) templates enhanced precise editing and reduced unwanted template multiplications. Supplementation with RAD52 increased single-stranded DNA (ssDNA) integration nearly 4 fold, though accompanied by a higher template multiplication. Targeting the antisense strand with two CRISPR RNAs (crRNAs) improved HDR precision compared to other strategies. Importantly, modifying donor DNA 5' ends substantially boosted efficiency: 5'-biotin increased single-copy integration up to 8 fold, while 5'-C3 spacer modification produced up to a 20-fold rise in correctly edited mice, regardless of donor strandness. These findings identify practical approaches to enhance HDR efficiency and precision in CRISPR-Cas9-mediated knock-in model generation.

medRxiv 2025-10-20 Preprint (No Snippets API) Schipper M, Shadrin AA, Romero C, Friligkou E, Polimanti R, Posthuma D, Van Someren EJ, Tissink E.
Show Full Abstract

Insomnia (INS), major depression (DEP) and anxiety disorders (ANX) frequently co-occur and share a substantial proportion of their genetic risk. Most genetic studies have focused on shared risk between DEP and ANX, often omitting INS. Other studies that include INS have been limited to genome-wide correlations or overlap. Identifying the specific genetic factors that influence these three conditions could offer a route to identify therapeutic targets with potential transdiagnostic benefits. Realizing this potential requires pinpointing the likely causal variants and genes that are shared, estimating how pleiotropic effects are mediated, as well as identifying the biological processes they affect. Here we conduct a multi-level trivariate genetic analysis of INS, DEP and ANX using genome-wide association studies (GWAS) of more than one million individuals from multiple ancestries. We show that 55% of the genetic signal is shared across all three conditions. Supporting its importance, INS shares a significant fraction of the genetic overlap (75%) and correlation (7%) between DEP and ANX. We identify 195 genomic loci with shared signal for at least two conditions, many of which are likely arising from the same causal variant (at least 50%) or effector gene (60-80%). Pairwise mediation analyses suggest that these shared likely causal variants are more consistent with models of vertical pleiotropy where DEP and INS are risk factors towards ANX, rather than with models of horizontal pleiotropy. We find convergence of shared effector genes on biological processes in inhibitory synaptic transmission, neuronal organization, and axonal development. These results reveal an interconnected but mechanistically diverse basis for shared genetic risk across INS, DEP and ANX, and offer potential candidates for future pathway-tailored therapeutic targets with transdiagnostic benefits.

bioRxiv 2025-10-20 Preprint (No Snippets API) Klasen L, Mork M, Nasehi R, Krishnamurthy VT, Zeevaert K, Babendreyer A, Di Russo J, Wagner W, De Laporte L.
Show Full Abstract

Organoid research holds tremendous potential for personalized medicine and drug development. However, current limitations include reproducibility issues largely due to the use of biologically derived materials, which are prone to batch-to-batch variations. Here, we report a new technology for human induced pluripotent stem cell (iPSC)-based organoid production with iPSC expansion and differentiation in the same construct in a reproducible and scalable manner, compatible with high-throughput automation. Chemically defined poly(ethylene glycol) (PEG)-based microgels are produced via parallelized step-emulsification microfluidics, enabling scalable production. This approach leverages the self-organization of iPSCs with microgels to build three-dimensional constructs, driven by robust cell-material interactions achieved through vitronectin-coated PEG microgels. This technology allows the iPSCs to expand and retain their pluripotency, after which they can be differentiated into the three germ layers, providing a suitable platform for organoid differentiation. This was further extended by differentiation into cardiac organoids and retinal photoreceptors to demonstrate two exemplary tissues.

DNAJC1
Also flagged:pathogenesishypertensionnucleusOsmrkidney diseaseretinopathy
Journal Article 2025-10-19 ✓ 1 Snippet Zhang S, Dai T, Zhao B, Wang X, Wang L, Tong L, Zeng Q, He Q, Zhang H, Du D.
In-Text Gene Mentions

…CircRNA Atrnl1, circRNADnajc1, and circRNA Rit2…

Show Full Abstract

<h4>Background</h4>The rostral ventrolateral medulla (RVLM) is a critical vasomotor center that plays a pivotal role in the pathogenesis of hypertension. However, the involvement of circular RNAs (circRNAs) in this nucleus in blood pressure (BP) regulation remains incompletely understood.<h4>Methods</h4>In this study, we investigated functional circRNAs in the RVLM associated with hypertension and elucidated their underlying mechanisms using multiple experimental approaches, including RNA sequencing (RNA-seq), primary cell culture, and intra-RVLM microinjection.<h4>Results</h4>Our results revealed a significantly elevated level of the highly conserved circCdh7 in the RVLM of spontaneously hypertensive rats (SHRs). Downregulation of circCdh7 in the RVLM reduced neuronal excitability, sympathetic outflow, and BP in SHRs. Mechanistically, circCdh7 functioned as a sponge for miR-346. miR-346 knockdown largely abolished the inhibitory effects of circCdh7 suppression on RVLM astrogliosis and neuroinflammation. Furthermore, miR-346 was found to target Osmr. Overexpression of miR-346 attenuated RVLM astrogliosis and neuroinflammation, but these beneficial effects were abolished by Osmr overexpression.<h4>Conclusions</h4>Collectively, our findings demonstrate that elevated circCdh7 expression in the RVLM drives hypertension progression, with the circCdh7/miR-346/Osmr axis serving as a key regulatory mechanism. Targeting circCdh7 may represent a promising therapeutic strategy for hypertension.

Also flagged:RKIPtumorRaf-1 Kinase Inhibitor Proteincytokinetype I interferonantigen presentation
Journal Article 2025-10-19 No Snippets Skouradaki E, Eptaminitaki GC, Kirio E, Zaravinos A, Dovrolis N, Baritaki S.
Show Full Abstract

Raf-1 Kinase Inhibitor Protein (RKIP) is a well-known metastasis suppressor that regulates key oncogenic signaling pathways. Emerging evidence also points to a dual role for RKIP as an immunomodulatory molecule, influencing the tumor immune microenvironment, a complex niche that promotes immune evasion and overall tumor progression. This review explores RKIP's impact on immune surveillance via its interactions with signaling pathways and cellular components of the tumor microenvironment, as well as its role in recruiting and polarizing immune cells with different dynamics in reshaping an immunocompetent milieu. We further discuss how RKIP downregulation promotes immune evasion, alters cytokine profiles, and reduces effector immune cell infiltration. Current studies suggest that RKIP supports type I interferon signaling and antigen presentation, while its loss contributes to an immunosuppressive, pro-metastatic environment. Therefore, by regulating the expression of RKIP in the pathways that control TME architecture, the TME can be reprogramed towards an immunoprotected milieu. Altogether, this review underscores RKIP's role in tumor immunity, offering new perspectives for therapeutic strategies aimed at overcoming cancer immune evasion and improving immunotherapy efficacy.

RC3H1
Also flagged:ZC3H12ARNA-binding proteinribonucleasetumorstumorangiogenesis
Journal Article 2025-10-19 ✓ 2 Snippets Lu M, Guo J, Wang C, Wan B, Ma T.
In-Text Gene Mentions

…out ZC3H12A orRoquin-1confers significant expansion…

…enhanced strategies targetingRoquin-1under clearly defined…

Show Full Abstract

ZC3H12A is a key RNA-binding protein and ribonuclease that plays a central role in negatively regulating inflammation and maintaining immune homeostasis. It does this by degrading the mRNA of multiple inflammatory mediators (such as <i>IL-6</i> and <i>IL-1β</i>), as well as through its deubiquitinating enzyme activity. Not only does it limit excessive immune activation by regulating innate and adaptive immune cells (e.g., macrophages and T cells), but it also exerts bidirectional effects in tumors, acting as an anti-tumor factor to inhibit angiogenesis and oncogenic signal pathways, while promoting tumor progression under specific conditions. In recent years, ZC3H12A has emerged as a critical target for tumor immunotherapy, particularly CAR-T cell therapy. Its knockout significantly enhances T-cell persistence and anti-tumor efficacy, demonstrating broad translational potential. Furthermore, ZC3H12A plays a crucial role in systemic metabolic-immune crosstalk and infectious diseases. This review systematically summarizes the multifunctional roles of ZC3H12A in immune regulation, tumor therapy, metabolic disorders and inflammation-related diseases, with the aim of providing new insights into its potential application in the treatment of human diseases.

Also flagged:Kinase Suppressor of Ras 1cell proliferationRASRAFMEKERK
Journal Article 2025-10-19 No Snippets Moon H, Park H, Lee S, Lee S, Ro SW.
Show Full Abstract

Carcinogenesis is driven by aberrant activation of molecular signaling pathways governing cell proliferation, apoptosis, and differentiation. Among these, the RAS/RAF/MEK/ERK (RAS/MAPK) cascade is one of the most frequently dysregulated oncogenic pathways, driving tumor initiation and progression across diverse cancer types. Although inhibitors of BRAF and MEK have achieved clinical success in selected malignancies, adaptive resistance often undermines therapeutic durability. This has spurred interest in alternative nodes within the pathway. The kinase suppressor of Ras (KSR) is a scaffold protein that organizes RAF, MEK, and ERK into functional complexes, ensuring efficient and sustained signal transmission. Once regarded as a passive structural component, KSR1 is now recognized as an active regulator of pathway dynamics. Emerging evidence indicates that KSR1 overexpression promotes cancer cell proliferation and survival, while genetic or pharmacologic inhibition of KSR1 attenuates RAS/MAPK signaling and suppresses tumor growth in preclinical models. In this review, we provide a comprehensive overview of accessory and scaffold proteins modulating the RAS/MAPK pathway, with a particular focus on KSR1. We highlight its structural and functional properties, summarize preclinical evidence for KSR1-targeted interventions, and discuss its therapeutic potential in cancer, with emphasis on hepatocellular carcinoma (HCC).

Also flagged:Stutteringspeech disorderspeech disordersDevelopmental stutteringfluency disorderbrain injury
Journal Article 2025-10-19 No Snippets Novaes Marques D.
Show Full Abstract

Stuttering, a complex and multifactorial speech disorder, has long presented an enigma regarding its etiology. While earlier approaches often emphasized psychosocial influences, historical clinical and speech-language strategies have considered multiple contributing factors. By integrating genomic, transcriptomic and phenomic evidence, the ongoing research illustrates how functional genomics can unravel the biological architecture of complex speech disorders. In particular, advances in omic technologies have unequivocally positioned genetics and underlying biological pathways at the forefront of stuttering research. I have experienced stuttering and lived with it since my early childhood. This perspective article presents findings from omic studies, highlighting relevant aspects such as gene discoveries, implicated cellular mechanisms, and the intricate genetic architecture of developmental stuttering. As a person who stutters, I offer an intimate perspective on how these scientific insights are not merely academic but profoundly impactful for the affected community. A multi-omic integration strategy, combining large-scale genetic discovery with deep phenotyping and functional validation, is advocated to accelerate understanding in this field. Additionally, a bibliometric analysis using an international database was conducted to map trends and identify directions in stuttering research within the omic context. Ultimately, these scientific endeavors hold the potential to inform not only personalized interventions but also critical policy and regulatory changes, enhancing accessibility, support, and the recognized rights of people who stutter.

HFE
Also flagged:Cystic FibrosisCFsignal transductionrecessiveCFTRchymotrypsin C
Journal Article 2025-10-19 ✓ 1 Snippet Ward A, Mauleon R, Ooi CY, Rosic N.
In-Text Gene Mentions

…, EDNRA ,HFE, LTA ,…

Show Full Abstract

<h4>Background</h4>Cystic fibrosis (CF) is the most common life-shortening monogenic autosomal recessive disease in Caucasians with diverse and extensive comorbidities. Where the majority of studies have focused on the respiratory and digestive systems, there has been a paucity of research focusing on pain, even though people living with CF have reported a high prevalence and increased severity of pain. Many studies have identified the complex relationship between genotype and phenotype, and growing evidence suggests that the phenotypic variation observed not only depends on the variations in the CF transmembrane conductance regulator (<i>CFTR</i>) gene but also on modifier genes. Gene modifiers (GMs) have been reported to affect many organs or systems in CF. However, there have been no studies on how GMs may influence pain. Therefore, this study is aimed at highlighting potential modifier genes that may affect pain perception in CF and possible responses to therapeutics.<h4>Methods</h4>The bioinformatics workflow adopted includes database and literature mining, pathway enrichment analysis, protein-protein interactions evaluation and drug-gene network investigation.<h4>Results</h4>We identified seven potential pain modifiers in CF, including chymotrypsin C (<i>CTRC</i>), serine protease inhibitor Kazal-Type 1 (<i>SPINK1</i>), tumour necrosis factor (<i>TNF</i>), ATP-binding cassette subfamily B Member 1 (<i>ABCB1</i>), protease serine 1 (<i>PRSS1</i>) and transforming growth factor beta 1 (<i>TGFB1</i>) interacting with the <i>CFTR</i> gene. The analysis of the biochemical pathways indicates that signal transduction and the immune system are likely to be involved in pain processes. The specific GMs, <i>TNF</i> and <i>ABCB1</i>, are found to be within the central hub genes, indicating their potential influence on the pain pathways in CF.<h4>Conclusions</h4>This in silico analysis highlights potential genes and biochemical pathways implicated in pain pathways that could significantly impact pain perception in people living with CF and their response to prescribed therapies. Further functional analyses are needed to include CF participants and provide a physiological relevance on how genetic polymorphisms of identified GMs may impact their pain phenotype or profile.

PRDX6
Also flagged:phosphorylationsystemic lupus erythematosusSLEpathogenesisGene Expressionskin lesions
Journal Article 2025-10-19 ✓ 2 Snippets Wang S, Hu H, Chen J, Li C.
In-Text Gene Mentions

…the OXPHOS-regulating genePRDX6leads to enhanced…

…individual genes (e.g.,PRDX6), lacking systematic multi-om…

Show Full Abstract

<h4>Objective</h4>Oxidative phosphorylation (OXPHOS) dysfunction is increasingly recognized as a key factor in systemic lupus erythematosus (SLE) pathogenesis. This study aimed to identify OXPHOS-related core genes as potential SLE biomarkers and therapeutic targets.<h4>Methods</h4>mRNA sequencing and GSEA were performed on MRL/lpr mouse kidneys. Cross-species differentially expressed genes (DEGs) were identified by integrating mouse data with human SLE kidney datasets from the Gene Expression Omnibus (GEO). Overlapping DEGs with OXPHOS-related genes from GeneCards, a protein-protein interaction (PPI) network was constructed to screen core genes, followed by GO and KEGG enrichment analyses. Gene expression was validated in SLE whole blood, skin lesions, and immune cell subsets using independent GEO datasets. Diagnostic value was assessed by receiver operating characteristic (ROC) analysis; correlation with disease activity was evaluated using the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI). Drug-target interactions were analyzed via DrugBank and STRING. Key genes were validated by qPCR in MRL/lpr kidneys.<h4>Results</h4>The OXPHOS pathway was significantly downregulated in MRL/lpr kidneys. Ten consistently upregulated core genes-CCNA2, KIF11, CDC20, TOP2A, TPX2, AURKB, DLGAP5, FOXM1, MKI67, and CEP55-were identified and enriched in cell cycle regulation and cellular senescence. All ten were upregulated in SLE blood; seven in skin lesions. They were broadly overexpressed in immune cells, especially plasmablasts and CD4<sup>+</sup> T cells. CDC20, DLGAP5, and CEP55 showed high diagnostic accuracy (AUC >0.8). CCNA2 (r = 0.50) and CDC20 (r = 0.56) correlated significantly with SLEDAI. Six genes interacted with known SLE drug targets. Integrating expression and interaction profiles, CCNA2, AURKB, FOXM1, and MKI67 were prioritized as top therapeutic candidates. Quantitative real-time polymerase chain reaction (qPCR) confirmed CCNA2 and FOXM1 upregulation in MRL/lpr kidneys.<h4>Conclusion</h4>This study identifies a systemic OXPHOS-related gene signature in SLE, highlighting promising candidates for diagnosis and targeted therapy.

DCC
Also flagged:methylationKallmann syndromeKSSpermatogenesis-relatedgonadotropin-releasing hormoneGnRH
Journal Article 2025-10-18 ✓ 2 Snippets Wang R, Li X, Zhang J, Wang X, Mao J, Feng X, Wang S, Li Y, Wu X, Guo Y.
In-Text Gene Mentions

…including CHD7 ,DCC, IL17RD, NELFA…

…– CHD7 ,DCC, IL17RD ,…

Show Full Abstract

<h4>Objective</h4>This study aims to comprehensively characterize the DNA methylation profile in the sperm of patients with Kallmann syndrome (KS), providing new insights into the potential epigenetic mechanisms contributing to the pathogenesis of the disease.<h4>Methods</h4>Sperm samples from patients with KS and healthy controls (HCs) were analyzed for DNA methylation patterns. Differentially methylated regions (DMRs) were identified, and the associated genes underwent enrichment analysis. Spermatogenesis-related genes were screened, analyzed for functional enrichment, and key genes were identified using the STRING database and CytoHubba. Their correlations with semen parameters were then evaluated.<h4>Results</h4>This study analyzed six patients with KS and six age-matched HCs, revealing higher DNA methylation in patients with KS. 4,749 DMRs were identified (4,020 hypermethylated, 729 hypomethylated) affecting genes linked to neuronal function, migration, and gonadotropin-releasing hormone (GnRH) secretion. DMRs were also observed in key KS-related genes, including CHD7, DCC, IL17RD, NELFA, and SEMA3E. Moreover, 1,938 spermatogenesis-related genes were identified within the gene body, with significant enrichment in chromosome remodeling pathways. Notably, core spermatogenesis genes such as BRCA1, H3FC3, and HSP90AA1 exhibited significant correlations with semen parameters.<h4>Conclusion</h4>This study identified DNA methylation changes in patients with KS after gonadotropin or pulsatile GnRH therapy, reflecting downstream epigenetic consequences of congenital gonadotropin deficiency and its treatment. These alterations are associated with persistent spermatogenic abnormalities, providing a foundation for future studies on epigenetic biomarkers and potential interventions.

SERPINC1
Also flagged:Antithrombin IIINafamostatHeparinclottingcitratenafamostat mesylate
Journal Article 2025-10-18 ✓ 3 Snippets Ide K, Tokuda Y, Morota J, Nashiki E, Nishi K, Miyaji M, Shibata M, Matsumoto S.
In-Text Gene Mentions

…low antithrombin III (ATIII) activity before CKRT…

…patients with anATIIIactivity of ≥59%…

…eparin.<h4>Conclusions</h4>LowATIIIactivity, NM monotherapy…

Show Full Abstract

<h4>Introduction</h4>Premature circuit clotting remains a major limitation of pediatric continuous kidney replacement therapy (CKRT). While anticoagulation with heparin or citrate has been well studied, the risk factors for circuit failure under nafamostat mesylate (NM) use have not been well characterized.<h4>Methods</h4>This retrospective cohort study included pediatric patients aged <16 years who underwent CKRT in a single tertiary care center in Japan. Circuits that were discontinued within 48 h due to clotting were defined as those with a shorter circuit lifespan. Patient demographics, laboratory parameters, and CKRT settings were compared between the circuits with short and long lifespans. Univariate and multivariate logistic regression analyses were performed to identify independent risk factors for a short circuit lifespan, and Kaplan-Meier analysis was employed to assess circuit survival over time.<h4>Results</h4>After excluding circuits associated with extracorporeal membrane oxygenation or elective discontinuation within 48 h, the final analysis comprised 162 CKRT circuits, including 52 circuits (32%) with a short lifespan. By multivariate analysis, low antithrombin III (ATIII) activity before CKRT initiation (odds ratio [OR] 0.97, 95% confidence interval [CI]: 0.95-0.99), NM monotherapy without heparin (OR 0.23, 95% CI: 0.059-0.88), and small filter size (OR: 0.23, 95% CI: 0.077-0.67) were independently associated with a short circuit lifespan. By Kaplan-Meier analysis, circuit survival was significantly longer in patients with an ATIII activity of ≥59% and in those treated with heparin.<h4>Conclusions</h4>Low ATIII activity, NM monotherapy without heparin, and small filter size were independent risk factors for a shorter circuit lifespan in pediatric CKRT.

Also flagged:peptidescoatomer proteinCOPB2protein kinase Cεlipid-activated novel protein kinase CType 2 Diabetes Mellitus
Journal Article 2025-10-18 No Snippets Olushola-Siedoks AA, Small L, Fincham KJ, Wai DCC, Monteiro D, Conway JRW, Cadell A, Parker BJ, Croucher DR, Schmitz-Peiffer C, Norton RS.
Show Full Abstract

The lipid-activated novel protein kinase C isoform, PKCε, plays a key role in the progression of Type 2 Diabetes Mellitus (T2DM) and has also been implicated in cancer, cardiac hypertrophy, pain and anxiety. As the spatial regulation of PKCε activity is linked to its interaction with the Receptor for Activated C Kinase 2 (RACK2, also known as COPB2), blockade of this interaction has potential therapeutic benefits for the treatment of several pathologies. Using a proximity-based chemiluminescent assay to monitor the binding of lipid-activated PKCε to RACK2, we discovered inhibitory peptides derived from the PKCε sequence; pentapeptides with a KxKxx motif and a C-terminal carboxylate potently inhibited this interaction, whereas other short sequences containing cationic residues were less effective. An alanine scan of the KIKIC peptide showed that the two Lys residues and C-terminal carboxylate were the most important for inhibitory activity. A previously described PKCε translocation inhibitory peptide from PKCε, εV1-2, exhibited much weaker inhibition of the PKCe-RACK2 interaction, with significant inhibitory activity observed only when it was conjugated to cell-penetrating peptides. KIKIC exhibited moderate cell-penetrating ability, showed no evidence of cytotoxicity, and modified PKCε translocation in response to lipid treatment. Several proteins that were captured in a RACK2 pulldown of a liver lysate in a KIKIC-peptide sensitive manner were identified as part of a PKCε-RACK2 complex isolated from intact cells. These results provide a basis for the rational design of peptides or peptidomimetics that inhibit the PKCε-RACK2 interaction and have potential for the prevention and/or treatment of T2DM.

SERPINC1
Also flagged:RetinoidAutismAutism spectrum disordercognitive impairmentsneurodevelopmental disordersneurological disorders
Journal Article 2025-10-18 ✓ 3 Snippets Xia X, Zhou X, Ma Z, Liu L, Wang Y, Wu Y, Zhang Y, Wang J.
In-Text Gene Mentions

…D-binding protein (GC),antithrombin-III(SERPINC1), retinol-binding pr…

…rotein (GC), antithrombin-III(SERPINC1), retinol-binding protein 4…

…APOA2, PZP, MEPE,SERPINC1, and GC showed…

Show Full Abstract

Autism spectrum disorder (ASD) is a group of neurodevelopmental dysfunctions characterized by a heterogeneous etiology that involves gene-environment interactions. Early postnatal lead (Pb) exposure has been found to be associated with the etiology of ASD, but the mechanisms remain unclear. The present study aims to investigate the effects of early Pb exposure on the emergence of ASD-like behaviors in offspring and to evaluate its potential relationship with morphological changes and underlying mechanisms in the cerebellum. The study established a mouse model to study early postnatal Pb exposure and examined ASD-like behaviors through the open field test, novel object recognition test, marble burying test, and three-chamber social test. Quantification of Pb levels was performed in cerebellar tissue, examination of Purkinje cell morphology was carried out, and identification of differential protein expression was conducted using TMT-based quantitative proteomics. The study revealed that the offspring of Pb-exposed mice showed significant social deficits, increased repetitive behaviors, and cognitive impairments. The cerebellum showed both elevated Pb levels and a reduction in Purkinje cells. Proteomic analysis identified 45 proteins that were differentially expressed, showing disruption in the retinoid signaling pathway. These findings demonstrate that early postnatal Pb exposure leads to ASD traits and that retinoid signaling may be a key pathway in the cerebellum, at least in part.

CDK5RAP1
Also flagged:Myogenesisadenineisopentenyladeninenucleotideribosideisopentenyladenosine
Journal Article 2025-10-18 ✓ 2 Snippets Kabiri F, Azimychetabi Z, Seneviratne D, Phan LN, Kavanagh HM, Smith HC, Emery RJN, Brunetti CR, Yee J, Tobin SW.
In-Text Gene Mentions

…or 2-methylthio modifications,Cdk5rap1, impairs mitochondrial protei…

…LikeCdk5rap1, mutations or deficiency…

Show Full Abstract

Myogenesis is a tightly regulated process essential for embryonic development, postnatal growth, and muscle regeneration. We recently identified that cytokinins (CTKs), a class of adenine-derived signaling molecules originally characterized in plants, are present in cultured skeletal muscle cells. The most abundant type of cytokinins detected within cultured muscle cells was isopentenyladenine (iP) in its nucleotide, riboside, and free base derivatives. The purpose of this study was to determine whether CTKs are also present in regenerating muscle tissue in vivo and to characterize the effects of iP and its riboside form, isopentenyladenosine (iPR), on muscle cell proliferation and differentiation. These effects were observed relative to adenine and adenosine, and to a second class of cytokinins with a large aromatic side chain, kinetin (the free base), and kinetin riboside. Cardiotoxin was used to induce muscle injury and repair processes in the gastrocnemius of 3- and 12-month-old mice. Samples were collected 3- and 7 days post-injury for ultra high-performance liquid chromatography tandem mass spectrometry with electrospray ionization (UHPLC-(ESI+)-HRMS/MS). Four CTKs (N<sup>6</sup>-benzyladenine (BA), dihydrozeatin-9-N-glucoside (DZ9G), isopentenyladenosine (iPR), and 2-methylthio-isopentenyladenosine (2-MeSiPR) were detected. 2-MeSiPR levels were significantly influenced by aging, as this CTK was increased in response to injury only in the younger mice. Treatment of C2C12 myoblasts with 10 µM of isopentenyladenosine (iPR) or kinetin riboside reduced cell proliferation, whereas iP (the free base) increased proliferation in a biphasic response. During differentiation, both iPR and kinetin riboside impaired myotube formation, while the free-base forms of iP and kinetin had no effect. Our data establishes that CTKs are present within muscle tissue and highly responsive to injury and aging. Furthermore, the biological activities of CTKs in muscle cells are influenced by structural modifications, including riboside conjugation and side chain composition. Understanding these differences provides insight into the distinct roles of CTKs in muscle cell metabolism and differentiation, offering potential implications for the use of exogenous CTKs in muscle biology and regenerative medicine.

HFE
Also flagged:transthyretincardiac amyloidosisATTRAmyloidosisCarpal tunnel syndromeCA
Journal Article 2025-10-18 ✓ 1 Snippet Deux JF, Brugières P, Kharoubi M, Zaroui A, Oghina S, Damy T, Cosson R.
In-Text Gene Mentions

…been demonstrated inhemochromatosis, where cardiac and…

Show Full Abstract

<b>Background/Objectives:</b> Carpal tunnel syndrome (CTS) may signal extracardiac amyloid deposition years before transthyretin cardiac amyloidosis (ATTR-CA). This study investigated potential alterations of wrist tissue T1 values in ATTR-CA patients. <b>Methods:</b> Patients with ATTR-CA and healthy volunteers underwent 1.5T wrist MRI using a gradient echo sequence. Manual contouring of the transverse carpal ligament (TCL), median nerve (MN), sheaths of the flexor carpi tendons (SFCT), subcutaneous fat (SCF), muscle of the thenar eminence (MTE), and global wrist (GCW) was performed by two readers. Native T1 values were compared between groups. <b>Results:</b> Thirty-six patients with ATTR-CA (mean age, 78 ± 9 years; 32 men) and 69 volunteers (43 ± 14 years; 24 men) were evaluated. Mean native T1 values of TCL, MN, SFCT, SCF, and GCW were significantly lower in patients than in volunteers (<i>p</i> < 0.005 for all). Multivariable regression adjusted for age and sex confirmed these associations. SCF T1 was significantly lower in patients with CTS symptoms (885 [762-1080] ms) than in asymptomatic patients (1041 [949-1267] ms, <i>p</i> = 0.04). The highest area under the curve (AUC) for detecting CA was obtained for SFCT (AUC = 0.85; 95% CI 0.77-0.93). <b>Conclusions:</b> Patients with transthyretin cardiac amyloidosis show a significant reduction in the native T1 of wrist tissues compared with controls. These preliminary findings suggest that wrist T1 mapping may serve as a non-invasive marker of peripheral amyloid involvement, but require further validation in larger, age-matched, histologically validated studies.

SERPINC1
Also flagged:neurodegenerative disordercognitive declineDementiaamyloid beta 40amyloid beta 42neurofilament light chain
Journal Article 2025-10-18 ✓ 1 Snippet Tiwari P, Gupta A, Kaushik M, Yadav A, Anjali A, Dwivedi R, Mudgal P, Kumar Y, Tripathi M, Dada R.
In-Text Gene Mentions

…The totalACE-IIIscore was also…

Show Full Abstract

Alzheimer's disease is a multifactorial neurodegenerative disorder marked by cognitive decline, synaptic dysfunction, and metabolic alterations. This study investigated disease-associated profiles in the Indian population using integrated clinical, metabolomic, and plasma biomarker analyses. We enrolled 25 clinically diagnosed patients (mean age: 61.20 ± 7.76 years) and 25 cognitively healthy controls (mean age: 60.56 ± 7.48 years). Cognitive and neuropsychiatric assessments included Addenbrooke's Cognitive Examination-III, Clinical Dementia Rating-Global, and Patient Health Questionnaire-9 for patients, and Montreal Cognitive Assessment, Clinical Dementia Rating-Global, and Patient Health Questionnaire-9 for controls. Plasma metabolomics was performed using liquid chromatography-mass spectrometry, and targeted ELISA quantified amyloid beta 40, amyloid beta 42, phosphorylated tau181, phosphorylated tau217, neurofilament light chain, apolipoprotein E, APOE4, 8-hydroxy-2'-deoxyguanosine, C-reactive protein, brain-derived neurotrophic factor, and glutamate. Statistical analyses included principal component analysis, volcano plots, receiver operating characteristic curves, pathway enrichment, and correlation analyses. Patients showed reduced cognition (median Addenbrooke's Cognitive Examination-III: 26). Clinical Dementia Rating-Global scores (1.44 ± 0.65 versus 0.24 ± 0.25; <i>P</i> < 0.0001) and Patient Health Questionnaire-9 scores (4.88 ± 4.21 versus 0.20 ± 0.50; <i>P</i> < 0.0001) were higher than controls. Principal component analysis revealed distinct metabolic clustering with 75 altered metabolites. Volcano analysis identified six upregulated (leucine, ascorbic acid, guanine) and 14 downregulated metabolites (valine, nicotinamide, octadecanedicarboxylic acid). Receiver operating characteristic curves highlighted octadecanedicarboxylic acid (AUC = 0.917), prolinamide (AUC = 0.908), 2-phosphoglycerate (AUC = 0.858), nicotinamide (AUC = 0.848), leucine (AUC = 0.768), and ascorbic acid (AUC = 0.748). Pathway enrichment indicated disruptions in branched-chain amino acid metabolism, nicotinamide metabolism, the tricarboxylic acid cycle, and neurotransmitter pathways. Biomarker analysis revealed elevated amyloid beta 40, amyloid beta 42/40 ratio, phosphorylated tau181, phosphorylated tau217, phosphorylated tau217/amyloid beta 42 ratio, neurofilament light chain, APOE4, C-reactive protein, and 8-hydroxy-2'-deoxyguanosine, with reduced brain-derived neurotrophic factor (all <i>P</i> < 0.05). Significant correlations included eupatilin with phosphorylated tau217 and 8-hydroxy-2'-deoxyguanosine, glyceraldehyde with brain-derived neurotrophic factor, guanine with APOE4, and valine inversely with phosphorylated tau181. This study identifies distinct metabolic (octadecanedicarboxylic acid, prolinamide, leucine, ascorbic acid) and biomarker profiles (phosphorylated tau217, 8-hydroxy-2'-deoxyguanosine, brain-derived neurotrophic factor) in Alzheimer's disease. Disrupted pathways linked to neuroinflammation and oxidative stress support the potential for integrated early detection strategies. Despite the small cross-sectional cohort, findings highlight the need for longitudinal, multi-centric validation.

Also flagged:gestationoxygendeathintraventricular hemorrhagenecrotizing enterocolitisfetal growth restriction
Journal Article 2025-10-18 No Snippets Bulsara JS, Waratkar Y, Vadhu D, Mehta P, Singh AK, Das MK.
Show Full Abstract

Background Cord clamping practices at birth vary widely. While early cord clamping (ECC) is the practice in cesarean sections (CS), post-placental separation cord clamping (PCC) is avoided due to the potential risk of maternal hemorrhage. This study aimed to document neonatal and maternal safety with PCC practice in CS delivery. Methods A prospective randomized controlled trial conducted between April and December 2022 included 211 pregnant women (PCC arm, n=102; ECC arm, n=109) with a gestation age of >34 weeks scheduled for CS delivery. In the PCC arm, the cord was clamped after placenta separation, and in the ECC arm, it was clamped after 30 seconds along with all other standard care.  The primary neonatal outcomes were the clinical outcomes with peripheral oxygen saturation (SpO<sub>2</sub>) and heart rate (HR) during the first 15 minutes of life. For the mothers, bleeding amount, postpartum hemorrhage, transfusion need, and hemoglobin change were documented. Results The neonatal parameters, including the SpO<sub>2</sub> and HR values during the first 15 minutes, were comparable between the two groups, with no additional risk of adverse clinical outcomes. Estimated maternal blood loss (402 mL (IQR 330-520 mL) vs. 350 mL (IQR 240-490 mL), p=0.05), mean hemoglobin change (0.8 gm/dL (0.3, 1.6 gm/dL) vs. 0.8 gm/dL (IQR 0.4, 1.5)) and blood transfusion need (6.8% vs. 10.0%) were comparable between the PCC and ECC groups, respectively. Conclusions Implementation of PCC during CS deliveries is feasible, potentially beneficial for term and late preterm neonates and safe for the mothers without any increased risk of bleeding.

HFE
Also flagged:ironSLC11A2divalent metal transporter 1autosomal recessive anaemiairon deficiencymalignant diseases
Journal Article 2025-10-17 ✓ 5 Snippets Brøns N, Rigas AS, Kaspersen KA, Pedersen OB, Erikstrup C, Hansen TF, Sørensen E, Dowsett J, Mikkelsen C, Christoffersen LAN, Dinh KM, Bruun MT, Aagaard B, DBDS Genetic Consortium, Frikke-Schmidt R, Bundgaard H, Ullum H, Glenthøj A, Ostrowski SR.
In-Text Gene Mentions

…CHB participants carryingHFEvariants, concurrent SLC11A2…

…potential interaction withHFEvariants C282Y and…

…Δ3 .5kb amongHFEvariant carriers…

…heterozygosity among maleHFEvariant carriers was…

…iron overload inHFEvariant carriers…

Show Full Abstract

The SLC11A2 gene encodes divalent metal transporter 1, a key mediator of cellular and intestinal iron transport. While ultra-rare pathogenic variants in SLC11A2 cause autosomal recessive anaemia with iron overload, the phenotypic consequences of structural variation in this gene remain unexplored. We investigated the impact of a recently identified structural deletion in the 3' untranslated region (SLC11A2-Δ3.5kb) using genetic, biomarker and registry data from two large Danish cohorts: the Danish Blood Donor Study and the Copenhagen Hospital Biobank (CHB). Among 4847 heterozygous carriers and 320 633 non-carriers, SLC11A2-Δ3.5kb was associated with lower ferritin levels in both sexes and increased risk of iron deficiency in women. In female donors, SLC11A2-Δ3.5kb was associated with lower haemoglobin levels, increased risk of donation deferral due to low haemoglobin and increased use of prescribed iron treatment. In male CHB participants carrying HFE variants, concurrent SLC11A2-Δ3.5kb carriage was associated with a 66% reduced risk of iron overload, suggesting a potential disease-modifying role in haemochromatosis. No associations were observed with cardiometabolic, inflammatory, neurological or malignant diseases. These findings suggest that SLC11A2-Δ3.5kb affects iron homeostasis through reduced systemic iron availability and may have clinical relevance for personalised iron deficiency risk assessment and haemochromatosis penetrance.

Also flagged:glucosidaseethylacetatemexicanolide-type limonoidsswietemicrolides E-Igrandifotane A
Journal Article 2025-10-17 No Snippets Vo HTT, Trinh DH, Ngo NTN, Nguyen LD, Tran PT.
Show Full Abstract

From an ethyl acetate extract of the bark of <i>Swietenia microphylla</i> Cam., five new mexicanolide-type limonoids, swietemicrolides E-I (<b>1-5</b>), along with the known compound, grandifotane A (<b>6</b>), were isolated using column chromatography method. The six compounds are mexicanolides sharing a unique grandifotane scaffold with three fused five-membered rings. Their chemical structures were elucidated on the basis of spectroscopic analyses and comparison of the spectral data with relevant literature. Furthermore, a possible biosynthetic pathway for the formation of the isolated compounds was proposed. The <i>in vitro</i> cytotoxicity of compounds <b>1</b>-<b>6</b> was tested against HepG2 hepatoma and MCF-7 breast cancer cell lines, revealing no significant effect. Additionally, their <i>α</i>-glucosidase inhibitory activity was evaluated, with compounds <b>2</b> and <b>6</b> exhibiting potent inhibition (IC<sub>50</sub> = 151.77 and 161.95 μg/mL, respectively), which are comparable to the positive control (acarbose, IC<sub>50</sub> = 166.57 μg/mL).

Also flagged:deathacute myeloid leukemiaAMLtumorautophagypyroptosis
Journal Article 2025-10-17 No Snippets Jianati R, Chen H, Yang X, Yan L, Guo Y, Fan C, Hao X, Zhu G, Shi Z.
Show Full Abstract

Acute myeloid leukemia (AML) is a highly heterogeneous hematologic malignancy, characterized by complex molecular features and mechanisms of treatment resistance, which lead to a poor prognosis and high relapse rates. The complexity of multi‑pathway interactions and the dysregulated dynamics of tumor cell death pathways may contribute to the wide range of clinical outcomes observed despite advancements in current therapies. Most current research focuses on a single form of cell death, neglecting the mechanisms of other death pathways and their synergistic interactions, which hinders the development of novel therapeutic approaches. The present review systematically integrates and compares the molecular features of key cell death modalities in AML, including autophagy, apoptosis, pyroptosis, necroptosis, ferroptosis and cuproptosis. The present review analyzes their specific triggers, signaling hubs and regulatory networks within the metabolic microenvironment, and discusses the dynamic crosstalk among these pathways. A key focus is the therapeutic potential of exploiting this crosstalk to design synergistic combination therapies. To overcome the limitations of conventional treatments and improve patient outcomes, it is essential to further investigate the transition mechanisms of various cell death modes in AML progression, drug resistance and relapse. Additionally, establishing a theoretical foundation for the development of innovative therapies that synergistically regulate multiple death pathways is crucial.

HTT
Also flagged:cytosolpyrenevinylCascade BlueCyaninedegradation
Journal Article 2025-10-17 ✓ 4 Snippets Schwarte JV, Lamy C, Cornelis S, Hazak O, Fromm KM.
In-Text Gene Mentions

…of the synhttdimer is also…

…0.8% for synhtt), after 8…

…15% of synhttis formed at…

…13.6% as synhtt) against 53.4,…

Show Full Abstract

Dyes for long-term imaging of live cells are rare, especially in the blue region, as they need to be nontoxic and photo-stable. New simple pyrene-derived dyes have been synthesized and fully characterized, showing good cellular uptake, intense emission, and excellent stability. Their unusual stability secret lies in their flexible conformation, evidenced by the solid-state structures of coordination compounds obtained from the dyes and by <sup>1</sup>H-NMR solution studies. Results show that under irradiation, the pyrene-based dye undergoes intersystem crossing (ISC) that leads to a configurational switching occurring at time scales that are faster than the formation of possible photobleaching products. Irradiation of these dyes over 24 hours shows great photostability that was evaluated in different solvents. The possible mechanism of the stability of these dyes is discussed here. Being nontoxic and emitting at only a specific wavelength, these compounds are perfect for staining the cytosol of live cells and long-term imaging in parallel with other dyes of different colors.

Also flagged:autophagyleukemiadegradationcancerdeathacute lymphoblastic leukemia
Journal Article 2025-10-17 No Snippets Faghiri Beyrami A, Movasaghpour Akbari AA, Aghebati-Maleki L, Dolati S, Yousefi M.
Show Full Abstract

Autophagy, a process of cellular degradation and recycling, plays a biphasic role in leukemia; it acts either as a protective process that promotes the cancer cell to survive, or as a pathway that triggers cell death depending on certain conditions. MicroRNAs (miRNAs) regulate many important genes of autophagy, and these involve autophagy's role in leukemia progression, drug resistance and therapy response. In this review, we will lay out the framework of how autophagy and miRNAs interact in that context and concentrate upon studies representative of how certain miRNAs such as miR-21, miR-155, or miR-29, regulate autophagy signaling pathways. We will also reflect on the potential of targeting the autophagy-miRNA axis to overcome drug resistance and enhance the outcome with treatment of leukemia. Although the utilization of miRNA-therapy and inhibitors have shown preclinical viability in leukemia, issues of delivery, specificity and toxicity create many obstacles. A greater comprehension of the molecular mechanisms underlying miRNA-mediated regulation of autophagy could lead to effective and novel therapeutic strategies for leukemia. This review highlights a clinical rationale to employ miRNAs and target autophagy modulation as a possible strategy to combat drug resistance leukemia.

ZNF664
Also flagged:Metal ionsIronoxygenIron deficiencyanemiazinc
Journal Article 2025-10-17 ✓ 2 Snippets Yuan Y, Wang Z, Si C, Li J, Ren F, Yuan Y, Shi Z, Sun N, Ma X, Dai X, Li Y, Zhang Y, Liu J, Wang H, Zhu Z, Shan B, Zhang Y.
In-Text Gene Mentions

…we show thatzinc finger protein 664finger protein 664…

…finger protein 664 (ZNF664), cysteine- and histidine-ric…

Show Full Abstract

Metal ions are essential in regulating protein functions through interactions with residues such as cysteine, but comprehensive mapping of metal-specific metalloproteomes in mammals remains limited. Here, we introduce CysMP, a cysteine-centered metalloprotein profiling strategy to profile the metalloproteomes of 11 key metal ions. CysMP identified 8895 metal-binding sites across 4150 proteins, enabling quantitative comparisons between different metals and revealing both their binding promiscuity and preferences. Notably, zinc and copper ions exhibit the broadest protein interaction profiles. CysMP uncovers numerous potential metalloproteins. We demonstrate that copper and zinc bind to and inhibit 5'-methylthioadenosine phosphorylase, resulting in the accumulation of 5'-methylthioadenosine. Furthermore, copper binding suppresses phosphoglycerate kinase 1 activity, leading to a down-regulation of glycolysis. Our work not only establishes a valuable resource for a dual-specific metalloproteome database but also paves the way for understanding the molecular insights of metalloprotein functions.

VRK2
Also flagged:gene expressionStutteringpersonality disorderSSUH2distal myopathyrippling muscle disease Type 2
Journal Article 2025-10-17 ✓ 1 Snippet Pruett DG, Scartozzi AC, Polikowsky HG, Highland HM, Shaw DM, Petty LE, Petty AS, Kraft SJ, Below JE.
In-Text Gene Mentions

…In particular,VRK2has been linked…

Show Full Abstract

<h4>Purpose</h4>Converging etiological evidence supports a genetic risk for developmental stuttering; however, major gaps detailing the genetic architecture remain. Technological advances in genetics have allowed us to explore novel approaches to analyzing this complex trait, but conducting robust and replicable genetic studies requires large, well-phenotyped cohorts of subjects. This article reviews previous research strategies employed to overcome these challenges in identifying genetic variants associated with stuttering and translating stuttering-associated variants into molecular and cellular mechanisms.<h4>Method</h4>We present an overview of data sources and strategies research teams have utilized for the genetic study of stuttering, highlighting the advantages and limitations of each approach. Primary data sources include (a) the International Stuttering Project, (b) the National Longitudinal Study of Adolescent to Adult Health, (c) BioVU, and (d) 23andMe, Inc. In addition to genome-wide association studies (GWASs), we review multiple post-GWAS follow-up analyses to probe the functional impact of stuttering-associated genetic variants and offer new transcriptome-wide analyses.<h4>Results</h4>To date, a diverse array of approaches has resulted in the identification of over 50 stuttering-associated genes. Many genetic associations were near or within genes previously linked to known neurological traits, highlighting a neurological role in stuttering. Additionally, validation studies using polygenic risk scores suggested a high level of genetic concordance between our samples. Functional follow-up studies suggest stuttering-associated variants may affect gene expression in tissues relevant to speech-related structures and neural correlates.<h4>Conclusions</h4>While understanding how specific regions of the genome contribute to stuttering risk remains complex, research from our team and others has utilized a variety of data sources in an attempt to overcome previous limitations in the identification of genetic variation associated with stuttering. As the field of genetics evolves toward large-scale biobanks for research and discovery, prioritizing inclusion of traits such as stuttering will be key.<h4>Supplemental material</h4>https://doi.org/10.23641/asha.30299764.

Also flagged:enolase 1breast cancertumorsextracellularvesiclescancer
Journal Article 2025-10-17 No Snippets Salmond N, Moravcova R, Tam WS, Khanna K, Rogalski JC, Lynn K, Brackstone M, Watson PH, Williams KC.
Show Full Abstract

Diagnosis of stage 1 breast cancer is challenging as small tumors are often left undetected by conventional imaging techniques. In addition, ~80% of detected breast masses are classified as benign, which means that a large proportion of diagnostic needle biopsies lead to unnecessary psychological stress and medical costs. We investigated circulating extracellular vesicles (EVs) as potential carriers of unique cancer-associated proteins capable of reporting on a breast cancer diagnosis. We isolated EVs from healthy (19), benign (19), and stage 1 breast cancer patient (86) plasma samples using size exclusion chromatography. Mass spectrometry identified 94 significantly changed proteins in the plasma EVs from breast cancer patients. Analysis of a subset of these proteins using a cohort of pre- and post-operative breast cancer patient plasma EVs identified enolase 1 as a promising biomarker. We further validated enolase 1 in a larger patient cohort by high-throughput ELISA of plasma. Enolase 1 was found to be significantly elevated in plasma from stage 1 breast cancer patients compared to healthy and benign individuals, and decreased in post-operative plasma upon tumor removal. Our findings suggest that an enolase 1 liquid blood biopsy could be used to support the detection of breast cancer at the earliest, most treatable, stage.

Also flagged:distigmasterolacylglycerolsPhytosterolsmembranescholesterololeic and palmitic acid
Journal Article 2025-10-17 No Snippets Grygier A, Rudzińska M, Kmiecik D, Grudniewska A.
Show Full Abstract

Phytosterols play a significant role for organisms. They are a component of cell membranes and also have transport functions. They are also important for lower human blood cholesterol levels. The asymmetric distigmasterol-modified acylglycerols (DStA) with oleic and palmitic acid were synthesized as new, more stable derivatives than free phytosterols. The new structure can improve phytosterols solubility in oil. The identification of more stable forms of phytosterols will allow their greater use as a food additive. Assessment of the volatile compounds formed during thermo-oxidative degradation of phytosterols (60 °C and 180 °C), which may affect the flavor of food products, is a rapid and sensitive method for evaluating phytosterol degradation. The GC/MS technique was used for the determination of volatile compounds. The aim of this work was to determine the volatiles formed during storage and thermal degradation of DStA in order to develop a rapid and sensitive system of measuring their degradation. The same compounds were identified for free stigmasterol, its esters with fatty acids, and new DStAs. Eight volatile compounds can act as indicators of sterol degradation during storage and heating. The synthesized 2,3-distigmasterylsuccinoyl-1-oleoyl-sn-glycerol (DStS-O) offered the highest thermo-oxidative stability during storage and thermal processing of all the examined acylglycerols.

LRRC7
Also flagged:mitosischromosomesCCCTC-binding factoranaphasetelophasechromatin
Journal Article 2025-10-17 ✓ 1 Snippet Goel VY, Aboreden NG, Jusuf JM, Zhang H, Mori LP, Mirny LA, Blobel GA, Banigan EJ, Hansen AS.
In-Text Gene Mentions

Condensindepletion led to…

Show Full Abstract

As cells exit mitosis and enter G1, chromosomes decompact and transcription is reestablished. Hi-C studies have indicated that all interphase three-dimensional genome features, including A/B compartments, topologically associating domains and CCCTC-binding factor loops, are lost during mitosis. However, Hi-C is insensitive to features such as microcompartments, nested focal interactions between cis-regulatory elements. Here we apply region capture Micro-C to mouse erythroblasts from mitosis to G1. We unexpectedly observe microcompartments in prometaphase, which strengthen in anaphase and telophase before weakening throughout G1. Microcompartment anchors coincide with transcriptionally spiking promoters during mitosis. Loss of condensin loop extrusion differentially impacts microcompartments and A/B compartments, suggesting that they are partially distinct. Polymer modeling shows that microcompartment formation is favored by chromatin compaction and disfavored by loop extrusion, providing a basis for strong microcompartmentalization in anaphase and telophase. Our results suggest that compaction and homotypic affinity drive microcompartment formation, which may explain transient transcriptional spiking at mitotic exit.

Also flagged:magnesiummetalscell growthreproductionskin allergycell proliferation
Journal Article 2025-10-17 No Snippets Jhamb SK, Goyal A, Pandey A, Bhowmik A.
Show Full Abstract

In recent years, magnesium alloys and their composites, a new generation of biodegradable metals, have become biomedical materials for orthopedic bone implants because of their adequate strength and high biocompatibility. Good biocompatible material should lead to low cytotoxicity, hemolysis, bleeding, and inflammation and must not be at risk for carcinogenic reactions. The medical equipment was tested for cell growth, reproduction, and morphology using in vitro tissue cells in the cytotoxicity test. This research examines the cytotoxicity of a Mg-1%Sn-2%HA composite, produced using powder metallurgy methods, utilizing an in vitro mammalian cell culture system in accordance with ISO 10993-5 criteria. Extracts were generated utilizing the elution technique in Dulbecco's Modified Eagle Medium (DMEM) supplemented with fetal bovine serum (FBS) and evaluated on L-929 mouse fibroblast cells. The cells were cultured at 37 °C with 5% CO<sub>2</sub> for 7 days, after incubation, the monolayers were evaluated microscopically for aberrant cell morphology and degeneration, followed by quantitative cell toxicity using the MTT method. The results indicated a high cell viability of 71.51% with the undiluted extract preparation, confirming the non-cytotoxic properties of the Mg-1%Sn-2%HA composite. Furthermore, cell viability improved with dilution, attaining 84.93%, 93.20%, and 96.52% at concentration of 50%, 25%, and 12.5%, respectively. No notable morphological alterations or indications of cellular deterioration were seen. The results support the viability of the Mg-1%Sn-2%HA composite as a biodegradable material for orthopedic applications. The research offers essential insights into the formulation and assessment of magnesium-based biomaterials for enhanced safety and efficacy in medical implants. The novelty of this study lies in combining a critical review of cytotoxicity evaluation methods with an experimental investigation of Mg-1%Sn-2%HA composite. This work is the first to systematically evaluate the cytotoxicity of Mg-1%Sn-2%HA composite, thereby filling a key research gap. Unlike earlier reports that focused solely on Mg-Sn alloys or Mg-HA composites, this work integrates both alloying and reinforcement strategies, thereby offering new insights into their collective role in biocompatibility assessment.

CA10
Also flagged:carbonic anhydrasegene expressionmorpholinooligonucleotidescarbonic anhydrasescarbonic anhydrase-related proteins
Journal Article 2025-10-17 ✓ 2 Snippets Aspatwar A.
In-Text Gene Mentions

…distinct human genes,CA10and CA11, respectively…

…biological roles ofCA10and CA11 in…

Show Full Abstract

Understanding gene function in vertebrate development requires tools that allow precise and timely manipulation of gene expression. Zebrafish (Danio rerio), with its transparent embryos and rapid development, offers an ideal model to study vertebrate biology. This review explores how morpholino oligonucleotides (MOs), a widely used tool for transient gene knockdown, have been employed to investigate the roles of carbonic anhydrases (CAs) and carbonic anhydrase-related proteins (CARPs) in zebrafish. CAs are metalloenzymes, while CARPs are inactive isozymes that play critical roles in pH regulation, ion transport, CO₂ metabolism, and protein interactions influencing diverse biological functions. Many of the MO knockdown studies presented here have been extensively conducted in our laboratory over the past decade, revealing novel roles for CAs in neural development, reproduction, and swim bladder formation. These studies also confirm roles previously reported in humans, such as pigmentation, acid-base homeostasis, neural development, and motor coordination. We discuss technical aspects of MO design, delivery, and validation, and address common challenges such as off-target effects, transient gene silencing, and the necessity of rescue experiments. In addition, the review includes a comparative analysis of MOs versus CRISPR/Cas9-based genome editing, underscoring their respective advantages and limitations for functional genomics. In conclusion, this review provides not only a methodological guide but also biological insights into CA function in zebrafish, highlighting how antisense technology continues to inform vertebrate development and disease modeling. The lessons learned here may inform the study of other gene families and support translational research in carbonic anhydrase-related human disorders.

Also flagged:psychological stressACC
Journal Article 2025-10-17 No Snippets Sierra-Casas A, Rodríguez-Marroyo JA, Castillo D, Gutiérrez-Arroyo J, Rodríguez-Fernández A.
Show Full Abstract

<h4>Background</h4>Soccer performance involves frequent high-intensity efforts and often insufficient recovery, making neuromuscular fatigue a critical factor in player monitoring. The drop jump (DJ) test, particularly the reactive strength index (RSI), has gained attention as a practical tool for assessing neuromuscular readiness. This study examined the relationship between accumulated external training load and neuromuscular status, assessed via DJ-derived metrics, in semi-professional soccer players.<h4>Methods</h4>Nineteen semi-professional outfield players (20.7 ± 1.4 years) were monitored over a 30-week competitive season, including 144 training sessions and 30 official matches. External load was tracked using 10 Hz Global Positioning System (GPS) devices. Neuromuscular performance was assessed weekly via the DJ test, measuring RSI, contact time (CT), and jump height (JH) with Optojump. Repeated-measures ANOVA evaluated longitudinal changes, and individual correlations were calculated across acute (7-day), chronic (28-day), and acute: chronic workload ratio periods.<h4>Results</h4>External load metrics varied significantly across microcycles, whereas DJ performance metrics remained stable at the group level. However, individual-level analyses revealed significant associations between external load and DJ-derived metrics (particularly between accelerations, decelerations, and high metabolic load distance with CT and JH) in both acute and chronic windows.<h4>Conclusion</h4>Neuromuscular responses to external training load appear highly individual among semi-professional soccer players. RSI and its components (CT and JH) should be interpreted separately to enhance decision-making regarding training and recovery. A multi-metric, individualized monitoring approach is recommended to optimize performance and reduce injury risk.<h4>Clinical trial number</h4>Not applicable.

DCC
Also flagged:disknervepathogenesisAgingossificationinnervation
Journal Article 2025-10-17 ✓ 3 Snippets Geng Q, Geng Y, Heng K, Zhai J, Song X, Sha L, Geng Y, Nie P, Liu F, Zhai H, Huang J, Liu Y, Li M, Wang G, Geng R, Xue K, Wang Q, Huang W, Suo S, Zhang H, Geng Y, Yang Y, Lan J, Hu H, Liu S, Meng X, Guo Y, Li J.
In-Text Gene Mentions

…in Colorectal Cancer (DCC; 1:1000, ab273570, Abcam),…

…the Netrin-1 receptorDCCin the LSI…

…ther implicating the Netrin-1/DCCaxis in the…

Show Full Abstract

BACKGROUND: Pyrroloquinoline Quinone (PQQ) is a redox cofactor with potent antioxidant and anti-inflammatory properties. This study investigated the therapeutic potential of PQQ in alleviating spinal pain and degeneration in a lumbar spine instability (LSI) mouse model. LSI is commonly associated with spinal pain and structural degeneration, with senescent osteoclasts (SnOCs) involved in spinal hypersensitivity and degeneration. METHODS: LSI was induced in 8-week-old C57/BL6 mice by surgically resecting the L3–L5 spinous processes and associated ligaments. The mice were treated with PQQ, and behavioral tests (spinal hypersensitivity, anxiety, and activity levels) were conducted. Spinal endplate structural integrity was assessed through micro-computed tomography imaging and histological analyses. Immunohistochemical staining was performed to identify SnOCs and inflammatory markers. RESULTS: PQQ treatment significantly reduced pain-related hypersensitivity and anxiety behaviors in LSI mice. Behavioral improvements were demonstrated by increased activity, quicker heat response times, and reduced mechanical hypersensitivity. PQQ treatment also preserved the microarchitecture of spinal endplates by reducing endplate porosity, trabecular separation, and osteoclast activity. Additionally, PQQ reduced the number of SnOCs and modulated their inflammatory secretory phenotype, thereby decreasing sensory nerve innervation and angiogenesis in the spinal endplates. CONCLUSIONS: PQQ alleviates spinal pain and degeneration by targeting SnOCs, modulating inflammation, and preserving spinal microarchitecture. These findings suggest that PQQ has potential as a therapeutic agent for managing pain and structural degeneration in spinal instability-related disorders.

Also flagged:γ-globinoxygenβ-hemoglobinopathiesβ-thalassemiasickle cell diseasepost-translational modifications
Journal Article 2025-10-17 No Snippets Ye D, Chen M, Zhu Y, Feng X, Xu L, Huang H.
Show Full Abstract

As a member of the hemoglobin family, γ-globin is usually persistently expressed at high levels to perform the oxygen-carrying function during fetal development. In recent years, related gene editing clinical trials have confirmed that reactivation of γ-globin expression is a promising therapeutic strategy for treating β-hemoglobinopathies, including β-thalassemia and sickle cell disease. Human γ-globin expression is finely regulated by multiple mechanisms, and a deeper understanding of the mechanisms will help develop drugs that target its activation. With the advancement of biotechnology, epigenetic modifications (EMs) and protein post-translational modifications (PPTMs) have shown irreplaceable roles in the regulation of γ-globin expression. Therefore, this review will comprehensively summarize the regulatory mechanisms of EMs and PPTMs on γ-globin to provide new ideas for the treatment of β-hemoglobinopathies.

DCC
Also flagged:nucleotidechromosomeautosomal recessive disordersdisordersgestationhydrops
Journal Article 2025-10-17 ✓ 1 Snippet Jiang Y, Li H, Zhu X, Xu L, Chang Y, Dong F, Xiao J, Gao J, Dong M, Peng Y, Jin H, Wang T, Xie X, Zhang L, Zhuang H, Hao N, Zhou X, Wang H, You Y, Ma K, Xiao R, Qi Q.
In-Text Gene Mentions

…P/LP variants inDCC, SMARCA4 ,…

Show Full Abstract

<h4>Objective</h4>To evaluate the diagnostic value of prenatal exome sequencing (ES) integrated with copy number variant (CNV) and single nucleotide variant (SNV) analysis (ES-CNV/SNV) in fetuses with structural anomalies following negative chromosomal microarray analysis (CMA) and karyotyping, and to delineate the practical challenges encountered during its clinical implementation in prenatal settings.<h4>Methods</h4>In this multicenter prospective cohort study (2018-2021), 275 fetuses with structural anomalies were categorized into three groups: sporadic single-system (n = 128), sporadic multisystem (n = 88), and recurrent anomalies (n = 59). Trio-based ES-CNV/SNV analysis was used to identify SNVs, CNVs, or compound heterozygous CNV/SNV combinations- the latter being defined as two distinct pathogenic variants (a CNV and an SNV) coexisting within the same gene, resulting in biallelic gene dysfunction, which is pivotal for autosomal recessive disorders. Incremental diagnostic yields across groups, the incidence of CNV/SNV combinations, and expanded prenatal phenotypic-genotypic correlations were analyzed.<h4>Results</h4>ES-CNV/SNV analysis improved the diagnostic yield to 29.45% (81/275) compared with conventional chromosome analysis combined with CMA in fetuses with malformations. The highest diagnostic yield was observed in the recurrent anomaly group (40.68%, 24/59), followed by the multisystem (28.41%, 25/88) and single-system anomaly groups (25.00%, 32/128). Notably, 1.45% of cases harbored compound CNV/SNV combinations, underscoring the diagnostic potential of ES-CNV/SNV in autosomal recessive disorders. In addition, this study expanded prenatal phenotypic-genotypic correlations for 36 variants and five genes.<h4>Conclusion</h4>ES-CNV/SNV analysis enhances prenatal diagnostic precision by detecting compound CNV/SNV combinations that are undetectable by standard testing. Recurrent anomalies demonstrated a greater diagnostic benefit than sporadic single-system or multisystem anomalies, underscoring the utility of this method in high-risk cases. This study broadens the prenatal phenotypic spectrum and deepens our understanding of developmental mechanisms.

Also flagged:chronic lymphocytic leukemiaBCL-2acalabrutinibtumor lysis syndromeneutropeniaanemia
Journal Article 2025-10-17 No Snippets Davids MS, Chanan-Khan A, Ailawadhi S, Ivanov V, Usenko G, Nogaieva L, Kryachock I, Muzhychuk I, Perekhrestenko T, Kyselova O, Myasnikov A, Lukavetskyy L, Uspenskaya O, Marlton P, Proydakov A, Borisenkova E, Winter A, Siddiqi T, Lysa T, Bakirov B, Gabrail N, Ganju V, Konstantinova T, Samoilova O, Karpenko O, Osipov I, Mudenda B, Fu T, Chen Z, Liang Z, Mekala DJ, Li M, Glass L, Ahmad M, De A, Shah V, Wang H, Winkler RE, Yang D, Zhai Y.
Show Full Abstract

<h4>Background</h4>Despite recent chronic lymphocytic leukemia (CLL) treatment advances, resistance and intolerance are challenges. Lisaftoclax is a selective, small-molecule oral BCL-2 inhibitor.<h4>Methods</h4>Lisaftoclax was administered with initial daily dose ramp-up (5-7 days depending on the target dose), followed by daily dosing as monotherapy, plus six 28-day cycles of rituximab or continuous acalabrutinib (ClinicalTrials.gov: NCT04215809). The primary endpoints comprised safety/tolerability (phases 1b and 2) and efficacy (phase 2), while the pharmacokinetic profile was a secondary endpoint.<h4>Findings</h4>Of 176 patients, 154 (87.5%) had relapsed/refractory and 22 (12.5%) treatment-naive CLL. Five patients (2.8%) experienced tumor lysis syndrome (TLS) (2 clinical and 3 laboratory). Any-grade treatment-emergent adverse events (TEAEs) included neutropenia in 67 patients (38.1%), diarrhea or anemia in 51 (29.0%), and COVID-19 in 63 (35.8%). Grade ≥3 cytopenias occurred in 53 patients (30.1%) with neutropenia and 15 (8.5%) with thrombocytopenia. No treatment-related discontinuations or deaths occurred. The overall response rate (ORR) was 67.4% (29/43) with lisaftoclax monotherapy, 84.6% (33/39) with lisaftoclax-rituximab, and 97.7% (85/87) with lisaftoclax-acalabrutinib. In the lisaftoclax-acalabrutinib cohort, this included 22 patients who were treatment naive and 65 relapsed/refractory, among whom 14 patients had prior venetoclax exposure. In these patients, the ORR was 92.9% (13/14); 100% (8/8) of these patients were Bruton tyrosine kinase inhibitor (BTKi) naive, 83.3% (5/6) had prior BTKi exposure, and 64.3% (9/14) were venetoclax refractory. Rituximab or acalabrutinib did not alter the pharmacokinetic profile of lisaftoclax.<h4>Conclusions</h4>Daily ramp-up over 5-7 days (to 400 or 800 mg) with continuous treatment with lisaftoclax alone or plus rituximab or acalabrutinib was well tolerated and led to responses in patients with CLL without clinically significant pharmacokinetic interactions.<h4>Funding</h4>Ascentage Pharma Group Corp Ltd. (Hong Kong).

TAOK3
Also flagged:Corylifol Apancreatic cancerTAOK1cancercachexiacancer cachexia
Journal Article 2025-10-17 ✓ 4 Snippets Yu K, Zhang RQ, Li N, Wang QS, Gu J, He SY, Wang YQ, Wang GG, Zhang XW, Guo XD, Liu X.
In-Text Gene Mentions

…cachexia by targetingTAOK3in pancreatic cancer…

…acid kinase 3 (TAOK3).…

…and overexpression ofTAOK3could alleviate the…

…well as targetingTAOK3in pancreatic cancer…

Show Full Abstract

As many as 80 % of pancreatic cancer patients might suffer from cancer cachexia, a distressing condition characterized by involuntary weight loss and muscle wasting. Regrettably, there remains an insufficiency of efficacious pharmacological interventions for the management of cancer cachexia. The effectiveness of corylifol A (CYA) in treating pancreatic cancer-associated cachexia was assessed, and its underlying mechanisms were examined in the present study. Cultured C2C12 myotubes induced with conditioned medium from MiaPaCa-2 pancreatic cancer cells (MIA CM) were utilized as an in vitro model to investigate the impact of CYA on muscle atrophy associated with cancer cachexia. The MIA cachexia mice model was utilized to evaluate the in vivo impact of CYA on cancer cachexia. CYA (2.5, 5, and 10 μM) dose-dependently mitigated MIA CM-induced myotube atrophy through targeting the thousand and one amino acid protein kinase 1 (TAOK1) and blocking protein degradation via the ubiquitin-proteasome system (UPS) and the autophagic-lysosomal pathway (ALP). Importantly, CYA (10 mg/kg/d, i.p.) not only significantly ameliorated weight loss and muscle atrophy but also inhibited the tumor growth in MIA cancer cachexia mice. In pancreatic cancer cells, CYA directly targets the thousand and one amino acid kinase 3 (TAOK3). Both knockdown and overexpression of TAOK3 could alleviate the cytotoxicity of CYA on pancreatic cancer cells. Collectively, CYA ameliorated pancreatic cancer-associated cachexia by targeting TAOK1 in skeletal muscle cells as well as targeting TAOK3 in pancreatic cancer cells.

PRDX6
Also flagged:Peroxiredoxinsthiol-dependent peroxidasescysteinePrdx1Prdx5peroxides
Journal Article 2025-10-17 ✓ 3 Snippets Ge MM, Zhang XM, Xu C, Miao CH, Liao QW.
In-Text Gene Mentions

…(Prdx5), and 1-Cys (Prdx6) [ 2 ].…

…Uniquely,Prdx6differs from its…

…Of note,Prdx6, as a bifunctional…

Show Full Abstract

Oxidative stress, an imbalance between the prooxidant-antioxidant system, is regarded as one of the crucial causative pathomechanisms of chronic pain. However, direct scavenging of intracellular reactive oxygen species (ROS) by antioxidants may disrupt normal physiological homeostasis. Peroxiredoxins (Prdxs), a family of ROS-regulating enzymes, have recently aroused growing interest in the broad field of antioxidant research. Six distinct groups of Prdxs (Prdx1-6) have been identified to date. Prdxs are essential for regulating diverse biological processes, including oxidative stress, neuroinflammation, apoptosis, mitochondrial dynamics, endoplasmic reticulum (ER) stress, and synaptic plasticity. Interestingly, the differential expression patterns of Prdxs in central nervous system (CNS) tissues, cell types, and subcellular locations imply specialized functions. This review systematically summarizes the expression patterns of specific Prdxs in tissues and cells of murine and human, as well as the regulatory factors of their enzymatic activities. It also discusses the underlying cellular signaling pathways through which Prdxs participate in several biological processes as well as chronic pain and anaesthetic-induced neurotoxicity. In addition, we summarize the therapeutic potential of Prdxs inducers in CNS disorders based on preclinical studies. A better understanding of these processes can promote the development of novel therapeutic targets for treating chronic pain and anaesthetic-induced neurotoxicity.

Also flagged:Polyurethanespolyurethanesynthesispolyolglycerol ethoxylateglycerol
Journal Article 2025-10-17 No Snippets Miravalle E, Olariu TA, Cecone C, Brunella V, Bracco P, Zanetti M.
Show Full Abstract

Thermoset polyurethanes invite industrial interest for their versatility and chemical and mechanical resistance due to their permanently crosslinked networks; yet this structural feature severely limits their recyclability. Recent advances in Covalent Adaptable Networks (CANs), enabled by Dynamic Covalent Chemistry (DCC), have demonstrated promising pathways toward reprocessability through bond-exchange mechanisms. However, no clear link has yet been identified between material properties and the retention of performance after reprocessing. This work investigates the role of crosslink density as a key factor in determining the reprocessability of polyurethane networks. Two model systems with comparable compositions but distinct crosslink densities were synthesised, reprocessed, and compared. Relaxation analysis based on the Maxwellian approach proved insufficient to predict reprocessing outcomes. Only the highly crosslinked network yielded homogeneous reprocessable films with significant retention of mechanical performance, whereas the less crosslinked network resulted in incoherent materials with markedly reduced properties. The application of Kohlrausch-Williams-Watts (KWW) fitting revealed that dynamic covalent exchange dominates relaxation in the highly crosslinked system, while in the looser network, relaxation is governed by soft segment mobility, hindering effective network reformation. These findings underscore the pivotal role of crosslink density in determining the recyclability of thermoset polyurethanes and provide new insights for the rational design of reprocessable materials.

SERPINC1
Also flagged:skeletal muscle atrophyimmune suppressionneuro-ocular syndromescritical illnessinsulin resistancemuscle atrophy
Journal Article 2025-10-17 ✓ 3 Snippets Shah J, Lee R, Pathuri S, Zheng J, Ong J, Suh A, Rezaei K, Mudhar G, Parsons AD, Park J, Lee AG.
In-Text Gene Mentions

…factors PECAM1 andSERPINC1are preserved […

…SOCS2, CISH, andSERPINC1, limits renal inflammation…

…genes (SOCS2, CISH,SERPINC1) suggests potential therapeut…

Show Full Abstract

Long-term spaceflight induces multisystem stress, including cardiovascular deconditioning, skeletal muscle atrophy, immune suppression, and neuro-ocular syndromes. Current countermeasures reduce symptoms but cannot replicate the synergistic resilience needed for extended missions or critical illness. Hibernating animals, specifically brown bears (<i>Ursus arctos</i>), survive prolonged immobility, starvation, and bradycardia without resultant pathology. This review incorporates adaptations observed in bears and certain torpid species, including reversible insulin resistance, suppression of muscle atrophy genes MuRF1 and Atrogin-1, and maintenance of the heart despite seasonal production decline. The thirteen-lined ground squirrels (<i>Ictidomys tridecemlineatus</i>) maintain retinal structure and synaptic stability throughout torpor, avoiding neuro-ocular complications despite prolonged inactivity. Mechanisms span from RBM3-dependent synaptic maintenance, titin isoform remodeling under the control of RBM20, mTOR and FOXO pathway regulation, remodeled hydrogen sulfide metabolism, and microbiome-mediated nitrogen salvage. These adaptations are different from human adaptation to microgravity and disuse and offer translational candidates for synthetic torpor, probiotic engineering, neuroprotection, and protein-sparing therapy. Hibernators are not passive stress subjects; they perform coordinated anticipatory responses in multiple organs. Comparing these systems in large and small hibernators, we aim to uncover a biologically realistic path to human resilience. These findings guide a shift from reactive, pharmacological measures for preserving human health during space flight, intensive care, and extreme environments towards proactive, biologically initiated measures.

Also flagged:Pulmonary FibrosisSystemic Sclerosisinterstitial lung diseaseautoimmune disorderextracellularpathogenesis
Journal Article 2025-10-17 No Snippets Alcolea MPI, Starita Fajardo G, Peña Rodríguez M, Lucena López D, Suárez Carantoña C, López Paraja M, García de Vicente A, Viteri-Noël A, González García A.
Show Full Abstract

This document provides an updated overview of the molecular mechanisms underlying pulmonary fibrosis associated with Systemic Sclerosis (SSc). It summarizes current knowledge on how immune activation, vascular injury, and impaired tissue repair contribute to interstitial lung disease (ILD), which is the most serious and life-threatening complication of SSc. SSc is a rare autoimmune disorder involving vascular dysfunction and progressive fibrosis of the skin and internal organs. In the lungs, the interaction between immune and vascular abnormalities and excessive extracellular matrix deposition leads to irreversible structural damage. These processes occur through complex, multifactorial mechanisms that are only partially understood. The review examines recent evidence on the cellular mediators, signaling pathways, and epigenetic alterations involved in ILD-SSc pathogenesis. It also discusses the potential roles of genetic predisposition, environmental factors, and autoantibody profiles in disease heterogeneity. Finally, it highlights emerging therapeutic strategies that target these molecular mechanisms. This work aims to integrate these advances to provide a clearer understanding of the biological basis of SSc-associated pulmonary fibrosis and support the development of novel diagnostic and therapeutic approaches that may improve patient outcomes.

Also flagged:ethersynthesisamino acidnanofiberssodium saltsdegradation
Journal Article 2025-10-17 No Snippets Wang Y, Zhao L, Liu B, Deng L, Wu Z.
Show Full Abstract

This article focuses on the utilization of the supramolecular self-assembly of renewable materials derivatives to obtain functional compounds. Novel bio-based amphiphile molecules (<b>CALAH</b> and <b>PALAH</b>) were synthesized through a tailored process, involving Williamson ether synthesis and amidation reactions, employing renewable amino acid and cashew nut shell liquid (CNSL) derivatives as essential reactants. Their molecular structures were confirmed by nuclear magnetic resonance (NMR), high-resolution mass spectrometry (HRMS), and Fourier-transform infrared spectroscopy (FT-IR). Notably, these compounds self-assemble into nanofibers that organize into a fibrous network, unexpectedly exhibiting two distinct morphologies: curved and rigid nanostructures. These structures were characterized by scanning electron microscopy (SEM), and their formation mechanisms were elucidated through temperature-dependent NMR studies and density functional theory (DFT) calculations. The sodium salts of the compounds (<b>PALA</b> and <b>CALA</b>) exhibited fundamental surfactant properties, exhibiting a hydrophilic lipophilic balance (HLB) value of 13.7 and critical micelle concentration (CMC) values of 1.05 × 10<sup>-5</sup> M and 4.10 × 10<sup>-6</sup> M. They also demonstrated low cytotoxicity, suggesting potential suitability in consumer applications. Furthermore, the compounds exhibited multi-functional performance as effective inhibitors of <i>Staphylococcus aureus</i> and efficient adsorbents for gaseous pollutants.

HTT
Also flagged:HDneurodegenerative diseaseHuntingtinchromosomeHuntington Diseaseneuropathy
Journal Article 2025-10-17 ✓ 1 Snippet Youhanan N, Kaur J, Hall A, Bagga K, Patel S, Sidhu A, Alskaf R, Shaik Z, Gilbert PE, Goble DJ, Corey-Bloom J.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene on chromosome…

Show Full Abstract

<h4>Background</h4>Balance impairment may begin prior to motor diagnosis in Huntington's disease (HD) and is associated with an increased risk of falls-an important predictor of nursing home placement.<h4>Objective</h4>To evaluate the ability of three balance measures to discriminate between Fallers and Non-Fallers and to estimate the likelihood of falling in HD patients.<h4>Methods</h4>125 gene-positive individuals were stratified into Fallers (n = 30) and Non-Fallers (n = 95) based on fall history. Participants completed a Total Body Sway (TBS) assessment using the BTrackS™ Balance Plate, Timed Up-and-Go (TUG), and Chair Sit-to-Stand Test (CST). Group differences were analyzed with Mann-Whitney <i>U</i> test. ROC curve analysis was used to calculate likelihood ratios (LRs) for each assessment's ability to distinguish Fallers from Non-Fallers.<h4>Results</h4>Fallers demonstrated significantly higher TBS scores compared to Non-Fallers (p < 0.001), while differences on TUG (p = 0.098) and CST (p = 1.00) were not significant. TBS yielded the highest area under the curve (AUC = 0.89, p < 0.001), followed by TUG (AUC = 0.66, p = 0.008), while CST did not discriminate between groups (AUC = 0.47, p = 0.617). TBS also demonstrated superior diagnostic utility (LR+ = 5.06; LR- = 0.24) compared to TUG (LR+ = 3.41; LR- = 0.62) and CST (LR+ = 1.59; LR- = 0.90).<h4>Conclusion</h4>TBS and, to a lesser extent, TUG are valid tools for identifying individuals at risk of falling in HD. In contrast, the CST may not be an effective clinical measure in this regard.

MMS22L
Also flagged:tumorbreast cancerCancerBRCAcell cycle-dependency
Journal Article 2025-10-17 ✓ 1 Snippet Liu S, Wang S, Wang G, Li Y, Zhao Z, Tian Y, Cao J.
In-Text Gene Mentions

…a complex withMMS22L, which recognizes…

Show Full Abstract

<h4>Background</h4>Triple-negative breast cancer (TNBC) is the most aggressive breast cancer subtype; however, clinically approved prognostic biomarkers and therapeutic options remain limited. This study aimed to investigate tumor dependency genes to identify novel therapeutic targets for TNBC.<h4>Methods</h4>Tumor dependency genes for TNBC were identified using the The Cancer Dependency Map (DEPMAP) database. The TCGA-BRCA dataset was utilized to analyze the expression, survival associations, and pathway enrichment of these genes. Single-cell datasets were employed to explore cellular trajectories and biological functions within tumor dependency gene-associated cell subpopulations. Genomic sequencing was used to investigate the somatic mutational landscape influencing the infiltration abundance of the tumor dependency-associated subpopulation. The METABRIC dataset assessed the impact of the tumor dependency-associated subpopulation on radiotherapy, chemotherapy, and combination therapy outcomes. Potential drugs were identified using the Connectivity Map (CMAP). Colony formation experiment and the CCK-8 experiment were performed to validate the biological function of gene.<h4>Results</h4>Four tumor dependency genes (TDGs) were identified. These genes were highly expressed in TNBC and associated with poor prognosis. Enrichment analysis revealed their significant involvement in cell cycle-related pathways. Single-cell analysis demonstrated that the tumor dependency-associated subpopulation (TDAS), defined by these four genes, resided at the differentiation terminus of epithelial/tumor cells and was linked to energy metabolism and cell proliferation pathways. Crucially, patients with high TDAS infiltration abundance were found to be unsuitable for surgery alone and should receive combined radiotherapy or chemotherapy. Potential therapeutic agents targeting the TDAS were screened. And <i>in vitro</i> experiments confirmed the cell proliferation role of candidate genes.<h4>Conclusion</h4>This study identifies four potential TNBC biomarkers for assessing TDAS abundance, providing novel insights and strategies for personalized TNBC treatment.

STAU1
Also flagged:autosomescell proliferationphosphorylationSOX15FGF11GPS2
Journal Article 2025-10-17 ✓ 1 Snippet Liu Y, Xi H, Xu Q, Zhou B, Li J, Su R, Lv Q, Zhang Y, Wang R, Wang Z.
In-Text Gene Mentions

…the body ‘sStau1protein negatively regulates…

Show Full Abstract

<h4>Introduction</h4>The early growth traits including birth weight (BW), weaning weight (WW), pre-weaning average daily gain (ADG) and yearling weight (YW) are crucial productivity indicators that directly influence growth rates of cashmere goats and economic income of herdsmen in the cashmere goat breeding programs. However, the genetic mechanism of these traits in Inner Mongolia Cashmere Goats (IMCGs) has not been elucidated.Copy number variation (CNV), as a prevalent form of genomic structural variation and a significant contributor to the genetic diversity, has emerged as a valuable molecular marker for analysis of complex traits.<h4>Methods</h4>In this study, Whole Genome Sequencing (WGS) data of 461 IMCGs were used to detect CNVs on autosomes and the Genome-Wide Association Study (GWAS) analysis based on CNVs was performed for early growth traits (BW, WW, ADG and YW) of IMCGs.The identified CNVs were further validated through PCR verification. In addition, t-test was performed on the phenotypes of individuals of IMCGs with significant CNVs.<h4>Results</h4>The 26,003 non-redundant CNVs and 5,014 non-redundant CNVRs were detected, covering a total of 1,015.4 Mb (38.97 %) of the autosomal goat genome. The 11 CNVs were significantly associated with early growth traits through GWAS analysis, including two pleiotropic CNVs simultaneously influencing ADG and WW. Through integrated bioinformatics analysis, seven key candidate genes (<i>ZN845</i>, <i>SOX15</i>, <i>FGF11</i>, <i>GPS2</i>, <i>DVL2</i>, <i>SPRY4</i> and <i>STAT2</i>) were identified as being associated with early growth traits.Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses demonstrated that these genes were primarily involved in biological pathways related to cell proliferation, differentiation and protein phosphorylation.Among the 11 significant CNVs, 9 CNVs were demonstrated to show significant associations with individual phenotypes.<h4>Discussion</h4>This study significantly expands the genomic CNV map of IMCGs through large-scale genotyping.The findings demonstrate the utility of CNV-based GWAS analysis in elucidating the genetic mechanisms underlying complex traits, providing valuable insights for molecular marker-assisted breeding and molecular genetic research of economically important traits in cashmere goats.

TRIM38
Also flagged:CD14messenger RNA (mRNAcDNAZsGMARV-NPIFNB1
Journal Article 2025-10-17 ✓ 1 Snippet Yordanova IA, Arnold CE, Corrales N, Guito JC, Lander A, Ang LT, Towner JS, Prescott JB.
In-Text Gene Mentions

…like TLR8 andTRIM38or the deletion…

Show Full Abstract

<h4>Introduction</h4>Egyptian rousette bats (ERBs) are the only known natural reservoir of Marburg virus (MARV), etiologic agent of a highly-pathogenic zoonotic viral hemorrhagic fever. Evolutionary adaptations in ERBs allow for fine-tuned discrete pro-inflammatory immune responses that control MARV infection, yet permit population-level viral maintenance.<h4>Methods</h4>To look for exclusive co-adapted responses between ERBs and MARV, we compared macrophage (MΦ) responses to MARV and Sudan virus (SUDV), a related filovirus not hosted by ERBs. We queried whether MARV counters normal ERB MΦ responses, illuminating co-adapted host responses not observed upon infection with SUDV, which fails to establish a productive infection and is efficiently immunologically cleared by ERBs.<h4>Results</h4>We observed stark differences in MΦ transcriptional responses to MARV and SUDV, including differences in type I and III interferon (IFN)-related genes, cytokines, chemokines, cell growth and proliferation genes. We show for the first time that while MARV-infected bat MΦs undergo muted IFN responses and cytokine storm signaling, SUDV induces unperturbed type I and III IFN gene expression, stronger cytokine and chemokine responses resembling typical host responses to a foreign viral pathogen.<h4>Discussion</h4>Our findings corroborate growing evidence of unique coevolutionary relationships between bats and the specific viruses they harbor.

bioRxiv 2025-10-17 Preprint (No Snippets API) de Paiva Narciso N, Christakopoulos F, Huang MS, Baugh NJ, Huerta-López C, Matos EX, Pashin KP, Spakowitz A, Heilshorn SC.
Show Full Abstract

The development of three-dimensional (3D) in vitro tissue culture models is critical for biomedical research. Hydrogel-based systems have become a preferred scaffold for 3D models, as they have tunable viscoelastic properties, which are well-known to influence cell morphology and function. In particular, reversible hydrogel crosslinks formed through dynamic covalent chemistry (DCC) can introduce viscoelastic behavior including stress relaxation. However, traditional strategies to increase stress-relaxation rates in DCC gels rely on faster bond kinetics, resulting in faster erosion rates that prevent their use for long-term 3D culture. As an alternative strategy, we explore the use of molecular parameters (specifically molecular weight and degree of functionalization) to independently control the stiffness and stress relaxation behavior while preventing rapid erosion. As demonstration, we develop and validate a modified theoretical model of gel viscoelasticity applied to a two-component DCC gel composed of modified hyaluronic acid and elastin-like protein. Finally, we utilize this tunable gel platform to explore the impact of scaffold viscoelasticity on encapsulated human neural progenitor cells. In summary, this work expands the molecular design space of DCC hydrogels to achieve tunable viscoelastic properties for 3D in vitro models.

bioRxiv 2025-10-17 Preprint (No Snippets API) Cohen CJ, Mimpen JY, Kurjan A, Paul C, Sharma S, Ramos-Mucci L, Ikwanusi CT, Aksu AC, Serebour TB, Nikolic M, Rue-Albrecht K, Gibbons C, Whitwell D, Cosker T, Gwilym S, Siddiqi A, Rajasekaran RB, Branford-White H, Cribbs AP, Hulley PA, Sims D, Baldwin MJ, Snelling SJB.
Show Full Abstract

<h4>ABSTRACT</h4> Tendons are transitional tissues linking muscle to bone, enabling locomotion and fine motor control. The cellular biology across the Achilles tendon unit is poorly understood, yet critical for interpreting normal function and pathological changes across its microanatomically-defined functional zones. We generated a spatially-resolved transcriptomic atlas of human Achilles tendon, sampling the tendon-bone junction (enthesis), midbody, myotendinous junction, and adjoining muscle. Six fibroblast subtypes were identified, with distinct transcriptional profiles and spatial distributions, suggesting specialised functional roles across the tendon-muscle unit. Two dominant fibroblast types were specifically positioned in the tendon mid-substance and paratenon (vessel-rich region surrounding the tendon fibrils); other populations included perineural, myotendinous junction-specific, muscle-specific, and lining-layer fibroblasts. These findings demonstrate how cellular diversity across a transitional tissue may underlie microanatomical-specific roles. This atlas provides a foundation for understanding cellular functions across the tendon-muscle unit and will be essential for comparisons with diseased tissue, identifying pathogenic mediators and treatment targets for autoimmune and degenerative pathologies of the Achilles tendon.

medRxiv 2025-10-17 Preprint (No Snippets API) Gülmez D, Siwy J, Kurz K, Wendt R, Banasik M, Peters B, Dudoignon E, Depret F, Salgueira M, Nowacki E, Kurnikowski A, Mussnig S, Krenn S, Gonos S, Löffler-Ragg J, Weiss G, Mischak H, Hecking M, Schernhammer E, Beige J, UriCoV working group.
Show Full Abstract

<h4>Background</h4> Post-acute sequelae of severe acute respiratory syndrome coronavirus 2-infection (PASC) is challenging to diagnose and treat, and its molecular pathophysiology remains unclear. Urinary peptidomics can provide valuable information on urine peptides that may enable improved and specified PASC diagnosis. <h4>Methods</h4> Using standardized capillary electrophoresis-MS, we examined the urinary peptidomes of 50 patients with PASC 10 months after COVID-19 and 50 controls including healthy individuals (n = 42) and patients with non-COVID-19-associated myalgic encephalomyelitis/chronic fatigue syndrome (n = 8). Based on peptide abundance differences between cases and controls, we developed a diagnostic model using a support vector machine. <h4>Results</h4> The abundance of 195 urine peptides among PASC patients significantly differed from that in controls, with a predominant abundance of collagen alpha chains. This molecular signature (PASC195), effectively distinguished PASC cases from controls in the training set [AUC of 0.949 (95% CI 0.900–0.998; p < 0.0001)] and independent validation set [AUC of 0.962 (95% CI 0.897–1.00); p < 0.0001)]. In silico assessment suggested exercise, GLP1-RA and MRA as potentially efficacious interventions. <h4>Conclusions</h4> We present a novel and non-invasive diagnostic model for PASC. Reflecting its molecular pathophysiology, PASC195 has the potential to advance diagnostics and inform therapeutic interventions. <h4>Statement of significance of the study</h4> Despite the recent emergence of omics-derived candidates for post-acute sequelae of SARS-CoV-2 infection (PASC), the pending validation of proposed markers and lack of consensus result in the continuous reliance on symptom-based criteria, being subject to diagnostic uncertainties and potential recall bias. Building upon prior findings of renal involvement in acute COVID-19 pathophysiology and PASC-associated alterations, we hypothesized that the use of urinary peptides for PASC-specific biomarker discovery, unlike conventional specimens that have been utilized thus far, may offer complementary information on putative disease mechanisms. In the present study, 195 significantly expressed peptides were used to form a classifier termed PASC195, which effectively discriminated PASC from non-PASC (p < 0.0001), including healthy individuals and non-COVID-19 associated myalgic encephalomyelitis/chronic fatigue syndrome, in both the derivation (n = 60) and an independent validation set (n = 40). Shift in collagen regulation was associated with PASC, as the majority of PASC195 peptides were derived from collagen alpha chains. Ongoing inflammatory responses, hemostatic imbalances, and endothelial damage were inferred from cross-sectional variations in endogenous peptide excretion.

STAU1
Also flagged:Triple-negative breast cancerbreast cancertumorsADAR1tumorAdenosine deaminase
Journal Article 2025-10-16 ✓ 1 Snippet Young AA, Juhler IG, Pierce JR, Bohlin HE, Harper HA, Onishile DS, Chua RN, Liu ME, Gardner EN, Elzey BD, Cottrell KA.
In-Text Gene Mentions

…example, DHX9 andSTAU1prevent PKR activation…

Show Full Abstract

Triple-negative breast cancer (TNBC), the deadliest breast cancer subtype, lacks broadly applicable targeted therapies. Induction of "viral mimicry" by activation of viral double-stranded RNA (dsRNA) sensors has potential therapeutic applications for TNBC and other cancers. Suppressors of dsRNA sensing prevent sensing of endogenous dsRNAs and resulting autoimmunity. Depletion of the suppressor of dsRNA sensing ADAR1 causes activation of dsRNA sensors and cell death in many cancer cell lines. These ADAR1-dependent cells are generally also dependent on the dsRNA-binding protein PACT, which is highly expressed and essential in many TNBC cell lines. While PACT is known as an activator of the dsRNA sensor PKR, overexpression of PACT had no effect on activation of PKR in multiple TNBC cell lines. Conversely, depletion of PACT in PACT-dependent cell lines caused robust activation of PKR and cell death, in addition to induction of integrated stress response genes and NF-κB targets. These phenotypes were entirely dependent on PKR. Rescue experiments revealed that PACT dimerization and dsRNA binding are required to suppress PKR activation. While depletion of PACT alone in ADAR1/PACT-independent cell lines had no effect on PKR activation, combined depletion of both PACT and ADAR1 in those cell lines caused robust PKR activation and cell death, supporting a partially redundant role for ADAR1 and PACT in suppression of dsRNA sensing. Taken together, these findings support a vital role for PACT in suppressing PKR activation and highlight the therapeutic potential of targeting PACT to treat TNBC.

DCC
Also flagged:Blastic plasmacytoid dendritic cell neoplasmBPDCNhematologicnatural killer (NK) cell lymphomaCD4NK cell leukemia
Journal Article 2025-10-16 ✓ 2 Snippets Kim J, Kim M, Chu D, Cho YU, Hwang SH, Jang S, Seo EJ, Choi EJ, Park HS, Lee JH, Lee JH, Yoon DH, Go H, Park CS, Lee KH, Park CJ, Hwang S.
In-Text Gene Mentions

…the loss ofDCC, a tumor…

…chromatin remodeling, andDCC-mediated apoptosis.…

Show Full Abstract

<h4>Background</h4>Blastic plasmacytoid dendritic cell neoplasms (BPDCNs) are rare and aggressive hematologic malignancies with poorly defined molecular characteristics. Genetic data for Korean patients with this condition are scarce. We conducted the first network-based analysis of Korean patients with BPDCN, using next-generation sequencing (NGS) alongside clinical, morphological, and cytogenetic evaluations.<h4>Methods</h4>We included 14 patients diagnosed with BPDCN between 2004 and 2021. Clinical, morphological, and cytogenetic data were collected. Conventional karyotyping and targeted NGS were performed. Network analysis was used to link gene variants with known BPDCN-associated genes.<h4>Results</h4>The median age at diagnosis was 52 yrs; the male:female ratio was 1.8:1. Cutaneous and bone marrow (BM) involvement were observed in 79% and 57% of patients at diagnosis, respectively; 85% of those not lost to follow-up eventually showed BM involvement. Allogeneic hematopoietic stem cell transplantation was associated with longer survival compared with chemotherapy alone (<i>P</i> =0.015). Complex karyotypes were common (87%), with novel chromosomal deletions at 1p, 18q, and 22q. BPDCN samples showed recurrent variations in <i>TET2, ASXL1</i>, and RAS-pathway genes, as well as novel variations in 22 genes, including <i>SMARCD2, DDX3X</i>, and <i>GNB1</i>. Network analysis revealed functional associations between these novel alterations and established BPDCN-related genes.<h4>Conclusions</h4>We present the first network-based analysis of Korean patients with BPDCN, along with conventional genetic assessments, highlighting the potential genetic drivers of BPDCN and facilitating the development of targeted therapies for the disease.

MLLT10
Also flagged:acute leukemiareverse transcriptionacute myeloid leukemiaT-cell acute lymphoblastic leukemiaB-cell acute lymphoblastic leukemiamixed-phenotype acute leukemia
Journal Article 2025-10-16 ✓ 5 Snippets Kim HY, Kim B, Park MS, Park JH, Ju HY, Yoo KH, Jang JH, Jung CW, Kim HJ.
In-Text Gene Mentions

…( FUS::ZNF362 andMLLT10:: UBE2L6 ), rarely…

…PAX5::NOL4L , and PICALM::MLLT10) fusion genes.…

…RUNX1 , one KMT2A::MLLT10, and three…

…3)MLLT10::UBE2L6 in relapsed AML…

…relapsed AML with KMT2A::MLLT10(case No. 111)…

Show Full Abstract

<h4>Background</h4>Fusion genes are major drivers of acute leukemia. Conventional diagnostics are limited in detecting the diverse fusions included in recently updated acute leukemia classifications. We evaluated the fusion detection performance of RNA sequencing (RNA-seq) compared with that of conventional diagnostics in patients with acute leukemia.<h4>Methods</h4>We retrospectively obtained the data of 101 patients with acute leukemia who underwent conventional diagnostics (i.e., karyotyping, FISH, or multiplex reverse transcription PCR) at diagnosis at Samsung Medical Center, Seoul, Korea, between September 2022 and September 2023. Whole RNA-seq was performed using the Illumina Stranded mRNA Prep kit (Illumina, San Diego, CA, USA). The concordance, sensitivity, and specificity of RNA-seq for fusion gene detection were compared with those of conventional diagnostics.<h4>Results</h4>RNA-seq helped identify 52 fusion genes in 51 (50.5%) of 101 patients, with detection rates of 40.7%, 70.3%, 37.5%, and 50% in acute myeloid leukemia, B-cell acute lymphoblastic leukemia, T-cell acute lymphoblastic leukemia, and mixed-phenotype acute leukemia, respectively. RNA-seq showed 83.3% sensitivity and 80.8% concordance with conventional diagnostics; it missed eight fusions, likely because of low transcript abundance or enhancer hijacking. RNA-seq also helped clarify three previously unspecified rearrangements and detected 12 fusions (21.4%) in 56 cases that tested negative with conventional diagnostics, including four novel (<i>KMT2A::THAP12, RUNX1::PRPF19, MLLT10::UBE2L6</i>, and <i>FUS::ZNF362</i>) and three rare (<i>HNRNPH1::ERG, RUNX1::USP42</i>, and <i>ETV6::NCOA2</i>) fusions.<h4>Conclusions</h4>This was the first study to evaluate the performance of whole RNA-seq in fusion detection in patients with acute leukemia in Korea. Incorporating RNA-seq into diagnostic workflows may facilitate earlier and more precise therapeutic decisions and improve prognostic assessment in patients with acute leukemia.

Also flagged:tumorMetal ionsdeathcancercuproptosissodium
Journal Article 2025-10-16 No Snippets Wang J, Tian Q, Liu Y, Cai CY, Fu S, Li J, Guan Y, Liao X, Su D, Sun T, Zhang Y, Lin R, Xu Y, Pang J, Zeng L, Pan Y.
Show Full Abstract

Metal ions-based regulated cell death (RCD), a form of cell death involving metal ions and controlled by one or more cascade signaling pathways, has recently been termed "metalloptosis". Given the rapid advances in understanding metalloptosis in malignant progression and nanotherapeutics, this review elucidates the latest progress in metalloptosis, focusing on the roles of various metal ions and the targeting of metalloptosis in cancer therapy and nanomedicine. We briefly describe the essential discoveries of RCD and comprehensively summarize the current major regulatory signaling pathways of emerging metalloptosis forms, including ferroptosis, cuproptosis, lysozincrosis, manganism, calcicoptosis, and necrosis by sodium overload (NECSO). Additionally, we demonstrated the effects of metalloptosis on malignant neoplastic progression and the tumor microenvironment (TME). Furthermore, we discuss the feasibility of targeting metalloptosis pathways using metal nanoparticles (MNPs) for cancer therapy and overcoming drug resistance in cancer cells. We hope that this review will provide both fundamental insights and translational outlooks for harnessing metalloptosis in precision oncology.

HFE
Also flagged:myostatinestrogen receptor 1ESR1
Journal Article 2025-10-16 ✓ 4 Snippets Lee JK, Kang BY.
In-Text Gene Mentions

…in the myostatin,hemochromatosis(HFE) and estrogen receptor…

…he myostatin, hemochromatosis(HFE) and estrogen receptor…

…polymorphism in theHFEgene was observed…

…polymorphism in theHFEgene may be…

Show Full Abstract

<h4>Backgound</h4>It is known that in addition to environmental factors such as the athlete's own efforts or the qualities of the coach, genetic predisposition can also have a significant impact on achievements in the sports field.<h4>Objective</h4>For this reason, this study tried to analyze whether single nucleotide polymorphisms (SNPs) in the myostatin, hemochromatosis(HFE) and estrogen receptor 1 (ESR1) genes, which are known to affect muscular strength, cardiorespiratory endurance and flexibility, respectively, could significantly affect the athletic performance of endurance or power/sprint events in Korean population.<h4>Methods</h4>A total of 192 Korean unrelated participants were recruited in this study. They were divided into two groups: controls (n = 72) and track-field athletes (n = 120), which included throwing athletes (n = 39) and distance runners (n = 81). Also, the determination of the genotypes constituting the SNP markers in the three kinds of candidate genes mentioned above was performed using TaqMan method.<h4>Results</h4>Among the three kinds of SNP markers studied, only the rs1799945 polymorphism in the HFE gene was observed to be significantly associated with endurance performance in Korean athletes (p < 0.05).<h4>Conclusion</h4>Therefore, our results suggest that the rs1799945 polymorphism in the HFE gene may be one of useful genetic markers for endurance performance in Korean athletes. Further studies using larger sample sizes and various sports events are needed to replicate our results.

Also flagged:Ubiquitindegradationcytoplasmicmale sterility proteinCytoplasmic male sterilitymitochondrial
Journal Article 2025-10-16 No Snippets Zhang Z, Ding Z, Feng X, Huang J, Peng X, Xiao Y, Zong W, Zhao Z, Liu YG, Xie Y, Chen L.
Show Full Abstract

Cytoplasmic male sterility (CMS) is caused by mitochondrial genes that are constitutively expressed in plant tissues, although the encoded proteins preferentially accumulate in anthers. The mechanisms regulating CMS protein accumulation remain unclear. Here, we explored this process using wild-abortive CMS (CMS-WA) rice (<i>Oryza sativa</i>). We show that WA352, the causal protein of CMS-WA, is degraded by the ubiquitin-proteasome system (UPS). Structural analysis and protein truncation assays revealed that the N terminus of WA352 is critical for its anchoring to the inner mitochondrial membrane and its UPS-mediated degradation. Functional complementation confirmed that WA352<sup>151-352</sup>, lacking the N-terminal domain, accumulates constitutively in vegetative tissues, causing a reactive oxygen species burst and retarding rice growth. We further identified three mitochondrion-localized F-box proteins that participate in WA352 ubiquitination and degradation. Our findings demonstrate that UPS-mediated regulation restricts WA352 accumulation to anthers, allowing it to specifically disrupt anther development, thus helping to explain the male-specific effects of CMS genes in plants.

Also flagged:α-lactalbumintryptophanindole-3-lactatemetabolismamino acidbranched-chain amino acids
Journal Article 2025-10-16 No Snippets He X, Shoff S, Lee H, Hartvigsen ML, Kvistgaard AS, Slupsky CM.
Show Full Abstract

The inherent inter-individual variability and associated complexity of dietary response constitute a major research challenge, but also present an opportunity to trace personalized patterns that may serve as targets for improving health. Here, we investigated the function of α-lactalbumin, a rich source of tryptophan, in a formula feeding study. We leveraged neonatal piglets as a preclinical model for human infants and took a systems-level approach that integrates evidence from serum, urine, liver, brain, and the gastrointestinal tract. Transcriptional and metabolomics analysis revealed an individualized, divergent response to α-lactalbumin linked to either efficient utilization of tryptophan by the host or production of indole-3-lactate by intestinal microbiota. This variability was further highlighted by differences in metabolic and immunological effects in a tissue-specific manner. Our work highlights the importance of considering the nutrition-microbiota-host metabolism axis to optimize the phenotypic response of a diet.

HFE
Also flagged:GHhepatocellular carcinomacopperIronmetabolismsynthesis
Journal Article 2025-10-16 ✓ 5 Snippets Allaume P, Le Maître J, Bardou-Jacquet E, Island ML, Loreal O, Ropert-Bouchet M, Turlin B.
In-Text Gene Mentions

…samples with genetichemochromatosis(GH) and 5…

…identified on genetichemochromatosisliver biopsies which…

…genes such asHFE, HAMP, TFR2 or…

…primary diagnosis ofHFEhemochromatosis nor for…

…diagnosis of HFEhemochromatosisnor for iron…

Show Full Abstract

In this proof-of-concept study, we devised a calibration method with matrix-matched samples (phantoms) and performed quantitative LASER Ablation Inductively Coupled Mass Spectrometry (LA-ICP-MS) on 16 paraffin embedded human liver samples with genetic hemochromatosis (GH) and 5 liver resection specimens with hepatocellular carcinoma arising on GH, with correlation to histology and integration into our lab's workflow. LA-ICP-MS enables easy recognition of histological structures including portal tracts, fibrous septa and centrilobular veins. Compared to adjacent non-tumoral liver, hepatocellular carcinoma presented a decreased iron concentration (p = 0.034) and no significant difference in copper concentration. This profile was similar to that of three Iron Free Foci identified on genetic hemochromatosis liver biopsies which showed decreased concentration of iron compared to the adjacent parenchyma (p = 0.013) and no significant difference in copper concentration. LA-ICP-MS outperformed Perls' stain for iron detection in liver achieving a detection limit below 1 µg.g-1 and a lateral resolution of 5 μm and can be performed on 3 μm-thick paraffin-embedded slides with few pre-analytics constraints, enabling topographical analysis and quantification, overlay with histological stains and a preservation of the histological material contrary to classic ICP-MS. This new approach opens retrospective analysis of archived histological samples and may prove a tool in the evaluation of metal-related afflictions.

HFE
Also flagged:zincinsulin resistancechronic non-communicable diseasesLipidmetabolismIR
Journal Article 2025-10-16 ✓ 1 Snippet Ghafouri-Taleghani F, Bahadoran Z, Jeddi S, Tohidi M, Azizi F.
In-Text Gene Mentions

…the development ofhemochromatosis60 , a…

Show Full Abstract

The global prevalence of insulin resistance is increasing and it plays a significant role in the pathophysiology of chronic non-communicable diseases. Lipid metabolism disorder is a key mediator of insulin resistance. This cross-sectional study investigated the possible association between serum zinc (SZn) concentration and distinct surrogates of insulin resistance (IR). SZn were measured using flame atomic absorption spectrometry (FAAS) in 3078 adults (mean age of 48.8 ± 14.5, and 39.8% were male) participated in the Tehran Lipid and Glucose Study (2009-2011). The associations between SZn concentrations and surrogates of IR including homeostasis model assessment of insulin resistance (HOMA-IR), the triglyceride-glucose (TyG) index, the TyG-body mass index (TyG-BMI index), the metabolic score for insulin resistance (METS-IR), and the triglyceride-to-high-density lipoprotein cholesterol ratio (TG-to-HDL-C ratio), were assessed using multivariable logistic regression analysis. The mean serum zinc concentration was 112 ± 37.1 µg/dL. Serum zinc concentrations exceeding 119 µg/dL were significantly associated with a 32% increased probability of IR, identified by elevated TyG index (OR = 1.32; 95% CI = 1.08-1.59). Similarly, SZn concentrations greater than 91.3 µg/dL and 119 µg/dL were associated with a 30% and 34% increased probability of IR, as identified by the TG-HDL-C ratio, respectively. Our study revealed that elevated SZn concentrations, probably due to exposure to environmental pollutants, may be associated with increased probability of IR, identified by the high TyG index and TG-to-HDL-C ratio.

PRDX6
Also flagged:E3 ligaseRNF4AMLE3CRBNVHL
Journal Article 2025-10-16 ✓ 3 Snippets Gotthardt G, Weckesser J, Tascher G, Barros da Gama S, Uckelmann HJ, Sun S, Schwalm MP, Mosler T, Ferrario G, Friedmann Angeli JP, Münch C, Knapp S, Müller S.
In-Text Gene Mentions

…PRDX1, PRDX2 andPRDX6showed covalent binding…

…peroxiredoxins, such asPRDX6(Yang et al,…

…PRDX2 (C51), andPRDX6(C47) as direct…

Show Full Abstract

Covalent inhibitors are an attractive targeting strategy that has expanded the development of degraders to target poorly druggable proteins including the E3 ligase RNF4. We show that RNF4 is a potential vulnerability of AML. High RNF4 expression levels correlate with poor patient survival and depletion of RNF4 results in increased sensitivity of AML cells to antileukemic drugs. Therefore, we aimed to develop chemical degraders (PROTACs) of RNF4 using a known covalent RNF4 ligand (CCW16), containing a chloro-N-acetamide group, as well as established E3 ligands targeting CRBN or VHL. However, while CCW16 and CCW16-derived PROTACs react potently with cysteines in recombinant RNF4, in cells, CCW16 forms covalent bonds with a large number of proteins, including peroxiredoxins. Consequently, CCW16 based PROTACs do not trigger degradation of RNF4, but induce the ferroptosis marker heme oxygenase-1 and impair cell viability in a distinct, RNF4-independent, ferroptotic cell death pathway. We hypothesize that other chloro-N-acetamide-containing E3 ligase ligands would also induce ferroptosis. Indeed, the RNF114 ligand EN219 also strongly induces ferroptosis, suggesting that ligands harboring this electrophile induce undesired off-target toxicity.

TNFSF4
Also flagged:FNDC1fibronectin type III domain proteincancerscancerovarian serous cancerFibronectin type III domain containing 1
Journal Article 2025-10-16 ✓ 5 Snippets Jiao H, Tian J, Liu Q, Jiang M, Niu X, Zhang W, Gong L.
In-Text Gene Mentions

…of FNDC1 andTNFSF4, an immune checkpoint…

…positively correlated withTNFSF4(alias OX40L) in…

…Notably,TNFSF4is a critical…

…between FNDC1 andTNFSF4suggested that FNDC1…

…immune checkpoint moleculeTNFSF4(also known as…

Show Full Abstract

<h4>Background</h4>Fibronectin type III domain containing 1 (FNDC1) is a member of fibronectin type III domain protein family, which is known to play an important role in the metastasis of some cancers. However, it has not been reported about the relationship between FNDC1 and ovarian serous cancer.<h4>Methods</h4>Firstly, we investigated the expression of FNDC1 in various cancer types, and analyzed its diagnostic value and potential role in ovarian serous cancer using TCGA database. Subsequently, a series of bioinformatics methods were used to explore the potential oncogenic effects of FNDC1, including the relationship between FNDC1 expression and immune cell infiltration and immune checkpoint molecules, protein-protein interaction network, gene ontology and Kyoto Encyclopedia of Genes and Genomes analysis, gene set enrichment analysis, and toxicity analysis. Finally, the results were further verified by cell function experiments.<h4>Results</h4>FNDC1 was highly expressed in ovarian serous cancer, which was further verified in cell line, indicating that it might be as a diagnostic marker of ovarian serous cancer. In addition, the expression of FNDC1 and TNFSF4, an immune checkpoint molecule, showed a strong positive correlation, and both them were involved in the same signaling pathway, indicating that they might jointly affect T-cell responses in ovarian serous cancer. Moreover, this effect might be inhibited by austocystin D.<h4>Conclusion</h4>FNDC1 was a potential diagnostic marker, prognostic indicator, and target for the treatment of ovarian serous cancer.

Also flagged:gene expressioncarbonnitrogensaltcoppertoxoplasmosis
Journal Article 2025-10-16 No Snippets Yaman Y, Behrem S, Aymaz R, Keleş M, Ki̇şi̇ YE.
Show Full Abstract

This study investigated the genetic basis of wool traits in Karacabey Merino sheep, a dual-purpose breed developed in Northwest Türkiye. Heritability estimates were moderate for fibre diameter (FD; h² = 0.360) and greasy fleece weight (GFW; h² = 0.443), but low for staple length (SL; h² = 0.119), suggesting that while some traits may respond well to selection, others may require larger datasets or complementary approaches to capture their underlying genetic variation. Genetic and phenotypic correlations with growth traits revealed complex interactions, indicating that selection for wool traits may have trade-offs with growth performance, a key consideration in the breeding of dual-purpose sheep. To identify genomic regions associated with these traits, we employed multiple multi-locus GWAS methods (mrMLM, FASTmrMLM, FASTmrEMMA, pLARmEB, and ISIS EM-BLASSO). To enhance the robustness of the findings and reduce the likelihood of false positives, a stringent significance threshold (LOD ≥ 5) was applied. Post hoc power analysis further demonstrated that a considerable proportion of the identified QTNs exceeded the critical statistical power threshold (≥ 0.8), providing greater confidence in their biological relevance. Importantly, several loci were consistently detected across different models, underscoring their stability and potential value as reliable markers. Together, these findings provide novel insights into the polygenic architecture of wool traits in Karacabey Merino sheep and identify promising targets for marker-assisted selection. Beyond their immediate relevance to this breed, the results also contribute to a broader understanding of the genetic regulation of wool traits in dual-purpose sheep. Future studies incorporating functional validation, gene expression analyses, and replication in independent populations will be essential to confirm the functional significance of the identified loci. Such efforts would not only improve the reliability of these associations but also enable their practical application in breeding programmes aimed at optimising both wool quality and growth performance.

HFE
Also flagged:PHtype 2 diabetesessential hypertensionschizophreniamultiple sclerosissickle cell anemia
Journal Article 2025-10-16 ✓ 1 Snippet Ma Y, Xu H, Li Y, Kim H, Xu LL, Miao L, Xu P, Mao F, Zhou XJ, Zhou W, Lee S, Zhang JF, Zhang P, Bi W.
In-Text Gene Mentions

…at rs1799945 inHFEacross both multi-ancestry…

Show Full Abstract

<h4>Background</h4>Inclusion of individuals with diverse or admixed genetic ancestries is crucial to discover novel findings that may be missed by genomics analyses rooted solely in European population.<h4>Results</h4>Here, we present an analysis framework, SPAmix, which is scalable to a large-scale biobank data analysis including hundreds of thousands of admixed individuals and is universally applicable to various types of complex traits including quantitative traits, time-to-event traits, ordinal traits, and longitudinal traits. Since no alternative model is fitted, SPAmix primarily focuses on association p values. For each genetic variant, SPAmix uses genotype data and genetic principal components to estimate individual-specific allele frequency, which is subsequently used to calibrate p values via a retrospective analysis. A hybrid strategy including saddlepoint approximation (SPA) can greatly increase the accuracy to analyze rare genetic variants, especially if the phenotypic distribution is unbalanced or extremely unbalanced. We also propose SPAmix<sub>local</sub> to incorporate local ancestry to calculate ancestry-specific p values. To maximize the statistical powers, SPAmix<sub>CCT</sub> is proposed to combine the p values of SPAmix and SPAmix<sub>local</sub> via Cauchy combination.<h4>Conclusions</h4>The SPAmix-based approaches are more accurate than Tractor to address phenotypic variance heterogeneity among ancestries when analyzing quantitative traits and to address an unbalanced case-control ratio when analyzing binary traits. SPAmix<sub>CCT</sub> is an optimal unified approach for various cross-ancestry genetic architectures. Extensive simulation studies and real data analyses of 369,314 UK Biobank individuals from multiple ancestries demonstrated that SPAmix is scalable and can discover novel hits while controlling type I error rates well.

TNFSF4
Also flagged:Cancertumordeathantigen presentationCD4CD8
Journal Article 2025-10-16 ✓ 1 Snippet He L, Testini C, Hekmati N, Bonello A, Schiza A, Nwadozi E, Phillipson M, Strell C, Welsh M.
In-Text Gene Mentions

…, Sema4b ,Tnfsf4, and Bmp7…

Show Full Abstract

The vasculature and the immune system both play roles in breast cancer progression and metastasis. In an experimental mouse model of Shb-gene deficiency in endothelial cells, breast cancer lung metastasis correlated with immune suppression rather than with vascular leakage. The present study aimed to assess underlying gene expression changes in endothelial and immune cells responsible for this phenotype and to explore their relationship to human disease. Mouse endothelial cell Shb-gene deficiency, leading to 'vessel normalization', resulted in altered expression of chemo/cytokine genes and upregulation of immune checkpoint genes in immune cells. Endothelial cells under these conditions exhibited gene expression patterns compatible with reduced angiogenesis and vascular leakage. Additionally, genes whose products relate to immune cell vascular transmigration and function were affected. In a human triple-negative breast cancer cohort, tumors with reduced vascular leakage exhibited a higher relative proportion of regulatory T cells and larger tumor size. However, these changes were not associated with increased metastasis. In conclusion, a low leakage vascular phenotype reduces tumor cell intravasation/metastasis and modifies the immune response, which in the current context becomes pro-tumoral.

Also flagged:autophagymitophagyoxygenmitochondriadegradationorganelles
Journal Article 2025-10-16 No Snippets Nàger M, Calvoli M, Larsen KB, Birgisdottir AB.
Show Full Abstract

The cardiovascular system, consisting of the heart and blood vessels, ensures delivery of oxygen and nutrient-rich blood throughout the whole body. The major cell types include cardiomyocytes, endothelial cells, and vascular smooth muscle cells. Dramatic consequences, sometimes with a deadly outcome, may arise when the activity of cardiovascular cells is compromised. The cardiomyocytes are terminally differentiated cells and thus do not normally regenerate. To sustain the high energy demand of the beating heart, the cardiomyocytes contain a high amount of energy producing mitochondria. Adaptation to metabolic demands is an integral part of cellular homeostasis and involves autophagy. Autophagy is an evolutionary conserved intracellular degradation pathway of cellular constituents. Mitophagy refers to selective degradation of damaged, and thus potentially harmful, mitochondria through autophagy. Both autophagy and mitophagy are widely implicated in physiological and pathological processes within cardiovascular cells. In this review, we highlight studies applying genetic modifications in mouse models to reveal the impact of autophagy and mitophagy on cardiovascular health and disease.

SLC2A14
Also flagged:VNN2IL1R2Polycystic Ovary SyndromePCOSendocrine disorderGene Expression
Journal Article 2025-10-16 ✓ 1 Snippet Alali Z.
In-Text Gene Mentions

…2 Member 14 (SLC2A14) were differentially expresse…

Show Full Abstract

<h4>Introduction</h4>PCOS is a common endocrine disorder in women of reproductive age, with granulosa cells playing a key role in its development. This study aims to identify shared differentially expressed genes (DEG) in granulosa cells and blood from PCOS patients, offering potential biomarkers and therapeutic targets.<h4>Methods</h4>Transcriptomic data were obtained from the Gene Expression Omnibus (GEO) database: GSE95728 (granulosa cells; 7 PCOS, 7 controls) and two blood-based datasets, GSE85932 and GSE54248 (12 PCOS, 12 controls). In silico tools were employed to identify DEG, hub genes, and protein-protein interactions and to explore predicted drug targets.<h4>Results</h4>DEG analysis revealed that Vanin-2 (VNN2) and Interleukin-1 receptor type 2 (IL1R2) were consistently dysregulated in PCOS patients. Dysferlin (DYSF), Carbonic Anhydrase 4 (CA4), and Solute Carrier Family 2 Member 14 (SLC2A14) were differentially expressed between the blood datasets, while Aquaporin 9 (AQP9), C-X-C Motif Chemokine Receptor 1 (CXCR1), and <i>Annexin A3 (ANXA3)</i> were dysregulated in GSE95728 (granulosa cells) and GSE54248 (blood). Functional enrichment highlighted immune and metabolic pathways. Protein-protein interaction analysis identified AQP9 as a hub gene. Drug prediction analysis suggested that IL1R2 could be targeted by anakinra, while VNN2 was predicted to interact with pantothenic acid.<h4>Discussion</h4>The dysregulation of VNN2 and IL1R2 across tissue types suggests their involvement in immune-inflammatory processes in PCOS. The expression of AQP9 and other metabolism-related genes indicates possible immune-metabolic crosstalk, aligning with known PCOS pathophysiology.<h4>Conclusion</h4>VNN2 and IL1R2 show potential as biomarkers or therapeutic targets in PCOS. Further validation is needed to confirm their clinical significance and roles.

CACNA1E
Also flagged:Inflammatory bowel diseaseCrohn's diseasecolorectal canceraminosalicylatescorticosteroidsazathioprine
Journal Article 2025-10-16 ✓ 2 Snippets Zhang H, Zhou L, Zhou Q, Wen H, Lu H, Li J, Yu L, Li H, Zhu Y, Xu M, Lu B, Shi C, Zhang Y, Hu X, Shubhra QTH, He X, Cai X.
In-Text Gene Mentions

…pathological conditions, withCacna1e(Cav2.3) identified as…

…calcium channels, includingCacna1eand Cacna1d, was…

Show Full Abstract

Ulcerative colitis (UC) involves immune dysregulation, barrier dysfunction, and dysbiosis, driving chronic inflammation and pain. Current treatments show limited efficacy and high toxicity. This study develops an engineered nanozyme, CO&MnOx@Hs (CMHs), synthesized via in-situ manganese oxide (MnOx) generation on halloysite nanotubes (Hs) with controlled encapsulation of the carbon monoxide (CO)-releasing molecule CORM-401 for gas therapy. CMHs selectively accumulate at inflamed UC sites, where MnOx scavenges reactive oxygen species (ROS) while CO exerts anti-inflammatory effects. These combined actions restore immune homeostasis, repair intestinal barrier, modulate gut microbiota, and alleviate inflammation-associated pain. In murine ulcerative colitis, CMHs outperform conventional treatments, demonstrating superior therapeutic efficacy. Mechanistic studies reveal that CMHs activate Nrf2/HO-1 for antioxidant effects while modulating PI3K-Akt and HIF-1α/LDHA pathways to promote M2 macrophage polarization and suppress NF-κB/TNF signaling. CMHs also fortify the intestinal barrier by mitigating bacterial invasion and ROS-induced damage while activating focal adhesion and ECM-receptor interaction. 16S ribosomal RNA sequencing further confirms CMHs' ability to remodel gut microbiota, reinforcing their immunomodulatory potential. Importantly, CMHs relieve chronic pain by reducing inflammation, inhibiting SP secretion and TACR1 expression, and suppressing TRPV1 channel activation and Ca<sup>2+</sup> influx. These findings establish CMHs as a multi-targeted and highly effective therapeutic strategy for UC.

Also flagged:hydroxyapatiteosteogenesismTORFoxOPPARγtumor
Journal Article 2025-10-16 No Snippets Bu L, Wei X, Zhang Y, Xu Q, Han Z, Chen Y, Zheng J, Yang C.
Show Full Abstract

Artificial prosthesis and implants in oral and maxillofacial surgery are in urgent need of innovation. Plenty of bioactive agents have been added to PEEK, whereas complex processing technique hinders clinical translation. To break through the limitation, this study first applied gradient 3D printing technique to incorporate hydroxyapatite and nano-Ag into the functional coating on surface of PEEK. The advantage of gradient 3D printing facilitates rapid manufacturing and customization with minimum cost, which presents a significant advance toward clinical application. Compared to traditional PEEK, the dual enhancement of osteogenesis and anti-bacterial property were testified in vitro and in vivo. In addition, the bio-mechanism behind was first revealed to bridge the gap between theory and practice. Hydroxyapatite activated mTOR signaling pathway to enhance osteogenesis, and nano-Ag showed prominence in FoxO signaling pathway to mediate anti-bacterial property, while triggered ROS reaction and activated PPARγ pathway, minorly hindering osteointegration process. The novel gradient 3D printed PEEK with nano-coating could be rapidly manufactured with micro-structural surface, bone-like elastic modulus and excellent osteogenesis and anti-bacterial property, which has great potential for clinical translation in the field of oral and maxillofacial surgery.

MLLT10
Also flagged:catheter-related bloodstream infectionacute myelogenous leukemiaBloodstream InfectionpolymerasemethicillinmecA
Journal Article 2025-10-16 ✓ 1 Snippet Kojima M, Kitagawa H, Tadera K, Touge R, Kurihara S, Tanaka M, Shimomura M, Saeki I, Ohge H.
In-Text Gene Mentions

…leukemia (AML) with PICALM::MLLT10and experienced a…

Show Full Abstract

<b>Background</b>: Digital polymerase chain reaction (dPCR) is a highly sensitive molecular method that allows rapid detection of bacterial DNA and resistance genes, requiring only a small blood volume. Although not a new technology, its application in pediatric patients with suspected catheter-related bloodstream infection (CRBSI) remains limited. <b>Case presentation</b>: A 16-year-old female, diagnosed with recurrent acute myelogenous leukemia, received re-induction chemotherapy through a peripherally inserted central venous catheter (PICC). The patient developed a fever, and the blood culture (BC) drawn from the PICC was positive for methicillin-resistant <i>S. epidermidis</i>, leading to suspicion of CRBSI. Several antibiotics were used, and the PICC was replaced. Eventually, the fever subsided, and the BC was negative after PICC removal. The levels of <i>S. epidermidis</i>-specific DNA sequences and <i>mecA</i> genes were correlated with the results of the BC and clinical course. Turnaround time was significantly shorter in dPCR (3.5 h) than in the BC (14-21 h); dPCR was performed using only 400 µL of blood. <b>Conclusions</b>: This case highlights the potential of dPCR as a complementary tool to conventional BCs in the management of pediatric CRBSI. dPCR may support rapid decision-making and monitoring of the treatment response, particularly when sample volumes are limited.

TNFSF4
Also flagged:LAIR1Celiac Diseaseleukocyte-associated immunoglobulin-like receptor 1CD3CD3ECD4
Journal Article 2025-10-16 ✓ 1 Snippet Carreras J, Roncador G, Hamoudi R, Bombi JA, Masugi Y.
In-Text Gene Mentions

…TNFSF18 , andTNFSF4), 6q22.31 (…

Show Full Abstract

<b>Background</b>: Celiac disease (CD) is a gluten-sensitive immune-related enteropathy of the small intestine characterized by villus atrophy, crypt hyperplasia, and increased intraepithelial lymphocytes (IELs). <b>Objectives</b>: To characterize the phenotype of IELs and immune cells of the lamina propria of small intestine control using immuno-oncology and immune-phenotype markers and test the most relevant marker, an immune checkpoint co-inhibitory receptor, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), in CD. <b>Methods</b>: Immunohistochemical analysis of CD3 (CD3E), CD4, CD8, CD103 (ITGAE), Granzyme B (GZMB), TCR beta (β), TCR delta (δ), CD56 (NCAM), CD16 (FCGR3A), LAIR1 (CD305), PD-L1 (CD274), PD1 (CD279), BTLA (CD272), TOX2, HVEM (TNFRSF14), CD163, HLA-DP-DQ-DR, IL4I1, and FOXP3 was performed using histological analysis. Gene expression analysis was performed using an independent dataset to expand and confirm the findings. <b>Results</b>: IELs exhibited a cytotoxic T-cell phenotype and were CD3+, CD8+, CD103+, TCR beta+, and LAIR1+. The lamina propria (LP) was abundant in CD163+, HLA-DP-DQ-DR+, BTLA+, PD-L1+, CD103+, CD56+, and LAIR1+ cells corresponding to macrophages and T- and B-lymphocytes. In CD, IELs and part of the inflammatory cells of the lamina propria cells were LAIR1+. CD was characterized by higher quantity of LAIR1+ IELs and LP immune cells than the small intestine control (<i>p</i> = 0.004). Higher intestinal lesions evaluated by Marsh scoring were correlated with higher LAIR1 (<i>p</i> < 0.001). Gene expression analysis confirmed the overexpression of the <i>LAIR1</i> pathway in CD and highlighted <i>BTLA</i>. At the protein level, BTLA overexpression was confirmed in CD. Finally, as a proof-of-concept AI analysis, a convolutional neural network classified LAIR1-stained image patches between the three diagnoses of small intestine control, CD, and reactive tonsils with high accuracy (99.6%). <b>Conclusions</b>: IELs exhibit a cytotoxic T-cell phenotype and were found to be CD3+, CD8+, CD103+, TCR beta+, and LAIR1+ in the small intestine control. Increased numbers of LAIR1+ IELs and lamina propria immune cells characterize CD.

OLFM4
Also flagged:Vitamin ARetinoic Acidall-trans retinoic acidretinol dehydrogenase 10RDH10cytochrome P450, family 26, subfamily A, polypeptide 1
Journal Article 2025-10-16 ✓ 5 Snippets Guo S, Xiong Y, He L, Yan J, Li P, Li C, Ding B.
In-Text Gene Mentions

…increased Lgr5+ ,Olfm4, Znrf3 ,…

…VA up-regulated theOlfm4expression ( p…

…as Lgr5+, Znrf3,Olfm4, and TACSTD2, regulate…

…while Znrf3 andOlfm4contribute to niche…

…G-protein-coupled receptor 5+Olfm4Olfactomedin 4 RALDH…

Show Full Abstract

This study investigated the interactive effects of dietary vitamin A (VA) and all-trans retinoic acid (ATRA) on growth performance and intestinal health in broilers. A total of 432 one-day-old male Arbor Acres chicks were assigned to a 2 × 3 factorial design with two VA levels (2000 and 6000 IU/kg) and three ATRA levels (0, 0.25, and 0.50 mg/kg). The maize-soybean meal basal diet contained 180 IU/kg VA without extra VA supplementation. Results showed that compared with 0 mg/kg ATRA, 0.50 mg/kg ATRA enhanced average daily gain (ADG) during days 1-21 (<i>p</i> < 0.05). Compared with 2000 IU/kg VA, 6000 IU/kg VA improved body weight on day 35 as well as ADG and feed intake during days 22-35 and reduced feed conversion ratio over the entire trial (<i>p</i> < 0.05). There were VA × ATRA interactions for the ratio of villus height (VH) to crypt depth (CD) in duodenum as well as VH and CD in ileum on day 21 (<i>p</i> < 0.05). The 0.25 mg/kg ATRA decreased duodenal VH/CD and ileal VH in broilers fed 2000 and 6000 IU/kg VA, respectively (<i>p</i> < 0.05). The 0.50 mg/kg ATRA increased ileal VH in broilers fed both 2000 and 6000 IU/kg VA (<i>p</i> < 0.05). When birds were fed 6000 IU/kg VA, 0.50 mg/kg ATRA increased ileal CD compared with 0.25 mg/kg CD (<i>p</i> < 0.05). On day 35, compared with 0 mg/kg ATRA, 0.25 mg/kg ATRA increased ileal VH while 0.50 mg/kg ATRA decreased ileal CD, and both of them increased ileal VH/CD (<i>p</i> < 0.05). The VA × ATRA interactions for mRNA expression of jejunal <i>Mucin5ac</i> on day 21 and jejunal <i>Occludin</i>, <i>Claudin-1</i>, <i>Mucin 2</i>, leucine-rich-repeat-containing G-protein-coupled receptor 5<sup>+</sup> (<i>Lgr5<sup>+</sup></i>), zinc and ring finger 3 (<i>Znrf3</i>), and secreted phosphoprotein 1 (<i>SPP1</i>) on day 35 were detected (<i>p</i> < 0.05). Dietary 0.50 mg/kg ATRA up-regulated jejunal <i>Mucin5ac</i> expression in broilers fed 6000 IU/kg VA on day 21 as well as <i>Claudin-1</i>, <i>Znrf3</i>, and <i>SPP1</i> expression broilers fed 2000 IU/kg VA on day 35 (<i>p</i> < 0.05). The 0.25 mg/kg ATRA down-regulated <i>Occludin</i> expression in broilers fed 6000 IU/kg VA on day 35 (<i>p</i> < 0.05). The 0.25 mg/kg ATRA decreased and increased <i>Lgr5<sup>+</sup></i> expression on day 35 in broilers fed 2000 and 6000 IU/kg VA, respectively (<i>p</i> < 0.05). Both 0.25 and 0.50 mg/kg ATRA down-regulated <i>Mucin-2</i> expression in broilers fed 2000 IU/kg VA on day 35 (<i>p</i> < 0.05). The VA × ATRA interactions were observed for jejunal retinol dehydrogenase 10 (RDH10), cytochrome P450, family 26, subfamily A, polypeptide 1 (<i>CYP26A1</i>), retinoic acid receptor (<i>RAR</i>) α, and <i>RARβ</i> expression on days 21 and 35 (<i>p</i> < 0.05). Both 0.25 and 0.50 mg/kg up-regulated <i>RDH10</i>, <i>CYP26A1</i>, and RARβ expression in broilers fed 6000 IU/kg VA (<i>p</i> < 0.05). The <i>RAR</i>α expression was up-regulated by 0.50 and 0.25 mg/kg ATRA on days 21 and 35, respectively (<i>p</i> < 0.05). Plasma metabolomics identified 269 VA- and 185 ATRA-associated differential metabolites, primarily enriched in lipid metabolism, vitamin digestion and absorption, and bacterial infection pathways. In conclusion, dietary 0.50 mg/kg ATRA and 6000 IU/kg VA enhanced growth performance, intestinal integrity, and VA metabolism, partly through activation of retinoic acid receptors and modulation of plasma lipid metabolism.

TNFSF4
Also flagged:seleniummetabolismlung adenocarcinomatumorLUADgene expression
Journal Article 2025-10-16 ✓ 1 Snippet Chen Y, Li P, Wang Y, Shen S, Chen N, Peng H, Xu Z.
In-Text Gene Mentions

…Notably, CD276 andTNFSF4showed elevated expression…

Show Full Abstract

<h4>Background</h4>The disruption of selenium metabolism has been associated with tumor progression. However, the prognostic significance and underlying molecular mechanisms of selenium metabolism in lung adenocarcinoma (LUAD) remain inadequately understood. This study primarily aimed to identify and validate prognostic genes related to selenium metabolism in LUAD patients.<h4>Methods</h4>Transcriptomic datasets from patients diagnosed with LUAD were meticulously analyzed to identify differentially expressed genes associated with selenium metabolism. The genes selected for the prognostic risk model were determined through various analyses, including differential gene expression assessment, univariate and multivariate Cox proportional hazards regression analyses, as well as other relevant analytical methods. A systematic approach was employed for functional enrichment analysis, characterization of the immune microenvironment, somatic mutation analysis, and evaluation of drug sensitivity to elucidate the mechanisms linked to prognostic genes and risk categories. Finally, a reverse transcription quantitative PCR(RT-qPCR) assay was conducted to validate the expression levels of the identified prognostic genes.<h4>Results</h4>F2, GPX3, KMO, and KYNU were identified as prognostic genes for establishing a risk model. The functions of these LUAD prognostic genes were influenced by DNA replication pathways, cell cycle regulation, and quiescent CD4 memory T cells. In the high-risk group (HRG), KEAP1, TTN, and USH2A exhibited the highest mutation rate at 48%, while TTN had an even higher mutation rate of 52% in the low-risk group (LRG). Within the HRG cohort, both cisplatin and gemcitabine demonstrated significant sensitivity. Ultimately, RT-qPCR findings corroborated results obtained from bioinformatics analyses; specifically compared to normal samples: GPX3, KMO, KYNU showed significant downregulation in LUAD tissues while F2 was found to be upregulated in LUAD.<h4>Conclusion</h4>This study identified four prognostic genes in LUAD and examined their associated mechanisms of action, which may contribute to the development of novel treatment strategies. The integration of immune characterization with drug sensitivity analysis offers valuable insights for stratified therapy.

Also flagged:neurodegenerative diseasesMitochondriamitophagymitochondrialpathogenesisAD
Journal Article 2025-10-16 No Snippets Chen B, Wang Q, Wang Y, Liu Q, Chen W, Mao H, Li J, Liu Q, Zhou X.
Show Full Abstract

<h4>Background</h4>Neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, <i>etc.</i>, are a group of complex and heterogeneous disorders characterized by progressive synaptic loss and pathological protein alterations. Mitochondria are the main source of energy produced by neurons and support the high energy consumption of the nervous system. Mitochondrial quality control, involving processes like mitophagy and mitochondrial biogenesis, is crucial for mitochondrial homeostasis, and mitochondrial dysfunction is closely related to neurodegenerative diseases pathogenesis, making targeting mitochondrial quality control a potential therapeutic strategy. Natural products offer benefits such as cost-effectiveness, fewer side effects, and other positive qualities, making them suitable choices as supplements or alternatives to traditional drugs for treating neurodegenerative diseases.<h4>Methods</h4>A thorough search was conducted on many databases including Web of Science, PubMed, EMBASE, and MEDLINE to investigate the role of mitochondria in neurodegenerative diseases and the therapeutic effects of natural products.<h4>Results</h4>By searching the relevant studies on neurodegenerative diseases and mitochondria in recent years, we observed a rise in the number of studies examining the functional characteristics and biological events of mitochondrial quality control systems in neurodegenerative diseases pathogenesis and the potential for natural products regulating mitochondrial quality control to improve neurodegenerative diseases.<h4>Conclusion</h4>This review summarizes the functional characteristics and biological events of mitochondrial quality control systems in neurodegenerative diseases pathogenesis, and comprehensively analyzes the pharmacological mechanisms by which natural products regulate mitochondrial quality control to improve neurodegenerative diseases, aiming to provide a scientific basis for further research and new clinical drug development.

HTT
Also flagged:Cas9agingNeurodegenerative diseasesmitochondrialCRISPRneurodegenerative disorders
Journal Article 2025-10-16 ✓ 1 Snippet Shamsi A, Alrouji M, AlOmeir O, Tasqeruddin S, Dinislam K, Zuberi A.
In-Text Gene Mentions

…of the huntingtin (HTT) gene haplotype structure…

Show Full Abstract

Neurodegenerative diseases such as Alzheimer's, Parkinson's, Huntington's, ALS, and spinocerebellar ataxia are becoming more prevalent as populations age, posing major global health challenges. Despite decades of research, effective treatments that halt or reverse these conditions remain elusive. Aging is the most significant risk factor in the development of these diseases, intertwining with molecular processes like DNA damage, mitochondrial dysfunction, and protein aggregation. Recent advances in gene-editing technologies, particularly CRISPR-Cas9, are beginning to shift the therapeutic landscape. This revolutionary tool allows for precise correction of genetic mutations associated with neurodegeneration, offering the potential for disease modification rather than symptom management alone. In this review, we explore how CRISPR-Cas9 is being leveraged to target key genes implicated in various neurodegenerative conditions and how it may overcome barriers posed by aging biology. We also examine the delivery systems and safety challenges that must be addressed before clinical application. With continued progress, CRISPR-Cas9 could mark a turning point in our ability to treat or even prevent age-related neurological decline.

SOX6
Also flagged:systemic autoimmune disorderpathogenesismacrophagetype I interferonNF-κBSTAT
Journal Article 2025-10-16 ✓ 1 Snippet Chengzhi W, Songwei L, Yifan L, Mengmeng D, Huan L.
In-Text Gene Mentions

…miR-23b-3p expression targetsSOX6, downregulating NF-κB p65…

Show Full Abstract

Primary Sjögren's disease (SjD) is a chronic systemic autoimmune disorder whose pathogenesis remains incompletely understood. Current clinical interventions demonstrate limited efficacy, yielding suboptimal therapeutic outcomes. microRNAs (miRNAs)-critical regulators of transcriptional networks-participate in SjD pathogenesis through multifaceted mechanisms. Dysregulated miRNA expression during SjD progression directly influences disease prognosis, establishing miRNAs as promising therapeutic targets. Evidence implicates macrophage polarization, apoptosis dysregulation, Th17/Treg imbalance, T/B lymphocyte dysfunction, glandular impairment, and aberrant type I interferon responses in SjD development. Notably, miR-216a-3p, miR-31-5p, and miR-155-5p modulate key signaling pathways (NF-κB, JAK/STAT, PI3K/AKT) to optimize macrophage polarization, suppress apoptosis, restore Th17/Treg equilibrium, regulate T/B lymphocyte activity, enhance glandular function, normalize type I interferon responses,thereby exerting potent anti-SjD effects. This review synthesizes recent literature to elucidate SjD pathogenesis and miRNA-mediated therapeutic mechanisms, providing a theoretical foundation for novel SjD management strategies.

BTN2A1
Also flagged:chimeric antigen receptorCARcancerhematological malignanciessolid tumorstumor
Journal Article 2025-10-16 ✓ 1 Snippet Hou Y, Hu S, Liu C, Chen X, Wang Y, Li Y, Fu Z, Feng C, Gong Y, Liu Z, Peng S.
In-Text Gene Mentions

…(e.g., MICA/B, ULBPs,BTN2A1/BTN3A1) offers a dual-targeti…

Show Full Abstract

Adoptive cell therapy (ACT) employing chimeric antigen receptor (CAR) engineering represents a transformative advancement in cancer immunotherapy. CAR-T cell therapies have demonstrated significant clinical success in hematological malignancies, yet their application to solid tumors faces persistent challenges. Key limitations include the paucity of tumor-specific antigens, poor intratumoral infiltration, immunosuppressive tumor microenvironment (TME), and treatment-related toxicities such as cytokine release syndrome (CRS) and neurotoxicity. In contrast, CAR natural killer (CAR-NK) cells show promise in solid tumors such as ovarian, pancreatic, and glioblastoma, with encouraging preclinical and early clinical evidence, although limited persistence and antigen heterogeneity remain major challenges. Unlike CAR-T cells, CAR-NK therapies mediate tumor clearance through both cytotoxic (e.g., granzyme/perforin release) and cytokine-mediated mechanisms while mitigating toxicity risks. Their lack of human leukocyte antigen (HLA) dependency enables "off-the-shelf" manufacturing from allogeneic donors, circumventing patient-specific production bottlenecks. CAR-macrophage (CAR-M) therapies further address solid tumor barriers by leveraging innate phagocytic clearance, antigen-presenting functions, and TME penetration. Macrophages inherently infiltrate hypoxic tumor regions and remodel stromal barriers, enabling CAR-Ms to synergize with adaptive immunity by cross-priming T cells. Preclinical models highlight CAR-M efficacy in depleting immunosuppressive tumor-associated macrophages (TAMs) and reversing TME-driven immune evasion. Emerging CAR- Gamma-Delta T (CAR-γδ T) cell therapies combine CAR-mediated antigen specificity with the intrinsic tumoricidal activity of γδ T cells, which recognize stress-induced ligands independently of major histocompatibility complex (MHC) presentation. This dual-targeting capability enhances tumor selectivity while reducing on-target/off-tumor toxicity. This review systematically examines cellular sources, mechanistic advantages and clinical progress. By evaluating these platforms' complementary strengths, we propose rational strategies for integrating CAR-NK, CAR-M, and CAR-γδ T cells into tailored therapeutic regimens for solid tumors.

HTT
Also flagged:Neurodegenerative DisordersNeurodegenerative diseasesamyotrophic lateral sclerosissynaptic transmissionIL-1IL-10
Journal Article 2025-10-16 ✓ 1 Snippet Bethea JP, Sharma H, Doberstein N, Shenker T, Gregory B, Hoffman R, Aizenman D, Guirguis G, Hoffmann J, Tazani S, Harris Z, Costin J.
In-Text Gene Mentions

…in the Huntingtin (HTT) gene on chromosome…

Show Full Abstract

Neurodegenerative diseases are comprised of a host of chronic conditions that impair the central nervous system. Osteopathic manipulative treatment (OMT) consists of many non-invasive modalities that can be used to treat a wide variety of ailments and conditions. OMT is reported to increase the range of motion and lymphatic flow, as well as decrease pain in a wide array of disorders. However, the efficacy of using OMT in neurodegenerative disorders has not been well established. The objective of this scoping review is to map the evidence that pertains to the application of OMT in treating neurodegenerative disorders and identify the gaps in the literature on this subject. This study was designed according to the Joanna Briggs Institute (JBI) guidelines for scoping reviews to gather information on OMT's potential efficacy in managing Parkinson's disease (PD), Alzheimer's disease (AD) dementia, amyotrophic lateral sclerosis (ALS), and Huntington's disease (HD). Peer-reviewed literature was collected through the Excerpta Medica database (EMBASE), Ovid Medical Literature Analysis and Retrieval System Online (MEDLINE), and Web of Science. The criteria were limited to papers in English published between 1999 and 2023. The following search string was utilized: "osteopathic manipulative treatment" OR "osteopathic manipulation" AND "neurodegenerative disorders" OR "Alzheimer's disease" OR "dementia" OR "amyotrophic lateral sclerosis" OR "Parkinson's disease" OR "Huntington's chorea". One hundred and forty-three articles were identified following final screening and critical appraisal, with eleven articles selected for analysis in this study. Data from the selected articles demonstrated that OMT can possibly attenuate symptoms in patients diagnosed with neurodegenerative diseases. Studies in rats showed that OMT techniques were found to alter cholinergic neuronal genes, improve spatial learning and memory, reduce amyloid β protein levels, modulate synaptic transmission, and increase levels of the cytokines IL-1, IL-10, IL-13, RANTES, IL-17A, and EOTAXIN effects in AD dementia. ALS patients demonstrated a high level of satisfaction with OMT and did not report any adverse effects, though there was no decrease in pain or increased quality of life reported. PD patients reported improved postural stability, balance, and gait after OMT. No results were returned regarding OMT's effects on HD.  Preliminary results in human PD and ALS patients who received OMT as an adjunct to traditional treatment regimens showed promising results, though few studies were found that address the topic, and the sample sizes of the studies that were found were small. There were no studies of the effects of OMT on human patients with AD or HD found, though preclinical studies in rats supported their trial in subsequent human studies. While current research on the impact of OMT on these neurodegenerative diseases is promising, there remain large gaps in the literature. Further research is necessary to support the use of and long-term efficacy of OMT in neurodegenerative diseases.

HFE
Also flagged:Hepatocellular carcinomaliver diseasealcoholMetALDalcohol-associated liver diseasedeath
Journal Article 2025-10-16 ✓ 1 Snippet John BV, Bastaich D, Paulus E, Spector S, Dahman B.
In-Text Gene Mentions

…hepatitis, hepatitis B/C,hemochromatosis, primary biliary cholangitis,…

Show Full Abstract

<h4>Background & aims</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) with increased alcohol consumption (MetALD) is an important, yet understudied cause of liver disease. This study aimed to examine hepatocellular carcinoma (HCC) rates in patients with MetALD and compare them with MASLD, alcohol-associated liver disease (ALD), and controls.<h4>Methods</h4>We conducted a retrospective cohort study of veterans with MetALD, MASLD, ALD, or no SLD. We used Poisson regression to estimate incidence rates within stratifications of patient characteristics, and a multivariable time-updated Fine and Gray model with death as a competing risk to examine HCC risks.<h4>Results</h4>We included 666,428 participants (392,286 MASLD, 104,065 MetALD, 40,230 ALD, and 129,847 controls) between 1 January 2011 and 31 December 2022, with a follow-up until 31 May 2023. All participants underwent abdominal imaging or transient elastography, confirming the presence (among SLD) or absence (among controls) of steatosis, along with identification of harmful alcohol use and ascertainment of cardiometabolic risk factors. In patients without cirrhosis, the adjusted HCC rates per 100,000 person-years were lowest for MASLD, higher for MetALD, and highest for ALD. The cumulative incidence of HCC at 5 years was highest with ALD, followed by MASLD and MetALD, with rates similar in the latter two groups. At 10 years, the cumulative incidence of HCC per 100,000 individuals was the highest with ALD (1,176.65), followed by MetALD (814.16), and MASLD (762.86).<h4>Conclusions</h4>The risk of HCC associated with MetALD is higher than MASLD, significantly lower than ALD, and likely driven by alcohol. Although HCC rates in non-cirrhotic patients with MetALD are not high enough to justify surveillance, this study identifies a relatively higher risk group compared to MASLD, which warrants counselling on alcohol cessation.<h4>Impact and implications</h4>Limited data exist on the risk of hepatocellular carcinoma (HCC) in patients with MetALD (metabolic dysfunction-associated steatotic liver disease [MASLD] with increased alcohol consumption) and how it compares with other steatotic liver diseases. In this retrospective study of 666,428 patients from the Veterans Analysis of Liver Disease cohort, we observed that the risk of HCC per 100,000 person-years in patients without cirrhosis with MetALD was 80.24 (95% CI 73.23-87.94), which was intermediate between MASLD (71.64, 95% CI 68.14-75.32) and ALD (104.83, 91.59-119.98). The cumulative incidence of HCC per 100,000 persons at 5 years was the highest with ALD (663.79, 581.77-754.83), followed by MASLD (450.71, 428.46-473.89), MetALD (449.89, 407.56-495.74), and controls (76.03, 61.47-93.46). The limitations of the study include its retrospective design and a study population enriched with male veterans with a higher prevalence of metabolic syndrome.

Also flagged:mucosa-associated lymphoid tissue translocation gene 1cancersGBMMALT1nuclear factor kappa-Bcancer
Journal Article 2025-10-16 No Snippets Li H, Du Z, Lu H, Xi J, Hu H.
Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is the most common intracranial malignancy in adults, and traditional treatments such as surgery, chemotherapy, and radiotherapy have shown limited improvements in patient prognosis. While immunotherapy has transformed treatment outcomes for many cancers, GBM patients often exhibit resistance due to the tumor's unique immunosuppressive microenvironment, resulting in poor prognosis. The mucosa-associated lymphoid tissue translocation gene 1 (MALT1) has been implicated in the activation of nuclear factor kappa-B and the promotion of cancer cell proliferation and migration. Inhibiting MALT1 has been shown to reduce the mesenchymal phenotype of GBM. Thus, understanding the role of MALT1 in GBM's immunosuppressive microenvironment is crucial.<h4>Materials and methods</h4>In this study, we analyzed RNA-seq data from 169 GBM patients obtained from The Cancer Genome Atlas database, categorizing them into MALT1_High and MALT1_Low groups based on MALT1 expression levels. We quantified the enrichment levels of 29 immune signatures for each patient in both the groups. We then identified differentially expressed immune genes and used these to develop an immune prognostic signature (IPS) through Least Absolute Shrinkage and Selection Operator Cox regression analysis. Furthermore, we validated the role of MALT1 in GBM through MTT(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), scratch assays, and small interfering RNA knockdown experiments. In addition, we tested the effects of promising MALT1 inhibitors identified through computer-aided technologies.<h4>Results</h4>Our analysis revealed that PDYN, a gene not previously associated with GBM prognosis, could serve as a potential target. Using a three-gene IPS, we created a predictive nomogram model to assess the prognosis of GBM patients. The validation experiments confirmed that MALT1 plays a significant role in promoting GBM cell proliferation, migration, and invasion. In addition, the computer-aided identification of MALT1 inhibitors demonstrated their potential to inhibit GBM progression.<h4>Conclusion</h4>This study explored the role of MALT1 in GBM's immunosuppressive microenvironment, developed a novel MALT1-related prognostic model, and identified potential targeted therapies for GBM, providing new avenues for therapeutic intervention.

bioRxiv 2025-10-16 Preprint (No Snippets API) Shaw S, Hughes-Games A, Montaguth OT, McDowall S, Diffin F, Dunn D, Cross S, Szczelkun M.
Show Full Abstract

<h4>ABSTRACT</h4> SauUSI is a dimeric, ATP-dependent Type IV restriction enzyme that protects Staphylococcus aureus by cleaving non-self DNA containing 5-methylcytosine or 5-hydroxymethylcytosine. Using biophysical, single-molecule, and nanopore sequencing methods, we show that 5-methylcytosine recognition first induces ATP-driven unidirectional translocation by one helicase-like subunit, displacing its target recognition domain (TRD). The partner TRD can then bind the liberated modified site, stabilizing a growing DNA loop. On symmetrically methylated DNA, both subunits engage in bidirectional loop translocation. Cleavage is triggered by binding a distal methylated site, by preferred DNA sequences, or upon reaching a DNA end. Interactions with other SauUSI dimers or protein roadblocks affect cleavage site distributions but are not required for nuclease activation. While the first cleavages principally generate blunt-ends or one-nucleotide 3′ overhangs, multiple binding-translocation cycles by individual enzymes ultimately shred the modified non-self DNA, neutralizing its threat.

DCC
Also flagged:Pancreatic cancercancerlocalized diseasepancreatic ductal adenocarcinomaPDACtumors
Journal Article 2025-10-15 ✓ 1 Snippet Shen MJ, Jamali A, Katona BW.
In-Text Gene Mentions

…, SMAD4 ,DCC, CDKN2A ,…

Show Full Abstract

Pancreatic cancer (PC) is a devastating disease, due in part to its diagnosis frequently being made at an advanced stage. Ongoing efforts are aimed at identifying early-stage PC in high-risk individuals, as early detection leads to downstaging of PC and improvements in survival. However, there are a myriad of challenges that arise when trying to optimize PC early detection strategies, including selection of the appropriate high-risk individuals and selection of the test or combination of tests that should be performed. Here, we discuss the populations that are the strongest candidates for PC screening and review professional PC screening guidelines. We also summarize the current state of imaging techniques for early detection of PC and further review many studied biomarkers - ranging from nucleic acid targets, proteins, and the microbiome - to highlight the current state of the field and the challenges that remain in the years to come.

Also flagged:malocclusiongingival recessiontemporomandibular joint disordersglass ionomersynthesisorganization
Journal Article 2025-10-15 No Snippets Rasol OA, Hajeer MY, Alam MK, Jaber ST, Kara-Boulad JM, Jaber S.
Show Full Abstract

<h4>Background</h4>A deep bite is a prevalent malocclusion, and its treatment remains one of the most debated topics in orthodontics due to the variety of underlying causes and the diverse orthodontic approaches employed to address it.<h4>Objective</h4>This systematic review aimed to assess the evidence on the most effective approach for treating deep bites in adult and adolescent patients.<h4>Search methods</h4>A thorough search was performed up to January 2025 among these databases: PubMed<sup>®</sup>, the Cochrane Library, Scopus<sup>®</sup>, Web of Science™, Embase<sup>®</sup>, and Google™ Scholar.<h4>Selection criteria</h4>Only randomized controlled trials (RCTs) were included in this review on adult and adolescent patients with deep bite malocclusion who underwent any orthodontic treatment to correct this malocclusion.<h4>Data collection and analysis</h4>The Cochrane tool (ROB2) was employed to assess the risk of bias, while the GRADE approach was used to evaluate the quality of evidence.<h4>Results</h4>Eight RCTs were included in this review. Five of the eight studies were suitable for qualitatively synthesizing the data. The meta-analysis showed that the miniscrew-supported intrusion (MSI) caused a statistically significant amount of overbite reduction (mean difference (MD) = - 0.36 mm), upper incisor intrusion (MD = - 0.77 mm), and upper incisor proclination (MD = 0.63<sup>o</sup>) compared to the Connecticut intrusion arch (CIA), and the quality of evidence was low to moderate. Moderate-quality evidence indicated that there was no statistically significant difference between the anterior bite turbos (ABT) and the lower reversed curve of Spee (RCS) regarding overbite reduction (MD= - 4.07 mm, MD = - 3.27 mm, respectively). A low-quality evidence indicated that the MSI and the utility arch (UA) caused more overbite reduction than the J-Hook headgear (J-Hg) (MD = -2.33 mm, MD = - 2 mm, MD = - 0.8 mm, respectively). However, the MSI was superior regarding upper incisor intrusion than the UA and the J-Hg (MD = - 2.08 mm, MD = - 1.33 mm, MD= - 0.1 mm, respectively).<h4>Conclusion</h4>Low-quality evidence suggests that MSI is superior to CIA for reducing overbite, and causing more upper incisor proclination. Moderate -quality evidence indicates that MSI is superior to CIA for intruding the upper incisors. Moderate-quality evidence indicates that the ABT and the RCS effectively reduce overbite. Low-quality evidence suggests that the MSI and the UA cause more overbite reduction and upper incisor intrusion than the J-Hook headgear, and the MSI causes more upper incisor intrusion than the UA.<h4>Registration</h4>The protocol was registered in the PROSPERO database (CRD42025633739) during the first stages of the review.

OLFM4
Also flagged:biliary tract cancersBiliary tract cancertumorsolid tumorsbiliary tumorscholangiocarcinoma
Journal Article 2025-10-15 ✓ 2 Snippets Tang N, Li J, Gu A, Li M, Liu Y.
In-Text Gene Mentions

…that Olfactomedin 4 (OLFM4), originating from malignant…

OLFM4was linked to…

Show Full Abstract

Biliary tract cancer (BTC) is a highly heterogeneous and aggressive gastrointestinal malignancy, marked by a high mortality rate and limited treatment efficacy. The primary contributing factors include the absence of reliable early detection methods, the anatomical intricacy of the biliary system, the inherently aggressive tumor biology, and the restricted effectiveness of systemic therapies. A profound understanding of molecular characteristics and clinically relevant emerging biomarkers is essential for advancing BTC treatment strategies. Recent developments in single-cell multi-omics technologies have enabled the analysis of genetic, transcriptomic, proteomic, and metabolomic data at the single-cell resolution, thereby uncovering the heterogeneity and complexity of tumor biology. These techniques provide critical insights into the diversity of immune cell populations within the tumor microenvironment (TME) and offer novel perspectives on tumor progression and potential therapeutic interventions. While single-cell technologies have significantly advanced the study of solid tumors, their application in BTC remains nascent, with a paucity of comprehensive reviews. This review systematically integrates single-cell genomics, transcriptomics, and epigenomics data to construct a cross-omics molecular atlas of BTC. It highlights the utility of single-cell multi-omics technologies in elucidating tumor heterogeneity, microenvironment remodeling, and clonal evolution in biliary tumors, while thoroughly analyzing their implications for clinical outcomes. Furthermore, this review explores personalized treatment strategies informed by single-cell technologies and underscores the significance of these technologies as indispensable tools for unraveling the complexity of BTC and fostering mechanism-based therapeutic innovation.

SLC9C2
Also flagged:TMEM217sodium-proton exchangerSLC9C1sperm motilityadenylyl cyclasesAC
Journal Article 2025-10-15 ✓ 5 Snippets Iida-Norita R, Miyata H, Ninomiya A, Emori C, Kamoshita M, Pan C, Wang H, Ikawa M.
In-Text Gene Mentions

…SLC9C1 Coevolves withSLC9C2and TMEM217 .…

SLC9C2, a homolog…

…SLC9C1 ,SLC9C2, and TMEM217…

…data suggest thatSLC9C2and TMEM217 coevolve…

…While bothSLC9C2and TMEM217 were…

Show Full Abstract

Sperm motility is essential for male fertility and is tightly controlled by signaling events in the flagellum. <i>Slc9c1</i> encodes a sperm-specific Na<sup>+</sup>/H<sup>+</sup> exchanger (sNHE/SLC9C1) that localizes to the flagellum and is indispensable for sperm motility and male fertility. SLC9C1 is unique among Na<sup>+</sup>/H<sup>+</sup> exchangers in that it possesses a voltage-sensing domain (VSD), the physiological function of which remains poorly understood in mammals. Here, by analyzing coevolving genes with <i>Slc9c1</i>, we identified <i>Tmem217</i>, which encodes a transmembrane protein that is localized in the sperm flagellum. Knockout (KO) of <i>Tmem217</i> in mice resulted in sperm motility defects and male infertility, phenocopying <i>Slc9c1</i> KO mice. Coimmunoprecipitation and structural prediction analyses indicated that TMEM217 binds to SLC9C1 via its VSD. Further analyses indicated that the amounts of SLC9C1 and its associated protein, soluble adenylyl cyclase (sAC), were lost in mature <i>Tmem217</i> KO spermatozoa, leading to disrupted 3',5'-cyclic monophosphate (cAMP) signaling pathways. Remarkably, cAMP analogs restored the impaired motility and fertilizing ability of <i>Tmem217</i> KO spermatozoa in vitro, validating the essential role of TMEM217 in regulating cAMP production. Our findings indicate that the association of TMEM217 with SLC9C1 via its VSD is critical for the proper organization and function of the SLC9C1-sAC-cAMP axis in mature spermatozoa.

LRRC7
Also flagged:cell divisioncytokinesisCyclin-dependent kinaseCDKCyclinsorganization
Journal Article 2025-10-15 ✓ 1 Snippet Parham J, Sorichetti V, Cezanne A, Foo S, Kuo YW, Hoogenberg B, Radoux-Mergault A, Mawdesley E, Gatward LD, Boulanger J, Schulze U, Šarić A, Baum B.
In-Text Gene Mentions

…it is toCondensinor Cohesin (…

Show Full Abstract

Cells must coordinate DNA segregation with cytokinesis to ensure that each daughter cell inherits a complete genome. Here, we explore how DNA segregation and division are mechanistically coupled in archaeal relatives of eukaryotes, which lack Cyclin-dependent kinase (CDK)/Cyclins. Using live cell imaging, we first describe the series of sequential changes in DNA organization that accompany cell division in <i>Sulfolobus,</i> which computational modeling shows likely aid genome segregation. Through a perturbation analysis we identify a regulatory checkpoint which ensures that the compaction of the genome into two spatially segregated nucleoids only occurs once cells have assembled a division ring-which also defines the axis of DNA segregation. Finally, we show that DNA compaction and segregation depend, in part, on a ParA homologue, SegA, and its partner SegB, whose absence leads to bridging DNA. Taken together, these data show how regulatory checkpoints like those operating in eukaryotes aid high-fidelity division in an archaeon.

HFE
Also flagged:vascular dementiadementiaAlzheimer's diseasepathogenesisironmetabolism
Journal Article 2025-10-15 ✓ 1 Snippet Yang J, Zhao H, Huang Y.
In-Text Gene Mentions

…those associated withhemochromatosis, substantially elevate the…

Show Full Abstract

Vascular dementia (VaD) is recognized as the second most prevalent form of dementia after Alzheimer's disease, with its pathogenesis intricately associated with cerebrovascular pathologies, including chronic hypoperfusion, oxidative stress, and neuroinflammation. Recent studies have highlighted dysregulated iron metabolism as a pivotal factor in the pathogenesis of VaD; however, the precise mechanisms and therapeutic implications of this dysregulation remain insufficiently elucidated. In this article, we synthesize clinical and basic research to systematically explore the interaction between iron metabolism and VaD. Aberrant iron metabolism contributes to neuronal damage by exacerbating oxidative stress, lipid peroxidation, and ferroptosis, while cerebrovascular injuries, such as blood-brain barrier disruption and chronic inflammation, further compromise iron metabolism, thereby perpetuating a detrimental cycle. From a diagnostic standpoint, imaging modalities such as susceptibility-weighted imaging, alongside biomarkers like ferritin and soluble transferrin receptors, serve as effective instruments for detecting iron-related pathologies in VaD. At the therapeutic level, the use of chelating agents such as deferoxamine and deferiprone, in combination with antioxidants and innovative nanomaterials, has exhibited neuroprotective effects in animal models by alleviating iron-induced oxidative damage. Nevertheless, further validation is required to establish their clinical efficacy and safety. This is a narrative review. This article investigates the influence and significance of iron metabolism in the pathophysiology of VaD and explores potential therapeutic targets associated with iron metabolism, offering implications for future clinical applications.

POU3F2
Also flagged:neuro-oncological ventral antigen 1NOVA1brain developmentautismschizophrenianucleotide
Journal Article 2025-10-15 ✓ 1 Snippet Joannes-Boyau R, de Souza JS, Arora M, Austin C, Westaway K, Moffat I, Wang W, Liao W, Zhang Y, Adams JW, Fiorenza L, Dérognat F, Moncel MH, Schwartz GT, Bailey M, Dos Santos FF, Guardia GDA, Mercuri RLV, Galante PAF, Martins AMA, Tsu BL, Barnes CA, Yates J, Petroski LP, Sanchez-Sanchez SM, Oviedo J, Herai RH, Lemos B, Tonge M, Muotri AR.
In-Text Gene Mentions

…, FOXP2 ,POU3F2, and GRID2…

Show Full Abstract

Gene-environmental interactions shape the evolution of brain architecture and function. Neuro-oncological ventral antigen 1 (<i>NOVA1</i>) is one gene that distinguishes modern humans from extinct hominids. However, the evolutionary pressures that selected the modern <i>NOVA1</i> allele remain elusive. Here, we show using fossil teeth that several hominids (<i>Australopithecus africanus</i>, <i>Paranthropus robustus</i>, early <i>Homo</i> sp., <i>Gigantopithecus blacki</i>, <i>Pongo</i> sp., <i>Homo neanderthalensis</i>, and <i>Homo sapiens</i>) were consistently exposed to lead over 2 million years, contradicting the idea that lead exposure is solely a modern phenomenon. Moreover, lead exposure on human brain organoids carrying the archaic <i>NOVA1</i> variant disrupts <i>FOXP2</i> expression in cortical and thalamic organoids, a gene crucial for the development of human speech and language abilities. Overall, the fossil, cellular, and molecular data support that lead exposure may have contributed to the impact of social and behavioral functioning during evolution, likely affording modern humans a survival advantage.

HTT
Also flagged:fibrilsneurodegenerative diseasesglutamineHDprolinepeptide
Journal Article 2025-10-15 ✓ 2 Snippets Kulshrestha A, Phan TM, Rizuan A, Mohanty P, Mittal J.
In-Text Gene Mentions

…1 of huntingtin (Htt) protein is intrinsically…

…tract length inHtt(>Q35) is associated…

Show Full Abstract

Protein aggregation, which is implicated in aging and neurodegenerative diseases, typically involves a transition from soluble monomers and oligomers to insoluble fibrils. Polyglutamine (polyQ) tracts in proteins can form amyloid fibrils, which are linked to polyQ diseases, including Huntington's disease (HD), where the length of the polyQ tract inversely correlates with the age of onset. Despite significant research on the mechanisms of Httex1 aggregation, atomistic information regarding the intermediate stages of its fibrillation and the morphological characteristics of the end-state amyloid fibrils remains limited. Recently, molecular dynamics (MD) simulations based on a hybrid multistate structure-based model, Multi-eGO, have shown promise in capturing the kinetics and mechanism of amyloid fibrillation with high computational efficiency while achieving qualitative agreement with experiments. Here, we utilize the Multi-eGO simulation methodology to study the mechanism and kinetics of polyQ fibrillation and the effect of the N17 flanking domain of the huntingtin protein. Aggregation simulations of polyQ produced highly heterogeneous amyloid fibrils with variable-width branched morphologies by incorporating combinations of β-turn, β-arc, and β-strand structures, while the presence of the N17 flanking domain reduced amyloid fibril heterogeneity by favoring β-strand conformations. Our simulations reveal that the presence of the N17 domain enhanced aggregation kinetics by promoting the formation of large, structurally stable oligomers. Furthermore, the early-stage aggregation process involves two distinct mechanisms: backbone interactions driving β-sheet formation and side-chain interdigitation. Overall, our study provides detailed insights into the fibrillation kinetics, mechanisms, and end-state polymorphism associated with Httex1 amyloid aggregation.

HFE
Also flagged:cancerthyroiditistype 1 diabetes mellitusthyroiditis hypothyroidismir-hypophysitisir-adrenalitis
Journal Article 2025-10-15 ✓ 1 Snippet Zhu L, Cheung YM, Chiang C, Gallagher EJ, Hamnvik OR, Mammen J, Quandt Z, Jones R, McDunn J, Al-Bahadili H, Angell T, Bancos I, Betof Warner A, Blackwell S, Calabrese C, Cho TA, Dougan M, Ferreira M, Funchain P, Herndon J, Johnson DB, Kennedy R, Kheterpal M, Khouri M, Lechner MG, Lim AM, Markova A, Meara A, Overton L, Perdigoto AL, Sachithanandan N, Sharon E, Spain L, Tsai K, Yarchoan M, Reynolds KL, Shariff A.
In-Text Gene Mentions

…(to rule outhemochromatosis).…

Show Full Abstract

Immune checkpoint inhibitors (ICIs) are an important class of cancer treatment. Endocrine immune-related adverse events (E-irAEs) account for a significant proportion of irAEs in ICI-treated patients. Diagnosing E-irAEs accurately and timely can be challenging in the absence of clear categorization and standardization across oncology, endocrinology and other specialties. While existing guidelines provide some broad directions to diagnosis and management, they lack clarity on irAE-specific symptom evaluation and work-up, as well as assessment of severity. These limitations can then impact triage, time-sensitive management and care escalation to specialists such as oncoendocrinologists. The objective of this study was to develop consensus-based statements on disease definitions for E-irAEs.A core working group of endocrinologists with expertise in the oncoendocrinology field drafted a survey with statements outlining the general approach to E-irAEs, disease definition and management approach of six specific diagnoses: ir-thyroiditis thyrotoxic phase, ir-thyroiditis hypothyroidism, ir-Graves' disease, ir-hypophysitis, ir-adrenalitis and ir-type 1 diabetes mellitus. Severity grading tables were drafted for three disease categories-"thyroid", "pituitary and adrenal", and "diabetes mellitus". A two-round modified Delphi process, using the RAND/University of California Los Angeles (RAND/UCLA) Appropriateness Method, was employed. In this process, a 25-member voting panel consisting of endocrinologists, oncologists and other specialists and healthcare providers with experience in management of ICI-treated patients and irAEs was recruited. The panel rated anonymously on usability, accuracy, appropriateness or agreement of 41 items on a 9-point scale in Survey 1, after which a meeting was convened. Statements were modified based on voting results from Survey 1 and Meeting 1, and the process was repeated in Survey 2 and Meeting 2. At the end of this process, consensus was achieved for all statements.Our study findings address the gap in standardized nomenclature, clinical, laboratory and radiological evaluations, and management principles of E-irAEs. With consensus achieved from a panel of experts from a variety of disciplines, we anticipate that the statements can form the basis for standardization of the diagnostic process and improvement of patient care.

CACNA1E
Also flagged:Piezo1mechanotransductionMechanosensitive ion channelsextracellularmechanosensitive channelcytoskeleton
Journal Article 2025-10-15 ✓ 1 Snippet A G Oliva M, Ciccone G, Fläschner G, Luo J, Voigt JL, Romani P, Genever P, Dobre O, Dupont S, Vassalli M, Roca-Cusachs P, Salmeron-Sanchez M.
In-Text Gene Mentions

…channels (such asCACNA1E, CACNA1B and…

Show Full Abstract

Mechanosensitive ion channels such as Piezo1 have fundamental roles in sensing the mechanical properties of the extracellular matrix. However, whether and how Piezo1 senses time-dependent matrix mechanical properties, that is, viscoelasticity, remains unknown. To address this question, we combine an immortalised mesenchymal stem cell line, in which Piezo1 expression can be silenced, with soft and stiff viscoelastic hydrogels that have independently tuneable elastic and viscous moduli. We demonstrate that Piezo1 is a regulator of the mechanotransduction of viscoelasticity in soft matrices, both experimentally and through simulations incorporating Piezo1 into a modified viscoelastic molecular clutch model. Using RNA sequencing, we also identify the transcriptomic responses of mesenchymal stem cells to matrix viscoelasticity and Piezo1 activity, identifying gene signatures that reflect their mechanobiology in soft and stiff viscoelastic hydrogels.

DCC
Also flagged:stromal in situ keratomileusisrefractive errorargonfluoridekeratectasiamyopia
Journal Article 2025-10-15 ✓ 1 Snippet Yang L, Yang R, Qi W, Li F, Wang G, Zhao S.
In-Text Gene Mentions

…SCC andDCC

Show Full Abstract

This study aimed to analyze and compare the effects of intraoperative delayed time (IDT) on refractive correction accuracy in femtosecond laser-assisted stromal in situ keratomileusis (FS-LASIK) using 1050 Hz excimer laser equipment. Eighty-one eyes of 81 myopic and astigmatic patients were divided into three groups according to the IDT: mild delay (IDT < 5 s, 29 eyes), moderate delay (5 s ≤ IDT < 10 s, 26 eyes), and severe delay (10 s ≤ IDT ≤ 60 s, 26 eyes) groups. Uncorrected distance visual acuity (UDVA), spherical equivalent (SE), and intraocular pressure (IOP) were measured 1 week, 1 month, and 3 months postoperatively. The static cyclotorsion and dynamic cyclotorsion components (SCC and DCC, respectively) were recorded. Central corneal thickness was measured before and 1 week after the operation. Differences in the UDVA, refractive power correction error (RPCE), and corneal ablation error (CAE) between the different groups were compared. The postoperative UDVA of the three groups was good; no significant difference as observed in the SCC and RPCE 1 week after surgery. The DCC and RPCE at 1 and 3 months postoperatively in the three groups significantly varied. For patients with an IDT less than 10 s, no significant difference was observed between the actual and theoretical ablation corneal thicknesses. However, for those with IDT longer than 10 s, the actual ablation thickness was greater than the theoretical ablation thickness. The CAE increased with the IDT lengthening, and the average actual ablation depth increased by 0.09 μm for every extra second. Education and training on preoperative ocular fixation should be emphasized. Patient delay in laser ablation due to poor cooperation may still lead to RPCE and CAE, even though the 1050 Hz excimer laser has the highest ablation speed, highest tracking speed, and seven-dimensional eye movement tracking.

Also flagged:immune responseInterferonIFNproteins with tetratricopeptide repeatsIFIT) 2viral infection
Journal Article 2025-10-15 No Snippets Glasner DR, Todd C, Cook B, D'Urso A, Khosla S, Estrada E, Wagner JD, Bartels MD, Hung CT, Ford P, Prych J, Hatch KS, Yee BA, Ego KM, Liang Q, Holland SR, Case JB, Corbett KD, Diamond MS, Lee B, Yeo GW, Herzik MA, Van Nostrand EL, Daugherty MD.
Show Full Abstract

Recognition of foreign RNA is critical for the innate immune response to viruses. Interferon (IFN)-induced proteins with tetratricopeptide repeats (IFIT) 2 and 3 are highly upregulated following viral infection, but mechanistic insight into their antiviral role is lacking. Here we demonstrate that short 5' untranslated regions (UTRs), a characteristic of many viral mRNAs, can serve as a molecular pattern for innate immune recognition via IFIT2 and IFIT3. Structure determination of the IFIT2-IFIT3 complex at 3.2 Å using cryo-EM reveals a domain-swapped heterodimer that is required for recognition of the viral mRNA 5' end, translation inhibition and antiviral activity. Critically, viral or host 5' UTR lengths less than 50 nucleotides are necessary and sufficient to enable translation inhibition by the IFIT2-IFIT3 complex. Accordingly, diverse viruses whose mRNAs contain short 5' UTRs, such as vesicular stomatitis virus and parainfluenza virus 3, are sensitive to IFIT2-IFIT3-mediated antiviral activity. Our work thus reveals a pattern of antiviral nucleic acid immune recognition that takes advantage of the inherent constraints on viral genome size.

HFE
Also flagged:liver diseaseCardiovascular diseaseCVDdeathMetabolic dysfunctionsteatotic liver disease
Journal Article 2025-10-15 ✓ 1 Snippet Zhai SM, Wang XL, Zhang H, Zuo YQ.
In-Text Gene Mentions

…liver diseases, includinghemochromatosis, autoimmune liver disease,…

Show Full Abstract

Cardiovascular disease (CVD) remains the most common cause of death worldwide. Carotid plaque is an indicator of subclinical CVDs. Metabolic dysfunction-associated steatotic liver disease (MASLD) is a risk factor for atherosclerotic CVDs. We aimed to develop and validate a predictive model for carotid plaque occurrence in annual health check-up populations, to integrate health check-up indicators with machine learning (ML) algorithms and LASSO-based feature selection and leverage advanced interpretability frameworks to elucidate the contribution of individual risk factors. In this retrospective cohort study, we enrolled 4,973 MASLD patients, among whom 1,178 were diagnosed with carotid plaques using carotid ultrasound. Collected baseline data included ​demographic indicators, ​clinical histories, blood ​biochemical parameters, and liver function test indicators. A predictive model for carotid plaques was developed and validated using five ML algorithms. Model performance was evaluated based on the​ area under the curve, ​sensitivity, ​specificity, ​accuracy, and ​F1 Score. For model interpretability, we adopted the ​Shapley Additive Explanations (SHAP) framework to quantify the contribution of individual features to the prediction outcomes. Among the five ML algorithm models, the support vectors machine model demonstrated superior discriminative capability, higher goodness-of-fit, and greater clinical utility compared to other ML algorithm models. Moreover, age, systolic blood pressure, total cholesterol, sex, and fasting plasma glucose were the most important risk factors associated with carotid plaques in the MASLD population. This study demonstrated the feasibility of constructing a predictive model for carotid plaques in MASLD populations using health check-up indicators combined with ML algorithms. The application of SHAP methods enhanced model interpretability by quantifying the contribution of individual risk factors to prediction outcomes, enabling clinicians to identify high risk MASLD patients prone to carotid plaque development, so that they can adjust interventions accordingly.

CA10
Also flagged:cervical cancermethylationgene expressioncancerinvasive cancercancers
Journal Article 2025-10-15 ✓ 2 Snippets Cheishvili D, El-Zein M, Franco EL, Szyf M.
In-Text Gene Mentions

…for each gene:CA10(Fig. 1 A-D),…

…to fHMH forCA10, DPP10 ,…

Show Full Abstract

DNA methylation is a critical epigenetic modification that regulates gene expression and plays a significant role in cancer development. This methylation signature can be detected in cancer-derived DNA from non-invasive samples, such as plasma, urine or Pap smears. However, in early-stage cancers-when detection is most critical-the concentration of cancer DNA is often low, limiting the sensitivity of current detection methods. Traditional DNA methylation detection techniques, which rely on methylation ratio-based measurements, may obscure subtle variations in methylation patterns, further reducing detection sensitivity. In this study, we analyzed cervical scraping specimens and examined whether detecting cancer-specific methylation patterns in cervical cancer could be enhanced using a Highly Methylated Haplotype (HMH) approach. This novel approach captures highly methylated haplotypes at single-molecule resolution using next-generation sequencing, providing greater detail than conventional methods. HMHs in specific DNA regions are a hallmark of cancer and stand out in contrast to sporadic methylation commonly observed in non-cancerous tissues. We applied HMH profiling to a gene panel of four biomarkers (CA10, DPP10, FMN2, and HAS1) previously validated in cervical cancer studies. At pre-specified cutoffs (99th percentile of normals), haplotype-based scoring achieved 89.9% sensitivity for invasive cancer at high specificity (~ 94-98%), outperforming median (78.0%) and single-CpG (71.6%) methods. For clinically relevant endpoints, the combined panel detected 51-52% of CIN2 + and 66-67% of CIN3 + cases, again exceeding the performance of median- and single-CpG-based scoring methods.These findings demonstrate the potential of HMH to substantially enhance sensitivity in cervical cancer detection, offering a promising approach for non-invasive diagnostics.

HTT
Also flagged:neurological diseasesParkinson´s diseaseneurodegenerative diseasesreproductionagingAD
Journal Article 2025-10-15 ✓ 1 Snippet Garcia Ruiz PJ.
In-Text Gene Mentions

…large protein huntingtin (HTT), which plays essential…

Show Full Abstract

Evolutionary approach tries to explain several aspects of neurological diseases under the perspective of evolution. Evolutive bottle-neck may explain some aspects of neurodegenerative diseases. Additionally, a number of genetic alleles may reflect an evolutionary trade-off between benefits in early life and late-life disadvantages. Antagonistic pleiotropy theory suggests that some adaptive evolutionary changes increase individual fitness early in life, but can exacerbate detrimental aging-related processes We discuss three diseases with movement disorders from an evolutionary perspective: Parkinson's disease, Huntington's disease, and Tourette syndrome.

HTT
Also flagged:choreaHDHuntington diseasehereditaryneurodegenerative diseaseCytosine
Journal Article 2025-10-15 ✓ 1 Snippet Hannemann W, Stahuber L, Kouba T, Lindenberg KS, Rapp D, Lewerenz J, Huppertz HJ, Tykalova T, Rusz J, Landwehrmeyer GB, Mühlbäck A.
In-Text Gene Mentions

…the huntingtin (HTT) gene […

Show Full Abstract

<h4>Background</h4>In Huntington disease (HD), speech alterations are common and may emerge before onset of chorea. Slow and irregular motion rates, i.e. altered oral diadochokinesis (oDDK), are a distinctive feature. This study investigated oDDK using alternating (AMR) and sequential motion rate (SMR) tasks in manifest HD and explored the impact of antidopaminergic medications (ADM).<h4>Methods</h4>Speech samples were acquired from 30 healthy controls (14 men; 27-78 years¸ age- and gender-matched to HD subjects) and 35 individuals with early-to-moderate HD (18 men; 22-76 years) phenotyped using standardized scales (UHDRS'99) and MR imaging to estimate disease severity. Acoustic analysis was used to quantify rate and regularity of oDDK. In an exploratory subgroup analysis, the impact of ADMs on oDKK was explored by comparing patients with and without ADMs (HD-ADM: n = 16; 8 men; 22-76 years; HD-nADM; n = 19; 10 men; 28-61 years).<h4>Results</h4>HD patients were slower and more irregular in AMR and SMR tasks (p < 0.001) compared to controls. Analyses using area under the receiver-operating characteristic curve (AUC) showed the best characteristics for AMR (AUC = 95.0%). oDDK parameters correlated with measures of motor, cognitive and functional impairment and striatal atrophy. Patients on ADMs showed slower motion rates in both tasks (AMR p = 0.021; SMR p = 0.026), but unchanged regularity.<h4>Conclusions</h4>Decreased AMR performance alone captured early motor impairment accurately, reflects disease severity and is ADM-sensitive. Therefore, objective acoustic analysis of AMR performance is a simple measure which may serve as read-out to monitor disease progression, e.g. in clinical trials.

HFE
Also flagged:hematopoiesisthalassemiachronic anemiaanemiaerythropoiesisradiculopathy
Journal Article 2025-10-15 ✓ 1 Snippet Saini SK, Srivastava S, Prusty SK, Aggarwal M, Sharma DN.
In-Text Gene Mentions

…in hemosiderosis orhemochromatosis—the density of affected…

Show Full Abstract

Extramedullary hematopoiesis (EMH) is a compensatory response to chronic anemia, commonly observed in thalassemia. EMH can cause neurological complications such as spinal cord compression and paraparesis, as well as other site-specific compressive symptoms necessitating timely intervention. While medical management and surgery have been explored, radiation therapy (RT) remains a safe and effective alternative. This case series presents five patients with thalassemia who developed symptomatic EMH. All patients exhibited compressive symptoms, including lower limb weakness, sensory deficits, and abdominal pain. They were treated with conformal external beam RT using volumetric modulated arc therapy (VMAT) at doses ranging from 20 to 24 Gy in 10-12 fractions. Symptomatic relief was achieved within days of initiating radiation treatment, with near-complete neurological recovery by treatment completion. MRI follow-ups over 1-2 years demonstrated significant regression of EMH masses, and there was no recurrence of symptoms. Radiation was well tolerated and no treatment-related toxicities were observed. This study highlights the role of radiation treatment as a non-invasive and effective treatment modality for symptomatic EMH. The rapid clinical response and durable control observed in these cases reinforce its potential as a primary intervention, particularly in patients who are not responding and progressing on medical management. A dose range of 20-24 Gy in 10-12 fractions by modern radiation delivery techniques is recommended for the management of extramedullary hematopoietic masses.

Also flagged:bone remodelingosteogenesismetabolismTCF20TRAPalkaline phosphatase
Journal Article 2025-10-15 No Snippets Chen M, Li Y, Yang Z, Chen M, Li J, Bao G, Ma L, Hu J.
Show Full Abstract

<h4>Background</h4>Orthodontic bone remodeling is a complex process involving a dynamic balance between osteogenesis and osteoclast genesis. Although M2 macrophage-derived exosomes (M2-exos) have emerged as key regulators of bone metabolism through immunomodulation and paracrine signaling, their specific mechanisms in orthodontic tooth movement (OTM) remain unclear. This study aimed to investigate the role of the epigenetic MeCP2-TCF20 complex in M2-exo-mediated orthodontic bone remodeling.<h4>Methods</h4>A rat OTM model was established to evaluate bone remodeling dynamics using micro-CT, histomorphometry (H&E and TRAP staining), and immunohistochemistry. Periodontal ligament stem cells (PDLSCs) were isolated and treated with M2-exos to assess osteogenic differentiation through alkaline phosphatase (ALP) and alizarin red S (ARS) staining, qPCR, and Western blot. Molecular mechanisms were explored via RNA sequencing (RNA-seq), immunoprecipitation-mass spectrometry (IP-MS), and functional validation experiments (siRNA knockdown and overexpression).<h4>Results</h4>Orthodontic tension force upregulate M2 polarization and osteoblast differentiation, in contrast to compressive force which triggered M1 polarization and osteoclastogenesis, with concomitant modulation of MeCP2 expression in mechanically stressed periodontal tissues. M2-exos significantly promoted the proliferation and osteogenic differentiation of PDLSCs. Mechanistic studies revealed that M2-exos activated the MeCP2-TCF20 complex, which directly suppressed HDAC1 expression, thereby activating the Wnt/β-catenin signaling pathway.<h4>Conclusion</h4>These findings highlight the critical role of the M2-exo/MeCP2-TCF20 axis in orchestrating orthodontic bone remodeling through epigenetic regulation. This study provides novel insights into the therapeutic potential of M2-exos for enhancing orthodontic treatment efficiency.

TRIM38
Also flagged:MLLT6ovarian cancergynecological malignanciescell proliferationPaclitaxeltumor
Journal Article 2025-10-15 ✓ 5 Snippets Bao Q, Wang S, Hong L.
In-Text Gene Mentions

…normal, while MZB1,TRIM38, BTN3A2 and MLLT6…

…WARS1, MLLT6, POU4F1,TRIM38, BTN3A2, MARK3, DMWD,…

TRIM38functions as a…

…cell lung cancer,TRIM38suppresses migration and…

…Conversely,TRIM38triggers the degradation…

Show Full Abstract

<h4>Objective</h4>Ovarian cancer is one of the most lethal gynecological malignancies, with high recurrence rates and poor prognosis. Identifying molecular mechanisms underlying recurrence is critical for improving patient outcomes. This study aimed to develop a recurrence-related gene signature (RRGS) for prognosis and explore the role of Myeloid/Lymphoid or Mixed-Lineage Leukemia; Translocated To 6 (MLLT6), a key gene within the RRGS, in ovarian cancer progression and drug resistance.<h4>Methods</h4>TCGA and GEO cohorts were analyzed to identify differentially expressed genes (DEGs) associated with recurrence. LASSO regression was applied to construct an eight-gene RRGS, which was validated in independent cohorts. Functional assays, including proliferation, migration, invasion, and drug resistance tests, were conducted in OVCAR3, TOV-21G and ES-2 cell lines to evaluate the role of MLLT6.<h4>Results</h4>The RRGS effectively stratified patients into high- and low-risk groups, with high RRGS scores correlating with poorer overall survival and progression-free survival. Among the RRGS genes, MLLT6 was identified as the most significant prognostic marker. Functional assays showed that MLLT6 knockdown inhibited ovarian cancer cell proliferation, migration, invasion, and significantly enhanced Paclitaxel sensitivity by reducing IC50 values.<h4>Conclusion</h4>The RRGS is a robust prognostic tool for ovarian cancer, and MLLT6 plays a critical role in tumor progression and drug resistance. Targeting MLLT6 may provide a novel therapeutic strategy to overcome Paclitaxel resistance and improve patient outcomes.

Also flagged:Atrial fibrillationAFarrhythmiadeathstrokeion channel
Journal Article 2025-10-15 No Snippets Tao Y, Liu Q, Wang Y, Jiang R, Zhang K.
Show Full Abstract

BACKGROUND: Atrial fibrillation (AF) is the most common type of arrhythmia and is linked to an increased risk of death, stroke, and other complications. Although studies have explored the pathophysiology of AF, its genetic mechanisms remain poorly understood, limiting the development of effective treatments. METHODS: We conducted a large-scale meta-analysis of genome-wide association study (GWAS) data from 1,347,178 participants in the FinnGen and Nielsen studies to identify novel genetic variants of AF. The novel genes were validated by expression quantitative trait loci (eQTLs) using a transcriptome-wide association study. The cross-phenotype genetic correlation analyses were conducted for our new GWAS. Afterward, the GWAS results were integrated with protein quantitative trait loci data from the UK Biobank, and Mendelian randomization with postselection inference and colocalization analyses were used to infer causal relationships between proteins and AF. We also conducted downstream analysis for the identified genes, including querying the Mouse Genome Informatics database, gene enrichment analysis, gene expression analysis, and druggability assessment. RESULTS: Our meta-analysis revealed 244 genome-wide significant AF risk variants, 77 of which were novel. In total, 372 genes were identified by a transcriptome-wide association study. Additionally, 155 proteins were significantly associated with AF, with 28 showing strong colocalization with AF genetic signals. Gene expression and enrichment analyses revealed that the identified genes were predominantly expressed in the heart and blood vessels, with related biological pathways such as cardiac development, myocardial hypertrophy and fibrosis. Single-nucleus RNA sequencing results revealed that these genes are expressed mainly in cardiomyocytes and macrophages. The quantitative real-time polymerase chain reaction results revealed significant changes in the expression of most genes in the AF group compared with the control group. Through druggability analysis, we identified potential AF drug targets, some of which are linked to approved or clinical-stage drugs. CONCLUSION: This study provides new insights into the genetic and proteomic basis of AF. We hope our findings will inspire further research and preclinical work to advance drug development programs for AF.

HTT
Also flagged:cGASSTINGagingneurodegenerative diseasescyclic GMP-AMP synthasestimulator of interferon
Journal Article 2025-10-15 ✓ 1 Snippet Li H, Cai R, Zhou Y, Jiang Y, Tan S.
In-Text Gene Mentions

…caused by mutantHTTprotein (mHTT) in…

Show Full Abstract

Aging is a major risk factor for neurodegenerative diseases, yet the underlying mechanisms linking aging to neurodegeneration remain incompletely understood. The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway plays a critical role in sensing mislocalized cytoplasmic DNA, triggering innate immune responses such as type I interferon (IFN-I) and NF-κB signaling, and promoting senescence-associated secretory phenotypes (SASP). In the aging central nervous system (CNS), cellular senescence is accompanied by mitochondrial DNA (mtDNA) leakage, nuclear DNA damage, and other changes that may aberrantly activate the cGAS-STING pathway. This activation drives neuroinflammation, potentially increasing susceptibility to neurodegenerative diseases or exacerbating pre-existing pathology. Conversely, neurodegenerative disease-related processes-such as pathological protein aggregation-can further stimulate cGAS-STING signaling, amplifying inflammatory cascades and accelerating cellular senescence. This review explores the molecular mechanisms linking cGAS-STING activation to neurodegeneration and discusses potential therapeutic strategies targeting this pathway.

Also flagged:Oral Squamous Cell CarcinomaOSCCtumorcancercell proliferationmetabolism
Journal Article 2025-10-15 No Snippets Shin JA.
Show Full Abstract

Oral squamous cell carcinoma (OSCC), the most common malignancy of the oral cavity, poses significant clinical challenges owing to late-stage diagnosis, frequent recurrence, and therapy resistance. Metabolic reprogramming, particularly the upregulation of aerobic glycolysis, is intricately associated with tumor progression, metastasis, and therapeutic failure. This metabolic alteration not only favors rapid cancer cell proliferation and promotes immune evasion but also results in the formation of a supportive tumor microenvironment (TME). This review synthesizes the current knowledge on the molecular regulators of glycolytic reprogramming in OSCC and elucidates their underlying mechanisms. We also delineated the glycolytic landscape of the OSCC tumor microenvironment, which encompasses cancer-associated fibroblasts (CAFs), CD4<sup>+</sup> and CD8<sup>+</sup> T cells, and tumor-associated macrophages (TAMs). Furthermore, we underscore the therapeutic potential of natural product-based strategies that target aerobic glycolysis in OSCC. A deeper understanding of these metabolic pathways may aid in the development of metabolism-targeted interventions for OSCC. This review also offers insights into how targeting glycolytic reprogramming, particularly with natural products, may enhance the efficacy of current chemotherapeutic and immunotherapeutic strategies for OSCC by overcoming resistance and reprogramming the TME.

Also flagged:diabetic retinopathytype 2 diabeteslipoproteincholesteroltriglyceridesc-peptide
Journal Article 2025-10-15 No Snippets Garberg G, Bengtsson Boström K, Hjerpe P, Ayala M, Lövestam Adrian M, Andersson T.
Show Full Abstract

<h4>Introduction</h4>This study investigated the incidence of diabetic retinopathy (DR) and sight-threatening DR (STDR) through 2021 in patients diagnosed with type 2 diabetes (T2DM) in 1996-2004. The study also investigated risk factors associated with DR.<h4>Research design and methods</h4>The cohort comprised patients in the Swedish Skaraborg Diabetes Register in 1996-2004 who were ≤70 years at T2DM diagnosis and without DR at first-eye examination. Clinical data at diagnosis included age, smoking habits, body mass index, blood pressure, HbA1c, high-density lipoprotein cholesterol, triglycerides, c-peptide and antihypertensive drugs as a proxy for hypertension. The level of DR at first eye examination after diagnosis through 31 December 2021 was extracted from medical records at the Department of Ophthalmology, Skaraborg Hospital. The cumulative incidence of DR was estimated by the Kaplan-Meier method, and multivariate Cox regression models were used to estimate the risk of DR.<h4>Results</h4>The study included 2267 patients; over the course of 24 years of follow-up (mean 12.8±5.8 years), 926 developed DR and 101 developed STDR. The cumulative incidence after 10 and 20 years was 29.0% and 67.6% for DR and 1.4% and 11.4% for STDR. Higher HbA1c (HR 1.02 per 1 mmol/mol, 95% CI 1.01 to 1.02) and antihypertensive treatment at diagnosis (HR 1.26, 95% CI 1.08 to 1.47) were associated with increased risk of DR. Higher age (HR 0.98 per year, 95% CI 0.97 to 0.98) and diagnosis in 1999-2004 versus 1996-1998 (HR 0.58, 95% CI 0.51 to 0.66) were associated with a lower risk of DR.<h4>Conclusion</h4>During follow-up, 926 patients developed DR, whereas 101 developed STDR. Higher HbA1c and antihypertensive treatment were associated with a higher risk of developing DR and STDR, while higher age at diagnosis and diagnosis in 1999-2004 versus 1996-1998 were associated with lower risk.

SERPINC1
Also flagged:AscitesPrednisoloneEsophageal Cancerliver cirrhosisCorticosteroidsesophageal squamous cell carcinoma
Journal Article 2025-10-15 ✓ 2 Snippets Tamura Y, Sekiguchi M, Honda K, Maruyama Y, Ito K, Inoue M, Shibasaki M, Takizawa D, Arai H, Uraoka T.
In-Text Gene Mentions

…the antithrombin III (ATIII) level was below…

…was below 70%,ATIIIreplacement was given…

Show Full Abstract

Endoscopic submucosal dissection (ESD) is widely used for early esophageal cancer, even in patients with liver cirrhosis (LC). Corticosteroids, administered orally or by local injection, are often used to prevent post-ESD esophageal stricture. However, their safety in patients with decompensated LC and refractory ascites remains unclear. A man in his 70s with alcohol-related decompensated LC and refractory ascites underwent ESD for subcircumferential superficial esophageal squamous cell carcinoma located on esophageal varices. To prevent post-ESD stricture, both oral prednisolone and local triamcinolone were administered. Ascites worsened significantly, and large-volume paracentesis was performed. Subsequently, the patient developed a mural thrombus in the superior mesenteric vein and non-occlusive mesenteric ischemia, leading to bowel perforation and death on day 51 post-ESD. In LC patients with refractory ascites, oral corticosteroids may exacerbate ascites and increase thrombotic risk, potentially leading to fatal complications. This case highlights the need for careful risk-benefit assessment of subcircumferential ESD in vulnerable cirrhotic patients.

ECI2
Also flagged:diabetic nephropathyECH1DHRS4ECHS1granulesdiabetic kidney disease
Journal Article 2025-10-15 ✓ 3 Snippets Zhang Y, Sheng G, Zhang C, Song T, Yu J, Ruan W, Xi D, Yu Z, Fei W, Yang X.
In-Text Gene Mentions

…targeting ECH1, DHRS4,ECI2, and ECHS1.…

…highlighted ECH1, DHRS4,ECI2, and ECHS1 as…

…modulating ECH1, DHRS4,ECI2, and ECHS1 pathways.…

Show Full Abstract

<h4>Ethnopharmacological relevance</h4>Yucan granules (YCG) have demonstrated therapeutic benefits in reducing urinary total protein in patients with diabetic kidney disease (DKD); however, their renoprotective mechanisms remain unclear.<h4>Aim of the study</h4>To evaluate the therapeutic efficacy of YCG in DKD and elucidate the underlying mechanisms using 4D label-free quantitative proteomics.<h4>Materials and method</h4>The principal components of YCG, together with serum and kidney metabolites after administration, were identified via UPLC-Q-TOF-MS. A DKD mouse model was established with streptozotocin with a high-fat, high-sugar diet. Mice were randomly assigned to six groups (n = 10 per group): negative control, DKD, low-dose YCG (1.5 g/kg), medium-dose YCG (3 g/kg), high-dose YCG (6 g/kg), and positive control (Losartan potassium at 10 mg/kg) groups. After an 8-week treatment period, renal function and injury were assessed by biochemical analysis, histopathology, and fibrosis staining. 4D proteomics and western blotting were performed to investigate mechanisms.<h4>Results</h4>YCG significantly lowered blood glucose levels, 24-h proteinuria, urinary microalbumin levels, and the urinary albumin-to-creatinine ratio, while renal pathology improved markedly. YCG also suppressed the expression of fibrosis markers (Fn, Col-Ⅰ, TGF-β1, α-SMA, and N-cadherin) and podocyte-associated proteins (WT1 and Nephrin). Proteomics analysis highlighted ECH1, DHRS4, ECI2, and ECHS1 as potential targets. In total, 13 chemical constituents and 9 metabolites were detected in in serum and kidney samples.<h4>Conclusion</h4>YCG alleviates DKD-related renal injury, presumably by modulating ECH1, DHRS4, ECI2, and ECHS1 pathways.

PRDX6
Also flagged:mitochondrialautism spectrum disorderMitochondriaorganellesenergy homeostasismethylation
Journal Article 2025-10-15 ✓ 2 Snippets Lu D, Liang Y, Huang X, Wei A, Lan Z, Xu J.
In-Text Gene Mentions

…metabolic flexibility, andPRDX6contributes to redox…

…axis-TMEM177, CRAT, andPRDX6-linking mitochondrial regulat…

Show Full Abstract

<h4>Background</h4>Mitochondrial dysfunction is increasingly implicated in autism spectrum disorder (ASD), yet its causal genetic basis remains unclear. Mitochondria are maternally inherited organelles essential for neurodevelopment and cellular energy homeostasis, while most mitochondrial proteins are nuclear-encoded and follow Mendelian inheritance. Clarifying how genetically regulated mitochondrial gene activity relates to ASD risk may provide new mechanistic insight.<h4>Methods</h4>We applied a multi-omics Mendelian randomization (MR) framework integrating methylation (mQTL), expression (eQTL; blood and 12 GTEx brain regions), and protein (pQTL) datasets. We used summary-data-based MR (SMR) with HEIDI to exclude LD-driven signals and Bayesian colocalization (PPH4 > 0.70) to require a shared causal variant. Where independent cis instruments were available, two-sample MR estimated effects and assessed robustness. ASD outcomes came from IEU-802, IEU-806, and FinnGen GWAS.<h4>Results</h4>Convergent evidence highlighted three mitochondria-related genes. CRAT and PRDX6 showed cross-layer support in specific datasets (mQTL/eQTL/pQTL) with overall protective associations. TMEM177 was supported across mQTL and eQTL and exhibited tissue-specific divergence-risk-increasing associations in cerebellar/cortical regions but protective associations in peripheral blood. TMEM177's biology is consistent with a role in complex IV (COX2) assembly, CRAT regulates acetyl-CoA buffering and metabolic flexibility, and PRDX6 contributes to redox homeostasis and membrane repair. Locus-specific CpG variation was directionally aligned with gene expression and ASD risk.<h4>Conclusions</h4>Our findings support a structure-metabolism-redox axis-TMEM177, CRAT, and PRDX6-linking mitochondrial regulation to ASD susceptibility.

HFE
Also flagged:porphyria cutanea tardaURODuroporphyrinogen decarboxylaseporphyrinsuroporphyrinogenheptacarboxylated
Journal Article 2025-10-15 ✓ 5 Snippets Harper P, Törnhage CJ, Sardh E.
In-Text Gene Mentions

…and homozygous forhemochromatosis.…

…UROD variants andHFEhomozygous.…

…between predisposition tohemochromatosisin children with…

…the two majorHFEvariants (C282Y; c.845G>A…

…homozygous for theHFEgene variant c.845G>A;…

Show Full Abstract

Clinically manifest porphyria cutanea tarda (PCT) is a rare condition in childhood; however, several cases have been reported in the literature and at our centre. Porphyria Center Sweden is a national knowledge centre, and since 1987, we have diagnosed approximately 1400 new cases of manifest PCT, of which only five have been children. All children have been identified as heterozygous carriers of a pathogenic <i>UROD</i> gene variant and homozygous for hemochromatosis. In our experience, the diagnosis of children with PCT has been delayed, even in the presence of cutaneous symptoms, without known family history. In this case report, and in another child from our centre, the disease has been suspected due to reddish discolored urine in the absence of cutaneous symptoms. In these two cases, the mothers associated the beetroot red urine with known cases of PCT in the family history. The remaining three cases documented in this report were diagnosed based on cutaneous symptoms.

Also flagged:type 1 diabetes mellitusnucleotidesT1DMpathogenesisdiabetesMEG3
Journal Article 2025-10-15 No Snippets Dieter C, Lemos NE, Girardi E, Massignam ET, Kowalski TW, Recamonde-Mendoza M, Puñales M, Assmann TS, Crispim D.
Show Full Abstract

<h4>Objective</h4>Long non-coding RNAs (lncRNAs) do not encode proteins and are transcripts longer than 200 nucleotides. The precise involvement of lncRNAs in type 1 diabetes mellitus (T1DM) pathogenesis remains unclear. Therefore, this study aimed to analyze the expressions of five lncRNAs in peripheral blood mononuclear cells of individuals with T1DM and without DM.<h4>Materials and methods</h4>This study comprised 27 patients with T1DM (cases) and 13 individuals without DM (controls). The case group was divided into two subgroups based on T1DM duration: < 5 years of diagnosis group and long-term diabetes group (≥5 years). LncRNA expression was evaluated by qPCR.<h4>Results</h4>MALAT1 and TUG1 were upregulated in patients within the first five years of diagnosis of T1DM compared to the other groups. MEG3 was upregulated in the case group of < 5 years of diagnosis compared to controls. TUG1 and MALAT1 levels were negatively correlated with the duration of T1DM, while TUG1 and MEG3 were positively correlated with glycated hemoglobin levels. Bioinformatics analysis revealed that MALAT1, MEG3, and TUG1 regulate and interact with protein-codifying genes and microRNAs involved in T1DM-related pathways.<h4>Conclusion</h4>Our study revealed MALAT1, MEG3, and TUG1 upregulation in patients within the first five years of diagnosis of T1DM.

Also flagged:pathogenesisskin diseasesdermatological disordersautoimmune skin conditionssystemic lupus erythematosussystemic sclerosis
Journal Article 2025-10-15 No Snippets Li W, Li H, Fan L, Zhao R, Dong F, Jia X, Yin L, Yang S, Zhao D, Wang J.
Show Full Abstract

Exosomes, owing to their potent capabilities for intercellular communication, have great potential in modern medicine. The pathogenesis of skin diseases is predominantly characterized by immune imbalance and impaired regenerative processes. Exosomes are rich in microRNAs, lipids, and proteins, which play a crucial role in immune regulation and regenerative medicine. Recent studies have highlighted the involvement of exosomes in the therapeutic management of dermatological disorders. This review provides a comprehensive overview of the potential therapeutic applications of exosomes in autoimmune skin conditions, such as systemic lupus erythematosus, systemic sclerosis, psoriasis, and vitiligo, as well as their roles in skin wound healing, skin aging, scar formation, skin flap regeneration, hair regeneration, and other skin regenerative disorders. The paper examines various exosome delivery methods and evaluates current clinical trials, identifying challenges related to exosome isolation, preservation, active components, mechanistic understanding, and clinical translation. Furthermore, it delineates future research directions and proposes innovative strategies for advancing exosome-based therapies in dermatology.

HFE
Also flagged:IronExcretioniron overload disorderhemolytic crisisdeathethylenediamine
Journal Article 2025-10-15 ✓ 1 Snippet Sullivan KE, Lavin SR, Warren LK, Mylniczenko ND, Livingston SE, Knutson MD, Valdes EV.
In-Text Gene Mentions

…are predisposed to non-hemochromatosisiron overload disorder…

Show Full Abstract

Black rhinoceros (<i>Diceros bicornis</i>) face threats to survival due to poaching in the wild and an incomplete understanding of preventive health monitoring under human care. Black rhinos under human care develop iron overload disorder (IOD) which is associated with predisposition to other disease, compromised immune function, hemolytic crisis, and death. Management of IOD is challenging but has been mitigated in some cases with dietary intervention and phlebotomy and documented through serum biomarker evaluation. Chelation therapy to reduce iron is rare in rhinos partially because of limited product availability and route of administration. An iron-specific chelator HBED (N,N'-Di(2-hydroxybenzyl)ethylenediamine-N,N'-diacetic acid) was investigated for oral use in southern black rhinos (<i>n</i> = 3) after successful testing was performed with equids as a model. Using a cross-over design, we tested the efficacy of short-term HBED administration. HBED was dosed at 40 mg/kg body weight for 10 days and resulted in increased urinary excretion of iron but unaltered fecal iron excretion in rhinos compared to control trials. Two rhinos maintained blood chemistry and cell distribution considered normal for the species. The third rhino experienced a hemolytic event after stopping HBED administration in the same time frame and at the same dose as the two conspecifics but fully recovered. Careful monitoring and tapering the drug at the completion of treatment is warranted, especially if the rhino's iron load is considered high. HBED's potential to induce iron excretion safely, as well as prevent excessive dietary iron uptake, may significantly benefit the black rhino population under human care.

POU3F2
Also flagged:Gliomasgene expressiontumortemozolomideSTAT3SORBS2
Journal Article 2025-10-15 ✓ 1 Snippet Palermo M, Pennisi G, Burattini B, Bruzzaniti P, Talacchi A, Olivi A, Sturiale CL.
In-Text Gene Mentions

…like SOX2, OLIG2,POU3F2, and ASCL1 […

Show Full Abstract

<h4>Background</h4>Enhancer RNAs (eRNAs), a subclass of long non-coding RNAs transcribed from enhancer regions, have emerged as dynamic regulators of gene expression, tumor progression, and therapeutic response. In gliomas, their biological and clinical significance is only recently being elucidated. This systematic review aimed to synthesize current evidence regarding the role of eRNAs in gliomagenesis, chemoresistance, and prognosis.<h4>Methods</h4>We conducted a systematic review following PRISMA 2020 guidelines. PubMed/MEDLINE and Scopus databases were searched on September 2025 using a predefined strategy. Eligible studies included clinical or pre-clinical analyses of eRNAs in gliomas, reporting associations with tumorigenicity, survival, or resistance to temozolomide (TMZ). Risk of bias was assessed using ROBINS-I (Version 2), and findings were qualitatively synthesized.<h4>Results</h4>From 26 retrieved records, 10 studies were included, encompassing 22 unique eRNAs. Two studies demonstrated that TMZR1-eRNA and LINC02454* modulate TMZ sensitivity by regulating STAT3, SORBS2, and DDR1 pathways. Seven studies evaluated prognostic implications: 12 eRNAs (e.g., AC003092.1, CYP1B1-AS1, CRNDE) were consistently associated with poor survival, while seven (e.g., LINC00844, ENSR00000260547) correlated with favorable outcomes, particularly in low-grade gliomas. One mechanistic study showed that HOXDeRNA directly promotes gliomagenesis by displacing PRC2 repression at key transcription factor promoters and activating oncogenic super-enhancers.<h4>Conclusions</h4>eRNAs are not passive transcriptional by-products but active modulators of glioma biology. They influence tumor initiation, therapeutic resistance, and survival outcomes, underscoring their potential as prognostic biomarkers and therapeutic targets. Future research should validate these findings in larger clinical cohorts and explore strategies for eRNA-directed therapies in precision neuro-oncology.

Also flagged:Gene Expressiongene silencingdegradationmetabolismtrichotheceneaurofusarin
Journal Article 2025-10-15 No Snippets Stakheev AA, Bagdasarova P, Rogozhin EA, Tikhomirova V, Popova E, Akhmetova A, Kost O, Kalinina NO, Taliansky M, Zavriev SK.
Show Full Abstract

<i>Fusarium</i> species and the mycotoxins produced by them represent a significant problem for agriculture and human health. Thus, the development of novel management strategies and tools is of high importance. Spray-induced gene silencing (SIGS), based on the natural mechanism of RNA interference (RNAi), has been considered as a highly specific and ecologically safe alternative to chemical fungicides, the use of which is restricted by the emergence of resistant strains and environmental concerns. At the same time, massive application of SIGS is challenged by the degradability of RNA molecules in the environment. Nanoparticles have been widely applied to protect RNA from degradation and improve its action. The aims of this study were to evaluate whether RNAi-mediated silencing of the regulatory <i>FgVe1</i> gene leads to inhibition of growth, mycotoxin production, and pathogenicity of <i>Fusarium graminearum</i> and whether the use of CaP nanoparticles (CaPs) as double-stranded RNA (dsRNA) carriers enhances and prolongs the silencing effect. It was shown that dsRNA treatment of fungal liquid cultures resulted in 19.78-fold silencing of <i>FgVe1</i> expression as well as inhibition of expression of genes related to secondary metabolism, including those involved in trichothecene and aurofusarin biosynthesis, thus leading to a reduction in DON accumulation and changes in culture color. The results also demonstrated that naked dsRNA and CaPs:dsRNA nanocomplexes differed in their abilities to induce a high silencing effect at different time points. Naked dsRNA proved more effective in inducing silencing in the early stages of fungal growth, whereas application of nanocomplexes provided a prolonged effect up to 10 days in liquid cultures and up to 14 days on detached leaves. The obtained data can be considered as a basis for the further development of new efficient SIGS-based plant protection strategies.

SERPINC1
Also flagged:Gingivitispro-inflammatory cytokineskeratinsmatrix metalloproteinasescollagendegradation
Journal Article 2025-10-15 ✓ 3 Snippets Ramji N, Hu P, Muñoz Bodnar A, Braga CP, Snowball J, Swift D, Ye H, Xie S, Trenner R, Klukowska M, Schneiderman E, Biesbrock AR.
In-Text Gene Mentions

…Figure 3 f),SERPINC1( Figure 3…

…CD55, PSME2, andSERPINC1are significantly associated…

…KRT17, PSME2, andSERPINC1are associated with…

Show Full Abstract

Poor oral health is a neglected epidemic, potentially contributing to systemic health issues. We employed a multi-omics approach to investigate the biological changes associated with gingivitis and the effects of stannous fluoride (SnF<sub>2</sub>) dentifrice on microbial composition and salivary proteomics in an eight-week clinical trial involving 39 participants categorized as high (<i>n</i> = 20) and low bleeders (<i>n</i> = 19). Baseline assessments revealed significant microbial dysbiosis in high bleeders, characterized by a higher abundance of <i>Porphyromonas</i> and <i>Fusobacterium</i>, alongside compromised epithelial barriers and increased inflammation. Following SnF<sub>2</sub> treatment, a substantial reduction in these bacteria, and an increase in <i>Rothia</i> and <i>Haemophulis</i>, were observed, correlating with improved clinical measures, including reduced bleeding and inflammation indices. In total, 80 proteins (including pro-inflammatory cytokines, alarmin keratins, and matrix metalloproteinases) showed a significant reduction in high bleeders after treatment, with 29 overlapping the disease biomarkers in the plasma atlas, supporting the role of SnF<sub>2</sub> in mitigating oxidative stress and enhancing epithelial integrity. Furthermore, SnF<sub>2</sub> treatment significantly reduced collagen degradation, suggesting the preservation of tissue integrity. These findings highlight that SnF<sub>2</sub> not only improves local oral health but may also benefit systemic health, showcasing the value of a multi-omics approach in understanding the interconnections among oral microbiota, inflammatory responses, and systemic health outcomes.

HFE
Also flagged:liver diseasecardiovascular diseasemetabolic dysfunction-associated liver diseasealcohol-associated liver diseaseMetALD
Journal Article 2025-10-15 ✓ 1 Snippet Sterling RK, Sternberg AL, Lake JE, Naggie S, Heath S, Price JC, Wilson L, Crandall H, Gawrieh S, Chalasani N, Loomba R, Sulkowski M.
In-Text Gene Mentions

…ndeficiency, Wilson’s disease,hemochromatosis, polycystic liver disease,…

Show Full Abstract

<h4>Background & aims</h4>Steatotic liver disease (SLD), both metabolic dysfunction-associated liver disease (MASLD) without or with alcohol-associated liver disease (MetALD), is common in people with HIV (PWH) and associated with increased risk of cardiovascular disease (CVD).<h4>Methods</h4>Clinical and laboratory data were collected prospectively. MASLD was defined as SLD with ≥1 cardiometabolic risk factors (CMRF) and non-significant alcohol use. CVD risk was assessed by five 10-year risk scores (Framingham CVD score, 2013 ASCVD score, and PREVENT scores for total CVD, ASCVD, and heart failure) and one 5-year CVD score (D:A:D). Those without SLD were compared to MASLD and MetALD.<h4>Results</h4>Among 991 PWH without history of CVD, MASLD was present in 40% and MetALD in 9%. At least 4 CMRF were present in 55% of those with MASLD, 61% MetALD compared to 29% without SLD. Those with MASLD had higher PREVENT total CVD score than those without SLD and similarly for mean PREVENT ASCVD and heart failure scores. Those with MASLD also had higher mean risk than those without SLD by Framingham CVD score, 2013 ASCVD score, and D:A:D score. Conversely, those with MetALD and those without SLD had similar CVD risk scores. 10-year CVD risk level by PREVENT score was generally least.<h4>Conclusions</h4>CMRF are very common in PWH, with MASLD or MetALD frequently having multiple CMRF. The PREVENT scores showed higher 10-year CVD, ASCVD, and heart failure risk in those with MASLD versus those without SLD.

PRDX6
Also flagged:immune responsesgene expressionmitochondrialinfectionphosphorylationoxygen
Journal Article 2025-10-15 ✓ 1 Snippet Vu Manh TP, Frias-De-Diego A, Williams A, Byrne J, Sirisereewan C, Hicks J, Liu HC, Crisci E.
In-Text Gene Mentions

…genes: PRDX3 andPRDX6enzymes involved in…

Show Full Abstract

<h4>Introduction</h4>Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most economically devastating viruses for the global swine industry. PRRSV has a known tropism for lung macrophages, where it causes impaired immune responses. This study evaluated the metabolic and immune profiles of primary porcine alveolar macrophages (PAMs) and pulmonary intravascular macrophages (PIMs) infected with different strains of PRRSV-2 isolated from North Carolina (NC) pig herds (NC134, NC18-9-7 referred to as NC174, and NC20-1 referred to as NC144), and VR2232, a PRRSV-2 prototype strain.<h4>Materials and methods</h4>Primary enriched mononuclear phagocytes were infected <i>in vitro</i> with NC134 and NC174, sorted, and processed. The total RNA was used for a transcriptomic approach; additionally, gene expression was further validated using RT-qPCR and NanoString technology. Complementary functional assays with additional NC strains were used to further investigate the mitochondrial and metabolic dysfunction, as well as the oxidative stress induced by PRRSV-2 infection.<h4>Results</h4>PAMs infected with both NC PRRSV-2 strains NC174 and NC134 showed similar transcriptomic profiles during the early stage of infection, with downregulation of genes involved in the oxidative phosphorylation and electron transport chain pathways. PIMs infected with both NC174 and NC134 strains showed limited alteration in the transcriptomic profiles compared to uninfected cells. Genetic reprogramming matched the PRRSV-2-induced mitochondrial impairment observed in functional assays performed using Seahorse technology. Mitochondrial respiration displayed slightly different profiles between PIMs and PAMs infected with the different PRRSV-2 strains, with PAMs showing a more substantial decrease in mitochondrial fitness compared to control cells. When reactive oxygen species (ROS) and nitric oxide (NO) production were evaluated, no differences were observed between PRRSV-2-infected PAMs and PIMs and control cells.<h4>Conclusion</h4>These results provide valuable insights into the pathogenetic mechanism of different NC PRRSV-2 strains by focusing on the alteration in mitochondrial function in lung macrophages during early infection and highlighting differences in lung macrophage responses to distinct PRRSV-2 strains.

Also flagged:ribosomescancerUbiquitindegradationproteasometumor
Journal Article 2025-10-15 No Snippets Zhong H, Li W, Luo P, Chen Q, Cheng L, Gan L, Zhang F, Lu Y, Zheng L, Qian B.
Show Full Abstract

CircRNAs are an important class of non-coding RNAs, which are produced via back-splicing of exons and/or intron sequences of precursor mRNAs and generally cannot be translated into proteins as they do not bind to ribosomes. There is varying evidence supporting the claim that circRNAs are abnormally expressed in cancer and play a crucial role in cancer initiation and progression. Ubiquitin is a highly stable protein that can be conjugated to target proteins. The most crucial role of ubiquitination is to mediate the degradation of substrate proteins by the proteasome. An increasing amount of evidence indicates that circRNAs are involved in the precise degradation of proteins via the ubiquitin-proteasome system. This review systematically summarizes the intricate mechanisms by which circRNAs regulate target protein ubiquitination, modulate cancerous signaling pathways, and control tumorigenesis and tumor development. Although studies are continuously uncovering additional complex interactions between circRNAs and proteins, we believe that circRNAs are promising but challenging molecules that have the potential to facilitate precise cancer therapies in the future.

SOX6
Also flagged:parvalbuminnucleusextracellularcell adhesion moleculesorganizationion channels
Journal Article 2025-10-15 ✓ 1 Snippet Naon C, Castell L, Thirard S, Moreno M, Rialle S, Goetz E, Casals E, Rogliardo A, Gut M, Esteve-Codina A, Quintana A, Bertaso F, Valjent E, Cutando L.
In-Text Gene Mentions

…groups ( Sox12,Sox6, Tox2, Tox3 )…

Show Full Abstract

Parvalbumin (PV) interneurons in the dorsal striatum (DS) are fast-spiking GABAergic cells critical for feedforward inhibition and synaptic integration within basal ganglia circuits. Despite their well-characterized electrophysiological roles, their molecular identity remains incompletely defined. Using the Ribotag approach in <i>Pvalb-Cre</i> mice, we profiled the translatome of DS PV interneurons and identified over 2,700 transcripts significantly enriched (fold-change > 1.5) in this population. Our data validate established PV markers and reveal a distinct molecular signature of DS PV neurons compared to PV interneurons from the nucleus accumbens. Gene ontology analyses highlight prominent expression of genes related to extracellular matrix components, cell adhesion molecules, synaptic organization, ion channels, and neurotransmitter receptors, particularly those mediating glutamatergic and GABAergic signaling. Notably, perineuronal net markers were robustly expressed in DS PV interneurons and confirmed by immunofluorescence. Transcriptomic analysis of DS PV neurons following repeated d-amphetamine exposure identified <i>Gm20683</i> as the only differentially expressed transcript between treated groups. Furthermore, RNAseq analysis of mice subjected to an operant behavior paradigm with two types of food reward (high-palatable diet or standard chow) identified over 1,000 and 100 genes enriched in DS PV neurons from standard and high-palatable masters, respectively. These findings provide a comprehensive molecular profile of DS PV interneurons, distinguishing them from other striatal PV populations, and reveal specific gene expression changes associated with psychostimulant exposure and reward-driven behaviors. Our findings deepen insight into the molecular mechanisms of PV interneuron activity in striatal circuits and their potential roles in neuropsychiatric, motor and reward-related disorders.

Also flagged:agingFerroptosisdeathironlipidage-related diseases
Journal Article 2025-10-15 No Snippets Mavaddatiyan L, Khamineh Y, Taghiyar L, Talkhabi M.
Show Full Abstract

Mesenchymal stem cells (MSCs) exhibit self-renewal and multipotent differentiation capabilities, and play roles in tissue repair and regeneration. However, age-related alterations can impair MSCs functions, potentially contributing to accelerated aging processes. Ferroptosis, a regulated form of cell death involving iron-mediated lipid peroxidation, is implicated in age-related diseases, although its specific role in MSCs aging remains unclear. Herein, the GSE68374 dataset was analyzed to obtain ferroptosis-related differentially expressed genes (FRDEGs). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed, and potential drugs targeting FRDEGs were predicted. Protein-protein interaction (PPI) analysis was conducted and hub genes were identified, which were validated using two independent datasets. Furthermore, an integrated regulatory network of kinases, transcription factors (TFs), and microRNAs was constructed. A total of 131 FRDEGs were screened, which were involved in cellular responses to starvation, oxidative stress, lipid metabolism, cellular senescence, ferroptosis, and cancer pathways. Among twenty hub genes, eight key FRDEGs, including activating transcription factor 3 (ATF3), Enhancer of zeste homolog 2 (EZH2), synuclein alpha (SNCA), prostaglandin-endoperoxide synthase 2 (PTGS2), NADPH oxidase 4 (NOX4), cyclin-dependent kinase inhibitor 2A (CDKN2A), sequestosome 1 (SQSTM1), and interleukin 6 (IL6), were similarly regulated across external datasets, and the expression of these genes was also confirmed by qRT-PCR. These findings highlight the pivotal role of these genes in MSCs aging and ferroptosis, suggesting that targeting them could enhance MSCs regenerative capacity and mitigate the progression of aging-related alterations in MSCs.

Also flagged:tumorprotein phosphatase 1cancersB-cell lymphomagenesisBLoligonucleotides
Journal Article 2025-10-15 No Snippets Obeidat M, Tadros S, Ismail B, Al-Khaldi A.
Show Full Abstract

Burkitt's lymphoma (BL) is an aggressive subtype of B-cell non-Hodgkin's lymphoma, known for its rapid tumor growth and poor prognosis. Transforming growth factor beta-inhibited membrane-associated protein (TIMAP) is a regulatory subunit of protein phosphatase 1 catalytic subunit, enriched in lymphoid tissues, and upregulated in various cancers. Despite suggestions that TIMAP promotes lymphomagenesis in a <i>c-myc</i>-driven model, its precise role remains unclear. This study aimed to investigate the contribution of TIMAP to B-cell lymphomagenesis by examining transcriptomic changes upon TIMAP downregulation in BL cells. Raji BL cells were transfected with 2'Fluoro Arabinonucleic acid (FANA)-antisense oligonucleotides (ASO) targeting TIMAP (FANA-ASO-TIMAP) or a scramble control (FANA-ASO-Scramble). TIMAP expression was significantly reduced at the mRNA (0.70 ± 0.04, p = 0.001) and protein levels (median = 0.73, IQR = 0.13, p = 0.002). RNA sequencing identified 2,368 differentially expressed genes (DEGs), of which 1,326 were upregulated, and 1,042 were downregulated. Gene Ontology analysis revealed that the DEGs were primarily involved in cellular processes, DNA replication, intracellular signal transduction, and apoptosis. Pathways related to lymphoma progression, such as B-cell receptor signaling, p53 signaling, and mTOR signaling, were notably affected. Key genes such as <i>PAK3</i>, <i>LINC00487</i>, <i>AID</i>, <i>PURPL,</i> and <i>BCL2</i> were among the most dysregulated, highlighting TIMAP's role in critical oncogenic pathways in B-cell Lymphoma. These findings suggest that TIMAP is a key regulator of gene expression and signaling pathways in B-cell lymphomagenesis and could serve as a potential therapeutic target for novel treatments.

Also flagged:autophagyhepatocellular carcinomadegradationlysosomesMitophagylysophagy
Journal Article 2025-10-15 No Snippets Hsieh CH.
Show Full Abstract

Selective autophagy, which is the targeted degradation of specific cellular components through lysosomes, serves a complex role in hepatocellular carcinoma (HCC). The present review explores the following 10 distinct selective autophagy pathways in HCC: Mitophagy, lysophagy, reticulophagy, pexophagy, nucleophagy, ribophagy, lipophagy, glycophagy, ferritinophagy and fluidophagy. In HCC, mitophagy can support therapy resistance by clearing damaged mitochondria, whereas lysophagy maintains lysosomal homeostasis through receptor recycling, such as coiled-coil domain containing 50. Reticulophagy, mediated by family with sequence similarity 134 member B (FAM134B), protects HCC cells from ferroptosis during kinase inhibitor treatment. Ferritinophagy, driven by nuclear receptor coactivator 4, regulates iron availability and sensitivity to ferroptotic cell death. Lipophagy has dual functions, where it provides energy substrates for tumor survival whilst potentially suppressing tumor growth through BCL2-interacting protein 3-mediated mechanism in fatty livers. Altogether, these aforementioned pathways offer therapeutic opportunities through inhibition, activation or synthetic lethality approaches. Promising strategies include combining ferroptosis inducers with autophagy inhibitors, targeting specific receptors, (such as FAM134B) and modulating mitophagy regulators (such as dynamin-related protein 1). In addition, autophagy-related biomarkers (sequestosome 1, LC-3B and beclin-1) are associated with clinical outcomes and may guide patient stratification. Given the bidirectional nature of selective autophagy in HCC, personalized approaches based on tumor context, specific pathway dependencies and disease stage are essential for effective therapeutic intervention.

Also flagged:Curculigosiderenal interstitial fibrosisrenal diseasesCCGnuclear factor erythroid 2-related factor 2Nrf2
Journal Article 2025-10-15 No Snippets Liu T, Sui M, Yu C, Bao Y, Xing L, Hou D, Xie R.
Show Full Abstract

<h4>Objectives</h4>Renal interstitial fibrosis (RIF) represents the final pathway in most progressive renal diseases. Curculigoside (CCG), derived from Curculigo Pilosa, affects oxidative stress and inflammation. However, the effects of CCG on RIF remain unclear. This study explored the nephroprotective role of CCG in regulating oxidative stress through the nuclear factor erythroid 2-related factor 2 (Nrf2)/heme oxygenase-1 (HO-1) pathway.<h4>Methods</h4>Bioinformatic analysis was employed to identify the targets of CCG, elucidate the underlying pathways, and analyze molecular docking results. C57BL/6 mouse models of unilateral ureteral obstruction (UUO) were established to validate the results. Morphologic changes were assessed by pathologic examination, and the expression of proteins associated with renal ferroptosis and fibrosis was analyzed by western blotting. Additionally, the levels of glutathione (GSH), malondialdehyde (MDA), superoxide dismutase (SOD), and iron were measured.<h4>Results</h4>In total, 3,532 differentially expressed genes (DEGs) were identified, comprising 2,290 upregulated and 1,242 downregulated genes. We retrieved 484 ferroptosis-related genes from the ferroptosis regulators (FerrDb) database, identifying 143 DEGs after intersecting with those from the Gene Expression Omnibus Series 217654 dataset (GSE217654). The key identified genes included nicotinamide adenine dinucleotide oxidase 4 (NOX4), activating transcription factor 3 (ATF3), mitogen-activated protein kinase 14 (MAPK14), tissue inhibitor metalloproteinase 1 (TIMP1), and early growth response 1 (EGR1). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses indicated that these genes were enriched in oxidative signaling pathways. The results exhibited the docking activity of CCG with related targets. CCG significantly alleviated histopathologic damage, reduced MDA and iron levels, and increased GSH and SOD levels. Protein analysis indicated that CCG alleviated fibrosis and enhanced the protein expression of antioxidants in UUO kidney tissues. CCG activated the Nrf2/HO-1 pathway and reduced UUO-induced ferroptosis.<h4>Conclusions</h4>CCG may improve renal fibrosis and mitigate ferroptosis by activating the Nrf2/HO-1 signaling pathway.

MRPL39
Also flagged:SYNPRnon-small cell lung cancerNSCLCcancerluciferasecell proliferation
Journal Article 2025-10-15 ✓ 1 Snippet Liu X, Yang H, Zhang X, Gu D.
In-Text Gene Mentions

MRPL39

Show Full Abstract

<h4>Objective</h4>To examine SYNPR-AS1 expression in non-small cell lung cancer (NSCLC) and evaluate its biological effects on cancer progression.<h4>Methods</h4>SYNPR-AS1 expression levels were quantified using quantitative real-time PCR. Functional experiments were performed to investigate the effects of SYNPR-AS1 on NSCLC cell phenotypes. In addition, the underlying mechanisms of action were explored through bioinformatic analysis, luciferase reporter assays, and RNA immunoprecipitation (RIP) experiments.<h4>Results</h4>SYNPR-AS1 was significantly upregulated in NSCLC tissues and cells. Functional experiments confirmed that SYNPR-AS1 knockdown suppressed cell proliferation, migration, and invasion, whereas its overexpression promoted these malignant behaviors. Mechanistically, SYNPR-AS1 competitively interacts with microRNA-3619-5p (miR-3619-5p), thereby preventing miR-3619-5p- mediated repression of Forkhead box protein K1 (FOXK1). Furthermore, rescue experiments confirmed that the inhibitory effects of SYNPR-AS1 knockdown in NSCLC cells were abrogated by miR-3619-5p inhibition or FOXK1 overexpression.<h4>Conclusions</h4>SYNPR-AS1 exerts pivotal functions in NSCLC through decoying miR-3619-5p and thereby regulating FOXK1 expression. The SYNPR-AS1/miR-3619-5p/FOXK1 axis may be an effective target for NSCLC therapy.

HFE
Also flagged:Fibroblast growth factorFGFInsulin-like Growth FactorIGFbromidecrystal violet
Journal Article 2025-10-15 ✓ 1 Snippet Qureshi ZH, Maqbool T, Farooq B, Altaf A, Azhar MM, Rafiq M, Sarwar M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Liver diseases remain a major global health burden, with limited treatment options for advanced hepatic dysfunction. Stem cell-based therapies offer a favorable strategy for liver regeneration by providing a renewable source of functional hepatocyte-like cells (HLCs). This study aims to investigate the effect of Fibroblast growth factor (FGF) and Insulin-like Growth Factor (IGF) pre-treatment on the differentiation capacity of Umbilical Cord-Derived Mesenchymal Stem Cells (UC-MSCs) and their potential application in regenerative therapy for liver fibrosis or cirrhosis.<h4>Methods</h4>Cell viability was evaluated through MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), crystal violet, and trypan blue assays. For the assessment of differentiation potential, ELISA (Enzyme-Linked Immunosorbent Assay) and Immunocytochemistry of Hepatocyte Growth Factor (HGF) and Epidermal Growth Factor (EGF) were performed. For angiogenesis, an ELISA of Vascular Endothelial Growth Factor (VEGF) was performed. For apoptosis, an ELISA of p53 was performed. Gene expression analysis of differentiation markers, including Cytochrome P450 Family 1 Subfamily A Member 2 (CYP1A2), Cytochrome P450 Family 3 Subfamily A Member 2 (CYP3A2), Hepatocyte Growth Factor (HGF), Epidermal Growth Factor (EGF), Alkaline Phosphatase (ALP), Alpha-Fetoprotein (AFP), and albumin, was also performed. Furthermore, antioxidant enzymes were also measured.<h4>Results</h4>UC-MSCs preconditioned with FGF and IGF exhibited significantly enhanced viability and reduced cell death, as confirmed by MTT, crystal violet, and trypan blue assays. ELISA and immunocytochemistry demonstrated marked upregulation of hepatic markers (HGF, EGF), angiogenic factor (VEGF), and reduced expression of the apoptotic marker p53 in the preconditioned groups. The gene expression analysis confirmed superior regenerative potential in the FGF+IGF-treated group. Antioxidative analysis further validated a higher level of antioxidative potential in preconditioned cells.<h4>Conclusion</h4>Preconditioned UC-MSCs offer a promising cell-based alternative to liver transplantation by enhancing regeneration, reducing apoptosis, and promoting angiogenesis and antioxidant defense in damaged liver tissue.

Also flagged:waterfluorocarbonperfluorooctanolsynthesisfluorinecarbon
Journal Article 2025-10-15 No Snippets Li X, Zhang C, Peng H, Ma S, Davis TP, Qiao R.
Show Full Abstract

Surfactants are central to droplet-based microfluidics, where they stabilize immiscible interfaces, prevent coalescence, and enable precise control of discrete fluid volumes for biological and chemical applications. Recent efforts in fluorosurfactant design have emphasized how variations in hydrophilic head groups, fluorinated tail architecture, and synthesis strategies determine performance in droplet systems. This review surveys advances from conventional polyethylene glycol (PEG)-perfluoropolyether (PFPE) architectures to emerging alternatives with nonionic polar head groups, highlighting those with the greatest potential to advance the field. Particular attention is given to reversible addition-fragmentation chain transfer (RAFT) polymerization, which has revolutionized fluorosurfactant development by enabling precise molecular control and tunable properties. This has allowed the integration of responsive functionalities, including temperature-sensitive <i>N</i>-isopropylacrylamide (NIPAM), pH-responsive 2-(dimethylamino)-ethyl acrylate (DMAEA), and zwitterionic monomers, thereby greatly expanding functional versatility. Such innovations improve droplet stability, suppress molecular exchange, and enhance biocompatibility under challenging experimental conditions. These advanced fluorosurfactants demonstrate exceptional utility across a spectrum of biological applications, including high-throughput screening, droplet digital PCR, single-cell genomics, cell encapsulation, and three-dimensional culture systems. Collectively, they establish a foundation for next-generation microfluidic technologies that demand robust compartmentalization with minimal biological interference.

Also flagged:behavioralbreast cancerBRCA1Huntingtoncystic fibrosisvision
Journal Article 2025-10-15 No Snippets Ramanan V, Vinod R, Williams C, Ramachandran S, Venkatasubramanian S.
Show Full Abstract

Genetic data collection has become ubiquitous, producing genetic information about health, ancestry, and social traits. However, unregulated use-especially amid evolving scientific understanding-poses serious privacy and discrimination risks. These risks are intensified by advancing AI, particularly multi-modal systems integrating genetic, clinical, behavioral, and environmental data. In this work, we organize the uses of genetic data along four distinct 'pillars', and develop a risk assessment framework that identifies key values any governance system must preserve. In doing so, we draw on current privacy scholarship concerning contextual integrity, data relationality, and the Belmont principle. We apply the framework to four real-world case studies and identify critical gaps in existing regulatory frameworks and specific threats to privacy and personal liberties, particularly through genetic discrimination. Finally, we offer three policy recommendations for genetic data governance that safeguard individual rights in today's under-regulated ecosystem of large-scale genetic data collection and usage.

Also flagged:bindingkinasetumorssolid tumorsAKTCasein kinase 2
Journal Article 2025-10-14 No Snippets Glossop PA, Brear P, Wright S, Flanagan N, Glossop MS, Lane CAL, Butt RP, Spring DR, Hyvönen M, Cawkill D.
Show Full Abstract

Casein kinase 2α (CK2α) is an oncology drug target that acts as a positive regulator of many tumorigenic signaling pathways. We previously reported that CK2α has a unique cryptic binding site, the αD pocket, that offers the potential for inhibitors with improved kinase selectivity. The prototype bivalent molecule CAM4066 (<b>6</b>) confirmed that improved selectivity could be achieved while binding in both the ATP-binding site and the αD pocket. A drug discovery project to develop a new series of bivalent CK2α inhibitors with increased cell potency and selectivity identified <b>61f</b> (APL-5125), a highly potent, ATP-competitive CK2α inhibitor with exquisite kinase selectivity and cellular potency. Compound <b>61f</b> demonstrates <i>in vivo</i> inhibition of p-AKT S129 in tumors (HCT116) following once-daily oral administration and shows a clear PK-PD relationship with unbound drug exposure. <b>61f</b> has a superior preclinical profile to existing CK2α inhibitors and is currently under evaluation in patients with advanced solid tumors.

Also flagged:nucleotidesynthesismetabolisminflammatory responsesCancercancers
Journal Article 2025-10-14 No Snippets Furlong M, Beitel SC, Conner R, Goodrich JM, Ding X, Rahn M, Stricker K, Guggenheim A, Hamilton A, Biering D, Hughes J, Gulotta JJ, Porter C, Hollister J, Burgess JL.
Show Full Abstract

<h4>Objective</h4>The study goal was to evaluate changes in serum proteins following firefighter exposure to the January 2025 Los Angeles area urban conflagrations.<h4>Methods</h4>The serum proteome was evaluated in 42 firefighters enrolled in the Fire Fighter Cancer Cohort Study with blood specimens collected in 2024 and in January and February of 2025, an average of 8.6 days after their most recent response to the urban conflagrations.<h4>Results</h4>Sixty proteins changed significantly from before to after exposure. These proteins were associated with nucleotide synthesis and repair, oxidative stress response, energy metabolism, and other mechanisms. Pathway analysis identified changes in metabolism and oxidative stress, immune and inflammatory responses, cellular barrier integrity and trafficking, and growth/cancer signaling.<h4>Conclusions</h4>Response to the Los Angeles area urban conflagration was associated with a change in the serum proteome of firefighters.

DCC
Also flagged:TRIM67extracellularaxonnetrin-1growth conesE3 ubiquitin ligase
Journal Article 2025-10-14 ✓ 2 Snippets Ho CT, Evans EB, Lukasik K, O'Shaughnessy EC, Shah A, Hsu CH, Temple B, Bear JE, Gupton SL.
In-Text Gene Mentions

…the netrin receptorDCCand is also…

DCC

Show Full Abstract

Neuronal morphogenesis depends on extracellular guidance cues accurately instructing intracellular cytoskeletal remodeling. Here, we describe a novel role of the actin binding protein coronin 1A (Coro1A) in neuronal morphogenesis, where it mediates responses to the axon guidance cue netrin-1. We found that Coro1A localizes to growth cones and filopodial structures and is required for netrin-dependent axon turning, branching, and corpus callosum development. We previously discovered that Coro1A interacts with TRIM67, a brain-enriched E3 ubiquitin ligase that binds the netrin receptor DCC, and is also required for netrin-mediated neuronal morphogenesis. Loss of Coro1A and loss of TRIM67 shared similar phenotypes, suggesting that they may function together in the same netrin pathway. A Coro1A mutant deficient in binding TRIM67 was unable to rescue loss of Coro1A phenotypes, indicating that the interaction between Coro1A and TRIM67 is required for netrin responses. Together, our findings reveal that Coro1A is required for proper neuronal morphogenesis, where it collaborates with TRIM67 downstream of netrin.

Also flagged:X-linked myotubular myopathyXLMTMX-centronuclear myopathycongenital muscle disorderdeath
Journal Article 2025-10-14 No Snippets Moschovaki-Filippidou F, Kretz C, Reiss D, Chicanne G, Payrastre B, Laporte J.
Show Full Abstract

The MTM1 gene encodes myotubularin (MTM1), a phosphatidylinositol 3-phosphate [PI(3)P] lipid phosphatase. Loss-of-function mutations in MTM1 cause X-linked myotubular myopathy (XLMTM), a severe congenital myopathy with no available cure and a poorly understood pathomechanism. The importance of MTM1 enzymatic activity and its PI(3)P substrate in physiology under normal conditions and in XLMTM is unclear. We generated the Mtm1-KI C375S mice in which the endogenous MTM1 was converted to a phosphatase-dead protein. Mutant mice survived a median of 12 weeks and demonstrated progressively impaired motor skills. Observed muscle hypotrophy and reduced force production compared with their WT littermates (~3.9-fold reduction in absolute maximal force) were responsible for these severe phenotypes. A significantly higher level of PI(3)P was found in the muscle of Mtm1-KI C375S mice. Muscle histology and molecular characterization revealed XLMTM hallmarks, with (a) alteration of the mTOR and autophagy pathways correlating with muscle hypotrophy and (b) abnormal myofiber intracellular organization correlating with impaired muscle force. Overall, this study reveals the importance of MTM1 phosphatase activity and related PI(3)P substrate for postnatal muscle maintenance, and it highlights the significance of MTM1 phosphatase activity in the development of X-linked myotubular myopathy.

HFE
Also flagged:liver fibrosischronic liver diseaseliver diseasecirrhosishepatocellular carcinomaviral hepatitis
Journal Article 2025-10-14 ✓ 1 Snippet Schreiner AD, Zhang J, Gebregziabher M, Marsden J, Mauldin PD, Rockey DC.
In-Text Gene Mentions

…primary biliary cholangitis,hemochromatosis, Wilson’s disease, and…

Show Full Abstract

<h4>Background</h4>Evidence suggests that there are racial differences in liver fibrosis progression for patients with chronic liver disease (CLD). We examined the association of Black race with the time to diagnosis of severe liver disease outcomes in primary care patients.<h4>Methods</h4>We captured electronic health record data from a primary care clinic between 2012-2021. Race, categorized as Black and non-Black, was the primary exposure. The outcome was the occurrence of a severe liver event identified by ICD-9/10 codes, defined as a composite of cirrhosis, complications of cirrhosis, hepatocellular carcinoma, and liver transplantation. Cox regression models evaluated the association of Black race with the time to severe liver outcomes while adjusting for potentially confounding covariates.<h4>Results</h4>The cohort included 20,828 patients of whom 43% identified as Black and 14% had a known diagnosis of CLD during follow-up. Of all patients, 3% received a diagnosis code for a severe liver event. In an unadjusted Cox regression model, Black race was associated with an increased hazard of a severe liver event (HR 1.32; 95%CI 0.98-1.34), but after adjusting for known CLD, baseline fibrosis risk, demographic, and comorbidity variables, Black race was associated with a significantly lower hazard of a severe liver outcome (HR 0.68; 95%CI 0.57-0.81).<h4>Conclusions</h4>After adjusting for potentially confounding covariates, Black race was associated with a longer time to a severe liver disease diagnosis. This finding raises the possibilities of delayed cirrhosis detection or differences in liver fibrosis progression by racial identifiers.

DARS2PRDX6
Also flagged:AnthracyclineschromatinBreast cancerTrastuzumabcardiovascular diseasesatrial fibrillation
Journal Article 2025-10-14 ✓ 5 Snippets Matthews ER, Abodunrin RO, Hurley JD, Paul S, Gutiérrez JA, Bogar AR, Ward MC.
In-Text Gene Mentions

…rs10798282 near thePRDX6gene.…

…(eQTLs) for theDARS2gene in heart…

…expression of theDARS2gene ( Fig…

…TSS of theDARS2gene overlaps a…

…Loss ofDARS2expression leads to…

Show Full Abstract

Breast cancer drugs including anthracyclines (ACs) and Trastuzumab increase the risk for cardiovascular diseases (CVDs) such as atrial fibrillation (AF) and heart failure (HF) that ultimately affect the heart muscle. These CVDs are associated with hundreds of genetic variants in non-coding regions of the genome. However, how these drugs affect the regulatory potential of the non-coding genome of the heart and CVD risk loci is unknown. We therefore measured global chromatin accessibility across iPSC-derived cardiomyocytes derived from four healthy individuals that we treated with topoisomerase II (TOP2) inhibiting ACs, Doxorubicin, Epirubicin, and Daunorubicin, and the anthracenedione, Mitoxantrone as well as the TOP2-independent monoclonal antibody Trastuzumab, for three and 24 hours. We identified tens of thousands of open chromatin regions that are differentially accessible in response to TOP2 inhibitor treatments over time, and no changes in response to Trastuzumab. Early AC-responsive regions are promoter-proximal and are enriched for regions bound by TOP2 beta. Late AC-responsive regions are enriched for AC response genes particularly those associated with mismatch repair. AC-response regions near AC response genes are enriched for FOS:JUNB transcription factor motifs. Three AC-induced cardiotoxicity-, 28 AF- and 14 HF-associated SNPs directly overlap late AC-responsive regions. Early AC-responsive regions are enriched for AF SNPs including rs3176326, which is also associated with HF, and is an eQTL for CDKN1A in heart tissue. This SNP associates with increased chromatin accessibility at a TOP2 beta-bound region, increased histone acetylation, and increased CDKN1A expression in response to all ACs. Our results demonstrate large-scale changes in chromatin accessibility in cardiomyocytes treated with ACs, which correspond to several regions harboring AF and HF risk loci. The identified drug-responsive chromatin regions can be used to annotate variants in cancer patient populations to contribute to risk estimation for CVD.

Also flagged:behavioralCardioceptioninteroceptiondevelopmental disorderscardiological diseasesdepression
Journal Article 2025-10-14 No Snippets Minenko I, Limonova A, Sukmanova A, Kutsenko V, Nazarova M, Ershova A, Drapkina O.
Show Full Abstract

Cardioception is the ability of the central nervous system to process signals from the heart. Methods for determining cardioception are still under discussion. In the present study, we considered metrics for cardiac interoceptive accuracy (CA) assessments in three behavioral cardioception tasks - (1) the heartbeat tapping (HTT), (2) the heartbeat discrimination (HDT), and (3) the heartbeat counting (HCT) - and heartbeat evoked potentials (HEP) recorded by an electroencephalography during resting state and the tasks. The study included forty-eight healthy volunteers (25 females, 36 ± 7 age). CA in the HTT assessed using various metrics, except for the metric based on the circular variation between heartbeat and pressing time, positively correlated both with each other and with the metric in the HCT. The HDT showed no correlation with the other tasks. However, none of the metrics showed a clear advantage over the others in their association with the neurophysiological marker of interoception, the mean HEP amplitudes, during task performance or at rest. During all three tasks, the HEP amplitudes (1) did not differ between individuals with high and low CA metrics, (2) was not different from the HEP amplitudes during the resting state, (3) was lower during the HDT compared to the HCT. Thus, our results contribute to the debate on the interaction between behavioral cardioception tasks and the HEP.

DCC
Also flagged:Netrin-1apolipoprotein EAPOEADtau
Journal Article 2025-10-14 ✓ 1 Snippet He B, Fu Z, Liang Y, Liang J, Zeng D, Zhong Y, Chen H, Wang X.
In-Text Gene Mentions

…to its receptors,DCCor UNC5, thus…

Show Full Abstract

The ɛ4 allele of the apolipoprotein E (APOE) gene stands as the most significant genetic risk factor for Alzheimer's disease (AD), although the underlying mechanism linking APOE to the disease remains elusive. Netrin-1, has been found to inhibit Aβ production, reduce neuroinflammation, and regulate synaptic plasticity, thereby playing a role in AD. Recent reports suggest that Netrin-1 could be a key protein connecting APOE ɛ4 with Aβ and tau tangles. This study aims to investigate whether APOE regulates the expression or function of Netrin-1, thus influencing the risk of developing AD. The serum levels of Netrin-1 were notably reduced in patients with AD compared to healthy individuals, whereas interleukin-6 (IL-6) concentrations were higher in the AD group. patients harboring the APOE ε4 allele exhibited a more pronounced decrease in Netrin-1 compared to those with other APOE genotypes. Furthermore, a correlation was observed between Netrin-1 concentrations and APOE allelic variations. Our results imply that Netrin-1 is a key player in the cognitive decline observed in AD and potentially contributes to the APOE-driven cognitive impairment process. This association is tightly linked to inflammatory factors, suggesting that Netrin-1 may serve as a crucial biomarker for the prognosis and therapeutic intervention of AD.

SOX6
Also flagged:reproductiongerm cell differentiationE6morphogenetic proteinsalkaline phosphatasetranscription factors
Journal Article 2025-10-14 ✓ 1 Snippet Barreñada O, Bochter J, Brieño-Enríquez MÁ, Del Mazo J.
In-Text Gene Mentions

…Sox genes: Sox5,Sox6, Sox8, Sox11, Sox13,…

Show Full Abstract

Primordial germ cells are the embryonic precursors to sperm and egg cells, and their development is regulated by multiple molecular pathways, including small non-coding RNAs. Environmental toxicants such as vinclozolin and mono-(2-ethylhexyl) phthalate (MEHP) can alter the expression of these regulatory RNAs, affecting both the exposed individuals and their descendants. To investigate these effects, we exposed pregnant mice to vinclozolin or MEHP and collected embryonic ovaries from their offspring across three generations. Small RNA sequencing identified 3,498 microRNA and 12,078 piwi-interacting RNA sequences. Exposure led to the deregulation of 34 microRNAs and 668 piwi-interacting RNAs, with changes persisting unexposed descendants of two generations. When both parents were exposed, dysregulation was more pronounced than with maternal exposure alone, an average increase of 4.06-fold for piRNAs and 5.5-fold for microRNAs. Quantitative PCR confirmed changes in selected microRNAs. Immunofluorescence analysis showed an increase in apoptotic cells in embryonic ovaries, particularly within primordial germ cells. The number of dying cells increased 2.44-fold after vinclozolin exposure and 1.75-fold after MEHP exposure. These findings contributed to the knowledge that in utero exposure to vinclozolin or MEHP disrupts small RNA expression and increases apoptosis in the developing ovary, with effects that persist across multiple generations.

Also flagged:aryl hydrocarbon receptormetabolismcoagulationorgan developmentAHRSR1
Journal Article 2025-10-14 No Snippets Lin Y, Geng F, Shieh JH, Torres LK, Sominskaia M, Gao M, Wingo M, Chen K, Rustam S, Chavez R, Shaykhiev R, Kopacz A, Pearson B, Redmond D, Schreiner R, Rafii S.
Show Full Abstract

Tissue-specific endothelial cells (ECs) regulate metabolism, inflammation, coagulation, organ development and regeneration. However, therapeutic application of EC transplantation requires scalable expansion of engraftable ECs that sustain their angiogenic and angiocrine functions. Here we identify a non-canonical aryl hydrocarbon receptor (AHR) pathway switched on by canonical AHR inhibitors that reactivates quiescent EC proliferation. Incubation of tissue-specific human ECs with AHR inhibitors, such as StemRegenin1 (SR1), increased EC proliferation by three-fold within an 8-day period. AHR inhibitors induced 100-fold greater expansion of 200,000 primary human adipose ECs to 2.4 × 10<sup>12</sup> ECs, retaining in vivo vessel-forming and homeostatic functions in the recipient mice. AHR inhibitors induce a non-canonical AHR pathway by ornithine decarboxylase 1 (ODC1)-dependent synthesis of polyamines that drives EC cell cycle progression, detoxification of reactive oxygen species and oxidative phosphorylation metabolism, thereby recruiting hibernating ECs to accompany expanding EC populations without imposing replicative senescence. Therefore, AHR inhibitors, through transcriptional-independent protein-protein interactions, shepherd unrestricted human-scalable functional EC expansion, enabling cell therapies.

Also flagged:amino acidscompoundsflavonoidscucurbitacinseleniumsugar
Journal Article 2025-10-14 No Snippets Chen Z, Guo X, Cheng S, Zhou X, He Z.
Show Full Abstract

<h4>Background</h4>'Tuershao' is a new chayote (Sechium edule) variety whose tuberous roots and tender shoots are edible. These parts are rich in beneficial substances, including amino acids, proteins, phenolic compounds, flavonoids, cucurbitacin, and selenium, demonstrating their unique value. However, its ovary cannot develop into a mature fruit, and cutting techniques help to achieve the breeding of 'Tuershao'.<h4>Results</h4>This study found that using peat soil as the substrate and treating semi-hard branches with 1.0 g·L⁻¹ indole-3-butyric acid (IBA) achieved the highest rooting rate of 94.33%, with the maximum values in root length, root surface area, root volume, and root diameter. Additionally, exogenous hormone treatment led to greater fluctuations in the contents of soluble sugar, starch, and soluble protein in 'Tuershao'. The activities of catalase (CAT), polyphenol oxidase (PPO), peroxidase (POD), and superoxide dismutase (SOD) were also enhanced. The contents of endogenous hormones such as auxin (IAA), cytokinin (CTK), and gibberellin A<sub>3</sub> (GA<sub>3</sub>) increased, while abscisic acid (ABA) decreased.<h4>Conclusions</h4>Treating semi-hard branches with 1.0 g·L⁻¹ IBA on peat soil shows the best effect in promoting rooting of 'Tuershao' cuttings. Exogenous IBA can promote nutrient metabolism, enhance antioxidant enzyme activities, and regulate endogenous hormone levels in 'Tuershao' cuttings, thereby further promoting rooting.

PEBP1
Also flagged:alcoholic hepatitisAHRNA-binding proteinsalcoholic liver diseasefatty aciddegradation
Journal Article 2025-10-14 ✓ 5 Snippets Zhao J, Cheng J, Liang S, Guo W, Zhao B, Zhang H, Mei X, Zhang N, Sheng M.
In-Text Gene Mentions

PEBP1exhibited the strongest…

…correlations suggest thatPEBP1, HSPA7 and…

…Notably,PEBP1, HSPA7 and DMGDH…

…the interaction betweenPEBP1and Periostin may…

…findings suggest thatPEBP1-regulated AASEs may…

Show Full Abstract

<h4>Background</h4>Alternative splicing (AS) plays a critical role in gene regulation, contributing to transcriptomic complexity and disease progression.<h4>Methods</h4>In this study, we investigated the regulatory effects of AS in alcoholic hepatitis (AH) using transcriptomic data from 41 samples (Normal: 21; AH: 20) from three projects (PRJNA597328, PRJNA600011 and PRJNA656197) from the NCBI database.<h4>Results</h4>A total of 1,061,774 transcripts were identified, of which 42.23% were novel and not annotated in the reference genome, highlighting the diversity of transcriptomic variation in AH. Furthermore, we identified 1,655 aberrant alternative splicing events (AASEs) associated with 1,170 genes, 487 of which were significantly correlated with 22 differentially expressed RNA-binding proteins (RBPs). Additionally, 4,745 splicing quantitative trait loci (sQTLs) were identified in AH, mapped to 2,438 genes enriched in the regulation of some metabolic processes. Notably, several susceptibility sQTL locis were located within known alcoholic liver disease (ALD) associated genes, including GAB1, TJP2 and RCAN1. These findings suggest that AS, through its regulation by RBPs and genetic variants (sQTLs), significantly influences key biological processes in AH, including fatty acid degradation and ferroptosis, processes that are central to the clinical manifestations of AH.<h4>Conclusions</h4>This study provides new insights into the molecular mechanisms underlying AH, emphasizing the importance of AS and its regulatory factors in disease progression.

HFE
Also flagged:non-alcoholic fatty liver diseasekidney diseasescardiovascular diseasesstrokehypertensionNAFLD
Journal Article 2025-10-14 ✓ 1 Snippet Behzad C, Shateri Z, Motamed N, Maadi M, Ajdarkosh H, Sobhrakhshankhah E, Zamani F, Doustmohammadian A, Nouri M.
In-Text Gene Mentions

…liver, viral hepatitis,hemochromatosis, autoimmune liver disease,…

Show Full Abstract

<h4>Background</h4>Several studies have demonstrated that the cardiometabolic index (CMI) is associated with multiple health conditions. These include kidney diseases, cardiovascular diseases, stroke, and hypertension. The objective of the present research was to investigate the relationship of CMI with the risk of non-alcoholic fatty liver disease (NAFLD) in a sample of the Iranian population.<h4>Methods</h4>This cross-sectional study included 3,120 participants from the second phase of the Amol cohort study. Ultrasound scanning was utilized to diagnose the NAFLD. The hepatic steatosis index (HSI), fatty liver index (FLI), and CMI values were calculated using standard equations. Multivariate and univariate logistic regression models were employed to investigate the relationship between CMI and NAFLD, FLI, and HSI.<h4>Results</h4>In the adjusted model, we found that the likelihood of NAFLD increased in the second and last tertiles of CMI compared to the first tertile (T). For NAFLD the odds ratio (OR) were 1.883 (95% confidence interval (CI): 1.487-3.653) in T<sub>2</sub> and 2.801 (95% CI: 2.149-3.653) in T<sub>3</sub>. Similarly, the FLI increased with higher CMI tertiles: T<sub>2</sub>- OR = 4.888; 95% CI: 3.018-7.919 and T<sub>3</sub>- OR = 41.622; 95% CI: 24.201-71.582). A higher likelihood of HSI was also observed in the last tertile of CMI in comparison to the first tertile (OR = 2.344; 95% CI: 1.637-3.356).<h4>Conclusions</h4>The current study showed a significant association between CMI and NAFLD, as measured by ultrasound, FLI, and HSI. However, due to the cross-sectional design, causal inference is limited, and further prospective studies are needed to validate these results.

HFE
Also flagged:ApoJmetabolic dysfunction-associated steatohepatitisapolipoproteinsapoA-Iobesitydiabetes
Journal Article 2025-10-14 ✓ 1 Snippet Cai Z, Najib S, Núñez-Sánchez MA, Martínez-Sánchez MA, García-Melgares C, Viguerie N, Rossell J, Julve J, Croyal M, Oliveira AR, Martínez CM, Dumas SJ, Genoux A, Frutos MD, Ramos-Molina B, Martinez LO.
In-Text Gene Mentions

…ase, hepatocellular carcinoma,hemochromatosis, Wilson’s disease, familial/g…

Show Full Abstract

<h4>Background</h4>Plasma apolipoproteins are linked to cardiometabolic dysfunctions, but their potential as biomarkers for metabolic dysfunction-associated steatohepatitis (MASH) remains underexplored.<h4>Methods</h4>Plasma levels of 14 apolipoproteins (apoA-I, A-II, A-IV, B100, C-I, C-II, C-III, D, E, F, H, J, L1, M) were quantified using liquid chromatography-tandem mass spectrometry in a cross-sectional study of 148 individuals with obesity undergoing bariatric surgery. Based on liver histology, participants were categorized as non-MASH (n = 94; no liver alterations or simple steatosis, ≥ 5% intrahepatic fat) or MASH (n = 54; steatosis with ballooning and lobular inflammation, with or without fibrosis). Correlations with clinical and biochemical parameters were assessed via Spearman's rank correlation, and associations with MASH were evaluated using logistic regression. Incremental predictive value beyond established risk factors was assessed through likelihood ratio tests (LRT), net reclassification improvement (NRI), and integrated discrimination improvement (IDI).<h4>Results</h4>ApoC-III and apoL1 were significantly higher in MASH compared with non-MASH participants, while other apolipoproteins showed no group differences. Higher apoE, apoL1 and apoJ levels were associated with increased odds of MASH, independently of age and sex. Associations for apoL1 and apoJ remained significant after adjustment for diabetes, dyslipidemia, and hypertension, or for established MASH risk factors including insulin resistance, triglycerides, waist circumference, and the AST/ALT ratio. LRT analyses showed that apoJ (ΔDeviance = 4.085, p = 0.043) and apoL1 (ΔDeviance = 3.954, p = 0.047) each improved model fit, with their combination providing additional improvement (ΔDeviance = 7.534, p = 0.023). NRI analysis indicated that the combination of apoJ and apoL1 provided the largest improvement (NRI total = 0.39, p = 0.026), mainly by correctly reclassifying non-MASH individuals (NRI non-event = 0.31, p = 0.0023). IDI was also greatest for the combination (IDI = 0.04, p = 0.034), indicating enhanced discrimination between MASH and non-MASH individuals. In an external cohort, the elevation of plasma apoJ in MASH was consistently replicated, whereas apoL1, apoC-III, and apoE showed no such pattern.<h4>Conclusions</h4>Plasma apoJ and apoL1 may serve as potential biomarkers for diagnosing MASH in individuals with obesity, independent of traditional risk factors. Further validation in larger cohorts and mechanistic studies is warranted.

Also flagged:ovarian cancertranslationalgynecological malignanciestumormalignantdeath
Journal Article 2025-10-14 No Snippets Dogra S, Adhikari L, Benbrook DM, Bohn JA, Burgett A, Chandra V, Dockery L, Singh A, McNally L, Rai R, Isingizwe ZR, Richardson DL, Yang Z, Hannafon BN.
Show Full Abstract

Ovarian cancer is one of the most lethal gynecological malignancies and is often associated with fluid build-up in the peritoneal cavity, known as ascites. Nearly one-third of patients with ovarian cancer present with ascites at the time of initial diagnosis, and more frequently with recurrent ovarian cancer. Ascites is a uniquely valuable tool for research, as it is representative of both the tumor and its microenvironment. Ascites is composed of cells (single cells and multicellular aggregates) and acellular components that contribute to the development of peritoneal metastasis and chemoresistance. Ascites is an underutilized resource that provides an opportunity to improve our understanding of ovarian cancer biology, identify novel drug targets, assess drug responses, and identify diagnostic and/or prognostic biomarkers. This review summarizes the current understanding of ovarian cancer ascites with a focus on, (1) etiology, (2) cytopathological and molecular characterization, (3) the role its cellular and acellular components play in shaping the tumor microenvironment, and (4) its application in translational research for drug development (organoids and patient-derived ascites xenografts) and biomarker discovery. Lastly, options for the treatment of malignant ascites, along with future opportunities to use ascites as a translational research tool to improve our understanding of ovarian cancer biology and to develop new therapeutic strategies, are discussed.

Also flagged:inflammatory breast cancerbreast cancerIBCcancerBRCA2RAD54L
Journal Article 2025-10-14 No Snippets Boujemaa M, Hamdi Y, Guidara S, Souissi A, Bouaziz H, Mejri N, Aloulou S, Mahjoub N, Chaabane K, Hakim H, Boussen H, Dhiab TB, Kamoun S, Ayadi R, Driss M, Ayadi A, Radouani F, Fakhkhari M, Khyatti M, Abdelhak S, Sadki K, Boubaker MS, Rebai A, Cherif B.
Show Full Abstract

<h4>Background</h4>Inflammatory breast cancer (IBC) is a rare and aggressive form of breast cancer, characterized by distinct clinicopathological features and a relatively high frequency in North African countries. While several studies have explored the genetic basis of breast cancer, limited research has looked into the specific genetic features of this aggressive form. This study aims to investigate the genetic factors associated with IBC in North Africa, particularly among Tunisian patients.<h4>Methods</h4>Whole exome sequencing was performed for 13 patients with IBC. Clinicopathological data have been collected to assess the phenotype-genotype correlation. Both germline point mutations and copy number variations (CNVs) were analyzed. Genes and variants were prioritized through phenotype and genotype-driven approaches. Variants were filtered based on pathogenicity predictions and ACMG classification. A Gene-Disease association analysis was conducted using DisGeNET data and the VarElect online tool to select candidate genes most likely involved in disease onset. The predictive and prognostic values of the relevant genes were assessed using publicly available datasets.<h4>Results</h4>Our investigations revealed relevant genetic variants within established cancer predisposing genes, inflammatory pathways, and potential candidate predisposing genes, including BRCA2 c.1794_1798del, a novel mutation in RAD54L gene (c.1712T > C) and c.555_559del in IFNAR2 gene. CNVs in ABRAXAS1, XRCC2 and FANC genes were identified. We have also found that the high expression levels of RAD54L and MTHFR are correlated with good survival rates. The genetic makeup of IBC seems to be very heterogeneous. For the same patient, we have detected several relevant variants that might explain disease development and progression, and this was consistent with the family history of cancer observed in the investigated families.<h4>Conclusions</h4>Our findings revealed a complex and heterogeneous genetic background of IBC in the Tunisian population that might contribute to disease susceptibility and impact disease prognosis. The genetic features of IBC presented in this study provide valuable insights into the molecular mechanisms underlying the disease offering not only a deeper understanding within the context of Tunisia but also shedding light on its relevance to other North African populations characterized by similar epidemiological and genetic features.

Also flagged:Acute respiratory distress syndromeARDSpathogenesismyocardial infarctionvasculitisCOVID-19
Journal Article 2025-10-14 No Snippets Costa Monteiro AC, Pickering H, Sarma A, Taylor CS, Jenkins MM, Hsu FM, Nadel B, Levy O, Baden LR, Melamed E, Ehrlich LIR, McComsey GA, Sekaly RP, Cairns CB, Haddad EK, Shaw AC, Hafler DA, Montgomery RR, Corry DB, Kheradmand F, Atkinson MA, Brakenridge SC, Higuita NIA, Metcalf JP, Hough CL, Messer WB, Pulendran B, Nadeau KC, Davis MM, Geng LN, Fernandez-Sesma A, Simon V, Krammer F, Kraft M, Bime C, Calfee CS, Erle DJ, Bosinger S, Eckalbar W, Maecker H, Rahman A, Guan L, Peters B, Kleinstein SH, Augustine AD, Diray-Arce J, Becker PM, Rouphael N, IMPACC Network, CAFPINT Site investigators of the PALISI Network, Agus M, Kulkarni H, Schaenmann JM, Salehi-Rad R, Matthay MA, Reed EF, Sapru A.
Show Full Abstract

<h4>Background</h4>Elevated circulating endothelial cells (CECs), released from monolayers after insult, have been implicated in worse outcomes in ARDS and COVID-19, however there is no consensus proteomic phenotype that define CECs. We queried whether a transcriptomic approach would alternatively support the presence of endothelial cells in circulation and correlate with worsening respiratory failure.<h4>Methods</h4>To test whether elevated endothelial cell signatures (ECS) in circulation plays a role in worse respiratory outcomes, we used unsupervised bulk-transcriptome deconvolution to quantify ECS% in two cohorts. Our pilot analysis included pediatric patients requiring invasive mechanical ventilation (CAF-PINT, NCT01892969). Our validation cohort included adult hospitalized patients with COVID-19 (IMPACC, NCT04378777), testing the association of ECS% to outcomes in patients at risk of acute respiratory failure/ARDS. Primary outcome was 28-day mortality.<h4>Results</h4>In CAF-PINT, day 0 ECS% was higher in non-survivors compared to survivors of respiratory failure (2.8%, IQR 2.4-3.4% versus 2.6%, IQR 2.2-3.0% n = 244, p < 0.05, Wilcoxon rank-sum). In IMPACC, baseline ECS% (< 72 h of hospitalization) was higher in COVID-19 non-survivors versus survivors (2.9%, IQR 2.6-3.4%, versus 2.7%, IQR 2.3-3.1%, n = 932, p < 0.001, Wilcoxon rank-sum). Each 1% increase in baseline ECS% was significantly associated with mortality (adjusted OR 1.36, CI 1.03-1.79) by multivariable logistic regression. Increased baseline ECS% was associated with worse respiratory trajectories (2.5%, IQR 2.2-2.8% for trajectory with no oxygen requirements, 2.9%, IQR 2.6-3.4% for the trajectory with fatal outcome by day 28, n = 932, p < 0.001, one-way ANOVA).<h4>Conclusion</h4>Quantifying ECS by deconvolution supports a transcriptomics-driven approach towards the non-invasive evaluation of endothelial damage in respiratory outcomes. This is a first step towards elucidating mechanistic components linking endothelial damage to ARDS utilizing non-invasive, circulating transcriptomic data by leveraging a novel deconvolution approach.

Also flagged:dementiaADAPOETREM2APPPSEN1
Journal Article 2025-10-14 No Snippets de Rojas I, Hulsman M, Tesi N, van Spaendonk RML, van der Schaar J, Dijkstra JIR, van der Flier WM, van Ruissen F, Jansen PR, Reinders MT, van Haelst MM, Pijnenburg YAL, Fernandez MV, Ruiz A, Holstege HH, van der Lee SJ.
Show Full Abstract

BACKGROUND: Many types of dementia have high heritability, which creates opportunities for DNA diagnostics. Clinicians sporadically test for causal genetic variants. However, in addition to causal genetic mutations, an increasing number of both common and rare risk factors are being identified, especially for Alzheimer’s disease (AD). Here, we describe and evaluate diagnostic performance of combining genetic risk factors for AD to assist memory clinic clinicians. METHODS: A retrospective analysis of 998 consecutive patients (mean age 62.1, 40.3% females, 63.3% dementia) was conducted over 2.5 years in a Dutch memory clinic. The patients underwent a complete genetic risk assessment, including whole-exome sequencing and array genotyping. We examined known pathogenic genetic variants for all dementia types and their correlation with clinical diagnoses. We evaluated a combined genetic score (GS) based on all genetic risk factors for AD - namely APOE genotypes, candidate risk rare variants in 11 genes, and a polygenic risk score (PRS) based on 82 common variants. Then, we analyzed the discriminatory characteristics of the GS. RESULTS: Causal pathogenic variants were rare, present in 3.4% of individuals, but genetic testing would have altered the diagnosis in over half of the carriers. Candidate rare risk variants were more common, identified in 31.6% of patients. Both APOE genotypes and the PRS were independently associated with AD, and gene-specific interaction was found between TREM2 and AD-PRS (β = -1.16, p = 0.015). Patients with a high GS were 7 times more likely receive an AD diagnosis compared to those with a low GS (p = 2.5E-07). CONCLUSION: Overall, this study highlights the potential of integrating genetic risk factors into clinical practice to enhance AD diagnosis, though the improvement in diagnostic accuracy was moderate. The findings underscore the importance of genetic testing in diagnosis while also recognizing its limitations.

VRK2
Also flagged:organellesextracellular spacesecretionfocal adesion kinaseFAKGolgi apparatus
Journal Article 2025-10-14 ✓ 1 Snippet Serafino G, Forciniti S, Scarpa E, Ranieri A, Santorelli L, De Blasi G, Costantini S, Lee EJ, Galeone A, Calcagnì A, Pirozzi M, Del Mercato LL, Venditti R, D'Angelo G, Parashuraman S, Verri T, Gigli G, Sztul ES, Grumati P, Rizzello L, Russo D, Rizzo R.
In-Text Gene Mentions

…SIK2, VRK1, andVRK2( www.phosphosite.org ).…

Show Full Abstract

The secretory pathway is a sophisticated endomembrane machinery designed to transport and deliver proteins and lipids to intracellular organelles and the extracellular space. While the molecular components of the secretory pathway are well understood, less is known about their regulation, especially by mechanical cues. Here, it is reported that substrate stiffness stimulates conventional secretion. A molecular pathway is unravelled that links a mechanical cue through proto-oncogene tyrosine-protein kinase Src (Src) and focal adesion kinase (FAK) kinases to promote the trafficking of secretory proteins out of the Golgi apparatus and prevent their post-Golgi lysosomal degradation. Phosphoproteomic analysis revealed the Golgi-specific Brefeldin A resistance factor 1 (GBF1) as a key downstream mechano-responsive regulator, whose phosphorylation state orchestrates post-Golgi cargo sorting, directing proteins either toward secretion or to lysosomes. Finally, AMP-activated protein kinase (AMPK) is identified as a stiffness-dependent upstream regulator of GBF1 phosphorylation. Together, the data reveal a molecular regulatory loop in which matrix stiffness positively regulates cellular secretion via the Src-FAK-AMPK-GBF1 axis, which can have relevant medical implications in conditions like cancer and fibrosis and their treatment.

ZNFX1
Also flagged:TTKOral Squamous Cell CarcinomatumorOSCCcell proliferationgene expression
Journal Article 2025-10-14 ✓ 1 Snippet Jin H, Liu T, Guo Y, Bu W, Liu F, Hou Y.
In-Text Gene Mentions

…in NALCN andZNFX1, as well as…

Show Full Abstract

<h4>Objective</h4>Oral squamous cell carcinoma remains difficult to treat because of its marked tumor heterogeneity, highlighting the need to identify molecular subtypes with distinct therapeutic vulnerabilities. This study aimed to comprehensively characterize OSCC molecular subtypes and identify potential therapeutic targets.<h4>Materials and methods</h4>We conducted an integrated analysis combining single-cell and bulk RNA sequencing from 709 OSCC cases. Protein interactions were examined using mass spectrometry and immunoprecipitation assays. The functional roles of key regulators were evaluated through in vitro cell proliferation and invasion assays, RNA sequencing of knockdown cell lines, and in vivo xenograft models. Statistical analyses included differential gene expression analysis, pathway enrichment, and IC50 determination for drug sensitivity.<h4>Results</h4>We identified a distinct molecular OSCC subtype marked by concurrent activation of the mTORC1 and NF-κB pathways, with TTK emerging as a central regulator of this co-activation. Patients in this subtype exhibited pronounced genomic instability, reflected by increased tumor mutational burden, higher TP53 mutation frequency, copy number amplifications across multiple genomic regions. Mechanistically, mass spectrometry and co-immunoprecipitation assays showed that TTK directly interacts with the TAK1-TAB protein complex, thereby activating the NF-κB pathway. RNA sequencing of TTK knockdown cell lines demonstrated significant downregulation of both mTOR and NF-κB signaling upon TTK suppression. Functional assays confirmed that TTK inhibition strongly reduced OSCC cell proliferation and invasion and markedly enhanced cisplatin sensitivity in vitro and in vivo.<h4>Conclusion</h4>Our findings establish TTK as a pivotal mediator defining a high-risk OSCC molecular subtype characterized by simultaneous activation of the mTORC1 and NF-κB pathways and severe genomic instability. The discovery of a direct interaction between TTK and the TAK1-TAB complex provides novel mechanistic insight into NF-κB activation, while its inhibition significantly improves cisplatin sensitivity. These results warrant further clinical evaluation of TTK inhibitors as a promising therapeutic strategy to improve outcomes in aggressive OSCC.

Also flagged:Head and Neck Squamous Cell CarcinomaHNSCCcancertumorscell differentiationextracellular
Journal Article 2025-10-14 No Snippets Katase N, Sakamoto Y, Suda H, Miyahara R, Fujita S.
Show Full Abstract

Introduction Head and neck squamous cell carcinoma (HNSCC) is the most common cancer of the head and neck region, including the oral cavity, larynx, pharynx, nasal cavity, and paranasal sinuses. Cancer arises because of cumulative genetic and epigenetic alterations in cancer-associated genes. It is important to understand the genetic/epigenetic background of the tumors to establish molecular targeted therapies. So far, the knowledge of key genes or molecules, which are closely associated with the carcinogenesis and development of HNSCC, is insufficient for targeted therapies. On the other hand, recent advances in next-generation sequencing (NGS) have greatly contributed to cancer genome research. In this research, using RNA sequence data of HNSCC stored in The Cancer Genome Atlas (TCGA) database, we identified differentially expressed genes (DEGs), functionally enriched gene sets, and new prognostic markers or candidate therapeutic targets. This exploratory study investigated whether novel prognostic markers and candidate therapeutic targets for HNSCC could be identified from TCGA RNA-seq data. Methods The RNA sequence data were downloaded from TCGA, including 504 cases from cancer and 44 cases from corresponding normal tissue. The DEGs between cancer and normal samples were detected using the DESeq2 package in R software. Differences with | log2 fold change (FC) | > 1.0 and p-value <0.05 were considered as DEGs. Functional enrichment analyses were performed by ShinyGO 0.85 with Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. A gene set enrichment analysis (GSEA) was also performed using GSEA software. We also analyzed the top 10 up- and down-regulated genes, which were sorted by adjusted p-value, by using Kaplan-Meier analysis to assess their potential as prognostic markers. Results Using the DESeq2 package, 10,976 DEGs were detected, including 6,932 up-regulated genes and 4,044 down-regulated genes in cancer. As expected, functional enrichment analyses revealed enrichment of KEGG terms associated with cancers, including "Pathway in Cancer", "Human Papillomavirus infection", and "PI3K-Akt signaling pathway" in up-regulated genes, whereas KEGG terms enriched in down-regulated genes were mainly "Metabolic pathways". GO terms for "Cell differentiation (GOBP)" and "Extracellular region (GOCC)" were enriched both in up- and down-regulated genes, suggesting aberrant expression of genes associated with cell differentiation and remodeling of the extracellular matrix. GSEA data supported the enrichment analyses data. Kaplan-Meier analyses revealed that high expression of homeobox C6 (<i>HOXC6</i>) (p=0.048), nucleobindin 2 (<i>NUCB2</i>) (p=0.007), IL12A antisense RNA 1 (<i>IL12A-AS1</i>) (p=0.001), calcium-binding protein 39-like (<i>CAB39L</i>)(p=0.038)<i>,</i> nitric oxide synthase traffickin<i>g</i> (<i>NOSTRIN</i>) (p=0.024), SLC8A1 antisense RNA 1 (<i>SLC8A1-AS1</i>) (p=0.016), were the significantly correlated with poorer prognosis. Conclusions Based on bioinformatical approaches, we identified significantly enriched gene sets and novel candidates for prognostic markers or therapeutic targets in HNSCC. Further investigation would aid in determining the anti-cancer effects of these candidates.

Also flagged:Hememetabolismbindingdetoxificationdegradationheme oxygenase
Journal Article 2025-10-14 No Snippets Fleischhacker AS, Blume-La-Torre J, Pendill K, Dozier K, Ragsdale SW.
Show Full Abstract

Heme is an essential biomolecule and cofactor that participates in many different biological processes by binding to a diverse group of proteins to affect structure, function, and regulation. Yet, heme becomes toxic to human cells when its levels are elevated. As will be the focus of this review, the major route of heme detoxification in humans is through the heme degradation pathway involving heme oxygenase (HO). Humans, as well as other amniotes, express two isoforms of HO, HO1 and HO2, and understanding the role each isoform plays in regulating heme homeostasis is of great interest. Recently, a role for HO2 in sequestering, rather than degrading, heme has been uncovered. Here, we highlight this role of HO2 and place it in context of how, when, and why heme degradation proceeds, including the regulation of HO activity by the other necessary components of the reaction: oxygen and electrons from NAPDH via cytochrome P450 reductase. In addition, we review the significant roles the products of heme degradation (biliverdin, iron, and carbon monoxide) play in human health. Therefore, HO has many spheres of influence centered around substrates and products of the reaction, signifying the wide-reaching effects of heme degradation and sequestration.

TRIM38
Also flagged:diabetescoronary artery diseaselow-density lipoprotein receptorfactorsKCNQ1ATP6V1B1
Journal Article 2025-10-14 ✓ 2 Snippets Aihemaiti G, Abula A, Luo J, Zhao Q, Song N, Liu F, Adili N, Yang Y, Li X.
In-Text Gene Mentions

…16 diabetes-related genes: “TRIM38,” “SAPG4,” “ODC1,” “NPY,”…

…model score= −0.0012369*exp (TRIM38) + 0.0017723*exp(SAPG4)+ 0.00…

Show Full Abstract

<h4>Background</h4>Diabetes mellitus (DM) and coronary artery disease (CAD) are closely interrelated clinical conditions. However, the combination analysis based on DM related CAD diagnostic model remains a gap. The primary objective of this study was to identify diagnostic models and diagnostic markers for CAD based on the association of diabetic phenotypes and attempt to explore them further in a mouse model.<h4>Methods</h4>We used data integration as well as multiple datasets for both coronary artery disease and diabetes to exclude bias as well as to improve reliability. We employed the least absolute shrinkage and selection operator (LASSO) regression algorithms to construct the CAD diagnostic model. Furthermore, we established mouse CAD model (low-density lipoprotein receptor deficient mice with high fat diet) to explore the crosstalk between the screened biomarkers and severe CAD progress.<h4>Results</h4>The intersecting genes from differential analysis and weighted correlation network analysis (WGCNA) results yielded 32 diabetes-related biomarkers. We then identified two diabetes-related phenotypes through the consensus clustering in CAD patients. Microenvironmental analysis revealed that phenotype 1 exhibited higher expression of most cytokines, inflammatory factors, interleukins, and related receptors. Immune cell composition in phenotype 1 showed increased infiltration compared to phenotype 2. The LASSO regression identified 16 diabetes-related genes and we further constructed a diagnostic model based on these genes, which the area under the curve (AUC) reached 0.8. Additionally, single cell immune analysis exhibited the location of these genes. KCNQ1, ATP6V1B1, MTDH, and ITPK1 were predominantly located in macrophages, indicating their potential in regulating macrophage during myocardial injury. Furthermore, We elucidated that KCNQ1 and ITPK1 exhibited high expression level in mouse CAD model in tissue level. exhibited similar expression trends with macrophage biomarkers (CD31 and CD68). The result of qPCR also indicated the elevated level of KCNQ1 and ITPK1, which exhibited crosstalk with CD31 and CD68 in mouse CAD model.<h4>Conclusion</h4>This study delves into the microenvironmental characteristics of diabetes-related phenotypes in CAD, constructing an optimal diagnostic model and validated the significance of diagnostic markers in mouse CAD model, which may offer insights that could be beneficial for clinical management in the near future.

HFE
Also flagged:MHC Class IT-cell receptorsMHC-IaMHC-Ibimmune responsesImmunosurveillance
Journal Article 2025-10-14 ✓ 1 Snippet Robert J, Najafi-Majd E.
In-Text Gene Mentions

…, Qa-2 ,HFE, and RT1…

Show Full Abstract

Unlike conventional T cells, which express a highly diverse repertoire of dimeric αβ T-cell receptors (TCRs) restricted by classical, polymorphic MHC class I molecules (MHC-Ia), a distinct group of T cells-collectively termed "innate-like T (iT) cells"-exhibits limited TCR diversity and depends instead on nonclassical, nonpolymorphic MHC class I molecules (MHC-Ib) for their development and function. While mounting evidence supports the role of iT cells as pivotal regulators and effectors in both innate and adaptive immune responses, many aspects of their biology remain incompletely understood. In humans, iT cells represent a significant fraction of the total T cell population, and evolutionarily conserved subsets have also been identified in other mammals and amphibians. Moreover, the expanding catalog of nonpolymorphic <i>MHC-Ib</i> genes and lineages-distinct from polymorphic <i>MHC-Ia</i> genes-across jawed vertebrate genomes suggests a broader and potentially more integral role for MHC-Ib molecules in T cell function and immune surveillance. In this review, we explore the immunological significance of MHC-Ib molecules and iT cells through an evolutionary lens, highlighting recent advances that shed light on their contributions to immune homeostasis and defense.

HFE
Also flagged:IronoxygenhematopoiesismetabolismNF-κBPI3K
Journal Article 2025-10-14 ✓ 1 Snippet Qian H, Wang P, Li T, Zhang C, Li J, Wang Q, Ren H, Jin F, Huang J, Yao J, Pan H, Guo R, An Q.
In-Text Gene Mentions

…FGF6 ) andhemochromatosis, and functional validation…

Show Full Abstract

Iron plays a key role in oxygen transport, hematopoiesis, and hypoxia adaptation. This study aimed to explore the dynamic response mechanism of the iron regulatory network and key genes in Duroc piglets. Eighteen weaned piglets were randomly divided into three dietary intervention groups: low iron (0 mg/kg), conventional (100 mg/kg), and high iron (200 mg/kg). Transcriptomics technology was used to screen key liver iron regulatory genes under the influence of different dietary iron concentrations, and the expression of related genes was verified using primary pig liver cells. Fasting serum iron metabolism parameters were detected and iron content in organs was quantified. The results show, enrichment analysis highlighted immune-metabolic signaling, including <i>NF-κB</i>, <i>PI3K-Akt</i>, and <i>TGF-β</i>, and a total of 14 candidate genes (such as <i>FGF21</i>, <i>SAA2/3</i>, <i>FNDC1</i>, <i>ETNPPL</i>, <i>TFR1</i>) were identified. The study observed that these genes showed obvious dosage differentiation and nonlinear patterns. However, findings reflect mRNA-level changes and GO/KEGG over-representation, protein-level validation is planned in follow-up studies. Through the integration of in vitro and in vivo data, this study discovered new liver genes that may be related to pig iron homeostasis function, providing a theoretical basis for analyzing the regulatory mechanism of piglet iron response.

HTT
Also flagged:Agingneurodegenerative disorderbehavioralHDcytosineadenine
Journal Article 2025-10-14 ✓ 2 Snippets Muñoz-Ortega AV, Conde Caballero D, Mariano Juárez L.
In-Text Gene Mentions

…in the huntingtin (HTT) gene [ 1…

…1 of theHTTgene [ 20…

Show Full Abstract

<b>Background/Objectives</b>: Huntington's disease (HD) is an autosomal dominant, neurodegenerative disorder that, because of the availability of presymptomatic genetic testing, places at-risk individuals in an anticipatory situation of great emotional, ethical, and social complexity. This review synthesizes the subjective experiences and coping strategies of individuals aware of their genetic risk before clinical diagnosis, emphasizing the importance of patient and family narratives as critical sources of evidence for enhancing care protocols. <b>Methods</b>: This work is a narrative review supported by a systematic literature search. Of the 75 studies analyzed, 22 met the inclusion criteria-i.e., qualitative research, reviews, and case studies addressing emotional, cognitive, behavioral, and ethical coping mechanisms. The information was structured within a thematic matrix, and inductive coding was applied to identify recurring patterns, unresolved tensions, and gaps in the literature. <b>Results</b>: Presymptomatic genetic diagnosis may trigger processes of anticipatory grief, disrupt individual and familial identity, and lead to constant somatic self-monitoring. Coping strategies vary from proactive approaches-e.g., seeking information and building support networks-to narrative reframing that emphasizes acceptance and the resignification of risk. Analyzing these narratives allowed us to identify silenced ethical dilemmas and family rituals that help alleviate uncertainty-dimensions often overlooked by traditional quantitative methods. Moreover, risk awareness also impacts reproductive and care planning decisions, underscoring the importance of ongoing, context-sensitive support. <b>Conclusions</b>: Coping with genetic risk in Huntington's disease extends beyond the biomedical aspects to encompass relational, ethical, and narrative dimensions. Incorporating narrative-based medicine into genetic and psychosocial counseling is crucial for identifying implicit needs and providing more empathetic, individualized care.

PEBP1
Also flagged:GlioblastomaIDHGBMpeptidecryptidestumor
Journal Article 2025-10-14 ✓ 2 Snippets Muntiu A, Vincenzoni F, Rossetti DV, Castagnola M, Messana I, Iavarone F, Urbani A, La Rocca G, Albanese A, Olivi A, Sabatino G, Desiderio C.
In-Text Gene Mentions

…hanolamine-binding protein 1 (PEBP1).…

…S100A12, H2AC12, andPEBP1proteins.…

Show Full Abstract

This research aimed to analyze the proteomic profile of the low-molecular mass fraction of salivary pools from patients with glioblastoma IDH wild type (GBM) to disclose the small protein and peptide components, including protein fragments, cryptides, and tumor-associated peptides, still lacking specific information in the literature, to the best of our knowledge. This fraction, corresponding to the unretained proteome fraction, was obtained by pretreating the acid-soluble fraction of saliva through Filter-Aided Sample Preparation devices with a filter molecular cutoff of 10 kDa. The fraction was analyzed by LC-MS in its entire form, without trypsin pre-digestion, following a top-down approach. Data from the analysis of pre- and post-operative salivary pools from patients with newly diagnosed and recurrent GBM were compared and discussed with data obtained in our previous study on the complementary salivary proteome fraction > 10 kDa analyzed by a bottom-up approach and data from the literature. The results highlighted a panel of GBM-associated peptide fragments from different protein precursors, namely, ANXA1, CFL1, GLUL, PFN1, H2AC12, ACTB, and HBB, which are suggested for further exploration as potential diagnostic and prognostic biomarkers and clinical applications. These findings, although providing only preliminary results on a small scale, offer new insights into the molecular characteristics of GBM tumor and lay the groundwork for further investigations on a large scale using saliva liquid biopsy for biomarker discovery and validation. The aim is to advance precision medicine and improve clinical outcomes in GBM, one of the most aggressive brain tumors with a poor prognosis, for which early diagnosis and monitoring of treatment response remain significant challenges.

BTN3A3
Also flagged:antibodieszooanthroponosisanthropozoonosisantibodyHA1influenza
Journal Article 2025-10-14 ✓ 4 Snippets Hennig C, Graaf-Rau A, Schmies K, Elling R, Henneke P, Dürrwald R, Beilage EG, Schwemmle M, Beer M, Harder T.
In-Text Gene Mentions

…with Mx andBTN3A3factors were identified…

…reveal MxA andBTN3A3escape mutations…

…MxA andBTN3A3were reported to…

…and one forBTN3A3-escape.…

Show Full Abstract

Influenza A viruses (IAV) circulate in both humans and pigs, with bidirectional transmission potentially driving viral evolution. Despite frequent contact and genetic compatibility, observed cross-species transmission remains rare, suggesting the presence of unexplored or little-known barriers. The study investigated transmission dynamics and mechanisms restricting IAV spread at the human-swine interface in Germany. We analyzed 3070 porcine and 333 human nasal swabs from 135 swine farms via RT-qPCR and full-genome sequencing. Concurrently, we conducted serological surveys: 1) Children's sera (urban, no pig contact) for antibodies against circulating swine IAV, and 2) Swine sera for antibodies against human-adapted IAV. Molecular surveillance identified only one zooanthroponosis event and sporadic anthropozoonosis (primarily in children) despite swine IAV strains carrying zoonotic-propensity genetic markers (MxA resistance). Serologically, urban children without pig exposure exhibited marked neutralizing activity against swine IAV, whereas swine sera contained neutralizing antibodies against human IAV strains. Pre-existing cross-reactive immunity-evidenced by unexpected antibody prevalence in both species-creates a more complex interspecies barrier than genetic factors alone. This serological "shield" may critically limit IAV transmission between humans and pigs, reshaping our understanding of zoonotic risk.

POU3F2
Also flagged:SchizophreniaZNF536retinoic acidtranscriptional repressorCas9zinc finger
Journal Article 2025-10-14 ✓ 1 Snippet Kurishev AO, Abashkin DA, Karpov DS, Marilovtseva EV, Chaika YA, Semina EV, Golimbet VE.
In-Text Gene Mentions

…EGR1, FOXP1, KLF6,POU3F2, SATB2, and TCF4,…

Show Full Abstract

ZNF536, a brain-specific transcriptional repressor, has recently emerged as a candidate risk gene for schizophrenia (SZ), yet its functional role in human neurodevelopment remains poorly understood. We used CRISPR/Cas9 genome editing to generate a dual-allelic ZNF536 knockout model in SH-SY5Y cells, combining a 103 kb deletion encompassing SZ-associated intronic regions with a disruption of zinc finger domains in exon 2. We performed transcriptome profiling of mutant cells undergoing all-trans retinoic acid (ATRA)-induced differentiation and analyzed neurite outgrowth phenotypes. Knockout cells exhibited impaired activation of retinoic acid receptor (RAR) target genes, reduced neurite outgrowth, and failure of neuronal maturation. Gene set enrichment analysis uncovered dysregulation of E2F4-mediated cell cycle pathways. The targeted intronic deletion altered the expression of multiple SZ-associated genes, supporting the functional importance of cis-regulatory elements within ZNF536. These findings identify ZNF536 as a critical regulator of RA-responsive gene networks and neuronal differentiation, modulating neurogenic commitment through coordinated control of transcriptional repression and cell proliferation, and offer new mechanistic insights into its contribution to schizophrenia pathogenesis.

HFE
Also flagged:canceracrylic acidiron oxidehydroxyethyl starchsucroseHER2
Journal Article 2025-10-14 ✓ 1 Snippet Korangath P, Yang CT, Healy S, Grüttner C, Gabrielson K, Ivkov R.
In-Text Gene Mentions

…absorption in secondaryhemochromatosisare managed through…

Show Full Abstract

<h4>Introduction</h4>Iron oxide nanoparticle formulations are widely used in clinical applications and have recently been explored for hyperthermia therapy, cancer imaging and treatment. Here, we report the effects of intravenously injected pegylated or poly acrylic acid decorated iron oxide nanoparticles coated with hydroxyethyl starch (HES) on host immune system and organs. These particles were compared with sucrose coated iron oxide nanoparticle (Venofer<sup>®</sup>) and the coating compound HES-both FDA approved agents-alongside non-iron oxide polystyrene nanoparticles coated with HES (micromer<sup>®</sup>).<h4>Methods</h4>Toxicity analysis was performed in healthy female normal FVB/NJ mice 60 days after nanoparticle injection, with complete blood analysis conducted at multiple time-points. In a separate cohort, nanoparticle biodistribution 24 h post-intravenous injection was evaluated using a HER2 overexpressing breast cancer mouse model.<h4>Results</h4>Toxicity analysis revealed no adverse effects on liver or kidneys with any of the tested formulations after 60 days. Immune cell perturbations were observed at early time points following iron oxide nanoparticle injection but normalized by the study endpoint. Biodistribution analysis demonstrated that the nanoparticle coating dictated their accumulation across various organs, with significant tumor accumulation observed for pegylated iron oxide nanoparticles and Venofer<sup>®</sup>.<h4>Conclusion</h4>Iron oxide nanoparticle formulations exert a transient effect on the host immune system and some exhibit tumor accumulation, suggesting their potential for further development in cancer imaging and treatment.

Also flagged:spironolactonepotassiumnatriuretic peptidedeathcardiac arrestCardiomyopathy
Journal Article 2025-10-14 No Snippets Nguyen DV, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>In recent heart failure (HF) trials, the win ratio statistical approach, developed to address the limitations of conventional methods, has been increasingly applied to better capture clinical benefits. The TOPCAT study was a randomised controlled trial designed to evaluate the efficacy of spironolactone in patients with HF and a left ventricular ejection fraction (LVEF) ≥45%. This study evaluated the cardiovascular benefits of spironolactone according to their clinical importance using the win ratio method.<h4>Methods</h4>A post hoc analysis was conducted using data from the TOPCAT Americas cohort. The primary outcome was a hierarchical composite comprising the time to cardiovascular death, time to first aborted cardiac arrest, time to first hospitalisation for HF, time to first hospitalisation for arrhythmia and change in the Kansas City Cardiomyopathy Questionnaire Overall summary score at 36 months. Outcomes were analysed using the win ratio statistical model.<h4>Results</h4>In all, 1,767 patients were included; 886 were assigned to receive spironolactone and 881 to receive placebo. Hierarchical analysis of the primary composite outcome revealed a significant higher probability of win (28.3%) compared to loss (23.1%) in the spironolactone group, yielding a win ratio of 1.22 (95% CI [1.05-1.42]; p=0.008) and a net clinical benefit (win difference) of 5.2% (95% CI [1.36-9.04]). Detailed assessment of the win differences revealed a concordant positive benefit (win difference >0) across all components of the outcome hierarchy. Subgroup analyses indicated no significant effect of age (<75 years versus ≥75 years), sex (male versus female) or LVEF (<50% versus ≥50%) on the efficacy of spironolactone (p for interaction>0.05).<h4>Conclusion</h4>This post hoc analysis, using a novel statistical approach, demonstrates the consistent benefits of spironolactone across adverse cardiovascular events, patient symptoms, functional status and quality of life in individuals with HF and mildly reduced or preserved LVEF.

Also flagged:mineralocorticoid receptorsmineralocorticoid receptorMRsteroidsthreonineleucine
Journal Article 2025-10-14 No Snippets Toso A, Boulahtouf A, Grimaldi M, Sansaloni A, Katsu Y, Baker ME, Escande A, Garoche C, Aït-Aïssa S, Balaguer P.
Show Full Abstract

The action of environmental chemicals (ECs) on the mineralocorticoid receptor (MR) has been suggested to impair physiological processes regulated by this nuclear receptor. However, it remains understudied both as a target of ECs and with respect to potential species-specific differences. In this regard, we have developed reporter cell lines to identify the response to different steroids, ECs, and urban wastewater (WW) sample extracts of human MR (hMR) and zebrafish MR (zfMR). Most of the steroids had a higher efficacy on zfMR than hMR, while the ECs were antagonists to both hMR and zfMR, with a lower potency on the latter. Interestingly, WW sample extracts revealed the presence of MR activity with a greater activity on zfMR compared to hMR, suggesting the presence of steroids in WW. These screening tools have proven to be powerful tools for characterizing the interaction of chemicals with MRs and revealing their presence in environmental samples.

Also flagged:pancreatic cancerpancreatic adenocarcinomasystemic lupus erythematosuscell cycleCD8gemcitabine
Journal Article 2025-10-14 No Snippets Xu S, Deng C, Man Z, Yang S, Xu M.
Show Full Abstract

This study aimed to identify novel prognostic biomarkers and therapeutic strategies by focusing on drug resistance-related phenotypes. We integrated multi-omics data from various databases encompassing sequencing, clinical information, resistance-related gene sets, and genomic alteration data. ssGSEA was employed to calculate resistance scores for individual samples, which were subsequently applied in survival analysis. Furthermore, we utilized machine learning algorithms to develop a robust prognostic model validated across multiple independent datasets. Our findings revealed 12 genes consistently linked to pancreatic adenocarcinoma (PAAD) prognosis in diverse datasets. Pathway enrichment analysis indicated that the high-risk group was enriched in pathways associated with systemic lupus erythematosus and the cell cycle, whereas the low-risk group showed significant enrichment in neuroactive ligand-receptor interaction pathways. Additionally, immune cell infiltration analysis exhibited substantial differences between risk groups, with the high-risk cohort presenting lower levels of activated CD8+ T cells but higher levels of regulatory T cells. The random survival forest model demonstrated superior predictive performance, achieving a concordance index of 0.634 and time-dependent receiver operating characteristic area under the curve values of 0.973, 0.978, and 0.996 at 1, 2, and 3 years, respectively. In conclusion, this study identifies 12 critical drug resistance genes in PAAD and highlights the associated immune differences in patient risk, paving the way for targeted immunotherapy research to improve therapeutic strategies against this formidable disease.

bioRxiv 2025-10-14 Preprint (No Snippets API) Naydenova K, Mund T, Yip MCJ, Harper CM, Leigh KE, Hankinson J, Boyle KB, Heatley A, Otten EG, Lulla V, Modis Y, Randow F.
Show Full Abstract

ZNFX1 is an SF1-family RNA helicase essential for innate immunity. Patients with ZNFX1 mutations experience recurrent infections, yet the underlying mechanism remains unclear. We determined cryo-EM structures of ZNFX1 in apo and RNA-bound forms, revealing auto-inhibition of the helicase through a regulatory insertion occluding the RNA-binding groove. ZNFX1 also functions as a bi-catalytic E3 ubiquitin ligase, containing an RZ-finger homologous to RNF213 and a previously unidentified Miz-like domain that catalyze ubiquitylation independently or cooperatively, with activity enhanced by ubiquitin chains. Patient mutations demonstrate that the helicase, E3 ligase, and rigid zinc-finger stalk connecting them are required for function. ZNFX1 can assemble into structured, pleiomorphic polymers via multivalent protein-protein interactions, revealing a mechanism that may facilitate RNA sequestration in stress granules and antiviral activity. These findings establish ZNFX1 as a multifunctional enzyme in innate immunity that couples RNA sensing to ubiquitin signaling and assembles into higher-order structures for signal amplification.

Also flagged:HDneurofilament lightT-tauCortisolautosomal dominant neurodegenerative diseasebehavioral
Journal Article 2025-10-13 No Snippets Paulsen JS, Bovin NA, Clemsen JD, Weiss A, Key AM, Janz ML, Pinto A, Burks DK, Zetterberg H, Shannon KM.
Show Full Abstract

Primary therapeutic objectives for Huntington's disease (HD) necessitate continued therapy for a long period before clinical motor diagnosis and its concurrent functional incapacities. Therefore, the need is paramount for alternative biomarkers that are not only highly sensitive but also clearly reflect the disease progression. Current trials increasingly rely upon biological definitions of disease to initiate intervention before significant decline. The primary biological measure of early-stage HD is volumetric evidence of structural decline on magnetic resonance imaging. This comprehensive review of biofluid markers is a systematic review documenting 804 records identified in a literature search. Updating a previous comprehensive review from 2018, we summarize effect sizes and conduct meta-analyses for 55 studies with reproducible findings. Evidence for neurofilament light (NfL) is sufficient to meet evidentiary guidelines as a prognostic biomarker in preHD (ie, before clinical motor diagnosis). Significant meta-analyses are found for 24-hydroxycholesterol (24-OHC), 27-hydroxycholesterol (27-OHC), NfL, and T-tau (total tau) in early-stage HD and for cortisol, high-density lipoprotein (HDL), mutant huntingtin (mHTT), and HTT in mid-stage HD after clinical motor diagnosis. Despite over 800 published studies of biomarkers in HD and over 200 reviews of those efforts, the current state of the literature is limited by inconsistent reporting of necessary detail in existing reports. This is compounded by an inability to effectively compare outcomes and by continued publication when rigor is compromised, revealing a significant knowledge gap for HD clinical trial methodology improvements. Findings support validation for eight biofluid markers in HD: one in preHD, four in early-stage HD, and four in mid-stage HD after clinical motor diagnosis. © 2025 The Author(s). Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

OLFM4
Also flagged:bladder cancerGSTM1cancerNTN1ITPR3CLU
Journal Article 2025-10-13 ✓ 5 Snippets Chen Y, Yu Q, Jiang X, Li L, Kang L.
In-Text Gene Mentions

…study also identifiedOLFM4, NTN1 ,…

…CTSK , andOLFM4were upregulated in…

…for five genes:OLFM4, NTN1 ,…

…including GSTM1 ,OLFM4, NTN1 ,…

…Genes such asOLFM4and NTN1 are…

Show Full Abstract

<h4>Background</h4>Bladder cancer, a highly aggressive malignancy, necessitates effective therapeutic strategies due to the significant correlation between muscle invasion and prognosis. Despite advancements in immunotherapy, the mechanisms through which immune-related genes influence bladder cancer remain unclear.<h4>Methods</h4>We conducted a comprehensive causal analysis of immune-related genes using GWAS data from the UK Biobank and FinnGen, and immune gene information from InnateDB. Mendelian Randomization (MR) analysis, supported by sensitivity, colocalization, and reverse causality analyses, was performed using eQTLGen Consortium and proteomics GWAS data. We analyzed protein-protein interaction networks with GeneMANIA and validated findings using mRNA expression and clinical survival data from the TCGA database.<h4>Results</h4>The expression of the GSTM1 gene demonstrated an inverse correlation with cancer risk, suggesting a protective role in disease progression. Our study also identified OLFM4, NTN1, ITPR3, CLU, and CARD11 as genes significantly associated with immune cell composition and bladder cancer survival. Additionally, we uncovered protein interaction networks and key pathways involving these immune-related genes, providing new insights into bladder cancer intervention and treatment.<h4>Conclusion</h4>This study elucidates the immune-related pathways influencing bladder cancer, highlighting GSTM1 and other key immune-related genes as potential biomarkers. These discoveries pave the way for innovative therapeutic approaches, advancing personalized medicine strategies in bladder cancer treatment.

NEGR1
Also flagged:ObesityChildhood obesityPolygenic obesitytype 2 diabetes mellitushypertensionnoncommunicable diseases
Journal Article 2025-10-13 ✓ 2 Snippets León-Reyes G, Alavez FJL, Tejero ME.
In-Text Gene Mentions

…BDNF , andNEGR1.…

…growth regulator‐1 (NEGR1), expressed only…

Show Full Abstract

Childhood obesity is a multifactorial public health problem worldwide. Genetic variation influences the predisposition to develop obesity at early stages of life. Childhood obesity may be classified as syndromic, monogenic, or polygenic depending on the genetic component. Polygenic obesity is the most frequent, having an important interaction with environmental factors. A scoping review was conducted to identify existing literature on the association between common genetic variation and obesity-related traits in children and adolescents. We retrieved 180 studies that were classified as genome-wide studies, meta-analyses targeting selected variants, and original studies with a targeted genotype approach. Most genome-wide meta-analyses have been conducted in Caucasian populations and have collectively identified over 100 variants in approximately 40 genes associated with obesity-related traits. The identified genes are related to appetite regulation and energy expenditure, although in some cases, their function remains to be elucidated. Studies analyzing targeted variants have replicated some findings across populations. Some genotypes have shown varying associations, probably due to differences in study design, populations, and sample size. The effects of genetic variation on common childhood obesity require further study in diverse populations. In addition, the functional effects and clinical significance of these variants require further research.

OLFM4
Also flagged:ALKBH8gene expressiontranslationaltranslation elongationcolorectal cancerAlkB homolog 8
Journal Article 2025-10-13 ✓ 2 Snippets Qian Y, Wu C, Wei S, Yan S, Peng J, Yu L, Gao Y, Hou J, Yu W, Chen Z, Zhang J, Gao X.
In-Text Gene Mentions

…ion, 16646-1-AP, Proteintech),Olfm4(1/200 dilution, 39141,…

…β-catenin , andOlfm4in Alkbh8 cKO…

Show Full Abstract

Reprogramming gene expression at the translational level drives intestinal tumorigenesis. Codon decoding during translation elongation relies on tRNA modifications, while their pathological relevance in colorectal cancer remains to be elucidated. Here, we show that AlkB homolog 8 (ALKBH8), a uridine 34 (U34) tRNA methyltransferase, is a direct target of Wnt/β-catenin and is upregulated in colorectal cancer. Genetic ablation of ALKBH8 inhibits the development of intestinal tumors in Apc<sup>min/+</sup>, azoxymethane/dextran sulfate sodium (AOM/DSS), and xenograft models. Loss of ALKBH8 induces ribosome pausing at adenine-ending codons, impairing the translation elongation of mRNAs enriched with these codons. Specifically, ALKBH8 regulates the translation of KRAS proto-oncogene in a codon-dependent manner. Rescue experiments demonstrate that the methyltransferase activity of ALKBH8 is required for its translation-promoting function. Together, our findings reveal ALKBH8-dependent mRNA translation as a critical mediator of intestinal tumorigenesis, underscoring its potential as a promising target for colorectal cancer therapy.

Also flagged:Phycocyaninneural stem cell differentiationironchitosanhydroxyapatiteiron oxide
Journal Article 2025-10-13 No Snippets Maskanati M, Ahmadi M, Sabet Sarvestani F, Morowvat MH.
Show Full Abstract

Incorporating magnetic materials into scaffolds has garnered significant interest due to its potential to enhance neuroregeneration. This study explored the development of novel chitosan scaffolds (CS) with phycocyanin and FeHA, containing iron and phycocyanin, into hydroxyapatite (HA) using a freeze-drying process. The synthesized powders were comprehensively characterized using scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), and X-ray diffraction (XRD) to elucidate their morphology and composition. Notably, the findings confirmed the successful incorporation of iron into the HA framework. The XRD pattern showed no secondary iron oxide phase, confirming successful iron incorporation into the HA lattice. The magnetic evaluation revealed that the powders exhibited saturation magnetization (Ms) and coercivity of approximately 0.25 emu/g and ~ 50 Oe, respectively. Furthermore, the results of the MTT assay demonstrated the superior performance of this newly developed composite scaffold, observing cells with neuron-like morphologies (spindle shape with cytoplasmic extensions) on the scaffold, which hints at neuroinductive effects suggesting its cytocompatibility and neuroregenerative potential which makes it a promising candidate for neural tissue engineering applications.

Also flagged:F-box proteinscancertumorUbiquitinationtranslationalubiquitin
Journal Article 2025-10-13 No Snippets Cheng J, Liu O, Bin X, Tang Z.
Show Full Abstract

F-box proteins have been well-established as important regulators of cancer development after decades of exploration. As the understanding of cancer biology continues to deepen, novel biological characteristics of cancer cells have been incorporated, and the perspective has expanded from cancer cells themselves to a more complex tumor microenvironment (TME). In this context, F-box proteins form an extensive and multi-layered regulatory network to fine-tune diverse biological events, not only within cancer cells, but also in the TME. Therefore, in this review, we summarize the functional and mechanistic paradigms of F-box proteins in both cancer cells and the TME, and underscore their adaptability and wide coverage on the basis of a sophisticated regulatory hierarchy, presenting the clinical prospects of F-box proteins as potential targets for cancer therapy.

Clinical cancer epigenetics.

PCDH17
Also flagged:methylationpsychiatric disordersMHC-complexC-reactive proteinDeathferroptosis
Journal Article 2025-10-13 ✓ 3 Snippets Unknown Authors
In-Text Gene Mentions

…with POU4F2 andPCDH17biomarkers improved diagnostic…

…as POU4F2 andPCDH17can enhance diagnostic…

…biomarker combination ofPCDH17and POU4F2 detects…

Show Full Abstract

No abstract available.

Also flagged:colorectal cancercancertumorcancersmetastatic lesionspan-cytokeratin
Journal Article 2025-10-13 No Snippets Liu Y, Zhang Y, Zhang R, Zhang C, Liu X.
Show Full Abstract

Colorectal cancer is a heterogeneous and molecularly complex cancer that often leads to poor prognosis. The standard treatment includes surgical resection and adjuvant therapies such as chemotherapy, radiotherapy, targeted therapy, and immunotherapy. However, owing to the individual heterogeneity of patients, the effectiveness of these treatments is difficult to achieve consistently and efficiently. Patient-derived organoids (PDOs), by mimicking key genes, physical, and mechanical cues from the tumor microenvironment, simulates tumor heterogeneity, tissue structure, and molecular characteristics, as well as the cellular interactions within the tumor microenvironment. Additionally, it provides a more physiological and relevant environment for anticancer drug screening and predicting patient responses to personalized approaches, bridging the gap between simplified 2D models and animal models. Here, we review the roles of PDOs in customizing CRC treatment, discussing its roles in predicting drug sensitivity, drug screening, studying drug resistance mechanisms, simulating cell-to-cell interactions, and exploring immunotherapy targets to develop personalized therapies.

Also flagged:genetic diseaseadenosine deaminasenervous system disordersAlzheimer'sParkinson'simmune diseases
Journal Article 2025-10-13 No Snippets Li JM, Huang J, Liao Y, Hu T, Wang CL, Zhang WZ, Huang CW.
Show Full Abstract

Gene editing and RNA editing technologies are advancing modern medicine by enabling precise manipulation of genetic information at the DNA and RNA levels, respectively. The third-generation gene editing tools, particularly Clustered regularly interspaced shortpalindromic repeats (CRISPR)/CRISPR-associated (Cas) system, have transformed genetic disease treatment with high efficiency, precision, and cost effectiveness, while RNA editing, via adenosine deaminase acting on RNA (ADAR) enzymes and CRISPR-Cas13, offers reversible regulation to avoid genomic integration risks. Despite advancements, challenges persist in delivery efficiency, tissue specificity, and long-term safety, limiting their clinical translation. This review systematically discusses the molecular mechanisms and technological evolution of these tools, focusing on their promising applications in treating nervous system disorders (e.g., Alzheimer's, Parkinson's), immune diseases (e.g., severe combined immunodeficiency, lupus), and cancers. It compares their technical attributes, analyzes ethical and regulatory issues, and highlights synergies between the two technologies. By bridging basic research and clinical translation, this review provides critical insights for advancing precision medicine, reshaping disease diagnosis, prevention, and treatment paradigms.

Also flagged:cuproptosisGastric cancerdeathcancerpathogenesistumor
Journal Article 2025-10-13 No Snippets Lu L, Yang W, Gu Y, Jin L, Liang Z.
Show Full Abstract

Gastric cancer has emerged as a major global public health threat due to its high incidence and mortality rates. Despite advances in diagnostic and therapeutic approaches, treatment outcomes remain unsatisfactory with frequent disease recurrence and poor prognosis. This underscores the urgent need to develop novel therapeutic strategies against gastric cancer. Cuproptosis, a novel form of cellular death, has garnered increasing attention from researchers regarding its relationship with the onset and progression of gastric cancer. This article aims to explore the molecular mechanisms of cuproptosis, its functions in gastric cancer, and its potential therapeutic applications. We analyze the driving factors and defense mechanisms of cuproptosis, as well as how it influences the growth, metastasis, and drug resistance of gastric cancer cells. Furthermore, we discuss the interplay between cuproptosis and the gastric cancer microenvironment, and consider the possibilities of this mechanism in future clinical treatments.

DNAH10
Also flagged:Alpha-lipoic acidAlpha lipoic acidhematoxylinestrogenprogesteroneovulation
Journal Article 2025-10-13 ✓ 1 Snippet Yin S, Li F, Pan Z, Bao H, Liu X.
In-Text Gene Mentions

…Additionally, KIF22 andDNAH10expression levels were…

Show Full Abstract

<h4>Introduction</h4>Vitrification may induce oxidative damage, mitigating cryodamage is crucial for preserving follicular development and ovarian function. Alpha lipoic acid (α-ALA) is an antioxidant which exerts its antioxidant activity directly or indirectly.<h4>Methods</h4>In this study, we established a α-ALA concentration gradients (0, 100, and 150 μM) in the vitrification solution, assessed follicular abnormalities through hematoxylin and eosin (HE), analyzed cell apoptosis via TUNEL staining analysis, immunohistochemistry (IHC) and Masson staining, explored differential genes by transcriptome sequencing.<h4>Results</h4>Our findings revealed that α-ALA alleviated oxidative stress damage and decreased follicular abnormalities induced by vitrification, enhanced antioxidant capacity and delayed the onset of fibrosis during in vitro culture. Moreover, our analysis revealed the effects of α-ALA on vitrification at the transcriptomic level.<h4>Discussion</h4>In this study, we focused on the anti-apoptotic effects of α-ALA in cat ovarian cortex vitrification, and concluded that α-ALA effectively mitigates vitrification correlated ovarian functional impairment.

Also flagged:Coppercuproptosisdeathautophagypyroptosisferroptosis
Journal Article 2025-10-13 No Snippets Tao F, Lin M, Meng X, Huang L, Zhuo B, Jiang S, Deng S, Meng Z, Shi J.
Show Full Abstract

Copper (Cu) is a vital trace element required for sustaining life and is involved in numerous critical metabolic processes within the body. Cuproptosis, a newly recognized type of Cu-dependent cell death, is mechanistically distinct from apoptosis, autophagy, pyroptosis, and ferroptosis. It is characterized by abnormal Cu accumulation and aberrant interactions with key enzymes of the tricarboxylic acid (TCA) cycle, which lead to protein aggregation, loss of iron-sulfur cluster proteins, and proteotoxic stress, ultimately leading to cell death. Recent studies have revealed that Cu dyshomeostasis and cuproptosis are intricately linked to the pathological progression of several neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), Wilson's disease (WD), and Menkes disease (MD). In this review, we systematically elucidate the systemic Cu metabolism, the molecular mechanisms of cuproptosis, and its intricate interplay with different neurodegenerative disorders. We also examined the relationship between cuproptosis and other types of cell death. Finally, we discuss therapeutic strategies targeting cuproptosis and Cu dyshomeostasis to combat neurodegenerative diseases and propose potential directions for future research.

Also flagged:LipaseSynthesisFatty Acid AmidesLipidFatty acid ethanolamidesenergy homeostasis
Journal Article 2025-10-13 No Snippets Bigliardi M, Donzella S, Dăescu DI, Pellis A, Tamborini L, Pinto A, Contente ML.
Show Full Abstract

Fatty acid ethanolamides (FAEAs) are bioactive lipids involved in inflammation, pain modulation, and energy homeostasis, gaining interest in the pharmaceutical, nutraceutical, and cosmetic sectors. Here, we present an intensified biocatalytic strategy for the synthesis of a mixture of FAEAspalmitoylethanolamide (PEA), oleoylethanolamide (OLA), stearoylethanolamide (SEA), and linoleoylethanolamide (LEA)starting from microbial lipids extracted from<i>Cutaneotrichosporon oleaginosus</i>, cultivated on whey permeate, a major dairy byproduct, supplemented with waste cooking oil. The two-step enzymatic cascadetransesterification of triacylglycerols into ethyl esters followed by aminolysis with ethanolaminewas catalyzed by Novozym 435 (immobilized <i>Candida antarctica</i> lipase B) in green solvents. Whereas ethanol has been used for the first step, eucalyptol proved particularly effective in aminolysis reaction with >99% conversion and complete selectivity. Process intensification <i>via</i> a SpinChem rotating bed reactor led to a 5-fold reduction in reaction time (48 to 10 h), a 5- to 7-times increase in space-time yield and quantitative yields for both steps. Biocatalyst reusability and process reproducibility was preserved. This integrated platform exemplifies a circular bioeconomy approach by valorizing agri-industrial residues into high-value compounds through clean and scalable technologies. The resulting FAEAs hold potential for synergistic therapeutic applications, while supporting cost-effective and sustainable manufacturing across diverse industries.

DCC
Also flagged:deathserotonindopaminegamma-aminobutyric acidneurotrophic factorsbrain-derived neurotrophic factor
Journal Article 2025-10-13 ✓ 1 Snippet Lopez-Martinez KM, Cortez-Sanchez JL, Perez Sánchez G, Chin Chan JM, Bautista-Rodriguez E.
In-Text Gene Mentions

…and netrin-1 receptors (DCC) signaling, respectively, sup…

Show Full Abstract

Suicide represents a priority clinical challenge because of the lack of specific biological and molecular biomarkers. The development of such markers would, together with clinical findings, allow for a concrete diagnosis. MicroRNAs (miRNAs), because of their stability in biological fluids and their role in gene regulation, emerge as useful candidates to complement traditional clinical evaluation. This narrative review synthesizes evidence on the role of miRNAs as biomarkers in suicide and suicidal behavior, based on reports in brain tissue and fluids such as peripheral blood, integrating data on miRNA regulation and their associated molecular pathways. Several miRNAs, including miR-124, miR-18a, miR-132, miR-185, miR-218, and miR-19a-3p, are consistently dysregulated across multiple studies. These findings suggest that miRNA measurement could complement clinical scales and provide an objective biological marker for suicide risk. Their integration into diagnostic protocols could improve risk stratification and open the door to personalized prevention strategies; however, it is essential to validate miRNA panels in multicenter clinical studies before routine implementation.

HTT
Also flagged:autosomal dominant neurodegenerative disorderHDcytosineadenineguanineneurodegenerative disorder
Journal Article 2025-10-13 ✓ 1 Snippet Ochoa-Morales A, Beutelspacher-Fernandez K, Jara-Prado A, Yescas-Gómez P, Guerrero-Camacho JL, Pérez-Pacheco NJ, Dávila-Ortiz de Montellano D, Ramírez-García MÁ.
In-Text Gene Mentions

…repeats in theHTTgene.…

Show Full Abstract

Background Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder. It typically presents between the ages of 30 and 40 years. However, a small proportion of cases begin after the age of 60 years, which is referred to as late-onset Huntington's disease (LoHD). This study aimed to describe the main characteristics of LoHD patients identified at Mexico's leading neurological center. Methodology A retrospective, cross-sectional study was conducted by reviewing records from 1994 to mid-2024. The data collected included the patients' age, age at onset, diagnostic delay time, family history, molecular outcomes, clinical manifestations at onset, and total motor scores on the Unified Huntington's Disease Rating Scale-Total Motor Score (UHDRS-TMS). Results From 1994 to mid-2024, the National Institute of Neurology and Neurosurgery Manuel Velasco Suárez reported 1,476 individuals with confirmed HD. Of those, 104 (7%) had LoHD, and 56.7% were female. The mean age of onset was 65.1 years. The mean age at molecular confirmation was 71.01 years. The mean diagnostic delay was 6.2 years. The origin of transmission was unknown in 41.3% of cases. Molecular testing revealed an average of 41.4 cytosine-adenine-guanine (CAG) repeats in the expanded allele. Motor symptoms were present at the beginning of the disease in 89% of cases. UHDRS-TMS showed a median score of 29. Conclusions LoHD is a rare form of HD with variable manifestations. A common finding in LoHD is the high proportion of patients with no family history of the disease. The lengths of the CAG expanded alleles are typically between 40 and 41 repeats. However, these lengths have also been observed in typical HD presentations. This suggests that further research is needed to identify possible modifiers and understand the pathways that delay disease onset.

CCPG1
Also flagged:mitochondrialextracellulartranscriptionalphosphorylationtranscription factorvascular endothelial growth factor A
Journal Article 2025-10-12 ✓ 1 Snippet Ahn C, Zhang T, Rode T, Yang G, Chugh OK, Ellis S, Ghayur S, Mehta S, Salzman R, Jiang H, Parker SCJ, Burant CF, Horowitz JF.
In-Text Gene Mentions

…ME3, ANXA7, ATL3,CCPG1, DDR2, EPDR1, GNS,…

Show Full Abstract

The primary aim of this study was to compare the acute effects of three exercise intensities on abdominal subcutaneous adipose tissue (aSAT) transcriptome in regular exercisers. A total of 45 adults who exercise regularly were assigned to perform a single session of either low-intensity continuous (LOW; 60 min at 30% VO<sub>2</sub>max; n = 15), moderate-intensity continuous (MOD; 45 min at 65% VO<sub>2</sub>max; n = 15) or high-intensity interval exercise (HIGH; 10 × 1 min at 90% VO<sub>2</sub>max interspersed with 1 min active recovery; n = 15). aSAT biopsy samples were collected before and 1.5 h after the exercise session for bulk RNA sequencing and targeted protein immunoassays. HIGH upregulated genes were involved in angiogenesis, protein secretion and insulin signalling pathways, whereas MOD and LOW upregulated genes regulated extracellular matrix (ECM) remodelling, ribosome biogenesis and oxidative phosphorylation pathways. Exercise-induced changes in aSAT clock genes, ERK protein phosphorylation and circulating cytokines were similar after all three exercise treatments. Network analysis identified exercise-responsive gene clusters linked to cardiometabolic health traits. Cell-type analysis highlighted a heterogeneous response of aSAT cell types to exercise, with distinct patterns observed across exercise intensities. Collectively, our data characterize early responses in aSAT after a single session of exercise. Because adaptations to exercise training stem from an accrual of responses after each session of exercise, these early responses to exercise are likely important contributors to the long-term structural and functional changes that occur in adipose tissue in response to exercise training. KEY POINTS: Chronic adaptations in adipose tissue from regular exercise support cardiometabolic health, but the acute molecular triggers of these adaptations remain unclear. We show that acute exercise alters gene expression, along with ERK phosphorylation in adipose tissue of regular exercisers. Exercise intensity shapes the transcriptomic response: high-intensity exercise induces inflammatory, cytokine and genes, whereas lower intensities upregulate genes involved in protein translation and oxidative phosphorylation. Network and cell-type analyses highlight intensity-specific adipose responses, revealing gene modules linked to health traits and differential engagement of adipocyte subpopulations.

Also flagged:STINGinnate immunitycancersenescenceautophagydeath
Journal Article 2025-10-12 No Snippets Yan Y, Tan X, Song B, Yi M, Chu Q, Wu K.
Show Full Abstract

Since its discovery, the cyclic GMP-AMP synthase (cGAS)-stimulator of the interferon gene (STING) signaling pathway has been considered a pivotal component of innate immunity and a promising target for cancer immunotherapy. Beyond its canonical role in pathogen defense, accumulating evidence has demonstrated that the cGAS-STING pathway critically regulates diverse cellular processes, including cellular senescence, autophagy, cell death, and tumor immunosurveillance; therefore, dysregulation of this pathway correlates with the pathogenesis and progression of various human diseases, ranging from autoimmune and inflammatory disorders to cancer. Herein, we reviewed the regulatory mechanisms and cellular functions of the cGAS-STING pathway, highlighting its essential role in maintaining immune homeostasis. We systematically discussed the dual roles of the cGAS-STING pathway in cancer immunity, in which it triggers both antitumor and immunosuppressive effects. Finally, we summarized the recent advances and challenges in therapeutic strategies targeting the cGAS-STING pathway and discussed the next generation of therapies, including nanomaterials, antibody-drug conjugates, engineered bacteria, alternative strategies, optogenetic approaches, and combination strategies. We hope that our efforts will advance the understanding of the fundamental principles of innate immune recognition and response, and provide novel directions for improving the clinical outcomes of cGAS-STING-targeted therapies.

Also flagged:organizationMyogenesisextracellularPenicillinStreptomycinGlucose
Journal Article 2025-10-12 No Snippets Demri N, Morizur L, Dumas S, Gropplero G, Martinat C, Descroix S, Wilhelm C.
Show Full Abstract

Engineering tissues with precise, long-lasting shapes and the capability for mechanical stimulation remains challenging. This study addresses this challenge by developing a next-generation magnetic bioprinting approach to create anisotropic, shape-controlled, scaffold-free, and stretchable skeletal muscle constructs. Murine skeletal muscle cells and human induced pluripotent stem cell-derived skeletal muscle cells, labeled with iron oxide nanoparticles, are magnetically bioprinted into wrench-shaped tissues. Their magnetic properties allow these tissues to be clipped onto magnetic needles, preserving their shape over two weeks of culture while promoting anisotropic differentiation and myoblast fusion. Additionally, the magnetic tissues can be stretched by up to 100%, enhancing their anisotropy and improving muscle maturation. This magnetic toolbox demonstrates significant advancements in muscle tissue engineering, as evidenced by enhanced indicators of myoblast differentiation, including cell fusion, increased myogenic maturation, and contractility. These findings highlight the potential of magnetic-based techniques for developing advanced muscle-on-chip systems and other complex tissue constructs.

Also flagged:asthmapathogenesissynthesisBronchial asthmaglucocorticoidsleukotriene
Journal Article 2025-10-12 No Snippets Li K, Xie H, Shen D, Li L, Chen H.
Show Full Abstract

<h4>Background</h4>Bronchial asthma is a complex, highly heterogeneous disease involving multiple pathological mechanisms and inflammatory pathways. Traditional pharmacotherapies, including glucocorticoids, leukotriene modifiers, β<sub>2</sub>-adrenergic agonists, and muscarinic antagonists, and new targeted biologics can alleviate symptoms and prevent acute exacerbations; however, achieving clinical remission or a cure remains a major challenge.<h4>Aim of review</h4>To systematically outline the definition, epidemiology, and multifactorial pathogenesis of asthma; to explore potential therapeutic targets incorporating the latest advances from clinical trials and targeted interventions; and to emphasize the development of multi-target ("omni-targeted") combination strategies based on individualized diagnosis, potentially guided by artificial intelligence (AI), to improve asthma control, clinical outcomes, and exacerbation rates, with an eye toward a definitive cure.<h4>Key scientific concepts of review</h4>We propose that the current therapeutic dilemma largely reflects the inability of single-target therapies to address an individual's multiple pathogenic pathways. In contrast, multi-target, personalized strategies can modulate diverse pathological pathways simultaneously and precisely. Realizing these strategies will require AI-enabled guidance, precise identification of individual pathogenic mechanisms, and further development of targeted therapeutics.

Also flagged:ageingNon-communicable diseasesischaemic heart disease-19Neonatal disorderslower respiratory infections
Journal Article 2025-10-12 No Snippets GBD 2023 Disease and Injury and Risk Factor Collaborators.
Show Full Abstract

<h4>Background</h4>For more than three decades, the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) has provided a framework to quantify health loss due to diseases, injuries, and associated risk factors. This paper presents GBD 2023 findings on disease and injury burden and risk-attributable health loss, offering a global audit of the state of world health to inform public health priorities. This work captures the evolving landscape of health metrics across age groups, sexes, and locations, while reflecting on the remaining post-COVID-19 challenges to achieving our collective global health ambitions.<h4>Methods</h4>The GBD 2023 combined analysis estimated years lived with disability (YLDs), years of life lost (YLLs), and disability-adjusted life-years (DALYs) for 375 diseases and injuries, and risk-attributable burden associated with 88 modifiable risk factors. Of the more than 310 000 total data sources used for all GBD 2023 (about 30% of which were new to this estimation round), more than 120 000 sources were used for estimation of disease and injury burden and 59 000 for risk factor estimation, and included vital registration systems, surveys, disease registries, and published scientific literature. Data were analysed using previously established modelling approaches, such as disease modelling meta-regression version 2.1 (DisMod-MR 2.1) and comparative risk assessment methods. Diseases and injuries were categorised into four levels on the basis of the established GBD cause hierarchy, as were risk factors using the GBD risk hierarchy. Estimates stratified by age, sex, location, and year from 1990 to 2023 were focused on disease-specific time trends over the 2010-23 period and presented as counts (to three significant figures) and age-standardised rates per 100 000 person-years (to one decimal place). For each measure, 95% uncertainty intervals [UIs] were calculated with the 2·5th and 97·5th percentile ordered values from a 250-draw distribution.<h4>Findings</h4>Total numbers of global DALYs grew 6·1% (95% UI 4·0-8·1), from 2·64 billion (2·46-2·86) in 2010 to 2·80 billion (2·57-3·08) in 2023, but age-standardised DALY rates, which account for population growth and ageing, decreased by 12·6% (11·0-14·1), revealing large long-term health improvements. Non-communicable diseases (NCDs) contributed 1·45 billion (1·31-1·61) global DALYs in 2010, increasing to 1·80 billion (1·63-2·03) in 2023, alongside a concurrent 4·1% (1·9-6·3) reduction in age-standardised rates. Based on DALY counts, the leading level 3 NCDs in 2023 were ischaemic heart disease (193 million [176-209] DALYs), stroke (157 million [141-172]), and diabetes (90·2 million [75·2-107]), with the largest increases in age-standardised rates since 2010 occurring for anxiety disorders (62·8% [34·0-107·5]), depressive disorders (26·3% [11·6-42·9]), and diabetes (14·9% [7·5-25·6]). Remarkable health gains were made for communicable, maternal, neonatal, and nutritional (CMNN) diseases, with DALYs falling from 874 million (837-917) in 2010 to 681 million (642-736) in 2023, and a 25·8% (22·6-28·7) reduction in age-standardised DALY rates. During the COVID-19 pandemic, DALYs due to CMNN diseases rose but returned to pre-pandemic levels by 2023. From 2010 to 2023, decreases in age-standardised rates for CMNN diseases were led by rate decreases of 49·1% (32·7-61·0) for diarrhoeal diseases, 42·9% (38·0-48·0) for HIV/AIDS, and 42·2% (23·6-56·6) for tuberculosis. Neonatal disorders and lower respiratory infections remained the leading level 3 CMNN causes globally in 2023, although both showed notable rate decreases from 2010, declining by 16·5% (10·6-22·0) and 24·8% (7·4-36·7), respectively. Injury-related age-standardised DALY rates decreased by 15·6% (10·7-19·8) over the same period. Differences in burden due to NCDs, CMNN diseases, and injuries persisted across age, sex, time, and location. Based on our risk analysis, nearly 50% (1·27 billion [1·18-1·38]) of the roughly 2·80 billion total global DALYs in 2023 were attributable to the 88 risk factors analysed in GBD. Globally, the five level 3 risk factors contributing the highest proportion of risk-attributable DALYs were high systolic blood pressure (SBP), particulate matter pollution, high fasting plasma glucose (FPG), smoking, and low birthweight and short gestation-with high SBP accounting for 8·4% (6·9-10·0) of total DALYs. Of the three overarching level 1 GBD risk factor categories-behavioural, metabolic, and environmental and occupational-risk-attributable DALYs rose between 2010 and 2023 only for metabolic risks, increasing by 30·7% (24·8-37·3); however, age-standardised DALY rates attributable to metabolic risks decreased by 6·7% (2·0-11·0) over the same period. For all but three of the 25 leading level 3 risk factors, age-standardised rates dropped between 2010 and 2023-eg, declining by 54·4% (38·7-65·3) for unsafe sanitation, 50·5% (33·3-63·1) for unsafe water source, and 45·2% (25·6-72·0) for no access to handwashing facility, and by 44·9% (37·3-53·5) for child growth failure. The three leading level 3 risk factors for which age-standardised attributable DALY rates rose were high BMI (10·5% [0·1 to 20·9]), drug use (8·4% [2·6 to 15·3]), and high FPG (6·2% [-2·7 to 15·6]; non-significant).<h4>Interpretation</h4>Our findings underscore the complex and dynamic nature of global health challenges. Since 2010, there have been large decreases in burden due to CMNN diseases and many environmental and behavioural risk factors, juxtaposed with sizeable increases in DALYs attributable to metabolic risk factors and NCDs in growing and ageing populations. This long-observed consequence of the global epidemiological transition was only temporarily interrupted by the COVID-19 pandemic. The substantially decreasing CMNN disease burden, despite the 2008 global financial crisis and pandemic-related disruptions, is one of the greatest collective public health successes known. However, these achievements are at risk of being reversed due to major cuts to development assistance for health globally, the effects of which will hit low-income countries with high burden the hardest. Without sustained investment in evidence-based interventions and policies, progress could stall or reverse, leading to widespread human costs and geopolitical instability. Moreover, the rising NCD burden necessitates intensified efforts to mitigate exposure to leading risk factors-eg, air pollution, smoking, and metabolic risks, such as high SBP, BMI, and FPG-including policies that promote food security, healthier diets, physical activity, and equitable and expanded access to potential treatments, such as GLP-1 receptor agonists. Decisive, coordinated action is needed to address long-standing yet growing health challenges, including depressive and anxiety disorders. Yet this can be only part of the solution. Our response to the NCD syndemic-the complex interaction of multiple health risks, social determinants, and systemic challenges-will define the future landscape of global health. To ensure human wellbeing, economic stability, and social equity, global action to sustain and advance health gains must prioritise reducing disparities by addressing socioeconomic and demographic determinants, ensuring equitable health-care access, tackling malnutrition, strengthening health systems, and improving vaccination coverage. We live in times of great opportunity.<h4>Funding</h4>Gates Foundation and Bloomberg Philanthropies.

Also flagged:neurological disordersdegradationAutophagosomelysosomemacroautophagyvesicles
Journal Article 2025-10-12 No Snippets Dafsari HS, Schuler J, Schober E, Möller B, Antebi A, Fanto M, Jungbluth H.
Show Full Abstract

Autophagy is a highly conserved cellular pathway for the degradation and recycling of defective intracellular cargo and plays a vital role in the homeostasis of post-mitotic tissues, particularly the nervous system. Autophagosome-lysosome fusion represents the final critical step in macroautophagy with a tightly regulated process mediated by a complex molecular machinery of tethering vesicles for degradation. Since the first reports of human autophagy disorders, the scientific and clinical focus condensed on severe phenotypes with biallelic-truncating genotypes as monogenic models of near-complete autophagy perturbation. Recent reports suggest a much wider disease spectrum with defective autophagy, ranging from neurodevelopmental disorders to neurodegenerative phenotypes with later manifestation due to "milder" genotypes, including Alzheimer's disease (AD), Parkinson's disease (PD), and Amyotrophic Lateral Sclerosis-Frontotemporal Dementia (ALS-FTD). In addition, recent evidence identified molecular connections between physiological autophagy regulation during normal aging and pathophysiological hallmarks of aging-related disorders. These translational observations led to a more comprehensive understanding of autophagy at health and disease, in particular: 1) genetic location and allelism of pathogenic variants ("genomic space"); 2) protein-protein interaction in functional protein complexes ("proteomic space"); 3) metabolic autophagic flux with positive and negative regulators ("metabolomic space"); 4) age-related phenotypic progression over time. Here, we review the autophagosome-lysosome fusion machinery as a key structure both on the molecular level and with regards to the pathogenesis of the autophagy-related disease spectrum. We highlight the clinicopathological signature of disorders in the autophagosome-lysosome fusion machinery, in particular features warranting awareness from clinicians and geneticists to inform adequate diagnosis, surveillance, and patient guidance.

Also flagged:ZirconiumOxideCancerastaxanthincarbon nanotubesfolic acid
Journal Article 2025-10-12 No Snippets You HS, Sathiyaseelan A, Wang MH, Baek JS.
Show Full Abstract

In this study, zirconium oxide nanoparticles (ZrO<sub>2</sub> NPs) were synthesized using astaxanthin (AST) rich extract (AZ) and subsequently conjugated with multiwalled carbon nanotubes (MWCNTs) (AZM) and functionalized with folic acid (FA) (FAZM) to develop a cancer-targeting nanocomposite with enhanced anticancer efficacy. The physicochemical properties of the synthesized materials were characterized using transmission electron microscopy (TEM), dynamic light scattering (DLS), electrophoretic light scattering (ELS), X-ray diffraction (XRD), and Fourier transform infrared spectroscopy (FT-IR). FAZM exhibited the highest antioxidant activity, with IC<sub>50</sub> values of 822.78 μg/mL against ABTS and 320.70 μg/mL against DPPH free radicals. Biocompatibility assessments revealed that FAZM exhibited little cytotoxicity in normal human skin cells and demonstrated improved hemocompatibility, as confirmed by a hemolysis assay. Furthermore, FAZM significantly inhibited the proliferation of MDA-MB-231 breast cancer cells, inducing apoptosis and exhibiting potent cytotoxic effects (IC<sub>50</sub>: 115.84 μg/mL). These findings suggest that FA and MWCNTs enhance the cancer-targeting capability of AZ while maximizing its selective cytotoxicity against cancer cells. This study highlights that FA-functionalized MWCNT-conjugated ZrO<sub>2</sub> NPs are a promising nanoplatform as an AST delivery system for targeted cancer therapy.

Also flagged:Transcription FactorsCancercell divisionmethylationpost-translational protein modificationstumor
Journal Article 2025-10-12 No Snippets Cammarota AL, Carrizzo A, De Marco M, Bukvic N, Romano FJ, Rosati A, Chetta M.
Show Full Abstract

Cancer is a multifaceted disease characterized by uncontrolled cell division resulting from substantial disruptions of normal biological processes. Central to its development is cellular transformation, which involves a dynamic sequence of events including chromosomal translocations, genetic mutations, abnormal DNA methylation, post-translational protein modifications, and other genetic and epigenetic alterations. These changes compromise physiological regulatory mechanisms and contribute to accelerated tumor growth. A critical factor in this process is the dysregulation of transcription factors (TFs) which regulate gene expression and DNA transcription. Dysregulation of TFs initiates a cascade of biochemical events, such as abnormal DNA replication, that further enhance cell proliferation and increase genomic instability. This microenvironment not only sustains tumor growth but also promotes the accumulation of somatic mutations, thereby fueling tumor evolution and heterogeneity. In this study, we employed an in silico approach to identify TFs regulating 622 key genes whose mutations are implicated in carcinogenesis. Transcriptional regulatory networks were analyzed through bioinformatics methods to elucidate molecular pathways involved in cancer development. A thorough understanding of these processes may help to clarify the function of dysregulated TFs and facilitate the development of novel therapeutic approaches designed to make cancer treatments personalized and efficacious.

HFE
Also flagged:aortic stenosisASangiodysplasiaacquired von Willebrand syndromeanemiacapsule
Journal Article 2025-10-12 ✓ 1 Snippet Henshall A, Ambrogetti R, De Palma R.
In-Text Gene Mentions

…Intype 1 ischemia1 ischemia, caused…

Show Full Abstract

Heyde's syndrome, characterized by the triad of severe aortic stenosis (AS), GI bleeding (GIB) from angiodysplasia, and acquired von Willebrand syndrome, presents a complex diagnostic and therapeutic challenge. We report the case of a male patient in his 70s with recurrent melena and profound anemia requiring multiple transfusions. Extensive initial investigations, including gastroscopy and colonoscopy, failed to identify a bleeding source. The diagnosis was suspected after echocardiography confirmed critical AS and was later confirmed by capsule endoscopy, which revealed bleeding small bowel angiodysplasia. Instead of pursuing direct endoscopic treatment of the angiodysplasia, the decision was made to address the underlying cause with transcatheter aortic valve implantation (TAVI). Following the procedure, the patient's hemoglobin stabilized, and subsequent enteroscopy confirmed resolution of the angiodysplasia. This case highlights that in patients with AS and obscure GIB, maintaining a high index of suspicion for Heyde's syndrome is crucial. It demonstrates that timely intervention with TAVI can serve as a definitive treatment by resolving the bleeding diathesis through correction of the shear-stress platelet insult and underscores the importance of a multidisciplinary approach between cardiology and gastroenterology to achieve optimal patient outcomes.

Also flagged:Atrial fibrillationAFarrhythmiahypertensionheart diseaseischemic stroke
Journal Article 2025-10-12 No Snippets Hoang VTA, Dinh HTT, Lam VS, Le PNT, Tran P.
Show Full Abstract

Systemic embolism is a serious complication of atrial fibrillation (AF), most commonly originating from thrombi in the left atrial appendage (LAA). Thrombi that are large (≥15 mm) or exhibit mobility carry particularly high embolic risk, yet management can be challenging in patients with elevated bleeding risk. Advanced echocardiographic techniques now allow quantification of thrombus mobility, and dense spontaneous echo contrast (SEC) on transesophageal echocardiography has been identified as an independent predictor of thromboembolic events. We report the case of an 80-year-old woman with paroxysmal AF, non-Hodgkin lymphoma in remission, hypothyroidism, and a history of perforated gastric ulcer, in whom a large, mobile LAA thrombus (8 × 15 mm) was incidentally detected and confirmed by transesophageal echocardiography. Anticoagulation with warfarin, titrated to an INR of 2.5-3.0, led to complete thrombus resolution within six weeks. This case illustrates the substantial embolic risk associated with mobile LAA thrombi and demonstrates that individualized anticoagulation with careful monitoring can achieve safe and effective thrombus resolution in patients at high risk of bleeding. The novelty lies in highlighting individualized management as a viable strategy in this complex clinical setting, providing an important teaching point for practice.

CA10
Also flagged:GlycosaminoglycanNeurexin-1Neurexinssynaptic adhesion moleculessynapsesynapses
Journal Article 2025-10-12 ✓ 1 Snippet Critcher M, Wu H, Lu Y, Huang ML.
In-Text Gene Mentions

…including FAM19A andCA10[ 73 –…

Show Full Abstract

Neurexins are synaptic adhesion molecules best characterized in neurons, where they regulate synapse assembly and function, with emerging evidence indicating they are also abundantly expressed by astrocytes. To elucidate the interactome of NRXN1α, we employed a proximity labeling strategy in cultured human fetal glial cells (SVG p12 cells). This approach enables the identification of transient and spatially restricted protein interactions, offering insights into the molecular environment of NRXN1α in glia. Further, we investigated how the presence and number of glycosaminoglycan (GAG) chains present on NRXN1α influence these interactions by generating glycosylation-deficient mutants at previously characterized GAG glycosites. Here, we show that the astrocytic NRXN1α interactome in SVG p12 cells consists of over 400 proteins, half of which are likely modulated by GAGs. Our findings provide a systems-level view of NRXN1α-associated proteins in fetal glia cultured in the absence of neurons and highlight the role of GAG valency in modulating its interactome.

Also flagged:Huntington's DiseaseHDHuntington's Disease‐like 2SANFELIZ IHDL2JPH3
Journal Article 2025-10-11 No Snippets Antolin-Sanfeliz I, Giguet-Valard AG, Duclos S, Cazeneuve C, Angelini C, Signaté A, Margolis RL, Goizet C, Bellance R.
Show Full Abstract

<h4>Background</h4>Huntington's Disease-like 2 (HDL2), caused by a CAG repeat expansion in JPH3, closely resembles HD. All reported HDL2 patients to date have some African ancestry. While both disorders exist in the Caribbean, their relative frequency and clinical characteristics remain largely unknown.<h4>Objectives</h4>To characterize HD and HDL2 patients in Martinique.<h4>Methods</h4>We retrospectively analyzed all HD and HDL2 patients evaluated over 20 years at a single neurology center in Martinique, collecting longitudinal clinical features, UHDRS scores, and repeat lengths.<h4>Results</h4>In Martinique, combined HD and HDL2 minimum prevalence was 7.77/100,000. We ascertained 24 HD individuals, from 16 pedigrees, and 18 HDL2 individuals, from two pedigrees, one being the most extensive HDL2 pedigree yet reported. Because most HDL2 patients belong to a single large pedigree, the data must be interpreted with caution as familial clustering may introduce bias. HDL2 cases were predominantly male (83% vs. 45% in HD). Motor symptoms were the most frequent initial manifestation in both. Repeat length negatively correlated with estimated onset age in both diseases. Longitudinal motor (UHDRS-TMS) and functional capacity (UHDRS-TFC) scores in HDL2 revealed progressive worsening similar to HD. Inter- and intra-familial clinical and genetic heterogeneity was obvious in both diseases. Anticipation was not exclusively reserved to paternal transmissions in HDL2.<h4>Conclusions</h4>HDL2 is nearly as prevalent as HD in Martinique. The study reinforces the similarities between HD and HDL2 in genotype-phenotype correlation and disease course, while highlighting heterogeneity and germline instability in HDL2. Interpretation is limited by the small number of HDL2 families.

RC3H1
Also flagged:AsthmalocalizationFAM157ATTNcytoplasmpathogenesis
Journal Article 2025-10-11 ✓ 2 Snippets Cui Y, Wei S, Liang L, Wang L.
In-Text Gene Mentions

…both datasets (LUCAT1,RC3H1-IT1, FAM157A, and TTN-AS1)…

…identified lncRNAs (LUCAT1,RC3H1-IT1, FAM157A, and TTN-AS1)…

Show Full Abstract

Recent studies have highlighted the important role of PANoptosis in asthma. The purpose of this work was to find long noncoding RNAs (lncRNAs) associated with PANoptosis and assess their potential as asthma diagnostic biomarkers. We examined two publicly accessible datasets (GSE165934 and GSE195599). Diagnostic lncRNAs linked to PANoptosis were screened using logistic regression and least absolute shrinkage and selection operator (LASSO) models. Subcellular localization and immune microenvironmental features were assessed. A competitive endogenous RNA (ceRNA) network was created by combining starBase predictions with differentially expressed mRNAs. The levels of potential lncRNAs' transcriptional expression were further confirmed. Four of the seven differentially expressed lncRNAs found in both datasets (LUCAT1, RC3H1-IT1, FAM157A, and TTN-AS1) were verified as diagnostic lncRNAs linked to PANoptosis. When compared to controls, asthma samples showed clear changes in the makeup of immune cells and signaling pathways. Three lncRNAs were shown to be mostly localized in the cytoplasm, according to subcellular localization studies. A ceRNA regulation network with 154 interaction partners and 72 nodes was created. In comparison to normal samples, asthma samples exhibited substantially reduced expression of all four diagnostic lncRNAs. This study provides the first evidence linking PANoptosis-related lncRNAs to asthma. The identified lncRNAs (LUCAT1, RC3H1-IT1, FAM157A, and TTN-AS1) may serve as clinically relevant diagnostic biomarkers and offer novel insights into asthma pathogenesis, potentially supporting the development of improved therapeutic strategies.

NEGR1
Also flagged:Colorectal cancercancerdeathActivating Transcription Factor 6 BetaATF6BCell Adhesion Molecule 2
Journal Article 2025-10-11 ✓ 1 Snippet Bouras E, Yu R, Kim AE, Markozannes G, Murphy N, Albanes D, Anderson LN, Barry EL, Berndt SI, Bishop DT, Brenner H, Burnett-Hartman A, Campbell PT, Carreras-Torres R, Chan AT, Cheng I, Devall MA, Diez-Obrero V, Dimou N, Drew DA, Gruber SB, Gsur A, Hoffmeister M, Hsu L, Huyghe JR, Kawaguchi E, Keku TO, Kundaje A, Küry S, Le Marchand L, Lewinger JP, Li L, Lynch BM, Moreno V, Morrison JL, Newton CC, Obón-Santacana M, Palmer JR, Papadimitriou N, Pellatt AJ, Peoples AR, Pharoah PDP, Platz EA, Qu C, Ruiz-Narvaez E, Mendez JS, Schoen RE, Stern MC, Thomas CE, Tian Y, Um CY, Visvanathan K, Vodicka P, Vymetalkova V, White E, Wolk A, Woods MO, Wu AH, Gunter MJ, Gauderman WJ, Peters U, Evangelou M, Tsilidis KK.
In-Text Gene Mentions

…Regulator 1 (NEGR1)] with fruit…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is a significant public health concern, highlighting the critical need for identifying novel intervention targets for its prevention.<h4>Methods</h4>We conducted genome-wide interaction analyses for 15 exposures with established or putative CRC risk [body mass index (BMI), height, physical activity, smoking, type 2 diabetes, use of menopausal hormone therapy, non-steroidal anti-inflammatory drugs, and intake of alcohol, calcium, fibre, folate, fruits, processed meat, red meat, and vegetables], and used interaction estimates to explore pathways and genes underlying CRC risk. The adaptive combination of Bayes Factors (ADABF), and over-representation analysis (ORA) were used for pathway analyses, and findings were further investigated using publicly available resources [hallmarks of cancer, Open Targets Platform (OTP)].<h4>Findings</h4>A total of 1973 pathways using ADABF, and 840 pathways using ORA, out of the 2950 analysed, were enriched (P < 0.05) for at least one exposure, as well as 1227 genes within the enriched pathways. Data were available for 811/1227 coding genes in the OTP, 241 of which were supported by strong relative abundance of prior evidence (overall OTP score > 0.05). Fifty percent of the genes (617/1227) mapped to at least one hallmark of cancer, most of which (388/617) pertained to the Sustaining Proliferative Signalling hallmark. Our findings reflect previously established pathways for CRC risk and highlight the emerging importance of several less studied genes. Common pathways were found for several combinations of exposures, potentially suggesting common underlying mechanisms.<h4>Interpretation</h4>The results of the present analysis provide a basis for further functional research. If confirmed, they may help elucidate the etiological associations between risk factors and CRC risk and ultimately inform personalized prevention strategies.<h4>Funding</h4>This study was funded by Cancer Research UK (CRUK; grant number:PPRCPJT∖100005) and World Cancer Research Fund International (WCRF; IIG_FULL_2020_022). Funding for grant IIG_FULL_2020_022 was obtained from Wereld Kanker Onderzoek Fonds (WKOF) as part of the World Cancer Research Fund International grant programme. Full funding details for the individual consortia are provided in the acknowledgements.

Also flagged:Cancertumorantigen presentationcross‐presentationautoimmune disorderstumors
Journal Article 2025-10-11 No Snippets Peng Y, Zhan L, Shi J, Wang J, Li Y, Sun X, Lv J, Yang H, Qiu Z, Liu X, Li C, Gong S, Jia W, Wang H, Zhao Y, Zhang B, Guo W, Guo J, Shang J, Zhou Q, Yang Y, Gao F.
Show Full Abstract

Despite the tremendous amount of basic knowledge in cancer immunity gained and many transitional approaches attempted, current cancer immunotherapies are still far from reaching universal effectiveness. Therefore, next-generation cancer immunotherapies would emerge from deepened mechanistic insights on the full spectrum of cellular and molecular interactions between cancer cells and their immune sentinels. This review embarks on an exhaustive exploration of the cardinal immunological principles that catalyze robust cancer surveillance and their potential escapes and recapitulate the state-of-art understanding of both receptors and corresponding immune cell types involved. Both tumor intrinsic and tumor microenvironmental mediators of immune escapes are outlined in the context of current clinic applications. Following emphasizing the exceptional requisites that effective cancer immunity cycle must meet, specific cellular subsets crucial for igniting tumor immunity, notably effector and helper T cells alongside antigen presentation cells are examined, focusing on their close interactions in both antigen-dependent and -independent manners. Such intricate interactions form dynamic immune hubs at the tumor site, holding promising key functionality in rendering effective cancer retreat. Grounded on these recent insights, refined immunotherapeutic strategies, especially those bolstering priming based anticancer effector functions are advocated.

Also flagged:chromosomeReproductionGSTM3SPATA1HFM1MSH4
Journal Article 2025-10-11 No Snippets Ziadi C, Morales RM, Vargas-Pérez MÁ, Calvo-Rubio GA, Demyda-Peyrás S, Molina A.
Show Full Abstract

Fertility is key for calf production. Direct selection for female fertility under field conditions is hindered by low accuracy and selection response. An alternative widely implemented is selection for scrotal circumference (SC), genetically correlated with daughter fertility. This study performed a genome-wide association study (GWAS) to identify genomic regions and candidate loci linked to SC and female fertility in Retinta cattle. A multivariate ssGBLUP was applied using SC records from 1061 bulls, fertility-related traits from 59,254 females and genotypes from 1230 animals using the Axiom™ Bovine Genotyping v3 Array (65k). The ssGWAS revealed 23 1-Mb windows explaining >1% of additive genetic variance for SC, one on chromosome 2 and 22 on chromosome 3. Within these windows, 198 regions spanning 118 protein-coding genes and 80 RNA genes were identified. Several genes, including <i>GSTM3</i>, <i>SPATA1</i>, <i>HFM1</i>, and <i>MSH4</i>, were previously associated with male fertility. Six regions overlapped across male and female traits, containing two protein-coding genes (<i>THSD7B</i> and ENSBTAG00000021755). Identification of genomic markers linked to both female fertility and male SC enables selection of superior animals, improving reproductive efficiency and advancing knowledge of the genomic basis of male-female fertility relationships.

Also flagged:chromatinabscisic acidwaternucleotidemethylationto drought
Journal Article 2025-10-11 No Snippets Bolc P, Puchta-Jasińska M, Motor A, Maździarz M, Boczkowska M.
Show Full Abstract

Drought is a leading constraint on plant productivity and will intensify with climate change. Plant acclimation emerges from a multilayered regulatory system that integrates signaling, transcriptional reprogramming, RNA-based control, and chromatin dynamics. Within this hierarchy, non-coding RNAs (ncRNAs) provide a unifying regulatory layer; microRNAs (miRNAs) modulate abscisic acid and auxin circuits, oxidative stress defenses, and root architecture. This balances growth with survival under water-deficient conditions. Small interfering RNAs (siRNAs) include 24-nucleotide heterochromatic populations that operate through RNA-directed DNA methylation, which positions ncRNA control at the transcription-chromatin interface. Long non-coding RNAs (lncRNAs) act in cis and trans, interact with small RNA pathways, and can serve as chromatin-associated scaffolds. Circular RNAs (circRNAs) are increasingly being detected as responsive to drought. Functional studies in <i>Arabidopsis</i> and maize (e.g., ath-circ032768 and circMED16) underscore their regulatory potential. This review consolidates ncRNA biogenesis and function, catalogs drought-responsive modules across model and crop species, especially cereals, and outlines methodological priorities, such as long-read support for isoforms and back-splice junctions, stringent validation, and integrative multiomics. The evidence suggests that ncRNAs are tractable entry points for enhancing drought resilience while managing growth-stress trade-offs.

MLLT10
Also flagged:AMLchildhood leukemiaacute lymphoblastic leukemiaALLleukemiasleukemia
Journal Article 2025-10-11 ✓ 5 Snippets Cencelewicz K, Pieniążek B, Chajec J, Buziak J, Ozygała A, Sochaczewska J, Lejman M, Zawitkowska J.
In-Text Gene Mentions

…the MLLT3 andMLLT10(Mixed-Lineage Leukemia; Trans…

…t(10;11)(p12;q23)/ KMT2A ::MLLT10translocation and classified…

…, KMT2A ::MLLT10, KMT2A ::…

…and KMT2A ::MLLT10translocations, while the…

…Translocated To 3MLLT10Mixed-Lineage Leukemia; Transl…

Show Full Abstract

Acute myeloid leukemia (AML) accounts for 15-20% of childhood leukemia cases; however, it is characterized by very high aggressiveness and has the highest mortality rate among leukemias, with relapse rates ranging from 34% to 38%. It is a disease characterized by high molecular diversity, and the frequency of specific genetic alterations in children is different from that in adults. Furthermore, mutations and rearrangements vary with age within the pediatric population. To date, a wide spectrum of genetic alterations has already been studied, but the molecular landscape of each patient is unique. An analysis of rearrangements and mutations specific to children of different ages appears to be crucial in order to individualize diagnosis and therapy appropriately. The aim of the following review is to analyze the molecular landscape of pediatric AML by age in detail in order to prioritize therapeutic strategies dedicated to specific age groups.

Also flagged:Focal cortical dysplasiaepilepsyIL1BTLR4BDNFHMGCR
Journal Article 2025-10-11 No Snippets Shakerzadeh J, Jaroušek R, Goliášová Z, Brázdil M.
Show Full Abstract

Focal cortical dysplasia (FCD) is a major cause of drug-resistant epilepsy, yet its molecular basis remains poorly understood. Numerous studies have analyzed RNA, protein, and microRNA alterations, but results are often inconsistent across subtypes and methodologies. To address this gap, we conducted a systematic review integrating transcriptomic, proteomic, and microRNA data from 117 human studies of FCD subtypes I-III. Differentially expressed factors were extracted, categorized by subtype, and analyzed using pathway enrichment and network approaches. Our integrative analysis revealed convergent dysregulation of neuroinflammatory, synaptic, cytoskeletal, and metabolic pathways across FCD subtypes. Consistently altered genes, including IL1B, TLR4, BDNF, HMGCR, and ROCK2, together with dysregulated microRNAs such as hsa-miR-21-5p, hsa-miR-155-5p, and hsa-miR-132-3p, were linked to PI3K-Akt-mTOR, Toll-like receptor, and GABAergic signaling, emphasizing shared pathogenic mechanisms. Importantly, we identified overlapping transcript-protein patterns and subtype-specific molecular profiles that may refine diagnosis and inform therapeutic strategies. This review provides the first cross-omics molecular framework of FCD, demonstrating how convergent pathways unify heterogeneous findings and offering a roadmap for biomarker discovery and targeted interventions.

Also flagged:AsthmaObesitychronic respiratory diseaseallergic asthmasecretioncytokine
Journal Article 2025-10-11 No Snippets Kachel M, Langwiński W, Szczepankiewicz A.
Show Full Abstract

Asthma is a chronic respiratory disease affecting over 262 million people worldwide, with obesity-associated asthma emerging as a distinct endotype of increasing prevalence characterized by metabolic inflammation and airway remodeling. Unlike allergic asthma, this phenotype is driven by chronic low-grade inflammation, originating from hypertrophic and hypoxic adipose tissue. This dysregulated state leads to the activation of pro-inflammatory pathways and the secretion of cytokines, contributing to airway dysfunction and remodeling. Recent evidence highlights non-coding RNAs (ncRNAs) as key regulators of these processes. MicroRNAs (miRNAs), long non-coding RNAs (lncRNAs), and circular RNAs (circRNAs) influence inflammation and remodeling by modulating immune cell polarization, cytokine secretion, extracellular matrix composition, and airway smooth muscle cell (ASMC) proliferation. Notably, H19, MEG3, GAS5, miR-26a-1-3p, and miR-376a-3p have been implicated in both asthma and obesity, suggesting their role in linking metabolic dysfunction with airway pathology. Moreover, ncRNAs regulate Treg/Th17 balance, fibroblast activation, and autophagy-related pathways, further influencing airway remodeling. Our in silico analysis highlighted the IGF1R signaling pathway as a key enriched mechanism, linking selected ncRNAs with metabolic dysregulation and inflammation in obesity-related asthma. This paper reviews how ncRNAs regulate inflammation and airway remodeling in obesity-associated asthma, emphasizing their potential molecular links between metabolic dysfunction and airway pathology.

Also flagged:ArylpiperazinylCarboxamidescancermelanomatumourviral infections
Journal Article 2025-10-11 No Snippets Murineddu G, Di Marzo C, Corona P, Coinu S, Plicanti E, Asproni B, Piras S, Freer G, Carta A.
Show Full Abstract

In this work, we synthesized a small library of tricyclic compounds to assess whether they might have both anticancer and antiviral activity against three viruses that have recently caused epidemics. Concerning their anti-tumour activity, derivative <b>1</b> was found to be the compound with the highest GI<sub>50</sub> values on some cancer cell line panels. Particularly, in melanoma cell lines, its GI<sub>50</sub> values ranged between 1.54 μM (MALME-3M) and 2.03 μM (M14). Several derivatives with considerable anti-tumour activity showed antiviral activity as well, against influenza A virus (e.g., derivative <b>19</b>, selectivity index of 21.36 in MDCK cells) or against Zika virus (compound <b>13</b>, selectivity index of 20.20 in Huh-7 cells). Moreover, compounds <b>13</b> and <b>12</b> showed anti-SARS-CoV-2 activity, with selectivity indices of 150.00 and 63.63, respectively. Compound <b>1</b>, for its anticancer activity, and <b>13</b>, for its anti-SARS-CoV-2 activity, together with the compounds active against Zika virus and influenza A virus, are promising candidates for further studies.

HTT
Also flagged:ZKSCAN3Huntington diseaseHDneurodegenerative diseasepolyglutaminemacroautophagy
Journal Article 2025-10-10 ✓ 2 Snippets Park HJ, Kim J, Choi J, Ryou C, Shin E, Lee JY.
In-Text Gene Mentions

…mutant form ofHTT(huntingtin; mHTT), caused…

…HD: Huntington disease;HTT: huntingtin; IXMC: ImageXpres…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disease caused by the expression of a mutant form of HTT (huntingtin; mHTT), caused by an abnormal expansion of polyglutamine in HTT. In HD, macroautophagy/autophagy dysfunction can cause mHTT accumulation. Moreover, the promotion of autophagy is considered a therapeutic strategy for the treatment of HD. ZKSCAN3 (zinc finger with KRAB And SCAN domains 3) has been identified as a transcriptional repressor of TFEB (transcription factor EB), a master regulator of autophagy and lysosomal functions. In this study, we conducted CRISPR-Cas9-based gene ablation to disrupt ZKSCAN3 in HD animal models and HD patient-induced pluripotent stem cell (iPSC) -derived three-dimensional (3D) spheroids. In animal models of HD, targeted in vivo <i>zkscan3</i> ablation via a single adeno-associated virus (AAV) mediated CRISPR-Cas9 approach resulted in reduced mHTT levels, leading to improvements in both behavioral symptoms and the brain environment. Furthermore, CRISPR-Cas9 mediated ablation of ZKSCAN3 in 3D spheroids from HD patient-derived iPSC resulted in increased autophagy and lysosomal function, along with reduced mHTT accumulation. Specifically, in iPSC-derived neurons from HD patients, ZKSCAN3-depleted neurons demonstrated increased lysosomal function and reduced oxidative stress compared to controls. Additionally, transcriptional analysis of ZKSCAN3-edited neurons revealed an increased expression of genes involved in synaptic function and transporter activity. Taken together, these results suggest that in HD treatment strategies for improving neuronal function and the brain environment, ZKSCAN3 downregulation in neurons by autophagy activation may improve the brain environment through neuronal self-repair.<b>Abbreviations:</b> 2D: two-dimensional; 3D: three-dimensional; 4-HNE: 4-hydroxynonenal; AAV: adeno-associated virus; AD: Alzheimer disease; Aβ: beta-amyloid; DAPI: 4,6-diamidino-2-phenylindole; GFP: green fluorescent protein; HD: Huntington disease; HTT: huntingtin; IXMC: ImageXpress microconfocal high-content imaging system; Indel: insertion or deletion; iPSC: induced pluripotent stem cell; LAMP1: lysosomal-associated membrane protein 1; mHTT: mutant huntingtin; NPCs: neural precursor cells; RBFOX3/NeuN: RNA binding fox-1 homolog 3; PD: Parkinson disease; RNP: ribonucleoprotein; sgRNAs: single guide RNAs; ST: striatum; TFEB: transcription factor EB; TUBB3/Tuj-1: tubulin beta 3 class III; ZKSCAN3: zinc finger with KRAB and SCAN domains 3.

Also flagged:tumorYBX1gene expressionmethylationcancerY-box binding protein 1
Journal Article 2025-10-10 No Snippets Xie G, Xie Y, Xu X.
Show Full Abstract

Y‑box binding protein 1 (YBX1/YB‑1) is a DNA/RNA‑binding protein, which plays a crucial role in promoting tumor progression and resistance to anticancer drugs. YBX1 is widely involved in a range of biological processes such as DNA repair, mRNA transcription, pre-mRNA splicing, mRNA stability regulation, translation and exosome sorting. In addition to these canonical DNA/RNA‑binding protein functions, YBX1 can also have a regulatory role in N6‑methyladenine (m<sup>6</sup>A) and 5‑methylcytosine (m<sup>5</sup>C) RNA modification. Moreover, YBX1 functions as an m<sup>5</sup>C reader to regulate mRNA stability, thus modulating gene expression and affecting disease development. Furthermore, SU056, an inhibitor of YBX1, has been shown to reverse drug resistance and prevent tumor development. In the present review, the structure of YBX1 and its functions in RNA methylation modifications are summarized, and its effects on m<sup>5</sup>C and m<sup>6</sup>A RNA modifications in cancer progression and drug resistance are emphasized.

SERPINC1
Also flagged:mesenteric ischemiaMeIslactatefibrinogenD-dimer
Journal Article 2025-10-10 ✓ 3 Snippets Taghiyev ZT, Sadowski M, Beier LM, Leweling C, Gunkel S, Keschenau P, Kalder J, Arneth BM, Skevaki C, Sachs U, Müller J, Böning A.
In-Text Gene Mentions

…(PTT), antithrombin III (ATIII), and platelet count…

…Antithrombin III (ATIII), which reflects physiologica…

…coagulopathy, and relevantATIIIconsumption later in…

Show Full Abstract

Cardiac surgery is considered to be a hypercoagulable state with an increased incidence of thromboembolic events. To evaluate the connection between hypercoagulability and mesenteric ischemia (Me-Is), we investigated hemostatic parameters in patients with diagnosed Me-Is. Out of a cohort of 500 consecutive cardiac surgery patients, 25 patients with hyperinflammatory indicators (interleukin-6 > 600 ng/l) and metabolic acidosis (lactate > 4 mmol/l) were retrospectively matched 1:4 into Me-Is (n = 5) and control (n = 20) groups. Blood samples collected before surgery, on intensive care unit (ICU) admission, and 12 h after ICU admission were assessed for hemostatic parameters, including fibrinogen, D-dimer, thrombin-anti-thrombin complex (TAT), and prothrombin fragments 1 + 2 (F1.2). Thrombin generation assays were conducted on all samples, and intestinal fatty acid-binding protein (I-FABP) was assessed as a marker for Me-Is. Baseline levels of hemostatic markers were similar between the two groups. TAT levels were significantly higher in the Me-Is group 12 h after ICU admission (54.20 ± 10.49 vs. 22.18 ± 12.43 ng/ml, p = 0.010). In contrast, at ICU admission, absolute F1.2 values were higher in the control group (1.19 ± 0.04 vs. 0.49 ± 0.47 ng/ml, p = 0.047). However, increase of F1.2 values of the Me-Is group (394.2 ± 231.6%) vs. the control group (114.7 ± 144.9%) 12 h after ICU admission were 3.9- vs. 1.1-fold compared to baseline (p = 0.046). Postoperatively, higher levels of I-FABP and of D-dimers were observed in the Me-Is group at ICU admission (17116.2 ± 18185.4 vs. 2252.3 ± 1582.7 pg/ml; p = 0.006; and 5.3 ± 1.3 vs. 3.0 ± 2.1 µg/ml; p = 0.043; respectively) and 12 h after ICU admission (16998.2 ± 20346.3 vs. 1030.8 ± 1100.0 pg/ml; p = 0.030; and 3.7 ± 1.8 vs. 1.2 ± 0.8 µg/ml; p = 0.005; respectively) compared to the control group. No significant differences were observed for parameters of thrombin generation (TGA, peak value, ETP) between the two groups. Our findings suggest that TAT and F1.2 levels are promising candidates as markers of coagulability after cardiac surgery. High levels of activation markers suggest a temporary stage of hypercoagulability immediately after surgery in Me-Is patients. Nevertheless, the serial assessment of thrombotic profiles offers valuable mechanistic insights, although these exploratory findings require confirmation in larger cohorts.

Also flagged:cardiovascular diseasesglucosehepatitis B surface antigenCDH2ADGRE2ADGRD1
Journal Article 2025-10-10 No Snippets Iona A, Wang B, Clarke J, Chan K, Kakkoura MG, Clarke C, Wright N, Yao P, Mazidi M, Im PK, Rahmati M, Kartsonaki C, Morris S, Fry H, Millwood IY, Walters RG, Chen Y, Du H, Yang L, Avery D, Schmidt-Valle D, Li F, Yu C, Sun D, Lv J, Hill M, Li L, Clarke R, Bennett DA, Chen Z, China Kadoorie Biobank Collaborative Group.
Show Full Abstract

No abstract available.

HFE
Also flagged:polycystic kidney diseasecystcystsgene expressionPkd1receptor
Journal Article 2025-10-10 ✓ 1 Snippet Yasinoglu SA, Novella-Rausell C, Wisse LE, Dijkstra KL, Mahfouz A, Baelde HJ, Baelde HJ, Peters DJM.
In-Text Gene Mentions

…Sdc1, Csf1r, andHfewere also among…

Show Full Abstract

<h4>Key points</h4>Myofibroblasts and injury repair-related cell types were exclusively observed in polycystic kidney disease and enriched within the cyst microenvironment. Cyst-associated gene signature of 45 genes with decreased expression further away from the cysts was largely related to inflammation. Communication in low-inflamed cystic microdomains related to cellular signaling, morphogenesis, and inflammation in polycystic kidney disease.<h4>Background</h4>Changes in the cyst microenvironment in polycystic kidney disease (PKD) may drive progressive cyst formation. Bulk-cell and single-cell RNA sequencing have advanced our understanding of altered signaling; however, the lack of spatial information has limited our insights into local gene expression and cellular communication near cysts.<h4>Methods</h4>We used wild-type and Pkd1 -deficient mouse kidneys to generate 10× Genomics Visium Spatial Gene Expression datasets. Using our single-cell mouse kidney atlas and single-cell sequencing data for spot deconvolution, we enhanced resolution and estimated enriched cell types. We analyzed spatial gene expression patterns and used a cyst-centered analysis to identify cyst-associated gene signature. Cell communication near cysts was investigated, identifying key ligand-receptors. Prioritized key factors were validated in tissues.<h4>Results</h4>We observed enrichment of fibroblasts, injury repair-related cell types, and diverse immune populations in PKD. Injury repair-related cells were exclusively observed in PKD, predominantly localized within immune cell-dense regions near cysts. These cells collectively contributed to the altered gene expression profile in PKD, including cyst-associated signature genes related to inflammatory processes. Analysis of cellular communication in less-inflamed regions around cysts revealed the involvement of multiple cell types. Key ligand-receptor interactions were associated with cytokine signaling, fibrosis, cellular development, and repair. These included Angpt2 , C3 , Csf1 , Cxcl12 , Il34 , Gas6 , Il16 , Mdk , Mif , Ptn , Sfrp2 , Spp1 , Sdc1 , Tnc , Tnfsf12 , and Wnt5a . In addition, extracellular matrix (ECM) proteins implicated in immune response, ECM remodeling, cell adhesion, and cell signaling were identified, such as Adam9 , Adam10 , Col1a1, Col3a1, Col4a2, Lamb2, Lamc1, Efnb1 , Efnb2 , Thbs1, Thbs2 , and Vcam1 . Immunohistochemistry confirmed expression of Syndecan-1-Collagen IV, Midkine-Integrin β 1, CSF-1, Pleiotrophin, and Tenascin-C in cystic kidneys.<h4>Conclusions</h4>Spatial transcriptomics in PKD revealed enrichment of (myo)fibroblasts, immune, and injury repair-related cells near cysts, creating a (pro)inflammatory and (pro)fibrotic niche. Key ligand-receptor and ECM interactions were identified and validated.

DCC
Also flagged:FrizzledEphrinneuroblasttranscription factorsWntmab-5
Journal Article 2025-10-10 ✓ 1 Snippet Jain VD, Lundquist EA.
In-Text Gene Mentions

…regulated by receptors UNC-40/DCCand PTP-3/LAR, which…

Show Full Abstract

Hox transcription factors are involved in neuronal and neural crest development and differentiation, including migration, but the genetic programs employed by Hox genes to regulate terminal differentiation remain to be defined. In C. elegans, the Antennapedia-like Hox factor MAB-5 is both necessary and sufficient to induce posterior migration of the Q lineage neuroblasts and neurons downstream of canonical Wnt signaling. Q lineage fluorescence-activated cell sorting and RNA seq in mab-5 loss-of-function and gain-of-function backgrounds revealed genes with expression in the Q lineage dependent upon MAB-5. Here, the roles of three mab-5-regulated genes in QL lineage posterior migration are delineated, vab-8/KIF26, lin-17/Fz, and efn-4/Ephrin. Live, time-lapse imaging of QL.a and QL.ap posterior migration revealed that this migration occurs in three distinct stages: QL.a migration posterior to QL.p (1st stage); after QL.a division, posterior migration of QL.ap to a region immediately anterior to the anus (2nd stage); and final migration of QL.ap posterior to the final position where it differentiates into the PQR neuron (3rd stage). vab-8 affected each of the three stages, lin-17 affected stages two and three, and efn-4 was required for the third stage of posterior QL.ap migration. Thus, different MAB-5-regulated genes control distinct stages of posterior migration. mab-20/Semaphorin, a known interaction partner with efn-4, also affected only the third stage similar to efn-4. Suppression of mab-5 gof posterior migration confirmed that these genes act downstream of mab-5 in posterior migration. Possibly, VAB-8/KIF26 helps deliver distinct molecules to the plasma membrane that mediate distinct stages of migration, including LIN-17/Fz and EFN-4. Surprisingly, failure of stages two and three led to the premature extension of a posterior dendritic protrusion, which normally forms after QL.ap had migrated to its final position and PQR differentiation begins. This suggests a link between migration and differentiation, where differentiation is delayed while migration proceeds. In sum, this work delineates a transcriptional program downstream of mab-5/Hox that controls posterior neuroblast migration, in response to Wnt signaling.

HFE
Also flagged:Haemochromatosisironhomeostatic iron regulator proteinhereditary haemochromatosis
Journal Article 2025-10-10 ✓ 3 Snippets Sasidharan A, Kazmi M.
In-Text Gene Mentions

…Early detection oftype 1 haemochromatosis1 haemochromatosis: a…

…iron regulator protein (HFE) genetic screening test…

…test which showedH63D type 1 haemochromatosistype 1 haemochromatosis.…

Show Full Abstract

Haemochromatosis is marked by excessive iron accumulation leading to damage to various organs. Although haemochromatosis dates to 1865, diagnosing the condition remains challenging due to its non-specific symptoms and due to its quiescent course, it often leads to significant delay in recognition. A woman in her 50s who presented with arthralgia was found to have raised transferrin saturation with normal ferritin. She underwent human homeostatic iron regulator protein (HFE) genetic screening test which showed H63D type 1 haemochromatosis. This report aims to draw attention to the pitfalls in diagnosing haemochromatosis as normal ferritin does not exclude hereditary haemochromatosis.

DCC
Also flagged:localizationlocalizationsparaformaldehydeglutaraldehydesodiumborohydride
Journal Article 2025-10-10 ✓ 3 Snippets Hou M, Yang J, Yang M, Hu F, Zhao R, Pan Y, Li W, Chen M, Xu J, Xu K, Pan L.
In-Text Gene Mentions

…11 improves overDCC(Fig. 2b, c…

…h ), whereasDCCand RCC were…

…>100-fold faster thanDCCand >10 4…

Show Full Abstract

Owing to its gradual accumulation of molecular positions, single-molecule localization microscopy (SMLM) depends on the proper correction of sample drifts that occur during data acquisition. However, current data-based drift-correction approaches for SMLM are often unreliable and time-consuming, limiting the achieved resolution and throughput. Here we report nearest paired cloud (NP-Cloud), a fast and robust SMLM drift-correction method. By pairing the nearest molecules in SMLM data segments and calculating their displacements within a small search radius, NP-Cloud efficiently utilizes the continuously valued positions of each super-localized molecule while drastically reducing the computational cost. With both simulated and experimental SMLM data, we thus demonstrate substantially improved robustness and fidelity for drift correction in three dimensions, as well as speeds >100-fold faster over traditional single-referenced approaches and >10<sup>4</sup> faster over traditional cross-referenced redundant approaches. Excellent drift corrections are achieved for diverse samples within seconds. We thus provide a robust, fast, and practical solution to SMLM drift correction.

VRK2
Also flagged:PD-1hepatocellular carcinomaMYCbHLH transcription factordegradationkinase
Journal Article 2025-10-10 ✓ 5 Snippets Su C, Liao Z, Mo J, Liu F, Wang W, Zhang H, Zhang H, Liu Y, Pan Y, Zhu H, Chen X, Zhang Z, Zhu P, Zhang B.
In-Text Gene Mentions

VRK2targeting potentiates anti-PD-…

…we show thatvaccinia-related kinase 2kinase 2 (VRK2)…

…vaccinia-related kinase 2 (VRK2) functions as a…

…This phosphorylation enablesVRK2to compete with…

…The stabilized MYC-VRK2complex amplifies transcriptio…

Show Full Abstract

Dysregulation of MYC proto-oncogene, bHLH transcription factor (MYC) represents a common yet mechanistically unresolved driver of hepatocellular carcinoma (HCC). While MYC remains an elusive therapeutic target, developing strategies to promote its degradation emerges as a promising alternative approach. Here we show that vaccinia-related kinase 2 (VRK2) functions as a direct MYC-interacting kinase that stabilizes the oncoprotein through phosphorylation at Serine (Ser)281/293. This phosphorylation enables VRK2 to compete with the Skp1-Cullin-F-box protein complex containing FBXO24 (SCF-FBXO24) E3 ligase, thereby blocking MYC polyubiquitination and proteasomal degradation. The stabilized MYC-VRK2 complex amplifies transcriptional activation of protumorigenic programs, including the immune checkpoint programmed cell death ligand 1 (PD-L1) and VRK2 itself, establishing a self-reinforcing oncogenic circuit. Therapeutic inhibition of VRK2 in HCC models reduces MYC protein levels, suppresses tumor progression, and synergizes with anti- programmed cell death-1 (PD-1) immunotherapy. Our results reveal VRK2-mediated stabilization of MYC as a critical nexus linking hepatocarcinogenesis to immune evasion, proposing VRK2 kinase inhibition as a mechanism-based therapeutic strategy for MYC-driven HCC.

Also flagged:adolescent idiopathic scoliosisgenetic disordermusculoskeletal disordersRYR1extracellulargene expression
Journal Article 2025-10-10 No Snippets Tuncay IO, Lee EK, Gustafson A, Lee Y, Jung D, Koh JY, Lee W, Lee S, Shazand K.
Show Full Abstract

Adolescent idiopathic scoliosis (AIS) is a complex genetic disorder. This study used whole-genome sequencing (WGS) to investigate the genetic basis of AIS in 119 patients from 103 families. Our WGS analysis identified known pathogenic or protein-truncating variants in 15 probands, and other strong or moderate candidate variants in 69 additional patients. We found both coding and non-coding mutations, including structural variants. Candidate genes included known AIS genes (e.g., COL11A2, FBN1) and genes linked to other musculoskeletal disorders with scoliosis (e.g., RYR1). Association analysis confirmed four known AIS single-nucleotide polymorphisms in our cohort. Gene set enrichment analysis revealed four gene clusters related to skeletal muscle contraction, extracellular matrix, and gene expression regulation. This WGS-based approach identified clinically relevant genetic variations and biological pathways in AIS patients, offering valuable insights into its complex development.

CCPG1
Also flagged:ATG16L1FIP200ATG8Macroautophagysynthesis-
Journal Article 2025-10-10 ✓ 2 Snippets Gong X, Zhou Y, Wang Y, Tang Y, Liu H, Zhou X, Zhang Y, Guo H, Guo Z, Pan L.
In-Text Gene Mentions

…p62, NBR1, Optineurin,CCPG1, NDP52, and TAX1BP1,…

…of NAP1, SINTBAD,CCPG1, NDP52, p62, NBR1,…

Show Full Abstract

Macroautophagy maintains cellular and organismal homeostasis, and entails de novo synthesis of double-membrane autophagosome. The effective formation of autophagosome requires the recruitment of the ATG12~ATG5-ATG16L1 complex to the pre-autophagosomal structure by relevant ATG16L1-binding autophagic factors including FIP200. However, the molecular mechanism governing the specific interaction of ATG16L1 with FIP200 remains elusive. Here, we uncover that ATG16L1 contains a FIP200-interacting region (FIR), which not only can directly bind FIP200 Claw domain, but also can serve as an atypical ATG8-interacting motif to selectively recognize mammalian ATG8 family proteins (ATG8s). We determine the high-resolution crystal structures of ATG16L1 FIR in complex with FIP200 Claw and GABARAPL1, respectively, and elucidate the molecular mechanism underlying the interactions of ATG16L1 with FIP200 and ATG8s. To distinguish the precise contribution of FIP200 from ATG8s for binding to ATG16L1 FIR in autophagy, we develop a ATG16L1 mutant that can exclusively interact with ATG8s but not FIP200. Finally, using relevant cell-based functional assays, we demonstrate that the interaction of ATG16L1 with FIP200 is indispensable for the effective autophagic flux. In conclusion, our findings provide mechanistic insights into the interactions of ATG16L1 with FIP200 and ATG8s, and are valuable for further understanding the function of ATG16L1 in autophagy.

Also flagged:Non-small cell lung cancerNSCLCprogrammed death 1tumorCD4PD-1
Journal Article 2025-10-10 No Snippets Aung TN, Monkman J, Warrell J, Vathiotis I, Bates KM, Gavrielatou N, Trontzas IP, Tan CW, Fernandez AI, Moutafi M, O' Byrne K, Schalper KA, Syrigos K, Herbst RS, Kulasinghe A, Rimm DL.
Show Full Abstract

Non-small cell lung cancer (NSCLC) shows variable responses to immunotherapy, highlighting the need for biomarkers to guide patient selection. We applied a spatial multi-omics approach to 234 advanced NSCLC patients treated with programmed death 1-based immunotherapy across three cohorts to identify biomarkers associated with outcome. Spatial proteomics (n = 67) and spatial compartment-based transcriptomics (n = 131) enabled profiling of the tumor immune microenvironment (TIME). Using spatial proteomics, we identified a resistance cell-type signature including proliferating tumor cells, granulocytes, vessels (hazard ratio (HR) = 3.8, P = 0.004) and a response signature, including M1/M2 macrophages and CD4 T cells (HR = 0.4, P = 0.019). We then generated a cell-to-gene resistance signature using spatial transcriptomics, which was predictive of poor outcomes (HR = 5.3, 2.2, 1.7 across Yale, University of Queensland and University of Athens cohorts), while a cell-to-gene response signature predicted favorable outcomes (HR = 0.22, 0.38 and 0.56, respectively). This framework enables robust TIME modeling and identifies biomarkers to support precision immunotherapy in NSCLC.

B4GALT5
Also flagged:interferonhypomethylationlipidmetabolismIFNtranscription factors
Journal Article 2025-10-10 ✓ 2 Snippets Park B, Nicaise AM, Tsitsipatis D, Pirvan L, Zucha D, Munteanu A, Prasad P, De Novales MLL, Bulgaru C, Kollyfas R, Whitten J, Willis CM, Culig L, Llewellyn J, Ionescu RB, Mekdad M, Simões-Abade MBC, Krzak G, Fan J, De S, Ellis MO, Cubero MS, Spathopoulou A, Peruzzotti-Jametti L, Leonardi T, Balmus G, Edenhofer F, Gorospe M, Valihrach L, Mohorianu I, Pluchino S, Beerman I.
In-Text Gene Mentions

…used ISG15 ,B4GALT5, IFITM3 ,…

…genes ISG15 ,B4GALT5, IFITM3 ,…

Show Full Abstract

Progressive multiple sclerosis (PMS) involves a persistent, maladaptive inflammatory process with numerous cellular drivers. We generated induced neural stem cells (iNSCs) from patient fibroblasts through a direct reprogramming protocol that preserved their epigenome, which revealed a PMS-specific hypomethylation of lipid metabolism and interferon (IFN) signaling genes. Single-cell multi-omics uncovered a novel, disease-associated radial glia-like cell (DARG) subpopulation in PMS cell lines exhibiting senescence and potent IFN responsiveness driven by specific transcription factors. Functionally, PMS iNSCs induced paracrine senescence and inflammation onto control cells, which was inhibited upon senolytic treatment. We identified in PMS brains a distinct population of senescent, IFN-responsive DARGs that developmentally aligned with the trajectories of iNSCs in vitro and spatially associated with inflammatory glia in chronically active lesions. DARGs may sustain smoldering inflammation, unveiling a previously unrecognized cellular axis that could underpin mechanisms in neurodegeneration. This discovery offers novel insights into disease mechanisms and highlights potential therapeutic targets.

Also flagged:prostate cancertumorcancerandrogenandrogen receptorpathogenesis
Journal Article 2025-10-10 No Snippets Chi Z, Zhang Y, Hong X, Yang T, Xu Q, Lin W, Huang Y, Zhang Y.
Show Full Abstract

<h4>Background</h4>Prostate cancer, a major global health issue for men, remains a critical clinical challenge in treatment, highlighting the need for improved biomarkers. Treatment options for prostate cancer include active surveillance, surgery, endocrine therapy, chemotherapy, radiotherapy, immunotherapy, etc. However, as the tumor progresses, the effectiveness of treatment regimens gradually decreases. Therefore, we need to understand the biological mechanisms that promote prostate cancer tumorigenesis and progression and to screen biomarkers for diagnosis and prediction of prognosis.<h4>Methods</h4>We utilized the expression profiles of prostate cancer from The Cancer Genome Atlas (TCGA) database and employed weighted gene co-expression network analysis (WGCNA) to construct a gene interaction network. Gene co-expression networks were constructed using WGCNA (soft-threshold power β = 10, scale-free R² > 0.9), with differential correlations computed via Fisher's <i>z</i>-test (FDR < 0.05). We used the "DiffCorr" package to discriminate between tumor and adjacent normal tissues to identify genes with differential representation in tumor and normal tissues, and perform in-depth analysis of these genes.<h4>Results</h4>Through WGCNA analysis, we identified a total of 20 modules, three gene modules were significantly associated with prostate cancer. We then analyzed the genes in these modules separately by the "DiffCorr" package and intersected these with differentially expressed genes. Finally, 21 genes were screened as biomarkers for prostate cancer.<h4>Conclusions</h4>Our study unveils a prostate cancer tumorigenesis mechanism by identifying differentially correlated gene pairs during normal-to-tumor transformation. We believe that the biomarkers derived from this algorithm have important reference implications for future research in prostate cancer.

HFE
Also flagged:Pulmonary fibrosislung diseaseextracellularlung diseasesCD44CD73
Journal Article 2025-10-10 ✓ 1 Snippet Wang X, Liu X, Fan Y, Tan K, Gao J, Wang Y, Zhang Z, Liu S, Wang X, Wang B, Cao P.
In-Text Gene Mentions

…Tfr2 mutations orHfedeficiency exhibit enhanced…

Show Full Abstract

Pulmonary fibrosis (PF) involves persistent activation of fibroblasts and excessive deposition of extracellular matrix, with limited therapeutic options. Pulmonary iron overload has been identified in PF and is associated with the progression of PF. However, the underlying signaling pathway remains unclear. This study demonstrated that iron accumulates in the mouse lung from day 7 post-bleomycin (BLM) instillation until harvest, coinciding with the activation of pulmonary fibroblasts and the onset of fibrogenesis. Iron supplementation promoted the G<sub>1</sub>/S cell cycle transition and proliferation of fibroblasts, and worsened PF, whereas iron deficiency demonstrated the opposite effects. Mechanistically, both iron and reactive oxygen species (ROS) suppress Forkhead box F1 (FOXF1) expression. FOXF1 overexpression upregulates the expression of antioxidant proteins, including ferredoxin 1 (FDX1) and heme oxygenase-1 (HO-1). Both FOXF1 overexpression and FDX1 overexpression reduced cellular labile iron pool (LIP), ROS levels, and collagen synthesis in human pulmonary fibroblasts. Sonic hedgehog (SHH) signaling elevated intracellular iron, fibroblast proliferation, and its own secretion, establishing a sustained SHH/iron amplifying loop. These findings identify an iron/ROS-FOXF1 positive feedback loop and an SHH-iron self-promoting pathway that drive sustained elevated iron levels and persistent fibroblast activation and fibrogenesis, thereby deepening our understanding of the iron signaling in PF.

Also flagged:detoxificationironalcoholdrug-induced liver injuryDILIalcohol-associated liver disease
Journal Article 2025-10-10 No Snippets Hemmati N, Anoush M, Kiasari BA, Torkamani A.
Show Full Abstract

Hepatotoxicity is a global health problem with a scarcity of treatment modalities that can reverse extensive liver injury. The liver's central role in detoxification, iron regulation, and redox balance makes it highly vulnerable to toxic, metabolic, and inflammatory insults. Ferroptosis, an iron-dependent form of regulated cell death, has emerged as a key mechanism linking oxidative stress, disrupted iron homeostasis, and hepatocellular injury Ferroptosis differs from apoptosis or necroptosis since it entails metabolic frailties of the glutathione-GPX4 system, the FSP1-CoQ10 system, and the BH4/DHFR system with peroxidation failure-prone lipid remodeling processes. Notably, growing evidence implicate ferroptosis in a number of hepatic disorders, including drug-induced liver injury, alcoholic and non-alcoholic liver disease, ischemia-reperfusion injury, and non-alcoholic steatohepatitis. Beyond acute death of hepatocytes, chronic ferroptotic signaling also enhances fibrogenesis and accelerates cirrhosis and hepatocellular carcinoma, and viral hepatitis exploits ferroptotic mechanisms via iron imbalances and oxidative stress. Acting both sides of this coin, pathogenic catalyst of parenchymal disease and therapeutic target of malignancy, puts ferroptosis both as a liability and a target. New therapeutic modalities, including natural products, synthetic small molecules, mesenchymal stem cell derivatives, and nanoparticle systems, modulate ferroptotic signaling to enhance antioxidant defenses, restore iron balance, or selectively induce tumor cell death. Collectively, these strategies underscore the translational promise of ferroptosis-based interventions. This review integrates mechanistic insights with emerging therapies, positioning ferroptosis as a context-dependent driver of hepatotoxicity and a compelling target for precision liver medicine.

Also flagged:AMPA receptorssynapseSynapsessynapticligand-gated ion channelsdepolarization
Journal Article 2025-10-10 No Snippets Francis F, Chettri D, Nair D.
Show Full Abstract

Synapses, once considered static conduits for neuronal signals, are now recognized as dynamic, multifunctional structures critical to brain function, plasticity, and disease. This evolving understanding has highlighted the tripartite nature of synapses, including pre-synaptic terminals, post-synaptic compartments, and regulatory glial elements. Among excitatory synapses, glutamatergic transmission dominates, with AMPA receptors (AMPARs) playing a central role in fast synaptic signaling. AMPARs are tetrameric, ligand-gated ion channels that mediate rapid depolarization and are tightly regulated by subunit composition, trafficking, and interactions with scaffolding and signaling proteins. Their activity-dependent modulation underpins key processes such as long-term potentiation and depression, central to learning and memory. Importantly, dysfunctions in AMPAR expression, localization, or signaling are increasingly linked to neurological and psychiatric disorders including autism spectrum disorders, epilepsy, schizophrenia, and Alzheimer's disease. This review discusses AMPAR biology in the context of synaptic organization, highlighting recent advances and ongoing challenges in understanding their roles in health and disease.

DCC
Also flagged:Malign melanomaskin cancerscancertumornevusmembranes
Journal Article 2025-10-10 ✓ 1 Snippet Ekinci B, Erdogdu IH, Orenay-Boyacioglu S, Boyacioglu O, Kahraman-Cetin N, Akin D, Turan M, Tataroglu C.
In-Text Gene Mentions

Tumor suppressor gene PTENsuppressor gene PTEN…

Show Full Abstract

<h4>Introduction</h4>Skin cancer is a highly heterogeneous disease affecting substantial geriatric individuals. Therefore, understanding gene variants and their presence in geriatric and adult skin cancer patient groups is valuable for the improvement of healthcare policies. The somatic variation profile in geriatric patients diagnosed with malignant melanoma (MM) was examined retrospectively by comparing them to the younger cases to reveal the clinical importance of the panel tests.<h4>Methods</h4>The study included all adult MM patients referred to Molecular Pathology Laboratory from Oncology Clinic between 2019 and 2023. The patients (<i>n</i> = 103) were chronologically divided into geriatric (≥65) and adult (<65 years) groups. The results of targeted next generation sequencing panel studied with probe-capture method were evaluated retrospectively.<h4>Results</h4>Among the study cohort, 58 (56.31%) were male, 45 (43.69%) were female, and also 55 were in the geriatric age group, 48 were in the adult group with an overall mean age of 63.30 years. The most commonly encountered pathogenic variants in the geriatric MM group were <i>BRAF</i> V600E (14.55%) and V600K (7.27%) variants in Exon 15 followed by <i>NRAS</i> (9.09%), <i>NF1</i> (9.09%), <i>KIT</i> (5.45%), <i>KRAS</i> (5.45%), <i>CDKN2A</i> (3.64%), and <i>PTEN</i> (3.63%). In the adult MM group, the most common pathogenic variants were <i>BRAF</i> V600E (39.58%) and V600K (8.33%) followed by <i>NRAS</i> (14.58%), <i>NF1</i> (8.33%), <i>PTEN</i> (8.33%), <i>BRCA2</i> (8.33%), and <i>TP53</i> (4.17%).<h4>Conclusions</h4>Delineating the distribution of somatic variations in geriatric MM cases holds significant importance in the development of healthcare policies. These data are the first reported findings from Türkiye.

FBXL4
Also flagged:mitochondrialDNA depletion syndromelactic acidosisdevelopmental delaypneumoniabacterial infection
Journal Article 2025-10-10 ✓ 5 Snippets Akiba T, Shimada S, Matsuda S, Ishida S, Baba Y, Yamashita A, Shoji H, Okazaki Y, Murayama K.
In-Text Gene Mentions

…Siblings ofFBXL4-related mitochondrial DNA dep…

…DNA depletion syndrome (FBXL4-MTDPS), characterized by lact…

…siblings diagnosed withFBXL4-MTDPS who died of…

FBXL4-MTDPS may involve intrinsic…

…TheF-box and leucine-rich repeat protein 4and leucine-rich repeat…

Show Full Abstract

The F-box and leucine-rich repeat protein 4 (<i>FBXL4</i>) is a nuclear encoded mitochondrial protein essential for mitochondrial DNA (mtDNA) maintenance. Biallelic variants in <i>FBXL4</i> cause FBXL4-related mitochondrial DNA depletion syndrome (FBXL4-MTDPS), characterized by lactic acidosis and developmental delay. We report two siblings diagnosed with FBXL4-MTDPS who died of fulminant pneumonia in infancy; autopsy revealed extensive pulmonary inflammation consistent with severe bacterial infection. FBXL4-MTDPS may involve intrinsic defects in pulmonary infection defense, increasing susceptibility to fatal infection such as pneumonia.

HTT
Also flagged:ALSHMGCRACTR2MYD88PTENEP300
Journal Article 2025-10-10 ✓ 1 Snippet De La Cerna JLO, Talubo NDD, Villanueva BHA, Tsai PW, Tayo LL.
In-Text Gene Mentions

…expansion in theHTTgene, which leads…

Show Full Abstract

<b>Background/Objectives</b>: Neurodegenerative diseases (NDs) such as Alzheimer's (AD), Parkinson's (PD), Huntington's (HD), and Amyotrophic Lateral Sclerosis (ALS) are clinically distinct but share overlapping molecular mechanisms. <b>Methods:</b> To identify conserved systemic signatures, we analyzed blood RNA-Seq datasets using Weighted Gene Co-Expression Network Analysis (WGCNA), differential expression, pathway enrichment, and miRNA-mRNA network mapping. <b>Results:</b> Two modules, the red and turquoise, showed strong preservation across diseases. The red module was enriched for cytoskeletal and metabolic regulation, while the turquoise module involved immune, stress-response, and proteostatic pathways. <b>Discussion:</b> Key hub genes, such as HMGCR, ACTR2, MYD88, PTEN, EP300, and regulatory miRNAs like miR-29, miR-132, and miR-146a, formed interconnected networks reflecting shared molecular vulnerabilities. The absence of classical heat shock proteins in preserved blood modules highlights tissue-specific expression differences between blood and neural systems. Several hub genes overlap with known pharmacological targets, suggesting potential in translational relevance. <b>Conclusions:</b> Together, these findings reveal conserved blood-based transcriptional modules that suggest parallel central neurodegenerative processes and may support future biomarker development and possible therapeutic exploration.

HFE
Also flagged:Cardiomyopathiesdiseases of the myocardiumarrhythmiasconduction disordersryanodine receptorscardiomyopathy
Journal Article 2025-10-10 ✓ 1 Snippet Thiene G, Rizzo S, Basso C.
In-Text Gene Mentions

…storage occurs inhemochromatosis( Figure 9…

Show Full Abstract

Cardiomyopathies are a heterogeneous group of diseases of the myocardium associated with dysfunction, with or without a structural substrate. They are frequently genetically determined. The dysfunction may be mechanical, both of the systole and diastole, or electrical, including arrhythmias or conduction disorders. Originally, only dilated, hypertrophic, restrictive-obliterative and arrhythmogenic dysfunctions were considered cardiomyopathies. Nowadays, since dysfunction can also be electric, disorders affected by electrical dysfunction without a structural substrate can be regarded as cardiomyopathies as well. This is the case of channellopathies and ryanodine receptors. This paper is a review of the history of cardiomyopathies, including the issues of their classification and nomination, genetic background and gene therapy.

UNC13CDCC
Also flagged:Oral Squamous Cell CarcinomaOSCCOral canceralcoholviral infectionstumors
Journal Article 2025-10-10 ✓ 3 Snippets Lopez-Gomez J, Cerrato-Izaguirre D, Quezada-Maldonado EM, Gaitan-Cepeda LA, Salcedo M, Hernandez-Castillo MA, Granados-García M, Sánchez-Pérez Y, García-Cuellar CM.
In-Text Gene Mentions

…, ARID2 ,UNC13C, and TRPM3…

…, BIRC6 ,DCC, and NCOR1…

…BIRC6 (apoptosis inhibition),DCC(neural regulation and…

Show Full Abstract

Oral squamous cell carcinoma (OSCC) is one of the most common malignancies affecting the head and neck and account for over 90% of all oral cancers (1) [...].

SUDS3
Also flagged:AspirinEugenolEndothelial FerroptosisJNKoxygenlipid
Journal Article 2025-10-10 ✓ 1 Snippet Feng J, Tao Q, Zhang ZJ, Yu QF, Yang YJ, Li JY.
In-Text Gene Mentions

…treatment, including theAP-1 adaptor complexadaptor complex, clathrin…

Show Full Abstract

Oxidative stress occurs within bovine when exposed to harmful stimuli, accompanied by substantial accumulation of reactive oxygen species. Without timely clearance, these reactive oxygen species attack vascular endothelial cells, concurrently inducing extensive production of lipid peroxides within the vascular endothelium, and thereby triggering ferroptosis. Aspirin eugenol ester (AEE) showed pharmacological activity against oxidative stress-induced vascular endothelial damage. However, whether it could alleviate vascular endothelial damage by inhibiting ferroptosis remains unclear. This study aimed to evaluate the effects of AEE on vascular endothelial ferroptosis and elucidate its underlying molecular mechanisms. This study established vascular endothelial damage models in vitro and in vivo to explore the ability of AEE to inhibit ferroptosis and oxidative stress by measuring ferroptosis- and oxidative stress-related biomarkers. Transcriptomic and network pharmacology analyses were performed to identify AEE-regulated pathways and key targets. Validation of the pathways were conducted using molecular docking, cellular thermal shift assay, and specific protein agonists/inhibitors. AEE inhibited oxidative stress and ferroptosis in bovine aortic endothelial cells induced by hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) or RSL3 via suppressing the upregulation of ferroptosis-related genes and enhancing the expression of antioxidant genes. Transcriptomic and network pharmacology analyses identified JNK as a core target of AEE in regulating ferroptosis. JNK agonists enhanced H<sub>2</sub>O<sub>2</sub>-induced ferritinophagy; on the contrary, JNK inhibitors alleviated it. AEE suppressed H<sub>2</sub>O<sub>2</sub>-induced phosphorylation of JNK/c-Jun and ferritinophagy. In a carrageenan-induced rat aortic vascular endothelial damage model, AEE alleviated vascular endothelial damage and ferroptosis-related gene changes, promoted antioxidant gene expression, and inhibited JNK/c-Jun phosphorylation and ferritinophagy. AEE inhibited vascular endothelial ferroptosis by enhancing antioxidant ability, blocking downstream ferritinophagy, and reducing ferrous ion release.

Also flagged:Glucosylceramideglycosphingolipidceramidelipidlysosomal storage disordersGaucher disease
Journal Article 2025-10-10 No Snippets Zhao X, Pandey MK.
Show Full Abstract

Glucosylceramide (GlcCer), a central glycosphingolipid derived from ceramide, is increasingly recognized as a bioactive lipid that intersects with key metabolic, inflammatory, and oncogenic pathways. While its dysregulation has long been associated with lysosomal storage disorders such as Gaucher disease (GD), growing evidence implicates GlcCer in cancer initiation and progression, particularly within tumor-predisposing conditions. GlcCer modulates membrane microdomains, intracellular trafficking, and cell signaling, counteracting ceramide-induced apoptosis and promoting cellular survival. In cancer, aberrant upregulation of UDP-glucose ceramide glucosyltransferase (UGCG), the enzyme responsible for GlcCer synthesis, drives tumor growth, metastasis, and multidrug resistance through activation of pathways such as phosphoinositide 3-kinase/protein kinase B (PI3K/Akt), mitogen-activated protein kinase (MAPK), canonical Wnt pathway (Wnt/β-catenin), and nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) pathways. Specific GlcCer species (e.g., C16:0, C18:0, C24:1) display tissue-dependent functions, adding structural specificity to their oncogenic potential. Moreover, emerging links between GlcCer metabolism and chronic inflammation, oxidative stress, and altered glucose utilization highlight its role as a metabolic node bridging inherited metabolic disorders and malignancy. This review integrates recent advances in GlcCer biology, emphasizing its roles in tumor-predisposing diseases and exploring its potential as a biomarker and therapeutic target in oncology.

Also flagged:Ion ChannelsCancernoncommunicabletumorion channelmembrane
Journal Article 2025-10-10 No Snippets Zhou S, Song X, Zeng W, Chen D.
Show Full Abstract

Cancer remains a major global health burden, representing one of the leading causes of mortality among noncommunicable diseases worldwide. Although conventional treatment modalities, including surgical resection, chemotherapy, radiotherapy, targeted therapy, and immunotherapeutic interventions, have demonstrated clinical benefits, their therapeutic efficacy is often constrained by inherent limitations such as low specificity, systemic toxicity, or tumor heterogeneity. These challenges underscore the imperative for developing innovative treatment strategies. Emerging evidence has implicated ion channels as critical players in oncogenesis and cancer progression. These proteins modulate diverse oncogenic phenotypes, including uncontrolled proliferation, metastatic dissemination, and apoptotic resistance. Their frequent dysregulation in malignancies correlates with disease aggressiveness and clinical outcomes, positioning them as promising targets for precision oncology. Notably, pharmacological modulation of ion channels exerts multifaceted antitumor effects, with several channel-targeting agents advancing through clinical trials. This review explores recent advances in ion channel-targeted therapies, emphasizing their mechanisms, clinical applications, and challenges. Furthermore, we examine the pathophysiological contributions of ion channels to tumor biology and evaluate their emerging utility as predictive biomarkers, providing perspectives on addressing critical gaps in current oncologic management.

HFE
Also flagged:Metabolic syndromecentral obesityhypertensiondyslipidemiahyperglycemiatype 2 diabetes
Journal Article 2025-10-10 ✓ 5 Snippets Hu Z, Liu H, Wang Z, Zang J, Wu F, Zhu Z.
In-Text Gene Mentions

…Iron Regulator (HFE), located on…

…Dysregulation ofHFEdisrupts iron homeostasis,…

…located near theHFEgene, has been…

…proximity to theHFEgene—a central regulator…

…upstream of theHFEgene [ 21…

Show Full Abstract

<b>Background:</b> Metabolic syndrome, a cardiovascular risk cluster, is recognized as a global health priority influenced by gene-diet interactions. The rs2794720 polymorphism has not been previously reported in relation to metabolic syndrome. This study examined the associations between dietary iron, SNP rs2794720, and metabolic syndrome in Chinese metropolitan population, with a focus on sex-specific and genotype-specific effects. <b>Methods:</b> A community-based cross-sectional study enrolled 2639 adults (1254 males, 1385 females) from Shanghai, China. Anthropometric measurements, laboratory analyses, and genotyping for the participants were performed. Dietary assessment utilized the 3-day 24 h dietary recall method. Metabolic syndrome was identified by the presence of at least three out of five metabolic abnormalities according to the NCEP-ATP III criteria. <b>Results:</b> After adjusting for confounders, in males, metabolic syndrome risk was associated with dietary iron (<i>p</i> = 0.002) but not with rs2794720 (<i>p</i> = 0.731). In females, metabolic syndrome risk was associated with rs2794720 (<i>p</i> = 0.014) and dietary iron (<i>p</i> = 0.016), with a significant interaction observed between rs2794720 and dietary iron (<i>p</i> = 0.047). Stratified by rs2794720, among females lacking the C allele, there was a linear trend between dietary iron and metabolic syndrome risk (<i>p</i> = 0.048). Compared to the reference group (lowest-intake GG homozygotes), the Q2-Q4 Ors (95% CI) were 5.31 (1.08, 39.52), 5.50 (1.16, 40.28), and 8.40 (1.80, 41.44)), while the major allele carriers did not show this trend (<i>p</i> = 0.704); compared to the reference group, the Q1-Q4 ORs(95% CI) were 6.13 (1.68, 39.66), 7.53 (2.06, 48.86), 8.10 (2.20, 52.60), and 7.84 (2.07, 51.70)). <b>Conclusions:</b> Our study first identified rs2794720 as a novel SNP associated with metabolic syndrome in Chinese females. The association between dietary iron and metabolic syndrome risk was unique to GG homozygotes (the minority), whereas CC/CG genotypes (the majority) showed no such association.

Also flagged:Monocalciummonocalcium phosphatehydroxyapatitePhosphatefertilizationwater
Journal Article 2025-10-10 No Snippets Kowalski Z, Wilkosz-Język A, Makara A.
Show Full Abstract

The study presents a developed process for producing monocalcium phosphate from hydroxyapatite ash, a by-product of meat-bone meal incineration. The process integrates technological and environmental synergies, enabling efficient recycling of both materials and energy. Waste hydroxyapatite ash, obtained as an intermediate by-product of the meat-bone meal process, is converted into high-quality monocalcium phosphate. Furthermore, waste heat from incineration is recovered, improving energy efficiency and reducing costs. Preliminary economic analysis indicates that the process is highly profitable, with an annual production capacity of 21,700 tons at a cost of $924 per ton, compared to a market price of $1400 per ton. The total production cost is estimated at $20,058,947, while total sales are projected to reach $30,380,000, yielding a profit of $10,321,053 (34% profit margin). The proposed method is consistent with the principles of the Circular Economy and Cleaner Production, promoting sustainability by reducing waste, lowering resource consumption, and enhancing energy efficiency. The developed technology is both environmentally friendly and economically viable, offering a promising pathway for efficient monocalcium phosphate production and a blueprint for industrial-scale implementation.

HFE
Also flagged:DeliriumPODalcoholhepatic encephalopathyModel for End-Stage Liver DiseaseIL-6
Journal Article 2025-10-10 ✓ 1 Snippet Roberts WS, Mittal V, Ryan MN, Knight AD, Schaffer S, Clifford A, Ouanes JP.
In-Text Gene Mentions

…epatocellular carcinoma (HCC),hemochromatosisand the resulting…

Show Full Abstract

Postoperative delirium (POD) is one of the most common psychiatric and neurologic complications experienced by patients undergoing general anesthesia. While it is widely hypothesized that hepatic impairment is associated with POD, the increased risk that various forms of preoperative hepatic impairment contribute to the development of POD is not well defined in the literature. A database search was performed on Embase, Web of Science, and MEDLINE-PubMed searching for articles containing keywords regarding the association between hepatic impairment and POD, ultimately yielding 34 studies for inclusion. Adjusted odds ratios (ORs) were extracted, with two-sided p-values <0.05 deemed significant. A total of 12,089 patients were included in this review, of which 2,663 developed POD (overall incidence of 22.03%). Inverse variance random-effects meta-analysis reveals that history of alcohol consumption (OR: 2.59, 1.85 - 3.64, p<0.0001), history of hepatic encephalopathy (OR: 3.42, 2.25 - 5.19, p<0.0001), and a MELD (Model for End-Stage Liver Disease) score ≥15 (OR 3.73, 1.93 - 7.20, p<0.0001) are independent risk factors for POD. Elevated serum IL-6 and total bilirubin did not reach significance as risk factors. Based on our findings, a medical history of known hepatic pathology potentially increases a patient's risk for POD. However, our study did not implicate any specific biomarkers as predisposing risk factors for POD but rather their indicated summative hepatic influence in the form of a MELD score.

Also flagged:Flavonoidsphenolic compoundsmitochondrialneurodegenerative diseasesflavonoidquercetin
Journal Article 2025-10-10 No Snippets Şahin TÖ, Cemali Ö, Özdemir M, Ayten Ş, Ağagündüz D.
Show Full Abstract

<h4>Background/aim</h4>Neurodegenerative diseases such as Alzheimer's, Parkinson's, Huntington's, and ALS are characterized by a progressive loss of nerve cells, for which no definitive cure currently exists. These conditions share common pathological mechanisms, including chronic neuroinflammation, oxidative stress, protein aggregation, and mitochondrial dysfunction. Flavonoids and other plant-derived phenolic compounds have recently attracted attention for the treatment of such conditions due to their antiinflammatory and antioxidant properties. This review explores the neuroprotective mechanisms of flavonoids and evaluates their potential for the prevention and treatment of neurodegenerative diseases.<h4>Materials and methods</h4>A literature search of the Web of Science, PubMed, and ScienceDirect databases was conducted to evaluate the therapeutic potential of flavonoids and phenolic compounds against neurodegenerative diseases. The search terms included "polyphenols", "flavonoids", and related compounds, along with "Alzheimer's", "Parkinson's", "Huntington's", and "Amyotrophic lateral sclerosis". Eligible studies included clinical trials, randomized controlled trials, and in vitro and in vivo research published in English. Priority was given to studies from the last decade, although older but significant publications were also included.<h4>Results</h4>The findings of multiple studies report the ability of flavonoid compounds such as quercetin, myricetin, apigenin, and epigallocatechin gallate (EGCG) to modulate critical signaling pathways, reduce oxidative stress, prevent the accumulation of neurotoxic proteins, and support mitochondrial function. These bioactive molecules have exhibited significant potential in slowing disease progression and preserving neuronal integrity. Their therapeutic application, however, has been limited by their poor bioavailability, low stability, and rapid metabolism.<h4>Conclusion</h4>Flavonoids have shown promise as naturally derived agents with multi-targeted activity against neurodegenerative processes. Enhancing their absorption and stability through novel delivery systems and structural modifications could significantly improve their clinical efficacy. When administered early or as a complementary therapy, flavonoids can be considered a safe and effective approach to the management of neurodegenerative diseases.

Also flagged:breast cancercell migrationSOX2extracellularorganizationTIMP2
Journal Article 2025-10-10 No Snippets Urbaniak A, Heflin B, Siegel ER, Seale D, Reed MR, Nix JS, Yee EU, Jędrzejczyk M, Klejborowska G, Stępczyńska N, Huczyński A, Nagalo BM, Chambers TC, Post SR, Eoff RL, MacNicol MC, Tiwari AK, Kelly T, Tackett AJ, MacNicol AM.
Show Full Abstract

Monensin (<b>MON</b>) is a polyether ionophore antibiotic of natural origin and is an FDA-approved drug for veterinary use. Recent studies have highlighted its potential anticancer activity in various <i>in vitro</i> and <i>in vivo</i> models. In this study, we evaluated the anti-breast cancer activity of <b>MON</b> and 37 synthetic analog compounds using cell monolayer and organoid models. Through a mini-ring cell viability assay, several compounds were identified that were more potent and selective against breast cancer cells compared to non-cancerous cells, surpassing the activity of parent <b>MON</b>. <b>MON</b> and these compounds induced significant DNA fragmentation, reduced cell migration, and downregulated SOX2 expression. Furthermore, <b>MON</b> and the most potent analog, compound <b>12</b>, reduced the percentage of CD44<sup>+</sup>/CD24<sup>-/low</sup> stem-like cells and diminished colony formation properties. Proteomics analyses revealed that several pathways, including extracellular matrix organization, were significantly dysregulated by <b>MON</b> and compound <b>12</b> in breast cancer cells. Among these, TIMP2, a protein associated with the suppression of tumor growth and metastasis, was identified as one of the most prominently upregulated proteins by <b>MON</b> and compound <b>12</b> in MDA-MB-231 cells. This finding was also validated in other breast cancer and melanoma cell lines. To simulate breast cancer metastasis to the brain, a human hybrid organoid system: tumor in brain organoid (HOSTBO) model was developed. <b>MON</b> and compound <b>12</b> significantly reduced Ki-67 expression within the HOSTBOs, and compound <b>12</b> significantly downregulated SOX2 expression. Collectively, <b>MON</b> and compound <b>12</b> significantly reduced the proliferation of breast cancer stem-like cells in the organoid models, inhibited their migration, and dysregulated markers associated with stemness, demonstrating their potential as anti-metastatic agents and warranting further clinical development.

Research Square 2025-10-10 Preprint (No Snippets API) Castilla-Silgado J, Perez-Oliveira S, Pinto-Hernandez P, Fernandez-Sanjurjo M, Corte-Torres MD, Iglesias-Gutierrez E, Menendez-Gonzalez M, Alvarez V, Tomas-Zapico C.
Show Full Abstract

<title>Abstract</title> <p> Background Late-onset Alzheimer´s disease (LOAD) is a heterogenous disorder influenced by genetic factors. In fact, we have previously described intermediate alleles ( <italic>IAs</italic> ) in the huntingtin ( <italic>HTT</italic> ) gene as potential modifiers in around 6% of AD population. The caudate nucleus, the most affected region in Huntington's disease, is highly sensitive to these <italic>HTT</italic> CAG expansions, as they can induce epigenetic changes, including altered microRNA profiles. All this implies a potential source of gene expression deregulation, affecting disease onset and/or progression in LOAD patients with <italic>HTT IAs</italic> . Methods We investigated the impact of <italic>HTT IAs</italic> on LOAD progression and neuropathology using a comprehensive approach, genotyping <italic>HTT</italic> CAG repeats in 323 LOAD patients and 335 healthy controls and further performing histopathological and molecular analyses on caudate nucleus samples in a small subcohort (6 healthy controls, 14 LOAD non- <italic>HTT IA</italic> carriers, and 13 LOAD <italic>HTT IA</italic> carriers). Results <italic>HTT IAs</italic> carriers patients exhibited decreased survival after disease onset, suggesting accelerated progression. Histopathologically, while LOAD patients showed increased soluble HTT levels and altered tau pathology compared to controls, these changes were consistently and markedly exacerbated in <italic>HTT IA</italic> carriers, characterized by heightened diffuse HTT immunoreactivity, pronounced tau 3R isoform imbalance, and increased 3R tau-enriched ghost tangles. Interestingly, this pathological exacerbation was supported by alterations in key splicing factors, including decreased SRSF6 and increased FUS-SFPQ complex formation. Analysis of microRNA (miRNA) profiling in the caudate nucleus revealed not only a LOAD-associated miRNA dysregulation that was significantly amplified in <italic>HTT IA</italic> carriers, but also five <italic>HTT IA</italic> signature miRNAs (miR-100-5p, miR-218-5p, miR-27b-3p, miR-487-3p, and miR-9-3p). <italic>In silico</italic> analyses, supported by network modeling and direct target validation, demonstrated that altered miRNAs target components of the nuclear spliceosome machinery, such as SRSF family, along with <italic>MAPT</italic> and <italic>HTT</italic> genes, suggesting a direct link to the observed tau 3R/4R imbalance. Conclusions Our findings underscore that <italic>HTT IAs</italic> as critical players in LOAD progression through an intricate network involving miRNA-mediated dysregulation of splicing. Thus, identifying <italic>HTT IAs</italic> through routine blood genetic screening offers a practical, non-invasive biomarker for patient stratification, taking a step closer to personalized therapeutic strategies in LOAD. </p>

Research Square 2025-10-10 Preprint (No Snippets API) Noronha MM, Passos PRC, Filho VOC, Megid TBC, Lima FT, Maia DCCC.
Show Full Abstract

<title>Abstract</title> <p> The <italic>CHEK2</italic> gene confers a moderate risk for breast cancer, but existing knowledge is largely based on the European founder variant, 1100delC. This study aimed to characterize the distinct phenotypes associated with unique <italic>CHEK2</italic> variants in Brazilian families. In this cross-sectional study, 1055 patients meeting criteria for Hereditary Breast and Ovarian Cancer syndrome underwent germline multigene panel testing. Pathogenic/likely pathogenic (P/LP) variants were found in 141 patients (13.4%), of whom 13 (9.2%) had a variant in <italic>CHEK2</italic> . Subsequent family cascade testing brought the total number of individuals studied to 57. Three distinct <italic>CHEK2</italic> P/LP variants were identified: c.846 + 1G > C, c.349A > G, and c.593-1G > T. While breast cancer was the most frequent tumor, specific variants correlated with different cancer spectra. The c.349A > G variant showed an enrichment for papillary thyroid cancer. In contrast, the c.846 + 1G > C variant was associated with melanoma, prostate, and testicular cancer, in addition to breast, colon, and kidney cancers. These findings highlight that different <italic>CHEK2</italic> variants can confer distinct cancer risks. Investigating these variants across diverse populations is crucial for refining phenotype characterization and improving genetic counseling as access to genetic testing expands. </p>

Research Square 2025-10-10 Preprint (No Snippets API) Le HM, Le THN, Ngo HTT, Luu TTT, Pham TQ, Tran GH, Ly TT.
Show Full Abstract

<title>Abstract</title> <p> <bold>Background</bold> CDX2, an intestine-specific transcription factor, is essential for colorectal epithelial differentiation and has been widely studied as a biomarker in colorectal adenocarcinoma (CRC). However, most previous studies applied a binary evaluation (positive/negative), which may underestimate its clinical significance. <bold>Methods</bold> We conducted a cross-sectional study of 356 surgically resected CRC cases at the University Medical Center, Ho Chi Minh City. CDX2 expression was evaluated by immunohistochemistry using an immunoreactivity score (IRS) that combined staining ratio and intensity. Associations between CDX2 expression and clinicopathological features were analyzed using chi-square and logistic regression tests. <bold>Results</bold> High CDX2 expression was observed in 88.8% of tumors, whereas 11.2% showed low expression. Low CDX2 was significantly associated with poor histological differentiation (OR = 3.79; 95% CI: 1.11–12.93; p = 0.033) and advanced local stage pT4a–pT4b compared with pT1–pT3 (OR = 2.86; 95% CI: 1.47–5.58; p = 0.002). No significant associations were found with patient age or sex. The combined scoring system allowed clearer discrimination between biologically distinct subgroups than the traditional binary method. <bold>Conclusions</bold> Low CDX2 expression is linked to aggressive pathological features and advanced tumor stage in CRC, highlighting its prognostic significance. Semi-quantitative evaluation of CDX2 using both staining ratio and intensity provides a more informative assessment that may aid risk stratification and guide clinical decision-making in CRC patients. </p>

Also flagged:acute leukemiamixed phenotype acute leukemiaMPALacute undifferentiated leukemiaacute leukemiashematopoiesis
Journal Article 2025-10-09 No Snippets Sherban A, Wolach O.
Show Full Abstract

Acute leukemia of ambiguous lineage (ALAL) is a rare, high-risk form of acute leukemia. It is characterized by the inability to assign a single lineage of differentiation to the leukemia and can manifest with more than one lineage-defining marker, called mixed phenotype acute leukemia (MPAL), or the complete absence of such markers, defined as acute undifferentiated leukemia (AUL). Recent genetic, epigenetic and metabolic insights refine diagnostic frameworks, inform classification and risk-stratification, and expose potential targetable vulnerabilities. However, the rarity and heterogeneous manifestations of ALAL result in ongoing diagnostic and therapeutic uncertainty. The most recent World Health Organization and International Consensus Classification documents provide a pragmatic framework integrating immunophenotypic and genetic criteria for classification, with recognition of specific somatic genetic alterations that define disease biology. These include rearrangements involving BCR::ABL1, KMT2A, ZNF384, and BCL11B activation. Current evidence supports the use of acute lymphoblastic leukemia-type induction regimens (with the addition of tyrosine kinase inhibitors for Philadelphia chromosome- positive MPAL) over acute myeloid leukemia or hybrid approaches. For AUL the optimal therapeutic approach is uncertain. Incorporation of targeted therapies in combination with intensive, and lower-intensity chemotherapy backbones based on the specific biological and genetic characteristics of ALAL is an appealing approach and is increasingly reported. The use of lineage-specific targeted approaches may result in therapeutic pressure and lineage switch in patients with acute leukemia with multi-phenotypic potential. The role and optimal platform for minimal residual disease surveillance in ALAL to guide therapy, and inform transplantation is unclear, given the paucity of prospective controlled data.

ARFGEF2
Also flagged:TuberculosisTBdeathinfectionlatent TB infectionphagosome-
Journal Article 2025-10-09 ✓ 1 Snippet Baros-Steyl SS, Nakedi KC, Ganief TA, Soares NC, Blackburn JM.
In-Text Gene Mentions

…proteins, including DENND4C,ARFGEF2, and DOCK10, further…

Show Full Abstract

Pathogenic mycobacteria, such as <i>Mycobacterium tuberculosis</i>, modulate the host immune system to evade clearance and promote long-term persistence, leading to disease progression or latent infection. Understanding how these mycobacteria evade elimination is key to uncovering the molecular mechanisms of infection. Protein kinase G (PknG) in pathogenic mycobacteria plays a critical role in avoiding macrophage clearance by inhibiting phagosome-lysosome fusion; however, the exact mechanism is not completely understood. To investigate the role of PknG during early events of macrophage infection, RAW 264.7 macrophages were infected with <i>Mycobacterium bovis</i> BCG wild-type and PknG knockout mutant strains. Phosphoproteomic analysis, including TiO<sub>2</sub>-based phosphopeptide enrichment and LC-MS/MS, identified 3003 phosphosites across 1638 host proteins. Differential expression analysis revealed 143 phosphosites significantly altered between wild-type and mutant infections, with 95 exhibiting increased phosphorylation in the presence of PknG. Additionally, 34 phosphosites were exclusively phosphorylated in the presence of PknG. Functional analysis demonstrated that PknG kinase activity reprograms normal macrophage function by interfering with host cytoskeletal organization, phagosome maturation, and programmed cell death, establishing a new role for PknG in directing the fate of mycobacteria within macrophages. Differentially phosphorylated proteins in this study serve as a foundation for further validation and the assignment of PknG host substrate assignment.

LRRC7
Also flagged:methylationactin binding rho activating proteinHLAglucosaminyl (N‐acetyl) transferase 2GCNT2ABRA
Journal Article 2025-10-09 ✓ 3 Snippets Lahnsteiner A, Ellmer V, Hao M, Tannert LK, Versteeg SA, Bindslev-Jensen C, van Ree R, Risch A, Aglas L.
In-Text Gene Mentions

…SRSF4 , cg19898963‐LRRC7, cg21436032, cg26856604‐…

…For cg19898963‐LRRC7, which also…

…nucleotide variation inLRRC7was identified, which…

Show Full Abstract

<h4>Background</h4>Until now, no study has investigated the impact of allergen immunotherapy (AIT) on genome-wide DNA methylation in a longitudinal set-up. Herein, we investigated whether differences in DNA methylation occur in birch pollen allergic patients undergoing 6 months of birch pollen AIT, assessed alterations in methylation-based blood cell type composition, and correlated DNA methylation to serological AIT biomarkers.<h4>Methods</h4>We performed genome-wide DNA-methylation analysis on bisulfite-converted DNA derived from whole blood samples of 16 birch pollen-allergic patients (pre-/post-birch pollen AIT) and 15 placebo (pre-/post-placebo treatment).<h4>Results</h4>Our analysis identified cg22187251, located within a regulatory region upstream of the glucosaminyl (N-acetyl) transferase 2 (GCNT2) gene and cg22336863 upstream of the transcription start site of actin binding rho activating protein (ABRA), as hypermethylated. Functional assays revealed that these regions exhibit methylation-dependent promoter and enhancer activities. We identified differentially methylated positions within the HLA gene complex, and an AIT-specific increase of CD8+ T cell populations accompanied by a decrease in natural killer (NK) cell proportion. Strong to moderate correlations with clinical biomarkers (such as specific IgG<sub>4</sub>) were observed for 42% of the top 100 differentially methylated positions.<h4>Conclusion</h4>GCNT2 and ABRA are implicated in Rho-signaling, a pathway involved in Th2 differentiation. GCNT2 modulates the SMAD-dependent TGF-β pathway, indicating a role in mediating AIT-induced immunotolerance. This is the first longitudinal study investigating DNA methylation changes induced by birch pollen AIT.

HTT
Also flagged:serotoninreuptakecitalopramfluoxetinefluvoxaminesertraline
Journal Article 2025-10-09 ✓ 1 Snippet Wiegand S, Hart XM, Egberts KM, Clement HW, Fleischhaker C.
In-Text Gene Mentions

…the serotonin transporter5-HTTof 80% is…

Show Full Abstract

Therapeutic reference ranges (TRRs) for selective serotonin reuptake inhibitors (SSRIs) and atypical antipsychotics are established for adults. In children and adolescents, however, knowledge on TRRs of psychotropic drugs is scarce. The aim of this study was to determine serum concentrations in children and adolescents to provide guidance for the definition of therapeutic reference ranges in this age group. Within the routine therapeutic drug monitoring service of a German child and adolescent psychiatric university hospital, serum concentrations of citalopram, fluoxetine, fluvoxamine, sertraline, aripiprazole, clozapine, olanzapine, quetiapine or risperidone in children and adolescents were collected between 1999 und 2022 and retrospectively analyzed. The 25th to 75th interquartile ranges (IQRs) were calculated and compared with the TRRs defined for adults. In total, 618 serum level concentrations were examined. The IQRs found for fluvoxamine (75-203 ng/ml), sertraline (25-54 ng/ml), olanzapine (13-57 ng/ml), and aripiprazole (93-245 ng/ml) were similar to published therapeutic ranges for adults. Citalopram (18-51 ng/ml), clozapine (180-419 ng/ml), risperidone plus 9-hydroxyrisperidone (11-35 ng/ml), aripiprazole plus dehydroaripiprazole (118-313 ng/ml) and quetiapine (34-234 ng/ml) exhibit somewhat lower ranges in children and adolescents when compared to adults. The IQR found for fluoxetin (102-263 ng/ml) could not be compared with that of adults due to methodological differences. Our results contribute to the knowledge of serum concentrations of SSRIs and atypical antipsychotics in children and adolescents. The differences found in some substances compared to adults clearly indicate that age- and substance-specific therapeutic ranges need to be defined for children and adolescents.

MLLT10
Also flagged:leukemiaMYCreverse transcriptionpolymeraseALLKMT2A
Journal Article 2025-10-09 ✓ 1 Snippet Chen B, Gao Z, Chen L, Zhang H, Lin Y, Li J.
In-Text Gene Mentions

…, KMT2A ::MLLT10, NUP98 ::…

Show Full Abstract

<h4>Background</h4>Targeted Next-Generation Sequencing (tNGS) is commonly used to detect genetic mutations in patients with leukemia on DNA-level, necessitating additional methods to confirm genomic rearrangements and gene fusions, resulting in a substantial sample volume requirement and significant labor expenses.<h4>Methods</h4>A novel custom leukemia tNGS panel, independently developed by Sino-US Diagnostics Lab, includes all exons from 302 genes closely associated with leukemia and 95 introns from 26 genes, thereby facilitating the detection of gene fusion alterations on DNA-level. Additionally, the common breakpoint regions of IGH and MYC are employed for the detection of IGH or MYC rearrangements. Commercial quantitative reverse transcription polymerase chain reaction (qRT-PCR) reagents were used simultaneously to detect 45 gene fusions in RNA samples. A total of 357 adults diagnosed with leukemia were included in the study.<h4>Results</h4>The qRT-PCR method detected a total of 102 gene fusions, encompassing 23 distinct types. The tNGS method identified the same gene fusions on DNA-level in 98 samples, achieving a Positive Percent Agreement (PPA) of 96.1% (98/102) when compared to the qRT-PCR method, and no false positive findings. Additionally, it revealed the presence of two gene fusions, KMT2A::ELL and KMT2A::MLLT3, which had gone undetected by qRT-PCR. The tNGS can also identify IGH or MYC gene rearrangements in patients with B-ALL, achieving a PPA of 93.8% (15/16) when compared to the FISH. Moreover, tNGS can accurately identify the specific partner genes associated with these rearrangements, facilitating a more precise analysis of the impact of mutations on prognosis.<h4>Conclusion</h4>This study confirms the feasibility of employing tNGS methods to concurrently identify gene mutations and fusions (including IGH and MYC rearrangements) at the DNA level in adults with leukemia.

KLHL20CCPG1
Also flagged:infectionGagrestriction factorserine incorporator 5SERINC5HIV-1 infection
Journal Article 2025-10-09 ✓ 5 Snippets Ahmad I, Zhang J, Li R, Su W, Liu W, Wu Y, Khan I, Liu X, Li LF, Li S, Zheng YH.
In-Text Gene Mentions

…(TGN)-located cullin-3 (Cul3)-Kelch-like protein 20protein 20 (KLHL20)…

…(Cul3)-Kelch-like protein 20 (KLHL20) E3 ubiquitin (Ub)…

…RTN3L, ATL3, SEC62,CCPG1, and TEX264 […

…generation of HEK293TCCPG1-, RTN3L -,…

…anti-CDC2L5 (NB100-68268) andKLHL20(NBP1-79570-20) were from…

Show Full Abstract

Serine incorporator 5 (SERINC5) is a host restriction factor that inhibits the infectivity of certain enveloped viruses, including human immunodeficiency virus type 1 (HIV-1) and murine leukemia virus (MLV), by incorporating into the viral envelope and blocking viral entry. To counteract this, HIV-1 and MLV encode accessory proteins-Nef and glycoGag, respectively-that downregulate SERINC5 expression in producer cells. Here, we demonstrate that glycoGag employs more complex and effective mechanisms than Nef to antagonize SERINC5. Despite being a type II integral membrane protein, glycoGag primarily localizes to the cytoplasm, while Nef is mainly associated with the plasma membrane. Additionally, glycoGag is rapidly degraded by proteasomes, in contrast to the greater stability of Nef, and becomes stabilized after binding to SERINC5. While both proteins downregulate SERINC5 at the cell surface, glycoGag also targets SERINC5 at the endoplasmic reticulum (ER). We further show that this ER-specific downregulation is mediated by reticulophagy regulator 1 (RETREG1), an ER-phagy receptor, through micro-ER-phagy. These findings reveal that retroviruses hijack a selective autophagy pathway to counteract host restriction and promote productive infection.

Also flagged:breast cancercanceralcoholestrogen receptorERprogesterone receptor
Journal Article 2025-10-09 No Snippets Zhou Y, Jiang M, Shen K, He T, Zhou S, Shao A, Li X, Wang J, Wu R, Singla RK, Jacobs JP, Shen B.
Show Full Abstract

Optimizing chemotherapy for breast cancer (BC) remains a critical challenge. Gut microbiota (GM) dysbiosis, varying across BC subtypes and stages, influences BC development and chemotherapy response through immune and metabolic pathways. Chemotherapy also disrupts the microbiota, creating a complex bidirectional interaction. Integrating artificial intelligence (AI) allows the identification of hidden patterns, deepening our understanding of the microbiota's role. This integrated approach promises to revolutionize BC treatment with novel insights and personalized interventions.

Also flagged:head and neck canceroral infectionschewingxerostomiaAmifostinetumor
Journal Article 2025-10-09 No Snippets Piraino LR, Chen CY, Mereness JA, Dunman PM, Ovitt CE, Benoit DSW, DeLouise LA.
Show Full Abstract

<h4>Background</h4>Most head and neck cancer patients treated with ionizing radiation loose salivary gland function. Patients with decreased saliva have trouble eating, speaking and are predisposed to oral infections and tooth decay. Amifostine is the only FDA approved drug to prevent radiation-induced hyposalivation. However, it has intolerable side-effects that limit its use, motivating the discovery of alternative therapeutics.<h4>Methods</h4>We leveraged our salivary gland tissue chip platform for high-content drug discovery that we developed using submandibular gland tissue from female SKH1 hairless mice, backcrossed 6 generations with C57BL/6 J mice. We developed in-chip assays to quantify reduced glutathione and cellular senescence, which are accepted biomarkers of radiation damage. We validated radioprotection using WR-1065, the active form of Amifostine and tested other reported radioprotective drugs including Edaravone, Tempol, N-acetylcysteine, Rapamycin, Ex-Rad, and Palifermin. Next, a Selleck Chemicals library of FDA-approved drugs was screened for radioprotection. Lead hits were tested in mouse models.<h4>Results</h4>We identify 25 candidate compounds and down-select them using EC50 values and published pharmacologic data. This lead us to test Phenylbutazone (an anti-inflammatory), Enoxacin (a fluoroquinolone antibiotic), and Doripenem (a carbapenem antibiotic) for in vivo radioprotection in mice. Results confirm that these three drugs exhibit radioprotection equivalent to Amifostine but with superior EC50 values, ranging from 140 to 6900-fold lower values.<h4>Conclusions</h4>This body of work demonstrates the development and validation of assays using a tissue chip platform for high-content drug screening and the successful discovery and in vivo validation of candidate radioprotective drugs with non-antioxidant primary modes of action. These results point to possible unknown mechanisms of radioprotection. These drugs can be developed to improve radioprotection efficacy and clinical administration without adverse side-effects.

Also flagged:NOD-like receptor pyrin domain-containing 3NLRP3ASCapoptosis-associated speck-like proteincaspaseCaspase-1
Journal Article 2025-10-09 No Snippets Zhang S, Usman M, Wu Q, Gao Y, Fu L, Chu M, Jia C.
Show Full Abstract

BACKGROUND: The NOD-like receptor pyrin domain-containing 3 (NLRP3) inflammasome is crucial for innate immunity. However, its uncontrolled and dysregulated activation may cause various inflammatory and autoimmune disorders. Therefore, tight regulation of NLRP3 inflammasome is necessary. Numerous post-translational modifications (PTMs) are reported to play a critical role in regulating NLRP3 inflammasome activation, including (de-)phosphorylation, (de-)ubiquitination, (de-)SUMOylation, (de-)palmitoylation, (de-)acetylation, deglutathionylation, ISGylation, S-nitrosylation, and alkylation. In addition, the subcellular localization of NLRP3, involving endoplasmic reticulum (ER), mitochondria, Golgi, endosomes, and the microtubule-organizing center (MTOC), is also closely related to inflammasome assembly and activation. AIMS OF REVIEW: This review first describes the effects of recently found PTMs on NLRP3 inflammasome activation. Furthermore, the stage at which PTMs occur is elucidated in detail while previous reviews do not distinguish it very clearly. In addition, based on the subcellular distribution of NLRP3, this review proposes a novel spatiotemporal activation of this inflammasome. KEY SCIENTIFIC CONCEPTS OF REVIEW: This review highlights the innovative findings about the effects of PTMs and localization on NLRP3 inflammasome, which enrich the regulatory networks of this inflammasome and offer references for potential clinical translation in the future.

SUDS3
Also flagged:Abdominal aortic aneurysmarterial diseasehypertensionhypercholesterolemiaagingpathogenesis
Journal Article 2025-10-09 ✓ 1 Snippet Wang Y, Zhang L, Jiang W, Kuang Q, Qin X.
In-Text Gene Mentions

…elongation factor complex,histone deacetylase complexdeacetylase complex, and…

Show Full Abstract

BACKGROUND: The incidence of abdominal aortic aneurysm (AAA) has been reported to be associated with rheumatoid arthritis (RA). This research aimed to analyze the co-pathogenesis of AAA and RA through bioinformatics and clinical data. METHODS: Microarray and single-cell RNA sequencing (scRNA-seq) datasets for AAA and RA were obtained from the Gene Expression Omnibus (GEO). Differentially expressed genes (DEGs) were identified using R software (v4.2.2), followed by enrichment analyses. Hub genes were identified via the STRING database and Cytoscape software (v3.10.1). An immune cell infiltration analysis was conducted to identify key immune cell types associated with AAA and RA. Hub genes and key immune cell types were further validated using scRNA-seq datasets. NetworkAnalyst and the Drug Signature Database (DSigDB) were employed to explore the associations of hub genes with related diseases, miRNAs, transcription factors (TFs), drugs, and drug targets. Additionally, peripheral blood samples from 629 clinical patients were collected to validate the results of the immune cell infiltration analysis. RESULTS: The AAA and RA dataset revealed 61 common DEGs, including 20 upregulated and 41 downregulated genes. Three hub genes were screened from the common DEGs, and ITK was validated as hub gene in both AAA and RA datasets. Immune infiltration analysis revealed significant upregulation of monocytes in both AAA and RA, positively correlated with ITK expression. This was validated by scRNA-seq datasets confirming elevated ITK levels in monocytes. A total of eighteen related diseases, ten target miRNAs, eight TFs, and the top ten drugs and drug targets associated with ITK were identified. Analysis of clinical data revealed that monocyte levels were significantly elevated in patients with AAA and RA. CONCLUSIONS: Our study suggests that ITK may serve as a potential biomarker involved in the co-pathogenesis of AAA and RA. Moreover, monocytes appear to play an important role in this process. The regulatory network constructed for ITK may offer preliminary insights for future research.

RC3H1
Also flagged:inflammatory responseinfectionsepsisIL-6TNF-αIL-1β
Journal Article 2025-10-09 ✓ 1 Snippet Wu L, Shen Q, Yu X, Li Y, Feng D.
In-Text Gene Mentions

…autoimmune dacryoadenitis viaRC3H1regulation [ 12…

Show Full Abstract

<h4>Background</h4>Sepsis is a life-threatening systemic inflammatory response triggered by infection. The rapid progression of the disease necessitates early diagnosis and precise intervention, making the identification of reliable biomarkers and therapeutic targets crucial for improving clinical outcomes and reducing sepsis-related mortality.<h4>Aim</h4>Exploring miR-142-5p as a novel diagnostic biomarker for sepsis and its therapeutic potential via targeting CXCL8.<h4>Methods</h4>The expression levels of inflammatory factors (IL-6, TNF-α, IL-1β) and miR-142-5p in the serum of patients with sepsis and healthy controls were detected by ELISA and qPCR methods respectively. The diagnostic potential of miR-142-5p was evaluated using Pearson correlation, ROC curve, and logistic regression analyses. Bioinformatic prediction and dual-luciferase assays identified CXCL8 as a target, while LPS-induced models and cell transfection experiments investigated miR-142-5p's therapeutic effects through CXCL8 regulation.<h4>Results</h4>Sepsis patients exhibited significantly decreased miR-142-5p expression, inversely correlating with inflammatory markers (IL-6, TNF-α, IL-1β). ROC analysis showed excellent diagnostic value (AUC = 0.917). Pearson correlations indicated significant clinical associations, while logistic regression identified miR-142-5p as an independent protective factor (HR = 0.498, 95% CI:0.282-0.882, P = 0.017). LPS models confirmed miR-142-5p's anti-inflammatory effects through cytokine suppression, with knockdown showing opposite effects. Mechanistically, dual-luciferase and transfection assays verified CXCL8 as a direct target mediating these effects.<h4>Conclusion</h4>miR-142-5p may alleviate sepsis by targeting CXCL8-mediated inflammation, suggesting its potential as a diagnostic biomarker and therapeutic target.

Also flagged:cancergene expressionoligonucleotidesgene silencingtumorlipid
Journal Article 2025-10-09 No Snippets Yan Y, Liu S, Wen J, He Y, Duan C, Nabavi N, Ashrafizadeh M, Sethi G, Liu L, Ma R.
Show Full Abstract

Cancer therapy has been revolutionised by the emergence of RNA-based therapeutics, providing several strategies and mechanisms to regulate gene expression via messenger RNA (mRNA), small interfering RNA (siRNA), microRNAs (miRNA), antisense oligonucleotides (ASOs), and RNA aptamers. The present review highlights the recent advances in the preclinical development and clinical applications of RNA-based therapeutics, focusing on the delivery strategies, biological targets, and pharmacological optimisation, together with key clinical data. mRNA therapeutics, especially those adapted from vaccine platforms are being developed for the cancer immunotherapy and protein replacement, while siRNAs and ASOs enable highly specific gene silencing and splice correction. miRNA therapies show potential for diverse oncogenic pathway control, despite ongoing challenges in the delivery and specificity. RNA aptamers are obtaining attention as tumor-targeting agents in the drug delivery systems. Progress in lipid nanoparticles, chemical modifications, and tissue-specific delivery has improved the stability and efficacy of these agents. Early-phase clinical trials report encouraging outcomes in both solid tumours and haematologic malignancies, particularly in overcoming resistance and modulating the tumor microenvironment (TME). Although challenges remain in scalability, immune activation, and deep-tumour penetration, RNA-based strategies are advancing towards integration into clinical oncology. Continued refinement of delivery technologies and targeted trial designs will be critical for translating these therapies into effective, personalized cancer treatments.

Also flagged:diabetic retinopathyNogginBMP2BMP4progesteroneestradiol
Journal Article 2025-10-09 No Snippets Liu G, Tian M, Li X, Wang X, Zhang S, Bai G, Zhang X.
Show Full Abstract

<h4>Purpose</h4>This study aims to utilize genetic instrumental variables - protein quantitative trait loci (pQTL), and through analysis methods such as Mendelian randomization (MR), systematically screen and validate druggable proteins that have a causal relationship with diabetic retinopathy (DR), and further explore related drug targets, providing genetic evidence and new directions for the drug development of this disease.<h4>Methods</h4>The research was based on large-scale public databases to conduct two-sample Mendelian randomization (MR) analysis. Firstly, 511 encoded proteins were selected from the known 4,479 druggable genes as initial exposure factors, with the summary data of GWAS for diabetic retinopathy as the outcome. MR analysis was conducted using the inverse variance weighted (IVW) method and the Wald ratio method, and strict screening was performed through Bonferroni correction. For the significantly associated proteins, heterogeneity tests, pleiotropy tests, leave-one-out analysis, and Steiger directionality tests were further conducted to verify the robustness of the results. Additionally, summary MR (SMR) analysis and colocalization analysis (coloc) were used to confirm the reliability of the causal relationship. Finally, a protein-protein interaction (PPI) network was constructed using the STRING database, and potential targeted drugs were mined from the DrugBank and DSigDB databases.<h4>Results</h4>A preliminary analysis identified 37 proteins with potential causal relationships to DR (p < 0.05). After more rigorous pQTL screening and multiple testing corrections, it was found that Noggin (NOG) protein has a significant negative causal relationship with the risk of DR (p.adjust < 0.05), meaning that higher NOG protein levels may reduce the risk of disease. All sensitivity analyses supported the robustness of this result (no heterogeneity, no pleiotropy), and SMR and colocalization analyses (PP.H4 > 0.8) further confirmed this causal association. PPI network analysis revealed that NOG interacts with 10 proteins (such as BMP2, BMP4, etc.). Drug mining identified DB01373 as a corresponding drug for BMP4, and through DSigDB analysis, progesterone and estradiol were found to be potential therapeutic compounds targeting the NOG network.<h4>Conclusions</h4>Through comprehensive genetic analysis, this study identified the NOG protein as a novel potential protective drug target for DR. Its function may be achieved by regulating the BMP signaling pathway. The research findings not only provide a new perspective for understanding the pathogenesis of this disease but also recommend existing drugs such as progesterone and estradiol as potential therapies, which are worthy of further functional experiments and clinical studies for verification.

HFE
Also flagged:InfectionMetatarsal Osteomyelitisglucosetype 3c) diabetes mellitusamoxicillin-clavulanatemusculoskeletal infections
Journal Article 2025-10-09 ✓ 1 Snippet Runde AP, Sen S, Franco Hondermann BM, Goodwyn C, Libot AR.
In-Text Gene Mentions

…80% of cases,hemochromatosis, pancreatic cancer, cystic…

Show Full Abstract

A male patient in his late 40s presented to the emergency department of an academic, tertiary medical center with a malodorous, full-thickness ulceration on the lateroplantar aspect of his right foot, exposing the fifth metatarsal head. He was also found to be in a hyperosmolar hyperglycemic state with a blood glucose level of 628 mg/dL (reference range: 70-100 mg/dL) secondary to uncontrolled pancreatogenic (type 3c) diabetes mellitus (T3cDM). Cultures from a bedside biopsy performed by our podiatry service grew <i>Streptococcus milleri</i> (<i>S. milleri</i>) and unidentified anaerobes. Despite early and broad-spectrum intravenous antibiotics, a partial fifth ray amputation with fillet toe flap was necessitated and performed without complication. With source control demonstrated by negative surgical margins, our patient was downgraded to a five-day course of oral amoxicillin-clavulanate and discharged two days after amputation. Our patient's case supports the notion that <i>S. milleri</i>, a commensal bacterium of the gastrointestinal (GI) and genitourinary (GU) tracts, may have an underappreciated ability to cause skin and musculoskeletal infections in the setting of severely elevated blood glucose levels.

Also flagged:Bile AcidPrimary sclerosing cholangitischronic cholestatic liver diseaseinflammatory bowel diseaseexperimental sclerosing cholangitismetabolism
Journal Article 2025-10-09 No Snippets Chang H, Jiang Y, Zhao Q, Su Z, Chen M, He Q, Lai J, Jiang Y, Zheng J, Pan R, Shao J, Zhao RC, Chen Y.
Show Full Abstract

Primary sclerosing cholangitis (PSC) is a chronic cholestatic liver disease that is frequently associated with inflammatory bowel disease (IBD). However, the precise mechanisms linking these conditions remain unclear. In this study, we established a murine model of experimental sclerosing cholangitis (eSC) using a DDC (3,5-diethoxycarbonyl 1,4-dihydrocollidine) diet. We then demonstrated that eSC mice exhibited increased susceptibility to DSS-induced colitis, accompanied by severe intestinal pathology. Further integrated analyses revealed that eSC disrupted bile acid metabolism and gut microbiota composition, notably increasing Th17-inducing bacteria and altering bile acid profiles. Single-cell and bulk RNA-seq analyses identified a marked expansion of colonic Th17 cells and a loss of immune homeostasis in eSC mice. Therapeutically, rectal administration of lithocholic acid (LCA) and its derivative, 3-Oxo-5β-cholanoic acid (3-O-LCA), was found to restore farnesoid X receptor (FXR) signaling, reduce Th17 cell proportions, and alleviate liver and intestinal injury. Mechanistic studies show that LCA and 3-O-LCA modulate macrophage polarization and Th17 differentiation via FXR. These findings highlight the central role of the gut-liver axis, bile acid signaling, and Th17 responses in PSC-IBD pathogenesis, and suggest that targeting bile acid metabolism offers a promising therapeutic strategy. This work advances our understanding of PSC-IBD and provides a foundation for novel interventions in high-risk patients.

Also flagged:FerroptosisChronic Kidney Diseasediabeteshypertensionglomerulonephritisrenal disease
Journal Article 2025-10-09 No Snippets Mao ZH, Liu Y, Zhang Q, Pan S, Chen D, Qiao Y, Wang H, Liu D, Liu Z, Feng Q.
Show Full Abstract

Chronic kidney disease (CKD) is a prevalent and progressive condition that leads to renal structural abnormalities and a gradual decline in kidney function. CKD has various etiologies, including diabetes, hypertension, and glomerulonephritis, and is associated with significant morbidity, mortality, and economic burden. Current treatments focus on slowing disease progression and managing complications; however, CKD often progresses to end-stage renal disease, necessitating renal replacement therapy. Therefore, innovative therapeutic approaches are urgently required. Recent studies have highlighted the role of ferroptosis, an iron-dependent form of cell death characterized by lipid peroxidation and oxidative stress, in CKD pathogenesis. Ferroptosis contributes to structural damage and functional impairment in renal cells. Furthermore, epigenetic modifications, including DNA methylation and histone changes, regulate gene expression without altering the DNA sequence and have been implicated in CKD progression. These epigenetic alterations may influence inflammation, fibrosis, and ferroptosis, thereby exacerbating renal dysfunction. This review explores the intersection of ferroptosis and epigenetic regulation in CKD, offering novel insights into the mechanisms driving disease progression and potential therapeutic targets. Through a comprehensive bibliometric analysis, this study provides a deeper understanding of CKD pathogenesis and proposes potential future treatment strategies.

HFE
Also flagged:Coronary Artery Diseasecardiac amyloidosisarteriosclerosisamyloidosismicrovascular diseaserestrictive heart failure
Journal Article 2025-10-09 ✓ 1 Snippet Planchat A, Guijarro D, Musayeb Y, Giannakopoulos G, Giraud R, Poku NK, Py DA, Noble S.
In-Text Gene Mentions

…including sarcoidosis andhemochromatosis).…

Show Full Abstract

The coexistence of cardiac amyloidosis with coronary artery disease is a complex diagnosis and a challenging clinical scenario. Amyloid fibril deposition contributes to arteriosclerosis, and amyloidosis is also recognized to be associated with intramural microvascular disease. The restrictive heart failure associated with amyloidosis worsened the complication of PCI. A multimodal imaging approach is necessary when cardiac amyloidosis is highly suspected.

HTT
Also flagged:Ceriumneurodegenerative diseasesmitochondrialneurodegenerative diseasesynthesisoxide
Journal Article 2025-10-09 ✓ 1 Snippet Mishra K, Tripathi S, Tiwari AK, Rana R, Yadav P, Chourasia MK.
In-Text Gene Mentions

…1 of theHTTgene, leading to…

Show Full Abstract

Delivering therapeutic agents across the blood-brain barrier (BBB) remains a formidable hurdle in the treatment of neurodegenerative diseases, which are primarily driven by mitochondrial dysfunction, oxidative stress, and neuroinflammation. Although our understanding of these disease mechanisms has advanced, effective treatments are still limited due to the restrictive nature of the BBB. In this context, nanotechnology has emerged as a promising approach, offering engineered nanocarriers capable of traversing the BBB and enabling targeted drug delivery to the brain. Amongst the various nanomaterials explored, cerium-based nanoparticles have gained particular attention as promising candidates for neurodegenerative disease therapy. Their multifunctionality stemming from reversible redox behaviour, enzyme-mimicking activity, sustained antioxidant effects, and anti-inflammatory properties, combined with their ability to penetrate the BBB and provide neuroprotection, positions them as a powerful platform for future therapeutic strategies. This review begins with a concise overview of the shared pathological mechanisms underlying neurodegenerative diseases, highlights BBB-related drug delivery challenges, and discusses nanocarrier strategies for brain targeting, focusing on cerium-based nanoparticles. We then delved into the structural features, synthesis techniques, and distinctive redox properties of cerium-based nanomaterials, with emphasis on cerium oxide and cerium vanadate. Their therapeutic potential is explored across Alzheimer's and Parkinson's diseases, as well as in stroke, multiple sclerosis, and glioblastoma. Key insights into their physicochemical properties, BBB permeability, and neuroprotective mechanisms are provided. We also address current limitations, including nanoparticle stability, toxicity, and translational barriers, and conclude with future directions for optimizing cerium-based nanozymes in neurotherapeutics.

HFE
Also flagged:diabetesmalnutritionexocrine insufficiencyglucoseinsulinPancreatectomy
Journal Article 2025-10-09 ✓ 1 Snippet Nakamura R, Yanagimachi M, Mitsuhashi K, Yamaichi M, Onodera W, Matsumoto A, Sato E, Tando Y, Fujita Y.
In-Text Gene Mentions

…pancreatic neoplasia, andhemochromatosis, as well as…

Show Full Abstract

<b>Introduction:</b> After total pancreatectomy, patients inevitably develop pancreatogenic diabetes with marked glycemic variability and high risk of malnutrition due to both endocrine and exocrine insufficiency. Weight loss and malnutrition can occur even in those with adequate dietary intake and plausible pancreatic enzyme replacement. We hypothesized that glycemic variability is associated with nutritional decline. <b>Methods:</b> We retrospectively analyzed 14 patients who underwent continuous glucose monitoring (CGM) after total pancreatectomy. Nutritional status was assessed using the Geriatric Nutritional Risk Index (GNRI), and patients were classified into malnutrition-risk progression or nutrition-maintaining groups. Then, we evaluated glycemic indices, dietary intake, anthropometry, and pancreatic enzyme replacement therapy (PERT). <b>Results:</b> Insulin use, PERT dose, and dietary intake were approximately comparable between groups. In contrast, the malnutrition-risk progression group showed significantly higher mean glucose and time above range, and lower time in range (TIR). Importantly, TIR consistently showed an inverse association with malnutrition-risk progression across models adjusted for clinical covariates, including time since pancreatectomy, primary diagnosis, insulin regimen, and pancrelipase dose. These findings indicate that the observed relationship between lower TIR and worsening GNRI was independent of dietary intake and adequacy of enzyme replacement therapy, underscoring TIR as a clinically meaningful indicator of nutritional decline in this population. <b>Conclusions:</b> Hyperglycemia and reduced TIR were significantly associated with worsening GNRI after total pancreatectomy, independent of dietary intake or PERT. CGM-based glycemic metrics may help identify patients at risk of malnutrition and guide postoperative management.

VRK2
Also flagged:MetabolismdementiaagingADamyloid-β
Journal Article 2025-10-09 ✓ 1 Snippet Astorino MF, Cipriano GL, Anchesi I, Lui M, Raffaele I, Calabrò M, Crisafulli C.
In-Text Gene Mentions

…1 CIT CitronRho-Interacting Serine/Threonine Kinase CLU ClusterinSerine/Threonine Kinase CLU…

Show Full Abstract

Alzheimer's disease (AD), the most prevalent form of dementia, poses a critical global health challenge as its incidence rises with aging populations. Despite extensive research into its genetic and molecular underpinnings, effective therapeutic strategies remain limited. Growing evidence suggests that physical exercise may offer neuroprotective benefits, potentially mitigating AD progression through multifactorial mechanisms. This review synthesizes current findings on the interplay between aerobic exercise and AD pathophysiology, with a focus on amyloid-β (Aβ) metabolism, gene expression, and neuroinflammation. We explore how exercise influences Aβ clearance, modulates amyloid precursor protein (APP) processing, and impacts the activity of key enzymes such as secretases and neprilysin. Further, we highlight the gene-exercise crosstalk identified through transcriptomic data, particularly in the entorhinal cortex-an early site of Aβ deposition. Our analysis also discusses how exercise-induced modulation of molecular pathways-including mitochondrial function, oxidative stress responses, and neuroinflammatory cascades-may confer cognitive resilience. By integrating molecular, genetic, and systems biology data, this review underscores the potential of structured physical activity as a non-pharmacological intervention to delay or attenuate AD pathology. These insights support a precision medicine approach, which combines lifestyle interventions with molecular profiling, to improve prevention strategies and therapeutic outcomes in AD.

POU3F2
Also flagged:Schizophreniamethylationhistonechromatinmitochondrialrespiratory-chain
Journal Article 2025-10-09 ✓ 1 Snippet Saada M, Stern S.
In-Text Gene Mentions

…, OXPHOS subunits,POU3F2/BRN2, PTN )…

Show Full Abstract

Schizophrenia is a highly polygenic and clinically heterogeneous disorder. In this paper, we first review layer-specific evidence across genetics, epigenetics, transcriptomics, proteomics, and patient-derived induced pluripotent stem cell (iPSC) models, then integrate cross-layer findings. Genetics research identifies widespread risk architecture. Hundreds of loci from common, rare, and CNV analyses. Epigenetics reveals disease-associated DNA methylation and histone-mark changes. These occur at neuronally active enhancers and promoters, together with chromatin contacts that link non-coding risk to target genes. Transcriptomics show broad differential expression, isoform-level dysregulation, and disrupted co-expression modules. These alterations span synaptic signaling, mitochondrial bioenergetics, and immune programs. Proteomics demonstrates coordinated decreases in postsynaptic scaffold and mitochondrial respiratory-chain proteins in cortex, with complementary inflammatory signatures in serum/plasma. iPSC models recapitulate disease-relevant phenotypes: including fewer synaptic puncta and excitatory postsynaptic currents, electrophysiological immaturity, oxidative stress, and progenitor vulnerability. These same models show partial rescue under targeted perturbations. Integration across layers highlights convergent pathways repeatedly supported by ≥3 independent data types: synaptic signaling, immune/complement regulation, mitochondrial/energetic function, neurodevelopmental programs and cell-adhesion complexes. Within these axes, several cross-layer convergence genes/proteins (e.g., <i>DLG4</i>/PSD-95, <i>C4A</i>, <i>RELN</i>, <i>NRXN1/NLGN1</i>, OXPHOS subunits, <i>POU3F2</i>/BRN2, <i>PTN</i>) recur across cohorts and modalities. Framing results through cross-layer and shared-pathway convergence organizes heterogeneous evidence and prioritizes targets for mechanistic dissection, biomarker development, and translational follow-up.

DCC
Also flagged:Appendiceal Cancerscolorectal cancerACmucinous appendiceal neoplasmsgoblet cell adenocarcinomassignet ring cell adenocarcinomas
Journal Article 2025-10-09 ✓ 1 Snippet Gironda DJ, Erali RA, Forsythe SD, Pullikuth AK, Zheng-Pywell R, Cummins KA, Soker S, Gui X, Levine EA, Votanopoulos KI, Miller LD.
In-Text Gene Mentions

…SMAD4 , andDCC—is frequently observed…

Show Full Abstract

<b>Background/Objectives</b>: Appendiceal cancer (AC) is a rare and understudied malignancy with limited genomic data available to guide clinical interventions. Historically treated as a subtype of colorectal cancer, AC is now recognized as a distinct disease with unique histologic subtypes and molecular features. This review aims to consolidate current genomic data across AC subtypes and explore the clinical relevance of recurrent mutations. <b>Methods</b>: A systematic literature review was performed in accordance with general Preferred Reporting Items for Systemic Reviews and Meta-Analyses (PRISMA) guidelines. Using search engines such as PubMed and Web of Science, we selected studies based on relevance to AC genomics using search terms such as "appendix cancer", "appendiceal cancer", "pseudomyxoma peritonei", "sequencing", "mutation", and "genotype". <b>Results</b>: AC comprises five major histologic subtypes-appendiceal neuroendocrine neoplasms (ANENs), mucinous appendiceal neoplasms (MANs), goblet cell adenocarcinomas (GCAs), colonic-type adenocarcinomas (CTAs) and signet ring cell adenocarcinomas (SRCs)-each with unique clinical behaviors and mutational profiles. Low-grade tumors, such as ANENs and MANs, frequently harbor <i>KRAS</i> and <i>GNAS</i> mutations, while high-grade subtypes, such as CTAs and SRCs, are enriched for <i>TP53</i>, <i>APC</i>, and <i>SMAD</i> gene alterations. GCA tumors exhibit a distinct mutational spectrum involving chromatin remodeling genes such as <i>ARID1A</i> and <i>KMT2D</i>. Compared to colorectal cancer, AC demonstrates lower frequencies of <i>APC</i> and <i>TP53</i> mutations and a higher prevalence of <i>GNAS</i> mutations, consistent with a pathological divergence from CRC. <b>Conclusions</b>: The genomic heterogeneity of AC is commensurate with its histological complexity and has important implications for diagnosis, prognosis and treatment. While certain actionable mutations are present in a subset of tumors, large-scale genomic characterization efforts and development of subtype-specific models will be essential for advancing precision medicine in AC.

Also flagged:Autophagylysosomechronic obstructive pulmonary diseasexenophagyacidificationidiopathic pulmonary fibrosis
Journal Article 2025-10-09 No Snippets Kim H, Wang W, Dobrescu I, Lee J, Martorelli J, Wang S, Guo JY.
Show Full Abstract

Autophagy is a lysosome-directed recycling program that preserves lung homeostasis yet, when dysregulated, can cause disease. This review organizes current evidence by lung compartment and disease phase, proposing that autophagy polarity is determined by cell identity, micro-niche, and timing along the injury-repair continuum. In chronic obstructive pulmonary disease, epithelial autophagy is initially cytoprotective, but chronic smoke exposure reveals a lysosome bottleneck and stalled flux, while alveolar macrophages show impaired xenophagy and poor acidification. In idiopathic pulmonary fibrosis, autophagy is suppressed in type II epithelial cells and fibroblasts downstream of transforming growth factor beta (TGF-β) and mTORC1, which promotes epithelial stress programs and collagen translation. In acute lung injury and respiratory distress syndrome, timely autophagy activation limits cGAS-STING and NLRP3 signaling, preserves barrier integrity, and supports recovery. In asthma, autophagy supports mucin biogenesis in epithelial cells but is reduced in antigen-presenting cells, while eosinophil and mast cell effector functions rely on autophagy. In infection, xenophagy clears microbes but is actively subverted by bacteria and respiratory viruses. In non-small cell lung cancer (NSCLC), tumor-intrinsic autophagy maintains energy metabolism, redox balance, and enables immune evasion, whereas host autophagy can alternately support antitumor immunity or supply nutrients. We summarize small-molecule modulators, delivery strategies, and flux-aware tools that enable precise, cell- and phase-resolved modulation of autophagy to guide patient selection and improve therapy in respiratory disease.

Also flagged:antibodiesantibodyimmune responsesimmunoglobulinsalbuminpeptide
Journal Article 2025-10-09 No Snippets Chen S, Shan B, Luo Y, Mo G, Rasheed U, Lv L, Yang X, Lu Q.
Show Full Abstract

<h4>Introduction</h4>Recombinant single-chain variable fragments (scFvs) are promising antibody formats for cost-effective and scalable production. However, their soluble expression in Escherichia coli is often limited by misfolding and aggregation, particularly for scFvs targeting small molecule haptens such as abscisic acid (ABA). To address this bottleneck, molecular chaperones can be co-expressed to enhance folding efficiency and functional yield.<h4>Methods</h4>An ABA-specific scFv was expressed in E. coli BL21(DE3) using five different chaperone plasmids (pG-KJE8, pGro7, pKJE7, pG-Tf2, and pTf16). Soluble expression was quantified by His-tag ELISA, and protein identity was confirmed by SDS-PAGE and Western blot. Functional characterization included competitive ELISA for IC<sub>50</sub> and specificity, while secondary structure was analyzed by FT-IR and circular dichroism spectroscopy.<h4>Results</h4>Trigger Factor (pTf16) significantly improved soluble scFv yield (19.65%) compared to the control (14.20%). The pKJE7 system achieved the highest sensitivity with the lowest IC<sub>50</sub>, whereas the pTf16 system provided superior specificity and a broader detection range by minimizing cross-reactivity. Structural analysis revealed that pKJE7-assisted scFv closely matched the predicted β-sheet content, correlating with high sensitivity, while pTf16-assisted scFv avoided non-native α-helices, supporting enhanced specificity. Circular dichroism further demonstrated that pKJE7- and pTf16-assisted scFvs exhibited conformational rigidity consistent with a lock-and-key binding mechanism.<h4>Discussion</h4>This study highlights that molecular chaperone choice influences both structural fidelity and functional performance of ABA-scFv in E. coli. While pKJE7 favors high sensitivity, pTf16 yields highly specific and structurally stable antibodies. These findings establish a practical basis for developing low-cost ABA immunoassays with tailored performance for agricultural biotechnology.

Also flagged:tumormetabolismtumorsosteosarcomaOSChondrosarcoma
Journal Article 2025-10-09 No Snippets Li L, Deng P, Hou S, Li G, Suo M, Xu L, Wang C, Song J.
Show Full Abstract

Malignant bone- and cartilage-forming tumors exhibit heterogeneous clinical behavior across various body regions. Understanding the mechanisms underlying these differences is essential for developing targeted diagnostic and therapeutic strategies. This review proposes the hypothesis that tissue stiffness heterogeneity contributes to the distinct progression and prognosis of tumors in the jaw and temporomandibular joint (TMJ) compared to peripheral skeletal sites, potentially through stiffness-mediated metabolic reprogramming. To evaluate this hypothesis, a conceptual framework is provided to guide future research. This review summarizes spatial and temporal variations in stiffness across the jaw, TMJ, and femur, and introduces potential mechanisms through which mechanical stiffness may influence tumor metabolism. Technical strategies and material considerations for designing scaffolds that mimic bone and cartilage stiffness are discussed, along with current applications of stiffness-biomimetic scaffolds for <i>in vitro</i> investigation of malignant bone- and cartilage-forming tumors. By integrating insights from mechanobiology, tumor metabolism, and scaffold engineering, this review aims to facilitate the development of targeted experimental approaches that may contribute to more effective treatment strategies.

PRDX6
Also flagged:aflatoxin B1ochratoxin AAFB1cytoplasmicmetabolismconjugation
Journal Article 2025-10-09 ✓ 1 Snippet Popescu RG, Dinischiotu A, Stroe AA, Georgescu SE, Marinescu GC.
In-Text Gene Mentions

…peroxiredoxin-5 (EC 1.11.1.27,PRDX6) are up-regulated, and…

Show Full Abstract

Mycotoxin contamination represents a major risk to both human and animal health. Antioxidants can mitigate some of these effects through free radical scavenging, reduction in oxidative stress, and anti-inflammatory and immunomodulatory actions. This work investigated the potential of antioxidants derived from grapeseed and sea buckthorn to mitigate the adverse effects of aflatoxin B1 (AFB1) and ochratoxin A (OTA) in weaned piglets. An unbiased Data-Independent Acquisition (DIA) proteomic approach was used to analyse the impact of OTA- and AFB1-contaminated diets on liver and kidney cytoplasmic metabolism, particularly focusing on the conjugation phase. Our results indicate that several toxic effects of these mycotoxins were partially alleviated by dietary antioxidant supplementation. Additionally, in kidneys, some of the effects are synergistically amplified, such as proteins involved in fatty acid degradation, peroxisome, PPAR signalling, translation, the TCA cycle, and excretion pathways. Inclusion of antioxidants in the animal diet can have beneficial effects. Nevertheless, caution is advised; synergistic effects can occur with potentially more serious consequences than the effects of mycotoxins alone.

ECI2
Also flagged:perfluorooctanoic acidperfluorooctanesulfonic acidcancerwaterimmunosuppressionrenal cell carcinoma
Journal Article 2025-10-09 ✓ 1 Snippet Ohmori K.
In-Text Gene Mentions

…were Etfb ,Eci2, Cpt1a ,…

Show Full Abstract

Perfluorinated alkyl substances and polyfluorinated alkyl substances (PFASs) are long-chain compounds, with perfluorooctanoic acid (PFOA) and perfluorooctanesulfonic acid (PFOS) being the most well-known examples. Both are considered typical non-genotoxic carcinogens (NGTxCs). In this study, we verified whether the Bhas 42 cell transformation assay (Bhas 42 CTA) can be used as an effective in vitro method to predict carcinogenicity of NGTxCs using both PFOA and PFOS as typical representatives. Transcriptome analysis during the PFOA-induced transformation process showed that many factors related to the effects of PFOA on the immune system and cancer hallmarks increased or decreased. Thus, we demonstrated that mechanistic analyses such as transcriptome analyses in combination with the transformation focus formation results from the Bhas 42 CTA may be useful tools when assessing the carcinogenicity and other biological effects of NGTxCs such as PFOA. We propose that the Bhas 42 CTA is a simple in vitro test for the detection of NGTxCs, that it has in vitro oncotransformation as an endpoint, and that it can also detect the activation of factors involved in malignant progression, such as invasion and metastasis. It allows for the comprehensive detection of subtle mechanisms in parallel with focus formation throughout the transformation process, from the early stages to malignancy.

Also flagged:alkynetissue transglutaminasehTG2-proteinceliac diseasecancer
Journal Article 2025-10-09 No Snippets Mader LK, Maunick N, Borean JE, Keillor JW.
Show Full Abstract

Human tissue transglutaminase (hTG2) is a multifunctional enzyme with both protein cross-linking and G-protein activity. Dysregulation of these functions has been implicated in diseases such as celiac disease and cancer, prompting the development of hTG2 inhibitors, many of which act covalently <i>via</i> a pendant electrophilic warhead. Most small molecule hTG2 inhibitors to date feature terminal, sterically minimal warheads, based on the assumption that bulkier electrophiles impair binding and reactivity. Here, we report structure-activity relationships (SAR) of a novel internal alkynyl warhead scaffold for irreversible inhibition of hTG2. This series includes one of the most potent non-peptidic hTG2 inhibitors reported to date. We demonstrate that this scaffold not only inhibits transamidase activity but also abolishes GTP binding, while exhibiting excellent isozyme selectivity. In addition, we investigate the tunability and stability of this warhead, providing insights into its broader applicability. Through detailed kinetic analysis, this study establishes a new scaffold for irreversible hTG2 inhibition and expands the design principles for covalent warheads beyond traditional terminal systems.

SOX6
Also flagged:CHD7neural crest cell differentiationatresia of the choanaeeardevelopmental disordercongenital heart defects
Journal Article 2025-10-09 ✓ 5 Snippets Yan S, Bombin A, Liu W, Gonzalez-Giraldo Y, Zhou F, Shi H, Wang Q, Jiao K.
In-Text Gene Mentions

…SOXD family members,Sox6and Sox13 ,…

…which also includesSOX6and SOX13.…

…of Sox5 orSox6in mice leads…

…Supporting this, Sox5/Sox6double knockout mice…

…BothSox6and Sox13 signals…

Show Full Abstract

CHARGE (coloboma of the eye, heart defects, atresia of the choanae, retardation of growth and development, genital abnormalities, and ear anomalies) syndrome, primarily caused by <i>CHD7</i> haploinsufficiency, is a complex developmental disorder frequently associated with congenital heart defects. Our comprehensive single-cell RNA sequencing (scRNA-seq) analysis of cardiac neural crest cells (cNCCs) with <i>Chd7</i> inactivation reveals impaired myocyte differentiation by cNCCs as a major cellular defect; loss of <i>Chd7</i> disrupts myogenic transcriptional programs, alters cell fate trajectories, and activates cellular stress responses. These results significantly advance our understanding of the NCC-autonomous role of CHD7 and the mechanisms underlying CHARGE-associated heart defects driven by cNCC dysfunction. We further discovered that CHD7 enhances its own expression through interaction with SOX5 at an upstream enhancer conserved among mammals. Notably, SOX5 overexpression in cultured <i>Chd7</i>-haploinsufficient cNCCs restores <i>Chd7</i> expression from the intact allele and rescues myocyte differentiation. These findings uncover a SOX5-mediated <i>Chd7</i> autoregulatory mechanism and suggest that enhancing the SOX5-CHD7 axis may represent a promising strategy to mitigate cardiovascular defects caused by <i>CHD7</i> insufficiency.

medRxiv 2025-10-09 Preprint (No Snippets API) Ali Asgari M, Langbehn DR, Skibinski DOF, Lee R, Griffiths WJ, Wang Y.
Show Full Abstract

Huntington’s disease (HD) arises from of an expanded polyglutamine-coding trinucleotide repeat in exon 1 of the huntingtin gene. Despite considerable research, a successful disease modifying therapy has yet to be confirmed. Cholesterol homeostasis in brain is considered one of the biological processes to be disturbed in HD. In the current study we have shown, using liquid chromatography – mass spectrometry with multistage fragmentation – based sterolomics, that non-esterified 24S-hydroxycholesterol (24S-HC), the stereo-specific brain-derived cholesterol metabolite that can cross the blood brain barrier, is at a lower concentration in plasma of a group of people with manifest HD than in groups of people with premanifest HD or healthy controls. Although our data does not indicate that 24S-HC is a prognostic biomarker at the individual level, it could potentially be used to monitor a pharmacodynamic response for groups of patients, or perhaps of disease progression in individuals. In addition, by exploiting binary classification techniques we show that a diagnostic model can be developed giving a good to very good performance according to the area under the curve (AUC) in receiver operating characteristic (ROC) curves to distinguish people with premanifest HD from people with manifest HD. Notably, the most important metabolites in the binary classification models were plasma concentrations of 24S-HC and of the cholesterol precursor 7-dehydrocholesterol, both of which showed statistical changes in the manifest HD group, reinforcing the involvement of cholesterol metabolism in HD.

Also flagged:Eosinophilic esophagitischronic inflammatory disease of the esophagusintercellular spacespathogenesisCD4immune response
Journal Article 2025-10-08 No Snippets Chakraborty S, Sharma A, Marella S, Rizza CF, O'Brien PA, Ganesan V, Idelman G, Min S, Chen M, McCright-Gill T, Gonzalez N, Polydorides AD, Foster PS, Hogan SP, Chehade M.
Show Full Abstract

Clinical trials have identified 2 distinct eosinophilic esophagitis (EoE) treatment phenotypes: those that show proton pump inhibitor (PPI) responsiveness (PPI-R) and those that show PPI unresponsiveness (PPI-UR). Comprehensive clinical, endoscopic, and RNA-Seq analyses of patients with EoE prior to and following PPI therapy have not previously been performed to our knowledge. We showed that clinical, endoscopic, and histologic evaluation of esophageal biopsies from pediatric PPI-R and PPI-UR individuals with EoE prior to PPI therapy (diagnosis) were indistinguishable. RNA-Seq analyses revealed common immune and inflammatory transcriptional signatures in both PPI-R EoE and PPI-UR EoE esophageal biopsy samples at diagnosis and distinct signatures enriched for processes related to neuropeptide signaling and cell cycle and division. PPI therapy induced histologic, endoscopic, and transcriptional remission in PPI-R EoE, but not in PPI-UR EoE. Persistent disease in PPI-UR EoE was associated with the presence of Th2 inflammatory and dedifferentiated esophageal epithelial transcriptomic signatures, while PPI-R EoE revealed genes enriched in cellular responses to LPS, host defense against viruses, and type I IFN signaling. In silico analyses identified common and unique EoE disease gene drivers in PPI-R and PPI-UR EoE. These studies indicate that the 2 EoE phenotypes have unique transcriptomic elements that underlie the molecular nature of PPI-R and PPI-UR EoE disease.

Also flagged:Maleic Anhydridesynthesisdrugpolymersacrylic acidacrylates
Journal Article 2025-10-08 No Snippets Smith MP, Klumperman B.
Show Full Abstract

Maleic anhydride (MAnh) and its derivatives comprise a collection of underutilized monomer classes, each with unique reactivities and properties, which afford the design and synthesis of highly functional (co)polymers. This review explores the opportunities and limitations associated with maleic anhydride and its derivatives in conventional radical and controlled radical polymerization techniques. The potential of these monomers to create (co)polymers with desirable properties in advanced polymer design is highlighted.

HFE
Also flagged:Sickle Cell Diseasediseasemalaria-occlusive crisesacute chest syndromechronic disease
Journal Article 2025-10-08 ✓ 1 Snippet Medland SM, Bainbridge J, Cawson M, Mealing SJ, Yudina A, Eastwood I, de Kreuk A, Besser M, Tsouana E.
In-Text Gene Mentions

…which results inhemochromatosis(iron overload) […

Show Full Abstract

<h4>Background/objective</h4>Sickle cell disease (SCD) is a group of inherited health conditions affecting 7.74 million people worldwide. Regular automated red blood cell exchange (aRBCX) transfusions have been shown to improve control and management of SCD compared with manual RBCX (mRBCX). The aim of this study was to estimate the lifetime clinical and economic impact of aRBCX versus mRBCX in two United Kingdom-based populations with SCD (paediatrics initiated aged 5 years and adults initiated aged 38 years) that were clinically indicated for chronic disease-modifying transfusions (DMTs).<h4>Methods</h4>An individual patient-level simulation model was developed to estimate lifetime quality-adjusted life years (QALYs) and healthcare costs. DMT administration programmes aligned with recommended treatment schedules. Monte Carlo methods determined baseline characteristics and clinical event occurrence. Pragmatic review findings and expert opinion informed model parameters and assumptions. Second-order probabilistic sensitivity analysis (PSA) was performed for 1000 individuals' lifetimes over 500 iterations.<h4>Results</h4>Per individual, aRBCX reduced acute clinical events by 19% in both populations versus mRBCX. The time spent receiving chelation therapy reduced by 63 and 32 months for paediatric-initiated and adult-initiated individuals, respectively. Total lifetime DMT costs were reduced by £71,217 and £30,740 for paediatric-initiated and adult-initiated individuals, respectively. Overall, aRBCX increased QALYs and reduced costs by 0.29 and £112,811 in paediatric-initiated individuals and 0.24 and £61,895 in adult-initiated individuals. aRBCX was cost-effective in 100% of PSA iterations for both populations.<h4>Conclusion</h4>aRBCX shows potential to improve health outcomes and reduce healthcare costs for individuals with SCD initiating a chronic DMT programme.

Also flagged:membranemetabolismHSP90chaperoneTP53insulin-like growth factor
Journal Article 2025-10-08 No Snippets Nonnis S, Maffioli E, Grana J, Madeddu M, Zaniboni L, Marelli SP, Perricone V, Iaffaldano N, Tedeschi G, Cerolini S.
Show Full Abstract

The conservation of local chicken breeds is essential to safeguard genetic biodiversity and promote sustainable poultry production. Sperm cryopreservation is a key tool for the long-term maintenance of genetic diversity by enabling the storage of male gametes from endangered or valuable breeders for future use in conservation and breeding programs. However, significant variability in semen quality and fertility across breeds limits the effectiveness of cryopreservation protocols. This study aimed to explore the relationship between sperm protein composition and semen quality in five Italian chicken breeds, Bionda Piemontese (BP), Bianca di Saluzzo (BS), Mericanel della Brianza (MB), Pepoi (Pe), and Robusta Maculata (R), known for distinct reproductive traits. Semen samples were analyzed for volume, concentration, membrane integrity, and sperm motility, and for sperm proteomes by a label-free shotgun proteomics approach, to characterize potential molecular pathways associated with semen quality. Significant inter-breed differences were observed in semen parameters; Pe roosters showed the highest semen volume and concentration, but lower values in kinematic traits, including curvilinear velocity (VCL), straight-line velocity (VSL), and average path velocity (VAP). RM and MB exhibited the most favorable sperm membrane integrity, progressive sperm motility and sperm kinematic profile, with high VCL, VSL, VAP, linearity and wobble, despite lower semen volume. The remaining breeds showed intermediate values across most traits. Overall, results suggest breed-specific patterns and a potential trade-off between semen quantity and sperm motion efficiency. Proteomic analysis showed that proteins involved in energy metabolism, cytoskeletal dynamics, and membrane integrity were differentially abundant across breeds and correlated with specific semen traits. Gene Set Enrichment Analysis revealed enrichment of pathways such as the HSP90 chaperone cycle, TP53 transcriptional regulation, and insulin-like growth factor signaling in association with sperm motility and quality. Our findings demonstrate that sperm proteomes are associated with breed-specific fertility traits. This study provides new insights into the molecular basis of semen quality variability and biological conservation of avian genetic resources.

HFE
Also flagged:Methyl-CpGbindingMethyl CpG binding domain 3Mbd3MBDmethylation
Journal Article 2025-10-08 ✓ 1 Snippet Nizinska K, Olszewski M, Binias S, Nowicka D, Szydlowska K, Nazaruk K, Wojtas B, Lukasiuk K.
In-Text Gene Mentions

…(APP, GSN, CSF1,HFE, WNT5A, PKD2, BMP6,…

Show Full Abstract

Methyl CpG binding domain 3 (Mbd3) protein belongs to the MBD family of proteins and is responsible for reading the DNA methylation pattern. Our previous study revealed increased levels of Nucleosome Remodeling and Deacetylase (NuRD) complex proteins, including Mbd3, in the brains of epileptic animals. The present study investigated whether the Mbd3 protein level determines the seizure threshold. We demonstrate that seizures induced by pentylenetetrazole (PTZ) cause a transient, brain area-specific increase in Mbd3 protein levels in the entorhinal cortex and amygdala. Overexpression of Mbd3 in the amygdala using AAV decreased anxiety, increased excitability in the open-field test, and accelerated epileptogenesis in the PTZ-kindling model. In vitro, mRNA profiling using RNA-seq in a model of magnesium deficiency-induced epileptiform discharges revealed complex, time- and state-specific changes in gene expression. Genes regulated by Mbd3 overexpression were associated with the Wnt and Notch pathways, potassium channel function, and GABAB receptor signaling. Our findings indicate that increased Mbd3 expression has pro-epileptic properties and contributes to the regulation of multiple pathways potentially involved in seizure development. Significantly, seizures themselves transiently elevate Mbd3 levels, suggesting a potential vicious circle that may aggravate disease progression. Targeting the pro-epileptic effects of Mbd3 could therefore represent a novel therapeutic approach in epilepsy.

HTTUNC13C
Also flagged:agingneurodegenerative diseasesmitochondrialdeathsynapsesendoplasmic reticulum
Journal Article 2025-10-08 ✓ 2 Snippets Wang L, Oliver EI, D'Urso DL, Graziano B, Bianchi L.
In-Text Gene Mentions

…function of unc-13 (UNC13Cin humans) (…

…the Huntingtin protein (HTT), resulting from an…

Show Full Abstract

Aging depends on genetic and environmental factors, but the specific cell types and mechanisms that coordinate aging of the entire organism are not yet fully understood. Glial cells regulate ionic homeostasis, which is essential for neuronal function and survival. Here, we investigated the role of glial ion channel CLH-1, which is a glial pH regulator, in aging. We found that loss of <i>clh-1</i> extends life span, improves stress resistance, reduces neuronal damage, and extends health span. These effects are linked to protective pathways, including those for oxidative stress and autophagy, and depend on the DAF-16/FoxO transcription factor. Notably, by knocking down and overexpressing the carbonic anhydrase <i>cah-4</i>, we show that it is the glial alkalinization caused by loss of <i>clh-1</i> that mediates these protective effects. This work highlights the crucial role of glial pH in regulating life span and health span.

Also flagged:CancertumorToll-like receptorsTLRTLR3immune response
Journal Article 2025-10-08 No Snippets Kim HS, Simpson GG, Carrothers J, Nguyen YTM, Kohler R, Hong S, Cha S, Kim DH, Garris CS, Weissleder R.
Show Full Abstract

The efficacy of tumor vaccines depends in large part on additional immunostimulation of antigen-presenting cells (APC) in tumor microenvironments. Various Toll-like receptors (TLR), and in particular TLR3 stimulation by dsRNA, generate a cellular immune response well suited for vaccines. A major drawback of currently used Poly I:C-based TLR3 agonists is their size heterogeneity, variable stability, as well as the toxicity of lipid nanoparticle (LNP) delivery vehicles. To improve existing platforms, here, we designed a myeloid cell targeting nanoparticle system with a refined TLR3 agonist (NexaVant, NVT) and additionally containing small molecule NF-κB stimulators. We termed this myeloid targeting immune enhancer cocktail "MyTai". MyTai, based on ferrocenoyl-aminoguanidine modified cross-linked bis succinyl cyclodextrin, efficiently charge-complexed NVT and small molecules, resulting in a ∼100 nm diameter nanoparticle. MyTai was shown to be extraordinarily robust, highly efficacious in eradicating multiple tumor types, stable, and characterized by low toxicity when administered systemically. MyTai represents a viable alternative to otherwise toxic LNP RNA delivery platforms for immune stimulation.

Also flagged:degradationsaltcollagenmetabolismagingglycerol
Journal Article 2025-10-08 No Snippets Wang Y, Wang Y, Hou L, Zhong L, Yang H, Kang X, Zhou Y, Pan J.
Show Full Abstract

This study investigates the airborne microbial contamination in three museums located in the dry region of Xinjiang region, China-Bayingolin, Hami, and Turpan. Airborne microbial concentrations in these museums were found to be relatively low, ranging from 7.5 to 38.3 CFU/m³, which is advantageous for the preservation of cultural relics, especially in comparison to humid regions where higher microbial concentrations have been reported. The microbial communities were dominated by bacteria, with Firmicutes being the most abundant phylum, followed by Proteobacteria and Bacteroidetes. Notably, Pseudomonas sp., Bacillus sp., and Staphylococcus hominis were identified as potential threats to the degradation of leather cultural relics. Additionally, Mycobacterium sp., Pantoea sp., and Priestia aryabhattai were first identified in the context of cultural heritage conservation. Metagenomic sequencing revealed a significant presence of salt-tolerant, spore-forming bacteria, which are characteristic of dry environments. Antibacterial tests showed that 0.5% K100 exhibited the best antimicrobial effect. This study provides valuable insights into the microbial ecology of museums in rid climates and suggests the need for targeted preservation strategies to mitigate microbial-induced biodeterioration, particularly through the use of antimicrobial agents and environmental management.

Also flagged:pathogenesisClostridioides difficile infectionnosocomial infectionsC. difficile infectiongene expressioninfection
Journal Article 2025-10-08 No Snippets Ghahari N, Narayanan S, AbdelKhalek A, Pillai D.
Show Full Abstract

Clostridioides difficile (C. difficile) is a common cause of antibiotic-induced diarrhea and causes the highest number of nosocomial infections. Only two antibiotics are currently recommended for treating C. difficile infection (CDI), which may contribute to unsatisfactory treatment outcomes and an increased likelihood of recurrence. In this study, we aim to evaluate the difference in gene expression between symptomatic and asymptomatic mice after infection with C. difficile using spatial transcriptomics analysis. We also aim to evaluate the spatial aspect of altered genes between different layers of intestinal mucosa (superficial vs. deep) and identify the key pathways. Formalin-fixed paraffin-embedded (FFPE) intestinal sections were utilized for analysis using NanoString<sup>TM</sup> platform to evaluate differential gene expressions in the caecum and colon. The IL-17 pathway, including Lcn2, Cxcl2, and S100a8 genes, was significantly upregulated in symptomatic mice. The IL-17 signaling pathway activated downstream signaling through NF-κB and MAPK pathways. Gene expression was significantly altered between the intestinal superficial and deep mucosal layers, highlighting layer-specific differences in gene expression patterns in the intestines of symptomatic and asymptomatic mice. Gene expression patterns in the enteric mucosa explain several clinical signs and lesions in CDI mice.

Also flagged:curcuminmitochondriaHepatocellular carcinomacancermembranedendrimers
Journal Article 2025-10-08 No Snippets Kianamiri S, Shokri E, Maleki P, Soudi S, Soltaninejad H, Sadeghizadeh M.
Show Full Abstract

Hepatocellular carcinoma (HCC) remains difficult to treat due to systemic toxicity of non-selective therapies. To address this, we hypothesized that targeting the highly active mitochondria of cancer cells, which have considerably increased membrane potential compared with normal cells, could be a promising approach to induce a stronger anticancer effect. Here, we report a curcumin nanocarrier (TDC) synthesized by modifying PAMAM G4 dendrimers with triphenylphosphonium (TPP). This design enables mitochondrial targeting, leveraging the elevated membrane potential of cancer cells to enhance curcumin's anticancer activity. According to the results, the TDC influences the secreted levels of INF-γ and IL-4 on tumor lysis-stimulated splenocytes. In tumor-positive groups, TDC also increased cell population (sub G1 phase) 3.5 times, which was remarkable compared to healthy groups. Consistent with this, in tumor-positive mice, the amount of ROS and the overall rate of TDC-induced apoptosis were increased by approximately 40-50%. In addition, TDC upregulates pro-apoptotic genes (bax, p53) and downregulates oncogenic genes (bcl2, p21, xiap) in the cancerous liver tissues, reflecting the anti-cancer effect of TDC as a mitochondria-targeted delivery system. Investigations conducted ex vivo on mitochondria isolated from liver and brain tissues revealed elevated levels of ATP, malonaldehyde (MDA), and reactive oxygen species (ROS), along with reduced glutathione (GSH) levels, all of which were linked to the process of apoptosis. Finally, the biodistribution findings indicate that the accumulation of TDC in the tumor and liver was considerably greater than that of free curcumin (FC), likely due to the rapid elimination of FC at the concentration tested.

SERPINC1
Also flagged:coagulationCOVID-19innate immunitypathogenesiscomplementSERPINA5
Journal Article 2025-10-08 ✓ 1 Snippet Liu S, Shi H, Yang Y, Zhu C, Zhou J, Jin W, Song S, Zhang L.
In-Text Gene Mentions

…2, SERPINA5 ,SERPINC1, PROC ,…

Show Full Abstract

The complement system, a key innate immunity component, is implicated in COVID-19 pathogenesis. Proteomic studies reveal dysregulated complement and coagulation cascades (CCC) proteins in COVID-19, yet comprehensive analyses remain limited. This bioinformatics study analyzed proteomic data (from inception to January 13, 2025) across Web of Science, PubMed, EMBASE, and Wiley Online Library using keywords "complement and coagulation cascades", "COVID-19", and "proteomics". Included studies compared differentially expressed proteins (DEPs) in COVID-19 patients versus healthy controls. Two reviewers independently extracted data. DEPs were analyzed via R (v4.4.2), Stata (v14), and STRING (v12.0). Twenty studies identified 3,018 DEPs, including 58 CCC-related genes (e.g., FGB, SERPINA5, FGG, F2). Hub genes were identified using MCODE and cytohubba in Cytoscape, and 16 hub genes (e.g., FGB, SERPINA5) were found. Stata confirmed consistent expression of FGB, SERPINA5, FGG, and F2. All of them are the biomarkers of diseases, and are the drug targets except SERPINA5 according to the reports from OpenTargets database. Immunohistochemistry validated FGB upregulation and SERPINA5 downregulation. In summary, CCC pathway proteins are extensively dysregulated in COVID-19. FGB and SERPINA5 are potential diagnostic biomarkers and therapeutic targets, offering insights into severe COVID-19 mechanisms and guiding novel treatment strategies.

Also flagged:Chromosomechromosomesmicrochromosomesagingsex determinationchromatin
Journal Article 2025-10-08 No Snippets Saunders PA, Sassi FMC, Cioffi MB, Simakov O, Burridge CP, Ezaz T, Wapstra E.
Show Full Abstract

<h4>Background</h4>Skinks (Scincidae) are one of the most diverse and ecologically versatile lizard families, making them key models for studying major evolutionary transitions including viviparity, limb reduction, and shifts between modes of sex determination. Despite their diversity and research potential, skinks remain underrepresented in genome databases, limiting comparative studies and our ability to investigate the genetic foundations of their evolutionary diversity.<h4>Results</h4>We generated a high-quality chromosome-level genome assembly for the Tasmanian snow skink, Carinascincus ocellatus, using PacBio long-read sequencing and Hi-C scaffolding. We validated the accuracy of chromosome models in this genome using an innovative application of Oligo-FISH, designing thousands of short probes directly from the genome assembly and hybridizing them to a single C. ocellatus metaphase slide. This single-step approach provides direct and independent cytogenetic validation of all 15 chromosomes in the assembly, including microchromosomes, which are broadly recognized as more susceptible to misassembly. We further demonstrate the approach's cross-species utility through comparative cytogenomics and in silico probe alignment to multiple other skink genomes, highlighting its potential for multi-genome validation and comparative analyses.<h4>Conclusions</h4>Our study establishes C. ocellatus as a genomic model for skinks and positions Oligo-FISH as a scalable, cost-effective, and broadly applicable approach for chromosome-level genome validation. By applying it across species, we demonstrate the method's potential to support more reliable genome reconstruction and comparative genomic analyses.

SERPINC1
Also flagged:venous thromboembolismheparinargatrobanwarfarinATAntithrombin deficiency
Journal Article 2025-10-08 ✓ 1 Snippet Kozak M, Vižintin Cuderman T, Božič Mijovski M, Lučovnik M, Miklič M, Tratar G, Rojnik T.
In-Text Gene Mentions

…flanking regions ofSERPINC1were analysed using…

Show Full Abstract

<h4>Background</h4>Antithrombin deficiency (ATD) in pregnant patients significantly increases the risk of venous thromboembolism (VTE), but guidelines for managing anticoagulation during pregnancy, labour, and postpartum in patients with ATD are limited.<h4>Case presentation</h4>A pregnant woman with ATD suffered recurrent VTE in the 20<sup>th</sup> week of pregnancy despite therapeutic doses of low-molecular-weight heparin (LMWH). The acute VTE was treated with argatroban and then with warfarin until delivery. LMWH with antithrombin (AT) concentrate was introduced before and shortly after delivery, followed by warfarin, which was continued also postpartum. No further complications occurred during the remainder of pregnancy, delivery, and two-year follow-up.<h4>Conclusion</h4>Our case highlights the challenges of anticoagulant treatment in pregnant patients with ATD. Standard weight-based LMWH dosing can lead to inadequate anticoagulation, as demonstrated by an acute VTE event in our patient. In our case, the use of argatroban proved to be safe and effective in the acute setting, followed by warfarin in the 2<sup>nd</sup> and 3<sup>rd</sup> trimester, and subsequent co-administration of LMWH and AT concentrate before and after delivery. Concomitant use of LMWH and AT concentrate allows for achieving target anti-Xa levels. Measurement of both anti-Xa and AT activity is advisable in this scenario to ensure reliable anticoagulant management. ATD is a heterogeneous disorder; therefore, each successfully managed pregnancy advances clinical practice.

ARFGEF2
Also flagged:agingage-related diseasescancercardiovascular disordersmetabolismsignal transduction
Journal Article 2025-10-08 ✓ 1 Snippet Wang Q, Xu Z, Ding X, Wang A, Song S, Zhang S, Chen Y, Ding Y, Jiang L, Ding X.
In-Text Gene Mentions

…as Pdk1 ,Arfgef2, and Osbp…

Show Full Abstract

<h4>Background</h4>Aging is a complex biological process characterized by progressive molecular alterations across multiple organ systems, significantly influencing disease susceptibility and mortality. Unraveling molecular interactions driving aging is crucial for interventions promoting healthy aging and mitigating senescence. However, the systemic mechanisms governing both inter-organ interactions and organ-specific aging trajectories remain incompletely characterized.<h4>Methods</h4>To investigate the molecular dynamics of aging, we conducted a systematic multi-omics analysis of 400 tissue samples collected from 10 organs (brain, heart, intestine, kidney, liver, lung, muscle, skin, spleen, and stomach) in mice at four distinct life stages: 4, 8, 12, and 20 months (from youth to elderly). Proteomic profiling was performed using data-independent acquisition (DIA) technology, while metabolomic analysis was performed in both positive and negative ion modes. Differential expression analysis of proteins and metabolites was employed to construct a comprehensive multi-organ aging dataset.<h4>Results</h4>Proteomic profiling across ten organs at four age stages identified a total of 14,763 protein groups (PGs). Of these, 18 proteins, including Ighm, C4b, and Hpx, exhibited consistent age-related differential expression patterns across all ten organs. Functional enrichment analysis highlighted the humoral immune response as a primary driver of age-related expression changes. Additionally, this study mapped a set of age-unique proteins, such as Hp, Egf, and Arg, with distinct expression patterns in aging organs. Metabolic analysis identified 3779 metabolites, with key aging-related metabolites such as NAD+, inosine, xanthine, and hypoxanthine showing significant expression changes across multiple organs. Pathway enrichment analysis revealed consistent alterations in purine metabolism, pyrimidine metabolism, riboflavin metabolism, and nicotinate/nicotinamide metabolism during multi-organ aging.<h4>Conclusions</h4>This study provides a multi-omics atlas of multi-organ aging, revealing both intra- and inter-organ similarities and heterogeneities. These findings offer valuable insights into the molecular mechanisms underlying geriatric health decline and serve as a foundational resource for organism-systematic early warning and targeted interventions against aging-associated pathologies.

Also flagged:HDACcisplatingastric cancerDTPcell cyclechromatin
Journal Article 2025-10-08 No Snippets Singh A, Natu A, Anthony F, Muthu H, Khade B, Smoot DT, Ashktorab H, Gupta S.
Show Full Abstract

Acquired therapy resistance is a dynamic process associated with early epigenetic modifications reshaping gene transcription across multiple cellular pathways, ultimately giving rise to drug-tolerant persister (DTP) cells. Unraveling the mechanisms that sustain DTP cell survival and drive their evolution into stable drug-resistant cells (DRC) is crucial for developing targeted therapies. Cisplatin-tolerant and cisplatin-resistant models were established using liver and gastric cancer cell lines for the first time to explore these mechanisms. Our investigation centered on the distinct epigenetic landscapes of DTP and DRC cells following cisplatin exposure. RNA sequencing revealed that DTP cells exhibit downregulation of pathways involved in cell cycle regulation, DNA replication, transcription, and chromatin maintenance while upregulating those associated with cell-cell communication and cytokine signaling. Interestingly, these transcriptional changes revert in the DRC state, suggesting a high degree of plasticity during the DTP phase. Furthermore, DTP cells have elevated levels of heterochromatin markers, H3K9me3, H3K27me3, and HP1α, along with their methyltransferases, G9a and Ezh2. Knockdown studies and inhibition of the enzyme activity of these modifiers showed suppression of DTP cell emergence. Valproic acid (VPA), a phase III candidate, was further assessed in vivo, where its sequential administration with cisplatin significantly reduced tumor burden versus cisplatin alone. These findings highlight the therapeutic promise of targeting epigenetic modifications to pre-sensitize cancer cells to chemotherapy, thereby restricting the survival advantage of DTP cells.

Also flagged:Alkyl-Phosphonic Acidsdegradation1-butylphosphonic acidoctylphosphonic aciddodecylphosphonic acidalkyl
Journal Article 2025-10-08 No Snippets Yang CW, Li PH.
Show Full Abstract

The aim of present study is to deposit protective coatings with various surface chemical states on AZ91D Mg alloy. Hydrothermal bioactive ceramic coatings are performed with a surface modification by the chemical bonding of self-assembled monolayers (SAM). The electrochemical corrosion behaviors of various surface-coated AZ91D alloy within DMEM cell culture medium related to their surface chemical states are evaluated through microstructure observations, XPS surface chemical bonding analysis, static contact angles measurements, potentiodynamic polarization curves, and immersion tests. XRD and high resolution XPS of F 1<i>s</i> analysis results show that the hydrothermal FHA coating with a phase composition of Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)F can be effectively and uniformly deposited on the AZ91D alloy. FHA-coated AZ91D displays better anti-corrosion performances and lower degradation rates than those of uncoated AZ91D alloy in the DMEM solution. Through the high resolution XPS analysis of O 1<i>s</i> and P 2<i>p</i> spectra, it is demonstrated that 1-butylphosphonic acid (BP), 1 octylphosphonic acid (OP), and dodecylphosphonic acid (DP) molecules can be effectively bonded on the FHA surface by a covalent bond to form SAM. BP/OP/DP-SAM specimens display increased static contact angles to show a hydrophobic surface. It demonstrates that the SAM surface treatment can further enhance the corrosion resistance of FHA-coated AZ91D in the DMEM solution. After 2-16 days in vitro immersion tests in the DMEM, the surface SAM-bonded hydrophobic BP/OP/DP-SAM layers can effectively inhibit and reduce the penetration of DMEM into FHA coating. Long alkyl chains of the dodecylphosphonic acid (DP) SAM represents superior enhancing effects on the reduction of corrosion properties and weight loss.

HFE
Also flagged:Fibrosishepatic fibrosisfatty liver diseaseobesityhypertensionsteatotic liver disease
Journal Article 2025-10-08 ✓ 1 Snippet Kirik A, Sumbul HE, Koca N, Paşalı Kilit T, Demiral Sezer S, Binnetoglu E, Araç E, Solmaz İ, Şen H, Demirci İ, Abaylı B, Akan H, Akkuş C, Aksakal B, Aktas G, Alakuş ÖF, Atak Tel BM, Aydın A, Bahçebaşı S, Balıkçı O, Saka Baraz L, Başgöz BB, Bayrak M, Bektaş Uysal H, Beyazal Polat H, Biçer İİ, Bozkuş R, Coşkun F, Çağatay C, Çağlar F, Çakmak E, Cekiç D, Değer Ü, Demir AK, Demir İ, Dizdar OS, Dulkadiroğlu E, Düzen Oflas N, Erişmiş B, Erol A, Ertınmaz A, Eryılmaz M, Gemcioğlu E, Genç AB, Gökgöz M, Gözel N, İleri F, İşsever K, İzlimek UC, Kama Başcı Ö, Kamburoğlu A, Kamış F, Kayhan S, Kırlı İ, Kimyon Y, Kocaman ŞE, Konur K, Kurtkulağı Ö, Küçük C, Mamiş MS, Metin H, Nas N, Ocak Serin S, Olmuşçelik O, Oral A, Özbilen M, Özdemir E, Özmen E, Öztop H, Ozturk HA, Özüdoğru O, Sağlam E, Serin HÖ, Sözel H, Şahin C, Şahin Tekin M, Şahiner ES, Şanibaş AV, Şahintürk Y, Şıvgın H, Tanrıkulu A, Taslamacıoğlu Duman T, Tazegul G, Topan ED, Tunca H, Uyar S, Ünal Çetin E, Yalçın N, Yalçın Kehribar D, Yaylacı S, Yıldırım MS, Yıldırım HE, Yıldız H, Yıldız P, Yücel HE, Zengin O, Zeynettin A, Atik F, Aslan SM, Akyıldız M, Aslan N, Babacan Çelikel S, Bakan SB, Durmuş M, Karacay M, Koçyiğitoğlu Ç, Paşa G, Sivri S, Şahin TN, Tosun YS, Totik ZG, Ulutaş R, Yazıcı TN, Yılmaz E, Yıldız H, Sönmez A, Doğru T.
In-Text Gene Mentions

…diseases, Wilson’s disease,hemochromatosis, and significant alcohol…

Show Full Abstract

<b>Introduction</b>: Metabolic dysfunction-associated steatotic liver disease (MASLD) prevalence data in Türkiye is limited. We aimed to determine the nationwide prevalence of MASLD and advanced hepatic fibrosis risk in subjects with cardiometabolic risk factors (CMRF). Despite recent international consensus redefining fatty liver disease terminology, no nationwide MASLD study has been reported in Türkiye. <b>Methods</b>: This cross-sectional study included 14,371 adults with ≥1 CMRF from 44 centers across 31 cities. MASLD was diagnosed using liver ultrasonography plus cardiometabolic criteria. Advanced fibrosis risk was assessed by fibrosis-4 (FIB-4) score (≥1.3 for ≤65 years; ≥2.0 for >65 years). Logistic regression was used to identify independent predictors of high FIB-4. <b>Results</b>: A total of 61.4% of participants were women, the mean age was 51.3 ± 14.4 years, and the mean BMI was 31.4 ± 6.0 kg/m<sup>2</sup>. MASLD prevalence was 75.7% (n = 10,873), rising with the number of CMRFs (56.5% with one factor vs. 83.4% with all). The prevalence of high FIB-4 scores was 12.0% overall, being lower in MASLD patients than non-MASLD patients (11.2% vs. 14.4%, <i>p</i> < 0.001). FIB-4 scores decreased with increasing BMI (28.1% underweight vs. 8.7% class III obesity). Male sex, T2DM, and hypertension independently predicted high FIB-4 scores, while smoking, higher BMI, and MASLD were inversely associated. <b>Conclusions</b>: Three-quarters of Turkish adults with CMRF have MASLD. Standard FIB-4 thresholds may underestimate fibrosis risk in obese and smoking populations, underscoring the need for adjusted cut-offs or alternative tools. This study is the first to provide nationwide MASLD prevalence data in Türkiye.

OLFM4
Also flagged:LactoferrinOsteopontinLFOPNDiamine OxidaseDAO
Journal Article 2025-10-08 ✓ 5 Snippets Zhang W, Li C, Bi R, Lu Y, Zhang Y, Shi C, Qiao Z, Sun Y, Chen J, Wang P, Wang R, Ren F, Li Y.
In-Text Gene Mentions

…CA, USA), anti-Olfm4(Cell Signaling Technology,…

…intestinal stem cells,Olfm4—a marker of…

…expression levels ofOlfm4in the OPN…

…group exhibited higherOlfm4expression levels (…

…intestinal stem cells (Olfm4+ ) (10×,…

Show Full Abstract

<b>Background/Objectives:</b> Early life is crucial for infant gut development and intestinal homeostasis. Lactoferrin (LF) and osteopontin (OPN) are bioactive breast milk proteins that are supplemented into infant formula to promote gut development. However, the combined effect of LF and OPN (LOP) on in vivo gut maturation has not been fully elucidated. This study investigated the effects of LF, OPN, and LOP on intestinal epithelium maturation in C57BL/6N mice from postnatal days 7 to 21. <b>Methods:</b> 3-day-old pups were assigned to four groups: Control group, LF group: 300 mg/kg LF; OPN group: 300 mg/kg OPN, LOP group: 300 mg/kg of a 1:5 (w/w) mixture of LF and OPN. <b>Results:</b> Compared to controls, LOP reduced plasma Diamine Oxidase (DAO) activity by 1.54-fold and D-lactate levels by 1.41-fold, demonstrating greater efficacy than LF or OPN alone in reducing intestinal permeability. LOP also significantly increased intestinal absorptive cells versus controls or single proteins. Mechanistically, LOP promoted directional intestinal stem cell differentiation, increasing jejunal transit-amplifying cells by 1.40-fold in 21-day-old mice. LOP upregulated expression of the Notch pathway target Hes1 by 1.70-fold. Further investigations revealed LOP activated Notch signaling via the transcription factor Brg1. Validation using intestinal organoids and IEC-6 cells confirmed intact OPN within LOP mediates increased Brg1 expression, activating the Notch pathway to direct intestinal stem cell differentiation into absorptive cells. <b>Conclusions:</b> Collectively, these findings in neonatal mice suggest that LOP cooperatively enhances intestinal barrier maturation and directs stem cell differentiation via Brg1-Notch signaling, offering potential insights for future research on bioactive protein supplementation in infant nutrition.

DCC
Also flagged:cholangiocarcinomaCCKlatskin tumorsdeathcancerLiver cancer
Journal Article 2025-10-08 ✓ 5 Snippets Akhmedullin R, Burkitbayev Z, Koishibayev T, Spatayev Z, Sharmenov A, Shatkovskaya O, Zharlyganova D, Manatova A, Kuanysh Z, Shalekenov S, Gaipov A.
In-Text Gene Mentions

…and ECC (combiningDCCand PCC).…

…Patients withDCChad slightly better…

…(and PCC) withDCCalone (Model 2)…

…that patients withDCChad paradoxically better…

…improved survival forDCC, adjusting for sex,…

Show Full Abstract

<h4>Background</h4>The existing literature highlights a lack of comparative studies between subtypes of cholangiocarcinoma (CC) and the impact of misclassification on the epidemiological parameters.<h4>Methods</h4>A retrospective study was conducted to evaluate the surgical outcomes. The authors used Poisson regression with modified errors to calculate the risk ratios (RR) and reported post-estimation marginal effects. Coefficient estimates, variance inflation factors, and Pearson's goodness-of-fit test statistics were used to check for multicollinearity and model fit, respectively. We also performed a reclassification analysis by modeling Klatskin tumors (PCC) as extrahepatic (ECC), reclassifying them as intrahepatic (ICC), and comparing the corresponding changes in estimates.<h4>Results</h4>Regression analysis revealed an increased risk of death in patients with ICC (RR = 2.05, 95% CI 1.11-3.78) and PCC (RR = 2.03, 95% CI 0.97-4.24) compared to those with DCC. When PCC was analyzed as an ECC, the ICC revealed an RR of 1.52 (95% CI 0.84-2.73). Further reclassification of PCC showed an RR of 2.04 for ICC (95% CI: 1.53-3.53). The adjusted marginal effects saw a reduction in the death probability for both ICC and ECC. However, post hoc analyses revealed insufficient evidence for differences between the reclassified models.<h4>Conclusions</h4>Patients with DCC had slightly better prognosis compared to ICC and PCC. We found no differences in survival between ICC and ECC (combining DCC and PCC). The decrease in mortality risk due to reclassification in both groups was not confirmed statistically. Future studies should focus on statistical evidence when referring to the Will Rogers phenomenon, instead of inferring from raw comparisons.

Also flagged:post-translational modificationschronic kidney diseasemethylationcognitive impairmentend-stage kidney diseasedeath
Journal Article 2025-10-08 No Snippets Wei M, Lin J, Zeng Y, Wang X, Wen J, Wang J, Zou W, Tu K, Liu M, Li J.
Show Full Abstract

Chronic kidney disease (CKD) involves intricate pathological mechanisms that currently lack definitive therapeutic interventions to halt disease progression. Increasing evidence suggests that enzymatic post-translational modifications (ePTMs) of proteins play an important role in CKD. As a dynamic and reversible type of PTM, ePTMs offer advantages such as enzyme-specific catalysis, high reversibility, and precise regulation. Various forms of ePTMs have been reported in CKD, including methylation, acetylation, ubiquitination, enzymatic glycosylation, lactylation, palmitoylation, crotonylation, SUMOylation, and prenylation. Given the critical roles of these ePTMs in CKD, this review summarizes their molecular mechanisms in disease progression, explores their potential as diagnostic markers and therapeutic targets, and highlights advances in small-molecule drugs targeting ePTMs. It is important to note that most ePTMs remain in the early stages of research, with evidence of cross-regulation and synergistic effects among different modifications. Further investigation will require more basic studies and clinical trials. This review aims to help bridge the gap between basic research and clinical application of ePTMs in CKD, and to support the development of more effective treatment strategies.

Also flagged:triple-negative breast cancervimentinCSF2breast cancersecretionColony Stimulating Factor 2
Journal Article 2025-10-08 No Snippets Wu M, Du Y, Dong Y, Zheng Y, Gu L, Tang X, Yan L, Ji H, Sang Y, Liu F.
Show Full Abstract

<h4>Introduction</h4>Circular RNAs (circRNAs) have been reported to be important in the development and progression of breast cancer. Nevertheless, the biological functions and mechanisms underlying the action of circRNAs in triple-negative breast cancer (TNBC) remain poorly understood. The present study aimed to explore the role of hsa_circ_0001910 (also termed circWWC3) interacting with vimentin in regulating the secretion of Colony Stimulating Factor 2 (CSF2) and its effects on the malignant biological behavior of triple-negative breast cancer as well as the cytotoxic activity of NK cells.<h4>Methods</h4>RNA-Seq was utilized to investigate potential circRNAs involved in five pairs of breast cancer (BC) tissues and their corresponding normal tissues. Fluorescence <i>in situ</i> hybridization (FISH) was conducted to verify the relationship between circWWC3 expression and patient clinical pathological parameters, as well as its intracellular localization. Gain- and loss-of-function assays were conducted to investigate the biological functions of circWWC3 in TNBC. A microarray analysis of mRNA expression profiles was conducted to explore the downstream target genes of circWWC3. RNA pull-down assays, RNA immunoprecipitation (RIP), and mass spectrometry were carried out to uncover the proteins interacting with circWWC3. Rescue experiments were performed to investigate the potential regulatory role of circWWC3 in the progression of TNBC <i>in vivo</i> and in virto.<h4>Results</h4>In our present study, Circular RNA sequencing analysis revealed that the expression of circWWC3 was significantly upregulated in breast cancer (BC). FISH assay results indicated that circWWC3 is highly expressed in TNBC, and its elevated expression is associated with the patient's T stage and lymph node metastasis, and it is primarily localized in the cytoplasm. The results of gain- and loss-of-function assays indicate that knockdown of circWWC3 significantly suppressed the proliferation, invasion, and migration of TNBC cells, while enhancing the killing efficiency of NK-92MI cells against TNBC cells. In contrast, overexpression of circWWC3 exhibited the opposite effects. The microarray analysis data indicated that CSF2 may be a downstream target of circWWC3. Interaction of circWWC3 with vimentin and their downstream target genes was confirmed by RNA pull-down, RIP, and mass spectrometry. Rescue experiments confirmed that vimentin knockdown partially counteracted the tumor-promoting effects of circWWC3. Further analysis revealed that circWWC3 upregulates CSF2 secretion mainly through its interaction with vimentin, a core component of the Epithelial-mesenchymal transition (EMT) signaling pathway, thereby facilitating the malignant progression of TNBC.<h4>Conclusion</h4>Overall, our findings reveal that elevated expression of circWWC3 serves a role in the malignant progression of TNBC by directly interacting with the S56 phosphorylation site of vimentin, an interaction that is associated with increased secretion of CSF2. Furthermore, circWWC3 emerges as a potential biomarker for breast cancer diagnosis and presents an attractive therapeutic target for the treatment of TNBC.

Also flagged:phosphoruscell wallmembranephotosynthesisisoflavonoidbiosynthesis
Journal Article 2025-10-08 No Snippets Liu X, Wang X, Zhang C, Zhang F, Zhao K, Yuan R, Lamlom SF, Zhang B, Ren H.
Show Full Abstract

<h4>Background and knowledge gap</h4>Phosphorus (P) deficiency is a major constraint to crop productivity worldwide, yet the molecular mechanisms behind stage-specific responses to severe P limitation during soybean development are not well understood. Although previous studies have looked at P stress responses, comprehensive multi-omics analyses across different developmental stages are missing, which limits our understanding of how P-efficient cultivars manage metabolic and transcriptional responses throughout their growth cycle.<h4>Objectives and methods</h4>This study used an integrated transcriptomic and metabolomic approach to analyze stage-specific responses to severe phosphorus limitation (99.875% reduction) in the P-efficient soybean cultivar Heinong 551 across four developmental stages: trefoil, flowering, podding, and post-podding.<h4>Results</h4>Metabolomic profiling identified 280 differentially expressed metabolites (DEMs) during trefoil and 851 during flowering, showing a threefold increase in metabolic disturbance during reproductive development. Transcriptomic analysis revealed 15,401 differentially expressed genes (DEGs) across stages, with 94% occurring in early phases (trefoil: 3,825; flowering: 10,660). Functional enrichment showed stage-specific responses, with the trefoil stage enriched in cell wall and membrane processes, and flowering enriched in photosynthesis, isoflavonoid biosynthesis, and cuticle development. Transcription factor analysis identified 87 differentially expressed transcription factors from 31 families, mainly <i>bHLH</i>, <i>bZIP</i>, and <i>WRKY</i>. Integrated multi-omics analysis under strict criteria (correlation coefficient |r| > 0.9) revealed networks between transcripts and metabolites, with flowering showing increased transcriptional control over metabolism. Key trade-offs included a shift from sucrose export to starch storage, suppression of nitrogen enzymes, and activation of antioxidant defenses despite oxidative damage. Physiological principal component analysis explained 92% of variance, distinguishing treatment groups and three metabolic clusters: carbon assimilation/export, nitrogen assimilation, and stress response.<h4>Conclusion</h4>Carbon metabolism exhibited compensatory mechanisms, including increased RubisCO and invertase activities, while nitrogen metabolism involved the downregulation of nitrate reductase, glutamine synthetase, and protein content. These findings reveal stage-specific molecular strategies used by P-efficient soybeans under severe limitation and inform sustainable agriculture practices aimed at optimizing crop performance in phosphorus-deficient conditions.

Also flagged:luciferasebioluminescenceenzymatic activitymetabolismarginase-1α-chymotrypsin
Journal Article 2025-10-08 No Snippets Sultana A, Geethakumari AM, Ahmed WS, Biswas KH.
Show Full Abstract

Molecular crowding has been shown to impact both enzymatic activity and protein conformation individually. However, a simultaneous assessment of its effect on the two parameters, especially in multidomain proteins, has not yet been reported. Here, utilizing multidomain proteins containing the mNeonGreen (mNG) fluorescent protein and the NanoLuc (NLuc) luciferase fused by either unstructured or α-helical linkers of different lengths, we report a differential impact of molecular crowding on the enzymatic activity and protein conformation in a linker and crowder size-dependent manner. Specifically, Gaussian accelerated molecular dynamics (GaMD) simulations with representative unstructured and α-helical linkers revealed differences in their structural dynamics. Simultaneous monitoring of enzymatic activity through NLuc bioluminescence and protein conformation through Bioluminescence Resonance Energy Transfer between NLuc (donor) and mNG (acceptor) revealed both polyethylene glycol molecular weight-dependent and linker length-dependent impacts on NLuc enzymatic activity and conformation of an unstructured linker-containing multidomain protein. Further, multidomain proteins containing α-helical linkers of different lengths revealed a pronounced impact of molecular crowding on NLuc enzymatic activity and a differential impact on protein conformation. Overall, through simultaneous monitoring of the impact of molecular crowding on enzymatic activity and protein conformation, we reveal a differential impact of molecular crowding on multidomain proteins containing different linkers and thus aid in further understanding the impact of molecular crowding on multidomain protein structure and function.

HTT
Also flagged:neurodegenerative diseasecytosineadenineguanineHDHuntington
Journal Article 2025-10-08 ✓ 2 Snippets Sumaiya T, Sultana R, Mridul MH.
In-Text Gene Mentions

…instability of theHTTgene, along with…

…The resultingHTTprotein causes dysfunction…

Show Full Abstract

Huntington's disease (HD) is an inherited, potentially incurable neurodegenerative disease. It typically presents as a triad of progressive psychiatric, cognitive, and motor symptoms and shows significant anticipation and penetrance. It is caused by trinucleotide CAG (cytosine, adenine, guanine) repeat expansion in the <i>Huntington</i> (<i>HTT</i>) gene. It exhibits significant anticipation, earlier onset in successive generations within a pedigree, which is caused by the instability of the <i>HTT</i> gene, along with a further increase in its length in subsequent generations. Reduced penetrance alleles of HD are relatively common in the general population. The threshold for disease is 35, with complete penetrance above 39 and incomplete penetrance for 36, 37, and 38 repeats. A series of three cases of HD have been discussed here, along with their pattern of presentation, anticipation, and genetic variation.

Also flagged:degradationmembranemembrane-polymersalkylaminescamptothecin
Journal Article 2025-10-08 No Snippets Liu Q, Ma D, Cheng H, Yang K, Hou B, Heng Z, Qian Y, Liu W, Chen S.
Show Full Abstract

Oral administration remains the most patient-friendly drug delivery route, yet its efficacy is limited by physiological barriers including gastric degradation and inefficient cellular uptake. pH-responsive nanogels have shown promise for gastrointestinal drug delivery, though their effectiveness is often constrained by poor membrane interaction. Inspired by natural membrane-anchoring mechanisms, a series of comb-like anionic polymers were designed via grafting alkylamines of different chain lengths (C<sub>10</sub>, C<sub>14</sub>, C<sub>18</sub>) at varying densities (10-30%) onto a biodegradable poly(L-lysine isophthalamide) (PLP) backbone. These pH-responsive comb-like polymers self-assembled into nanogels for loading the hydrophobic chemotherapeutic agent camptothecin. The alkyl length and grafting density significantly influenced pH-responsive behavior, membrane disruption, and drug release profiles. The optimal formulation-the nanogel prepared with PLP grafted 30% C<sub>14</sub>-achieved a high drug-loading capacity, ideal particle size and stability, and offered superior protection in acidic conditions (only 7 ± 5% release at pH 1.2 over 24 h), while enabling rapid intestinal release (78 ± 2% at pH 7.4 within 24 h). The nanogels significantly enhanced cellular uptake, cytoplasmic delivery, and cytotoxicity against colorectal carcinoma cells. This study demonstrates the key role of hydrophobic modification in designing effective oral nanocarriers, providing a promising platform for the treatment of intestinal diseases.

Also flagged:Dilated Cardiomyopathyheart muscle diseaseheart failuredeoxyribonucleic acidmethylationhistone modifications
Journal Article 2025-10-08 No Snippets Liu CF, Leon S, Tang WHW.
Show Full Abstract

Dilated cardiomyopathy (DCM) is a nonischemic heart muscle disease characterized by impaired contractility, cardiac dilation, and heart failure, with both genetic and nongenetic causes. Emerging evidence highlights epigenetic mechanisms, including deoxyribonucleic acid methylation, histone modifications, chromatin remodeling, and noncoding RNAs, as critical regulators of gene expression in DCM pathogenesis. This article explores familial DCM linked to pathogenic variants in genes like lamin A/C and titin, as well as nongenetic forms such as diabetic and autoimmune DCM. By summarizing recent discoveries, it highlights the epigenetic factors in bridging genetic and environmental influences, offering potential biomarkers and therapeutic targets for improved DCM management.

DCC
Also flagged:major depressive disorderbehavioraldendritic spinespinesdendritesdepression
Journal Article 2025-10-08 ✓ 5 Snippets Mahmud A, Hernandez G, Abboud F, Flores C.
In-Text Gene Mentions

…Guidance Cue ReceptorDCCAlters Corticolimbic Circuit…

DCC receptorsreceptors regulate neuronal…

…to investigate whetherDCC receptorsreceptors contribute to…

…prevented by downregulatingDCC receptorsreceptors in these…

DCC-expressing neurons in the…

Show Full Abstract

<h4>Background</h4>Elevated expression of the guidance cue receptor gene <i>DCC</i> in the adult prefrontal cortex (PFC) is a hallmark of major depressive disorder. DCC receptors regulate neuronal connectivity and plasticity in adulthood. In male mice, <i>Dcc</i> knockout in the PFC promotes resilience to behavioral dysregulation following chronic social defeat stress (CSDS), whereas <i>Dcc</i> upregulation increases susceptibility. However, the underlying mechanisms remain to be elucidated.<h4>Methods</h4>We combined CSDS, behavioral tests (i.e., social interaction, nestlet shredding, and dark-light tests), retrograde neuronal tracing, and quantitative neuroanatomical analysis in adult male mice (<i>N</i> = 90) to investigate whether DCC receptors contribute to stress susceptibility/resilience by remodeling dendritic spine architecture of selective PFC neuronal networks.<h4>Results</h4>CSDS reduced both mature and newly formed spines on the apical, but not basal, dendrites of PFC pyramidal neurons. This effect was prevented by downregulating DCC receptors in these neurons, a manipulation that also prevented depression-like behaviors, suggesting a mechanistic link. DCC-expressing neurons in the PFC predominantly projected to the nucleus accumbens, and social defeat stress induced dendritic spine loss specifically in projections from the infralimbic PFC. Notably, knockout of DCC receptors in infralimbic PFC neurons projecting to the nucleus accumbens shell protected against stress-induced social avoidance.<h4>Conclusions</h4>DCC receptors may influence susceptibility or resilience to social stress-induced depression-like behaviors by altering the apical dendritic architecture of PFC pyramidal neurons, particularly those projecting to the nucleus accumbens shell. This mechanism may be at play in the neurobiology of depression, pointing to DCC receptors as promising therapeutic targets.

HFE
Also flagged:positronLyme myocarditisLyme disease-borne illnessinfectionatrioventricular block
Journal Article 2025-10-08 ✓ 1 Snippet Joseph J, Birnie D, Nery PB, Small G.
In-Text Gene Mentions

…as sarcoidosis andhemochromatosis, myocardial ischemia, and…

Show Full Abstract

No abstract available.

SERPINC1
Also flagged:BivalirudinHeparinMembranethrombinantithrombin IIIdeficiency
Journal Article 2025-10-07 ✓ 2 Snippets Lofy T, Juul J, Duewell B, Tchen S, Held-Godgluck B, Brazauskas R, Feih J.
In-Text Gene Mentions

…requires antithrombin III (ATIII) for its activity,…

…risk for acquiredATIIIdeficiency.…

Show Full Abstract

<h4>Background</h4>Extracorporeal membrane oxygenation (ECMO), a form of temporary mechanical circulatory support, causes a prothrombotic state due to activation of inflammatory processes via exposure of blood to the circuit. Systemic anticoagulation is recommended to prevent thrombosis. Unfractionated heparin (UFH) and direct thrombin inhibitors (DTIs) are anticoagulant agents that inactivate thrombin; however, UFH requires antithrombin III (ATIII) for its activity, and patients supported by ECMO are at risk for acquired ATIII deficiency. In addition, heparin may cause heparin-induced thrombocytopenia, complicating therapy. Guidelines on anticoagulant use in ECMO reference UFH as a recommended agent with DTIs as an alternative option. Meta-analyses comparing the 2 agents in ECMO have evaluated efficacy and safety; however, discordant results prompt the need for additional research.<h4>Objective</h4>The objective of this study is to evaluate differences in bleeding and thrombotic events between UFH and bivalirudin for anticoagulation during ECMO support.<h4>Methods</h4>This study is a retrospective, single-center cohort study conducted at a primary ECMO center and a tertiary academic medical center.<h4>Results</h4>Bleeding and systemic thrombosis rates were not different between bivalirudin and UFH (30 vs 33 events, hazard ratio [HR] = 0.89; 95% confidence interval [CI] = 0.55-1.47, <i>P</i> = 0.7; 12 vs 17 events, HR = 0.68; 95% CI = 0.32-1.42, <i>P</i> = 0.3); however, when controlled for covariates, device thrombosis was lower with bivalirudin (30.2% vs 43.4%, <i>P</i> = 0.017). Time in therapeutic range (TTR) was higher with bivalirudin (69.98% vs 55.5%, <i>P</i> < 0.001).<h4>Conclusion and relevance</h4>When compared to heparin, bivalirudin for anticoagulation in ECMO was associated with a decreased rate of device thrombosis and greater TTR.

PTGIS
Also flagged:steroidogenesisandrogensteroidFoxl2Wnt4Igfbp5
Journal Article 2025-10-07 ✓ 1 Snippet Yin Q, Spradling AC.
In-Text Gene Mentions

…(0.61 ± 0.14),Ptgis(1.08 ± 0.26),…

Show Full Abstract

The earliest growing mouse follicles, wave 1, rapidly develop in the ovarian medulla, while the great majority, wave 2, are stored for later use as resting primordial follicles in the cortex. Wave 1 follicles are known to mostly undergo atresia, a fate sometimes associated with the persistence of steroidogenic theca cells, but this connection is poorly understood. We characterized wave 1 follicle biology using tissue clearing, lineage tracing, and scRNA-seq to clarify their contributions to offspring and steroidogenesis. Wave 1 follicles, lineage-marked by E16.5 <i>Foxl2</i> expression in granulosa cells, reach preantral stages containing theca cell layers by 2 weeks. Atresia begins about a week later, during which 80-100% of wave 1 follicles degrade their oocytes, turn over most granulosa cells, but retain theca cells which expand in number together with interstitial gland cells in the medulla. During puberty (5 weeks), these cells ultrastructurally resemble steroidogenic cells and highly express androgen biosynthetic genes. Unexpectedly, the <i>Foxl2</i> lineage tag also marked about 400 primordial follicles, located near the medullary-cortical boundary, that become the earliest activated wave 2 follicles. These 'boundary' or 'wave 1.5' follicles generate 70-100% of the earliest mature oocytes, while fewer than 26 wave 1 follicles with oocytes survive. Consistent with their largely distinct fates in steroid or oocyte production, granulosa cells of antral wave 1 and 2 follicles differentially express multiple genes, including <i>Wnt4</i> and <i>Igfbp5</i>.

DNAH10
Also flagged:idiopathic scoliosismineralluciferaseERK1IGF1metabolism
Journal Article 2025-10-07 ✓ 1 Snippet Xiang G, Xie J, Wang Y, Jiang Z, He S, Li J, Zhang H.
In-Text Gene Mentions

…genes, including DNAAF1,DNAH10, and POC5 […

Show Full Abstract

Adolescents with idiopathic scoliosis (AIS) often exhibit a slender body shape and reduced bone mass, even in the absence of evident vertebral deformities. Although prior studies have implicated microRNAs (miRNAs) in the development and progression of AIS, the precise mechanisms remain poorly understood. Therefore, primary osteoblasts and plasma samples from AIS patients and controls were isolated and associated mechanism was investigated in this study. We observed impaired osteogenic capacity of AIS-osteoblasts, and further identified a significant elevation of miRNA-130b-3p in AIS patients compared to controls through RNA sequencing of plasma samples. The expression levels of miR-130b-3p were validated in an independent cohort of 40 individuals using qPCR. Dual-energy X-ray absorptiometry showed reduced bone mineral density (BMD) in AIS patients. And the correlation analysis revealed a significant negative relationship between miR-130b-3p levels and BMD. Additionally, transcriptomic analysis and dual-luciferase assays confirmed that overexpression of miR-130b-3p in primary osteoblasts inhibited the activation of the ERK1/2 signaling pathway by targeting IGF1, thereby disrupting bone metabolism. Meanwhile, knockdown of miR-130b-3p in AIS-derived osteoblasts improved osteogenic function. In zebrafish, miR-130b-3p overexpression delayed vertebral development and induced spinal deformities. In summary, this study identifies a significant increase of miR-130b-3p in AIS patients and demonstrates its role in impairing osteogenic function through suppression of the IGF1/ERK signaling pathway.

DCC
Also flagged:chromatinTRPV1kinasesynapsesaxontranslational
Journal Article 2025-10-07 ✓ 4 Snippets Toikumo S, Parisien M, Leone MJ, Srinivasan C, Yu H, Arendt-Tranholm A, Franco-Enzástiga Ú, Hofstetter C, Curatolo M, Luo W, Pfenning AR, Seal RP, Kember RL, Price TJ, Diatchenko L, Waxman SG, Kranzler HR.
In-Text Gene Mentions

…axon guidance (DCCand SLIT2 ),…

…neuron projection (DCC, PTPRO ,…

…netrin 1 receptorDCCand sodium transporter…

…DAR-gene associations involvedDCCand SLC4A10 ,…

Show Full Abstract

Chronic pain is a complex clinical problem comprising multiple conditions that may share a common genetic profile. GWAS have identified many risk loci whose cell-type context remains unclear. Here, we integrated GWAS data on chronic pain with single-cell RNA-Seq (scRNA-Seq) data from human brain and dorsal root ganglia (hDRG) and single-cell chromatin accessibility data from human brain and mouse dorsal horn. Pain-associated variants were enriched in glutamatergic neurons, mainly in the prefrontal cortex, hippocampal CA1-3, and amygdala. In hDRG, the hPEP.TRPV1/A1.2 neuronal subtype showed robust enrichment. Chromatin accessibility analyses revealed variant enrichment in excitatory and inhibitory neocortical neurons in the brain and in midventral neurons and oligodendrocyte precursor cells in the mouse dorsal horn. Gene-level heritability in the brain highlighted roles for kinase activity, GABAergic synapses, axon guidance, and neuron projection development. In hDRG, implicated genes were related to glutamatergic signaling and neuronal projection. In cervical DRG of patients with acute versus chronic pain, scRNA-Seq data from neuronal or non-neuronal cells were enriched for chronic pain-associated genes (e.g., EFNB2, GABBR1, NCAM1, SCN11A). This cell-type-specific genetic architecture of chronic pain across central and PNS circuits provides a foundation for targeted translational research.

ZNF664
Also flagged:DecitabinemethylationDNA methyltransferasesDNMTsgene expressionribosome
Journal Article 2025-10-07 ✓ 1 Snippet Perera E, Navarro-Guillén C, Román-Padilla J, Huesa-Cerdán R, Hidalgo-Perez JA, Martos-Sitcha JA, Martínez-Rodríguez G, Alpízar-Pedraza D, Fernandes JMO, Rodriguez-Casariego JA.
In-Text Gene Mentions

…3, trmt1 ,znf664-like, tma16 ).…

Show Full Abstract

Epigenetic manipulations have the potential to improve traits in farmed fish. To explore this opportunity in the gilthead seabream (<i>Sparus aurata</i>), the catalytic domains of five DNA methyltransferases (DNMTs) were predicted by homology modeling, and their interaction with the inhibitor 5-aza-2'-deoxycytidine (DAC) was assessed by docking, revealing that the inhibitor can bind all DNMTs with similar energy. Then, pituitary and liver explants from gilthead seabream were exposed to DAC for 24 h, and changes in genome-wide DNA methylation (RRBS) and gene expression (RNA-seq) were assessed. In the liver, functional enrichment revealed upregulation of ribosome biogenesis and protein synthesis, while mitochondrial functioning, genome stability, and DNA and amino acid metabolism were downregulated. Exposed pituitaries displayed upregulation of ribosomal biogenesis and protein synthesis, alongside mitochondrial functioning and genome stability. Nucleotide-level methylomes were obtained for the first time in this species, with hypomethylated sites observed in 3'UTRs, promoter regions, and introns of highly expressed genes across both tissues. A higher level of DNA methylation at exons was found in highly expressed genes in the liver. The seabream pituitary was more permissive to DNA methylation remodeling than the liver. Functional Epigenetic Module analysis revealed seven interactome hotspots in liver and four in pituitary, mostly related to protein trafficking and signal transduction in the liver, and mitochondrial functioning in the pituitary, indicating that these functions can potentially be targeted by epigenetic interventions in seabream. The data resources generated in our study may be used to explore novel avenues to boost seabream performance and welfare.

ZNF311
Also flagged:SMOC1type 2 diabetes-nucleusinsulinsecretion
Journal Article 2025-10-07 ✓ 1 Snippet Kang RB, Varela M, Oh E, Lee J, Zhang T, Karakose E, Stewart AF, Scott DK, Thurmond DC, Garcia-Ocana A, Lu G.
In-Text Gene Mentions

…Among these genes,ZNF311, PAPPA2, TM4SF4…

Show Full Abstract

β-cell dysfunction and dedifferentiation towards an α-cell-like phenotype are hallmarks of type 2 diabetes. However, the cell subtypes involved in β-to-α-cell transition are unknown. Using single-cell and single-nucleus RNA-seq, RNA velocity, PAGA/cell trajectory inference, and gene commonality, we interrogated α-β-cell fate switching in human islets. We found five α-cell subclusters with distinct transcriptomes. PAGA analysis showed bifurcating cell trajectories in non-diabetic while unidirectional cell trajectories from β-to-α-cells in type 2 diabetes islets suggesting dedifferentiation towards α-cells. Ten genes comprised the common signature genes in trajectories towards α-cells. Among these, the α-cell gene SMOC1 was expressed in β-cells in type 2 diabetes. Enhanced SMOC1 expression in β-cells decreased insulin expression and secretion and increased β-cell dedifferentiation markers. Collectively, these studies reveal differences in α-β-cell trajectories in non-diabetes and type 2 diabetes human islets, identify signature genes for β-to-α-cell trajectories, and discover SMOC1 as an inducer of β-cell dysfunction and dedifferentiation.

HFE
Also flagged:COVID-19chronic liver diseaseliver fibrosisobesityimmunosuppressioncoronavirus disease
Journal Article 2025-10-07 ✓ 1 Snippet Blaise L, Lebossé F, Costentin C, Ahmed SS, Heurgué A, Fontaine H, Meszaros M, Radenne S, Vanlemmens C, Landrieux A, Bouzbib C, Barraud H, Bardou-Jacquet E, Chazouillères O, Latournerie M, Rosa I, Anty R, Gelu-Simeon M, Khaldi M, Amaddeo G, Lemaitre C, Bernard-Chabert B, Moga L, Roulot-Marullo D, Elkrief L, Boursier J, Plessier A, Bureau C, Pageaux GP, Rémy AJ, Sultanik P, de Ledinghen V, Reboux N, Texier F, Hiriart JB, Montialoux H, de Montigny S, Rudler M, Williet N, Talib Z, Mboup B, Bourlière M, Vicaut E, Ganne-Carrié N, Dumortier J.
In-Text Gene Mentions

…hepatitis, biliary disease,hemochromatosis, porto-sinusoidal liver disea…

Show Full Abstract

The deleterious impact of Coronavirus SARS CoV-2 related Disease (COVID-19) in patients with chronic liver disease (CLD) has been previously described. We report here data from the largest French "real-life" cohort. Patients with CLD regardless of etiology and liver transplant recipients who developed COVID-19 confirmed by a positive PCR and/or an evocative chest CT scan were included. The primary outcome was 30-days mortality. Prognostic factors were analyzed using both uni- and multivariate models in subgroups of transplanted and non-transplanted patients. Between August, 2020, and December, 2021, 1219 patients were included, mostly men (n = 754), median age 61 years, 477 patients with advanced CLD (decompensated (Child-Pugh B or C) in 164 patients); 366 patients were immunocompromised, including 271 organ transplant recipients. Hospitalization in intensive care unit was required in 11% of cases. The median follow-up was 68 days. The overall 30-days mortality was 13% (159 deaths, 62% related to extra-hepatic causes). Among transplant recipients, age was the only independent prognostic factor. In the non-transplanted population, the independent prognostic factors were advanced liver fibrosis (F3 or F4, HR 2.5), obesity (HR 1.56) and age (HR 1.03), whereas immunosuppression was not. Within the subgroup of patients with advanced CLD, decompensation (Child-Pugh B or C) was an independent predictor of mortality (HR 3.8). In conclusion, our results highlight the increased vulnerability of patients with advanced CLD to COVID-19, particularly those with decompensated disease. Conversely, they confirm the absence of excess mortality related to immunosuppression, particularly in organ transplant recipients. Clinical trial registration: Clinical trial (NCT 04,375,670).

MLLT10
Also flagged:acute myeloid leukemiaAMLacute leukemiachildhood leukemialeukemiaTumor
Journal Article 2025-10-07 ✓ 2 Snippets Voss RK, Pastor Loyola VB, Cardenas MF, Kumar P, Maciaszek JL, Namwanje M, Ma J, Neary JL, Jin M, Umeda M, Wilkinson MR, Payne-Turner D, Eldomery MK, Ma J, Gu J, Dalton J, Melton S, Liu YC, Foy S, Rusch M, Wheeler DA, Zhang J, Nichols KE, Karol SE, Inaba H, Ribeiro R, Rubnitz JE, Klco JM, Wang L.
In-Text Gene Mentions

…:MRTFA (SJ030209), and KMT2A::MLLT10(SJ030361), were only…

…fusion and a TEC::MLLT10(rarely reported in-frame…

Show Full Abstract

Pediatric acute myeloid leukemia (AML) exhibits distinct genetic characteristics, including unique driver alterations and mutations with prognostic and therapeutic implications. Cytogenetics study, along with Next Generation Sequencing (NGS) panel testing, have long been the standard for molecular diagnosis of AML. While these approaches enable diagnosis and prognosis determination in most cases, they have limitations-particularly in detecting emerging rare, recurrent genetic abnormalities. In this study, we systematically reviewed our real-time clinical experience with the diagnostic workup of pediatric AML using an integrated whole genome and whole transcriptome sequencing (iWGS-WTS) approach and compared the test results obtained from various methodologies, including whole genome sequencing (WGS), whole exome sequencing (WES), whole transcriptome sequencing (WTS), iWGS-WTS, cytogenetics, and targeted panel NGS. Our findings demonstrate that the iWGS-WTS approach improves the identification of clinically relevant genetic alterations, enhancing precise disease classification and risk assessment. Additionally, the iWGS-WTS approach streamlines sample acquisition and reduces testing redundancy, positioning it as a practical and superior alternative to traditional diagnostic methods in pediatric AML management.

SERPINC1
Also flagged:CoagulationHemebindingMASP1A2MSERPING1
Journal Article 2025-10-07 ✓ 1 Snippet Sun SS, Zhang HT, Yan HW, Kang XY, Buren QQ, Wang QC, Ming M, Feng JR, Zhu N, Li X, Ling Y, Zhang D, Wu XD, Yuan S, Fu HP.
In-Text Gene Mentions

…, ITGAM ,SERPINC1, MBL1 ,…

Show Full Abstract

High-altitude environments are characterised by extreme conditions, including hypoxia, low temperatures, and intense ultraviolet radiation. Mammals inhabiting these environments have evolved unique adaptive mechanisms, the study of which elucidates survival strategies and evolutionary pathways under extreme conditions. Understanding how native high-altitude animals respond to such environments is highly important. This study investigated the high-altitude adaptation mechanisms of the five-toed jerboa (Orientallactaga sibirica) distributed in Qinghai Province (4229 m) and Hebei Province (498 m), China, through comparative transcriptomic analysis of heart, lung, and kidney tissues. The results revealed greater mRNA transcriptional differences in the lung tissue than in the heart and kidney tissues of high-altitude jerboas, indicating heightened lung sensitivity to high-altitude conditions. In lung tissue, high-altitude jerboas show differential expression of genes related to the Complement and Coagulation cascades, Heme binding, Oxidation-reduction process (such as MASP1, A2M, SERPING1, CD55, FGA, C5AR1, and KNG1), which may be associated with modulating immune functions to mitigate hypobaric hypoxia, intense radiation, and cold-induced damage and reducing thrombosis and inflammation risks. Heart tissue exhibits differential expression of Oxidative phosphorylation and Lipid metabolism genes (such as NDUFC2, NDUFA3, NDUFS4, COX4I2, PAFAH1B3, SGMS2 and PPAR2B), which may help maintain energy equilibrium under hypoxic and cold challenges. Kidney tissue exhibits differential enrichment of pathways such as arachidonic acid metabolism and steroid hormone biosynthesis mediated by genes including CYP4A11, CYP2C29, GPX2, PTGDS, CBR1, and UGT2B31, which may help coordinate vascular regulation, immune response, and oxidative balance to maintain systemic homeostasis. These pathways and genes are differentially enriched and expressed between high-altitude and low-altitude five-toed jerboas, which may be candidates for further functional studies of plateau environmental adaptability. Our findings provide candidate genes and pathways for intraspecies adaptations across microenvironments and highlight the need for further functional validation.

HTT
Also flagged:mental disordersHTR2Amajor depressive disorderbipolar disorderschizophrenia5-hydroxytryptamine receptor 2A
Journal Article 2025-10-07 ✓ 3 Snippets Del Casale A, Gentile G, Arena JF, Modesti MN, Zocchi C, Mancino S, De Luca O, Angeletti G, Ferracuti S, Preissner R, Pompili M, Simmaco M, Borro M.
In-Text Gene Mentions

…was involved in5-HTTbinding in the…

…be involved in5-HTTexpression, trafficking, and…

…Further supporting this,5-HTTavailability in the…

Show Full Abstract

<h4>Background</h4>This study investigates the role of genetic variations in the 5-Hydroxytryptamine Receptor 2A (HTR2A) gene in subjects with treatment-resistant obsessive-compulsive disorder (TR-OCD), compared to individuals with other treatment-resistant mental disorders (TRMDs). The goal is to explore whether specific HTR2A polymorphisms contribute to distinguishing TR-OCD from other TRMDs, thereby advancing our understanding of the underlying pathophysiological mechanisms.<h4>Methods</h4>A retrospective observational study was conducted with 210 individuals affected by TRMDs (72 with major depressive disorder, 62 with bipolar disorder, 37 with schizophrenia, 30 with OCD, and 9 with other diagnoses). Genetic analyses focused on three HTR2A single nucleotide polymorphisms (SNPs) (rs6314, rs7997012, and rs6311), using next-generation sequencing from blood samples. Chi-square testing and single- and multiple-SNP analyses were employed to study the association between these SNPs and the TR-OCD diagnosis.<h4>Results</h4>The analysis revealed that the HTR2A rs7997012 A|A vs. G|G genotype was significantly associated with a higher likelihood of belonging to the TR-OCD group compared to other TRMDs, with an odds ratio of 6.85 (95% CI = 2.44-19.26; p < 0.001). The same genotype, compared to the combined G|G and A|G genotypes, showed a significant association with TR-OCD (OR = 7.68; 95% CI = 2.90-20.34; p < 0.001). Haplotype analyses demonstrated a significant global association between the combined rs6314-rs7997012-rs6311 variants and TR-OCD (p = 0.028). Specifically, the G-G-C haplotype was significantly associated with a reduced likelihood of TR-OCD (OR = 0.32; 95% CI = 0.11-0.93; p = 0.038) compared to the reference haplotype G-G-T.<h4>Conclusions</h4>This preliminary study identifies the rs7997012 polymorphism in the HTR2A gene as a potential genetic marker for TR-OCD, distinguishing it from other TRMDs. The study of rs7997012 and other genetic variants within the serotonergic system may enhance our understandings of the biological mechanisms underlying OCD and contribute to the development of precision psychiatry approaches.

Also flagged:CCKNeuropeptideZBTB20GlioblastomaGBMcentral nervous system cancer
Journal Article 2025-10-07 No Snippets Dakal TC, Sharma NK, Yadav V, Kumar A, Chen P, Schmidt-Wolf I, Maciaczyk J, Sharma A.
Show Full Abstract

Glioblastoma (GBM), the most malignant central nervous system cancer, has a median survival rate of 14–16 months. GBM patients have a poor prognosis despite rigorous multi-modal treatments like surgical resection, chemotherapy, and radiation. A systematic bioinformatics analysis of GXA gene expression datasets showed thirty-three overexpressed genes in GBM that were enriched in neuroactive ligand receptor interaction. Subsequently, bulk brain tissue gene expression profiling showed high to moderate expression of CCK, VGF, APLN, CNR1, GRIA4, and PDYN in the cortex, frontal cortex-BA9, BA24 region, cerebellar hemisphere, cerebellum, hippocampus, amygdala, basal ganglia, hypothalamus, substantia nigra, and spinal cord. Interesting, the cortex, frontal cortex-BA9, and BA24 regions had unbelievably high CCK expression. Brain cortex and frontal lobe mutational scoring showed significant rates of IDH1 (49%), TERT (25%), SETD2 (17%), and BRAF (9%). We initially confirmed glioblastoma (GBM) malignancy and therapeutic responses to CCK overexpression and IDH1 mutations in cerebral cortex and frontal cortex tissue samples. However, Mann–Whitney analysis revealed ZBTB20 mutations cause CCK expression, not IDH1 mutations. Overall, CCK expression and ZBTB20 mutations may be used in therapeutic treatments as predictive and diagnostic markers. The expression of CCK was not linked with overall survival and excludes its potential application as prognostic biomarker for GBM. This study showed that CCK and ZBTB20 based predictive and diagnostic technologies can improve precision and personalization of targeted cancer therapies for GBM patients. Nevertheless, experimental evidences have yet to reveal additional therapeutically meaningful connections between CCK expression and ZBTB20 mutations.

DCC
Also flagged:RBM15RNA-binding proteinaxonNova1Nova2NTN1
Journal Article 2025-10-07 ✓ 5 Snippets Harms FL, Kortüm F, Alawi M, Staudt M, Kutsche K.
In-Text Gene Mentions

…between Rbm15 andDccsupports a role…

DCC, NTN1 ,…

Dccalternative splicing generates…

…alternative splicing generatesDcclong and Dcc…

…Dcc long andDccshort isoforms, which…

Show Full Abstract

Congenital mirror movements (CMMs) are involuntary movements of one side of the body that mirror intentional movements of the opposite side. DCC, NTN1, RAD51, ARHGEF7, and DNAL4 have been associated with CMMs. Two-thirds of CMM-affected individuals remain without a genetic diagnosis, indicating that variants in additional genes need to be discovered. We report on a 27-year-old female with CMMs of the hands. Trio exome sequencing in the proband and healthy parents did not reveal a likely pathogenic variant in one of the CMM-associated genes but rather a de novo heterozygous frameshift variant c.523dup (p.Ser175Lysfs∗8) in the candidate RBM15. The variant results in only partial nonsense-mediated mRNA decay of RBM15 transcripts in the proband's lymphoblastoid cells. RBM15 encodes an RNA-binding protein involved in alternative splicing as well as other processes. Dcc alternative splicing generates Dcc<sub>long</sub> and Dcc<sub>short</sub> isoforms, which are important for commissural axon midline crossing. We tested whether Rbm15 regulates Dcc alternative splicing by using an in vitro minigene assay. Ectopic expression of Rbm15, similar to the splicing factors Nova1 and Nova2, promotes the production of Dcc<sub>long</sub> transcripts. The possible link between Rbm15 and Dcc supports a role for Rbm15 in CMMs.

Also flagged:CarbonNitrogencollagendegradationtestosteroneestradiol
Journal Article 2025-10-07 No Snippets Brenning M, Longstaffe FJ, Miller JH, Fraser D.
Show Full Abstract

Populations of Arctic barren-ground caribou (<i>Rangifer tarandus groenlandicus</i>) have fluctuated over the past few decades but are currently in decline. To support conservation efforts of caribou, it is integral to develop both historical and modern datasets; these datasets allow us to understand how caribou have adapted to past climatic shifts and may respond to future change. Caribou are the only extant species in which both males and females grow antlers each year, providing unique sex-specific isotope datasets. Isotopic study of antlers is proving to be a source of annualized data on caribou diet and migration, but uncertainty remains in the magnitude and drivers of isotopic changes across individual antlers. Nitrogen (δ<sup>15</sup>N<sub>Col</sub>) in male antlers from the Qamanirjuaq herd has been shown to increase along the main antler beam aligned with known shifts in seasonal diet and/or the increased energy requirements. We examined 19 female antlers from the same population to compare δ<sup>13</sup>C<sub>Col</sub> and δ<sup>15</sup>N<sub>Col</sub> between sexes and among varying reproductive statuses. Female antlers were found to be ~0.4‰ lower in δ<sup>13</sup>C<sub>Col</sub> at the bases of their antlers compared to males. In both sexes, caribou antler collagen varied in δ<sup>13</sup>C<sub>Col</sub> among individuals by ~2‰ (-20.0‰ to -18.1‰) and in δ<sup>15</sup>N<sub>col</sub> by ~5‰ (+2.3‰ to +7.3‰). We conclude that δ<sup>13</sup>C<sub>Col</sub> differences between sexes are the result of differing diets during the onset of antler formation, corresponding to the different seasons that females and males initiate antler growth. Despite dietary differences, both males and females increased in δ<sup>15</sup>N<sub>Col</sub> along the antler beam by approximately 1‰-1.5‰. Increases in δ<sup>15</sup>N<sub>Col</sub> along the antler beam coincide with the increased physiological stress and material demands during antler development. Antler tissue remains a promising resource for studying both short- and long-term changes in male and female caribou ecology.

BTN2A1
Also flagged:trogocytosiscancerCD3CD28tumorendometrial cancer
Journal Article 2025-10-07 ✓ 5 Snippets Billon E, Imbert C, Bruyat D, Grassi P, Robert L, Fernez T, Livrati P, Ben Amara A, Rouvière MS, Richaud M, Boucherit N, Nunès JA, Sabatier R, Lambaudie É, Chrétien AS, Gravis G, Gorvel L, Olive D.
In-Text Gene Mentions

BTN2A1acquisition through trogocytos…

…targeting BTN3A orBTN2A1are under development,…

…report that lymphocytes'BTN2A1expression increases with…

…For instance,BTN2A1can be acquired…

…acquired by theBTN2A1-knockout (BTN2A1KO) B cell…

Show Full Abstract

Butyrophilins (BTNs) are emerging as novel druggable immune targets in oncology, promoting the activation of gamma delta (γδ) T cells against cancer cells. Therapies targeting BTN3A or BTN2A1 are under development, but their regulation is poorly understood. Here, we report that lymphocytes' BTN2A1 expression increases with CD3/CD28 stimulation, mediated by trogocytosis in the presence of activated myeloid cells. For instance, BTN2A1 can be acquired by the BTN2A1-knockout (BTN2A1KO) B cell line through trogocytosis when cultured with monocytes. In addition, cytotoxicity assays determine that BTN2A1-acquired normal or tumor cells exhibit higher sensitivity to Vγ9Vδ2 T cell lysis. Finally, we show that trogocytosis-mediated acquisition of BTN2A1 by circulating lymphocytes involves activated monocytes and is correlated with endometrial cancer stage in a cohort of 87 patients. This study provides new insights about the regulation and functions of BTN2A1 but also highlights the potential impact of trogocytosis in regulating the expression of immune checkpoints in normal and pathological conditions.

PRDX6
Also flagged:GLP-1 receptorpolycystic ovary syndromePCOSGlucagon-like Peptide-1 ReceptorGLPinsulin resistance
Journal Article 2025-10-07 ✓ 2 Snippets Hoteit BH, Kotaich J, Ftouni H, Hazime F, Safawi A, Masri R, Marwani M.
In-Text Gene Mentions

…as Peroxiredoxin 6 (PRDX6) and Fibronectin 1…

…3 amino-terminal peptidePRDX6peroxiredoxin 6 RAAS…

Show Full Abstract

Polycystic ovary syndrome (PCOS) is a prevalent disorder in the modern world, affecting around 6%-20% of females of childbearing age. Hormonal and metabolic symptoms vary over time but often arise throughout puberty. Treatment includes lifestyle interventions as a first line of treatment. In certain cases, specific medications may be considered. However, there is a growing interest in using Glucagon-like Peptide-1 Receptor Agonists (GLP-1RAs) in PCOS due to their efficacy in weight loss, insulin resistance, and heart health. Aside from the metabolic role of GLP-1RAs, which aids in the relief of PCOS symptoms, there is also the possibility of direct involvement in reproductive health in PCOS, including its role in the hypothalamic-gonadal axis, menstrual irregularity, ovulation, ovarian morphology, anti-inflammatory properties, and fertility. This review discusses the latest data on GLP-1RAs' metabolic and reproductive health benefits in PCOS. Moreover, this article covers pharmaceutical interactions and synergistic effects of drugs, including metformin and other medications, with GLP-1RAs. It also conveys an overview of recent clinical trials utilizing GLP-1RAs to treat PCOS.

HFE
Also flagged:disccalciumhydroxyapatitenucleusradicular compression syndrometorticollis
Journal Article 2025-10-07 ✓ 1 Snippet Zongo YE, Ayouba Tinni I, Guingani HH, Bayala YLT, Ouedraogo A, Kabore F, Zabsonré/Tiendrebeogo WSJ, Ouedraogo DD.
In-Text Gene Mentions

…osis, hyperparathyroidism, andhemochromatosis[ 5 ,…

Show Full Abstract

We report an intervertebral disc calcification in a Black African child who had consulted us for neck pain. The diagnosis of C2-C3 intervertebral disc calcification was made on a standard X-ray and CT scan. Treatment was exclusively conservative. Intervertebral disc calcifications in children are rare and benign, requiring long-term monitoring.

Also flagged:Synthesisnuclear factor-2Nrf2response to oxidative stressmitochondrialnuclear factor-κB
Journal Article 2025-10-07 No Snippets Cordaro M, Neri G, Ansari SAMK, Buccheri R, Scala A, Piperno A.
Show Full Abstract

This review provides a comprehensive overview of the therapeutic potential of omaveloxone (OMA) for the treatment of Friedreich's ataxia (FA), along with an analysis of the historical development and current status of the synthetic strategies for OMA production. OMA activates the nuclear factor-2-(erythroid-2)-related (Nrf2) pathway in vitro and in vivo, in both animal models and humans. The Nrf2 pathway plays a crucial role in the cellular response to oxidative stress. Furthermore, OMA has been shown to mitigate mitochondrial dysfunction, restore redox homeostasis and downregulate nuclear factor-κB (NF-κB), a key mediator of inflammatory responses. Through these mechanisms, OMA contributes to tissue protection and inflammation reduction in patients with FA. The review also highlights future perspective, focusing on the challenges associated with OMA reprofiling through innovative drug delivery approaches and its potential repurposing for diseases beyond FA.

Also flagged:genetic diseasesdentatorubral pallidoluysian atrophybulbar muscular atrophynucleusHDdeath
Journal Article 2025-10-07 No Snippets Deleanu R.
Show Full Abstract

Several genetic diseases affecting the human nervous system are incurable and insufficiently understood. Among them, nine rare diseases form the polyglutamine (polyQ) family: Huntington's disease (HD), spinocerebellar ataxia types 1, 2, 3, 6, 7, and 17, dentatorubral pallidoluysian atrophy, and spinal and bulbar muscular atrophy. In most patients, these diseases progress over decades to cause severe movement incoordination and neurodegeneration. Although their inherited genes with tandem-repeat elongations and the encoded polyQ-containing proteins have been extensively studied, the neuronal-type-specific pathologies and their long pre-symptomatic latency await further investigations. However, recent advances in detecting the single-nucleus transcriptome, alongside the length of tandem repeats in HD post-mortem brains, have enabled the identification of very high CAG repeat sizes that trigger transcriptional dysregulation and cell death in specific projection neurons. One challenge is to better understand the complexity of movement coordination circuits, including the basal ganglia and cerebellum neurons, which are most vulnerable to the high CAG expansion in each disease. Another challenge is to detect dynamic changes in CAG repeat length and their effects in vulnerable neurons at single-cell resolution. This will offer a platform for identifying pathological events in vulnerable long projection neurons and developing targeted therapies for all tandem-repeat expansions affecting the CNS projection neurons.

PTGIS
Also flagged:Fibromyalgiachronic syndromesleepcognitive impairmentpathogenesismitochondrial
Journal Article 2025-10-07 ✓ 1 Snippet Bonomi S, Oltra E, Alberio T.
In-Text Gene Mentions

…EDN1), prostacyclin synthase (PTGIS), and neurovascular peptides—…

Show Full Abstract

Fibromyalgia is a chronic syndrome characterized by widespread musculoskeletal pain, fatigue, non-restorative sleep, and cognitive impairment. Its pathogenesis reflects a complex interplay between central and peripheral mechanisms, including altered pain modulation, neuroinflammation, mitochondrial dysfunction, autonomic imbalance, and genetic and epigenetic factors. Evidence from neuroimaging, omics studies, and neurophysiology supports this multifactorial model. Epidemiological updates confirm a global prevalence of 2-8%, with a strong female predominance and a significant impact on quality of life and healthcare costs. Diagnostic criteria have evolved from the 1990 American College of Rheumatology tender points to the 2010/2011 revisions and the 2016 update, improving case ascertainment but still lacking objective biomarkers. Recent omics and systems biology approaches have revealed transcriptional, proteomic, and metabolic signatures that may enable molecularly informed stratification. Therapeutic management remains multidisciplinary, combining pharmacological interventions (e.g., duloxetine, pregabalin, milnacipran) with non-pharmacological strategies such as graded aerobic exercise and cognitive behavioral therapy. Emerging approaches include drug repurposing to target neuroinflammation, mitochondrial dysfunction, and nociceptive pathways. Despite promising advances, progress is limited by small sample sizes, heterogeneous cohorts, and lack of standardization across studies. Future priorities include large-scale validation of biomarkers, integration of multi-omics with clinical phenotyping, and the design of precision-guided trials. By synthesizing mechanistic insights with clinical evidence, this review provides an updated framework for the diagnosis and management of fibromyalgia, highlighting pathways toward biomarker-guided, personalized medicine.

Also flagged:SynthesisBrassinosteroidAndrostane-esterheterocyclic acid chlorides
Journal Article 2025-10-07 No Snippets Araya O, Núñez M, Mellado M, Olea AF, Espinoza-Catalán L.
Show Full Abstract

Brassinosteroid analogs with heterocyclic rings in the side chain are interesting because important biological activity has been shown by these compounds. Thus, herein, five 23-24-dinorcholane BR analogs with a heterocyclic ester function at C-22 were synthesized and fully characterized by different spectroscopic techniques. The acylation reaction at C-22, which is a key synthetic step, was carried out by two different methods, namely acylation with heterocyclic acid chlorides and Steglich esterification reaction. In both cases, the acyl derivatives were obtained with good yields. Additionally, a preliminary molecular docking study of BRI1-BAK1 complexes formed by these analogs and brassinolide was performed to estimate what their biological activity would be. Results indicate that the complex formed by the analog <b>36</b>, which has an indole group in the side chain, within the active site of BRI1-BAK1 is more stable than that formed by brassinolide. Additionally, molecular docking of a derivative having a benzoate function at C-22 and a F atom in the <i>ortho</i> position, <b>23</b>, shows a similar pose and interactions at the active site but the highest binding energy. As <b>23</b> has shown similar activity to brassinolide in the Rice Lamina Inclination Test, it is expected that <b>36</b> will also exhibit similar behavior.

NEGR1
Also flagged:developmental brain injuriesneurodevelopmental disordersperinatal brain injurieschromosomeautoantibodiesmaternal preeclampsia
Journal Article 2025-10-07 ✓ 2 Snippets Patel P, Ku J, Uzoaru I, Goldstein JA.
In-Text Gene Mentions

…that methylation ofneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1) and serotonin 2A…

Show Full Abstract

Neurodevelopment shapes how children think, move, and engage with their surroundings. Understanding the pathways underlying neurodevelopmental pathophysiology in the perinatal stage can inform intervention strategies to mitigate or reduce the severity and extent of developmental brain injuries. Early risk stratification enables timely therapies and resource planning during a critical period for the developing brain. Over the past decade, attention has turned to the placenta as a uniquely informative vantage point for the identification of pregnancies at high risk for adverse neurodevelopmental outcomes. Situated at the maternal-fetal interface, the placenta functions as a dynamic record of intrauterine conditions, integrating genetic and environmental signals into distinct and quantifiable biomarkers. Emerging evidence indicates these placental biomarkers may predict later neurodevelopmental outcomes, highlighting the organ's value in precision perinatal care. With this in mind, the objective of this scoping review will be to investigate the current use of placental biomarkers as predictors of neurodevelopmental outcomes in clinical practice, particularly the trisomies (T13, T18, T21). In the second section of this paper, we will focus on recent advancements and improvements in the use of placental biomarkers for diagnostic and prognostic purposes in other neurodevelopmental outcomes. Finally, this article concludes with a discussion of the impact of neuroplacentology in protocol development, risk stratification, and psychosocial wellness of pregnant women.

DCC
Also flagged:amino acidtranslationalRNA-binding proteincancersnucleotidepseudonucleotide
Journal Article 2025-10-07 ✓ 1 Snippet Cai J, Jin F, Cheng N, Xia J, Ye C.
In-Text Gene Mentions

…Similarly, DAC,DCC, and DACC features…

Show Full Abstract

Synonymous mutations, a unique class of genetic variants, do not change the amino acid sequence of the encoded protein. Despite this, they can impact protein stability and function through diverse molecular mechanisms. Such subtle alterations can contribute to disease initiation and progression, making the prediction of pathogenic synonymous mutations crucial for understanding disease mechanisms as well as improving clinical diagnosis and treatment. In this study, we introduce DRP-PSM, a novel method for predicting pathogenic synonymous mutations that integrates DNA, RNA, and protein-level biological features. Building upon our earlier method, DRP-PSM greatly expands the feature set by incorporating protein-level information alongside enriched DNA and RNA signatures. Our goal is to elucidate how features from distinct biological levels contribute to the pathogenicity of synonymous mutations and to construct a comprehensive, multilevel prediction framework. DRP-PSM systematically integrates DNA-, RNA-, and protein-level sequence and structural features. Experimental results indicate that DNA-level features contribute the most to prediction accuracy, followed by RNA-level features, whereas protein-level features add only marginal utility. Notably, incorporating additional sequence- and structure-based descriptors yielded little performance gain, while biological features such as DNA conservation and splicing effect consistently dominated. These findings highlight that synonymous mutations primarily exert pathogenic effects through perturbations in splicing or transcriptional efficiency, rather than through translational or post-translational processes. This insight enhances our mechanistic understanding of their biological impact and underscores regulatory mechanisms as key targets for future therapeutic intervention.

Also flagged:IsoindolinonepositronbindingtranslationalHDcarbon
Journal Article 2025-10-07 No Snippets Li Y, Wang L, Pei Z, Factor SA, Liang SH.
Show Full Abstract

Mutant huntingtin (mHTT) aggregates represent a key pharmacodynamic biomarker of Huntington's disease (HD). The development of positron emission tomography (PET) tracers targeting mHTT addresses a critical unmet need by enabling the noninvasive quantification of pathological burden <i>in vivo</i>. The first-generation tracer, [<sup>11</sup>C]-CHDI-180R, a benzoxazole derivative, laid the foundation for this effort. Subsequent analogs such as [<sup>11</sup>C]-CHDI-626 and [<sup>18</sup>F]-CHDI-650 were developed to improve <i>in vivo</i> performance; however, key challenges including limited metabolic stability and suboptimal selectivity persisted. To address these limitations, a recent study introduced a new class of isoindolinone-derived candidate tracers, including [<sup>11</sup>C]-CHDI-009, [<sup>18</sup>F]-CHDI-385, and [<sup>18</sup>F]-CHDI-386, identified through systematic structure-activity relationship (SAR) optimization. These next-generation tracers exhibit markedly enhanced binding affinity, selectivity, and translational potential, offering valuable tools to investigate mHTT pathology and its role in HD progression.

HTT
Also flagged:neurodegenerative disordersNeurodegenerative illnessesAlzheimer's diseaseParkinson's diseaseHuntington's diseaseAPP
Journal Article 2025-10-07 ✓ 1 Snippet Roy K, Syed M, Narad P, Sengupta A.
In-Text Gene Mentions

…like APP, SNCA,HTT, and C9orf72 mutations…

Show Full Abstract

Neurodegenerative illnesses such as Alzheimer's disease, Parkinson's disease, and Huntington's disease present with increasing neurodegeneration and derangement. Genomic mutations and epigenetic changes are known to be part of their causation. This particular chapter discusses the key genetic factors like APP, SNCA, HTT, and C9orf72 mutations that influence the development and course of the disease. Furthermore, we examine epigenetic mechanisms-DNA methylation, histone modification, and non-coding RNAs-that regulate gene expression and contribute to neuronal susceptibility. The discussion also focuses on environmental and behavioral factors that affect the epigenome, highlighting gene-environment interactions. Advancements in omics technology and integrative studies have enhanced comprehension of biological pathways and uncovered novel biomarkers and therapeutic targets. The chapter therefore integrates epigenetic and genetic viewpoints to elucidate the intricate regulatory processes responsible for neurodegeneration and highlights potential avenues for early diagnosis, precision medicine, and therapeutic interventions aimed at remodeling disease pathways.

HFE
Also flagged:end-stage liver diseasecalciumcoronary artery diseaseStenosisacute myocardial infarctionsST-elevation MI
Journal Article 2025-10-07 ✓ 1 Snippet Lacaita PG, Finkenstedt A, Senoner T, Zoller H, Friedrich G, Pamminger M, Scharll Y, Widmann G, Feuchtner GM.
In-Text Gene Mentions

…MASH-LD, viral hepatitis,hemochromatosisand others presented…

Show Full Abstract

<h4>Background</h4>Cardiovascular risk stratification is crucial in patients with end-stage liver disease (ESLD) yet the optimal noninvasive strategy remains debated<b>.</b> Our study aimed to assess the prognostic value of coronary computed tomography angiography (CTA) and coronary artery calcium (CAC) in patients undergoing orthotopic liver transplantation (LT).<h4>Methods</h4>Patients with ESLD scheduled for LT referred to coronary CTA and the CACscore were included. The primary endpoint was all-cause mortality and the secondary endpoint was myocardial infarction (MI).<h4>Results</h4>Four hundred fifty-eight patients for pre-LT risk stratification were enrolled with 270 LT recipients (79.3% male; mean age 61 ± 8.5 years) finally being included. The mean follow-up was 7.5 ± 3.1 years, range: 2-13. Among 248 patients undergoing CTA, the majority (n = 173, 69.8%) had coronary artery disease (CAD) by CTA (Coronary Artery Disease-Reporting and Data System[CAD-RADS] 1-5), and n = 75 (30.2%) had no CAD. Stenosis severity was minimal-to-mild (<50%) in 112 (45.1%), intermediate (50-70%) in 44 (17.7%), and severe (>70%) in 17 (6.5%) patients. The all-cause mortality rate was 46 (17.0%) (n = 3 cardiovascular). Stenosis severity (CAD-RADS) was associated with mortality (Kaplan-Meier analysis, <i>P</i> < 0.001). On multivariate Cox regression, total plaque burden were associated with all-cause mortality (hazard ratio [HR]: 1.1, <i>P</i> = 0.034; 95% confidence interval [CI]: 0.649-0.983 and HR: 1.1, <i>P</i> = 0.029; 95% CI: 1.0-1.6), while the CAC score was not. Six acute myocardial infarctions (MIs, 3 ST-elevation MI [STEMI] and 3 non-STEMI) occurred, none of them (0%) in patients with CAD-RADS 0-1 and 100% CAD-RADS 2-4.<h4>Conclusion</h4>Coronary CTA is a valuable tool for pre-LT cardiovascular risk assessment. Patients with no or minimal CAD on CTA have an excellent prognosis regarding survival.<h4>Clinical relevance statement</h4>Coronary CTA enables refined risk stratification in patients undergoing liver transplantation by assessing stenosis severity and plaque burden.

bioRxiv 2025-10-07 Preprint (No Snippets API) Schwert H, Salur E, Richard M, Pöllmann M, Lesch K, Asan E, Schmitt-Böhrer A.
Show Full Abstract

Hyperactivity of the basolateral amygdaloid nuclear complex (BLA) is a hallmark of anxiety-related disorders in humans. Excitation of BLA projection neurons (PN) is fine-tuned by inhibitory interneurons (INs). Monoaminergic afferents to the BLA modulate PN and IN activity. In the present study, BLA-INs immunoreactive(ir) for parvalbumin (PV) or neuropeptide Y (NPY) and their interrelations with serotonergic and catecholaminergic afferents were analyzed in wildtype (WT) and serotonin transporter knockout (5-HTT KO) mice, a model for anxiety- and stress-related disorders. In WT mice, PV- and NPY-ir INs fall into morphological subgroups which possess perisomatic appositions by serotonergic and tyrosine hydroxylase-ir afferents. Dual immunolabeling shows no colocalization of PV and NPY. NPY/somatostatin(SOM) dual labeling documents colocalization of the peptides in some neurons, and single labeling for NPY or SOM in others. These features appear largely preserved in 5-HTT KO mice. However, quantification of PV- and NPY-ir neurons documents a reduction in number and density of NPY-ir neurons throughout the rostrocaudal extent of the amygdala in 5-HTT KO mice. PV-ir neurons remain unchanged. Quantitative PCR shows increased expression of Npy receptor 2, Som receptor 4, and corticotropin releasing factor receptor 1 in the BLA of 5-HTT KO mice. mRNA for the three peptides is unchanged, indicating that it may be NPY propeptide translation which is reduced in 5-HTT KO mice. Taken together, the results document an effect of life-long serotonin imbalance on the BLA NPY-system, which may contribute to previously observed morphological alterations in BLA PNs and increased anxiety-like behavior in 5-HTT KO mice.

DCC
Also flagged:TUBB2BRAD51NTN1tubulinopathiesTUBB3developmental delay
Journal Article 2025-10-06 ✓ 1 Snippet Shah S, Hegde AU, Rajarajan K, Panwala H.
In-Text Gene Mentions

…While mutations inDCC, RAD51, NTN1 and…

Show Full Abstract

<h4>Background</h4>Congenital mirror movements (CMM) are involuntary movements on one side of the body that mirror intentional movements on the opposite side, which persist in adult life. While mutations in DCC, RAD51, NTN1 and other genes have been associated with CMM, recent evidence suggests tubulinopathies, including TUBB3 mutations, may also contribute.<h4>Cases</h4>An 11-year-old girl with developmental delay and CMM was evaluated, along with her mother and sibling via clinical assessments, neuroimaging, and genetic analysis. Diffusion tensor imaging (DTI) was used to assess corticospinal tract abnormalities. A heterozygous TUBB2B variant was identified in all three affected individuals. DTI revealed reduced corticospinal tract decussation, similar to findings in other genetic causes of CMM.<h4>Conclusions</h4>This study highlights new phenomenology of congenital mirror movements associated with TUBB2B-related tubulinopathy, highlighting the role of TUBB2B mutations in neuronal migration, expanding the genetic spectrum of congenital mirror movements.

Also flagged:ferroptosisMetabolic dysfunctionsteatotic liver diseasemetabolic liver diseasechronic liver diseaseMetabolic dysfunction-associated steatohepatitis
Journal Article 2025-10-06 No Snippets Liu Y, Zhang M, Huang Y, Zhang Y, Zhu C, Guan J, Xia S, Liao J.
Show Full Abstract

Metabolic dysfunction-associated steatotic liver disease (MASLD), as a metabolic liver disease, is emerging as the most prevalent chronic liver disease worldwide. Metabolic dysfunction-associated steatohepatitis (MASH) is the severe form of MASLD, which progresses from simple steatosis to an inflammatory state, even fibrosis and hepatocellular carcinoma. Accumulating evidence has proved that cell death is a hallmark of MASH, while the specific pathogenesis remains unclear. Several cell deaths, including apoptosis, necroptosis, autophagy, and pyroptosis, have been studied in MASLD/MASH. In recent years, ferroptosis, a novel iron-dependent non-apoptotic form of cell death characterized by the excessive accumulation of intracellular iron and lipid peroxidation, has emerged as a promising target in MASLD/MASH. In this review, we mainly summarize the mechanism of ferroptosis and describe the role of ferroptosis in the progression of MASLD to MASH and related diseases, including liver fibrosis and hepatocellular carcinoma. Then, we discussed the crosstalk between ferroptosis and other cell deaths in MASLD/MASH. Finally, we focus on the potential therapeutic applications of targeting ferroptosis in MASH, which might shed light on the future directions of MASH treatment.

POU3F2
Also flagged:microtubule-associated protein doublecortinDCXcell proliferationcapsuletranscription factorBrn2
Journal Article 2025-10-06 ✓ 3 Snippets Freixes J, Abdel-Rahman FES, Nebbia R, Medina L, Desfilis E.
In-Text Gene Mentions

…transcription factor Brn2 (Pou3f2), suggesting the incorporatio…

…nuclei (NeuN) andPou3f2/Brn2 (Brn2), using specific…

…mmunofluorescence using Brn2 (Pou3f2) (which is expressed…

Show Full Abstract

Swine have an excellent sense of smell and highly complex olfactory brain structures, which play a crucial role in their complex social interactions. In other mammals the olfactory system is known to exhibit significant plasticity, even during adulthood. The aim of this study was to investigate postnatal plasticity in olfactory areas of juvenile swine brains by studying immature cells immunoreactive for the microtubule-associated protein doublecortin (DCX). Using immunofluorescence, we studied DCX coexpression with the cell proliferation marker Ki-67, and different neuronal markers. Our results show the existence of numerous DCX + cells throughout the olfactory pallial areas. In some of them, we found DCX+/Ki-67 + coexpressing cells, suggesting that they were proliferating. Some of these proliferating cells were grouped in tangentially-oriented migratory-like chains, forming the rostral migratory stream to anterior olfactory area and olfactory bulb. Moreover, chains of DCX + cells were found in the external capsule and white matter adjacent to the temporal horn of the ventricle. Chains of DCX + cells were observed crossing the internal layers of the piriform and entorhinal cortices. In layer II of these cortices, DCX + cells of varying maturity degrees and neuronal phenotypes (including NeuN expression) were present. This suggests the existence of multiple migratory streams along the anteroposterior axis. Most DCX + immature cells in the migratory chains and in the anterior olfactory area, piriform and entorhinal cortices expressed the transcription factor Brn2 (Pou3f2), suggesting the incorporation of new glutamatergic neurons in these areas. Together, these results highlight the interest of swine to study the role of postnatal brain plasticity and their potential for regeneration in large, gyrencephalic brains.

Also flagged:methylationhistone modificationschromatinspermatogenesisgene expressionhistone
Journal Article 2025-10-06 No Snippets Cui Y, Deng J, Zhang Y, Du L, Jiang F, Li C, Chen W, Zhang H, He Z.
Show Full Abstract

As key factors of cellular development, epigenetic regulation can accurately control gene expression through multiple manners, e.g., DNA methylation, histone modification, and chromatin remodeling complexes (CRCs). Epigenetic factors play pivotal roles in various kinds of cell processes, including cell proliferation, differentiation, and apoptosis, and diseases may be resulted from their dysfunction. Spermatogenesis refers to the complex process by which spermatogonial stem cells (SSCs) self-renew and differentiate into the differentiating spermatogonia that further develop to spermatocytes and mature spermatids. Significantly, epigenetic regulation has recently been shown to mediate fate determinations of SSCs to ensure normal spermatogenesis. Interestingly, much progress has recently been made in epigenetic regulation and their dysfunction in controlling spermatogenesis and male infertility, respectively. In this review, we address the dynamic expression patterns, functions and mechanisms of DNA methylation, histone modification, and CRCs in mediating the development of SSCs and spermatogenesis, and we also discuss the association between epigenetic dysfunction and male infertility. We further point out the perspectives in epigenetic regulation on human spermatogenesis. Our review on the in-depth analysis of epigenetic regulatory mechanisms in normal and abnormal spermatogenesis not only helps us better understand the etiology of male infertility but also provides novel targets for treating this disease.

UNC13C
Also flagged:innate immunitycomplementdependent cytotoxicitymembraneantibodiesadaptive immunity
Journal Article 2025-10-06 ✓ 1 Snippet van der Horst HJ, Csikós T, Quik M, van der Schans JJ, de Lint K, Nuñez Moreno G, Guan M, Karagoz K, Breij ECW, Santegoets KCM, Chamuleau MED, Roukens MG, Overdijk MB, Mutis T.
In-Text Gene Mentions

…signaling (e.g., NCALD,UNC13C, CACNA2D3, CADPS, STC2…

Show Full Abstract

Complement-dependent cytotoxicity (CDC) is an important effector function of various therapeutic antibodies. Cancer resistance to CDC is primarily attributed to extracellular factors. Using diffuse large B-cell lymphoma (DLBCL) models, we elucidated intracellular evasion mechanisms. By CRISPR-Cas9 library screening, we identified mitochondrial damage and reactive oxygen species as the key intracellular drivers of CDC. CDC resistance was linked to augmented mitochondrial mass, elongated mitochondria and reduced mitophagy, and decreased expression of actin-related genes. Actin downregulation in CDC-resistant cells occurred specifically within the mitochondria, connecting mitochondrial rearrangements and cytoskeletal dynamics with resistance. Stimulating actin polymerization could partially overcome CDC resistance. Of clinical significance, we observed a positive association between the cytoskeleton and antibody responses in DLBCL patient samples. In conclusion, our study unveils novel intracellular resistance mechanisms to antibody-induced CDC, highlighting the critical roles of mitochondrial rearrangements and cytoskeletal dynamics in CDC. We propose that decreased mitochondrial actin prevents overload of the mitophagy pathway, thereby reducing CDC.

NEGR1
Also flagged:type 2 diabetes mellitusmajor depressive disorderglucosemetabolismemotional dysregulationdepression
Journal Article 2025-10-06 ✓ 3 Snippets Xu J, Du X, Zhai Y, Zhao Q, Zhang Y, Wang H, Wu Y, Peng Y, Liu F, Zhang Q.
In-Text Gene Mentions

…, MON1A ,NEGR1, NICN1 ,…

…genes, GIGYF2 andNEGR1exhibited various abnormal…

NEGR1is associated with…

Show Full Abstract

Type 2 diabetes mellitus (T2DM) and major depressive disorder (MDD) are prevalent chronic conditions that frequently co-occur, suggesting potential shared mechanisms. Neuroimaging meta-analyses were conducted to identify gray matter volume (GMV) alterations in T2DM and MDD, with further identification of the overlapping regions between the two diseases. Large-scale genome-wide association study (GWAS) summary statistics were utilized, and conjunctional false discovery rate (conjFDR) analysis was applied to identify shared genes. Transcriptome-neuroimaging association and expression-trait association analyses were performed to identify and prioritize shared genes contributing to these structural brain changes. Knockout mouse models were employed to investigate the functional roles of the prioritized genes. Neuroimaging meta-analysis revealed significant GMV reductions in T2DM and MDD patients compared to controls, with overlapping decreases, such as the bilateral median cingulate gyri, right insula and superior temporal gyrus. ConjFDR analysis identified 664 genes shared between T2DM and MDD, with nine prioritized genes linked to GMV alterations. Knockout models of these genes revealed neural and metabolic abnormalities, highlighting their potential roles in shared neurobiological and metabolic pathways underlying both disorders. This integrative analysis identifies shared neuroimaging and molecular mechanisms between T2DM and MDD, offering novel insights into their comorbidity and underlying biological pathways.

ANKRD45ZNF664CCDC92
Also flagged:schizophreniapathogenesisMRsynaptic transmissionmicrotubuleDPYD
Journal Article 2025-10-06 ✓ 4 Snippets Li X, Fan L, Zhao Y, Li Y, Wang J, Xu S, Xia J.
In-Text Gene Mentions

…, KANSL1 ,ANKRD45, TBC1D5 ,…

⭐ same-sentence co-mention

…, CSPG4P12 ,CCDC92, ZNF664 ,…

⭐ same-sentence co-mention

…, CCDC92 ,ZNF664, CRELD2 ,…

…, DGKZ ,CCDC92, LRRN3 ,…

Show Full Abstract

Alternative splicing (AS) plays a vital role in the pathogenesis of schizophrenia (SCZ). Previous studies have linked the genetic signals from genome-wide association studies (GWAS) with expression quantitative trait loci (eQTL), but the interplay with other genetic regulatory mechanisms, particularly splicing QTL (sQTL), remains unclear. Here, we constructed a comprehensive disease-specific sQTL map to provide genetic variants that could alter gene activity through RNA splicing in SCZ. We analyzed data from 539 SCZ patients, identifying a total of 24,810 significant sQTLs (FDR < 0.05) involving in AS events of 7083 unique genes. By combining this with a large-scale SCZ GWAS, we employed Mendelian randomization (MR) and colocalization analyses to pinpoint 27 significant risk genes with genetic AS regulation that may play a causal role in SCZ. Additional differential splicing analysis of these genes in 539 cases and 754 controls revealed 12 significant genes that may increase SCZ risk due to their AS dysregulation. Notably, five genes (DPYD, LACC1, CCDC122, ANAPC7, and DGKZ) showed consistent splicing regulation effects in both MR analysis and differential splicing analysis. Pathway enrichment analysis of differentially spliced genes revealed potential biologically pathways relevant to SCZ, particularly in synaptic transmission and microtubule movement. Furthermore, single-cell RNA-seq analysis revealed that several genes were preferentially expressed in specific brain cell types, including oligodendrocytes, microglia, and excitatory neurons. Overall, our findings highlight several susceptibility genes that may contribute to SCZ risk by AS regulation. Further characterization of these genes could advance mechanistic understanding and therapeutic discovery for SCZ.

Also flagged:Endometrial cancerPTENcancerPI3KAKTTGFβ
Journal Article 2025-10-06 No Snippets Vidal-Sabanés M, Bonifaci N, Navaridas R, Egea J, Encinas M, Rodriguez-Barrueco R, Silva JM, Matias-Guiu X, Llobet-Navas D, Dolcet X.
Show Full Abstract

Endometrial cancer is the most frequent type of cancer in the female reproductive tract. Loss-of-function alterations in PTEN, leading to enhanced PI3K/AKT activation, are among the most frequent molecular alterations in endometrial cancer. Increased PI3K/AKT signaling resulting from PTEN loss promotes cellular proliferation and confers resistance to TGFβ-mediated apoptosis, a key regulator of endometrial homeostasis. In this study, we have analyzed the role of miRNAs in driving these altered cellular responses. A comprehensive transcriptomic analysis of miRNA expression revealed the upregulation of several miRNAs caused by PTEN deficiency and/or TGFβ stimulation. The miR-424(322)<sup>~</sup>503 cluster drew our attention due to its involvement in regulating apoptosis and proliferation. However, miR-424(322)<sup>~</sup>503 cluster has a paradoxical role in cancer, exhibiting either oncogenic and tumor suppressive functions depending on cell type or context. To ascertain the function of miR-424(322)<sup>~</sup>503 in endometrial carcinogenesis caused by PTEN deficiency, we generated a double Pten/miR-424(322)<sup>~</sup>503 knock-out mice. We demonstrate that loss of miR-424(322)<sup>~</sup>503 impairs proliferation of both wild type or Pten deficient endometrial organoids by interfering with growth factor and PI3K/AKT signaling. Furthermore, the absence of miR-424(322)<sup>~</sup>503 restores TGFβ-induced apoptosis, which is otherwise compromised by PTEN deficiency. In vivo, Pten/miR-424(322)<sup>~</sup>503 knock-out mice exhibit reduced endometrial cancer progression compared to Pten deficient mice through a cell-autonomous mechanism.

HFE
Also flagged:Transferrindry age-related macular degenerationironretinal diseasesferroptosisage-related macular degeneration
Journal Article 2025-10-06 ✓ 2 Snippets Youale J, Bigot K, Jaworski T, Lebon C, Françon A, Delaunay K, Bénard R, De Bastard T, Daruich A, Kaddour N, Bordet T, Behar-Cohen F, Picard E.
In-Text Gene Mentions

…diseases such ashemochromatosis[ 50 ],…

…observations from ahemochromatosisanimal model […

Show Full Abstract

Dysregulation of iron homeostasis plays a crucial role in retinal diseases, contributing to oxidative stress, inflammation, and ferroptosis, key processes that drive the degeneration of the retinal pigment epithelium (RPE) and photoreceptors in age-related macular degeneration (AMD). Previous studies, though limited in patient numbers, have reported elevated iron levels in the aqueous humor, RPE, and Bruch's membrane of AMD patients. In this study, we aimed to confirm iron imbalance in a larger cohort of AMD patients and assess its correlation with disease stage. Elevated iron levels and a reduction in transferrin (TF) iron-binding capacity were observed in patients with early geographic atrophy (GA). RPE cells derived from human stem cells exhibited AMD-like features when exposed to iron overload or oxidized lipids. Treatment with TF appeared to restore aspects of iron homeostasis and reduce oxidative stress, mitochondrial damage, inflammation, complement activation, and ferroptosis in this model. These findings suggest that TF supplementation may represent a potential therapeutic strategy to help prevent or slow AMD progression.

HTT
Also flagged:GSK3Proteolysisneurodegenerative diseasesE3 ligaseGlycogen Synthase Kinase 3CNS
Journal Article 2025-10-06 ✓ 1 Snippet Holmqvist A, Kocaturk NM, Duncan C, Riley J, Baginski S, Marsh G, Cresser-Brown J, Maple H, Juvonen K, Sathe G, Morrice N, Sutherland C, Read KD, Farnaby W.
In-Text Gene Mentions

…37 and Huntingtin (HTT) 38 were dramatically…

Show Full Abstract

Bifunctional targeted protein degraders, also known as Proteolysis Targeting Chimeras (PROTACs), are an emerging drug modality that may offer a new approach for treating neurodegenerative diseases. Identifying chemical starting points for PROTACs remains a largely empirical process and the design rules for identifying Central Nervous System (CNS) active PROTACs have yet to be established. Here we demonstrate a concept of using orthogonally reactive linker reagents, that allow the construction of screening libraries whereby the E3 ligase binder, the target protein binder and the linker can be simultaneously varied and tested directly in cellular assays. This approach enabled the discovery of Glycogen Synthase Kinase 3 (GSK3) PROTACs which are CNS in vivo active in female mice. Our findings provide opportunities to investigate the role of GSK3 paralogs in cellular and in vivo disease models and for the rapid discovery of in vivo quality bifunctional chemical probes for CNS disease concepts.

Also flagged:seed germinationpolypropylenestarchwatermineralsiron
Journal Article 2025-10-06 No Snippets Yousuf HMB, Yasin M, Rebouh NY, Aldawood AS, Ali U, Rosentrater KA.
Show Full Abstract

The current study assessed the effectiveness of five conventional and three hermetic storage facilities for extended storage of wheat grains under ambient storage conditions during two storage seasons (2023 and 2024). The findings indicated that hermetic storage facilities outperformed conventional ones throughout the six-month storage period. For instance, GrainPro PHB exhibited the minimal increase in grain moisture contents (0.50 and 0.33%), resulting in the least grain damage (2.38 and 2.44%) and weight loss (0.93 and 0.93%) during both years, respectively. Additionally, GrainPro PHB recorded the highest seed germination (90.50 and 90.33%) for both years. Compared to conventional storage methods, GrainPro PHB exhibited a lower number of storage insects. The proximate composition analysis revealed significant nutritional differences between polypropylene bags and GrainPro PHB. GrainPro PHB successfully maintained proximate composition, with minimal decreases in protein (1.03 and 0.71%), fat (16.88 and 14.95%), and starch content (0.8 and 0.5%) and minimal increases in ash (25.00 and 23.33%) and fiber contents (18.33 and 16.80%) in both years. Moreover, results revealed a positive correlation between grain moisture contents and damage parameters, suggesting that the higher moisture contents may aggravate the percent grain damage and weight loss. There were also better rheological properties in flour made from grains stored in GrainPro PHB, like a lower minimum water absorption capacity (WAC), a longer dough development time (DDT), and a maximum dough stability time (DST). Furthermore, texture profile analysis (TPA) of bread made from flour of grains stored in GrainPro PHB showed improved texture, with higher chewiness, cohesiveness, springiness, and resilience, and lower hardness, resulting in superior overall quality compared to bread made from conventionally stored grains. Eventually, these findings underscore the effectiveness of hermetic storage facilities in maintaining grain moisture contents, reducing losses, preserving seed quality, and enhancing food and nutrition security.

PEBP1
Also flagged:lung adenocarcinomaLUADSVBPHSDL1UBTD1GNPNAT1
Journal Article 2025-10-06 ✓ 1 Snippet Young CD, Carey KM, Dill CD, Nunez SK, Griffen TL, Dammer EB, Lillard JW.
In-Text Gene Mentions

…SVBP, UBTD1, BEND5,PEBP1, TMEM59 and denominator:…

Show Full Abstract

A comprehensive analysis of the transcriptomic landscape in early-stage LUAD (stages 1 and 2) can identify robust survival and staging predictors. Using a systems-biology approach with TCGA LUAD transcriptomic data, we identified 18 co-expression modules, 11 correlated with staging and 7 with survival. Five survival- and staging-associated (SAS) modules (M1, M3, M6, M9, and M16) distinguished patients with differing survival curves based on module eigengene expression. Anti-correlated SAS-modules (M3 and M6) exhibited the strongest associations with OS and staging. Key differentially-expressed hub genes from M3 and M6 were nominated as prognostic markers through iterative combinatorial ROC analysis. Survival prediction was refined by testing equal-weight gene ratios with opposing correlations to survival, revealing additive or synergistic predictive value. The top-performing ratio, ATP6V0E1 + SVBP + HSDL1 + UBTD1/GNPNAT1 + XRCC2 + TFAP2A + PPP1R13L, achieved an average AUC of 75.5% across three timepoints (12 months, 18 months, and 3 years). Comparison with three established LUAD prognostic signatures (Shedden, Soltis, and Song) within the TCGA network showed that our 8-gene signature had comparable or superior predictive power while maintaining concordance with existing signatures, some of which contain an order of magnitude more transcripts. Our findings suggest that novel gene signature holds promise for refining early-stage LUAD prognostic modeling and informing treatment strategies.

Also flagged:hydrogenperoxidestrontiumFluorapatitewatercalcium
Journal Article 2025-10-06 No Snippets Hong JY, Kang EJ, Kwon JS.
Show Full Abstract

This study evaluated the effects of 30% hydrogen peroxide (HP) solution incorporated with strontium-containing Fluorapatite (Sr-FAp) on whitening efficacy and enamel surface properties, aiming to minimize enamel damage during bleaching. A total of 60 extracted bovine teeth were stained with black tea and divided into five groups (n = 12): DW (distilled water), 30% HP, 1 wt% Sr-FAp + HP, 5 wt% Sr-FAp + HP, and 10 wt% Sr-FAp + HP. DW and HP solutions with or without Sr-FAp were applied three times for 20 min each. The surface color alteration, gloss, roughness, microhardness, and enamel microstructure were analyzed before and after bleaching. All experimental groups showed significantly higher ΔE<sub>ab</sub> values than those of the DW group (p < 0.05), with no significant differences between Sr-FAp concentrations (p > 0.05). ΔWI<sub>D</sub> and ΔE₀₀ followed similar trends. Gloss decreased in all HP-treated groups compared to the DW group (p < 0.05), with the 10 wt% Sr-FAp group showing the lowest gloss (p < 0.05). There were no significant differences in surface roughness (p > 0.05), whereas the 10 wt% Sr-FAp group showed the highest microhardness value (p < 0.05). Observations of the enamel surface revealed the presence of Sr-FAp nanoparticles in all Sr-FAp groups. HP containing Sr-FAp effectively whitened the teeth while preserving the enamel microhardness and structure via a protective Sr-FAp layer. Sr-FAp shows promise as a remineralizing filler for whitening treatments, maintaining whitening efficacy while minimizing enamel damage.

PEBP1
Also flagged:ferroptosistumorkidney cancerirondeathlipid
Journal Article 2025-10-06 ✓ 5 Snippets Chen S, Cheng X, Li Z, Fan H, Xue X, Ma K, Li J, Zhu F.
In-Text Gene Mentions

…and reveals thatPEBP1is an important…

…the identified genes,PEBP1showed elevated expression…

…this, we examinedPEBP1expression patterns and…

…results indicated thatPEBP1deletion was strongly…

…prognosis, while reducedPEBP1expression correlated with…

Show Full Abstract

Ferroptosis, an iron-dependent type of regulated cell death driven by excessive lipid peroxidation, plays an important role in natural tumor suppression. In this study, we identified 23 ferroptosis-related genes associated with prognosis in kidney cancer datasets. Based on the expression profiles of these genes, we classified kidney cancer into four distinct subtypes and constructed a 9-gene risk score to predict the prognosis of patients. Our analysis revealed that patients classified into group III and those in the low-risk group demonstrated significantly better survival probability. Moreover, the risk score exhibited strong predictive accuracy for the prognosis of kidney renal clear-cell carcinoma (KIRC) patients. Among the identified genes, PEBP1 showed elevated expression in both subtype III and the low-risk group, suggesting that it may act as a critical tumor suppressor. To further evaluate this, we examined PEBP1 expression patterns and their clinical correlations using TCGA-KIRC and KIRP cohorts. The results indicated that PEBP1 deletion was strongly associated with poor prognosis, while reduced PEBP1 expression correlated with advanced disease progression in both KIRC and KIRP patients. Functional enrichment analysis suggested that PEBP1 may be involved in pathways related to fatty acid metabolism and oxidative phosphorylation. Experimental validation supported these findings, showing that PEBP1 overexpression suppressed the proliferation and migration of kidney cancer cells. Additionally, PEBP1 promoted the accumulation of lipid reactive oxygen species (ROS), an effect that was reversed by a ferroptosis inhibitor. Conversely, silencing PEBP1 counteracted the lipid ROS induced by RSL4, a ferroptosis activator. In summary, our results demonstrate that PEBP1 functions as a potential tumor suppressor in kidney cancer and may serve as a promising prognostic biomarker and therapeutic target.

SERPINC1
Also flagged:clottingHeparinconjugationthrombinbindingdabigatran
Journal Article 2025-10-06 ✓ 4 Snippets Yu H, Pitoc G, Zhang M, Clancy J, Frederiksen J, Yan A, Francis S, Sullenger R, Rempel R, Gammell S, Caiazzi J, Sullenger BA.
In-Text Gene Mentions

…2 µ mATIIIand 10 U…

…weight of UFH‐antithrombin (ATIII) complex (≈80 KDa)…

…Although the UFH‐ATIIIcomplex (1 µ…

…more effectively than UFH‐ATIII.…

Show Full Abstract

Unfractionated heparin (UFH), designated as an essential medicine by the World Health Organization (WHO), is indispensable in cardiac surgery and various clinical applications. However, its production depends on the farming of over a billion large animals annually, posing sustainability challenges, especially amidst increasing efforts to mitigate greenhouse gas (GHG) emissions by reducing animal farming. The rising demand for UFH has outpaced its supply, and previous attempts to develop synthetic alternatives have fallen short because of their limited potency and reversibility. Here, HD1-12dmA-DAB is presented, a novel synthetic anticoagulant developed through chemical conjugation of a thrombin exosite-binding aptamer (HD1) with a thrombin active-site inhibitor (dabigatran). By optimizing dual-site synergistic binding, HD1-12dmA-DAB achieves an enhancement of over three orders of magnitude in thrombin-binding affinity and specificity compared to HD1 alone. It also demonstrates superior plasma stability and anticoagulant efficacy comparable to UFH, as validated in in vitro, in vivo, and ex vivo clotting models. This breakthrough highlights a promising step toward a sustainable, animal-free alternative to UFH, addressing the growing clinical demand and advancing environmental sustainability objectives.

OLFM4
Also flagged:tumorcancertumorscolon cancercolorectal cancerglucose
Journal Article 2025-10-06 ✓ 2 Snippets Wang Y, Chen W, Wang Z, Cai S, Zhao X, Jin J, Gao T, Qu J.
In-Text Gene Mentions

…TA cells (OLFM4and MKI67 ).…

…cells identified byOLFM4and MKI67 .…

Show Full Abstract

<h4>Background</h4>Immunometabolic adaptations may induce tumor immune escape and immunotherapeutic resistance, representing crucial mechanisms in cancer progression. Understanding the metabolic rewiring of tumor-infiltrating immune cells as tumors advance could enhance current immune-oncology treatments.<h4>Methods</h4>In this study, we investigated metabolic heterogeneity in immune cells within both tumor and adjacent normal tissue using single-cell transcriptome profiling of colon cancer. We also utilized the MC38 colorectal cancer model, a commonly employed mouse tumor model, to assess the metabolic atlas of major immune cell populations in tumor and normal tissue.<h4>Results</h4>We examined the immunometabolic features in tumor tissue and adjacent normal tissue using public single-cell transcriptomic datasets of colorectal cancer (CRC) patients, in which myeloid cells showed dominant metabolic activity. Using a mouse tumor model, we demonstrated distinct metabolic reprogramming of major immune cell types in tumor compared to normal tissue. Specifically, we observed increased glucose and lipid uptake, along with abundant lipid accumulation in tumor-infiltrating myeloid cells, particularly macrophages. Additionally, we identified diverse mitochondrial fitness and oxidative stress levels within the tumor immune microenvironment. Macrophages exhibited metabolic fitness, CD8<sup>+</sup> T cells displayed mitochondrial depolarization, and neutrophils showed high oxidative stress. Furthermore, we investigated immunometabolic dynamics and observed augmented metabolic activity in immune cells infiltrating progressive and late stages of tumor development. Notably, intratumoral macrophages exhibited metabolic heterogeneity, characterized by robust lipid uptake and synthesis, which correlated with a pro-tumor phenotype and poor clinical outcomes.<h4>Conclusion</h4>Overall, our study unveils the heterogeneity and dynamics of metabolic properties in immune cells within the tumor microenvironment. These findings provide insights for developing therapeutic strategies that target metabolism to enhance antitumor immunity.

Also flagged:MAPKbreast cancergene expressioncancermitogen-activated protein kinasecell proliferation
Journal Article 2025-10-06 No Snippets Ding B, Wang X, Zhang Z, Wang Y, Bo W, Zhang M, Tian Z, Wang Y, Xue X, Zhang M.
Show Full Abstract

Long non-coding RNAs (lncRNAs) are increasingly recognized as key modulators of gene expression and cellular processes, playing pivotal roles in cancer biology. In breast cancer, a multifaceted malignancy driven by diverse genetic and epigenetic alterations, the mitogen-activated protein kinase (MAPK) signaling pathway is critical for regulating processes such as cell proliferation, survival, and metastasis. Emerging research highlights intricate interactions between lncRNAs and MAPK signaling components, including ERK, p38, and JNK, revealing novel regulatory mechanisms underlying breast cancer development and progression. These interactions often involve lncRNAs modulating MAPK pathway activity or engaging in crosstalk with other oncogenic networks. This review explores how lncRNAs influence MAPK signaling in breast cancer pathogenesis, emphasizing their dual roles as potential oncogenes or tumor suppressors depending on the molecular context. While these findings suggest that lncRNAs could serve as diagnostic biomarkers or therapeutic targets to influence tumor growth, metastasis, and drug resistance, challenges such as study heterogeneity, conflicting functional outcomes, and the complexity of lncRNA-MAPK interactions limit immediate clinical translation. By elucidating these molecular relationships, we aim to provide insights into breast cancer biology and highlight the potential, as well as the limitations, of leveraging lncRNA-MAPK interactions for improved diagnostic and therapeutic strategies, pending further mechanistic and clinical validation.

DNAH10ZNF664CCDC92
Also flagged:obesitylipidcardiovascular diseaseCVDdyslipidemialipoprotein
Journal Article 2025-10-06 ✓ 5 Snippets Kim D, Highland HM, Smit RAJ, Hysong MR, Buchanan VL, Young KL, Zhao C, Spracklen CN, Kilpeläinen TO, Guo B, Darst BF, Cai Y, Wang Z, Lundin J, Berndt SI, Manson JE, Marouli E, Lange L, Lange E, Fornage M, Gignoux CR, Haiman CA, Rich SS, Buyske S, Loos RJF, Kooperberg C, Peters U, Avery CL, Gordon-Larsen P, Graff M, Raffield LM, North KE.
In-Text Gene Mentions
⭐ same-sentence co-mention

…locus 1851, RILPL2,DNAH10, CCDC92, and ZNF664…

⭐ same-sentence co-mention

…1851, RILPL2, DNAH10,CCDC92, and ZNF664 were…

⭐ same-sentence co-mention

…DNAH10, CCDC92, andZNF664were prioritized, consistent…

…FDFT1 , andCCDC92) were also…

…Four genes,CCDC92, PPP1R3B, HMGCR ,…

Show Full Abstract

<h4>Background</h4>Obesity is thought to increase cardiovascular disease (CVD) risk partly through dyslipidemia. Yet, obesity's effects on dyslipidemia are not uniform. Understanding the shared genetic basis between obesity and lipid traits can provide insight into this heterogeneity and its implications for CVD risk.<h4>Methods</h4>We examined local genetic correlations between three lipid measures [high-density lipoprotein cholesterol (HDL), low-density lipoprotein cholesterol (LDL), and triglycerides (TG)] and body mass index (BMI) using genome-wide association study summary statistics from European ancestry UK Biobank participants. We identified genomic loci with opposing genetic effects on obesity and dyslipidemia risk (protective BMI-lipid loci) and those with concordant directions for both obesity and dyslipidemia risk (adverse BMI-lipid loci). Gene-based association analyses were used to prioritize potential causal genes. We then constructed polygenic risk scores for BMI (PRS<sub>BMI</sub>) based on protective and adverse loci and assessed their associations with BMI, lipid levels, CVD, and related traits in the diverse Population Architecture using Genomics and Epidemiology (PAGE) study. PheWAS was performed in the All of Us cohort. Mendelian randomization (MR) was conducted to assess the causal impact of protective/adverse loci on cardiometabolic outcomes. Finally, we investigated the associations with fat distribution traits using MRI-based fat measures in the UK Biobank.<h4>Results</h4>Among 2495 regions, we identified 789 HDL, 26 LDL, and 494 TG loci with significant local genetic correlation with BMI (including overlapping loci). Of these, 3 HDL, 10 LDL, and 8 TG loci showed protective correlations. Gene-based analyses prioritized 18 candidate causal genes. The protective PRS<sub>BMI(+)HDL(+)</sub> was associated with higher BMI but favorable lipid profiles and reduced CVD risk in PAGE. PheWAS revealed protective associations with hyperlipidemia, atrial fibrillation, and Alzheimer's disease. MR supported the favorable causal effects of these protective loci on several cardiometabolic outcomes. Notably, protective PRS<sub>BMI(+)TG(-)</sub> was uniquely associated with decreased visceral-to-abdominal subcutaneous adipose tissue ratio.<h4>Conclusions</h4>Identifying and validating genomic loci with shared genetic signals between BMI and lipid levels further supports the importance of genetics in defining the heterogeneous impact of obesity on dyslipidemia and CVD.

Also flagged:gene expressionchromatintranscription factorsagingmethylationorganization
Journal Article 2025-10-06 No Snippets Ji L, Zou Q, Tang K, Wang C.
Show Full Abstract

Single-cell multiomic technologies enable the joint analysis of different modalities, but face challenges due to experimental complexity. Current computational methods for single-cell cross-modality translation lack biological interpretability. Here, we present Cisformer, a cross-attention-based generative model tailored for cross-modality generation between gene expression and chromatin accessibility at single-cell resolution. Systematic benchmarking demonstrates the superior accuracy and generalization of Cisformer against existing methods. Cisformer leverages its inherent interpretability to precisely link cis-regulatory elements to target genes, facilitating the identification of functional transcription factors associated with tumorigenesis and aging. Overall, Cisformer is a powerful tool for single-cell multiomic data analysis.

Also flagged:Nucleic acidoligonucleotidesbindingguanineneurodegenerative disordersParkinson's
Journal Article 2025-10-06 No Snippets Arciuolo V, D'Aria F, Caruso MR, Calvino MM, Amato J, Lazzara G, Milioto S, Giancola C, Cavallaro G, Pagano B.
Show Full Abstract

Aptamers have emerged as promising therapeutic oligonucleotides (TOs) due to their structural adaptability, high binding affinity, and remarkable specificity toward diverse biological targets. Among them, G-quadruplex-forming aptamers stand out for their unique secondary structures and distinct chemical properties. Their potential in neurodegenerative diseases such as Alzheimer's, Parkinson's, and Huntington's lies in their ability to inhibit protein aggregation and modulate pathogenic pathways. However, their application is hindered by enzymatic degradation and limited membrane permeability. To overcome these issues, chemical modifications, such as backbone and sugar alterations, and nanomaterial-based delivery strategies have been developed. Notably, clay nanoparticles, such as halloysite nanotubes and montmorillonite, have gained attention as effective carriers for TOs, enhancing their structural stability and bioavailability. This review discusses recent advancements in aptamer-based TOs, with a focus on G-quadruplex-forming oligonucleotides, their therapeutic potential in neurodegenerative diseases, and innovative nanocarrier systems that can improve their stability and targeted delivery. Finally, it highlights current challenges and future directions in the chemical design and formulation of aptamer-based therapeutics for targeted applications.

DARS2
Also flagged:Amino acidleukoencephalopathiesmitochondrial aminoacyl tRNA synthetasemt-ARSmitochondrialprotein synthesis
Journal Article 2025-10-06 ✓ 3 Snippets Catania A, Marchet S, Einvag K, Lamantea E, Salsano E, Ghezzi D, Lamperti C.
In-Text Gene Mentions

…AARS2 andDARS2biallelic mutations are…

…= 2) andDARS2(n = 4)…

…adult patients withDARS2-related disorders.…

Show Full Abstract

<h4>Background</h4>Mitochondrial aminoacyl tRNA synthetase (mt-ARS) related disorders represent a widely heterogeneous group of diseases affecting the efficiency of mitochondrial protein synthesis. AARS2 and DARS2 biallelic mutations are associated with clinical syndromes prominently characterized by diffuse leukoencephalopathy with a highly variable age of onset, ranging from early infancy to adulthood. Preliminary in vitro results on patients' fibroblasts and some anecdotal reports on patients affected by mt-ARS related disease have suggested a possible benefit of supplementation with the specific substrate amino acid of the defective mt-ARS.<h4>Methods</h4>We recruited 6 adult patients affected by AARS2 (n = 2) and DARS2 (n = 4) related leukoencephalopathies and started an oral supplementation with alanine and aspartate, respectively, for a total duration of 2 years. Therapeutic efficacy and safety were assessed through clinical examinations, standardized scales, functional tests, quality of life (QoL) scores, brain MRI, and laboratory analyses.<h4>Results</h4>Overall, the treatment was safe and well tolerated by all patients, but efficacy endpoints were not met as no significant improvements were observed in global, cognitive, or motor scores.; nonetheless, all patients but one remained clinically stable.<h4>Conclusions</h4>Despite inherent limitations of this pivotal trial, our findings suggest that specific amino acid supplementation is a safe intervention but do not yield a clear symptomatic benefit; nevertheless, we cannot exclude a potential role in stabilizing the clinical condition in adult patients with DARS2-related disorders.

Also flagged:gene expressiontranslationalpeptidescardiovascular diseasesheart failureatherosclerosis
Journal Article 2025-10-06 No Snippets Capirossi G, Brasini S, Tremoli E, Binatti A, Roncarati R.
Show Full Abstract

Circular RNAs are a class of stable non-coding RNAs generated through a back-splicing mechanism. They are now recognized as central players in cell function and are no longer considered byproducts of transcription. CircRNAs regulate gene expression at the transcriptional, post-transcriptional, and translational levels by interacting with various molecules. They act as sponges for miRNAs and proteins, molecular scaffolds, and can also be translated into peptides. Although advances in next-generation sequencing and PCR methods have improved their identification and quantification, technical and bioinformatic challenges remain. Increasing evidence shows their involvement in cardiovascular diseases such as heart failure, hypertrophy, fibrosis, and atherosclerosis, with protective or deleterious effects depending on the context. Given their presence in biological fluids and extracellular vesicles, they can be considered promising biomarkers, but their therapeutic applications are still under investigation. Future studies including a better understanding of their mechanisms of action, the development of standardized validation methods, and potential clinical applications (prevention, early diagnosis, personalized therapies) in diseases are still needed. This review provides an updated overview of the knowledge regarding circRNAs and their translational role in health and disease with a particular focus on cardiovascular diseases.

Also flagged:tissue homeostasisinflammatory responsesinfectionscancerimmune responsecell activation
Journal Article 2025-10-06 No Snippets Ikra ZJ, Huang Q, Yu H, Belz GT, Jenne CN, Jacquelot N.
Show Full Abstract

Type 2 innate lymphoid cells (ILC2s) are critical mediators of type 2 immunity that play non-redundant context-dependent modulatory functions. Primarily associated with responses against helminths and allergens via the activation of a potent epithelial-ILC2 axis, a growing body of evidence also suggests that a crosstalk between ILC2 and T cells is equally important in maintaining tissue homeostasis. In barrier tissues and secondary lymphoid organs, ILC2s co-localize with T cells, forming hubs where bi-directional signals are exchanged. Here, we describe the diversity of functional interactions between ILC2s and T cells, detailing known contact-dependent and -independent mechanisms, including a relatively new and still poorly defined antigen-presenting function during inflammation. Understanding these complex interactions is necessary to fully elucidate how this specific crosstalk helps maintain tissue homeostasis and regulate inflammatory responses. Identifying the spatial and temporal specificities of these interactions will certainly open new avenues for future targeting of this axis to improve immune-mediated host protection.

Also flagged:Syphilisinfectionimmune responseextracellularRho GTPasesendothelial to mesenchymal transition
Journal Article 2025-10-06 No Snippets Waugh S, Goodyear MC, Gomez A, Ranasinghe A, Lithgow KV, Falsafi R, Hancock REW, Lee AH, Cameron CE.
Show Full Abstract

Syphilis, caused by <i>Treponema pallidum</i> subsp. <i>pallidum</i>, is an urgent global public health threat. Syphilis vaccine development has been impeded by limited understanding of the molecular mechanisms that enable <i>T. pallidum</i> to establish and maintain infection. The vascular endothelium is critical for <i>T. pallidum</i> attachment, dissemination, and host immune response initiation; however, the molecular details of <i>T. pallidum</i>-endothelial interactions are incompletely understood. To enhance understanding, we performed time-course transcriptomic profiling on <i>T. pallidum</i>-exposed brain microvascular endothelial cells. These analyses showed <i>T. pallidum</i> exposure altered pathways related to extracellular matrix, growth factors, integrins, and Rho GTPases. The induced transcriptional response was consistent with endothelial to mesenchymal transition, a process involved in fetal development and vascular dysfunction. In cells exposed to <i>T. pallidum</i>, the primary transcription factor associated with this process (Snail) was increased at both the transcript and protein levels, and microscopy analyses demonstrate F-actin cellular contraction. This study provides a comprehensive understanding of the molecular responses of endothelial cells to <i>T. pallidum</i> and identified the host pathways that might cause syphilis disease symptoms, information that could aid in syphilis vaccine design.

Also flagged:transpirationchalk formationwaterporepore openingsphotosynthesis
Journal Article 2025-10-06 No Snippets Mu Q, Wang S, Liu Y, Gao Y, Liu W, Okpala NE.
Show Full Abstract

High temperatures during the grain-filling stage in rice often shorten grain-filling duration and accelerate maturity, typically reducing grain yield and quality. Leaf evaporative cooling via transpiration has been identified as an important adaptive mechanism for heat stress in rice. However, its relevance in evaluating varietal tolerance to heat during grain filling remains unclear. In this study, we assessed 28 newly bred, high-quality rice varieties to examine the extent of, and genotypic variation in, transpirational cooling and its effects on grain yield and quality under a staggered sowing system (S1 and S2). Our results showed that high temperatures significantly decreased 1,000-grain weight by 1.6 g and head rice rate by 6.7%, while increasing chalkiness by 3.3%. Cluster analysis grouped the varieties into three categories of heat tolerance: tolerant, intermediate, and susceptible. Under heat stress, heat-tolerant varieties maintained significantly lower leaf and panicle temperatures and exhibited higher stomatal conductance than heat-susceptible varieties during grain filling. These tolerant varieties also possessed higher stomatal density and total stomatal area. Furthermore, the change in 1,000-grain weight was negatively correlated with stomatal density, whereas the change in head rice rate showed a negative correlation with stomatal size. These findings suggest that varietal differences in heat tolerance during grain filling may parallel those observed at anthesis. Stomatal regulation of the canopy microenvironment may serve as a general physiological basis for varietal heat response in rice.

DCC
Also flagged:Dopaminenucleusanxietybehavioralhyperpolarization-activatedmembrane
Journal Article 2025-10-06 ✓ 1 Snippet Pulcrano S, D'Addario SL, Federici M, Mercuri NB, Longone P, Bellenchi GC, Guatteo E.
In-Text Gene Mentions

…the Netrin-1 receptorDCC(deleted in colorectal…

Show Full Abstract

<h4>Background</h4>MiR-218 is a micro-RNA expressed in two isoforms (miR-218-1 and miR-218-2) in the brain and, within the mesencephalic area, it represents a specific regulator of differentiation and functional maturation of the dopamine-releasing neurons (DAn). Deletion of miR-218 isoforms within the midbrain alters the expression of synaptic mRNAs, the neuronal excitability of DAn of the substantia nigra pars compacta (SNpc), and their ability to release dopamine (DA) within the dorsal striatum.<h4>Objectives</h4>Here we have investigated if miR-218 impacts the function of the DAn population adjacent to SNpc, the mesencephalic ventral tegmental area (VTA) innervating the nucleus accumbens (NAcc), and the medial prefrontal cortex.<h4>Methods</h4>With the use of miR-218-1, miR-218-2, and double conditional knock-out mice (KO1, c-KO2, c-dKO), we performed electrophysiological recordings in VTA DAn to investigate firing activity, measurements of DA release in NAcc slices by constant potential amperometry (CPA), and in vivo behavioral analysis.<h4>Results</h4>We find that KO1 VTA neurons display hyperexcitability in comparison with c-KO2, c-dKO, and wild type (WT) neurons. DA efflux in the NAcc core and shell is reduced in all single- and double-conditional KO striatal slices in comparison with controls. The KO1 mice display a tendency toward an anxiety-like trait, as revealed by the elevated plus maze test.<h4>Conclusions</h4>Our data indicate that miR-218-1 is the isoform that mainly regulates VTA DA neuron excitability whereas both miR-218-1 and miR-218-2 impair DA release in the mesoaccumbens pathway.

HFE
Also flagged:metalsironcopperzincgene expressionmetal ions
Journal Article 2025-10-06 ✓ 1 Snippet Grabacka M, Pierzchalska M.
In-Text Gene Mentions

…in iron metabolism:hemochromatosisand ferritin complex…

Show Full Abstract

Micro- and nanoplastic particles (MNPLs) present in the environment have recently become a potential health hazard factor due to the ability to penetrate living organisms, their organs, and cells. MNPLs interact with and absorb chemicals and elements, including metals, such as iron, copper, and zinc, and transport them into the cells. The cells subsequently respond with the altered gene expression profiles. In this study, we applied freely accessible online bioinformatic tools to draw out the sets of genes modulated by the metal ions and MNPLs. We focused on the gene interactome as revealed by The Comparative Toxicogenomics Database (CTD). To achieve a deeper insight into the biological processes that are potentially modulated, the retrieved CTD lists of genes, whose expression was influenced by MNPLs and metals, were subsequently analyzed using online tools: Metascape and String database. The genes from the revealed networks were arranged into functional clusters, annotated mainly as inflammation and immune system activity, regulation of apoptosis, oxidative stress response, Wingless-related Integration Site (WNT) signaling and ferroptosis. The complexity of the interactions between the gene sets altered by MNPLs and metal ions illustrates their pleiotropic effects on living systems.

HFE
Also flagged:anemiaend-stage kidney diseaseerythropoiesisstimulatingironiron deficiency
Journal Article 2025-10-06 ✓ 3 Snippets Rostoker G, Griuncelli M, Francisco S, Loridon C, Languille-Llitjos E, Boulahia G, Cohen Y.
In-Text Gene Mentions

…infectious disease, genetichemochromatosisand transfusional-related hemo…

…cases of genetichemochromatosisand secondary hemosiderosis…

…individuals with genetichemochromatosisand secondary hemosiderosis…

Show Full Abstract

<h4>Background</h4>Iron overload by liver magnetic resonance imaging (MRI) is highly prevalent today in the hemodialysis population worldwide and is a controversial topic in the management of dialysis-related anemia, as iron deposits can be seen on MRI but without clinical consequences. The aim of this study was to look for evidence of pancreatic iron deposits (a surrogate marker of severity in iron overload diseases) and their possible association with mortality.<h4>Methods</h4>Liver iron concentration was analyzed in 115 patients on dialysis using signal intensity ratio MRI and R2* Relaxometry MRI to determine liver, spleen, spine and pancreas iron loads.<h4>Results</h4>Overall, 44.3% (51/115) had liver iron overload upon MRI and 20% (23/115) of patients exhibited increased pancreatic iron load. The percentage of patients with abnormal pancreatic T2* was significantly higher in the group with moderate and severe liver iron overload [46.7% (7/15)] as compared with the groups of patients with normal iron load [15.6% (10/64)] and mild iron overload [16.7% (6/36)] (<i>P =</i> .032, Fisher's exact test). Median survival time was reduced to 2.6 years in patients with pancreatic iron deposits as compared with 6.6 years in patients with normal pancreatic iron (<i>P</i> = .028, Log-rank test). Pancreatic iron deposits were associated with a 3-fold higher risk of death in the Cox proportional hazard regression model (hazard ratio 3.614, <i>P</i> = .0031).<h4>Conclusion</h4>Pancreatic iron deposits are observed in a substantial proportion of patients on dialysis with moderate and severe liver iron overload and may be associated with an increased risk of mortality. <b>Trial registration:</b> ClinicalTrials.gov number NCT05593068.

bioRxiv 2025-10-06 Preprint (No Snippets API) Kathofer M, Mediano P, Spies M, Liardi A, Dörl G, Stöhrmann P, Schmidt C, Briem E, Schlosser G, Eggerstorfer B, Klöbl M, Leder H, Lanzenberger R, Crone J.
Show Full Abstract

Ketamine exerts rapid-acting, pro-hedonic effects, yet its precise mechanism remains elusive. Here, we present behavioral and fMRI data from a randomized, placebo-controlled crossover study in 38 healthy participants investigating ketamine’s sub-acute effects on multivariate information-processing during music-evoked peak hedonic experiences. Leveraging information-theoretical measures, our findings indicate that hedonic experiences depend on a distinct global (as measured by O-Information) and local (as measured by integrated information) balance between redundant – information shared across nodes – and synergistic – information emerging from joint interactions – processes. As hedonic intensity rises, neural dynamics shift toward greater synergy; with the one exception of a deliberate increase in redundancy particularly for key sensory information to ensure reliable transmission of and access to critical external information for subsequent hedonic processing. In contrast, ketamine’s sub-acute pro-hedonic effects arise potentially from enhancing redundant dynamics at rest, boosting the brain’s capability to robustly represent and access critical internal information, and thus, fostering an environment optimized to amplify the phenomenological hedonic experience, while simultaneously allowing for more efficient information integration.

Preprints.org 2025-10-06 Preprint (No Snippets API) Mahmud MI, Reza MS, Elias F, Ahmed KA, Ahammad M, Abeer IA, Ahmed N.
Show Full Abstract

Credit Scoring helps financial organizations to provide credit services where the advancement in computing has opened ways for credit scoring approaches with different Machine Learning (ML) techniques becoming increasingly useful. Although complex models provide better predictions, they tend to lack interpretability which is a concern for credit scoring where fairness in decision making is emphasized. This study addresses credit scoring, a vital aspect of financial risk management, by employing advanced machine learning techniques to three distinct datasets: Credit Risk Dataset (CRD), Econometric Analysis (EA), and Default of Credit Card Clients (DCC). A broad spectrum of individual classifiers, including Decision Trees, Logistic Regression, Random Forests, XGBoost, LightGBM, and CatBoost, are systematically trained and evaluated using metrics such as accuracy, F1-score, sensitivity, specificity, MCC, Cohen's Kappa, and ROC AUC. A key contribution is the Bayesian Optimized Stacking Ensemble (BO-StaEnsemble), which leverages Optuna for hyperparameter tuning of its base and meta-learners. Beyond predictive performance, we integrate statistical validation (paired t-tests, McNemar's tests) and Explainable AI (LIME, SHAP, Morris Sensitivity). Furthermore, t-SNE is utilized for visualizing model probability spaces. The BO-StaEnsemble consistently outperforms individual models across all datasets with AUC of 0.998 for CRD, 0.999 for EA, 0.974 for DCC, as well as, demonstrated consistently high agreement and classification reliability across all datasets, achieving Matthews Correlation Coefficient (MCC) and Cohen’s Kappa values of 0.9159 and 0.9147 on the CRD, 0.9903 and 0.9902 on the EA Datasets, respectively, demonstrating the power of ensemble learning, advanced optimization, and comprehensive interpretability for robust credit risk modeling.

HFE
Also flagged:Proton pumpClostridioides difficile infectionnitriteoxygendiarrheal syndromeileus
Journal Article 2025-10-05 ✓ 1 Snippet Floria DE, Obeidat M, Váncsa S, Kávási SB, Földvári-Nagy L, Hegyi P, Veres DS, Drug VL, Erőss B.
In-Text Gene Mentions

…46 individuals withhemochromatosisto assess the…

Show Full Abstract

Observational studies reported conflicting results regarding the association between proton pump inhibitors (PPIs) and intestinal dysbiosis. We assessed the risk of enteric infections, including <i>Clostridioides difficile</i> infection (CDI), and small intestinal bacterial overgrowth (SIBO) among PPI users compared to non-users in randomized controlled trials (RCTs). A systematic search was conducted on April 15th, 2025 (CRD42023403322). Eligible RCTs compared adults treated with PPIs versusplacebo or alternative therapies. Risk ratios (RR) with corresponding 95% confidence interval (CI) were calculated using random effects models. Eight RCTs with 29,880 participants reported CDI rates. No significant difference was observed between PPI users and non-users (RR = 1.19, 95% CI: 0.75; 1.89). Four RCTs totaling 27,254 participants compared PPIs to H2-receptor blockers, showing no significant difference in CDI risk (RR = 0.72, 95% CI: 0.49; 1.07). Similarly, three RCTs (1,645 participants) comparing PPIs with potassium-competitive acid blockers found no significant difference (RR = 1.23, 95% CI: 0.43; 3.55). The qualitative synthesis found that other enteric infections and SIBO may be more common in PPI users. Data from RCTs suggest that PPIs do not seem to increase the risk of CDI compared to placebo and other acid-suppressive medications.

DCC
Also flagged:Deathbraincardiac arrestarrestoxygenmetabolism
Journal Article 2025-10-05 ✓ 5 Snippets Robinson C, Douvris A, Rahmani W, Odutayo A, Clotet-Freixas S, Young A.
In-Text Gene Mentions

…TheDCCactivity has already…

…experimental studies ofDCC(published after 2014).…

…also evident whenDCCoutcomes and perfusion…

…in IRI andDCCoutcomes, future experimental…

…preclinical studies ofDCCin kidney transplantation…

Show Full Abstract

<h4>Purpose of review</h4>Kidney transplantation is associated with survival benefit compared to dialysis. Yet, there is an unmet need for access to kidney transplantation within Canada and globally. Donation after death determined by circulatory criteria (DCC) has expanded access to kidney transplantation among the adult and pediatric population. However, there are concerns inherent to DCC kidneys, including warm ischemia time and ischemia-reperfusion injury (IRI). This narrative review aims to summarize relevant literature in this context, discuss potential opportunities to expand the use of DCC kidneys, and highlight knowledge gaps for further study.<h4>Sources of information</h4>PubMed (Medline), the Canadian Institute for Health Information, and regulatory bodies for organ donation and transplantation.<h4>Methods</h4>A focused review and critical appraisal of existing literature on the mechanisms of kidney IRI, consideration of sex in experimental studies relevant to DCC kidney transplantation, ex vivo perfusion strategies, and pediatric kidney transplant considerations.<h4>Key findings</h4>DCC kidneys confer a higher risk of delayed graft function (DGF) due to prolonged warm ischemic time. However, long-term graft survival is generally comparable to that of kidneys from donors with death determined by neurologic criteria (DNC). Key barriers to expansion include the paucity of sex-balanced experimental studies on DCC graft preservation and outcomes and existing protocols for DCC donor selection, including thresholds for warm ischemia time. Ex vivo strategies including non-oxygenated and oxygenated hypothermic machine perfusion and normothermic ex vivo kidney perfusion are promising research areas. Improving DCC protocols to reduce kidney IRI has the potential to further expand access to DCC transplantation, including to the pediatric population.<h4>Limitations</h4>This narrative review only included articles written in English. Study quality was not formally assessed. Discussion points were influenced by the author's areas of expertise.

Also flagged:polyacrylamidelumenorganizationmembraneextracellularcysts
Journal Article 2025-10-05 No Snippets Felsenthal N, Vignjevic DM.
Show Full Abstract

Intestinal organoids are generated from intestinal epithelial stem cells, forming 3D mini-guts that are often used as an in vitro model to evaluate and manipulate the regenerative capacities of intestinal epithelial stem cells. Plating 3D organoids on different substrates transforms organoids into 2D monolayers, which self-organize to form crypt-like regions (which contain stem cells and transit amplifying cells) and villus-like regions (which contain differentiated cells). This "open lumen" organization facilitates multiple biochemical and biomechanical studies that are otherwise complex in 3D organoids, such as drug applications to the cell's apical side or precise control over substrate protein composition or substrate stiffness. Here, we describe a protocol to generate homogenous intestinal monolayers from single-cell intestinal organoid suspension, resulting in de novo crypt formation. Our protocol results in higher viability of intestinal cells, allowing successful monolayer formation. Key features • This protocol requires preexisting experience in culturing mouse intestinal organoids. • This protocol requires preexisting experience in generating polyacrylamide (PAA) gels for culturing 2D monolayers. • This protocol generates intestinal monolayers that can be subjected to additional analysis, e.g., drug treatment, immunofluorescent staining, single-molecule fluorescent in-situ hybridization (smFISH), or live imaging.

medRxiv 2025-10-05 Preprint (No Snippets API) Garimella KV, Li Q, Wertz J, Lee SK, Cunial F, Huang Y, Mostovoy Y, Lorig-Roach R, English A, Su H, Levy S, Muzny DM, Berngruber C, Danzi MC, Harvey WT, LaPlante EL, Patterson K, Rozanski AN, Schwartz S, Shifaw B, Wang Y, Wong I, Xu IRL, Zaheri S, Zuchner S, Zheng X, Dugan-Perez S, Izydorczyk M, Mehta H, Gibbs RA, Lichtenstein L, Gupta N, Lennon N, Gabriel S, All of Us Research Program Long Read Working Group, Timp W, Doheny KF, Dutka T, Musick A, Wei C, Sedlazeck FJ, Schatz MC, Talkowski ME, Eichler EE.
Show Full Abstract

The All of Us Research Program (AoU) is a national biobank seeking to enroll one million individuals in the United States to link genomic and biomedical data, including short- and long-read whole-genome sequencing (srWGS/LRS), with rich electronic health record (EHR) information. Here, we present the first large-scale analyses of long-read sequencing (LRS) in AoU and offer a new framework for deriving genomic insights into complex structural variation (SV) of relevance to human health and disease. We performed joint analyses of 1,027 individuals self-identifying as Black or African American, sequenced to ~8x coverage with Pacific Biosciences HiFi technology and processed using cloud-native pipelines. From these LRS data we constructed a comprehensive variant callset encompassing known (FMR1 and HTT) and novel repeat expansions, clinically relevant haplotypes at loci inaccessible to srWGS, and haplotypes relevant to disease risk (HLA) and pharmacogenomics (CYP2D6), including SNVs, indels, and SVs. We developed methods for cohort-level variant calling and a scalable workflow to impute >750,000 of these SVs into existing srWGS datasets for trait association and human disease studies. Expanding to 10,000 self-identified Black or African American AoU participants with srWGS and matched EHRs, we identified 291 SV-disease associations (p < 1e-5) spanning 226 conditions with 50.9% of associations involving SVs absent from the matched srWGS callset. Across the 226 traits, after fine-mapping using SVs and SNVs we identified 191 SV-disease pairs spanning 160 traits (70.8%) where the SV had the strongest association within the locus. Associations specific to those with computed ancestry similar to the African reference population exhibited larger effect sizes and lower allele frequencies, consistent with high-risk, ancestry-specific variants. These results demonstrate that the integration of LRS into AoU and future biobank initiatives can provide transformative new insights into genomic variation with potentially profound impact on precision medicine.

PEBP1
Also flagged:hepatocellular carcinomaG1 phasecell cycleLuciferasecell proliferationtumour
Journal Article 2025-10-04 ✓ 1 Snippet Lin J, Cai Y, Chen Z, Ma J, Zhao K.
In-Text Gene Mentions

…, CYP1B1 ,PEBP1, PTCH2 ,…

Show Full Abstract

Aberrantly expressed microRNA-4484 (<i>miR-4484</i>) has recently garnered attention for its involvement in human diseases, but its specific role in hepatocellular carcinoma (HCC) remains largely unexplored. This study investigates the function of <i>miR-4484</i> in HCC progression and its regulatory interaction with <i>KIF2C</i>. Analysis of the data from the TCGA-LIHC database revealed that <i>miR-4484</i> expression is significantly downregulated in HCC tissues, with lower levels correlating with worse prognosis. <i>In vitro</i> experiments confirmed that <i>miR-4484</i> expression is lower in HCC cell lines compared to a normal liver cell line. Functional assays demonstrated that <i>miR-4484</i> overexpression via a <i>miR-4484</i> mimic suppressed cell proliferation and induced G1 phase arrest, whereas <i>miR-4484</i> inhibition promoted proliferation and facilitated cell cycle progression from G1 to S and G2 phases. Additionally, <i>KIF2C</i> expression was significantly upregulated in HCC tissues and cell lines, exhibiting an inverse correlation with <i>miR-4484</i> levels. Dual-Luciferase Reporter Assays confirmed that <i>miR-4484</i> directly binds to <i>KIF2C</i>, thereby regulating its expression and influencing cell proliferation and cell cycle progression. <i>In vivo</i>, subcutaneous intratumoral injection of the <i>miR-4484</i> mimic in nude mice significantly inhibited HCC tumour growth. These findings highlight <i>miR-4484</i> as a potential tumour suppressor in HCC through its direct targeting of <i>KIF2C</i>, underscoring its promise as a therapeutic target for HCC treatment.

HFE
Also flagged:MSinflammatory neurological disordermyelin sheathsaxonsHLA-DRB1vitamin D deficiency
Journal Article 2025-10-04 ✓ 2 Snippets van Rensburg SJ, van Toorn R, Jaftha M, Kemp MC, Engel-Hills P, Kotze MJ.
In-Text Gene Mentions

…transferrin receptor 2;HFE: Hereditary hemochromatosis p…

…2; HFE: Hereditaryhemochromatosisprotein; BMP: bone…

Show Full Abstract

Multiple sclerosis (MS) is a neurological disorder characterized by damage to the myelin sheaths surrounding axons in the central nervous system, causing decreased axonal signal transmission and disability in people with MS. Epstein-Barr virus (EBV) infection and vitamin D deficiency have been put forward as causal factors for the development of MS, but their effects have not been conclusively linked to the disruption of myelin maintenance. Interestingly, both EBV infection and vitamin D deficiency increase the levels of hepcidin, an acute-phase peptide hormone that inhibits iron absorption. The current understanding of iron dysregulation in MS is that iron accumulates in deep gray matter brain structures which leads to disability progression. However, recent studies have revealed that the apparent iron influx may be an artefact of disease-related brain atrophy, and that iron is in contrast depleted in the deep gray matter in MS, which could cause iron deficiency in oligodendrocytes (the cells producing myelin), leading to their demise due to a mitochondrial energy deficit, with consequent demyelination. EBV infection, vitamin D deficiency and iron deficiency may converge as causal risk factors for MS. Dismantling the current understanding that iron excess underpins MS would improve testing and optimization of iron parameters and vitamin D as part of clinical management of MS. This review additionally explores the risk factors for lytic reactivation of EBV which is hypothesized to drive MS disease activity. Conversely, ensuring that EBV remains in a latent state by ameliorating these risk factors may prevent MS exacerbations and disease worsening.

Also flagged:depolarizationaction potentialshyperpolarizationcationcalciumPIR
Journal Article 2025-10-04 No Snippets Mahrous AA, Chardon MK, Johnson MD, Miller JF, Heckman CJ.
Show Full Abstract

<h4>Background</h4>Neural circuits throughout the CNS can exhibit rebound excitation following prolonged periods of inhibition. However, the potential to control this phenomenon and harness it for clinical applications remains largely unexplored.<h4>Objective</h4>We investigate rebound excitatory responses evoked by spinal cord stimulation (SCS) that can generate functional motor output, providing a testable model of circuit-level rebound excitation relevant to neuromodulation across the CNS.<h4>Methods</h4>Brief (5 s) electrical stimulation trains were delivered to the lumbar spinal cord in adult cats. We recorded intracellular neuronal activity in the cord and EMG and force output from hindlimb muscles.<h4>Results</h4>SCS elicited a robust and long-lasting rebound excitation selectively targeting the ipsilateral ankle extensors-a response we term Long Extension Activated Post-stimulation (LEAP). The force output during LEAP can support weight-bearing in cats, underscoring its clinical potential. Intracellular recordings revealed that extensor motoneurons received strong inhibitory inputs during stimulation, driven by reciprocal inhibition via proprioceptive afferents. Upon cessation of stimulation, a shift to a rebound excitatory synaptic input occurred, resulting in sustained firing in extensor motoneurons during LEAP. We also observed concurrent dynamic changes in interneuron firing across spinal laminae, suggesting broad circuit engagement. We systematically mapped the parameter space required to reliably evoke LEAP, including stimulation location, amplitude, and frequency, providing a framework for controlled rebound activation.<h4>Conclusions</h4>LEAP represents a novel rebound response that can generate weight-supporting postural output. This mechanism not only expands the therapeutic potential of SCS in motor disorders but also serves as a model for modulating rebound excitation throughout the CNS.

ZNF664
Also flagged:PTPRNFRKPTPN23PTPRTphosphorylationdephosphorylation
Journal Article 2025-10-04 ✓ 1 Snippet Arias KD, More M, Goyache F, Cruz A, Burgos A, Gutiérrez G, Cervantes I, Gutiérrez JP.
In-Text Gene Mentions

…MITF, RNF10, andZNF664) with GO terms…

Show Full Abstract

Improving fibre quality traits is a key objective in alpaca breeding programmes. A total of 630 alpaca individuals managed at the Pacomarca experimental farm located in Puno, Perú, and subjected to selection for fibre quality traits were genotyped using the Affymetrix Custom Alpaca genotyping array (76 508 SNPs). Two tests, the integrative Haplotype Score (iHS) and the number of segregating Sites by Length (nSL), aimed at identifying incomplete sweeps, were applied on all sample genotypes to identify selective candidate genomic regions spanning genes putatively involved in fibre production. The Cross-Population Extended Haplotype Homozygosity (XP-EHH) statistic was applied to two divergent subpopulations included in the total genotyped population: one less selected (reference; 49 individuals) and one highly selected (target; 127 individuals) to assess if some of the selective sweeps identified with both iHS and nSL were fixed in the target subpopulation. A total of 544 single-nucleotide polymorphisms (SNPs) were identified as candidate selective signals using both the iHS and nSL tests. Furthermore, 27 SNPs were identified as surrounding selective signals and further considered as candidate selective signals as well. A total of 509 candidate selective genomic regions covering 14.6 Mb of the alpaca genome were constructed. Gene-annotation enrichment analyses enabled to identify 293 candidate genes in these selective candidate genomic regions. Up to 11 candidate genes (e.g. PTPRN, FRK, PTPN23, and PTPRT) were associated with Gene Ontology (GO) terms related to phosphorylation and dephosphorylation and 28 candidate genes (e.g. FOXP1, MITF, RNF10, and ZNF664) with GO terms related to RNA polymerase activity. These genes have been reported to play a crucial role in the development of animal hair follicles, as well as in regulating hair growth and quality across different livestock species. Functional annotation conducted allowed to identify four significantly enriched functional term clusters including a total of 32 candidate genes. These functional clusters may be involved in the modulation of fibre growth and quality as well as skin and hair follicle development. Moreover, enrichment analyses within candidate selective genomic regions identified with XP-EHH allowed to identify 54 candidate genes, 10 of which were also identified using both the iHS and nSL tests. However, no functional clusters were identified. The results presented suggest that the genomes analysed were shaped by directional selection for fibre quality traits, involving multiple chromosomal areas of the alpaca genome. This fits well with traits expected to be mainly controlled by genes of additive effect.

HTT
Also flagged:Neuroblastomaagingneurodegenerative diseasesendoplasmic reticulumautophagymitophagy
Journal Article 2025-10-04 ✓ 4 Snippets Aygun N.
In-Text Gene Mentions

…ynuclein (α-Syn), huntingtin (HTT), neurofilament, SOD1, TAR…

…expansion involving theHTTprotein in HD…

…Therefore, misfoldedHTTprotein with polyQ…

…reveals that wild-typeHTTprotein is required…

Show Full Abstract

The normal aging brain does not show massive neuron loss. However, neurodegenerative diseases are characterized by the progressive loss of neurons that differentiate from neuroblasts arising in the neural tube. Oxidative stress induces protein misfolding and aggregation that generates endoplasmic reticulum (ER) stress, leading to the activation of the unfolded protein response (UPR). Oxidative stress can also impair autophagy and mitophagy. Prolonged ER stress and impaired autophagy or mitophagy together can promote neuronal death. Neuroblastoma is an embryonal tumor developing from sympathetic neuroblasts. Stage 4S neuroblastoma is frequently associated with spontaneous regression. Autophagy decreases in stage 4S neuroblastoma, whereas apoptosis increases. The present review focuses on the molecular and cellular fundamentals of normal brain aging, neurodegenerative diseases, and neuroblastoma with spontaneous regression. Differential gene expressions and associated potential mechanisms of the normal aging brain, Alzheimer's disease (AD) brain, and stage 4S neuroblastoma are investigated by analyzing the Gene Expression Omnibus (GEO) datasets and publications. In conclusion, there are gender- and region-specific differential expressions and connected differential molecular mechanisms in the normal aging brain and AD brain. PRH1 and <i>MIR181A1HG</i> are likely to play neuroprotective roles in certain brain regions of elderly females. The loss of myelinating oligodendrocytes in the entorhinal cortex (EC) and repressed adult hippocampal neurogenesis can contribute to cognitive impairment in AD. Neurodegeneration of mature neurons and spontaneous regression of immature sympathetic neuroblast-derived neuroblastomas may occur via similar cellular behavior of mature and immature nerve cells. Impaired autophagy and apoptosis can play crucial roles in both synaptic dysfunction and neuron death in AD and the spontaneous regression of stage 4S neuroblastoma. Finally, the present analytical review provides novel insights into apoptosis, neuronal differentiation, immune response, impaired autophagy, and impaired double-strand break (DSB) repair, considered potential mechanisms underlying spontaneous regression in stage 4S neuroblastoma.

Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disorderauditory hallucinationsbindingdegenerative parkinsonism
Journal Article 2025-10-04 No Snippets Amro S, Punchihewa C, Bravo E, Dizdarevic S.
Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by an unstable expansion of CAG trinucleotide repeats that lead to progressive degeneration of postsynaptic striatal medium-spiny GABAergic neurons. We report a case of abnormal [ <sup>123</sup> I] Ioflupane single-photon emission computed tomography/computed tomography (DaTSCAN) and a subsequent genetic test confirming HD. A 68-year-old man presented with progressive memory difficulties, auditory hallucinations, nightmares, suicidal thoughts, low mood, and involuntary limb movements. DaTSCAN showed borderline reduced putaminal binding ratios bilaterally, more prominent on the left side, and a low putamen-to-caudate ratio suggesting degenerative parkinsonism. Genetic testing revealed one pathogenic expansion (40/17 CAG repeats), confirming HD. Postsynaptic dopaminergic involvement has previously been documented in postmortem studies. However, an emerging in vivo research also suggests presynaptic dopaminergic involvement. While genetic testing remains the gold standard for diagnosis of HD, DaTSCAN may play a role in assessing dopamine transporter activity and tracking the progression of neurodegeneration in HD.

HTT
Also flagged:Huntington's Diseaseparkinsonismdystoniachorea-onset HDHuntington Disease
Journal Article 2025-10-03 ✓ 1 Snippet Sabatini U, Maffi S, Caligiuri ME, Sánchez-Castañeda C, Tinelli E, Squitieri F.
In-Text Gene Mentions

…≤59CAG repeats inHTTgene.<h4>Results</h4>POHD had …

Show Full Abstract

<h4>Background</h4>Pediatric-onset Huntington's disease (POHD) is usually associated with signs and symptoms of parkinsonism and dystonia predominating on chorea, which is typical of adult-onset HD (AOHD). Brain changes responsible of such an atypical POHD phenotype remain poorly understood.<h4>Objectives</h4>To detect Midbrain and Substantia Nigra (SN) volumetric changes and their potential association with clinical parameters.<h4>Methods</h4>Cross-sectional study by 3 T high-field Magnetic Resonance Imaging and Unified Huntington Disease Rating Scales assays in POHD cohort with ≥60 CAG repeats and AOHD cohort with ≤59CAG repeats in HTT gene.<h4>Results</h4>POHD had volumes of SN lower than adult-onset HD (AOHD) (P = 0.003), in addition to lower striatum volume (P < 0.05). The lower SN volume of the whole HD population correlated significantly with clinical measures of UHDRS motor (P = 0.009), functional capacity (P = 0.001) and independence (P = 0.021) scores.<h4>Conclusions</h4>Our findings suggest SN volume decrease as potential POHD brain signature contributing to the atypical HD parkinsonism.

Also flagged:DFSPsoft tissue sarcomasoft tissue sarcomasCD34COL1A1PDGFB
Journal Article 2025-10-03 No Snippets Remiszewski P, Pisklak A, Filipek K, Spałek MJ, Szumera-Ciećkiewicz A, Szostakowski B, Krotewicz M, Czarnecka AM.
Show Full Abstract

<h4>Opinion statement</h4>Dermatofibrosarcoma protuberans (DFSP) is a rare soft tissue sarcoma with an incidence of 0.008 to 0.045 cases per 100,000 per year, accounting for less than 1% of all soft tissue sarcomas. It mainly affects adults aged 30-50 years, usually on the trunk and proximal extremities. DFSP is Locally aggressive, with metastases occurring in up to 5% of cases, typically < 1%. Diagnosis is based on histology, including CD34 antigen expression and COL1A1-PDGFB fusion detection by FISH or RT-PCR. Mohs micrographic surgery is the mainstay of treatment, ensuring clear margins to minimise recurrence. Radiotherapy is used as adjuvant or preoperative therapy to improve Local control. Imatinib, a tyrosine kinase inhibitor, is highly effective in unresectable or metastatic DFSP, especially in cases with PDGFB mutations, achieving disease control in over 70% of patients and partial responses in 36%. The 10-year overall survival rate is 90.7%, although the fibrosarcomatous variant (DFSP-FS) has worse outcomes, with a 5-year Local progression-free survival rate of 33%. Rare metastases to the lungs, lymph nodes or brain are treated surgically; chemotherapy remains ineffective. We comprehensively reviewed the clinical data regarding DFSP, highlighting subtype differences (myxoid, pigmented, myoid, granular cell, sclerosing, atrophic, and fibrosarcomatous), as well as reconstruction methods.

CA10
Also flagged:upper tract urothelial carcinomaurothelial cancerCancerUrothelial Carcinomatumorhydronephrosis
Journal Article 2025-10-03 ✓ 1 Snippet Fujita K, Miyake M, Hashimoto M, Shimizu T, Linehan J, Gottlieb J, Pagano I, Tikhonenkov S, Luu M, Tanaka S, Siguencia F, Murakami K, Lee R, Sakatani T, Rosser CJ, Furuya H.
In-Text Gene Mentions

…( MYO3A ,CA10, NKX6-2 ,…

Show Full Abstract

<h4>Purpose</h4>Urine-based assays currently have a limited role in the management of patients with upper tract urothelial carcinoma (UTUC) because of insufficient accuracy. This study evaluated a multiplex urine assay designed to accurately and noninvasively diagnose UTUC.<h4>Materials and methods</h4>Oncuria-Detect is a multiplex immunoassay capable of detecting urothelial cancer using a single voided urine specimen. In the current multi-institutional study, we tested the assay's utility in identifying UTUC in 60 subjects presenting for evaluation of upper tract mass compared with samples from 60 age-, sex-, and race-matched controls. Cancer status was confirmed by histopathological assessment of tissue specimens obtained during ureteroscopy/biopsy or at the time of definitive surgical intervention (nephroureterectomy or ureterectomy).<h4>Results</h4>For detecting UTUC, Oncuria-Detect provided an AUC of 0.77 (95% CI: 0.70-0.84) with an overall sensitivity of 93%, specificity of 55%, negative predictive value 89%, and positive predictive value 67%. Assay sensitivity values for low-grade, high-grade, noninvasive, and invasive UTUC were 94%, 93%, 93%, and 92%, respectively. Voided urine cytology showed an overall sensitivity of 54%, specificity of 100%, negative predictive value 31.0%, and positive predictive value 100%. Selective (upper tract) cytology had a sensitivity of 80%. Oncuria-Detect outperformed both noninvasive voided urinary cytology and invasive selective cytology in overall assay performance.<h4>Conclusions</h4>Oncuria-Detect accurately identified and categorized UTUC and discriminated patients with cancer from nontumor-bearing individuals. The Oncuria-Detect test provides a rapid, accurate, and noninvasive method for detecting UTUC.

Also flagged:TitaniummineralizationCalcium Phosphatetitanium dioxidehydroxyapatiteACP
Journal Article 2025-10-03 No Snippets Zhang J, DiCecco LA, Williams A, Merlo A, Grandfield K.
Show Full Abstract

The integration of titanium dioxide (TiO<sub>2</sub>) with calcium phosphate (CaP)-based hydroxyapatite (HAP) is a promising strategy for enhancing the bioactivity of bone implants. However, a fundamental understanding of the interfacial reactions governing CaP mineralization on TiO<sub>2</sub> remains limited due to lack of characterization techniques with sufficient spatial and temporal resolution in hydrated state. In this study, in situ liquid transmission electron microscopy (TEM) imaging and correlative ex situ TEM analyses are combined to investigate the nucleation, aggregation, and crystallization of the CaP layer on TiO<sub>2</sub> nanoparticle surfaces. The findings reveal a three-step mineralization process: 1) aggregation of TiO<sub>2</sub> nanoparticles in solution, 2) formation of an amorphous CaP-like (ACP-like) layer, leading to an ACP-like coated TiO<sub>2</sub> nanoparticle structure, and 3) progressive crystallization of ACP into HAP, forming a HAP-like coated TiO<sub>2</sub> nanoparticle structure. Liquid-TEM imaging captured dynamic transformations, including nanoparticle aggregation, structural evolution, and phase transitions, providing unprecedented insights into the physicochemical interactions underlying mineralization. Additionally, the effects of electron beam exposure on TiO<sub>2</sub> nanoparticles are evaluated, demonstrating that high electron flux densities can induce morphological instability. This study advances the understanding of CaP-TiO<sub>2</sub> interfacial mineralization and offers valuable guidance for optimizing bioactive coatings to improve osseointegration and the stability of bone implants.

TNFSF4
Also flagged:haemorrhagic disease-HDHDantibodiesprimary infectionviremia
Journal Article 2025-10-03 ✓ 1 Snippet Maehr T, Lopez J, Drake G, Ferreira FM, Fraser R, Mckown R, Kailath R, Morris S, Chambers A, Graves LP, Walker SL, Dastjerdi A, Edwards KL, Nakaya HI, Steinbach F.
In-Text Gene Mentions

…, TNF ,TNFSF4, TNFSF10 ,…

Show Full Abstract

We report the results of the world's first trial of a vaccine against elephant endotheliotropic herpesvirus (EEHV) in elephants. EEHV-induced haemorrhagic disease is a major threat to juvenile Asian elephants. A vaccine preventing severe disease and death would support conservation efforts for this endangered species. We developed a heterologous, recombinant modified vaccinia virus Ankara prime and adjuvanted protein boost vaccine, containing regulatory protein EE2 and major capsid protein. Vaccine design targeted Th1 and cytotoxic T cell responses, crucial for herpesvirus immunity. In a proof-of-concept trial, safety and immunogenicity were tested in adult elephants. A modified interferon-γ release (IFNG) point-of-care vaccine-specific whole blood assay was established to avoid sample transport-related loss of immune readouts and determine T cell responses by RT-qPCR first. Subsequently, RNA sequencing was utilised to investigate transcriptomic changes post-vaccination. No adverse reactions were observed following heterologous vaccination. IFNG responses to candidate antigens were detected against the pre-existing latent immunity in adult elephants. Over-representation analysis revealed induction of T cell-associated pathways. Thus, we show that the vaccine has a favourable safety profile and stimulates EEHV-specific T cell-biased immune responses, warranting further evaluation.

TNFSF4
Also flagged:lung adenocarcinomaLUADlung cancertumorsTumorGRIA1
Journal Article 2025-10-03 ✓ 1 Snippet Wang H, Zhang Q, Liu Y, Tang J, Chen X, Zhang R.
In-Text Gene Mentions

…LAG3, TNFRSF18, TNFRSF9,TNFSF4, and TNFSF9), and…

Show Full Abstract

Lung adenocarcinoma (LUAD) is a common histological subtype of lung cancer, but its prognosis remains poor. Recent studies have suggested that liquid-liquid phase separation-related genes (LRGs) can significantly predict the prognosis of low-grade tumors. Identifying potential LRGs associated with prognosis in LUAD could have significant clinical value for predicting patient outcomes. Data were sourced from public databases. Differentially expressed LRGs (DE-LRGs) were identified through differential expression analysis and by taking intersections between datasets. Regression analysis and the Least Absolute Shrinkage and Selection Operator (Lasso) method were used to shortlist prognostic genes, and a multivariate Cox regression model was developed to create a prognostic risk model. Tumor samples were stratified into high- and low-risk groups based on the median risk score. Independent prognostic analyses and the construction of a nomogram were performed in conjunction with clinical characteristics. Immune characteristics of the two risk groups were also analyzed. Additionally, single-cell RNA sequencing (scRNA-seq) data were used to identify cell clusters and annotate known cell types. A total of 389 DE-LRGs were identified, and 7 prognostic genes were selected to construct the risk model. Patients in the high-risk group exhibited lower survival rates, and the nomogram demonstrated high predictive accuracy. Significant differences were observed in clinical characteristics, immune status, and drug sensitivity between the high- and low-risk groups. Based on scRNA-seq data, 8 distinct cell types were annotated, with the prognostic genes GRIA1 and BCAN showing higher expression levels in fibroblasts and mast cells, respectively. Seven prognostic genes were identified, and the resulting prognostic model accurately predicted the survival outcomes of LUAD patients. This model provides valuable insights for the prognosis and personalized treatment of LUAD patients.

DCC
Also flagged:bindingABL1kinaseCovid-19hydrogentranslations
Journal Article 2025-10-03 ✓ 1 Snippet Bocchi G, Frosini P, Micheletti A, Pedretti A, Palermo G, Gadioli D, Gratteri C, Lunghini F, Biswas AD, Stouten PFW, Beccari AR, Fava A, Talarico C.
In-Text Gene Mentions

…In contrast,DCCdoes not consider…

Show Full Abstract

Structure-based virtual screening approaches like molecular docking rely on accurately identifying and precisely calculating binding pockets to efficiently search for potential ligands. In this paper, we introduce GENEOnet, a machine learning model designed for volumetric protein pocket detection that employs Group Equivariant Non-Expansive Operators (GENEOs). These operators simplify model complexity and enable more informed domain knowledge integration by selecting specific physical and chemical properties for each operator to focus on, as well as how they should react. Unlike other methods in this field, GENEOnet has fewer model parameters, resulting in reduced training costs, and offers greater explainability, allowing the parameters to be easily interpreted. GENEOnet processes the empty space within a protein by converting it into a 3D grid of uniform blocks, known as 'voxels'. It then identifies regions of the grid with an output value above a threshold, thus producing a list of predicted pockets, ranked according to the model's average output value. Our experimental results show that GENEOnet performs robustly even with small training datasets of 200 proteins and surpasses other established state-of-the-art methods in various metrics. Specifically, GENEOnet's [Formula: see text] score indicating the probability that the top-ranked pocket is the correct one is 0.764, compared to 0.702 for P2Rank, the next best performing algorithm on our PDBbind test set. Moreover, a case study considering various ABL1 kinase conformations demonstrates the excellent agreement between GENEOnet's predictions and experimental sites. GENEOnet is available as a web service at https://geneonet.exscalate.eu , where users can access the pre-trained model for detecting and ranking protein cavities.

Also flagged:TDP-43synthesisAmyotrophic lateral sclerosisALSneuromuscular junctionTAR DNA-binding protein 43
Journal Article 2025-10-03 No Snippets Ionescu A, Ankol L, Ganapathy Subramaniam A, Altman T, Magen I, Cohen Y, Danino Y, Gradus-Pery T, Niv Y, Bar Avi O, Geller D, Ibraheem A, Cheng R, Steinberg N, Alfahel L, Duc P, Ergul-Ulger Z, Arslan D, Tan E, Rage F, Riva N, Quattrini A, Bekircan-Kurt CE, Israelson A, Dori A, Hornstein E, Perlson E.
Show Full Abstract

Amyotrophic lateral sclerosis (ALS) is characterized by neuromuscular junction (NMJ) disruption and neurodegeneration. Recent findings highlight a pivotal role for TAR DNA-binding protein 43 (TDP-43) in forming axonal pathological condensates and facilitating NMJ disruption through inhibition of local protein synthesis. However, the mechanisms that drive local TDP-43 accumulation remain unknown. Here we identify that the TDP-43 axonal accumulation in peripheral nerves of SOD1 patients and mice stems from its aberrant local synthesis. This is a non-cell-autonomous process driven by muscle-derived miR-126a-5p extracellular vesicles (EVs). Inhibiting muscle secretion of miR-126a-5p prompts presynaptic TDP-43 synthesis and accumulation, which disrupts axonal translation and causes NMJ degeneration. Introducing miR-126 to SOD1<sup>G93A</sup> mice, primary co-cultures and human induced pluripotent stem cell (iPSC)-derived co-cultures with ALS mutations exhibits neuroprotective effects and delays motor decline. These findings identify a transcellular communication axis between muscles and motor neurons that regulates axonal local synthesis and NMJ maintenance, offering insights into ALS onset and progression.

DCC
Also flagged:substance useCADM2cannabis use disorderalcoholbrain developmentcell adhesion molecule 2
Journal Article 2025-10-03 ✓ 3 Snippets Bright U, Beck S, Galimberti M, Gupta P, Chen Y, Dao C, Nunez YZ, Kranzler HR, Zhou Y, Zhang Y, Choi KW, Levey DF, Gelernter J.
In-Text Gene Mentions

…NPC1 *rs1788783 andDCC*rs2045154 (Table 2…

…significant effect ofDCC, which has…

…including AKT3 ,DCC, NRXN1 ,…

Show Full Abstract

Cannabis is one of the most commonly used drugs in the world, and use is trending alarmingly higher. We aimed to examine the genetic basis of cannabis lifetime use (CanLU) and its genetic relationships with a variety of psychiatric- and physical health-related phenotypes. We conducted a multi-ancestral genome-wide association study (GWAS) of CanLU using data from All of Us in five genetic populations. We meta-analyzed the results of EUR participants with previously published CanLU data (total effective sample size: 258,823), and conducted a set of post-GWAS analyses, including genetic correlation analysis using LDSC, local genetic correlation analysis with LAVA, Mendelian randomization (MR) to assess causality, and phenomewide association analysis. We found 11 independent variants significantly associated with CanLU, most prominently CADM2*rs7609594 (p = 7.4 × 10<sup>-20</sup>). CanLU was genetically correlated with traits related to openness to experience and risk taking, including substance use and sexual behaviors. MR demonstrated that most of these traits had a bidirectional causal relationship with CanLU, and six were locally genetically correlated with CanLU in a region that maps to CADM2. Genetic correlations sometimes differed from those previously observed for cannabis use disorder. Our results highlight the distinct genetic architecture of CanLU, and support the genetic, and biological, differentiation between CanLU and cannabis use disorder. Genetic correlations between CanLU and other risk taking- and substance use-related traits indicate a broad mutual genetic mechanism underlying these traits, and suggest involvement of CADM2. These findings provide potential targets for future prevention and intervention strategies for substance use and risk-taking behaviors.

HTT
Also flagged:neurodegenerative diseasecognitive impairmentsHDlong-term potentiationmemory impairmentsamino
Journal Article 2025-10-03 ✓ 5 Snippets McLean FH, Monteiro O, Lelos MJ, Ekkunagul T, Spicer RM, Rybnicek J, Lambert JJ, Langston RF.
In-Text Gene Mentions

…the huntingtin (HTT) gene 1…

…of the humanHttgene with expanded…

…the endogenous mouseHttgene.…

…has the mouseHttexon 1 replaced…

…by the humanHTTexon 1 sequence…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disease. In humans, the clinical diagnosis is often dependent on the emergence of motor symptoms. However, cognitive impairments and metabolic changes can be early indicators. HD mouse models are a useful tool to understand disease progression, however, relatively few studies have monitored the timeline for the emergence of cognitive indices with motor and metabolic phenotypes in parallel. In this study, cognitive, motor, and metabolic phenotypes were investigated at different ages in the zQ175 knock-in mouse alongside immunohistochemical and long-term potentiation (LTP) studies. We demonstrated that zQ175 mice developed impaired hippocampal LTP at 3-months and cognitive deficits in visuospatial attention were evident by 4-months. Long-term and spatial memory impairments emerged by 12-months, alongside motor impairments. Additionally, an anxiolytic-like phenotype emerged at 6-months. Differences in body weight were also detected from 6-months onwards, primarily driven by a reduction in fat mass. Additionally, reduced brain weight and the presence of huntingtin aggregates in the hippocampus, striatum and hypothalamus were observed at 12-months. These data support the zQ175 mouse as a model of HD, which recapitulates many aspects of the disease progression in humans and can be used to understand mechanisms underlying the disease.

TNFSF4
Also flagged:Cytokinegene expressionADpathogenesisamyloid-βcognitive decline
Journal Article 2025-10-03 ✓ 2 Snippets Godoy JB, Vialle RA, Dos Santos L, Raittz RT, Wang Y, Menon V, De Jager PL, Schneider JA, Tasaki S, Bennett DA, Guizelini D, de Paiva Lopes K.
In-Text Gene Mentions

…( IGF1, THPO,TNFSF4, IL33 ).…

…THPO, TGFB1, CCL2,TNFSF4, SPP1, PSPN, C3,…

Show Full Abstract

Alzheimer's disease (AD) is a complex neurodegenerative condition linked to chronic neuroinflammation. This study investigates the cytokine gene expression profile in cortical tissue samples from elderly individuals with and without AD to identify potential biomarkers and enhance our understanding of disease pathogenesis. Utilizing high-depth RNA sequencing data, we identified a set of cytokines whose expression significantly associated with different aspects of the AD phenotype, including measures of neurofibrillary tangles, amyloid-β deposition, and a person-specific rate of cognitive decline. Single-nucleus transcriptomics data facilitated the identification of specific cell types, such as microglia and astrocytes, that significantly contribute to the inflammatory response in AD. Additionally, we observed a correlation between the expression of certain cytokines and genetic risk for the disease. Our findings indicate that cytokine-mediated neuroinflammation may play an important role in neurodegeneration and that modulating the immune response may offer a promising strategy for developing new therapies.

B4GALT5
Also flagged:methylationBeckwith-Wiedemann syndrometumourschromosomeIC2imprinting
Journal Article 2025-10-03 ✓ 2 Snippets Cecere F, Pignata L, D'Angelo E, Giaccari C, Saadat A, Sparago A, Angelini C, Hay Mele B, Mussa A, Ferrero GB, Scarano G, Gori G, Di Maria E, Romano C, Tarani L, Piscopo C, Scala I, Tenorio JA, Lapunzina P, Cerrato F, Riccio A.
In-Text Gene Mentions

…with cancer (e.g.B4GALT5, SLC12A9 and…

…36 ] andB4GALT5[ 37 ]…

Show Full Abstract

<h4>Background</h4>The expression of imprinted genes, which depends on their gamete of origin, is regulated by DNA sequences characterized by differential methylation between the maternal and paternal alleles (also known as germline differentially methylated regions or gDMRs). The most common molecular defect associated with Beckwith-Wiedemann syndrome (BWS), a condition linked to overgrowth and tumours, is the loss of methylation of the KCNQ1OT1-TSS gDMR located on chromosome 11p15.5 (also known as IC2 LoM). Approximately one-third of BWS patients with IC2 LoM exhibit multi-locus imprinting disturbances (MLID). While maternal-effect variants in proteins of the oocyte subcortical maternal complex (SCMC) have been linked to MLID, the underlying mechanisms and health impact of this epigenetic disturbance remain unclear.<h4>Results</h4>We used the Infinium EPIC methylation array to investigate whole-genome CpG methylation in 64 BWS patients with IC2 LoM and 37 control subjects. We distinguished two patient groups, one with a variable methylation level of 24 gDMRs and the other with single-locus IC2 LoM. We observed that the mothers of the former patient group carried more variants in maternal-effect genes than those of the latter group, and 50% of them, but none of the latter group had variants in the SCMC genes. Additionally, in the former group, the mothers were older at the time of pregnancy, and the patients showed higher variation in methylation levels of thousands of CpGs located in non-imprinted loci, including protochaderins and cancer-associated genes. We found no differences in clinical features or in the incidence of assisted reproductive technology between the two patient groups. However, multiple affected siblings and recurrent miscarriages were observed only among cases with biallelic maternal-effect SCMC gene variants.<h4>Conclusions</h4>This study demonstrates that the BWS patients with MLID exhibit highly variable methylation changes that affect both imprinted and non-imprinted loci in a seemingly stochastic manner throughout the genome. These findings support the hypothesis that MLID results from the interaction of maternal-effect genes and environmental factors in aged oocytes, leading to disordered DNA methylation in the whole genome. Future research should investigate whether and how these epimutations impact the health of affected individuals, particularly in adulthood.

SERPINC1
Also flagged:ischemic strokestrokedementiaepilepsycognitive impairmentcerebral infarction
Journal Article 2025-10-03 ✓ 5 Snippets Ohara H, Shimizu H, Yamanaka M, Yamada N, Kikutsuji N, Miyoshi R, Kanesaki H, Kanda T, Honda K, Kinoshita M, Sugie K.
In-Text Gene Mentions

…cut-off scores ofACE-IIIwere ≤ 58.5…

…Cognitive scores, especiallyACE-III, within two weeks…

…InACE-III, the maximum Youden’s…

…cognitive scores, especiallyACE-III, for risk measurement…

…the utility ofACE-IIIwas superior to…

Show Full Abstract

<h4>Background</h4>Late seizures are well-known sequelae after stroke. Previous history of stroke and dementia is common etiology of epilepsy, however, the effect of cognitive impairment on late seizures has not been fully investigated. We investigated the clinical significance of cognitive scores in predicting the occurrence of post-stroke late seizures.<h4>Methods</h4>Adult patients with acute cerebral infarction were analyzed. Their cognitive function was evaluated using the Addenbrooke's Cognitive Examination (ACE)-III and the Japanese version of Montreal Cognitive Assessment (MoCA-J) within two weeks after stroke. Factors associated with late seizures and accuracy of cognitive scores to predict late seizures were analyzed.<h4>Results</h4>Of 45 patients enrolled (28 males, age 77.2 ± 8.5 years, mean ± SD), eight patients had late seizures within 123.8 ± 126.5 days after cerebral infarction. Cognitive evaluation was performed at 8.0 ± 3.9 days. ACE-III and MoCA-J scores were significantly lower in patients with late seizures than in those without late seizures (ACE-III: 27.5 ± 17.3 vs. 59.1 ± 27.2, MoCA-J: 7.6 ± 5.9 vs. 15.4 ± 8.6, p < 0.05, unpaired t-test). Receiver operating characteristic curve analysis revealed that area under curve of ACE-III was larger than that of MoCA-J and size of cerebral infarction. The optimum cut-off scores of ACE-III were ≤ 58.5 (Sensitivity: 1.00, specificity: 0.62) and ≤ 45.0 (0.88, 0.73). Kaplan-Meier estimates showed that each cut-off score significantly associated with late seizures. Sizes of infarcts and of cortical lesion were not significantly different between patients with and without late seizures. ROC curve and Kaplan-Meier survival analyses showed a significant association between size of infarct and late seizures, however, ACE-III scores more strongly associated with late seizures than the size of infarct did.<h4>Conclusion</h4>Cognitive scores, especially ACE-III, within two weeks after cerebral infarction can be useful for predicting post-stroke late seizures.

OLFM4
Also flagged:acute myeloid leukemiaAMLELANELTFS100A12SLPI
Journal Article 2025-10-03 ✓ 3 Snippets Li ZF, Lu JR, Dai Y, Mao RJ, Lu YL, Sun R, Liu J, Dong LL, Xia LL, Xu YC, Xia T, Qin X, Dong T.
In-Text Gene Mentions

…KKI67, CLSPN, KNL1,OLFM4, CAMP, and LTF…

…CRISP3, CLSPN, KNL1,OLFM4, CAMP, LTF (Supplementary…

…+ FCGR3B +OLFM4+ Myelocyte), 9…

Show Full Abstract

Acute myeloid leukemia (AML) is defined as a highly heterogeneous clonal malignant disease of immature myeloid hematopoietic stem cells. The objective of this study was to identify the principal cell clusters in AML and their associated hub genes through the analysis of single-cell sequencing data. We present a comprehensive and valuable landscape of 58,717 cells and 27,311 genes derived from bone marrow samples obtained from 5 patients with AML and 3 controls. Then, 9 cell subclusters were identified. The ratios of common myeloid progenitor (CMP), Myelocyte, and Pro-Myelocyte were found to be significantly different between AML and control, as these cells were utilized as differential cells in the present study. A total of 26 differentially expressed genes were identified following the merging and de-weighting of the data. 4 hub genes, ELANE, LTF, S100A12, and SLPI, were selected for further analysis. Homogeneity analysis was conducted on the Myelocyte and Pro-Myelocyte cells, which were subsequently re-clustered into 11 and 8 cell clusters, respectively. In conclusion, we leveraged high-throughput single-cell transcriptomics to parse the cell landscape in the bone marrow from AML patients, 2 key cell types, myelocyte, and pro-myelocyte and related hub genes, ELANE, LTF, S100A12, SLPI were found, and biological functions, regulatory relationships, and developmental status of these key cells, as well as the biological pathways, the molecular regulatory mechanisms, and the related drugs, involved in the hub genes were demonstrated. Our data and findings provide novel insight into AML pathological development and can be inspired in the treatment of AML.

Also flagged:nemaline myopathycongenital muscle disordersarcomereNRAPFBXO40TRIM63
Journal Article 2025-10-03 No Snippets Hedberg-Oldfors C, Bedir AZ, Visuttijai K, Michael E, Oldfors A.
Show Full Abstract

<h4>Background</h4>Nemaline myopathy is a rare congenital muscle disorder characterized by the presence of nemaline rods, protein aggregates, in muscle fibers. Pathogenic variants in several genes, most commonly <i>NEB</i> and <i>ACTA1</i>, which encode thin filament proteins of the sarcomere, have been implicated in its etiology. Currently, there is no cure for nemaline myopathy, underscoring the need to identify disease-modifying targets for therapeutic development.<h4>Methods</h4>In this study, we employed quantitative nanoscale liquid chromatography-tandem mass spectrometry (LC-MS<sup>3</sup>) with labeled protein analysis on muscle tissue from five normal controls and seven infants diagnosed with nemaline myopathy due to <i>NEB</i> or <i>ACTA1</i> pathogenic variants.<h4>Results</h4>We identified and quantified 4,846 proteins across all samples, with 183 proteins showing significant dysregulation. Protein-protein interaction analysis revealed nine upregulated, muscle-specific proteins: NRAP, FBXO40, TRIM63, TRIM54, ALPK3, XIRP1, ANKRD2, LMOD2, and CSRP3. Further pathway analysis indicated upregulation of protein synthesis and proteasomal degradation processes, alongside downregulation of glycolysis. Notably, the dysregulated proteins and pathways were consistent across both genetic subtypes, suggesting shared molecular mechanisms underlying the disease.<h4>Conclusion</h4>This proteomic profiling study has identified key dysregulated proteins and pathways in infantile nemaline myopathy. These findings advance our understanding of the disease's molecular basis and highlight candidate targets for future therapeutic intervention.

Also flagged:magnesiumosteogenesishydrogenscandiumstrontiumdegradation
Journal Article 2025-10-03 No Snippets Gmitro S, Larraza A, Sotoudehbagha P, Alayon Mata A, Romero A, Lovejoy J, Razavi M.
Show Full Abstract

<h4>Introduction</h4>With an average of 6.8 million fractures per year in the United States, the current method for surgical intervention involves bioinert materials that do not promote osteogenesis and can have inflammatory reactions that hinder bone healing. Magnesium has emerged in research due to the material's biodegradability and biocompatibility; however, it has a low corrosion resistance, which can lead to hydrogen gas evolution and tissue necrosis. Therefore, magnesium is typically alloyed with rare earth elements (REEs) to increase corrosion resistance. The main goal of this study involves fabricating a magnesium (Mg)-based metal matrix nanocomposite (MMNC) containing scandium (Sc) and strontium (Sr) as alloying elements, as well as diopside (CaMgSi2O6) -based bioactive glass-ceramic nanoparticles for reinforcement.<h4>Methods</h4>MMNCs were processed using ultrasonic melt processing and hot rolling to disperse nanoparticles and refine their microstructure. These MMNCs have undergone detailed tests to determine microstructure and degradation properties, followed by <i>in vitro</i> and <i>in vivo</i> tests to determine the MMNC's biodegradation and biocompatibility characteristics.<h4>Results</h4>Through cell culture with human bone marrow-derived mesenchymal stem cells (hBM-MSCs) we determined that MMNCs provide <i>in vitro</i> cytocompatibility of >80%. Next, MMNC pins were implanted into rat femoral defects and monitored for 3 months post-implantation with the WE43 Mg alloy used as a control. Utilizing <i>in vivo</i> and <i>ex vivo</i> X-ray imaging and histology of these defects implanted with MMNC or WE43 pins, we found that our composite allows for no or minimal hydrogen gas evolution and fibrotic body response with osteointegration and new bone formation.<h4>Discussion</h4>This allows for an understanding of potential applications of our composite as a biomaterial.

Also flagged:HMGB1FerroptosisirondeathlipidHigh-mobility group box 1
Journal Article 2025-10-03 No Snippets Lv L, Wang Y, Lv X, Miao Q.
Show Full Abstract

Ferroptosis is a distinct, iron-dependent form of regulated cell death characterized by lipid peroxidation and redox imbalance. High-mobility group box 1 (HMGB1), a nuclear protein with strong immunomodulatory capacity, has emerged as a key regulator in ferroptosis-related pathologies. Acting both as a downstream effector released during ferroptotic cell death and as an upstream amplifier of inflammation, immune activation, and metabolic dysfunction, HMGB1 plays a context-dependent dual role in disease progression. In tumor settings, HMGB1-mediated ferroptosis enhances antitumor immunity and suppresses tumor growth. Conversely, in non-neoplastic diseases, such as ischemia-reperfusion injury and inflammatory disorders, HMGB1 release exacerbates tissue damage and immune dysregulation. This review comprehensively summarizes the molecular mechanisms of HMGB1-induced ferroptosis, including its regulation via autophagy-ferritinophagy and redox signaling pathways. We further examine how the HMGB1-ferroptosis axis contributes to systemic diseases affecting the respiratory, digestive, nervous, circulatory, urinary, locomotor, endocrine, reproductive, and immune systems. Finally, we discuss emerging therapeutic strategies that target this axis with an emphasis on disease-specific interventions modulating ferroptosis, inflammation, and immune responses.

PLCL1
Also flagged:autophagyATG16L1CDpathogenesisbindingAutophagy Related 16 Like 1
Journal Article 2025-10-03 ✓ 1 Snippet Ren S, Wei W, Liu X, Kang X, Liu J, Zhai W, Zhang Y, Chuai Q, Hu B, Liu J, Lang X.
In-Text Gene Mentions

…four genes RP11-973H7.1,PLCL1, ATG16L1, and RPL9…

Show Full Abstract

<h4>Background</h4>ATG16L1 (Autophagy Related 16 Like 1) is a key regulatory protein in the autophagy pathway. Although previous studies have established a significant association between the ATG16L1 genotype and Crohn's disease (CD) susceptibility, the specific molecular mechanism of its high-frequency missense variant rs2241880 has yet to be systematically elucidated.<h4>Methods</h4>In this study, we first confirmed the important role of ATG16L1 in CD pathogenesis through genome-wide association study analysis and Western blot, as well as qRT-PCR. Subsequently, high-precision structural prediction, protein model-based dynamic simulation, and AI model thermodynamic stability analysis were innovatively integrated. The thermal shift assay (TSA) was employed to validate the structural stability of the mutant, while the pull-down assay was used to examine its binding capacity with WIPI2b.<h4>Results</h4>The results show that ATG16L1 plays a significant role in the pathogenesis of CD. The mutation causes the protein's overall conformation to become more compact, significantly increasing the rigidity of key functional regions, and enhancing the structural and thermodynamic stability, which in turn affects the cleavage efficiency of caspase-3 and the function of the WD40 domain. The results of the TSA experiment provided evidence for the computational findings. The pull-down assay confirmed that the binding capacity of the mutant to WIPI2b was significantly impaired.<h4>Conclusion</h4>This finding not only provides the first molecular mechanism of the ATG16L1 T300A mutation, offering an important theoretical basis for understanding CD susceptibility differences, but also provides insights for precision medicine interventions and gene editing strategies.

HTT
Also flagged:genetic neurological diseaseoligonucleotideneurological diseasesnervous system disordersimmune responsesneurological disease
Journal Article 2025-10-03 ✓ 1 Snippet Rahim AA, Kurian MA, Zhou H, Ferguson R, Tabrizi SJ, Lignani G, Aquilina K, Waddington SN.
In-Text Gene Mentions

…lowering the wild-typeHTTprotein, or both.…

Show Full Abstract

Often, gene therapy reviews concentrate upon specific therapeutic modalities-particularly either viral vector-mediated or a nonviral approach. Here, we draw together a comprehensive array of knowledge across the field of genetic therapy for genetic neurological disease. The sections on preclinical and clinical application of viral vectors are followed by sections on RNA-based therapies and then by antisense oligonucleotide approaches also in preclinical and clinical settings. We present a separate section on gene editing strategies and conclude with a section elaborating on the neurosurgical techniques and the expertise required for clinical application of many of these technologies. SIGNIFICANCE STATEMENT: Genetic therapies have significant potential to treat life-limiting neurological diseases. This review examines the different approaches, clinical successes, and considerations on how to deploy them.

SOX6
Also flagged:Foveal hypoplasiaFHpigmentationnystagmusgenetic disorderalbinism
Journal Article 2025-10-03 ✓ 5 Snippets Gregory-Evans K, Gregory-Evans CY.
In-Text Gene Mentions

…AHR , andSOX6were upregulated in…

…peripheral cones, whereasSOX6was elevated in…

…the role ofSOX6in the retina…

…Loss ofSox6in mice leads…

…reduced levels ofSOX6are seen in…

Show Full Abstract

The fovea is an anatomic specialization of the human retina critical for high visual acuity, color vision, and contrast sensitivity. The molecular and cellular pathways directing this focal topography are still to be determined. Abnormalities of the fovea (e.g., foveal hypoplasia in children) are considered a significant contributor to reduced quality of life. In addition, the fovea is often damaged in common retinal diseases, such as age-related macular degeneration and diabetic retinopathy, with a global economic burden of $500 billion USD. Currently, there are no treatments for foveal defects. Most genes contributing to foveal abnormalities have been identified but are yet to be characterized and studied. This is because common laboratory animals do not have a fovea, and only rare human tissue samples are available during the major phase of foveal maturation, from birth to the end of the fourth year of life. We discuss validation of the anole lizard, which has a foveal structure, for research studies into foveal development. Since foveal development continues after birth, it may be possible to stimulate new foveal maturation where there is developmental damage. From this review, we propose an evidence-based cellular mechanism that offers new possibilities for testing future therapies for foveal defects.

PTGIS
Also flagged:metabolismagingsignal transductionprimary immunodeficiencyB cell receptorautoimmune disease
Journal Article 2025-10-03 ✓ 1 Snippet Shah S, Zhang H, Tang B, He D, Nabi G, Zheng J, Hao Y.
In-Text Gene Mentions

…The genesPTGIS, GPX7, PLA2G4F, and…

Show Full Abstract

No abstract available.

Research Square 2025-10-03 Preprint (No Snippets API) Mucha R, Furman M, Urbanova A, Kopolovets I, Nemethova M, Virag M, Hresko S, Katuch V, Sihotsky V.
Show Full Abstract

<title>Abstract</title> <p> Stroke is a serious disease, ranking among the leading causes of mortality and permanent disability in EU countries. The ischemic cascade, triggered by the blockage of oxygenated blood supply to brain tissue, leads to excitotoxicity, oxidative stress, inflammation, and eventually, cell death. Current research highlights the promising neuroprotective effects of conditioning, which induces ischemic tolerance (IT). Thus, the main objective of this study is to analyse selected genes affected by ischemic stroke and the neuroprotective response to ischemic stroke, with a focus on ischemia and ischemic tolerance in peripheral blood.We investigated changes in gene expression indicative of cerebral ischemia during carotid endarterectomy (CEA), a procedure that involves the temporary occlusion of the <italic>arteria carotis interna</italic> .To assess the influence of CEA on IT induction, we performed a whole-transcriptome analysis of peripheral blood cells isolated from symptomatic, asymptomatic, and oximetric patients.The presence of gene expression changes in genes selectively identified through whole-transcriptome analysis was subsequently statistically verified. Using quantitative qRT-PCR, we monitored gene expression changes <italic>in SLC2A14, TRPM7, UGP2, PLLP, ND4L, HMSD, SESN3, DPY19L4, UBE3A</italic> , and <italic>PCDH9</italic> . The results suggest that CEA affected the expression of all monitored genes, with statistically significant differences between groups, indicating the activation of distinct ischemic tolerance cascades in different patient groups.These findings may contribute to a better understanding and characterising of the molecular mechanisms underlying ischemic tolerance. </p>

DCC
Also flagged:Endophilin A1organizationsynapsesneuropsychiatric disordersinhibitory postsynaptic scaffold proteinγ-aminobutyric acid type A receptors
Journal Article 2025-10-02 ✓ 1 Snippet Chen X, Pan D, Liu JJ, Yang Y.
In-Text Gene Mentions

…the transmembrane proteinDCC(Deleted in Colorectal…

Show Full Abstract

The assembly and operation of neural circuits in the brain rely on the coordination and balance of excitatory and inhibitory activities. Inhibitory synapses are key regulators of the functional balance of neural circuits. However, due to the diversity of inhibitory presynaptic neurons, the complex composition of postsynaptic receptor subunits, and the lack of typical postsynaptic dense structure, there are relatively few studies on the regulatory mechanisms for inhibitory synaptic structure and function, and insufficient understanding of the cellular and molecular abnormalities of inhibitory synapses in neurological and neuropsychiatric disorders. Here, we report a crucial role for endophilin A1 in inhibitory synapses. We show that endophilin A1 directly interacts with the inhibitory postsynaptic scaffold protein gephyrin in excitatory neurons and promotes organization of the inhibitory postsynaptic density and synaptic recruitment/stabilization of the γ-aminobutyric acid type A receptors via its plasma membrane association and actin polymerization-promoting activities. Loss of endophilin A1 by gene knockout in mouse hippocampal CA1 pyramidal cells weakens inhibitory synaptic transmission and causes imbalance in the excitatory/inhibitory function of neural circuits, leading to increased susceptibility to epilepsy. Our findings identify endophilin A1 as an iPSD component and provide new insights into the organization and stabilization of inhibitory postsynapses to maintain E/I balance as well as the pathogenesis of epilepsy.

Also flagged:Acquired Gray platelet syndromeJAK2polycythemia vera myelofibrosisbleeding disorderdesmopressingray platelet syndrome
Journal Article 2025-10-02 No Snippets Pradeep A, Falade AS, Botero JP, Chen DC, Pruthi RK, Matin A.
Show Full Abstract

We report the case of a 70-year-old male with a history of JAK2 mutation-positive post-polycythemia vera myelofibrosis and an acquired bleeding disorder. Investigations revealed platelet dysfunction, and platelet electron microscopy demonstrated an acquired gray platelet syndrome. His platelet function improved with desmopressin administration, and he successfully underwent a central venous catheter placement and hematopoietic stem cell transplant with no bleeding complications. Follow up testing demonstrated normalization of platelet function testing and resolution of his acquired gray platelet syndrome.

PRDX6
Also flagged:Lipidtype I interferonmacrophage activationpulmonary TBsst1TB
Journal Article 2025-10-02 ✓ 1 Snippet Yabaji SM, Zhernovkov V, Araveti PB, Lata S, Rukhlenko OS, Abdullatif SA, Vanvalkenburg A, Alekseyev YO, Ma Q, Dayama G, Lau NC, Johnson WE, Bishai WR, Crossland NA, Campbell JD, Kholodenko BN, Gimelbrant AA, Kobzik L, Kramnik I.
In-Text Gene Mentions

…Sod2, Gstm1, Gpx4,Prdx6, Srxn1, Txn2, and…

Show Full Abstract

A quarter of the human population is infected with <i>Mycobacterium tuberculosis</i>, but less than 10% of those infected develop pulmonary TB. We developed a genetically defined sst1-susceptible mouse model that uniquely reproduces a defining feature of human TB: the development of necrotic lung granulomas and determined that the sst1-susceptible phenotype was driven by the aberrant macrophage activation. This study demonstrates that the aberrant response of the sst1-susceptible macrophages to prolonged stimulation with TNF is primarily driven by conflicting Myc and antioxidant response pathways leading to a coordinated failure (1) to properly sequester intracellular iron and (2) to activate ferroptosis inhibitor enzymes. Consequently, iron-mediated lipid peroxidation fueled superinduction of Ifnβ and sustained the type I interferon (IFN-I) pathway hyperactivity that locked the sst1-susceptible macrophages in a state of unresolving stress and compromised their resistance to Mtb. The accumulation of the aberrantly activated, stressed, macrophages within the granuloma microenvironment led to the local failure of anti-tuberculosis immunity and tissue necrosis. The upregulation of the Myc pathway in peripheral blood cells of human TB patients was significantly associated with poor outcomes of TB treatment. Thus, Myc dysregulation in activated macrophages results in an aberrant macrophage activation and represents a novel target for host-directed TB therapies.

OLFM4
Also flagged:Crotonatechromatingene expressionhistonesodiumdextran sulfate sodium
Journal Article 2025-10-02 ✓ 5 Snippets Xiao Y, Yu S, Zhang M, Zhong N, Hua S, Fang Z, Zhang Z, Liu H, Tan R, Liu Y, Chen YG.
In-Text Gene Mentions

…Cruz, sc-56, 1:200), anti-OLFM4(CST, 39141, 1:200),…

…, Ascl2, andOlfm4(Supplementary Fig. 3a…

…, Defa5, andOlfm4, but no…

…the number ofOLFM4+ cells did…

…did not decrease,OLFM4expression showed a…

Show Full Abstract

The intestinal epithelium undergoes rapid turnover driven by Lgr5<sup>+</sup> intestinal stem cells at the crypt base, and can recover upon damage. Histone crotonylation plays a critical role in chromatin regulation and gene expression. However, the role of histone crotonylation, specifically H3K14 crotonylation (H3K14cr) in the intestine remains poorly understood. Here we demonstrate that both crotonate and H3K14cr levels are increased in the regenerating crypts. Treatment with sodium crotonate significantly alleviates dextran sulfate sodium induced colitis, an effect largely dependent on HBO1-mediated H3K14cr. Notably, HBO1 deficiency severely dampens regeneration, correlating with reduced H3K14ac and H3K14cr levels, decreased chromatin accessibility at transcriptional start sites, and impaired expression of stem and fetal genes. Single-cell RNA sequencing analysis reveals that HBO1 is expressed in stem cells and regenerative cells during recovery after irradiation, further supporting the critical role of HBO1 in intestinal regeneration. Together, our findings uncover a mechanism by which crotonate, HBO1, and H3K14cr contribute to epithelial regeneration and suggest that crotonate may represent a promising therapeutic agent for the treatment of gastrointestinal diseases.

Also flagged:Congenital diaphragmatic herniapulmonary hypertensionPHmembraneoxygenC-reactive protein
Journal Article 2025-10-02 No Snippets Dang DA, Van Nguyen T, Nguyen DTT, Pham DT, Nguyen PTH, Nguyen TD, Pham TA, Le DTT, Ngo MT, Nguyen MH, Dao HH, Pham SH, Nguyen MTT, Tran HTT, Do SN, Nguyen NH, Luong CQ.
Show Full Abstract

<h4>Background</h4>Congenital diaphragmatic hernia (CDH) has a high mortality rate, particularly in low- and middle-income countries. This study aimed to investigate mortality rates and associated factors in CDH neonates in Vietnam.<h4>Methods</h4>This retrospective observational study included CDH neonates admitted to a central children's hospital in Vietnam between November 2021 and September 2023. We collected data on neonates' characteristics, management, complications, and outcomes, comparing these data between survivors and non-survivors. We also employed logistic regression analysis to identify factors associated with hospital mortality.<h4>Results</h4>Of 74 neonates with CDH, 64.9% (48/74) were male. The hospital mortality rate was 50.0% (37/74). The median gestational age at birth was 38 weeks (interquartile range [IQR]: 38-39), and the median age at admission was 5.2 h (IQR: 3.0-15.8). All neonates were referred from various prior hospitals, with 83.8% (62/74) requiring immediate postnatal intubation. The neonates presented in critical condition, as reflected by a median pre- and post-ductal SpO<sub>2</sub> difference of 2.5% (IQR: 1.0-10.0), a mean pulmonary artery systolic pressure (PASP) of 51.7 mmHg (standard deviation: 18.3) on admission, and a median Oxygenation Index at 6 h of life of 13.3 (IQR: 6.8-28.2). The median peak Vasoactive Inotropic Score (VIS) during surgical intensive care unit stay was 35.0 (IQR: 15.0-80.0). High-frequency oscillatory ventilation was used as the initial ventilatory mode in 52.7% (39/74) of cases. Supportive therapies included vasopressors (84.9%; 62/73), inotropic agents (29.6%; 21/71), inhaled nitric oxide (13.5%; 10/74), Ilomedin (29.7%; 19/64), and extracorporeal membrane oxygenation (6.8%; 5/74). Surgical repair was performed in 70.3% (52/74) of neonates. Multivariable logistic regression analysis identified higher peak VIS (adjusted odds ratio [AOR]: 1.061; 95% confidence interval [CI]: 1.011-1.113; p = 0.017) and elevated admission PASP (AOR: 1.140; 95% CI: 1.041-1.247; p = 0.005) as independent predictors of hospital mortality.<h4>Conclusions</h4>In this selected cohort of CDH neonates admitted to a central children's hospital in Vietnam, a high hospital mortality rate was observed. The findings suggest that limited access to neonatal intensive care and surgical repair may have influenced outcomes, warranting further evaluation in similar resource-limited settings to improve care strategies.<h4>Trial registration</h4>Not applicable.

POU3F2
Also flagged:Spinal cord injurycord injurycord injuriescollagenpolycaprolactoneWallerian Degeneration
Journal Article 2025-10-02 ✓ 1 Snippet Haratizadeh S, Liu H, Li H, Adeli M, All AH.
In-Text Gene Mentions

…increased level ofPOU3F2, a transcription factor…

Show Full Abstract

Spinal cord injury (SCI) imposes a significant physical, social, and economic burden on millions of patients and their families worldwide. Although medical and surgical care improvements have decreased mortality rates, sustained recovery remains constrained. Cell-based therapies offer a promising strategy for neuroprotection and neuro-regeneration post-SCI. This article reviews the most promising preclinical approaches, encompassing the transplantation of embryonic stem cells (ESCs), mesenchymal stem cells (MSCs), neural stem cells (NSCs), oligodendrocyte progenitor cells (OPCs), Schwann cells (SCs), and olfactory ensheathing cells (OECs), along with the activation of endogenous pluripotency cell banking strategies. We also outline key ancillary strategies to enhance graft cell viability and differentiation, such as trophic factor assistance, engineered biomaterials for supportive scaffolds, and innovative methods for a synergistic effect in treatment, including promoting neuronal regeneration and reducing glial scars. We highlight the key aspects of SCI pathophysiology, the fundamental biology of cell treatments, and the advantages and limitations of each approach.

Also flagged:dopaminebehavioralagouti-related peptidenucleusaggressionwater
Journal Article 2025-10-02 No Snippets Kamath T, Lodder B, Bilsel E, Green I, Dalangin R, Raghubardayal M, Wang W, Capelli P, Legister J, Timmins J, Hulshof L, Wallace JB, Tian L, Uchida N, Watabe-Uchida M, Sabatini BL.
Show Full Abstract

Caloric depletion induces behavioral changes that help an animal find food and restore its homeostatic balance. Hunger increases exploration and risk-taking behavior, allowing an animal to forage for food despite risks; however, it is unknown which neural systems coordinate such behavioral adaptations. Here, we characterize how hunger restructures an animal's spontaneous behavior as well as its directed exploration of a novel object. We show that hunger-induced changes in exploration are accompanied by and result from the modulation of dopamine signaling in the tail of the striatum (TOS). Dopamine signaling in the TOS is in turn modulated by hunger through the activity of agouti-related peptide (AgRP) neurons, putative "hunger neurons" in the arcuate nucleus of the hypothalamus that are polysynaptically connected to the TOS through the lateral hypothalamus. Thus, we delineate how hypothalamic systems modulate dopaminergic circuitry to mediate changes in exploratory behavior in the hungry state.

LRRC7
Also flagged:amyotrophic lateral sclerosisALSgene expressionmotorneuron degenerationRNA-binding proteins
Journal Article 2025-10-02 ✓ 1 Snippet Ma GM, Xia CC, Lyu BY, Liu J, Luo F, Guan MF, Wang JY, Sun L, Zhang L, Chen Y, Mao YW, Yu GQ, Wang WY.
In-Text Gene Mentions

…, SCN2A ,LRRC7, and others…

Show Full Abstract

Here, we conducted temporal RNA sequencing (RNA-seq) profiling of human induced pluripotent stem cells (hiPSCs) and induced pluripotent stem cell (iPSC)-derived motor neurons (iMNs) carrying C9orf72, FUS, TARDBP, or SOD1 mutations in both patients with amyotrophic lateral sclerosis (ALS) and healthy individuals. We discovered dysregulated gene expression and alternative splicing (AS) throughout iMN development and maturation, and iMNs with mutations in ALS-associated genes displayed enrichment of cytoskeletal defects and synaptic alterations from the premature stage to mature iMNs. Our findings indicate that synaptic gene dysfunction is a common molecular hallmark of familial ALS, which may result in neuronal susceptibility and progressive motor neuron degeneration. Analysis of upstream splicing factors revealed that differentially expressed RNA-binding proteins (RBPs) in iMNs from patients with ALS may cause abnormal AS events. Overall, our research provides a comprehensive and valuable resource for gaining insights into the shared mechanisms of familial ALS pathogenesis during motor neuron development and maturation in iMN models.

Also flagged:Neurodegenerative diseasesmetabolismmitochondrialphosphorylationcalciumorganelles
Journal Article 2025-10-02 No Snippets Huang J, Zhang C, Huang C, Deng K, Xiao Y, Gao W, Wu M, Lei M.
Show Full Abstract

Neurodegenerative diseases represent a major health threat, with dysfunction in energy metabolism and imbalance in glucose-lipid homeostasis constituting key pathogenic factors. As the cell's energy hub, mitochondria are closely associated with neurodegenerative diseases, such as Alzheimer's and Parkinson's diseases. However, the precise mechanism by which mitochondrial energy metabolism affects glucose-lipid homeostasis remains unclear. This review summarizes currents insights into the role of mitochondrial function in energy metabolism and glucose-lipid regulation in neurodegenerative diseases. We examined how mitochondrial dynamics, oxidative phosphorylation, calcium homeostasis, and key signaling pathways-AMP-activated protein kinase/mammalian target of rapamycin, peroxisome proliferator-activated receptor gamma coactivator 1-alpha, and Sirtuin 1-contribute to neuronal energy balance and metabolic regulation. We further explored the impact of other organelles on mitochondria and how the dynamic switching of mitochondrial morphology and function disrupts the critical glucose-lipid homeostasis. By focusing on mitochondrial dysfunction, metabolic disorders, and their interactions, we introduce the mitochondria-centered multi-organelle-energy metabolic-glucose-lipid homeostasis (MMH) network as a unifying theoretical framework that positions the progressive loss of metabolic flexibility as the fundamental essence of neurodegenerative disorders. The MMH network furnishes a novel lens through which the shared mechanistic underpinnings of neurodegenerative diseases can be deciphered, and thereby enable earlier diagnosis and precision therapeutics.

Also flagged:metabolismcancersRNA helicasespathogenesisgene expressioncell growth
Journal Article 2025-10-02 No Snippets Seto AM, Saville BJ.
Show Full Abstract

RNA helicases are conserved enzymes found in both prokaryotes and eukaryotes. They function in all aspects of RNA metabolism and are known to influence various cellular and metabolic processes. In addition, they have been implicated in certain cancers and diseases. Studies on RNA helicases in fungi indicate their conserved roles in RNA metabolism and suggest that their dysregulation can affect fungal growth. However, the roles of RNA helicases in fungal plant pathogenesis remain underexplored, despite increasing knowledge of how RNA helicases modulate gene expression and disease progression. We used the basidiomycete plant pathogen <i>Ustilago maydis</i> as a model to identify 46 RNA helicases. We review the roles of RNA helicases in RNA metabolism, cellular growth and homeostasis, and metabolism. We then utilized available <i>U. maydis</i> transcriptome data and current research to hypothesize potential functions of RNA helicases in fungal plant pathology. These roles include influencing cell growth, modulating stress response, contributing to virulence and disease progression, and regulating fungal spore dormancy and germination. Understanding the roles of RNA helicases in gene regulation may aid in developing strategies to mitigate disease spread in fungal plant pathogens.

Also flagged:gene expressionssynthesiscell proliferationproenkephalinPENKepidermal growth factor-like protein 6
Journal Article 2025-10-02 No Snippets Hakki SS, Bozkurt SB, Ergul Z, Karaoz E, Kayis SA.
Show Full Abstract

The aim of this study was to compare whole-genome gene expressions of periodontal ligament (PDL) and pulp (P) mesenchymal stem cells (MSCs) isolated from third molar (m), premolar (p), and deciduous (dec) teeth. Total RNAs were isolated and used for cRNA synthesis. Human Expression Hybridization Assay was used for 47,000 probes. Data were subjected to quantile normalization before analysis. Based on the differentially expressed genes, immunomodulation properties of m/p/dec-MSCs were evaluated. Lymphocytes cocultured P/pdl-MSCs were investigated for apoptosis and cell survival of phytohemagglutinin-stimulated T cells. T cells and medium supernatants were collected on Days 1 and 4 of the experiments to evaluate T-cell proliferation by WST-1 and apoptotic markers by flow cytometry. Statistical analysis demonstrated that 291 genes were differentially expressed ≥2 fold in the cells isolated from p/m/dec, and pdl/P MSCs. The most significant difference was recognized in the proenkephalin (PENK) gene (24-fold) in pPDLMSCs, epidermal growth factor-like protein 6 (EGFL6), and complement factor D (CFD) genes were differentially expressed in decPMSCs 16.9-fold and 11-fold, respectively, when compared to other MSCs. A difference in PENK mRNA expression was also confirmed by RT-PCR. Findings of the study revealed that all dental MSCs cocultured with T cells suppressed the proliferation of T cells on Day 1 when compared to T cells alone (<i>p</i>=0.001). The suppression of T lymphocytes proliferation, PENK, and IL-10 mRNA expressions was higher in pPDLMSCs. Highest PENK and IL10 mRNA expressions and T-cell regulation in PDLMSCs suggested that PDLMSCs might be a promising candidate for immune regulation.

OLFM4
Also flagged:LactoferrinischemiaLFdegradationethanolcholesterol
Journal Article 2025-10-02 ✓ 4 Snippets Lin Y, Ding R, Zhang Y, Wang Y, Song S, Guo H.
In-Text Gene Mentions

…including Pcna andOlfm4.…

…of Pcna andOlfm4( Figure 6…

… height, increasing PCNA/Sox9/Olfm4-positive crypt stem cells,…

…lial proliferation (PCNA/Sox9/Olfm4upregulation) with negligible…

Show Full Abstract

Radiation-induced intestinal injury (RIII), a severe complication of abdominopelvic radiotherapy, causes intestinal ischemia, ulcers, and necrosis, severely impacting patients' quality of life. Currently, effective treatments are limited, and a specific cure remains elusive. Our previous research showed that lactoferrin (LF) can promote intestinal stem cell (ISC) proliferation and tissue repair; however, its oral administration is limited by rapid degradation in the gastric environment. In this study, we developed LF-loaded liposomal nanoparticles (Lip-LF) using a simple ethanol injection method. The optimal formulation (cholesterol/egg yolk lecithin ratio 2:8, LF concentration 12.5 mg/mL) achieved a drug-loading capacity of 6.8% and a narrow size distribution (0.2 < PDI < 0.4). In vitro experiments demonstrated that Lip-LF protected LF from pepsin degradation in simulated gastric fluid (SGF), retaining over 80% integrity after 120 min, while releasing in simulated intestinal fluid (SIF). In vivo imaging revealed prolonged gastrointestinal retention of Lip-LF compared to free LF. In a murine model of RIII (12 Gy whole-body irradiation), Lip-LF significantly restored villus counts, increased crypt height, and promoted goblet-cell regeneration. Immunohistochemical and qPCR analyses revealed enhanced ISCs proliferation and upregulation of repair-associated genes, including <i>Pcna</i> and <i>Olfm4</i>. These findings demonstrate that Lip-LF protects LF from gastric degradation and enhances its targeted delivery to the intestine, improving its therapeutic efficacy in repairing RIII. Lip-LF thus offers a promising strategy for managing RIII.

Also flagged:tumorN6-methyladenosinegene expressioncancertranslationalmethyltransferases
Journal Article 2025-10-02 No Snippets Chen X, Pu S, Lian K, Li L, Jiang X.
Show Full Abstract

N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic mRNA and has emerged as a pivotal regulator of gene expression at the post-transcriptional level. In the tumor immune microenvironment, tumor-associated macrophages (TAMs) represent a highly plastic and heterogeneous population that profoundly influences cancer progression, immune evasion, and therapeutic response. Recent studies have uncovered that m6A modification, mediated by dynamic "writers," "erasers," and "readers," exerts critical regulatory effects on TAM differentiation, polarization, and functional reprogramming. By modulating the stability, translation, and decay of transcripts involved in inflammatory signaling, metabolic adaptation, and immune checkpoints, m6A shapes the balance between tumor-promoting (M2-like) and tumor-suppressive (M1-like) macrophage phenotypes. Moreover, dysregulation of m6A machinery in TAMs has been linked to the suppression of anti-tumor immunity and resistance to immunotherapy, highlighting its translational potential as a therapeutic target. This review summarizes current advances in understanding the roles and mechanisms of m6A modification in TAM biology, discusses its implications in tumor immunity, and outlines the challenges and opportunities of targeting the m6A-TAM axis for cancer treatment.

HTT
Also flagged:infectionCOVID-19CD8peptideORF10T cell receptor
Journal Article 2025-10-02 ✓ 1 Snippet Parsons E, Lu Z, Richard SA, Zelkoski A, Le J, Palanikumar N, Nguyen P, Alba C, Sukumar G, Rosenberger J, Zhang X, Burgess TH, Colombo R, Mende K, Berjohn C, Epsi N, Agan BK, Tribble D, Lindholm DA, Dalgard CL, Pollett SD, Malloy AMW, EPICC COVID-19 Cohort Study Group.
In-Text Gene Mentions

…0.6%) recognized HTTDPSFLGRY (HTTORF1ab ) from…

Show Full Abstract

<h4>Introduction</h4>T cells influence COVID-19 severity and establish long-lasting immune memory in response to vaccination and infection. The diversity of the T cell repertoire, and complexity of T cell epitope recognition, make it challenging to define protective epitope-specific T cells. In this study, we created a highly specific TCR meta-database to identify T cell epitopes from the nearly complete SARS-CoV-2 proteome and determine whether vaccination with mRNA vaccines influenced the TCR repertoire.<h4>Methods</h4>Using this meta-database, we analyzed immunosequencing data of genomic DNA to define the variable region of T cell receptor (TCR) b chain (TCRB) sequences among participants in a longitudinal COVID-19 cohort study. The TCR repertoire was compared between participants who were vaccinated or unvaccinated against SARS-CoV-2 and stratified by disease severity. TCR diversity was measured using clonality, an index defined as the inverted normalized Shannon entropy.<h4>Results</h4>Highly clonal TCR repertoires correlated with age and comorbidities. Using our meta-database approach, we found that vaccinated participants hospitalized with infection had the most restricted SARS-CoV-2-specific CD8 TCR repertoire. However, TCRB with predicted specificity to non-spike SARS-CoV-2 proteins dominated the response, even in vaccinated participants. We identified a peptide sequence in the ORF10 accessory protein that was more frequently recognized in study participants with mild disease. Conversely, CD8 T cell recognition of a peptide sequence in ORF1ab more closely correlated with severe disease.<h4>Discussion</h4>Overarchingly, TCR repertoire analysis revealed that CD8 T cells responding to SARS-CoV-2 broadly recognize epitopes across the SARS-CoV-2 proteome, and provided opportunities to identify epitopes associated with disease.

ZNFX1
Also flagged:AutophagyorganellesautophagosomelysosomemTORC1mTORC2
Journal Article 2025-10-02 ✓ 3 Snippets Shoeran G, Anand N.
In-Text Gene Mentions

…the RNA-binding proteinZNFX1have emerged as…

ZNFX1stabilizes mRNA encoding…

…Loss ofZNFX1impairs autophagy, reduces…

Show Full Abstract

Autophagy, host immune responses, and macrophage polarization form a tightly regulated network. This network significantly influences the outcome of intracellular pathogenic infections. Autophagy acts as a critical cellular defense mechanism. It degrades intracellular pathogens and helps with antigen presentation in antigen presenting cells like macrophages. Intracellular parasites have evolved diverse strategies to modulate autophagy. They may inhibit autophagosome formation, block autophagosome-lysosome fusion, or redirect autophagic flux for their survival. These manipulations allow pathogens to evade degradation and persist within host cells. Macrophage polarization further influences autophagic activity: M1 macrophages typically exhibit enhanced autophagy, supporting antimicrobial functions, while M2 macrophages show reduced autophagic flux, contributing to immune regulation and tissue repair. Autophagy itself can influence macrophage phenotypes, with its activation promoting M1-like characteristics and its inhibition favoring M2-like responses. The macrophage polarization states influence T cell polarization and infection outcome. This bidirectional relationship between autophagy and macrophage polarization plays a pivotal role in determining host resistance or susceptibility to intracellular pathogens. In this review, we highlight findings from macrophage-infecting pathogens that manipulate autophagy, macrophage and T cell to enhance their survival within the host.

Also flagged:cervical cancerpathogenesishuman papillomavirus infectionHPV infectioncancerPersistent infection
Journal Article 2025-10-02 No Snippets Sisodiya S, Singh P, Joshi T, Aftab M, Firdausi N, Khan A, Mishra N, Jamil Khan N, Tanwar P, Gupta V, Hussain S.
Show Full Abstract

Cervical cancer is a one of the leading causes of mortality in women, and WHO's initiative to eliminate cervical cancer by 2030 needs to explore several emerging research areas for its elimination such as epigenetics which could play a crucial important role in the cervical cancer pathogenesis driven by persistent high-risk-human papillomavirus infection. Understanding the molecular and epigenetic mechanisms underlying HPV infection and its progression to cancer is critical for advancing prevention, diagnosis, and treatment strategies, which may play a crucial role in eliminating cervical cancer. Persistent infection of human Papillomavirus is intricately linked to the initiation and progression of cervical cancer with different molecular mechanisms, pathways, viral genes, and proteins. HPV-mediated alterations in the host epigenome play a pivotal role in driving oncogenic transformation by modulating gene expression, chromatin dynamics, and DNA methylation patterns, ultimately disrupting normal cellular functions. The relationship between HPV-induced epigenetic changes and cancer progression underscores the virus's ability to bypass conventional gene-silencing mechanisms. By altering critical regulatory pathways, HPV not only fosters cancerous growth but also influences patient responses to existing treatments, posing challenges to effective disease management. In this current review, we have discussed the role of epigenetic disruptions caused by HPV, which provided a unique opportunity to identify novel therapeutic targets and biomarkers. Epigenetic factors, being reversible and independent of direct genetic manipulation, offer promising avenues for innovative drug delivery strategies. Such approaches could enhance disease management by advancing therapeutic strategies and diagnostics for improving patient outcomes.

Also flagged:polymodal cation channelnociceptioncapsaicinresiniferatoxinsubstance PSP
Journal Article 2025-10-02 No Snippets Wang EC, Jeong P, Han C, Oh Y, Zhao Y, Hong J.
Show Full Abstract

The transient receptor potential vanilloid-1 (TRPV1) channel is a key mediator of pain perception and responds to various stimuli such as heat, low pH, and inflammation. Among TRPV1 antagonists, (<i>R,E</i>)-<i>N</i>-(2-hydroxy-2,3-dihydro-1<i>H</i>-inden-4-yl)-3-(2-(piperidin-1-yl)-4-(trifluoromethyl)-phenyl)-acrylamide (AMG8562) shows promise as a nonopioid analgesic, attenuating pain behaviors in rodent models without eliciting hyperthermic side effects commonly associated with other TRPV1 antagonists. Despite its potential, there has been limited research regarding the synthesis of AMG8562. Here, we present an asymmetric synthesis of AMG8562 featuring a lipase-catalyzed kinetic resolution of racemic 4-nitroindan-2-ol. This approach enables scalable access to enantiomerically pure material and provides a platform for the synthesis of structurally diverse AMG8562 analogues with potential for improved pharmacological properties.

Also flagged:trypsinchymotrypsinpolyanionspolycationscytochrome ccyt c
Journal Article 2025-10-02 No Snippets Ivanov NM, Tsitsimeli AT, Huck WTS.
Show Full Abstract

Understanding changes in the physicochemical properties of enzymes upon immobilization is the key to optimizing their activities. Immobilization on or modification with polyelectrolytes will induce shifts in the pH-activity profiles of enzymes, but a systematic study comparing various enzymes and polyelectrolyte supports is lacking. Here, we report the pH-activity profiles of eight enzymes immobilized via covalent bonds within six different polyacrylamide-<i>co</i>-polyelectrolyte hydrogel particles containing diverse ionic groups. Depending on the enzyme, shifts of the maximum activity toward either acidic or basic pH, as well as broadening of the pH-activity curves, were observed. While a general correlation of the direction of the shifts with the nature of the polyelectrolyte is not evident, we highlight that enzyme structural features, electrostatic factors, and local buffering are among the determinants of the observed effects. Finally, we demonstrate examples of unexpectedly large shifts that can be used to create biocatalysts with improved activities at unusual pHs.

bioRxiv 2025-10-02 Preprint (No Snippets API) Wiggins CD, Sangés Ametllé M, Wu C, Boswell KL, Watkins TA, Koup RA, Lauffenburger DA.
Show Full Abstract

While neutralizing ability has traditionally been considered the most important antibody function, appreciation has grown for Fc-mediated 'extra-neutralizing' functions, which are shaped by IgG glycosylation. However, there remain fundamental questions as to how B lymphocytes induce and regulate antibody glycosylation and thus functional capability. Understanding how transcriptional and cell state regulation shape glycosylation could reveal levers to tune protective humoral profiles in a disease- and antigen-specific manner. Prior studies have explored a limited panel of glycogenes and measured bulk glycosylation changes. Here, employing an in vitro antigen-specific B cell culture system, we systematically characterize transcriptional and humoral responses to cytokine perturbations. After exposure to a broad panel of cytokines (IL-4, IL-6, IL-10, IL-17, TNFa, IFNg, APRIL, and BAFF) across multiple concentrations and timepoints, transcriptomic profiling and lectin-based IgG glycome assays are employed to associate cytokine stimuli with both glycogene expression and IgG glycosylation. Supervised and unsupervised machine learning models identify cytokine-specific glycogene "signatures" as well as distinct immunoglobulin glycosylation profiles. We find that cytokines induce rapid transcriptional responses, with glycogene signatures outperforming single-gene changes in distinguishing stimulation conditions. We further demonstrate the ability to induce both pro- and anti-inflammatory IgG glycosylation profiles, particularly in terms of IgG galactosylation. This work demonstrates the utility of this system to parse the cytokine-driven regulation of B lymphocyte glycogenes, establishing a framework for dissecting how environmental cues shape antibody glycosylation, with relevance for autoimmune disease, infection, and vaccine responses.

medRxiv 2025-10-02 Preprint (No Snippets API) Toivonen J, Clancy J, FinnGen, Åberg F, Ritari J, Arvas M.
Show Full Abstract

Hereditary hemochromatosis is an autosomal recessive disorder characterized by excessive iron accumulation in the body. Early diagnosis of hemochromatosis allows starting treatment before severe organ damage has occurred. The C282Y variant in the HFE gene is the most common cause of hemochromatosis. However, its penetrance of only 20% limits its utility for population-wide screening. We aimed to identify and quantify the predictive value of novel genetic variants and non-genetic factors from electronic health care records that could modify the effect of the C282Y variant on hemochromatosis, thereby partly explaining its incomplete penetrance. We carried out a cohort study on data from 420,543 individuals in the FinnGen project, for whom genotype information and health care records were available. We performed a regular and an interaction GWAS of hemochromatosis and fitted statistical models of hemochromatosis with multiple genetic and non-genetic predictors. We validated our results using data from the UKBB. Our analyses identified one novel statistically significant variant (rs181949568) in CASC15 gene, within 4 Mb from the HFE gene, and we were able to quantify the strong protective role of blood donation. We found that donating at least twice a year is likely to be sufficient to drop the risk of C282Y homozygote to that of a C282Y-H63D compound heterozygote. To facilitate clinical application, we present the results as individual-level risk tables. Also, we found that in Finland hemochromatosis related diagnosis predicted later hemochromatosis diagnosis suggesting that in Finland hemochromatosis is not well recognized.

Preprints.org 2025-10-02 Preprint (No Snippets API) Orzołek A, Dziekońska A, Skorynko P, Ner-Kluza J.
Show Full Abstract

Candling is a standard method for assessing egg fertility and embryonic development in poultry. Fertilisation success can be influenced by several factors, including semen quality. Poor semen parameters may necessitate more frequent inseminations or the removal of males with consistently low fertility. This study evaluated turkey ejaculates (n=37) with good fertility (GF) and impaired fertility (IF). The analyses included sperm motility, plasma membrane integrity (PMI), mitochondrial membrane potential (MMP), and nitric oxide (NO) production, as well as enzymatic and biochemical assays of semen, such as superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) activities, glutathione (GSH) content, malondialdehyde (MDA) levels, and zinc (Zn²⁺) concentration. In parallel, the proteomes of seminal plasma and spermatozoa were separated using SDS- and Tricine-PAGE, and selected proteins were identified by nano LC-MS/MS. The findings suggest that IF ejaculates exhibit insufficient extracellular antioxidant capacity to neutralise reactive oxygen species (ROS). Elevated antioxidant enzyme activity, reduced GSH levels, and increased MDA concentrations indicate the presence of oxidative stress in spermatozoa. A proteomic analysis revealed differences in fertility-associated proteins: PRDX6 was detected exclusively in GF semen, whereas ENO1, FABP7, GOT1, and LDHB were unique to IF semen. Overall, the results demonstrate that both semen parameters and proteomic composition may contribute to fertilisation outcomes in turkeys.

MMS22L
Also flagged:primary ovarian insufficiencyEO-POIOvarian InsufficiencySTAG3MCM9
Journal Article 2025-10-01 ✓ 4 Snippets McGlacken-Byrne SM, Suntharalingham JP, Ishida M, Buonocore F, Del Valle I, Cameron-Pimblett A, Dattani MT, Achermann JC, Conway GS.
In-Text Gene Mentions

…, MEF2A ,MMS22L, RXFP3 ,…

…(in PCIF1 ,MMS22L, DND1 ,…

…was found inMMS22L, which together…

…, 51 );MMS22Lrepresents a plausible…

Show Full Abstract

<h4>Context</h4>Establishing the genetic basis of early-onset primary ovarian insufficiency (EO-POI, <25 years) is important, but defining variant pathogenicity is challenging.<h4>Objective</h4>We aimed to elucidate the genetic architecture of EO-POI in a unique, large cohort. Young women with EO-POI (n = 149; n = 31 familial, n = 118 sporadic) attending a specialist reproductive unit were included. Exome sequencing was performed. After filtering, variants were retained that were: (1) rare/novel (minor allele frequency <0.01%); (2) predicted pathogenic/likely pathogenic; and (3) enriched in the cohort. Each variant was assigned to a category: Category 1, variants in Genomics England Primary Ovarian Insufficiency PanelApp genes (n = 69); Category 2, variants in other POI-associated genes (n = 355) or Category 1 variants following unexpected inheritance patterns; and Category 3, homozygous variants in novel candidate POI genes.<h4>Results</h4>A total of 127 Category 1 or 2 variants were identified in 74 different genes (heterozygous 30.9%; homozygous 9.4%; polygenic 21.8%). In familial EO-POI, 64.7% (11/17 kindred) had a Category 1 or 2 variant identified (homozygous: STAG3, MCM9, PSMC3IP, YTHDC2, ZSWIM7; heterozygous: POLR2C, NLRP11, IGSF10, PRKD1, PLEC; polygenic: PDE3A, POLR2H, MSH6, CLPP). In sporadic EO-POI, 63.6% (n = 75/118) women had a variant identified: 21.2% (n = 25) Category 1; 42.4% (n = 50) Category 2. Novel POI candidate genes (Category 3) included PCIF1, DND1, MEF2A, MMS22L, RXFP3, C4orf33, and ARRB1.<h4>Conclusion</h4>The genetic basis of EO-POI is complex and affected genes span ovarian developmental processes from fetal life to adulthood. Establishing the pathogenicity of individual heterozygous variants can be challenging. However, some women have clear monogenic causes, particularly in familial POI with autosomal recessive inheritance. Others have potential polygenic causes. We describe novel candidate POI genes warranting further exploration.

TNFSF4
Also flagged:Tartrate-Resistant Acid Phosphatase 5Allergic asthmaeosinophiliaacid phosphatase 5ACP5metallophosphatase
Journal Article 2025-10-01 ✓ 1 Snippet Padra M, Bergwik J, Adler A, Marcoux G, Bhongir RKV, Papareddy P, Egesten A.
In-Text Gene Mentions

…member 4 (Tnfsf4), and T-box…

Show Full Abstract

Allergic asthma is characterized by Type 2 inflammation and eosinophilia. Tartrate-resistant acid phosphatase 5 (TRAP5; also referred to as acid phosphatase 5 [ACP5]) is a metallophosphatase expressed by alveolar macrophages that dephosphorylates osteopontin, a phosphoglycoprotein with increased expression in asthma. To investigate the role of TRAP5 during asthma, we used a murine model of ovalbumin (OVA)-induced allergic airway inflammation as well as IL-33-induced airway inflammation, including <i>Trap</i>5<sup>-/-</sup> and wild-type (WT) mice. Histological analyses of murine lung revealed that OVA-induced inflammation induced the formation of inflammatory lesions and increased mucus production in both WT and <i>Trap</i>5<sup>-/-</sup> mice. However, lower cytokine levels (including IL-5 and IL-13) were detected by multiplex immunoassay in <i>Trap</i>5<sup>-/-</sup> mice after OVA-induced inflammation. Furthermore, quantitative PCR analysis detected different gene expression profiles of <i>Trap</i>5<sup>-/-</sup>/OVA mice, including upregulation of <i>Il-17a</i> and downregulation of <i>Il-33</i>. Lower eosinophil numbers were measured in BAL fluid of <i>Trap</i>5<sup>-/-</sup>/OVA mice using flow cytometry analysis, whereas immunofluorescence staining revealed a high eosinophil number in lung tissue of both groups with OVA challenge. In the IL-33 model of Type 2 inflammation, both WT and <i>Trap</i>5<sup>-/-</sup> mice showed similar inflammatory responses with regard to cytokine levels and cell recruitment patterns. <i>In vitro</i>, eosinophil chemotaxis was facilitated by nonphosphorylated, but not phosphorylated, osteopontin, an effect inhibited by an α4β1 integrin inhibitor. The results suggest that TRAP5 is important in the recruitment of immune cells, including eosinophils, as well as in shaping the profile and amplification of the inflammatory response during allergic airway inflammation. Thus, TRAP5 may serve as a therapeutic target in allergic asthma.

HFE
Also flagged:vWFdegradationRBP
Journal Article 2025-10-01 ✓ 1 Snippet He X, Narayanaswamy K, Fischer MB, Schmitt L, Ruthmeier T, Messner B, Jakubek S, Zimpfer D, Granegger M.
In-Text Gene Mentions

…human blood fromhemochromatosispatients.…

Show Full Abstract

<h4>Objective</h4>Operating conditions significantly influence hemolysis generation in rotodynamic blood pumps (RBPs). Previous experiments conducted under constant operating conditions have demonstrated that lower flow rates are associated with a higher normalized index of hemolysis (NIH). However, in clinical scenarios, the pump flow rate fluctuates in response to the residual cardiac function. This study aims to investigate the effects of various pulsatile operating conditions on hemolysis generation and von Willebrand Factor (vWF) degradation of RBP.<h4>Methods</h4>To investigate these conditions, pulsatile flow experiments were conducted for 12 hours using HeartMate 3 (HM3, Abbott Inc, USA) in a hybrid mock circulatory loop with citrated human blood from hemochromatosis patients. Three operating conditions (high, low, and no residual cardiac function) were examined under two pump speed settings: normal (5400 rpm, 4.3 L/min) and low (4800 rpm, 2.5 L/min). Hemolysis was assessed by measuring delta free hemoglobin every 30 minutes (dfHb<sub>30 min</sub>) and calculating NIH. High molecular weight (HMW) vWF multimer degradation was assessed using immunoblotting.<h4>Results</h4>There was no significant difference in dfHb<sub>30 min</sub> (p>0.388), NIH (p > 0.382), and HMW vWF multimers degradation (p > 0.364) between the three operating conditions, but differences in these parameters were observed between the normal and low speed settings. Meanwhile, a consistent trend in the hemolysis outcomes was observed with slightly elevated hemolysis in no and high pulsatility conditions of both speed settings.<h4>Conclusion</h4>Hemocompatibility of the HM3 is not significantly affected by periodic high/low flow or backflows through the pump in in-vitro evaluation but rather by the pump operating condition: flow rate and pump speed.

POU3F2
Also flagged:BAP1meningiomaCNS tumorPolycomb repressive complexMeningiomasintracranial neoplasms
Journal Article 2025-10-01 ✓ 1 Snippet Sievers P, Arora S, Hielscher T, Savran D, Schrimpf D, Banan R, Vonhören D, Pusch S, Sill M, Appay R, Wirsching HG, Hortobagyi T, Dohmen H, Acker T, Kohlhof-Meinecke P, Schweizer L, Wefers AK, Harter PN, Hartmann C, Beschorner R, Schittenhelm J, Behling F, Tabatabai G, Mawrin C, Snuderl M, Maas SLN, Wesseling P, Brandner S, Korshunov A, Ratliff M, Krieg SM, Wick W, Jones DTW, Pfister SM, Holland EC, von Deimling A, Szulzewsky F, Sahm F.
In-Text Gene Mentions

POU3F2

Show Full Abstract

<h4>Background</h4>Meningiomas are the most common primary intracranial neoplasms, with highly variable patient outcomes. While most meningiomas are benign, a significant subset recurs postoperatively, presenting substantial treatment challenges. BAP1 gene inactivation has been suggested as a marker for aggressive meningiomas, although its precise molecular and clinical roles remain poorly understood.<h4>Methods</h4>To comprehensively investigate BAP1-altered meningiomas, we used six meningiomas with known BAP1 alterations as a discovery set. Genome-wide DNA methylation profiling of these samples, along 11 151 reference meningiomas, identified a distinct molecular cluster (n = 42) using unsupervised visualization approaches. These tumors were further characterized by DNA/RNA sequencing, histopathological examination, and a retrospective review of clinical data, compared to reference meningioma cohorts, providing a thorough characterization of this rare tumor subtype.<h4>Results</h4>Our integrative analysis revealed BAP1-altered meningiomas as a distinct CNS tumor subtype, characterized by recurrent loss of chromosome 3p21 and driven by various BAP1-inactivating alterations. Although rhabdoid morphology is present in some cases, it is not exclusive and should not be used as a grading criterion. Progression-free survival analysis showed a median of 21 months (95% CI: 12-NA), with a 2-year overall survival rate of 79% (95% CI: 60%-100%), highlighting the aggressive nature of these tumors. Gene expression profiling revealed upregulation of PRC target genes, dysregulated Polycomb signaling, and elevated expression in several cellular and growth factor pathways.<h4>Conclusions</h4>BAP1-altered meningiomas represent a distinct and aggressive CNS tumor subtype associated with PRC dysregulation and recurrent 3p chromosome loss. These findings support the designation "meningioma, BAP1-altered."

Also flagged:innate immunitycancersepsisimmune responsesgranulocyte colony-stimulating factorG-CSF
Journal Article 2025-10-01 No Snippets Lee J, Jin BR, Cho J.
Show Full Abstract

Neutrophils are the most abundant leukocytes in humans and are indispensable for innate immunity. They are short-lived, terminally differentiated cells. However, mounting evidence indicates that neutrophils are heterogeneous in health and disease: they are young or aged in a steady state, while their heterogeneity becomes more diverse in disease conditions, such as cancer, sepsis, and thromboinflammation. Although the presence of distinct neutrophil subsets is well recognized, it is not fully understood how neutrophils have functional and phenotypic heterogeneity and what mechanisms control it. This review will focus on our current understanding of the molecular basis for neutrophil heterogeneity in pathophysiological conditions. In addition, we will discuss the possibility of targeting a specific subset of neutrophils to attenuate inflammation and tissue damage without compromising innate immune responses.

HTT
Also flagged:ALSprion diseasesAutophagyautophagy receptorsmitophagyPD
Journal Article 2025-10-01 ✓ 3 Snippets Freisem D, Hoenigsperger H, Catanese A, Sparrer KMJ.
In-Text Gene Mentions

…Mutated Huntingtin (Htt) with a polymorphic…

…Polyglutamine (polyQ) expandedHttforms amyloid-like protein…

…hibitor Temsirolimus decreasedHttaggregates in mouse…

Show Full Abstract

Neurodegenerative disorders (NDDs), characterized by a progressive loss of neurons and cognitive function, are a severe burden to human health and mental fitness worldwide. A hallmark of NDDs such as Alzheimer's disease, Huntington's disease, Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS) and prion diseases is disturbed cellular proteostasis, resulting in pathogenic deposition of aggregated protein species. Autophagy is a major cellular process maintaining proteostasis and integral to innate immune defenses that mediates lysosomal protein turnover. Defects in autophagy are thus frequently associated with NDDs. In this review, we discuss the interplay between NDDs associated proteins and autophagy and provide an overview over recent discoveries in inborn errors in canonical autophagy proteins that are associated with NDDs. While mutations in autophagy receptors seems to be associated mainly with the development of ALS, errors in mitophagy are mainly found to promote PD. Finally, we argue whether autophagy may impact progress and onset of the disease, as well as the potential of targeting autophagy as a therapeutic approach. Concludingly, understanding disorders due to inborn errors in autophagy-"autophagopathies"-will help to unravel underlying NDD pathomechanisms and provide unique insights into the neuroprotective role of autophagy, thus potentially paving the way for novel therapeutic interventions.

Also flagged:SUMO-27,dimethylbenz(a) anthracenechromatinobesity7,12-dimethylbenz(a)anthracene
Journal Article 2025-10-01 No Snippets Rishi JK, Montes C, Walley JW, Keating AF.
Show Full Abstract

SUMOylation is a post-translational modification critical for oocyte development and chromatin-associated processes. Environmental exposures and obesity can cause follicle depletion and exposure to 7,12-dimethylbenz(a)anthracene (DMBA) altered ovarian small ubiquitin-like modifiers (SUMO) protein abundance in lean and obese mice. Thus, the hypothesis that exposure to DMBA may alter ovarian protein SUMOylation as a mode of ovotoxicity dampened by obesity was tested. Lean and obese mice (KK.Cg-a/a and KK.Cg-Ay/J) were exposed to either corn oil or DMBA (1 mg/kg) intraperitoneally for 7d (n = 4/treatment) and ovaries were flash-frozen on the second day of diestrus. Protein was isolated followed by immunoprecipitation using a SUMO-2/3 antibody and precipitated proteins were identified via liquid chromatography-tandem mass spectrometry. A total of 114 SUMO-2/3 ovarian protein targets were identified. Obesity basally altered (P ≤ 0.05) the abundance of 55 SUMOylated proteins with an additional 11 proteins tending (P ≤ 0.1) to be altered. In lean mice, DMBA altered (P < 0.05) the level of SUMOylation profile of 18 proteins with an additional three proteins tending (P ≤ 0.1) to be changed by DMBA exposure. In obese mice, DMBA exposure altered (P < 0.05) the abundance of 29 SUMOylated proteins and seven proteins had a tendency toward being different (P ≤ 0.1). DMBA exposure of lean compared to obese mice affected (P < 0.05) SUMOylation of 43 proteins, and four additional proteins tended (P ≤ 0.1) to differ. These findings suggest that protein SUMOylation is a mode of ovotoxicity which is influenced by physiological status.

ABT1
Also flagged:Clathrin light chain 2ubiquitin ligaseATL5E3 ligasetóxicos en levadura 5degradation
Journal Article 2025-10-01 ✓ 1 Snippet Lyu Y, He W, Zhou X, Gao X, Fan M, Chen D, Chen X.
In-Text Gene Mentions

…the degradation ofactivator of basal transcription 1of basal transcription…

Show Full Abstract

Seed longevity is crucial both ecologically and agronomically. Previously, we demonstrated that the E3 ligase Arabidopsis tóxicos en levadura 5 (ATL5) positively regulates seed longevity by mediating the degradation of activator of basal transcription 1 in Arabidopsis. In the present study, we demonstrated that clathrin light chain 2 (CLC2), another ubiquitinated substrate of ATL5, affects seed longevity in Arabidopsis. The interaction between CLC2 and ATL5 was first identified in yeast cells and then in planta. Seeds of clc2 mutants displayed slower accelerated aging, whereas CLC2-OE seeds showed faster accelerated aging than wild-type seeds. An in vitro assay showed that ATL5 promotes CLC2 degradation through the 26S proteasome pathway. Degradation of endogenous CLC2 was diminished in atl5 seeds, which could be induced by aging and occurred in a proteasome-dependent manner. Moreover, the role of CLC2 in seed longevity was independent of endocytosis; however, CLC2 exhibited transcriptional activation activity. Transcriptomic analysis revealed that the expression of numerous ribosomal protein genes was significantly up-regulated in clc2 seeds after aging. Collectively, our study demonstrated that CLC2 is another ubiquitinated substrate of ATL5 that negatively regulates seed longevity by influencing the expression of ribosomal protein genes in Arabidopsis.

CACNA1E
Also flagged:fibrotic interstitial lung diseasepathogenesismethylationcytosineguaninecartilage-associated protein
Journal Article 2025-10-01 ✓ 1 Snippet Goobie GC, Assadinia N, Yang CX, Chu F, Clifford RL, Cooper JD, Fabisiak JP, Gibson KF, Johannson KA, Kass DJ, Kim SE, Li X, Lindell KO, Marinescu DC, Vasilescu DM, Wang V, Carlsten C, Nouraie SM, Ryerson CJ, Hackett TL, Zhang Y.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<b>Rationale:</b> Particulate matter ⩽2.5 μm (PM<sub>2.5</sub>) adversely impacts patients with fibrotic interstitial lung disease (fILD). <b>Objectives:</b> We sought to determine whether PM<sub>2.5</sub>-associated epigenetic alterations contribute to the environmental pathogenesis of fILD. <b>Methods:</b> A retrospective two-cohort study applied satellite-derived PM<sub>2.5</sub> and constituent exposure matching to the residential location of patients with fILD. Robust linear regressions were used to evaluate cohort-specific, epigenome-wide differential blood DNA methylation with increasing pollutant exposures (Illumina MethylationEPIC BeadChip). Cox and linear regressions were used to evaluate associations of cytosine-phosphate-guanine (CpG) loci with transplant-free survival and lung function. A Wilcoxon test was used to evaluate cartilage-associated protein (CRTAP) levels in fILD and control lungs. <b>Measurements and Main Results:</b> The University of Pittsburgh cohort (<i>n</i> = 306) had 5-year median PM<sub>2.5</sub> exposures of 12.1 μg/m<sup>3</sup> compared with 5.1 μg/m<sup>3</sup> in the University of British Columbia cohort (<i>n</i> = 170). Higher pollutant exposures in the University of Pittsburgh cohort were associated with lower methylation at cg25354716, annotated to <i>CRTAP</i>, a critical extracellular matrix remodeling enzyme. Higher exposures in the University of British Columbia cohort were associated with higher methylation at cg01019301, annotated to <i>TLN2</i> (talin-2), a cytoskeletal protein involved in fibroblast migration. A 10% increase in cg25354716 methylation was associated with a hazard ratio of 0.81 for death or lung transplantation in the meta-analyzed cohorts (95% confidence interval = 0.69-0.96; <i>P</i> = 0.01), whereas the same change in cg01019301 was associated with a hazard ratio of 1.36 (95% confidence interval = 1.07-1.74; <i>P</i> = 0.01). CRTAP protein was more abundant in lungs from patients with fILD compared with those from donor controls (<i>P</i> < 0.001). <b>Conclusions:</b> PM<sub>2.5</sub> is associated with altered blood DNA methylation in fILD. This work identifies novel pollution-sensitive targets that hold potential for therapeutic modulation in fILD.

PRDX6
Also flagged:tumorscancerbreast cancercell proliferationmetabolismtumor
Journal Article 2025-10-01 ✓ 1 Snippet Venkat A, Youlten SE, San Juan BP, Purcell CA, Gupta S, Amodio M, Neumann DP, Lock JG, Westacott AE, McCool CS, Burkhardt DB, Benz A, Mollbrink A, Lundeberg J, van Dijk D, Holst J, Goldstein LD, Kummerfeld S, Krishnaswamy S, Chaffer CL.
In-Text Gene Mentions

…PRDX4 , andPRDX6), respectively (Supplementary…

Show Full Abstract

Identifying functionally important cell states and structure within heterogeneous tumors remains a significant biological and computational challenge. Current clustering- or trajectory-based models are ill-equipped to address the notion that cancer cells reside along a phenotypic continuum. We present Archetypal Analysis network (AAnet), a neural network that learns archetypal states within a phenotypic continuum in single-cell data. Unlike traditional archetypal analysis, AAnet learns archetypes (AT) in a simplex-shaped neural network latent space. Using preclinical and clinical models of breast cancer, AAnet resolves distinct cell states and processes, including cell proliferation, hypoxia, metabolism, and immune interactions. Primary tumor ATs are recapitulated in matched liver, lung, and lymph node metastases. Spatial transcriptomics reveals archetypal organization within the tumor and intra-archetypal mirroring between cancer and adjacent stromal cells. AAnet identifies GLUT3 within the hypoxic AT that proves critical for tumor growth and metastasis. AAnet is a powerful tool, capturing complex, functional cell states from multimodal data.<h4>Significance</h4>Defining critical cell states among cells that reside along a phenotypic continuum is a current biological and computational challenge. In this study, we present AAnet, a neural network that learns archetypal cell states of cancer cells. AAnet defines discrete spatially localized ATs that resolve intratumoral heterogeneity.

SERPINC1
Also flagged:Deep vein thrombosispulmonary embolismvenous thromboembolismfactor V LeidenTUBB1PROC
Journal Article 2025-10-01 ✓ 1 Snippet Wolford BN, Zhao QY, Wu KH, Yu X, Richter CE, Bhatta L, Brumpton BM, Desch KC, Thibord F, Klarin D, Johnson AD, Trégouët DA, Damrauer SM, Smith NL, Lo Faro V, Tsuo K, Daly MJ, Neale BM, Zhou W, Willer CJ, Shavit JA, Surakka I.
In-Text Gene Mentions

…the knockout ofSERPINC1, 34 PROS1…

Show Full Abstract

<h4>Abstract</h4>Venous thromboembolisms (VTEs) are a leading cause of morbidity and mortality. Although many genetic risk factors have been identified, a substantial portion of the heritability remains unexplained. In this study, we employed a genome-wide association study (GWAS) for VTE across 9 international cohorts of the Global Biobank Meta-Analysis Initiative to address this question, along with in vivo functional validation. In this multipopulation GWAS (VTE cases, 27 987; controls, 1 035 290), 38 genome-wide significant loci were identified, 4 of which were potentially novel. For each autosomal locus, we performed gene prioritization using 7 independent, yet converging, lines of evidence. Through prioritization, we identified genes associated with VTE through GWAS and/or functional studies (eg, F5, F11, VWF, STAB2, PLCG2, TC2N), functionally validated those that did not have evidence other than GWAS (TC2N, TSPAN15), and discovered 1 not previously associated with coagulation (RASIP1). We evaluated the function of 6 prioritized genes with strong genetic evidence, including F7 as a positive control, using laser-mediated endothelial injury to induce thrombosis in zebrafish after CRISPR/Cas9 knockdown. From this assay, we have supportive evidence for the role of RASIP1 and TC2N in the modification of human VTE and suggestive evidence for STAB2 and TSPAN15. This study expands on the currently identified genomic architecture of VTE through biobank-based, multipopulation GWASs, in silico candidate gene predictions, and in vivo functional follow-up of candidate genes.

DCC
Also flagged:methylationMEKhypomethylationimprintingchromosomeGSK3
Journal Article 2025-10-01 ✓ 1 Snippet Bi Y, Hu J, Wu T, Ouyang Z, Lin T, Sun J, Zhang X, Xu X, Wang H, Wei K, Gao S, Wang Y.
In-Text Gene Mentions

…These include Rebastinib (DCC-2036), an Abl1 inhibitor;…

Show Full Abstract

Human naïve pluripotent stem cells (PSCs) hold great promise for embryonic development studies. Existing induction and culture strategies for these cells, heavily dependent on MEK inhibitors, lead to widespread DNA hypomethylation, aberrant imprinting loss, and genomic instability during extended culture. Here, employing high-content analysis alongside a bifluorescence reporter system indicative of human naïve pluripotency, we screened over 1,600 chemicals and identified seven promising candidates. From these, we developed four optimized media-LAY, LADY, LUDY, and LKPY-that effectively induce and sustain PSCs in the naïve state. Notably, cells reset or cultured in these media, especially in the LAY system, demonstrate improved genome-wide DNA methylation status closely resembling that of pre-implantation counterparts, with partially restored imprinting and significantly enhanced genomic stability. Overall, our study contributes advancements to naïve pluripotency induction and long-term maintenance, providing insights for further applications of naïve PSCs.

Also flagged:serotonindepressionsynaptic cleftserotonin transporterSERTSLC6A4
Journal Article 2025-10-01 No Snippets Ellenberger DT, Herrington RTB, Seda SE, Lambert AN, Rosenfeld CS.
Show Full Abstract

The rate of depression in pregnant mothers has dramatically risen in the past few decades. One of the well-studied causes of depression is a deficiency of serotonin (5-HT) in the synaptic cleft of neurons in the central nervous system, called the serotonergic theory of depression. The serotonin transporter (SERT/SLC6A4) binds 5-HT such that it can no longer bind and activate its cognate receptors on the post-synaptic neurons. Greater number of pregnant women are prescribed a selective serotonin reuptake inhibitor (SSRI) drug to combat depression. These compounds act to bind to SERT, and thereby prolonging the duration 5-HT remains active within the synaptic cleft. While such treatments might be beneficial for the mother, the placenta and fetal brain can be inadvertently affected. SERT has been proposed to be the primary means by which the placenta internalizes maternal 5-HT and then transfers this neurotransmitter to the emerging brain, where it guides initial brain development. We consider evidence that SSRIs might influence the placenta-brain axis and contribute to gestational disorders, such as preeclampsia, fetal growth restriction, and gestational diabetes. Current data with rodent models, in vitro cell approaches with human trophoblast cell lines, and human epidemiological studies are reviewed. Gaps in our current understanding and future directions are discussed. A better understanding of how SSRIs might affect the placenta is crucial as by obstructing acquisition of maternal 5-HT by the placenta and downstream alterations on fetal brain development, these treatments might impact the lifelong health of sons and daughters.

BTN3A3
Also flagged:breast cancercancerLEG1adenosine diphosphateglucokinasedeath
Journal Article 2025-10-01 ✓ 1 Snippet Syleouni ME, Joshu CE, Coresh J, Gunter MJ, Butler KR, Couper DJ, Guevara M, Lu J, Prizment A, Prizment A, Riboli E, Ru M, Mahamat Saleh Y, Smith-Byrne K, Soori M, Visvanathan K, Burk VA, Wang Z, Chatterjee N, Rohrmann S, Platz EA.
In-Text Gene Mentions

butyrophilin subfamily 3 member A3

Show Full Abstract

<h4>Background</h4>Plasma proteomic data can be used to discover breast cancer risk biomarkers beyond established risk factors. Discovery using a large-scale platform in a diverse population is needed.<h4>Methods</h4>We investigated 4712 plasma proteins and breast cancer risk among postmenopausal women in a prospective cohort analysis in the Atherosclerosis Risk in Communities study. Proteins were measured by SomaScan 5K Assay. Incident cases were ascertained primarily from state cancer registries. We estimated hazard ratios (HRs) and 95% confidence intervals (CIs) using Cox regression adjusting for risk factors and applied the Benjamini-Hochberg method to control false discovery. We determined whether the statistically significant proteins were confirmed in a case-cohort study within the European Prospective Investigation into Cancer and Nutrition.<h4>Results</h4>After median follow-up of 23.3 years, 340 of 4403 women had an incident breast cancer. Two proteins were statistically significantly associated after P value adjustment: per doubling, the hazard ratio of breast cancer was 1.45 (95% CI = 1.23 to 1.70; P = 7.47*10-6, Padjusted = .0370) for protein LEG1 homolog and 2.52 (95% CI = 1.66 to 3.83; P = 1.50*10-5, Padjusted = 0.0371) for adenosine diphosphate (ADP)-dependent glucokinase. Results were consistent in a lagged analysis and among Black (28.1%) and White women. In the European Prospective Investigation into Cancer and Nutrition, both associations were confirmed (protein LEG1 homolog: HR = 1.24, 95% CI = 1.14 to 1.35; P = 9.79*10-7; ADP-dependent glucokinase: HR = 1.13, 95% CI = 1.03 to 1.23; P = .01).<h4>Conclusion</h4>We identified 2 plasma proteins associated with increased breast cancer risk over the longer term in postmenopausal women; both were confirmed in an independent cohort. If further validated, these plasma protein biomarkers could be considered for utility in current risk stratification tools.

H4C8
Also flagged:Lsm11SMNhistonesnRNPSUMO2antibodies
Journal Article 2025-10-01 ✓ 1 Snippet He S, Lyu P, Skinner MW, Desotell A, Foley B, McCaig CM, Wang W, Qian J, Tong L, Marzluff WF, Matunis MJ.
In-Text Gene Mentions

…H2BC21 , andH4C8as shown previously…

Show Full Abstract

Histone mRNAs are the only nonpolyadenylated mRNAs in eukaryotic cells and require specialized processing in the histone locus body (HLB), a nuclear body where essential processing factors, including the U7 snRNP, are concentrated. Recent studies have revealed that misregulation of histone pre-mRNA processing can lead to polyadenylation of histone mRNAs and disruption of histone protein homeostasis. Despite links to human disease, the factors contributing to polyadenylation of histone mRNAs and the mechanisms underlying HLB assembly and U7 snRNP biogenesis remain unclear. Here, we report novel functions of the small ubiquitin-related modifier 2 (SUMO2) in promoting histone pre-mRNA processing. Using a SUMO2 knockout osteosarcoma cell line, we identified a defect in 3' end cleavage and a global increase in histone mRNA polyadenylation. Subsequent analysis of HLBs revealed increased dynamics and reduced levels of the U7 snRNP complex. By overexpressing the U7 snRNP-specific components Lsm11 and U7 snRNA, we rescued U7 snRNP levels and processing defects in SUMO2 knockout cells. Through analysis of Lsm11, we identified a SUMO-interacting motif in its N terminus required for efficient formation of U7 snRNP. Collectively, we demonstrated that SUMO2 promotes histone pre-mRNA 3' end processing by stabilizing HLB interactions and facilitating U7 snRNP assembly.

POU3F2
Also flagged:transcription factorstrokeneurogenin 2NGN2Cortical ischemic strokeaxonal myelination
Journal Article 2025-10-01 ✓ 1 Snippet Martinez-Curiel R, Hajy M, Tsupykov O, Jansson L, Avaliani N, Tampé J, Monni E, Skibo G, Lindvall O, Palma-Tortosa S, Kokaia Z.
In-Text Gene Mentions

…markers such asPOU3F2(BRN2; a marker…

Show Full Abstract

Stem cell sources capable of producing appropriate cells for replacement will be necessary for functional repair of the injured brain. Here, we have determined whether transcription factor programming of human embryonic stem (hES) cells can be used to generate layer-specific cortical neurons capable of integrating into the stroke-injured rat cortex. Human embryonic stem cells were programmed via overexpression of neurogenin 2 (NGN2). After 7 days, hES-induced neurons (hES-iNs) were characterized in vitro using immunocytochemistry, RT-qPCR, and whole-cell patch-clamp. Cortical ischemic stroke was induced in rats via distal middle cerebral artery occlusion. Forty-eight hours later, hES-iNs were transplanted into the somatosensory cortex adjacent to the ischemic lesion. Three months thereafter, brains were analyzed for expression of neuronal markers, axonal myelination, and synapse formation using immunohistochemistry and immunoelectron microscopy (iEM). Overexpression of NGN2 in hES cells for 7 days generated excitatory neurons, expressing cortical markers at different stages of maturation. After transplantation, the hES-iNs expressed markers of both immature and mature neurons and of upper and deep cortical layers. The hES-iNs sent widespread projections to both hemispheres, and iEM revealed that they were myelinated by host oligodendrocytes and had formed efferent synaptic connections with host cortical neurons. The hES cells programmed via NGN2 overexpression gave rise to subtypes of cortical neurons, capable of integrating structurally into the injured brain, more rapidly than neurons produced by previous protocols. Functional characterization of the grafted hES-iNs and their impact on the balance between brain excitation and inhibition are now highly warranted. This new stem cell source should be considered when, in the future, the most suitable candidate will be selected for clinical translation.

GPR52
Also flagged:tetracyclinesmatinggene expressiondoxycyclineanhydrotetracyclinebehavioral
Journal Article 2025-10-01 ✓ 1 Snippet Kriete AL, Scott MJ.
In-Text Gene Mentions

…These includedG-protein coupled receptor 52coupled receptor 52…

Show Full Abstract

Tetracyclines are broad-spectrum antibiotics widely used in agriculture, medicine, and research. However, they are associated with harmful side effects. In arthropods, parental exposure to tetracyclines has been linked to reduced health and fitness in untreated offspring. These transgenerational effects of tetracyclines could jeopardize the success of pest control programs that use tetracyclines to control gene expression. In this study, we investigated the transgenerational effects of 2 tetracyclines, doxycycline (DOX) and anhydrotetracycline (ATC), in the blowfly Lucilia cuprina, a significant pest of sheep. To simulate the rearing conditions of a transgenic male-only release program, blowflies were reared on standard diet alone, or standard diet plus DOX or ATC, for 3 generations, and then reared for an additional fourth generation on standard diet alone. We used behavioral assays, 16S amplicon sequencing, and mRNA sequencing to determine how DOX and ATC influenced male sexual competitiveness, microbiome composition, and gene expression in the third and fourth generations. We found that 3 generations of DOX treatment led to lower sexual competitiveness in both third- and fourth-generation males. In addition, DOX and ATC shifted the composition of the blowfly microbiome and altered the expression of numerous mitochondria- and immunity-related genes in both generations. Our study supports an emerging body of evidence that tetracyclines exert not only direct but also transgenerational effects, and sheds light on the transcriptional and microbial responses to antibiotic exposure and removal. Our findings emphasize the need for pest control programs that use tetracyclines to evaluate the long-term effects of these antibiotics.

PTGIS
Also flagged:cell proliferation-cell signalingextracellular matrixorganizationgene expressionRIF
Journal Article 2025-10-01 ✓ 1 Snippet Nguyen TTN, Kwok YSS, Zhang C, Russell SJ, Librach CL.
In-Text Gene Mentions

…genes, such asPTGIS, PTGDS, and PTGES,…

Show Full Abstract

<h4>Study question</h4>Which biological pathways are modulated by primary human endometrial cells in response to in vitro treatment with non-autologous human platelet lysate (HPL)?<h4>Summary answer</h4>HPL treatment stimulates endometrial growth and trophoblast attachment by activating cell proliferation, and modulating cell-cell signaling and extracellular matrix organization.<h4>What is known already</h4>There is currently no standard therapy for recurrent implantation failure (RIF), and existing treatments have variable effectiveness and do not consistently improve clinical pregnancy rates. Intrauterine infusion of autologous platelet-rich plasma (aPRP), before embryo transfer, promotes endometrial growth and may be the most effective immunomodulatory intervention to significantly improving pregnancy outcomes in RIF patients. HPL is a commercially available, pooled, and cell debris-cleared derivative of PRP suitable for cell culture.<h4>Study design, size, duration</h4>Cross-sectional (control versus treatment) study including five non-RIF (control) patients and 18 RIF patients. The 18 RIF patients were categorized into two sub-groups: RIF and RIF including thin endometrium (TE).<h4>Participants/materials, setting, methods</h4>Endometrial tissue was collected from pre-menopausal women (32-47 years of age) during routine biopsy procedures at the CReATe Fertility Centre, Toronto. Primary endometrial epithelial (EECs) and stromal cells (ESCs) were enzymatically isolated, cultured separately, and treated for 48 h with either serum-free media (SFM) as the untreated control, or SFM supplemented with 1% HPL (EECs), or 10% HPL (ESCs). Cell proliferation was assessed by metabolic assay and immunocytochemistry for Ki-67 expression. Following 48-h treatment, total RNA was isolated from untreated and treated cells to prepare pooled RNA libraries, which were then subjected to RNA sequencing (150 cycles paired-end). Differential gene expression was performed using the DESeq2 package and RStudio/R. Significant differentially expressed genes were determined with the following cut-off values: log2FoldChange >|2| and Padj <0.05. Pathway enrichment analysis was then performed with Enrichr (Reactome 2022 database) to identify enriched pathways. After 48-h treatment with SFM or HPL, a trophoblast attachment assay was also performed with fluorescently labeled HTR-8/SVneo trophoblast spheroids, where spheroids were seeded on top of pre-treated EEC monolayers for a 1-h incubation to allow for attachment. Fluorescent microscopy and ImageJ software were used to image and quantify the total number of seeded and attached spheroids.<h4>Main results and the role of chance</h4>Treatment with non-autologous HPL for 48 h significantly increased EEC proliferation by 1.24- to 1.49-fold (P < 0.05) in all groups. ESCs showed a significant proliferation increase of 1.29-fold in the proliferative phase RIF group and 1.92-fold in the secretory phase RIF+TE group (P < 0.05). HPL treatment upregulated 45 genes in EECs, including MMP1, MMP9, and ADAMTS18, while 378 genes were upregulated in ESCs, such as BUB1, CDK1, MKI67, and PLK1. Twenty-two common genes were significantly upregulated in both cell types. EECs had 30 downregulated genes, including KL and ADRA2A, while ESCs had 429 downregulated genes, such as PTGIS, PTGDS, and PTGES, with seven common genes downregulated in both cell types. Pathway enrichment analysis revealed that upregulated pathways in EECs included extracellular matrix organization and degradation, while ESCs showed enrichment in cell cycle (mitotic), cell cycle checkpoints, and extracellular matrix degradation. Downregulated pathways included receptor signaling of the fibroblast growth factor receptor 1 in EECs, prostaglandin synthesis in ESCs, and G-protein coupled receptor signaling in both cell types. HPL treatment also increased primary EEC attachment to trophoblast spheroids compared to the untreated control. This increased attachment was consistent in EECs from RIF patients, regardless of endometrial thickness, with a 26% increase (from 42.58% to 68.90%, P < 0.01) in RIF cultures and a significant 29% increase (from 57.52% to 86.5%, P < 0.01) in RIF+TE cultures.<h4>Large scale data</h4>Raw sequencing and count data have been deposited under GEO accession number GSE279514.<h4>Limitations, reasons for caution</h4>One limitation is the small sample size of primary human endometrial samples (N = 23), divided into four patient groups (N = 5-6 per group). Additionally, all participants were pre-menopausal women aged 32-47 years, most of whom fall into the advanced reproductive age category (>35 years), a group often recommended for infertility assessment after 6 months of unsuccessful conception attempts. Although our study utilized primary endometrial cells and indicates that HPL may be an effective treatment for RIF and TE, these in vitro findings need to be validated in vivo. While research from our group and others suggests that PRP and HPL contain a similar growth factor milieu, randomized controlled trials are necessary to evaluate and compare the efficacy of commercial HPL as a treatment alternative to aPRP.<h4>Wider implications of the findings</h4>Our data provide the first detailed map of the signaling and extracellular-matrix programs that platelet derivatives activate in primary endometrial cells, offering a mechanistic bridge between the growing clinical use of platelet-rich plasma and its observed improvements in implantation. By clarifying which pathways (chiefly cell-cycle drivers, matrix remodeling enzymes, and intercellular signaling factors) are engaged, the study equips clinicians to refine treatment variables such as dose and timing, and highlights actionable biomarkers that could be monitored to verify a receptive endometrial response. At the scientific level, these insights shift the focus from empirical application to rational modulation of endometrial paracrine signaling, guiding the design of next-generation platelet formulations or synthetic analogs that replicate the same molecular signature with greater consistency and safety.<h4>Study funding/competing interest(s)</h4>This study was funded by the CReATe Fertility Centre.

OLFM4
Also flagged:acute myeloid leukemiaAMLhematopoiesisgranulopoiesisneutropeniainfections
Journal Article 2025-10-01 ✓ 1 Snippet Goel P, Aryal S, Franceski AM, Kuznetsova V, Costa A, Luca F, Connelly AN, Phillips DW, Ennis CC, Curtiss BM, Karfa S, Crown BL, Larson CR, Carminita E, Camacho V, Welsch D, Cheng C, Yokota A, Cobo I, Hirai H, Lu R, Bhatia R, Datta PK, Ferrell PB, Welner RS.
In-Text Gene Mentions

…Wfdc17 , andOlfm4and decreased interferon…

Show Full Abstract

<h4>Abstract</h4>Acute myeloid leukemia (AML), an aggressive hematological malignancy, is driven by oncogenic mutations in stem and progenitor cells that give rise to AML blasts. Although these mutations are well characterized, their impact on healthy hematopoiesis, those blood cells exposed to AML but not mutated, has not been well characterized. Because the marrow is the major site for granulopoiesis, neutrophils are heavily influenced by AML pathobiology. Indeed, most patients with AML report neutropenia, rendering them susceptible to infections. However, because AML studies use peripheral blood mononuclear cells devoid of neutrophils, the characterization of neutrophil dysfunction remains poorly understood. To investigate AML-exposed neutrophils, a preclinical AML mouse model in which primary leukemic cells were transplanted into nonirradiated neutrophil reporter (Ly6G-tdTomato; Catchup) hosts was used. Neutrophils could not completely mature, suggesting impaired granulopoiesis. Single-cell transcriptomics of AML-exposed neutrophils revealed higher inflammation signatures and expression of CD14, an inflammatory marker. To address the factors contributing to this biology, an ex vivo cytokine screen was performed on marrow neutrophils, and it identified that nuclear factor κB signaling drove CD14 expression. AML-exposed neutrophils displayed widespread chromatin remodeling, and de novo motif discovery predicted increased binding sites for CCAAT enhancer-binding proteins and interferon regulatory factors. Moreover, AML-exposed neutrophils inhibited T-cell proliferation, highlighting their immune-suppressive capability. Finally, a similar biology of immature, inflammatory neutrophils was found in patients with AML, again indicating dysregulated granulopoiesis. Collectively, these data show that AML-associated inflammation alters neutrophil granulopoiesis, impairs neutrophil function, and drives immunosuppression, thereby contributing to patient susceptibility to infection.

Also flagged:mitochondriamitochondrialneurological diseasesdendritesaxonscognition
Journal Article 2025-10-01 No Snippets Lickfett S, Menacho C, Cambridge S, Prigione A.
Show Full Abstract

Neuronal branching, the extension and arborization of neurites, is critical for establishing and maintaining functional neural circuits. Emerging evidence suggests that mitochondria play an important role in regulating this process. In this review, we explore how the use of human induced pluripotent stem cell (iPSC)-derived neuronal models in two dimensions (2D) and three dimensions (3D) could help uncover possible mechanisms linking mitochondrial function and dysfunction to neuronal branching capacity. We highlight examples of iPSC-based models of mitochondrial and neurological diseases where aberrant neurite growth has been observed and discuss the potential therapeutic implications. Additionally, we review current methodologies for assessing neurite outgrowth in 2D and 3D neuronal models, addressing their strengths and limitations. Insights gained from these models emphasize the significance of mitochondrial health in neuronal branching and demonstrate the potential of iPSC-derived neurons and brain organoids for studying disrupted neuronal morphology. Harnessing these human stem cell models to devise phenotypic drug discovery platforms can eventually pave the way for innovative therapeutic interventions, particularly in the context of disorders with poorly understood genetic mechanisms and limited therapeutic options.

ECI2
Also flagged:FoxO1PPARαGene Expressiontranscription factorsFoxO3CREB
Journal Article 2025-10-01 ✓ 1 Snippet Kitamoto T, Watanabe H, Miyachi Y, Miyabayashi M, Qiang L, Ajiro M, Yoshimi A, Maezawa Y, Yokote K, Accili D.
In-Text Gene Mentions

Eci2

Show Full Abstract

Several transcription factors regulate the fasting response in liver. They include FoxO1 and FoxO3, CREB, C/EBP α/β, glucocorticoid receptor (GR), peroxisome proliferator-activated receptor-α (PPARα), FoxA2, hepatocyte nuclear factor-α (HNF4α), and others. Genome-wide chromatin occupancy studies revealed an unexpected overlap of FoxO1 and PPARα DNA binding sites at active intergenic and intron enhancers, yet their functional significance remains unknown. To address this gap in knowledge, we conducted molecular interaction analyses of these transcription factors and generated combined hepatocyte-specific ablation of the respective genes. Integrated analysis of hepatic RNA sequencing from these mice by FoxO1 and PPARα chromatin immunoprecipitation sequencing revealed a concerted regulation of glucose metabolism, with additive effects on in vivo glucose tolerance. Synergistic effects on glycogenesis were observed when PPARα was ablated in the absence of FoxO1, particularly following a high-fat diet. Free fatty acids increased following FoxO1 and were normalized by PPARα ablation, while liver triglyceride content increased in PPARα knockouts and was normalized by FoxO1 ablation. The findings highlight a functional relay between FoxO1 and PPRAα, linking insulin signaling with hepatic lipid metabolism, and offer insight into potential therapeutic strategies for metabolic diseases.<h4>Article highlights</h4>FoxO1 and PPARα share significant DNA binding sites, regulating a coordinated transcriptional network in hepatic metabolism. FoxO1 and PPARα orchestrate distinct yet overlapping roles in gluconeogenesis and fatty acid/lipid metabolism. High-fat diet amplifies the metabolic interplay between FoxO1 and PPARα, with implications for insulin resistance management. Targeting the FoxO1-PPARα interplay offers novel strategies for treating selective insulin resistance and metabolic disorders.

OLFM4
Also flagged:colorectal cancerCancersplicingoncogenestumorPPIG
Journal Article 2025-10-01 ✓ 1 Snippet Lu P, Zhang Y, Cui Y, Liao Y, Liu Z, Cao ZJ, Liu JE, Wen L, Zhou X, Fu W, Tang F.
In-Text Gene Mentions

…( LEFTY1 ,OLFM4, LCN2 ,…

Show Full Abstract

Dysregulated RNA splicing is a well-recognized characteristic of colorectal cancer (CRC); however, its intricacies remain obscure, partly due to challenges in profiling full-length transcript variants at the single-cell level. Here, we employ high-depth long-read scRNA-seq to define the full-length transcriptome of colorectal epithelial cells in 12 CRC patients, revealing extensive isoform diversities and splicing alterations. Cancer cells exhibited increased transcript complexity, with widespread 3'-UTR shortening and reduced intron retention. Distinct splicing regulation patterns were observed between intrinsic-consensus molecular subtypes (iCMS), with iCMS3 displaying even higher splicing factor activities and more pronounced 3'-UTR shortening. Furthermore, we revealed substantial shifts in isoform usage that result in alterations of protein sequences from the same gene with distinct carcinogenic effects during tumorigenesis of CRC. Allele-specific expression analysis revealed dominant mutant allele expression in key oncogenes and tumor suppressors. Moreover, mutated PPIG was linked to widespread splicing dysregulation, and functional validation experiments confirmed its critical role in modulating RNA splicing and tumor-associated processes. Our findings highlight the transcriptomic plasticity in CRC and suggest novel candidate targets for splicing-based therapeutic strategies.

Also flagged:Oxygencarbonatecarbonacidsbioapatiteacetic acid
Journal Article 2025-10-01 No Snippets Varkulevičiūtė K, Winter-Schuh C, Makarewicz CA.
Show Full Abstract

<h4>Rationale</h4>Chemical pre-treatment is a common methodological step aimed to remove exogenous materials introduced to archaeological tooth enamel in the burial environment through diagenetic processes. However, some of these methods, involving the use of oxidising reagents such as NaClO, H<sub>2</sub>O<sub>2</sub>, as well as weak acids like CH<sub>3</sub>COOH, have been shown to alter the chemical composition and stable isotope values of enamel. Here, we aim to re-examine the effects of commonly used pre-treatment protocols on bioapatite δ<sup>13</sup>C and δ<sup>18</sup>O values, and investigate the relationship between diagenetic alteration and measured isotope values, as indicated by pre-screening using attenuated total reflectance-Fourier transform infrared (ATR-FTIR) spectroscopy.<h4>Methods</h4>Modern and archaeological samples were subjected to 10 commonly used pre-treatment protocols that apply NaClO, H<sub>2</sub>O<sub>2</sub> and/or CH<sub>3</sub>COOH to tooth enamel powders at treatment lengths. Preservation status and diagenetic alteration prior to and after treatment were investigated using ATR-FTIR. δ<sup>13</sup>C and δ<sup>18</sup>O values were measured before and after treatment to determine if different wet chemistry protocols induced isotopic shifts.<h4>Results</h4>The results show that all pre-treatment protocols imparted shifts in δ<sup>13</sup>C and δ<sup>18</sup>O values of up to ± 1.5‰ in both archaeological and modern samples. Most treated samples display increased crystallinity, likely indicating sample recrystallisation. We suggest that these changes indicate the removal of contamination and diagenetic alteration, and also the dissolution and restructuring of enamel carbonate leading to changes in the in vivo isotope signal.<h4>Conclusions</h4>We discourage the use of H<sub>2</sub>O<sub>2</sub> and NaClO to remove organic matter from samples as it incurs unwanted changes to the enamel structure and carbon and oxygen isotope ratios. We also recommend the use of only short-duration acetic acid treatment protocols to avoid recrystallisation caused by prolonged acid exposure and concomitant unwanted change to in vivo isotope values.

Also flagged:autismbehavioralANK2set-4KMT5Bdaf-18
Journal Article 2025-10-01 No Snippets Zoga K, Villiere S, Tikiyani V, Edwards-Cintron AF, Thokachichu P, Nicodemus P, Camara PG, Hart MP.
Show Full Abstract

Variation in over 100 genes is now associated with increased risk for autism and related neurodevelopmental conditions, but how this variation results in distinct and overlapping behavioral changes is still not well understood. Recent efforts have focused on screening many autism genes at once for functional and phenotypic convergence, and identified subsets that are crucial for many early steps of neurodevelopment. Few studies have screened later steps of neurodevelopment, circuit function, circuit plasticity, or behaviors. We screened 20 conserved autism-associated genes for impact on experience-dependent neuron remodeling in Caenorhabditis elegans. Loss of unc-44/ANK2, set-4/KMT5B, daf-18/PTEN, gap-2/SYNGAP1, and chd-1/CHD2/8 increased, while unc-36/CACNA2D3 decreased, neurite outgrowth of the GABAergic DVB neuron in adults. Although daf-18/PTEN, set-4/KMT5B, and unc-44/ANK2 had convergent phenotypes, they arise from distinct temporal trajectories with differential impact on DVB presynaptic morphology. Screening for the DVB regulated spicule protraction behavior identified multiple autism genes involved, but only unc-44/ANK2 and unc-36/CACNA2D3 were shared between screens. Application of a metric geometry computational framework (CAJAL) to the DVB morphology dataset identified 5 additional genes that impact DVB morphology, including unc-2/CACNA1A and unc-10/RIMS1, which also significantly impacted behavior. This work defines new regulators and molecular mechanisms of experience-dependent neuron remodeling and circuit plasticity, and further links these processes with conserved autism genes. It also demonstrates the utility of using intact, behavior generating circuits in C. elegans, to screen for novel roles for conserved autism genes.

DCC
Also flagged:reproductiongalactoseα-1,3-galactosyltransferasecoagulationgene modificationsCas9
Journal Article 2025-10-01 ✓ 2 Snippets Huo 霍学云 X, Sun 孙先辉 X, Xing 邢向阳 X, Lu 路静 J, Zhang 张晶晶 J, Jiang 蒋艳艳 Y, Zhu 朱筱 X, Li 李长龙 C, Lv 吕建祎 J, Guo 郭萌 M, Cao 曹立雪 L, Liu 刘欣 X, Chen 陈振文 Z, Pan 潘登科 D, He 何顺民 S, Zhang 张晨 C, Du 杜小燕 X.
In-Text Gene Mentions

…Four genes (DCC, EGFR ,…

…For example,DCCis a well-characterized…

Show Full Abstract

Although xenotransplantation has been revolutionized by the development of genome-edited pigs, it is still unknown whether these pigs and their offspring remain genomically stable. Here, we showed that GGTA1-knockout (GTKO) pigs accumulated an average of 1205 genome-wide genetic mutations, and their filial 1 (F1) offspring contained an average of 18 de novo mutations compared with wild-type controls and their parents. The majority of mutations were in regions annotated as intergenic without altering protein functions, and none were located at predicted off-target sites. RNA sequencing analysis and phenotypic observations indicated that the accumulated mutations may have only a limited influence on GTKO pigs, and most of the mutations in the GTKO pigs could be attributed to the electrotransfection of plasmids into cells. This is the first report demonstrating that genetic mutations in genome-edited pigs are inherited stably by the next generation, providing a reference for the safe application and a standard approach to breed genome-edited pigs for xenotransplantation.

POU3F2
Also flagged:prostate canceradenocarcinomaneuroendocrine prostate cancerPROX1tumorprostate adenocarcinoma
Journal Article 2025-10-01 ✓ 1 Snippet Venkadakrishnan VB, Presser A, Voss NCE, Neiswender J, Brenan L, Sosa KP, Weng K, Acosta AM, Vazquez F, Beltran H.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Histologic transformation of prostate cancer from adenocarcinoma to neuroendocrine prostate cancer (NEPC) is associated with aggressive disease and poor prognosis. This lineage transition is accompanied by polycomb complex 2-mediated epigenetic derepression of cell fate-determining transcription factors, including prospero homeobox 1 (PROX1). In this study, we sought to functionally characterize the role of PROX1 in NEPC. An unbiased CRISPR screen in two NEPC patient-derived organoid models demonstrated high cellular dependency for PROX1. Knockout of PROX1 impeded tumor growth in NEPC models, and overexpression of PROX1 promoted tumor growth and spontaneous metastasis in prostate adenocarcinoma. Transcriptomic and cistromic analyses across castration-resistant adenocarcinoma and neuroendocrine models pointed to PROX1-mediated regulation of neuroendocrine-lineage transcriptional programs. Immunoprecipitation followed by mass spectrometry identified three phosphorylated sites in the DNA-binding domain of PROX1 that are critical for its stability and function. CHEK1 and CDK2 were predicted to be upstream kinases that phosphorylate PROX1, and treatment with a CHEK1 or CDK2 inhibitor reduced NEPC viability. Together, these results substantiate the role of PROX1 in NEPC and identify PROX1 phosphorylation in the DNA-binding domain, which might represent a therapeutic target in NEPC.<h4>Significance</h4>PROX1 mediates lineage reprogramming, tumor growth, and metastasis in neuroendocrine prostate cancer and represents a cellular dependency that can be exploited for targeted treatment strategies.

HFE
Also flagged:CarboxymaltoseIron Deficiency AnemiaIDAironcytochromereductase
Journal Article 2025-10-01 ✓ 1 Snippet Gong F, Hu S, Yuan J, Song J.
In-Text Gene Mentions

…diseases, such ashemochromatosisor conditions affecting…

Show Full Abstract

The objectives of this study were to compare the pharmacokinetics and safety profiles of the test (T) preparation (Ferric carboxymaltose injection, BrightGene Bio-Medical Technology Co. Ltd.) and reference (R) preparation (Ferinject, Vifor France) after intravenous injection in Chinese adult subjects with iron deficiency anemia (IDA) under fasting conditions. Conducted as a single-center, randomized, open-label, parallel-group trial, the study enrolled 96 IDA patients who were randomly allocated (1:1) to receive a 500 mg intravenous dose of either the T or R preparation. Post-dose blood samples for pharmacokinetic analysis were collected at multiple time points, while any adverse events were documented. The pharmacokinetic results showed comparable serum concentration-time curves between the two groups. The 90% confidence intervals for the geometric mean ratios of C<sub>max</sub>, AUC<sub>0-t</sub>, and AUC<sub>0-∞</sub> of total serum iron and C<sub>max</sub>, AUC<sub>0-t</sub> of serum transferrin-bound iron were within the predefined bioequivalence criterion of 80%-125%, indicating bioequivalence between the T and R preparations under fasting conditions. There were no significant differences in the safety profile between the two groups. This study confirmed the bioequivalence of the T and R preparations under fasting conditions, along with good safety.

DCC
Also flagged:steatotic liver diseaseliver diseasecirrhosisCCdecompensated cirrhosisdiabetes
Journal Article 2025-10-01 ✓ 1 Snippet Younossi ZM, Paik JM, Yilmaz Y, Kanat M, El-Kassas M, Al-Busafi SA, Al-Naamani KM, Elzouki AN, Alswat K, Cordie A, Osman AOA, Debzi N, Khamis J, Hassanein M, Abu-Farha M, Al-Mulla F, Aba-Alkhail F, Henry L, Zelber-Sagi S, Alaklabi A, AlQahtani S.
In-Text Gene Mentions

…= 2.24%) andDCC(0.020%-0.025%; APC =…

Show Full Abstract

<h4>Background</h4>The Middle East and North Africa (MENA) region is undergoing demographic shifts potentially increasing metabolic dysfunction-associated steatotic liver disease (MASLD) and its complications. We assessed MASLD prevalence and liver disease burden from 2010 to 2021.<h4>Methods</h4>Data from Global Burden of Disease (GBD), United Nations Population Division and NCD Risk Factor Collaboration covering 21 MENA countries were used for annual percent change (APC) trends per Joinpoint regression. Regression modelling determined MASLD cirrhosis prevalence (compensated [CC]/decompensated cirrhosis [DCC]). Prevalence and mortality estimates were age-standardised (children and adults).<h4>Results</h4>MENA region's population: progressively aged, increased (518-623 million), and experienced prevalence increases in adult diabetes (7.4%-12.1%), obesity (25.4%-31.3%) and MASLD (26.3% [117.97 million] to 27.7% [164.31 million]; APC = 0.47%; 95% CI, 0.35-0.59); steeper increase in adults ≥ 20 years (37.1%-41.0%; APC = 0.90%; 0.79-1.01). MASLD cirrhosis (0.22% [1.13 million] to 0.28% [1.73 million]; APC = 2.18%; 2.05-2.31), CC (0.20%-0.25%; APC = 2.24%) and DCC (0.020%-0.025%; APC = 2.23%) increased. Algeria, Iraq, Morocco and Turkey had the highest increases (APCs > 2.8% for both CC and DCC). MASH cirrhosis mortality (APC = 0.60%), and DALYs (APC = 0.47%) increased. MASH liver cancer prevalence (APC = 2.90%), incidence (APC = 2.90%), mortality (0.50-0.69 per 100 000; APC = 2.87%) and DALYs (APC = 2.51%) increased. Iran had the most rapid increases (APC > 6%) for all liver cancer outcomes; Egypt accounted for ≥ 50% liver cancer DALYs in 2021. Kuwait, West-Bank/Gaza and United Arab Emirates showed stable/declining trends.<h4>Conclusions</h4>The prevalence of MASLD and associated complications (cirrhosis and liver cancer) increased substantially across the MENA region from 2010 to 2021, with variation across countries.

HFE
Also flagged:Non-Alcoholic Steatotic Liver Diseaseliver diseasediabetesGCKRFibrosisSteatotic liver disease
Journal Article 2025-10-01 ✓ 1 Snippet Sato-Espinoza K, Vierkant RA, Chotiprasidhi P, Vairo FPE, Tian S, Ma J, O'Brien D, Lazaridis KN, Dlugosch C, Scheider C, Allen AM, Wangensteen KJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Steatotic liver disease (SLD) is characterised by liver fat accumulation exceeding 5%. Lean body weight (BMI ≤ 25 kg/m<sup>2</sup>) with non-alcoholic SLD is a rare phenotype, and the balance of risks related to metabolic conditions or genetic predisposition, or the risk of progressive liver disease, is not known. This study evaluates clinical and genetic predictors of non-alcoholic SLD and advanced liver disease in lean individuals.<h4>Methods</h4>We used International Classification of Disease codes, radiology and pathology review to identify 177 lean non-alcoholic SLD cases (47 cryptogenic, 130 MASLD), 677 matched lean controls, and 3090 overweight/obese SLD cases in the Mayo Clinic Biobank and Tapestry databases. We performed case-control and cross-sectional comparisons of clinical and genetic factors between these groups, using univariable and multivariable analyses.<h4>Results</h4>Lean individuals with non-alcoholic SLD exhibited metabolic and genetic profiles that were intermediate between those of lean controls without SLD and overweight/obese SLD individuals, including intermediate rates of diabetes, hypertension, hyperlipidaemia and of homozygosity for the risk allele of PNPLA3. Multivariable analysis indicated that diabetes was an independent predictor of SLD among lean individuals. Among lean individuals with non-alcoholic SLD, those with metabolic-associated SLD (MASLD), as compared to those with cryptogenic SLD (without metabolic risk factor), were more likely to be homozygous for risk alleles in GCKR. The Fib-4 score, a tool for screening advanced liver disease in SLD, accurately predicted advanced fibrosis among lean individuals with non-alcoholic SLD.<h4>Conclusion</h4>Diabetes serves as a primary predictor of non-alcoholic SLD in lean individuals. These results support the recommendation to screen for SLD in patients with diabetes, regardless of BMI. The GCKR risk allele is associated with MASLD in lean individuals, and the risk factors for cryptogenic SLD remain unclear.

SOX6
Also flagged:matingbehaviouralspina bifidaarthrogryposisatresia anihindlimb ataxia
Journal Article 2025-10-01 ✓ 2 Snippets Mainzer J, Yin T, Giambra I, Hümmelchen H, Engel P, Wagner H, Wehrend A, König S.
In-Text Gene Mentions

…of the geneSOX6.…

SOX6influenced bone mineral…

Show Full Abstract

The aim of this study was an in-depth genomic analysis for tail length (TL), tail characteristics and body measurements in the Merinoland sheep breed considering whole-genome sequence data. Genomic analyses included the estimation of genetic parameters and dominance effects, genome-wide associations for the additive and dominance component, and the annotation of potential candidate genes. We implemented a unified selection and mating experiment to create extreme lamb groups based on breeding values for TL. The 254 lambs from the mating experiment were phenotyped at birth for TL, tail circumference, and body length (all in cm), for body weight, and X-rayed to count the number of vertebrae and to identify tail abnormalities for tail fractures, axis deviations, block vertebrae, and wedged vertebrae. Heritabilities using the variant-based relationship matrix were large for the morphological measurements TL (0.85), body length (0.93), and body weight (0.85), moderate for tail circumference (0.21), and number of vertebrae (0.29), but close to zero for tail abnormalities. Dominance variance for TL explained 14.95% of the phenotypic variation, but was close to zero for the remaining tail traits. The positive breeding value correlations indicate longer and thicker tails for taller and heavier lambs. Breeding value correlations were negative between TL with block vertebrae and wedged vertebrae. Genome-wide associations for additive-genetic and dominance effects revealed 726 significant variants, which are located close to potential candidate genes. These candidate genes have known functions on skeletal growth, and regulate the development of bone structures and of vertebrae characteristics.

Also flagged:lung cancerepithelial ovarian cancercancercancerscomplexchromosomes
Journal Article 2025-10-01 No Snippets Dai 戴景岚 J, Zhang 张艺昕 Y, Gao 高源 Y, Li 李鸿儒 H, Du 杜莎 S, Hong 洪豪 H, You 尤东方 D, Li 郦再鸣 Z, Zhang 张汝阳 R, Zhao 赵杨 Y, Liu 刘中华 Z, Christiani DC, Chen 陈峰 F, Shen 沈思鹏 S.
Show Full Abstract

With the emergence of population-scale whole-genome sequencing (WGS), rare variants can be captured precisely. Studying rare variants explains part of the heritability of complex traits that is overlooked by conventional genome-wide association studies (GWASs). However, the extent to which imputed data can approximate or improve upon the power of WGS data in rare variant association studies remains unclear. Using the UK Biobank WGS data (n = 150,119) as the ground truth, we first evaluated the consistency of rare variants in the single-nucleotide polymorphism (SNP) array data imputed using TOPMed or HRC+UK10K reference panel. Imputation quality (average R2) of the TOPMed-imputed data reached 0.6 even for extremely rare variants with minor allele count ≤ 5. TOPMed-imputed data were closer to WGS data across three ethnic groups, with average Cramer's V > 0.75. Furthermore, association tests were performed on 45 traits. At the same sample size (n = 150,119), neither imputed dataset outperformed WGS data, but the results of the TOPMed-imputed data were more consistent with those of WGS data. When the sample size was increased to 488,377, the number of significant rare variants identified from the TOPMed-imputed data increased by 27.71% for quantitative traits and by approximately 10-fold for binary traits. Finally, we meta-analyzed the association results of SNP array and WGS for lung cancer and epithelial ovarian cancer, respectively. Compared to WGS-based results, more significant variants and genes were identified. Our findings highlight that incorporating rare variants imputed using large-scale sequencing populations can boost the power of rare variant association studies when WGS has limited sample sizes.

Also flagged:HPOaginggene expressionCLcell proliferationcancer
Journal Article 2025-10-01 No Snippets Barbitoff YA, Bogaichuk PM, Pavlova NS, Malysheva PV, Predeus AV.
Show Full Abstract

Pleiotropy, a phenomenon of multiple phenotypic effects of the same genetic alteration, is one of the most important features of genotype-to-phenotype networks. Over the last century, biologists have actively debated the prevalence, mechanisms, and consequences of pleiotropy. In this work, we employed data on genotype-to-phenotype associations from the Human Phenotype Ontology and Mouse Genome Database, as well as genome-wide associations from the UK Biobank and FinnGen cohorts to investigate the similarities and dissimilarities in the patterns of pleiotropy between species and different trait types (i.e. Mendelian traits and complex traits). We found that the pleiotropic effects of genes correlate well between species but have a much weaker correlation when comparing different types of traits for the same species. In all cases, however, highly pleiotropic genes possessed a common set of features, such as broad expression across tissues, involvement in many biological processes, or a high number of protein-protein interactions of the respective gene products. Furthermore, we observed a universal tendency of highly pleiotropic genes to be under greater negative selection pressure compared to other groups of genes, including genes essential for cell growth and development. Besides, highly pleiotropic genes also show a significant enrichment of recent positive selection signals. Taken together, our results pinpoint a common mechanism underlying pleiotropic effects in different trait domains and suggest that high degree of pleiotropy plays a role in adaptation, despite imposing additional constraint on genetic variation.

Also flagged:lumenhyaluronic acidelastin-like proteingelatinenterogenesisShort bowel syndrome
Journal Article 2025-10-01 No Snippets Salimi-Jazi F, de Paiva Narciso N, Fell G, Thomas AL, Navarro RS, Rafeeqi T, Baugh NJ, Suhar RA, Nguyen JA, Lopez N, Heilshorn SC, Dunn JCY.
Show Full Abstract

Spring-mediated distraction enterogenesis has shown success in intestinal lengthening, with spring confinement achieved by external plication with sutures to reduce the lumen diameter at both ends of the intestinal segment. Endoscopic spring placement would minimize the morbidity associated with device insertion. This study investigates the use of submucosal injection of engineered hydrogel to temporarily confine a compressed spring within an intestinal segment. Engineered hydrogels were composed of hyaluronic acid (HA) alone or HA with elastin-like protein (HELP). To simulate endoscopic injection in six juvenile pigs, hydrogel was injected into the submucosa in everted jejunum, followed by the placement of a gelatin-encapsulated, compressed nitinol spring. The jejunum was then unfolded over the spring, and hydrogel was injected distally into the submucosa. Sutures were placed as fiducial markers. After 7 days on a liquid diet, the pigs were euthanized, and their intestinal segments were analyzed for lengthening and histological changes. The spring-containing jejunal segments expanded in all animals, lengthening to 132% in the HA group and 188% in the HELP group. HELP hydrogels exhibited slower biodegradation than HA-only hydrogels. Histological analysis showed increased crypt width and decreased crypt density in the spring-containing segments compared to controls. Hydrogel effectively provides temporary spring confinement within intestinal segments without adverse effects. The mechanical stimulation from the spring induces crypt fission, expanding the intestinal epithelium. These results support the feasibility of gel-enabled, spring-mediated distraction enterogenesis for intestinal lengthening.

HFE
Also flagged:Hepatobiliary Cancerhepatocellular carcinomaintrahepatic cholangiocarcinomaextrahepatic cholangiocarcinomagallbladder cancernonspecified liver cancer
Journal Article 2025-10-01 ✓ 1 Snippet Park A, Vodinh-Ho A, Rok I, Qi X, Hung GA, Kikuta N, Jamal A, Kim GS, Palaniappan LP, Srinivasan M, Huang RJ, Bacong AM.
In-Text Gene Mentions

…alcoholic liver disease,hemochromatosis, and nonalcoholic steatohepat…

Show Full Abstract

<h4>Background</h4>Asian Americans (AAs) are a diverse population, and aggregation of AA health data in national reports conceals significant differences between AA subgroups. As hepatobiliary cancer rates increase globally, a greater understanding of hepatobiliary mortality among AA subgroups could motivate precision intervention and screening programs.<h4>Methods</h4>Using national mortality data from 2005 to 2020, we report age-adjusted mortality rates, standardized mortality ratios, and annual percent change for hepatocellular carcinoma (HCC), nonspecified liver cancer (NOS), intrahepatic cholangiocarcinoma (ICC), extrahepatic cholangiocarcinoma (ECC), and gallbladder cancer (GBC) using national mortality data for the six largest AA subgroups (Asian Indian, Chinese, Filipino, Japanese, Korean, and Vietnamese) compared to non-Hispanic White people (NHW).<h4>Results</h4>All AA subgroups (except Asian Indians) had significantly higher hepatobiliary cancer mortality than NHW people. Vietnamese people demonstrated the highest mortality from HCC (7.65 per 100,000) and nonspecified liver cancer (5.57 per 100,000), while Korean people had the highest mortality from the biliary tract cancers: ICC (3.10 per 100,000), GBC (0.72 per 100,000), and ECC (0.97 per 100,000). Notably, ICC mortality increased across the study period. Across all subgroups, male individuals had significantly higher hepatobiliary cancer mortality than female individuals, with differences being largest for HCC and nonspecified liver cancer.<h4>Conclusions</h4>Differences in mortality across hepatobiliary cancer types demonstrate the importance of analyzing subtypes separately. These differences also highlight the importance of developing ethnically targeted screening, prevention strategies, and treatment.

TNFSF4
Also flagged:Rheumatoid ArthritisInflammatory ResponseTumor necrosis factor superfamily member 4OX40Lautoimmune diseasesRA
Journal Article 2025-10-01 ✓ 5 Snippets Cai X, Yao Y.
In-Text Gene Mentions

TNFSF4Promotes Bone Erosion…

…superfamily member 4 (TNFSF4), also known as…

…study reveals thatTNFSF4expression is elevated…

…we demonstrate thatTNFSF4exacerbates synovial inflammat…

TNFSF4knockout reduces M1…

Show Full Abstract

Tumor necrosis factor superfamily member 4 (TNFSF4), also known as OX40L, is implicated in autoimmune diseases, but its role in rheumatoid arthritis (RA) remains poorly understood. This study reveals that TNFSF4 expression is elevated in RA synovial tissue and correlates with disease activity markers. Using a collagen-induced arthritis (CIA) mouse model, we demonstrate that TNFSF4 exacerbates synovial inflammation and promotes bone erosion by skewing macrophage polarization toward the pro-inflammatory M1 phenotype. TNFSF4 knockout reduces M1 macrophages, increases M2 macrophages, and attenuates cytokine-driven inflammation and osteoclast activity. Importantly, TNFSF4 does not directly modulate macrophage polarization but requires CD4<sup>+</sup> T cell involvement. These findings uncover a novel mechanism by which TNFSF4 contributes to RA pathogenesis and highlight its potential as a therapeutic target for modulating immune responses and preventing joint damage in RA.

Also flagged:BudesonideBronchopulmonary Dysplasiadeathgestationporactanthyperglycemia
Journal Article 2025-10-01 No Snippets Ambalavanan N, Carlo WA, Nowak KJ, Wiener LE, Cosby SS, Bhatt AJ, Watterberg KL, Poindexter BB, Keszler M, D'Angio CT, Brion LP, Narendran V, Rau CA, Cotten CM, Laughon MM, Das A, Rysavy MA, Hibbs AM, Fuller J, Puopolo KM, Katheria A, Patel RM, Bermick JR, Laptook AR, Prelipcean I, Wyckoff MH, Moore R, Merhar SL, Ohls RK, Yoder BA, Perez M, Ghavam S, Meyer LR, Chock VY, DeMauro SB, Jackson WM, Handa D, Walsh MC, National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Importance</h4>Extremely preterm infants are at high risk for bronchopulmonary dysplasia (BPD) and death. Multiple small randomized clinical trials showed that a combination of budesonide with surfactant compared with surfactant alone reduced BPD or death.<h4>Objective</h4>To determine if early intratracheal administration of a combination of budesonide (0.25 mg/kg) mixed with surfactant, compared with surfactant alone, reduces physiologic BPD or death by 36 weeks' postmenstrual age in extremely preterm infants.<h4>Design, setting, and participants</h4>This double-masked randomized clinical trial was conducted from April 2021 to June 2024 in the 17 centers of the United States Neonatal Research Network. Infants 22 to 28 weeks' gestation or 401 to 1000 g birth weight were enrolled after clinical decision to give surfactant, with the first dose of surfactant being study drug (prior surfactant was an exclusion criterion).<h4>Interventions</h4>Infants were randomly allocated 1:1 to receive 1 to 2 doses of budesonide + surfactant (poractant alfa) or surfactant alone via endotracheal tube within 50 hours of birth.<h4>Main outcomes and measures</h4>The primary outcome was physiologic BPD or death by 36 weeks' postmenstrual age. There were 5 prespecified secondary outcomes and multiple prespecified exploratory and safety outcomes.<h4>Results</h4>The trial was stopped with 641 infants enrolled (55.3% of 1160 planned; mean birth weight, 810 g [SD, 256 g]; gestational age, 25.9 weeks [SD, 1.9 weeks]), because interim analysis at 50% enrollment reached the prespecified futility threshold. The incidence of BPD or death was 68.5% in the budesonide + surfactant group and 67.9% in the surfactant-alone group (adjusted relative risk [RR], 1.00 [95% CI, 0.90-1.11]). No differences were noted in mortality (15.3% vs 13.2%; adjusted RR, 1.13 [95% CI, 0.78-1.64]) or BPD among survivors to 36 weeks' postmenstrual age (62.9% vs 63.0%; adjusted RR, 0.99 [95% CI, 0.87-1.12]). More infants who received budesonide + surfactant compared with surfactant alone had hyperglycemia (66.7% vs 49.8%; adjusted RR, 1.33 [95% CI, 1.17-1.51]).<h4>Conclusions and relevance</h4>In this large multicenter trial, the combination of budesonide with surfactant did not reduce the risk of BPD or death at 36 weeks' postmenstrual age in extremely preterm infants.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT04545866.

HFE
Also flagged:blood disordercongenital dyserythropoietic anemia type Ianemiaerythropoiesisironchromatin
Journal Article 2025-10-01 ✓ 1 Snippet Bosques L, Modepalli S, Nagarajan A, Tang C, Martínez-Morilla S, Rahman NT, Mehta SS, Krause DS, Tamary H, Gallagher PG, Hattangadi SM, Kupfer GM.
In-Text Gene Mentions

…hallmark of CDA-1–hemochromatosis.…

Show Full Abstract

<h4>Background</h4>Congenital dyserythropoietic anemia type I (CDA-I) is an autosomal recessive disorder marked by ineffective erythropoiesis, abnormal morphology of bone marrow erythroblasts, and iron overload. Most cases of CDA-I are caused by mutations in the CDAN1 gene, which encodes a ubiquitous protein of unknown function, Codanin-1.<h4>Methods</h4>To investigate the role of Codanin-1 in the molecular pathways involved in CDA-I, we developed erythroid models using human K562 cells and primary human CD34 + cells from mobilized peripheral blood.<h4>Results</h4>Here we show that Codanin-1 expression is required for erythroid progenitor development and normal erythroid cell differentiation. Erythroid cells lacking Codanin-1 demonstrated morphologic changes similar to those observed in CDA-I. Global gene expression changes after Codanin-1 knockdown revealed alterations in a set of key erythroid genes. In particular, the AHSP gene, which showed reduced mRNA and protein expression levels after Codanin-1 knockdown, also demonstrated increased Codanin-1 occupancy at its gene regulatory region by chromatin immunoprecipitation coupled to high-throughput sequencing.<h4>Conclusion</h4>In summary, using cell models recapitulating many features of CDA-I, we have studied and confirmed the importance of Codanin-1 during erythroid differentiation and provide mechanistic insight into how loss of Codanin-1 expression results in CDA-I.

Also flagged:Neurotrophicneurodegenerative diseasesNTFADPDHD
Journal Article 2025-10-01 No Snippets Kim SC, Lee SY, Jung UJ, Kim SR.
Show Full Abstract

Neurotrophic factors (NTFs) are secreted proteins that are crucial in neuronal growth, survival, and function. Individuals with neurodegenerative diseases, characterized by neuronal loss and various functional disorders, have been reported to exhibit altered levels of NTFs. This suggests that modulating NTF levels may offer a promising therapeutic strategy to alter the progression of neurodegenerative diseases. Although numerous efforts have been made to deliver NTFs to target regions, their clinical application remains challenging due to their inability to cross the blood-brain barrier (BBB) and the adverse side effects observed in clinical trials. Consequently, various delivery methods have been explored to overcome these limitations. In this review, we discuss recent therapeutic approaches utilizing NTFs and their signaling pathways as interventions against neurodegenerative diseases.

DNAH10
Also flagged:methylationhistonegene expressionobesitychildhood obesitychronic diseases
Journal Article 2025-10-01 ✓ 1 Snippet León-Reyes G, González-Quijano GK, López-Alavez FJ, Tejero ME.
In-Text Gene Mentions

…TSPAN6 , andDNAH10mediated the associations…

Show Full Abstract

Epigenetic mechanisms, including DNA methylation, histone modification, and activity of noncoding RNAs (nc RNAs), affect the regulation of gene expression. These mechanisms are regulated by numerous environmental factors and are critical at specific windows of biological development, when organs and systems plasticity is increased. Evidence suggests that exposure to factors influencing these mechanisms may have an effect on health, including the risk for obesity at early stages of life. This study analyzed published evidence on the association between epigenetic mechanisms and childhood obesity. We searched for studies using untargeted detection methods followed by validation of associations between epigenetic mechanisms and obesity in children. Fifteen studies were found: two meta-analyses on DNA methylation, seven original studies on DNA methylation, one systematic review on microRNAs, and five studies on nc RNA. No studies on histone modifications were identified. Most studies were conducted in blood cells or blood-derived fluids. DNA methylation in different tissues was associated with childhood and adolescent obesity or related phenotypes, although comparison across studies is difficult due to technical differences. Nc RNA differed between children with and without obesity. Research on the role of factors regulating epigenetic mechanisms associated with childhood obesity is highly needed.

Also flagged:internal transcribed spacer (ITS)ITS1FITS4squalestatin S1ophiobolin biosyntheticoblA
Journal Article 2025-10-01 No Snippets Hue Y, Nam Y, Choi B, Kim S, Jang SH, Chung H, Park SY, Kim KT.
Show Full Abstract

Bipolaris oryzae, the causal agent of rice brown spot, is a necrotrophic fungus that produces phytotoxic secondary metabolites, yet its genomic basis of pathogenicity remains incompletely defined. We sequenced six South Korean B. oryzae isolates and analyzed them together with publicly available genomes from Bipolaris and related Pleosporaceae, covering 37 Bipolaris isolates across eight species. Phylogenomics based on singlecopy orthologs confirmed the monophyly of Bipolaris and resolved B. oryzae as a distinct lineage. Comparative analyses showed that B. oryzae has a moderately reduced secretome and fewer candidate pathogenicity gene families relative to B. maydis and B. sorokiniana, while retaining a conserved core enriched in carbohydrate and amino acid metabolism. We identified 48 secondary metabolite biosynthetic gene clusters in B. oryzae F1253 and, critically, localized the ophiobolin biosynthetic gene cluster to pseudochromosome 2. The cluster contains conserved core genes, oblA to oblD, which are broadly retained across Bipolaris, and exhibits interspecies variation in synteny and copy number associated with repeat element insertions. These findings reveal the genomic architecture underlying metabolic specialization and toxin biosynthesis in B. oryzae. They also provide actionable targets and markers for management, including diagnostics for oblA to oblD, screening of rice germplasm for ophiobolin tolerance, and RNAi-based suppression of ophiobolin biosynthesis under climate-related stress.

HTT
Also flagged:Schizophrenia spectrum disordersbrainmetabolismschizophreniacognitionpsychosis
Journal Article 2025-10-01 ✓ 2 Snippets García-San-Martín N, Bethlehem RA, Segura P, Mihalik A, Seidlitz J, Sebenius I, Alemán-Morillo C, Dorfschmidt L, Shafiei G, Morgan SE, Ruiz-Veguilla M, Ayesa-Arriola R, Vázquez-Bourgon J, Misic B, Suckling J, Crespo-Facorro B, Romero-García R.
In-Text Gene Mentions

…ibution of neurotransmitters (5-HTT, DAT, VAChT, 5-HT…

…4 , DAT,5-HTT, D 1 ,…

Show Full Abstract

Schizophrenia spectrum disorders (SSD) are characterized by atypical brain maturation, including alterations in structural similarity between regions. Using structural MRI data from 195 healthy controls (HC) and 352 individuals with SSD, we construct individual Morphometric INverse Divergence (MIND) networks. Compared to HC, individuals with SSD mainly exhibit reduced structural similarity in the temporal, cingulate, and insular lobes, being more pronounced in individuals exhibiting a 'poor' clinical status (more impaired cognitive functioning and more severe symptomatology). These alterations are associated with cortical hierarchy and maturational events, locating MIND reductions in higher-order association areas that mature later. Finally, we map 46 neurobiological features onto MIND networks, revealing a high presence of neurotransmitters and astrocytes, along with decreased metabolism and microstructure, in regions with reduced similarity in SSD. These findings provide evidence on the complex interplay between structural similarity, maturational events, and the underlying neurobiology in determining clinical status of individuals with SSD.

Also flagged:carbon dioxidecarbonsilicacalciumhydroxidecalcium silicate
Journal Article 2025-10-01 No Snippets Mitikie BB, Wubetie TA, Elsaigh WA.
Show Full Abstract

The production of cement is growing every year due to its higher consumption in the construction industries. Several studies have been carried out that focus on the possibility of alternative cementing materials such as Industrial and agricultural wastes. Rice husk is one of such agricultural residues and cattle bone is animal waste that are available but didn't get much attention as alternative cementing material. This study aimed to investigate the effect of partial replacement of cement by combining cattle bone ash and rice husk ash mix in cement mortar at 0%, 5% 10% 15% and 20% by volume of cement. The workability test, compressive strength, Ultrasonic Pulse Velocity, water absorption, and sulfate attack tests were conducted for different curing ages (3, 7, 28, 56, and 90 day). In addition, the morphology scanning electron microscopy (SEM), thermogravimetric analysis (TGA), differential thermal analysis (DTA), fourier transform infrared spectroscopy (FTIR) and Brunauer-Emmett-Teller (BET) surface area test, complete silicate analysis test was conducted. Compressive strength increases with an increment of from 0 to 10% replacement at 28 days of curing from 31.5 to 45.9 MPa and slightly decreased beyond 15-20% replacement with 39.9 MPa and 30.6 MPa. The result revealed that the mechanical performance of mortar indicated enhancement of calcium silicate hydrate gel, thus reduce the porosity of cement matric. Under scanning Electron Microscopy (SEM) image, mortar sample possessed a dense matrix with a widespread presence of calcium silicate hydrate (C-S-H) gels.

Also flagged:CRPmineralsleepdeathHCP
Journal Article 2025-10-01 No Snippets Chen W, He L, Cao B, Zhou P, Wang Y, Wang H, Jia Y.
Show Full Abstract

Aiming at the issues of uneven energy consumption among nodes and the optimization of cluster head selection in the clustering routing of underwater wireless sensor networks (UWSNs), this paper proposes an improved gray wolf optimization algorithm (CTRGWO-CRP) based on cloning strategy, t-distribution perturbation mutation, and opposition-based learning strategy. Within the traditional gray wolf optimization framework, the algorithm first employs a cloning mechanism to replicate high-quality individuals and introduces a t-distribution perturbation mutation operator to enhance population diversity while achieving a dynamic balance between global exploration and local exploitation. Additionally, it integrates an opposition-based learning strategy to expand the search dimension of the solution space, effectively avoiding local optima and improving convergence accuracy. A dynamic weighted fitness function was designed, which includes parameters such as the average remaining energy of the network and the communication distance from cluster heads to base stations. This function utilizes an adaptive weight adjustment mechanism to achieve multi-objective optimization of energy balance and transmission efficiency. During the cluster head election phase, an elite retention strategy is adopted to prioritize high-energy nodes. In the data transmission phase, a multi-hop relay mechanism based on gradient fields and energy thresholds is constructed, optimizing communication energy consumption through path loss prediction. Simulation results demonstrate that, compared to the LEACH, DMaOWOA, and GSHFA-HCP algorithms, the proposed algorithm significantly extends the network lifetime by at least 23.5%, showcasing its substantial advantages. This verifies the effectiveness of the multi-strategy fusion mechanism in routing optimization.

DCC
Also flagged:axontranscription factorsJunItgamPtprcFn1
Journal Article 2025-10-01 ✓ 4 Snippets Xiang Z, Fang D, Gao D, Zhang Q, Zhang Y, Sun Y, Li L, Zhang X, Li J, Ding L.
In-Text Gene Mentions

…in Colorectal Cancer (Dcc), Ephrin type-A receptor…

…our study identifiedDccas a downregulated…

…site within theDccpromoter, which is…

…the regulation ofDcctranscription in response…

Show Full Abstract

<h4>Background</h4>Spinal Cord Injury (SCI) impacts neural function and regeneration. This study aimed to identify key axon regeneration genes in SCI and their correlations with immune infiltration and SCI subtyping.<h4>Methods</h4>Gene expression profiles of 30 sham-operated mice and 29 SCI mice were obtained from GSE5296, GSE47681, and GSE93561 datasets. A PPI network of axon regeneration genes was constructed. Consensus clustering classified SCI subtypes. Differential expression analysis identified genes associated with SCI and its subtypes. Immune infiltration was assessed. WGCNA identified key genes. Potential drugs targeting hub genes were explored. An SCI mouse model was established and subjected to HE staining to assess pathological changes. The dysregulation of five key axon regeneration-related genes was validated in mouse spinal cord tissues using qRT-PCR and Western blotting.<h4>Results</h4>We identified 2,971 genes associated with SCI, including 19 axon regeneration-related genes, and 144 differentially expressed transcription factors, with Jun being highly interconnected. Significant alterations in immune cell abundance correlated with axon regeneration genes. Consensus clustering stratified SCI samples into two subtypes. WGCNA identified 21 hub genes associated with SCI subtypes. Drug-gene interaction analysis identified Itgam and Ptprc as potential therapeutic targets. Validation experiments showed significant upregulation of Fn1, Sdc1, and Cspg4, and downregulation of Col4a1 and Lamb1 in the SCI model group compared to controls.<h4>Conclusions</h4>Our study elucidates the interplay among axon regeneration genes, immune infiltration, and transcriptional regulation in SCI. Validation experiments confirmed the dysregulation of key axon regeneration-related genes in SCI mice, supporting their role in SCI pathology.

OLFM4
Also flagged:colorectal cancerHTR2Btumorcancerepithelial-mesenchymal transitionserotonin receptor
Journal Article 2025-10-01 ✓ 2 Snippets Carmi I, Orosz A, Hajdó S, Zeöld A, Hegedűs T, Kelemen-Győri D, Pozsár J, Tölgyes T, Wiener Z.
In-Text Gene Mentions

…genes MUC2 andOLFM4at a higher…

…the NOTCH targetsOLFM4and MUC2 but…

Show Full Abstract

Colorectal cancer (CRC) is the second-third most frequent cancer type in the Western countries, with significant inter- and intra-patient cellular heterogeneity. The transcriptomics-based CRC classification identified a cluster of patients with epithelial-mesenchymal transition (EMT), the accumulation of fibroblasts, and dismal prognosis. Although the serotonin receptor HTR2B is thought to be one of the epithelial markers of this aggressive CMS4 subgroup, its precise role in CRC tumorigenesis is still largely unknown. By using patient-derived organoids (PDO), we prove the heterogeneous expression of this receptor that is under the control of the mTOR pathway. Unfavorable conditions, applying the clinically used 5-fluorouracil, co-culturing with fibroblasts, and collagen-I accumulation in the extracellular matrix (ECM) increased the number of HTR2B + cells. Interestingly, whereas stimulating HTR2B had no effect on PDOs under normal conditions, it reduced cellular survival under unfavorable conditions when carbohydrates were lacking. In contrast, serotonin and an HTR2B agonist induced invasion of HTR2B + tumor cells only in collagen-I, representing a permissive ECM for cellular migration. CRC cells positive for HTR2B also expressed the NOTCH3 receptor and NOTCH target genes at a higher intensity than cells with low HTR2B levels. Similar to HTR2B + organoids, NOTCH3 + PDOs had increased EMT markers and HTR2B levels. Furthermore, blocking NOTCH activity inhibited the serotonin-induced invasion. Collectively, our results show that the serotonin receptor HTR2B marks a CRC cell population with increased proliferative capacity, invasive potential, and partial EMT, and they highlight the critical role of ECM in shaping the effect of serotonin in CRC.

Also flagged:Strokeischemic strokedeathGFAPsecretioninflammatory response
Journal Article 2025-10-01 No Snippets Yang S, Chen Y, Tang J, Cui Y, Wei W, Hao Z, Xiao Z, Pan Y, Tian Q, Xin W, Li M.
Show Full Abstract

Ischemic stroke, the most prevalent form of stroke, severely impacts human health due to its high incidence, disability, and mortality rates. The complex pathological response to ischemic stroke involves the interplay of various cells and tissues. Among these, astrocytes and microglia, as essential components of nervous system, play significant roles in the pathological processes of ischemic stroke. In addition to their individual functions, an increasing number of studies have revealed that the interaction between astrocytes and microglia is crucial following ischemic stroke. It integrates current research reports to examine and clarify the effects of interaction between the microglia and astrocytes on the nervous system after ischemic stroke, aiming to provide new insights and approaches for future academic research and disease treatment.

HFE
Also flagged:Alzheimer's diseaseADlipidpeptideslysophosphatidylcholinesphingomyelin
Journal Article 2025-10-01 ✓ 1 Snippet Yang L, Chan M, Sheng J, Qi S, Chan B, Shantaram D, Rima XY, Reategui E, Han X, Hsueh WA, Wong STC.
In-Text Gene Mentions

…diagnosis of lipodystrophy,hemochromatosis, or other systemic…

Show Full Abstract

<h4>Introduction</h4>Obesity is a major modifiable risk factor for Alzheimer's disease (AD), but the mechanistic link between peripheral metabolic dysfunction and AD progression remains unclear. Adipose-derived extracellular vesicles (EVs) may penetrate the brain and alter lipid homeostasis, contributing to neurodegeneration.<h4>Methods</h4>We isolated exosome-enriched EVs from subcutaneous and visceral fat of lean and obese individuals, followed by lipidomic profiling. An in vitro amyloid-β (Aβ) aggregation assay using purified Aβ40 and Aβ42 peptides was performed under lipid environments mimicking physiological and pathological states.<h4>Results</h4>Obese-derived EVs exhibited distinct lipid profiles, particularly in lysophosphatidylcholine (LPC) and sphingomyelin (SM) species. Functional assays demonstrated that lipid identity and concentration critically influenced Aβ aggregation kinetics.<h4>Discussion</h4>Our study reveals that obesity-associated EV lipids modulate Aβ aggregation, linking adipose metabolism to AD pathology. These findings support lipid-targeted strategies as potential therapeutics for neurodegenerative diseases.<h4>Highlights</h4>Human adipose-derived extracellular vesicles (EVs) from obese individuals exhibit distinct lipidomic profiles. EV lipids modulate amyloid-β (Aβ) 40 and Aβ42 aggregation in a lipid-type- and concentration-dependent manner. Lysophosphatidylcholine (LPC) and sphingomyelin (SM) species from obese EVs significantly deregulate Aβ fibrillization in vitro. EV lipid cargo links peripheral metabolic state to amyloid pathology in Alzheimer's disease.

HFE
Also flagged:Vitamin C Deficiencyvitamin Cnutritional disorderironmetabolismHp
Journal Article 2025-10-01 ✓ 1 Snippet Delanghe J, Buyzere M, Speeckaert M.
In-Text Gene Mentions

…prevalence of theHFEC282Y mutation is…

Show Full Abstract

No abstract available.

HFE
Also flagged:Glycogenic HepatopathyDiabetesGHtype 1 diabetes mellitusT1DMtype 1 diabetes
Journal Article 2025-10-01 ✓ 1 Snippet Musleh M, AlMokbel A.
In-Text Gene Mentions

Hemochromatosiswas excluded by…

Show Full Abstract

Glycogenic hepatopathy (GH) is an underrecognized yet reversible cause of hepatomegaly and transaminase elevation in adolescents with poorly controlled type 1 diabetes mellitus (T1DM). While liver biopsy is often utilized to exclude other hepatic pathologies, it can also aid in confirming GH when noninvasive findings are inconclusive. We present a case of an 18-year-old male with type 1 diabetes, whose poorly controlled condition led to the development of GH. The diagnosis was confirmed through a liver biopsy, emphasizing the significance of early detection and proper glycemic management in preventing irreversible liver damage.

Also flagged:metalstumormetabolismcollagencolorectal cancergene expression
Journal Article 2025-10-01 No Snippets Srivastava A, Shaik N, Lu Y, Chan M, Diallo A, Zavras J, Han S, Punshon T, Jackson B, Vahdat L, Liu X, Mittal V, Lau K, Gui J, Vaickus L, Hoopes J, Kolling F, Perreard L, Marotti J, Levy J.
Show Full Abstract

The complex interplay between metal abundance, transport mechanisms, cell distribution, and tumor progression-related biological pathways (e.g. metabolism, collagen remodeling) remains poorly understood. Traditionally, genes and metals have been studied in isolation, limiting insights into their interactions. Recent advances in spatial transcriptomics and elemental profiling now enable comprehensive exploration of tissue-wide metal-gene interactions, though integration remains challenging. In this proof-of-concept study, we investigated metal-dependent signaling within the tumor microenvironment of a unique colorectal cancer (CRC) tumor. We implemented a spatial multimodal workflow which integrated elemental imaging, gene expression, cellular composition, and histopathological features to uncover metals-related pathways through spatially resolved gene expression correlation analyses. Preliminary findings revealed significant associations, for instance: elevated iron correlated with mesenchymal phenotypes located at the tumor's proliferative front, correlating with expression of genes involved in the epithelial-to-mesenchymal transition pathways, and extracellular matrix remodeling. Preliminary observations from this single sample revealed that high copper concentrations were localized to regions of active tumor growth and were associated with increased expression of immune response genes. This proof-of-concept workflow demonstrates the feasibility of integrating elemental imaging with spatial transcriptomics to identify metals-based gene correlates. Future application of this workflow to larger patient cohorts will pave the way for expansive comparisons across the metallome and transcriptome, ultimately identifying novel targets for tumor progression biomarkers and therapeutic interventions.

SUDS3
Also flagged:p53bindingTP53transcription factor p53response to stresspeptidyl-arginine deiminase 4
Journal Article 2025-10-01 ✓ 1 Snippet Indeglia A, Valdespino A, Pantella G, Offley S, Hill C, Foster M, Casey K, Tang HY, Faustino AM, Gardini A, Murphy ME.
In-Text Gene Mentions

…and illustrate howchromatin modifiersmodifiers like PADI4…

Show Full Abstract

TP53 encodes for the transcription factor p53, which binds to a diverse set of target genes in response to stress. Activation of p53 results in highly specific transcriptional responses, but the regulation of promoter selectivity by p53 is poorly understood. Here, we report that sequence-specific binding of p53 is regulated by its target gene and binding partner peptidyl-arginine deiminase 4 (PADI4). PADI4 enzymatically converts peptidyl-arginine to peptidyl citrulline in a process known as citrullination. We show that PADI4 citrullinates p53 at the C terminus in vitro, and we confirm two citrullination events in cells and mouse tissue (R306 and R363). Chromatin immunoprecipitation sequencing (ChIP-seq) reveals that PADI4 expression causes a redirection of p53 away from a subset of canonical binding sites to target genes associated with ETS transcription factors. Chromatin profiling using citrullination-specific p53 antibodies supports this conclusion. These findings link citrullination to p53 function and illustrate how chromatin modifiers like PADI4 can direct the p53 transcriptional response.

TRIM38
Also flagged:bindingtopoisomerasesTOP1TOP2ATOP2BTOP3A
Journal Article 2025-10-01 ✓ 5 Snippets Zhang H, Xiong Y, Chen Z, Chen J.
In-Text Gene Mentions

…of ZNF451 andTRIM38in the Regulation…

…we found thatTRIM38from the chromatin…

…TOP2A and TOP2B:TRIM38is an E3…

…that interactions betweenTRIM38and TOP2A/TOP2B were…

…WhetherTRIM38regulates TOP2A/TOP2B function…

Show Full Abstract

Topoisomerases are essential for resolving topological stress in DNA during key cellular processes. In human cells, six topoisomerases perform specialized yet overlapping functions to manage these challenges. To investigate their distinct and shared roles, as well as their involvement in DNA damage repair, we conducted a comprehensive analysis of the human topoisomerase-associated protein landscape. Using tandem affinity purification coupled with mass spectrometry, we mapped the protein-protein interaction networks of five human topoisomerases under both normal and stressed conditions. Our analysis identified several key interactions that may regulate topoisomerase function. Notably, TOP1 interacts with PUM3, which undergoes a similar relocalization from nucleoli to nucleoplasm following treatment with a TOP1 poison. In addition, we uncovered novel interactions of TOP3A with NSMCE4A, YTHDC2, and NDUFAF7, as well as a previously uncharacterized interaction between TOP3B and the mitochondrial membrane protein TDRKH (TDRD2). We further examined dynamic changes in these interactomes in response to TOP1 and TOP2 poisons and replication stress, distinguishing between interactions in chromatin and soluble fractions. These findings provide new insights into the regulation and functional coordination of human topoisomerases, offering potential biomarkers or therapeutic targets for topoisomerase inhibitors in cancer treatment.

DDX27
Also flagged:methylationcolorectal cancerEZH2wound healingLuciferasetumor
Journal Article 2025-10-01 ✓ 5 Snippets Chen Q, Song J, Zhang B, Wang H, Xu J, Li X, Wang X.
In-Text Gene Mentions

…DNA methylation-regulatedDDX27promotes colorectal cancer…

…oncogenic role ofDDX27in colorectal cancer…

…ation of EZH2.<h4>Methods</h4>DDX27expression and prognostic…

…and adjacent tissues;DDX27levels in CRC…

…methylation of theDDX27promoter and the…

Show Full Abstract

<h4>Objective</h4>To investigate the oncogenic role of DDX27 in colorectal cancer (CRC) and its regulation of EZH2.<h4>Methods</h4>DDX27 expression and prognostic value were analyzed using TCGA. qRT-PCR was performed on 30 paired CRC and adjacent tissues; DDX27 levels in CRC cell lines (HCT116, HT-29, SW480, SW620, HCT-8) were assessed by qRT-PCR and Western blot. Methylation-specific PCR evaluated CpG methylation of the DDX27 promoter and the effect of 5-azacytidine (5-AZ). Functional assays (CCK-8, flow cytometry, wound healing, transwell) examined proliferation, apoptosis, migration and invasion after DDX27 knockdown (si-DDX27). RNA-seq and bioinformatics analyses, together with Western blot assays, were used to identify downstream effectors. Luciferase reporter assays tested EZH2 promoter activity following DDX27 depletion. Rescue experiments overexpressed EZH2 in DDX27-silenced cells. In vivo, HCT116 cells with DDX27 shRNA or control shRNA were implanted in mice and tumor EZH2 was evaluated by IHC.<h4>Results</h4>DDX27 was upregulated in CRC and correlated with poorer prognosis. Promoter hypomethylation was observed and 5-AZ increased DDX27 expression. DDX27 knockdown inhibited proliferation, migration and invasion and increased apoptosis. Silencing DDX27 reduced EZH2 protein and significantly lowered EZH2 promoter luciferase activity. EZH2 overexpression partially rescued the anti-tumor effects of DDX27 silencing. In vivo DDX27 depletion suppressed tumor growth and reduced EZH2 expression.<h4>Conclusions</h4>DDX27 promotes CRC progression partly via transcriptional upregulation of EZH2; promoter hypomethylation contributes to DDX27 overexpression. Targeting the DDX27-EZH2 axis may be therapeutically valuable.

OLFM4
Also flagged:adiponectinadiponectin receptor 1Indole‐3‐Acetic Aciddextran sulfate sodiumpregnane X receptorlumen
Journal Article 2025-10-01 ✓ 1 Snippet Liu H, Su X, Wang J, Jin M, Zhang Y, Yang R.
In-Text Gene Mentions

…markers (Ki67, Lgr5,Olfm4[ 37 ])…

Show Full Abstract

The intestinal epithelium is tightly regulated by intestinal stem cells (ISCs), but the precise mechanisms governing their differentiation remain incompletely understood. We here demonstrate that adiponectin secreted by Paneth cells (PCs) suppresses ISC renewal and differentiation via adiponectin receptor 1 (adipoR1). Genetic ablation of adiponectin in gut epithelial cells (adip<sup>fl/fl-Villi-Cre</sup> mice) enhanced crypt cell renewal and differentiation. Single-cell RNA sequencing (scRNA-seq) revealed a significant increase in the enrichment of ISCs and transit-amplifying (TA) cells in adip<sup>fl/fl-Villi-Cre</sup> mice compared to control adip<sup>fl/fl</sup> mice. Furthermore, adip<sup>fl/fl/-Villi-Cre</sup> mice exhibited accelerated regeneration of intestinal epithelial cells following irradiation or dextran sulfate sodium (DSS)-induced injury. Intestinal organoids derived from adip<sup>fl/fl-Villi-Cre</sup> mice also displayed markedly faster growth than those from adip<sup>fl/fl</sup> mice. Consistent with these findings, adipoR1 knockout (KO) mice exhibited elongated crypt structures, further supporting adiponectin's inhibitory role in ISC proliferation. Notably, gut microbiota-derived indole-3-acetic acid (IAA) downregulated adiponectin expression, thereby promoting ISC renewal and proliferation. This was corroborated by in vitro organoid cultures, where IAA treatment accelerated development. Thus, our findings reveal that adiponectin modulated by microbial IAA serves as a critical regulator of ISC dynamics, ensuring epithelial homeostasis.

DCC
Also flagged:tumortumorsserous carcinomaserous carcinoma tumorscancerscolorectal cancer
Journal Article 2025-10-01 ✓ 5 Snippets Hu K, Liu CJ, Qin Z, Udager AM, Cieslik MP, Tomlins SA.
In-Text Gene Mentions

…SMAD4 , andDCC) are located…

…SMAD4 , andDCC(chr18) are located…

…Smad4 , andDccin these five…

…Smad4 , andDcc) and could…

…profile Smad2 orDcc, in support…

Show Full Abstract

Despite shared genetic driver alterations and histology, the genomic fidelity of most mouse tumor models, including those genetically engineered (GEMM), to their human counterparts is unknown. In this study, we developed MiMouse, a mouse comprehensive genomic profiling panel for high-throughput credentialing applicable to routine formalin-fixed, paraffin-embedded tumors. Through simulation/validation, we focused on considerations for cross-species mutation prioritization, strain determination, and aneuploidy detection. Using MiMouse, we profiled >250 tumors from high-grade serous carcinoma GEMMs based on conditional inactivation of Brca1 (B), Trp53 (P), Pten (Pt), Rb1 (R), and/or Nf1 (N) and a colorectal carcinoma GEMM based on conditional inactivation of Apc, Kras, and/or P. We confirmed increased genomic instability in high-grade serous carcinoma tumors, with BPPt cancers having both the shortest latency and the least genomic instability. In colorectal cancer, focusing on fidelity to human colorectal cancer aneuploidy events, our results highlighted the critical importance of synteny in transgenic studies, as not only was loss of mouse chromosome 18 (containing the tumor suppressor gene Smad4) a significant aneuploidy event (18%), additional tumors harbored focal Smad4 copy loss, potentially due to the mouse-specific proximity of Apc (mouse and human chromosomes 18 and 5, respectively). Likewise, mouse chromosome 5, the only significantly gained (46%) chromosome in our colorectal cancer models, has syntenic blocks from human chromosomes 7p, 7q, and 13q, including Cdx2, which is both a lineage-specific colorectal cancer oncogene and the colorectal cancer GEMM promoter source. Given the importance of mice to translational cancer research, this study highlights the considerations and utility of approaches for comprehensive genomic credentialing.<h4>Significance</h4>The genomic fidelity of most mouse tumor models is unknown. Considering cross-species issues, we develop MiMouse for high-throughput genomic credentialing and profile >250 tumors from fallopian tube and colorectal tumor models.

Also flagged:AgingSpermatogenesismiscarriagedegenerative diseasesreproductionsystemic diseases
Journal Article 2025-10-01 No Snippets Li T, Xu W, Yin L, Zhang J, DhikhirullahI O, Zhang Z, Yuan S.
Show Full Abstract

Aging refers to the irreversible changes in the structure and function of organisms over time. Under the influence of social and economic factors, the apparent effect of aging on female fertility has been widely recognized; however, its effect on male fertility has not received sufficient attention. Spermatogenic stem cells can differentiate and produce gametes continuously for a long time in a man's life, but more significant cumulative effects often occur over time. These age-related effects mainly manifest as increased chromosomal abnormalities and DNA damage, lower levels of sex hormones, impaired testicular function, and reduced spermatozoa count and quality. In the past, more attention has been paid to some of the macroscopic changes associated with aging. In this review, we will focus on the cellular level, discussing the effects of aging on male germ cells and the changes in the spermatogenic microenvironment, which consists mainly of Sertoli and Leydig cells.

Also flagged:RNase HAPOBEC3BApolipoprotein Bediting catalytic subunit 3BA3Bcytidine
Journal Article 2025-10-01 No Snippets Saito Y, Yamamoto Y, Yamamoto F.
Show Full Abstract

Apolipoprotein B mRNA editing catalytic subunit 3B (A3B), a nuclear enzyme that catalyzes cytidine-to-uridine (C-to-U) editing in single-stranded DNA (ssDNA), contributes to genetic diversity in many cancers. A3B is induced or activated by DNA damage owing to a variety of factors; however, the mechanisms by which A3B accesses ssDNA within the genome remain unclear. In this study, we showed that in unstimulated cells, A3B is retained in the nucleoplasm in an RNA-dependent manner. Upon DNA damage induced by camptothecin or actinomycin D (Act D), both targeting topoisomerase I, or by 1-methyl-3-nitro-1-nitrosoguanidine (MNNG), an alkylating agent that generates apurinic/apyrimidinic sites, A3B accumulates at the nucleolar rim and interior. Using confocal microscopy, we assessed the colocalization of A3B with drug-induced R-loops. A3B accumulation was abolished by RNase H treatment, implicating R-loops in its localization. However, the S9.6 antibody, commonly used to detect DNA/RNA hybrids, did not identify R-loop-specific signals in the nucleolus, leaving the direct involvement of R-loops in A3B accumulation unresolved. Conversely, immunoprecipitation-mass spectrometry with data-independent acquisition (IP-MS DIA) revealed increased interactions between A3B and RNA helicases such as DDX17 and DDX21, which are known R-loop-binding proteins, following MNNG or Act D treatment. Our results demonstrate that A3B-induced secondary DNA damage occurs in the nucleolus after DNA damage, providing new insights into the acquisition of cancer diversity involving A3B and the DNA damage response in the nucleolus.

ARFGEF2STAU1
Also flagged:agingICcell proliferationmetabolismchronic diseasesbehavioral
Journal Article 2025-10-01 ✓ 5 Snippets Beyene MB, Visvanathan R, Visvanathan R, Alemu R, Benyamin B, Bhattacharjee R, Beyene HB, Theou O, Cesari M, Beard JR, Amare AT.
In-Text Gene Mentions

…MAPT, SCN4A, andSTAU1genes, respectively (…

…capacities, rs34841991 (STAU1) — with…

…such as geneSTAU1- critical for synaptic…

…41 and MAPT,ARFGEF2, SCN4A, and GOSR2…

…mitochondria, 57 andSTAU1is involved in…

Show Full Abstract

<h4>Background</h4>Intrinsic capacity (IC) is a multidimensional concept within the World Health Organization framework for healthy aging. It refers to the composite of an individual's physical and mental capacities that enable them to maintain well-being, functional ability, and engagement in valued activities throughout life. While substantial evidence supports the biological basis of IC and its subdomains, the extent to which genetic factors influence IC remains largely unexplored, with no studies currently available.<h4>Methods</h4>Using datasets from the UK Biobank (UKB; N = 44 631) and the Canadian Longitudinal Study on Aging (CLSA; N = 13 085), we implemented the restricted maximum likelihood method to estimate SNP-based heritability (h2snp), followed by a Genome-Wide Association Study (GWAS) to identify genetic variants associated with IC, and post-GWAS analyses to pinpoint biological implications.<h4>Results</h4>The h2snp for IC was estimated at 25.2% in UKB and 19.5% in CLSA. Our GWAS identified 38 independent SNPs for IC across 10 genomic loci and 4289 candidate SNPs, mapped to 197 genes. Post-GWAS analysis revealed the role of these genes in cellular processes such as cell proliferation, immune function, metabolism, and neurodegeneration, with high expression in muscle, heart, brain, adipose, and nerve tissues. Of the 52 traits tested, 23 showed significant genetic correlations with IC, and a higher genetic loading for IC was associated with higher IC scores.<h4>Conclusions</h4>Overall, this study provides comprehensive evidence on the genetic architecture of IC, identifying novel genetic variants and biological pathways, advancing our current knowledge and laying the foundation for ongoing and future research on healthy aging.

IMI-Myopia Genetics Report.

NEGR1
Also flagged:myopiahigh myopiarefractive errorextracellularAgingSLC25A12
Journal Article 2025-10-01 ✓ 1 Snippet Voogelaar M, Tedja MS, Guggenheim JA, Saw SM, Tjon-Fo-Sang M, Mackey DA, Hammond CJ, Klaver CCW, Verhoeven VJM.
In-Text Gene Mentions

…including the genesNEGR1, TRIB2 ,…

Show Full Abstract

<h4>Purpose</h4>The genetic landscape of myopia has advanced considerably since the previous International Myopia Institute genetics reports. This white paper provides an updated overview of current findings on myopia genetics and identifies priorities for future research.<h4>Methods</h4>We performed a comprehensive literature review covering genome-wide association studies (GWASs), rare variant analyses, functional genomics, and multiomics approaches. Specific focus areas included common and high myopia, monogenic syndromes, and gene-environment interactions.<h4>Results</h4>Over 1000 common variants have now been associated with refractive error and myopia, implicating pathways in retinal signaling, extracellular matrix remodeling, and neurodevelopment. Whole-exome and whole-genome sequencing studies have uncovered rare variants in new candidate genes for high and syndromic myopia. Polygenic risk scores show improved predictive power when combined with environmental and demographic factors. A growing number of studies have explored gene-environment interactions, genetic pleiotropy, and causal inference using Mendelian randomization. These analyses support a role for educational attainment, screen time, physical activity, and metabolic or inflammatory biomarkers in refractive error development.<h4>Conclusions</h4>While a substantial portion of myopia heritability remains unexplained, future efforts should prioritize integrative approaches combining genetic, functional, and multiomics data across diverse populations. This will be essential for advancing personalized risk prediction, our understanding of gene-environment interplay, and identifying individuals most likely to benefit from targeted prevention or treatment strategies.

Also flagged:alcoholintoxicationApolipoprotein MApoMlipocalinbinding
Journal Article 2025-10-01 No Snippets Chang M, Breslin JW.
Show Full Abstract

<h4>Objective</h4>Microvascular hyperpermeability is a serious complication that occurs from hemorrhagic shock and resuscitation (HSR), especially when combined with acute alcohol intoxication (AAI). We tested the hypothesis that administration of Apolipoprotein M (ApoM), a lipocalin that normally resides in plasma high-density lipoproteins (HDL) and a carrier of sphingosine-1-phosphate (S1P), reduces combined AAI and HSR-induced microvascular leakage.<h4>Methods</h4>An established rat model of AAI/HSR was combined with intravital microscopy to study whether the administration of ApoM in resuscitative fluids reduces microvascular leakage of FITC-albumin. The impact of ApoM on human umbilical vein endothelial cell (HUVEC) monolayer barrier function and junctional integrity was tested, using trans-endothelial electrical resistance (TER) and immunofluorescence labeling of junctional VE-Cadherin, respectively. Immunoprecipitation of ApoM in HUVEC and mass spectrometry of complexes were used to determine potential binding partners. The Rac1 G-LISA assay was used to determine if ApoM causes Rac1 activation in HUVEC.<h4>Results</h4>Compared to sham controls, combined AAI and HSR significantly increased microvascular leakage. Administration of S1P, ApoM, or their combination during resuscitation significantly decreased microvascular leakage. In HUVEC monolayers, with or without alcohol pretreatment, S1P, ApoM, and S1P + ApoM all significantly increased barrier function and improved the junctional integrity of VE-cadherin compromised by alcohol. The small GTPase Rac1 was found to bind with ApoM in HUVEC and was significantly activated within 5 min of ApoM addition.<h4>Conclusions</h4>The findings suggest that fluid resuscitation with ApoM ameliorates AAI/HSR-induced microvascular leakage. The mechanism involves stabilizing VE-Cadherin junction integrity, which could be caused by Rac1 activation.

HFE
Also flagged:pigmentationochronosiscollagenAlkaptonuriametabolic disorderhomogentisate dioxygenase
Journal Article 2025-10-01 ✓ 1 Snippet Solís Chávez MB, Montero Cruces L, Romiti S, Saiz-Pardo Sanz M, Maroto Castellanos LC.
In-Text Gene Mentions

…disease, amyloidosis, andhemochromatosis, should be considered…

Show Full Abstract

<h4>Background</h4>Alkaptonuria is a rare autosomal recessive disorder characterized by homogentisic acid accumulation, leading to ochronosis and multisystemic manifestations including cardiovascular complications.<h4>Case summary</h4>A 63-year-old male with a known family history of alkaptonuria presented with dyspnea and severe aortic stenosis. Coronary angiography revealed diffuse, severe calcific coronary artery disease The patient underwent successful mechanical aortic valve replacement, revealing characteristic ochronotic pigmentation intraoperatively.<h4>Discussion</h4>Cardiovascular involvement in alkaptonuria, although rare, can cause sever valvular and coronary artery disease. Early recognition through biochemical testing and imaging is essential. Early-onset valvular disease should raise suspicion of underlying systemic disorders such as alkaptonuria.<h4>Take-home messages</h4>Alkaptonuria, although primarily known for musculoskeletal and connective tissue involvement, can lead to significant cardiovascular complications. Routine screening with echocardiography and computed tomography coronary angiography should be considered in patients with alkaptonuria to detect early valvular and coronary artery disease in order to ensure timely intervention.

Also flagged:trabecular tumor of the thyroidtrabecular tumortumormembranechromatintumors
Journal Article 2025-10-01 No Snippets Hu DJ, Luo YL, Zhao YW, Xie YX, Su XL, Sun KY, Liu ZY.
Show Full Abstract

<b>Objective:</b> To analyze the cytological, histological, immunohistochemical, and molecular pathological features of hyalinizing trabecular tumor (HTT). <b>Methods:</b> Clinical and pathological data of the HTT cases diagnosed at Shanghai Sixth People's Hospital affiliated to Shanghai Jiao Tong University School of Medicine between 2020 and 2024 were collected and analyzed. HE staining, special staining, immunohistochemical staining, and next-generation sequencing were performed on all cases. <b>Results:</b> Among the 10 HTT patients, 4 were male and 6 were female. The age at onset ranged from 29 to 85 years, with a median age of 49 (35,61) years. The maximum tumor diameter ranged from 0.3 to 5.3 cm. Cytologically, the smears were hypercellular and showed tumor cells arranged in nested clusters with visible basement membrane-like material. The nuclei were oval with finely granular chromatin, and nuclear pseudoinclusions were readily identifiable. Histologically, the tumors were well demarcated. The tumor cells were arranged in a paraganglioma-like pattern, exhibiting typical nuclear features of papillary thyroid carcinoma and psammoma bodies. Yellow bodies were observed in the cytoplasm. The stroma was rich in hyalinized material, which was periodic acid-Schiff stain (PAS)-positive. Immunohistochemically, the tumor cells showed diffuse expression of TTF-1 and focal expression of thyroglobulin. Aberrant immunoreaction with Ki-67 was present in the cytoplasm and membrane of the tumor cells. Molecular testing was performed on 8 cases. The PAX8-GLIS3 gene fusion was detected in 7 cases. Among these fusion-positive cases, 4 exhibited additional genetic abnormalities: one concurrent TSHR point mutation (p.D617H); one concurrent HRAS point mutation (p.Q61R); one concurrent LRP1B point mutation (p.S1752L), SUGCT point mutation (p.K137), and TERT point mutation (p.P785L); one concurrent MTOR mutation (7528+27A>T) and FLT3 mutation (p.E77K). The key initiating factors for thyroid carcinoma, including the BRAF V600E mutation and RET rearrangements, were absent in all cases tested. <b>Conclusions:</b> Cellular pleomorphism, yellow bodies and basement membrane-like material constitute important cytological and histological features for the differential diagnosis of HTT. Immunophenotypically, thyroglobulin may show focal expression, while Ki-67 is typically localized in the tumor cell membrane and cytoplasm. This study also demonstrates that PAX8-GLIS3 fusion is a characteristic molecular abnormality in HTT, although cases with wild type of GLIS gene may also present. Although rare, HTT may harbor point mutations in HRAS and TSHR, and other uncommon genetic alterations.

Also flagged:fatty acidmonounsaturatedpolyunsaturatedPalmitic acidcarbonssynthesis
Journal Article 2025-10-01 No Snippets Batista D, Macedo GA, Luccas V, Macedo JA.
Show Full Abstract

This study aimed to evaluate the fatty acid (FA) composition of Brazilian refined peanut oil (RPO) and the effect of enzymatic interesterification on its regiodistribution, aiming the production of lipids with lower digestibility and, consequently, lower caloric value, in line with current consumption trends focused on health. The composition and distribution of FAs in the sn-2 position of triacylglycerols (TAGs) were analyzed by GC-MS and TLC/GC-MS, respectively. Acidity was determined by titration, and TAG content was analyzed by HPSEC. Interesterification was performed using TL-IM lipase, and the modified oil (CP-10) was compared to the native oil (RPO) in terms of acidity, TAG content, and distribution of FAs at the sn-2 position. The FA composition of RPO was 16.98% saturated (SFA), 75.78% monounsaturated (MUFA), and 7.25% polyunsaturated (PUFA); the acidity was 0.03% and the TAG content was 99.69%. At the sn-2 position, the FAs were 17.80% SFA, 74.81% MUFA, and 7.39% PUFA. After modification, CP-10 presented an acidity of 3.05%, a TAG content of 95.19%, and a sn-2 distribution of 34.67% SFA, 58.40% MUFA, and 7.93% PUFA. Palmitic acid at the sn-2 position increased by 65%, and SFA with 20 or more carbons increased by 88%. These structural modifications resulted in a 10.6% reduction in the in vitro digestibility, compared to RPO. The results suggest that enzymatic interesterification may be an effective method for modifying peanut oil, allowing the synthesis of lipids with reduced caloric content and thereby improving its nutritional value, which is relevant for the development of healthier foods.

Also flagged:nitrogenphosphorusmalnutritionfertilizationnitrogen fixationnucleotides
Journal Article 2025-10-01 No Snippets Kanonge G, Chiduwa MS, Muchaonyerwa P.
Show Full Abstract

Soil phosphorus deficiency and the high cost of mineral fertilizers necessitate research into alternative strategies. Inoculating seeds with adapted phosphorus-solubilizing microorganisms (PSMs) could be a cost-effective option. This study explored diversity, including phenotypic and genotypic characteristics of PSMs from selected soils and cropping systems of Zimbabwe, for coapplication with rock phosphate (RP). Culturable PSMs were isolated from preincubated or cowpea rhizosphere soil. Over 91% of the 37 isolates (PSM1-PSM37) were bacteria, while 8% were fungi. Diversity was higher in Dorowa (H' 2.99; DMn 8.49) than that in Marondera (H' 2.85; DMn 7.57), and under groundnut and maize (H' 3.26) than other crops. Some PSMs occurred only in Marondera (8%) and Dorowa (14%). The P solubilization index on RP-amended Pikovskaya medium, ranged between 1.00 and 15.9. Sixty-five percent of the best 28 isolates were Gram-negative cocci or bacilli, while 35% were Gram-positive cocci. A dendrogram based on morphological, biochemical, and functional characterization grouped the isolates into two major clusters and four subgroups. On the basis of 16S recombinant DNA analyses, the Bacillus genus predominated (61%), with the highest P solubilization capacity (Bacillus amyloliquefaciens), while the rest (39%) were Enterobacter, Microbacterium, Paenibacillus, Klebsiella, Priestia, Acinetobacter, Nocardioides, and Kocuria genera. In conclusion, studied soils harbor diverse PSMs that solubilize RP, indicating their potential to develop affordable bioinoculants for improved productivity on P-limited soils. The study pioneers the discovery of diverse PSMs native to Zimbabwean soils. Further studies are required to evaluate PSM-RP efficacy with various crops under glasshouse and field conditions and benchmark with conventional fertilizers.

PEBP1
Also flagged:apolipoprotein EAPOEAlzheimer's diseaseADAD dementiametabolism
Journal Article 2025-10-01 ✓ 3 Snippets Vromen EM, Lageman SB, Gobom J, van der Kant R, Dobricic V, Bertram L, Streffer J, Lovestone S, Vos SJB, Tainta M, Freund-Levi Y, Frölich L, Popp J, Peyratout G, Tsolaki M, Verhey F, Vandenberghe R, Schaeverbeke J, Blennow K, van der Lee SJ, Scheltens P, Pijnenburg YAL, van der Flier WM, Teunissen CE, Zetterberg H, Visser PJ, Tijms B.
In-Text Gene Mentions

…proteins (LDHB, GOT1,PEBP1, TPI1, GMFB) were…

…these proteins (ENO1,PEBP1, LDHB, TPI1) were…

…(PKM, LDHB, GOT1,PEBP1, GMFB, MDH1) that…

Show Full Abstract

<h4>Background</h4>The apolipoprotein E (APOE) gene includes the strongest protective (ε2) and risk (ε4) variants for sporadic Alzheimer's disease (AD), but underlying mechanisms remain unclear. We studied APOE genotype effects on the cerebrospinal fluid (CSF) proteome.<h4>Methods</h4>Using untargeted tandem mass tag mass spectrometry, we analyzed CSF from 227 cognitively normal (CN) controls (A-T-), 165 CN A+, and 177 individuals with mild cognitive impairment (MCI A+) from two large cohorts. We compared protein levels across APOE genotypes using linear regression and characterized biological pathways.<h4>Results</h4>Five hundred forty-nine of 978 proteins (56%) differed between ε2/ε3 (n = 32 individuals) or ε4 carriers (n = 181 individuals) and ε3/ε3 controls. ε2/ε3 controls showed the most differences, with higher levels of 280 proteins enriched for neuronal plasticity. ε4 carrier controls showed increased proteins linked to blood-brain barrier dysfunction, and A+ ε4 carriers were related to glucose metabolism.<h4>Discussion</h4>Combining two cohorts enabled analysis of the rare APOE ε2 genotype, suggesting protective effects may occur through improved neuronal plasticity.<h4>Highlights</h4>Apolipoprotein E (APOE) genotypes show distinct cerebrospinal fluid proteomic mechanisms in early Alzheimer's disease (AD). Combining cohorts enabled analysis of rare APOE ε2-associated protection in AD. The rare ε2 genotype may confer protection through improved neuronal plasticity. APOE ε4 carriers show increased blood-brain barrier dysfunction and glucose metabolism. These findings offer new insights into genotype-specific mechanisms in early AD.

BTN2A1
Also flagged:autoimmune hepatitischronic inflammatory disorderimmune responsebutyrophilin subfamily 2localizationhuman leukocyte antigen E
Journal Article 2025-10-01 ✓ 5 Snippets Li C, Liu T, Zhou L, Chen J, Wei Z, Li J.
In-Text Gene Mentions

…2 member A1 (BTN2A1), human leukocyte…

…plasma concentrations ofBTN2A1and HLA-E were…

…risk of AIH (BTN2A1: odds ratio [OR]…

…indicated that AGER,BTN2A1, BTN3A2 , and…

…_P = .491;BTN2A1to AIH: r…

Show Full Abstract

Autoimmune hepatitis (AIH) is a chronic inflammatory disorder caused by an aberrant immune response directed against liver tissues. However, current treatments for AIH are insufficient in preventing disease progression, managing relapses, and minimizing adverse effects. Therefore, new treatments are urgently needed to improve the management of AIH. Protein quantitative trait loci data for 2940 plasma proteins were obtained from the UK Biobank Pharma Proteomics Project. Genetic association data for AIH were obtained from the FinnGen Consortium (including 264 AIH patients and 3,72,273 healthy controls) and from the study by Sakaue et al (including 821 AIH cases and 4,84,422 controls) and were considered as the discovery and validation sets, respectively. Summary-based Mendelian randomization and colocalization analyses were undertaken to pinpoint target proteins and to reveal the shared drivers between plasma proteins and AIH, respectively. In addition, we performed enrichment analysis, protein-protein interaction analysis, and drug availability analysis of AIH-related proteins to further explore the genetic mechanisms of AIH susceptibility and the potential of proteins as drug targets. Four plasma proteins, namely advanced glycosylation end product-specific receptor, butyrophilin subfamily 2 member A1, butyrophilin subfamily 3 member A2, and human leukocyte antigen E, were found to be significant in both the discovery set and validation sets, and their association with AIH was supported by both co-localization and sensitivity analyses. Phenome-wide association study analysis assessed the side effect profile of the 4 identified proteins; enrichment analysis and protein-protein interaction network showed that these proteins affected the occurrence of AIH by regulating immune response. Drug formation analysis suggested that advanced glycosylation end product-specific receptor and human leukocyte antigen E had the potential to be drug targets. This study highlights the important role of 4 plasma proteins in AIH risk. Further study of these proteins may reveal their potential in the prevention and treatment of AIH.

HFE
Also flagged:hepatocellular carcinomacancerhepatitis C virus infectionsalcoholnonalcoholic fatty liver diseaseNAFLD
Journal Article 2025-10-01 ✓ 1 Snippet Wang J, Shen T, Shen T, Wang S.
In-Text Gene Mentions

…radical diseases, includinghemochromatosis, can induce the…

Show Full Abstract

Hepatocellular carcinoma (HCC), as a cancer with high morbidity and mortality, urgently requires the development of a clinical prediction model with high robustness and generalizability and its prognostic study of the tumor microenvironment to provide personalized clinical treatment for patients. Key prognostic genes were screened by analyzing mRNA expression data from GTEx and The Cancer Genome Atlas (TCGA) using limma difference analysis, Cox analysis, and machine learning (ML) algorithms. TCGA database was used as a training set, and the International Cancer Genome Consortium database was used as a test set to screen the best prognostic modeling algorithms using a combination of 101 ML algorithms for training and constructing Nomo score plots based on the algorithmic risk scores as well as Shiny online prediction models. Based on shapley additive explanations analysis, drug sensitivity analysis, and immune infiltration analysis were performed on the 6 genes screened to visualize the importance of prognostic genes. HCC tumor mutation load analysis was also performed. A risk prediction model for HCC death was developed based on the RSF algorithm, with an RSF model C-index of 0.765 and AUC values of 0.978, 0.989, and 0.964 for 1-, 3-, and 5-year ROC curves for the Nomo score model, respectively. LPL, RAET1E, RNASEH2A, GTF2H4, SCML2, and PRDM12 were potential diagnostic and prognostic markers, among which SCML2 and PRDM12 were significantly correlated with multiple drugs in drug sensitivity analysis.TP53 mutations were correlated with patients' age, chronological age, gender, histological tumor stage, T stage, and lymph node metastasis. An online HCC mortality risk prediction model was developed using the RSF algorithm. LPL, RAET1E, RNASEH2A, GTF2H4, SCML2, and PRDM12 are potential prognostic target genes, whereas TP53 mutations are associated with clinical features that may inform the development of HCC therapy.

SHISA6
Also flagged:nucleustumoursepilepsygangliogliomasgangliogliomaBRAF V600E
Journal Article 2025-10-01 ✓ 1 Snippet Cases-Cunillera S, Müller P, van Waardenberg AJ, Schoch S, Huberfeld G, Höllig A, Delev D, Hamed M, Becker AJ, van Loo KMJ.
In-Text Gene Mentions

…, NPTXR orSHISA6, were among…

Show Full Abstract

Gangliogliomas are glioneuronal neoplasms, generally with a benign evolution, accounting for the most common tumours in patients with long-term pharmacoresistant epilepsy. <i>BRAF<sup>V</sup></i> <sup>600<i>E</i></sup> has been detected in a high percentage of World Health Organization grade 1 gangliogliomas. However, biopsy collections from epilepsy patients include tumours that meet neuropathological ganglioglioma criteria but lack the <i>BRAF<sup>V</sup></i> <sup>600<i>E</i></sup> mutation. The molecular pathology of such BRAF<sup>V600E</sup>-negative gangliogliomas remains largely unexplored. We here focused on decoding the molecular and cellular profiles of these BRAF<sup>V600E</sup>-negative gangliogliomas at the single-cell resolution. Our results identify an exclusive profile in excitatory, but not inhibitory, neurons, astrocytes and oligodendrocytes in BRAF<sup>V600E</sup>-negative gangliogliomas. Moreover, we confirm the presence of immature excitatory neurons with higher expression of genes related to glutamatergic transmission as well as metabolically active astro- and oligodendrocytes which may contribute to epileptogenicity. Our study provides important resources to understand the molecular profile of BRAF<sup>V600E</sup>-negative gangliogliomas aiming to drive forward future research directions to novel and tailored treatment options for epilepsy.

HFE
Also flagged:cancergenetic diseasehereditary cancerfamilial hypercholesterolemiabreast cancerdeath
Journal Article 2025-10-01 ✓ 1 Snippet Gilmore MJ, Frawley HE, Shuster E, Bulkley JE, Muessig KR, Wilfond BS, Leo MC, Hunter JE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Genetic testing for cancer predisposition and other actionable findings aims to improve health outcomes by informing patients and practitioners about genetic disease risks and guiding decisions on risk-reducing actions. This study explored patient-initiated lifestyle changes following genetic testing in a study population who predominantly screened positive on a hereditary risk assessment cancer tool prior to genetic testing, with a large proportion of individuals from marginalized groups with historically limited access to genetic services. A survey was administered to 761 study participants 6 months after result disclosure to capture initiation of lifestyle changes (diet, exercise, smoking cessation). Initiation of changes was assessed for association with patient-specific factors. Five hundred and fifty-six individuals completed surveys; 75% met criteria for belonging to a marginalized group. Among respondents, 20.5% reported at least one lifestyle change; primarily in diet (17.1%) and exercise (13.7%). Making a lifestyle change was associated with having a personal cancer history and higher perceived personal utility but not genetic finding, being a member of a marginalized group, or gender. Most participants with a personal cancer history did not receive a positive finding in a cancer risk gene, potentially motivating them to make lifestyle changes compared with participants without a personal cancer history.

Also flagged:metabolic disordersgenetic disorderscardiomyopathiesconnective tissue disordersretinal dystrophiesimmunodeficiencies
Journal Article 2025-10-01 No Snippets Brancato D, Treccarichi S, Bruno F, Coniglio E, Vinci M, Saccone S, Calì F, Federico C.
Show Full Abstract

Next-Generation Sequencing (NGS) techniques have become a cornerstone of molecular diagnostics, enabling high-throughput, parallel analysis of multiple disease-associated genes. Their targeted design allows streamlined interpretation and optimised diagnostic yield, especially in disorders with known genetic heterogeneity. In this review, we provide a comprehensive overview of the clinical application of NGS techniques-targeted gene panels, whole exome sequencing (WES) and whole genome sequencing (WGS)-detailing the methodological workflow and the critical steps involved in their implementation. Particular emphasis is placed on the genes identified through NGS that are implicated in neurodevelopmental, neurodegenerative, psychiatric, neuromuscular, cardiovascular, and metabolic disorders. We also compare the advantages and limitations of panel-based diagnostics versus WES and WGS, and discuss future directions, including the integration of long-read sequencing technologies into multidisciplinary clinical practice. Finally, we consider how these advances may ultimately bridge biomedical research and clinical practise to improve the diagnosis and management of multifactorial diseases.

ABT1
Also flagged:sleeppathogenesisasthmaTBX6YPEL3ailment
Journal Article 2025-10-01 ✓ 4 Snippets Fu C, Xu W, Zhang Y.
In-Text Gene Mentions

…shared causal genes—TBX6,ABT1, and YPEL3—with directionally…

…these—BTN3A2, MST1R, RBM6,ABT1, TBX6, and YPEL3—exhibited…

…genes, namely TBX6,ABT1, and YPEL3, exerted…

…causal influence, TBX6,ABT1, and YPEL3 were…

Show Full Abstract

<h4>Objectives</h4>This study employs a dual-pronged approach, integrating retrospective cohort analysis with genetic methodologies, to elucidate the causal role of nightly short sleep in the pathogenesis of asthma and to unravel its underpinning biological mechanisms.<h4>Methods</h4>This study employed a dual-evidence framework for a comprehensive analysis. The retrospective cohort component utilized data from 6770 participants in the China Health and Retirement Longitudinal Study (CHARLS) to assess the dose-response relationship and risk thresholds for asthma incidence via multivariable logistic regression, restricted cubic splines, and segmented regression models. The genetic analysis component integrated large-scale Genome-Wide Association Studies (GWAS) data for nightly short sleep from the UK Biobank and for asthma from the FinnGen biobank. A suite of methodologies, including Linkage Disequilibrium Score Regression (LDSC), High-Definition Likelihood (HDL), Pleiotropic Analysis under Composite Null Hypothesis, (PLACO), Colocalization (COLOC), and Summary-data-based Mendelian Randomization (SMR), was employed to evaluate genetic correlations and identify shared loci. To infer causality, this study applied a battery of advanced, robust MR models-including Mendelian Randomization-Clustering (MR-Clust), Maximum Likelihood Mendelian Randomization (MRcML), Contamination Mixture (ConMix), and CAUSE-to systematically correct for and evaluate the influence of horizontal pleiotropy.<h4>Results</h4>The cohort regression analysis revealed that increased sleep duration confers a significant protective effect against asthma (Model 3: OR = 0.83, 95% CI 0.75-0.92). A pronounced dose-response trend was observed (P for trend < 0.0004), wherein longer sleep corresponded to lower risk. Further analysis with restricted cubic splines confirmed a U-shaped, nonlinear relationship, identifying a risk inflection point at 7.5 h of sleep. Subgroup analyses indicated that this protective effect was robust across diverse age, gender, and lifestyle strata, with no significant interaction effects detected (all P-interaction > 0.05). At the genetic level, a significant positive genetic correlation was established between nightly short sleep and asthma (LDSC rg = 0.257; HDL rg = 0.247, with p < 0.001 for both). Colocalization analysis identified three shared causal loci (rs6939576, rs13107325, and rs205024) with distinct protein-altering and regulatory functions. Subsequent SMR analysis identified three shared causal genes-TBX6, ABT1, and YPEL3-with directionally consistent effects. Consistent evidence from multiple analytical models-including MR-cML (β = 0.927, p = 0.0009), ConMix (β = 1.585, p = 0.0006), and CAUSE (favoring the causal model, ΔELPD = -3.3; causal effect γ = 0.54)-supports the conclusion that genetically predicted nightly short sleep is a causal factor for an increased risk of asthma.<h4>Conclusion</h4>This research provides compelling evidence substantiating nightly short sleep as a causal risk factor for asthma, with genetically predicted nightly short sleep significantly elevating disease risk.

TNFSF4
Also flagged:calciumgastric cancerNPTP53RETlymph node metastatic gastric cancer
Journal Article 2025-10-01 ✓ 1 Snippet Cai M, Nie X, Cai F, Yang X, Sun W, Zhang R, Liang H, Yang Y, Zhang L.
In-Text Gene Mentions

…THFRSF4, TNFSF18, andTNFSF4) was significantly higher…

Show Full Abstract

<h4>Background</h4>Lymph node (LN) status is crucial for assessing the treatment effectiveness and potential for cure in early gastric cancer (GC; T1-T2), whether treated through endoscopy or surgery. The purpose of this study was to identify biomarkers related to calcium signaling pathway in T1 and T2 lymph node metastatic gastric cancer and explore potential regulatory mechanisms.<h4>Methods</h4>All data applied in this study were obtained from public databases. Biomarkers were identified through univariate Cox regression analysis and survival analysis. Subsequently, enrichment analysis, somatic mutation analysis, immune microenvironment analysis, drug sensitivity analysis, and single cell analysis were used to investigate the functional mechanisms. Finally, clinical sample validation was performed.<h4>Results</h4>RET was identified as a biomarker through selection. Enrichment analysis indicated that 36 significantly different pathways between the NP (LN-positive samples (N1, N2, N3)) and NO (LN-negative samples (N0)) groups. A total of 2 oncogenic pathways showed significant differences between the NP and NO groups. The scores of 14 immune cell types showed significant differences, including mast cells. RET exhibited the strongest correlation with mast cells. The ESTIMATE score, stromal score, and immune score were significantly elevated in the NP group. Additionally, the NP group showed significantly higher expression of 13 immune checkpoint genes. TP53 had the highest mutation rate in both the NP and NO groups. There was a significant difference in the sensitivity to 15 chemotherapy drugs between the NP and NO groups. Additionally, RET was expressed in multiple cell types, including fibroblasts and mast cells. In both the TCGA-GC-LN and GSE84433 datasets, RET was significantly upregulated in the NP group. The RT-qPCR results of clinical samples also indicated a significant upregulation of RET in the NP group.<h4>Conclusion</h4>RET laid the foundation for targeted therapy in the treatment of T1 and T2 lymph node metastatic gastric cancer.

BTN2A2
Also flagged:lung cancergene expressionZKSCAN4cancerscanceralcohol
Journal Article 2025-10-01 ✓ 5 Snippets Zhao T, Shi J, Yang Y, Zhou D, Ping J, Xu S, Xu L, Wu J, Shu XO, Tao R, Li B, Zheng W, Long J, Cai Q.
In-Text Gene Mentions

…joint‐tissue model), andBTN2A2( p =…

…, FRS3 ,BTN2A2) for SCC.…

…Meanwhile, the geneBTN2A2encodes butyrophilin subfamily…

…gene BTN2A2 encodesbutyrophilin subfamily 2 member A2subfamily 2 member…

BTN2A2may inhibit T‐cell…

Show Full Abstract

<h4>Background</h4>Genome-wide association studies (GWAS) have identified over 80 susceptibility loci for lung cancer risk. However, the genes underlying these associations remain largely unknown.<h4>Methods</h4>We conducted a large transcriptome-wide association study (TWAS) to identify lung cancer susceptibility genes. We leveraged gene expression data from lungs and 48 other tissue types and whole-genome sequencing data from up to 706 samples of European ancestry in the GTEx (version 8) to build lung-tissue and joint-tissue gene expression prediction models. These models were applied to GWAS data, including 29,266 lung cancer cases and 56,450 controls, to assess the associations of genetically predicted gene expression levels with lung cancer risk.<h4>Results</h4>A total of 8624 genes were successfully built for single-tissue models, and 11,341 genes for joint-tissue models (12,133 unique genes altogether). Among 40 genes whose expression levels were associated with the risk of lung cancer at a Bonferroni-corrected significance level, ZKSCAN4 was located more than 2 Mb away from the GWAS-identified variants linked to lung cancer. Among the remaining 39 genes within 2 Mb of GWAS-identified variants, seven genes were independent of these. Among 53 genes associated with the risk of lung cancer subtypes, 13 genes were beyond 2 Mb of GWAS-identified variants, and four genes were independent of the GWAS-identified variants within 2 Mb regions.<h4>Conclusion</h4>Our TWAS identified over 50 candidate susceptibility genes for lung cancer, providing new insights into lung cancer genetics.

Also flagged:homeobox transcription factorMNX1MNPancreas Homeobox 1ISL1LHX3
Journal Article 2025-10-01 No Snippets Sun MA, Fan H, Ralls S, Wu W, Demmerle J, Jiang J, Jin J, Miller CJ, Wolf G, Macfarlan TS.
Show Full Abstract

Motor neurons (MNs) control muscle movement and are essential for breathing, walking and fine motor skills. MN and Pancreas Homeobox 1 (MNX1) has long been recognized as a key marker of the MN lineage, and its deficiency in mice results in early postnatal lethality-likely by causing abnormal MN development and respiratory malfunction. However, its genome-wide targets and regulatory mechanism remain unresolved. Using an in vitro model for efficient MN induction, we identified ∼6000 MNX1-bound loci, of which half are conserved enhancers frequently overlap peaks for core MN-inducing factors ISL1 and LHX3. Despite its widespread binding, Mnx1 knockout affects only a few dozen bound loci and causes mis-regulation of ∼100 genes, the majority are up-regulated neuronal genes which routinely have comparable or even higher expression in brain relative to MNs. Integrative analysis predicts Pbx3 and Pou6f2 as two putative direct targets-both are homeobox genes highly expressed in the central nervous system, and adjacent to MNX1-repressed enhancers according to luciferase reporter assay. Collectively, our results suggest MNX1 restrains the expression of non-MN-specific neuronal genes, likely mainly through an indirect fashion. Further, the rarity of direct targets in contrast to widespread binding reflects a distinctive mode of transcriptional regulation.

SUDS3
Also flagged:starchbiosynthesispollen developmentstamen developmenturidine diphosphate sugarspollen wall
Journal Article 2025-10-01 ✓ 1 Snippet Robinson J.
In-Text Gene Mentions

…epigenetic mechanism involvingpolycomb repressiverepressive complexes by…

Show Full Abstract

No abstract available.

SOX6
Also flagged:IL-19YAP1chronic degenerative diseasesInterleukin19inflammatory responsesIL-1β
Journal Article 2025-10-01 ✓ 1 Snippet Deng J, Gu J, Gong X, Tang H, Cai Y, Yang Y, Dong S, Zhao C.
In-Text Gene Mentions

…ifferentiation; it upregulatesSox6expression by binding…

Show Full Abstract

<h4>Introduction</h4>Osteoarthritis (OA) is one of the most prevalent chronic degenerative diseases, characterized by the progressive destruction of joints, which is primarily evidenced by alterations in the phenotype of chondrocytes, chondrocyte apoptosis, and the progressive fibrosis of cartilage. Interleukin19 (IL-19) is predominantly expressed and secreted by B cells, monocytes, and macrophages. Recent studies have demonstrated that IL-19 attenuated inflammatory responses and facilitated tissue repair. However, no reported studies have explored the effects of IL-19 on osteoarthritis.<h4>Method</h4>We established an Interleukin 1β (IL-1β)-induced inflammation model and an anterior cruciate ligament transection (ACLT)-induced osteoarthritis model to validate the anti-inflammatory, anti-apoptotic, and osteoarthritis-delaying effects of IL-19.<h4>Results</h4>This study found an elevated expression of IL-19 in the joints of OA mice and confirmed that the IL-19 in these joints primarily derives from synovial M2 macrophages. Additionally, we found that IL-19 mitigates IL-1β-induced osteoarthritis by inhibiting the Hippo signaling pathway and the phosphorylation of the YAP1 (Yes-associated protein 1) protein.<h4>Conclusion</h4>IL-19 represses the inflammatory response and apoptosis of IL-1βw-induced chondrocytes, thereby helping to delay the progression of osteoarthritis.

Update on Genetic Chorea.

HTT
Also flagged:Hereditary choreaschoreacognitionHuntington's diseaseneuroacanthocytosis syndromesbenign hereditary chorea
Journal Article 2025-10-01 ✓ 1 Snippet Pérez-Pérez J, Olmedo-Saura G, Martínez-Horta S, Bernal S, Pagonabarraga J, Kulisevsky J.
In-Text Gene Mentions

…1 of theHTTgene with an…

Show Full Abstract

Hereditary choreas are a clinically and genetically heterogeneous group of monogenic disorders in which chorea constitutes the core or an early-dominant feature. These conditions result from various genetic mutations affecting the structures and pathways involved in movement control, primarily the caudate and putamen, ultimately impairing the basal ganglia circuits involved in the regulation of movement, cognition, and behavior. This review focuses on the main forms of hereditary choreas, including Huntington's disease, neuroacanthocytosis syndromes, Huntington's disease phenocopies, benign hereditary chorea, and other less common genetic disorders presenting with chorea. We discuss the clinical, genetic, and pathophysiological features of each condition, alongside key aspects of phenomenology, examination, and complementary tests-including laboratory findings-to guide phenotype-driven genetic testing. We detail the characteristic features of key disorders while also highlighting less common but emerging conditions. This review aims to assist neurologists in recognizing and diagnosing hereditary choreas efficiently, including guidance on the selection of appropriate genetic tests, thereby reducing diagnostic delays, informing accurate counseling, and facilitating access to disease-specific interventions and clinical trials.

Also flagged:tumorbreast cancerBRCAskin cutaneous melanomacancerdepression
Journal Article 2025-10-01 No Snippets Xue J, Xu Y, Li J, Ma S, Fang K.
Show Full Abstract

In biomedical studies, gene-environment (G-E) interactions and imaging-environment (I-E) interactions play an important role in modeling disease outcomes. Substantial investigations have been made; however, there is still a lack of related studies exploring flexible nonparametric statistical methods for modeling ordinal responses, such as the tumor pathological stage. In this paper, we develop a neural network-based method for modeling ordinal responses with interaction analysis. A novel definition of the output function for the neural network is derived to predict ordinal categories. To facilitate variable selection, we employ a sparse layer within the proposed neural networks. The penalized estimation is obtained using the local quadratic approximation (LQA) algorithm. Extensive simulation studies demonstrate that the proposed method achieves competitive performance in both prediction and variable selection. We further apply our method to breast cancer (BRCA) and skin cutaneous melanoma (SKCM) datasets, examining tumor stage prediction based on G-E and I-E interaction analyses, respectively. The proposed method identifies relevant main effects and interactions, providing insights into the underlying biological mechanisms.

ZNFX1
Also flagged:interferonE3 ligaselysinehydroxylsubiquitin
Journal Article 2025-10-01 ✓ 3 Snippets Horner SM.
In-Text Gene Mentions

…plit-site ubiquitination givesZNFX1new power in…

…mechanism by whichZNFX1, an interferon-stimulated gen…

…This activity enablesZNFX1to compact pathogenic…

Show Full Abstract

Recent work by Grabarczyk et al.<sup>1</sup> uncovers the molecular mechanism by which ZNFX1, an interferon-stimulated gene, employs a novel split-site E3 ligase domain structure to ubiquitinate both protein lysine residues and RNA 2' hydroxyls. This activity enables ZNFX1 to compact pathogenic RNA into dense, ubiquitin-coated particles, revealing a new modality for interferon-induced antiviral defense.

TRIM38
Also flagged:Retinoic acid-inducible gene-IRIG-IRNA sensorsvirus infectionsvirus infectionhost cell
Journal Article 2025-10-01 ✓ 1 Snippet van Huizen M, Gack MU.
In-Text Gene Mentions

TRIM38

Show Full Abstract

Retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) are crucial cytosolic RNA sensors in the innate immune defense against virus infections. RLRs recognize defined molecular features in viral RNAs; however, virus infection can also trigger sensing of host-derived RNAs due to disturbances in host cell RNA processing, localization, or protein interactome. The activity and stability of RLRs are tightly controlled by various host proteins and post-translational modifications (PTMs), enabling protective antiviral immune responses when needed while preventing aberrant RLR activation. Recent studies revealed that metabolic reprogramming during virus infection regulates RLR signaling, while RLR responses, in turn, influence host metabolism. Furthermore, increasing evidence suggests that RLRs and various host cell processes are interregulated. In this review, we discuss the specific features of RLR ligands and how RLR signaling is regulated by host factors and PTMs. We also highlight how RLR signaling is integrated with other cellular processes, including metabolism, cytoskeleton dynamics, and autophagy.

Also flagged:post‐translational modificationscell adhesionsignal transductionglucosecatabolismhexosamine
Journal Article 2025-10-01 No Snippets Yu H, Chen X, Yang Y, Gu M, Ren K, Wei Z.
Show Full Abstract

Glycosylation is a highly dynamic and complex post-translational modification that plays a pivotal role in regulating protein folding, trafficking, stability, and function. Accumulating evidence indicates that aberrant glycosylation is intimately involved in the pathogenesis of multiple neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS). This review provides a comprehensive overview of the molecular mechanisms by which the two predominant forms of glycosylation, N-glycosylation and O-GlcNAcylation, contribute to protein misfolding, synaptic dysfunction, neuroinflammation, and impaired stress responses in the diseased nervous system. We further explore the diagnostic potential of glycosylation biomarkers and emerging therapeutic strategies targeting glycosylation pathways. Special emphasis has been placed on recent advances in glycomic technologies, artificial intelligence-driven analytics, and nanocarrier-based drug delivery platforms. By integrating mechanistic insights with translational applications, this review highlights glycosylation as both a pathological driver and a promising therapeutic target in neurodegenerative disorders.

Also flagged:Ulcerative colitiscolorectal cancercolitis-associated colorectal cancersporadicprimary sclerosing cholangitiscancer
Journal Article 2025-10-01 No Snippets Catalano M, Mini E, Nobili S, Vascotto IA, Ravizza D, Amorosi A, Tonelli F, Roviello F, Roviello G, Nesi G.
Show Full Abstract

Ulcerative colitis (UC) is associated with an increased risk of developing colitis-associated colorectal cancer (caCRC), a major complication of long-standing disease. In this review, we examined the pathogenic association between UC and caCRC, highlighting the risk factors, molecular mechanisms, and current strategies for prevention and management. Compared to sporadic colorectal cancer, caCRC tends to occur at a younger age and is more frequently characterized by mucinous or signet-ring cell histology, proximal colonic involvement, and a higher incidence of synchronous lesions. The risk of caCRC increases 8-10 years after UC diagnosis and is influenced by disease duration, extent of colonic involvement, inflammatory burden, family history of colorectal cancer, and coexisting primary sclerosing cholangitis. The inflammation-to-cancer progression follows a multistep pathway of genetic alterations, advancing from low-grade to high-grade dysplasia, and ultimately to carcinoma. While chemopreventive agents such as 5-aminosalicylates may offer some benefit, surveillance colonoscopy remains the primary strategy for risk reduction. Early detection and individualized prevention strategies are critical for improving long-term outcomes in patients with UC.

Also flagged:CoumarincancerDoxorubicincisplatinIL-6secretion
Journal Article 2025-10-01 No Snippets Szwaczko K, Strzyga-Łach P, Struga M, Kiernozek-Kalińska E, Szafrański K, Skiba A, Płazińska A, Skalicka-Woźniak K, Bielenica A.
Show Full Abstract

Menthol-modified coumarin esters (<b>1a</b>-<b>e</b>) and 3-phosphorylated coumarins (<b>2a</b>, <b>2b</b>, <b>3</b>) were synthesized. The Michael addition of P-(O)H groups to the coumarin skeleton offered access to 3,4-dihydrocoumarin derivatives (<b>4a</b>-<b>4d</b>, <b>5a</b>-<b>5b</b>). The addition reaction proceeded with high yields (89-98%) in a short time under mild temperature conditions and environmentally friendly solvents such as CH<sub>3</sub>CN or water. The resulting compounds (<b>1a</b>-<b>1f</b>, <b>2a</b>, <b>2b</b>, <b>3</b>, <b>4a</b>-<b>4d</b>, <b>5a</b>-<b>5b</b>) were subjected to <i>in vitro</i> cytotoxicity evaluation against human cancer cell lines: colorectal (SW480, SW620), prostate (PC3), breast (MDA-MB-231), and human keratinocytes (HaCaT) by MTT assay. Doxorubicin and cisplatin were used as reference compounds. Based on the findings, the three most promising compounds (<b>2b</b>, <b>4a</b>, <b>4b</b>) were selected for further biological studies, which included evaluation of their ability to induce apoptosis, inhibit IL-6 secretion, and antiproliferative activity. Compounds such as <b>4a</b> and <b>4b</b> were tested as diastereomeric mixtures due to the limited possibility of separating them into individual isomers at this stage. Nevertheless, promising activity and selectivity against selected cancer cell lines were observed. The <i>in vivo</i> toxicological evaluation performed on zebrafish larvae indicated that coumarin <b>2b</b> did not present toxic effects. In addition, the prediction of physicochemical properties, ADME, and pharmacokinetic profiles was performed by <i>in silico</i> methods. The results indicate the significant potential of the selected compounds as candidates for further research toward the design of new bioactive compounds.

Also flagged:gene expressionbehaviouralEpigeneticdosage compensationgenomic imprintinghistone
Journal Article 2025-10-01 No Snippets Assis SG, Tavares PH, Oliveira N, Serpeloni F, Avanci JQ.
Show Full Abstract

<h4>Introduction</h4>While several studies have examined the relationship between adverse social exposures and epigenetic mechanisms, the association between DNA methylation, resilience, protective factors and factors that promote positive outcomes remains underexplored.<h4>Goals</h4>This study aims to analyse scientific publications on epigenetics, specifically focusing on DNA methylation in relation to resilience and individual/social protective/positive factors.<h4>Method</h4>A scoping review was conducted using the descriptors DNA methylation, resilience, self-esteem, emotional regulation, social support and social and emotional functioning, covering the years 2008-2019. The databases used included Web of Science, PubMed and Embase. The analysis included 110 articles, reviewed for identification and profile, article focus, objectives, epidemiological and epigenetic methods, protective/positive factors and impacts on physical and mental health.<h4>Results</h4>There has been a significant, gradual increase in publications over the years, particularly regarding epidemiological studies involving human participants. Most studies utilized a candidate gene approach to assess DNA methylation, while broader genome-wide methylation profiles were less frequently examined. Histone modifications and noncoding RNAs were also discussed, especially in review articles. Resilience was identified as the most studied topic, with analyses focusing on (1) mental disorders, (2) parental mental health, (3) early life stress, (4) biological age and development, (5) clinical and physiological conditions and (6) environmental/socioeconomic factors. A wide variety of genes associating resilience and epigenetics were pointed out, for example, NR3C1, SLC6A4, BDNF, and FKBP5. Additionally, individual and social bonds and competencies such as social and emotional functioning, maternal care and social interaction among others were grouped as protective factors or that promote positive outcomes and were linked to genes such as OXTR, followed by FKBP5 and NR3C1.<h4>Discussion</h4>The significance of epigenetics in neuroscience and its potential public health applications is still emerging. This field invites reflection on prevention and health promotion strategies and highlights growing evidence that social inequalities, adversities and early-life experiences may have lasting effects on gene expression throughout the lifespan.

MLLT10
Also flagged:cancertumormethylationbreast canceraddictionlactate transporter
Journal Article 2025-10-01 ✓ 1 Snippet Ding R, Shao Z, Yu T.
In-Text Gene Mentions

…in KMT2C andMLLT10( Figure 5A…

Show Full Abstract

<h4>Objective</h4>Large-scale CRISPR screens have identified essential genes across cancer cell lines, but links between tumor functional properties and specific dependencies require investigation to reveal the mechanisms underlying dependencies and broaden understanding of targeted therapy.<h4>Methods</h4>We selected 47 breast cancer cell lines from the Cancer Cell Line Encyclopedia (CCLE) with multi-omics data including gene dependency; somatic mutations; copy number alterations; and transcriptomic, proteomic, metabolomic, and methylation data. We established a dependency marker association (DMA) analytic pipeline by using linear regression modeling to assess associations between 3,874 representative gene dependencies and multi-omics markers. Additionally, we conducted non-negative matrix factorization clustering, to stratify breast cancer cell lines according to gene dependency features, and investigated cluster-specific DMAs.<h4>Results</h4>We interpreted valuable DMAs according to two primary aspects. First, dependencies associated with gain-of-function alterations revealed addiction to lactate transporter SLC16A3, thus suggesting a promising therapeutic target. Second, dependencies associated with loss-of-function alterations included synthetic lethality (SL), collateral SL, and prioritized metabolic SL, encompassing paralog SL (e.g., IMPDH1 and IMPDH2), single pathway SL (e.g., GFPT1 and UAP1), and alternative pathway SL (e.g., GPI and PGD). DMA analysis of the two clusters with divergent dependency signatures demonstrated that cluster1 cell lines exhibited extensive metabolism with mitochondrial protein dependencies, whereas cluster2 displays enhanced cell signaling, and reliance on DNA replication and membrane organelle regulators.<h4>Conclusions</h4>We established a DMA analysis pipeline linking the gene dependencies of breast cancer cell lines to multi-omics characteristics, thus elucidating the underpinnings of tumor dependencies and offering a valuable resource for developing novel precision treatment strategies incorporating relevant markers.

HFE
Also flagged:Pancreatic CancerDiabetic KetoacidosisType 3c Diabetes Mellitusdiabetes mellituschronic pancreatitischronic focal pancreatitis
Journal Article 2025-10-01 ✓ 1 Snippet Ibraheem IM, Askar RS, Aly NA.
In-Text Gene Mentions

…pancreatitis, cystic fibrosis,hemochromatosis, pancreatic cancer (as…

Show Full Abstract

We report the case of a 55-year-old male patient who presented with an acute one-day history of confusion and disorientation of one-day duration. The patient was dehydrated and in hypovolemic shock. After being diagnosed with diabetic ketoacidosis (DKA) (he did not have any prior history of diabetes mellitus, or any previous history of significant abdominal pain) he was transferred to the ICU. Extensive work up was done to diagnose the primary etiology of DKA. An MRI imaging of the abdomen and pelvis showed diffusely swollen pancreas, indicating chronic pancreatitis along with multiple hyper enhancing scattered foci in distal pancreatic body and tail. Endoscopic ultrasound (EUS) was subsequently performed revealing a lesion suggestive of either chronic focal pancreatitis versus pancreatic neoplasm. An EUS-guided fine-needle biopsy (EUS-FNB) was performed for histopathological correlation, which confirmed a final diagnosis of pancreatic adenocarcinoma. The patient's condition was therefore classified as Type 3c diabetes mellitus, secondary to the malignancy. DKA is a common medical presentation, but a thorough workup is essential to identify its underlying etiology. Pancreatic malignancy should be considered as a rare, but critical, underlying cause.

CCPG1
Also flagged:Gastric cancerstomach adenocarcinomaSTADcancerchronic gastropathiesvirus
Journal Article 2025-10-01 ✓ 1 Snippet Kamal E, Omar ZMM, Geddawy A, Omer AAA.
In-Text Gene Mentions

…IG2P-PILRB, VASH1-AS1, DNAAF4-CCPG1, MIRLET7BHG, XIST, GAS5,…

Show Full Abstract

<h4>Background</h4>Stomach adenocarcinoma is a major contributor to worldwide mortality and significantly impacts life expectancy. The main objective of the current study was to identify a prognostic biomarker for stomach adenocarcinoma to advance translational medicine and improve patient outcomes.<h4>Method</h4>various databases (GEPIA, UALCAN, miRNet, StarBase, and Kaplan Meier plotter) bioinformatics tools (cytoscape) and were used in this study.<h4>Results</h4>Ten novel unfavorable prognosis-associated <i>genes</i> were identified. In addition, 41 potential miRNAs were predicted. ELAVL3-hsa-mir-29a-3p and CALCR-hsa-mir-29a-3p were identified as the two critical networks in the oncogenesis of stomach adenocarcinoma via bioinformatics analysis. Subsequently, the binding of lncRNAs to hsa-mir-29a-3p was predicted utilizing the starBase and miRNet databases. Following the execution of both expression and survival analyses for the predicted lncRNAs, it was determined that only one lncRNA, KCNQ1OT1, exhibited significant overexpression in stomach adenocarcinoma, and its elevated expression was associated with an unfavorable prognosis. Subsequently, we constructed a triple ceRNA network involving mRNA, miRNA, and lncRNA, which is associated with the prognosis of stomach adenocarcinoma.<h4>Conclusions</h4>In summary, the current study provides an extensive ceRNA network that highlights novel prognostic biomarkers for stomach adenocarcinoma.

SLC2A14
Also flagged:Pancreatic Cancernucleotidemetabolismcell growthGemcitabinePancreatic ductal adenocarcinoma
Journal Article 2025-10-01 ✓ 1 Snippet Amrutkar M, Li Y, Finstadsveen AV, Verbeke CS, Gladhaug IP.
In-Text Gene Mentions

…CALB2, HDDC2, NT5E,SLC2A14, TPD52L1, and ZDHHC21…

Show Full Abstract

<h4>Background</h4>Gemcitabine (GEM) remains a cornerstone in the treatment of pancreatic cancer. Upon exposure to GEM, pancreatic cancer cells (PCCs) tend to adapt quickly to outcompete drug-induced cytotoxicity, thereby contributing to treatment failure. Thus, understanding GEM-induced molecular changes in PCCs is important.<h4>Methods</h4>Three primary PCC lines (PCC-1, PCC-2, PCC-7) and Mia PaCa-2 cultured for 40 passages (p) in the absence (control) or presence of GEM (GemR) were assessed for phenotypic changes. Proteome profiles for all PCCs at p10, p20, p25, p30, p35, and p40 were obtained using mass spectrometry (MS). Protein expression was determined using immunoblotting. Differentially abundant proteins (DAPs) were evaluated for enrichment of functional and biological attributes and protein-protein interactions.<h4>Results</h4>GEM sensitivity and growth were both reduced in GemR versus paired controls for all four PCC lines. MS mapped > 7000 proteins in each PCC line, and the abundance of 70-83% of these was found to be significantly altered when comparing all sample groups. Proteomic changes in GemR versus paired controls differed remarkably among the PCCs and were affected by passaging and treatment duration. DAPs at p40 were mostly related to metabolic pathways, including nucleotide metabolism and diverse cell growth processes. Several closely related DAPs and multiple hub proteins in each PCC line were identified.<h4>Conclusions</h4>Overall, this study revealed cell-line-specific, heterogeneous changes in proteome profiles of PCCs following their long-term exposure to GEM, and these were likely affected by treatment duration, dosage, and passaging.

SERPINC1
Also flagged:deep venous thrombosisconvulsive status epilepticusDVTD-dimersinfectionpulmonary embolism
Journal Article 2025-10-01 ✓ 3 Snippets Ren J, Tang C, Sun D.
In-Text Gene Mentions

…platelet count andantithrombin-III, but the activated…

…3 (30%) hadantithrombin-III(AT-III) activity <85%…

…thrombin time AT-IIIantithrombin-IIICSE convulsive status…

Show Full Abstract

This study investigates the clinical characteristics and prognosis of convulsive status epilepticus combined with deep venous thrombosis (CSE-DVT) in children. We retrospectively analyzed the data of CSE-DVT (n = 10) and nonconvulsive DVT (n = 31) admitted to Wuhan Children's Hospital between January 2014 and May 2023. In the CSE-DVT group, 10 cases (5 males, 5 females) were studied, with a median age of 3.2 years (range 0.2-12.5 years). All of them developed unilateral lower extremity DVT and had markedly elevated levels of serum D-dimers. In the nonconvulsive DVT group, 31 cases (20 males, 11 females) were studied, with a median age of 2.0 years (range 0.1-13.0 years). Fifteen cases (48.3%) developed unilateral lower extremity DVT. Twenty-three cases (74.2%) had markedly elevated levels of serum D-dimers. Compared with the nonconvulsive DVT group, the CSE-DVT group had a larger case number of ventilator support, infection, and intravenous nutrition support (P < .05). The CSE-DVT group also had a higher blood platelet count and antithrombin-III, but the activated partial thromboplastin time was shorter than that in the nonconvulsive DVT group (P < .05). The mean period of follow-up was 6 ± 2 months. In the CSE-DVT group, none of them had a pulmonary embolism, and 5 cases (50%) had a thrombus-absorbed state. In the nonconvulsive DVT group, 16 patients (51.6%) had a thrombus-absorbed state, and 2 cases (6.4%) had a pulmonary embolism. The deep vein of the lower extremity is the most common site in children diagnosed with CSE-DVT whose D-dimers are markedly elevated. The effective methods to improve prognosis in patients are early diagnosis and timely treatment.

HFE
Also flagged:ironlung cancercancerscancerSCLCNSCLC
Journal Article 2025-10-01 ✓ 1 Snippet Yu L, Wang Z, Chen C, Li M, Sun X, Yang Y.
In-Text Gene Mentions

…erload disorders (thalassemia,hemochromatosis), infections, inflammation, a…

Show Full Abstract

Lung cancer (LC) is among the most prevalent cancers and is the leading cause of cancer-related mortality. Smoking behavior is the primary etiological factor for LC; however, the potential causal relationship with other risk factors, such as iron status, remains unclear. Currently, there is a significant lack of research investigating the potential causal link between iron homeostasis and LC development. This study employs a 2-sample Mendelian randomization approach to explore the causal relationship between these 2 entities. Data on small cell LC (SCLC) and non-small cell LC (NSCLC) were obtained from the FinnGen R11 database, while data on iron homeostasis, encompassing 4 indicators (ferritin, serum iron, total iron binding capacity, and transferrin saturation) were sourced from the Decode Genetic Sequence Bank. The inverse variance weighted analysis demonstrated a causal genetic association between ferritin levels (β = 0.351; 95% confidence interval = 1.006-2.046; P = .045) and SCLC. The application of Cochran Q test, Rucker Q test, MR Egger intercept, and MR-PRESSO global tests did not reveal any evidence of heterogeneity or pleiotropy (P > .05). In conclusion, from a genetic perspective, elevated ferritin levels are positively correlated with an increased risk of SCLC. Furthermore, no genetic causality was observed between the other 3 indicators of iron homeostasis and either SCLC or NSCLC, nor between ferritin and NSCLC.

SERPINC1
Also flagged:Factor V Leidenactivated protein Csickle cell diseasestrokethrombophiliapolymerase
Journal Article 2025-10-01 ✓ 1 Snippet Ahmed AA, Ahmed AA, Eltayeb R, Alsaif G, Siddeeg S, Nasreldeen R, Elhag D, Alimam S, Abdalla E.
In-Text Gene Mentions

…as variants inSERPINC1. […

Show Full Abstract

Thrombotic complications, particularly stroke, are significant causes of morbidity in children with sickle cell disease (SCD). While the Factor V Leiden (FVL) G1691A mutation is a recognized genetic risk factor for thrombophilia in Caucasian and Middle Eastern populations, its role in African pediatric SCD patients remains unclear. To determine the prevalence of the FVL G1691A mutation and its association with activated protein C resistance in Sudanese pediatric SCD patients with a history of cerebrovascular accidents. This descriptive cross-sectional study was conducted from December 2015 to May 2016 at Jaafar Ibn Auf Specialized Hospital for Children in Khartoum, Sudan. One hundred Sudanese children (<18 years) with homozygous SCD and documented cerebrovascular accidents were recruited. Genotyping for FVL was performed using allele-specific polymerase chain reaction (PCR), and activated protein C resistance was assessed using a clotting-based assay. Demographic, clinical, and familial data, including tribal affiliation and parental consanguinity, were collected. Data were analyzed using SPSS V29. Among the 100 participants (mean age 6.1 ± 3.3 years; 57% male), 2% were heterozygous for the FVL mutation (GA genotype), and none were homozygous mutants. Both heterozygous individuals demonstrated resistance to activated protein C. Parental consanguinity was reported in 79% of cases. No other FVL-associated thrombophilia was detected in the remaining 98 patients, all of whom had the wild-type genotype. The FVL mutation is rare among Sudanese pediatric SCD patients with stroke, suggesting it is unlikely to be a significant contributor to thrombosis risk in this population. These findings support the need for broader genetic and clinical investigations to identify more relevant risk factors and inform stroke prevention strategies in African children with SCD.

SERPINC1
Also flagged:Endometriosisestrogeninflammatory diseasemenstruationpathogenesisAngiogenesis
Journal Article 2025-10-01 ✓ 1 Snippet Li J, Li F, Zhang S, Zhai C, Ma X.
In-Text Gene Mentions

…discovery rate FOXC1Forkhead Box C1Box C1 GBM…

Show Full Abstract

This study aims to identify angiogenesis-associated genes (AAGs) in endometriosis (EM) by integrating bioinformatics analysis with machine learning, and to investigate their underlying mechanisms. Differentially expressed genes (DEGs) were screened from integrated EM-related gene sets in the Gene Expression Omnibus database. These DEGs were integrated with AAGs retrieved from the AMIGO2 database. Weighted gene co-expression network analysis (WGCNA) was then employed to identify potential EM-AAGs, followed by functional enrichment analysis using gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes. Five machine learning algorithms - Random Forest, LASSO, XGBoost, Gradient Boosting Machine (GBM), and SVM-RFE - were utilized for cross-validated screening of hub genes. The diagnostic efficacy of these genes was evaluated through receiver operating characteristic curves, calibration curves, and decision curve analysis. Further analyses included single-gene gene set enrichment analysis (GSEA), immune infiltration profiling, prediction of regulatory transcription factors, and construction of a competitive endogenous RNA (ceRNA) network. This study identified FZD4, SRPX2, and COL8A1 as hub genes for angiogenesis in EM. These genes were significantly upregulated in EM patients and demonstrated excellent diagnostic efficacy. Immune infiltration analysis revealed their regulatory associations with immune cell subpopulations, including M1/M2 macrophages and neutrophils. Single-gene GSEA and competitive endogenous RNA (ceRNA) network construction further elucidated their core regulatory roles in cell cycle control and multi-tiered molecular networks. Integrated bioinformatics and machine learning revealed FZD4, SRPX2, and COL8A1 as hub genes of angiogenesis in EM, proposing novel anti-angiogenic therapeutic strategies targeting EM.

DCC
Also flagged:chromosomechromosomesautosomesSex chromosomesdosage compensationX chromosomes
Journal Article 2025-10-01 ✓ 5 Snippets Aharonoff A, Kim J, Washington A, Ercan S.
In-Text Gene Mentions

…dosage compensation complex” (DCC) is driven by…

…that recruit theDCChave functionally diverged…

…the C. elegansDCCwere identified by…

…the C. elegansDCCis a condensin…

…TheDCCmediates two major…

Show Full Abstract

Mechanisms of X chromosome dosage compensation have been studied in model organisms with distinct sex chromosome ancestry. However, the diversity of mechanisms as a function of sex chromosome evolution is largely unknown. Here, we anchor ourselves to the nematode Caenorhabditis elegans, where dosage compensation is accomplished by an X chromosome-specific condensin that belongs to the family of structural maintenance of chromosomes (SMC) complexes. By combining a phylogenetic analyses of the C. elegans dosage compensation complex with a comparative analysis of its epigenetic signatures, such as X-specific topologically associating domains and enrichment of H4K20me1, we show that the condensin-mediated mechanism evolved recently in the lineage leading to Caenorhabditis following an SMC-4 duplication. Unexpectedly, we found an independent duplication of SMC-4 in Pristionchus pacificus along with X-specific topologically associating domains and H4K20me1 enrichment, which suggests that condensin-mediated dosage compensation evolved more than once in nematodes. Differential expression analysis between sexes in several nematode species indicates that dosage compensation itself precedes the evolution of X-specific condensins. In Rhabditina, X-specific condensins may have evolved in the presence of an existing mechanism linked to H4K20 methylation as Oscheius tipulae X chromosomes are enriched for H4K20me1 without SMC-4 duplication or topologically associating domains. In contrast, Steinernema hermaphroditum lacks H4K20me1 enrichment, SMC-4 duplication, and topologically associating domains. Together, our results indicate that dosage compensation mechanisms continue to evolve in species with shared X chromosome ancestry, and SMC complexes may have been co-opted at least twice in nematodes, suggesting that the process of evolving chromosome-wide gene regulatory mechanisms are constrained.

Also flagged:chromosomeinsulin growth factorgrowth hormoneoxygenblood circulationsodium
Journal Article 2025-10-01 No Snippets Araya-Donoso R, Baty SM, Johnson JE, Lasku E, Taft JM, Fisher RE, Losos JB, Dolby GA, Kusumi K, Geneva AJ.
Show Full Abstract

The genomic characteristics of adaptively radiated groups could contribute to their high species number and ecological disparity, by increasing their evolutionary potential. Here, we explored the genomic variation of Anolis lizards, focusing on three species with distinct phenotypes: Anolis auratus, one of the species with the longest tail; Anolis frenatus, one of the largest species; and Anolis carolinensis, one of the species that inhabits the coldest environments. We assembled and annotated two new chromosome-level reference genomes for A. auratus and A. frenatus and compared them with the available genomes of A. carolinensis and Anolis sagrei. We evaluated the presence of structural rearrangements, quantified the density of repeat elements, and identified potential signatures of positive selection in coding and regulatory regions. We detected substantial rearrangements in scaffolds 1, 2, and 3 of A. frenatus different from the other species, in which the rearrangement breakpoints corresponded to hotspots of developmental genes. Further, we detected an accumulation of repeats around key developmental genes in anoles and phrynosomatid outgroups. Finally, coding sequences and regulatory regions of genes relevant to development and physiology showed variation that could be associated with the unique phenotypes of the analyzed species. Our results show examples of the hierarchical genomic variation within anoles that could provide the substrate that promoted phenotypic disparity and contributed to their adaptive radiation.

ISEV2025 Abstract Book.

Also flagged:Tissue homeostasisextracellular vesicleExtracellular vesicleshyaluronic acidantibodiesRCA
Journal Article 2025-10-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

OLFM4
Also flagged:ocular surface diseaseautoimmune disordersammoniumbicarbonateMagE3
Journal Article 2025-10-01 ✓ 1 Snippet Feret N, Ter Schiphorst S, Kindermans J, Crowdy H, Fichter L, Vialaret J, Hirtz C, Loulier K, Michon F, Daien V.
In-Text Gene Mentions

…(≈4.0×), THBS1 (≈2.8×),OLFM4(≈3.6×), MUC5B (≈3.4×),…

Show Full Abstract

<h4>Purpose</h4>To map time-resolved tear proteome changes during corneal epithelial wound healing after photorefractive keratectomy (PRK) and nominate tear-based biomarker panels with translational potential.<h4>Methods</h4>Tears from 10 healthy adults were collected before PRK (Pre), ∼30-60 minutes after PRK (D0), and day 3 (D3) using Schirmer strips. Proteins were extracted (SP3), trypsin-digested, and analyzed by DIA on an Evosep One-timsTOF HT platform. DIA-NN (1% FDR) provided identification/quantification. Paired contrasts (Pre vs. D0; Pre vs. D3) defined differentially abundant proteins (adjusted P < 0.05; |fold change|≥2) for pathway enrichment. A stringent screen (adjusted P < 0.001; FC>2.5) and UniProt-based annotation distinguished secreted versus intracellular candidates.<h4>Results</h4>Across 2025 identified proteins, 909 (∼45%) were significantly modulated. D0 tears showed an "injury/ECM" program (e.g., TGFBI, lumican, keratocan, fibrinogen chains, complement C8B, APOA1), whereas D3 shifted toward remodeling and epithelial polarity with regulated proteolysis (e.g., SERPINA3, MMP7, THBS1, MUC5B, CXCL17). A subset persisted across time points (e.g., A2M, haptoglobin, OLFML3). Intracellular signatures paralleled phase transitions: D0 was enriched for chromatin/DNA-repair and RNA-binding proteins (histones, XRCC5/Ku80, HNRNPs), whereas D3 highlighted transport/cytoskeletal factors linked to apical remodeling and fluid/ion handling (AQP5, NHERF1/EBP50, ANO1/TMEM16A, ACTN1, RDX). H6PD was elevated at both D0 and D3.<h4>Conclusions</h4>Time-stamped, tear-accessible biomarker panels emerge from this analysis: early-injury (TGFBI, lumican/keratocan, fibrinogen/complement), sustained (A2M, haptoglobin, OLFML3), and late-remodeling/epithelial (SERPINA3, MMP7, THBS1, MUC5B, CXCL17), with complementary intracellular markers (AQP5/NHERF1/ANO1). These candidates may support perioperative monitoring, risk stratification (delayed closure, stromal haze), and phase-adapted therapy after PRK, warranting prospective clinical validation.

Also flagged:IronMetabolismColorectal Carcinogenesiscancercell proliferationcytokine
Journal Article 2025-10-01 No Snippets Ahmadi N, Vidanapathirana G, Gopalan V.
Show Full Abstract

<h4>Background/objectives</h4>Colorectal cancer (CRC) is a leading cause of cancer-related mortality worldwide. Iron metabolism and chronic inflammation are two interrelated processes that significantly influence the initiation and progression of CRC. Iron is essential for cell proliferation, but its excess promotes oxidative stress and DNA damage, while inflammation driven by cytokine-regulated pathways accelerates tumourigenesis. We therefore conducted this narrative review to collate the available evidence on the link between iron homeostasis and inflammatory signalling in CRC and highlight potential diagnostic and therapeutic applications.<h4>Methods</h4>This narrative review of preclinical and clinical studies explores the molecular and cellular pathways that connect iron regulation and inflammation to CRC. Key regulatory molecules, such as the transferrin receptor (TFRC), ferroportin (SLC40A1), ferritin (FTH/FTL), hepcidin, and IL-6, were reviewed. Additionally, we summarised the findings of transcriptomic, epigenomic, and proteomic studies. Relevant therapeutic approaches, including iron chelation, ferroptosis induction, and anti-inflammatory strategies, were also discussed.<h4>Results</h4>Evidence suggests that CRC cells exhibit altered iron metabolism, marked by the upregulation of transferrin receptor (TFRC), downregulation of ferroportin, and dysregulated expression of ferritin. Inflammatory mediators such as IL-6 activate hepcidin and STAT3 signalling, which reinforce intracellular iron retention and oxidative stress. Increased immune evasion, epithelial proliferation, and genomic instability appear to be linked to the interaction between inflammation and iron metabolism. Other promising biomarkers include ferritin, hepcidin, and composite gene expression signatures; however, their clinical application remains limited. Although several preclinical studies support the use of targeted iron therapies and combination approaches with anti-inflammatory agents or immunotherapy, there is a lack of comprehensive clinical validation confirming their efficacy and safety in humans.<h4>Conclusion</h4>Although preclinical studies suggest that iron metabolism and inflammatory signalling form an interconnected axis closely linked to CRC, translating this pathway into reliable clinical biomarkers and effective therapeutic strategies remains a significant challenge. Future biomarker-guided clinical trials are essential to determine the clinical relevance and to establish precision medicine strategies targeting the iron-inflammation crosstalk in CRC.

Also flagged:keratoconusmyopiakeratectomyDNase IRNaseIonization
Journal Article 2025-10-01 No Snippets Jaskiewicz-Rajewicz K, Wysocka A, Maleszka-Kurpiel M, Matuszewska-Mach E, Wozniak J, Ploski R, Matysiak J, Rydzanicz M, Gajecka M.
Show Full Abstract

<h4>Purpose</h4>There is no molecular evidence available confirming or contradicting inter-eye molecular variability in keratoconus (KTCN). The key question is whether the use of a model of more and less affected eyes of the same pair facilitates the identification of specific molecular features of KTCN severity.<h4>Methods</h4>This retrospective case-control study involved 21 KTCN patients (n = 132 experimental samples derived from 42 corneal epithelium samples separated into central, middle, and peripheral topographic regions) analyzed in the paired model. Transcriptomic (RNA-sequencing) and proteomic (MALDI-TOF/TOF MS/MS) profiling was performed. An additional non-paired model, including KTCN patients (n = 42) and controls (n = 14), strengthened the assessment. Then, key findings were validated in a rediscovery study with 20 patients using reverse-transcription quantitative polymerase chain reaction, immunofluorescence staining, and confocal microscopy.<h4>Results</h4>In the paired model, which included patients with ≥1 grade difference in topographic keratoconus classification, 48 differentially expressed genes were identified. Over-representation analysis highlighted the GO term "cell-cell adhesion" (adjusted P = 0.028), with key contributors including ACTN1, EPCAM, PCDH19, PVR, and TFRC. TFRC showed significantly higher expression in the middle topographic region of more severely affected eyes (P = 0.008, paired t-test), correlating with the average topographic region thickness (R = 0.53, P = 0.008) and flat keratometry (K1; R = 0.49, P = 0.016). Immunofluorescence confirmed intra-individual and regional differences in transferrin receptor (TFRC) protein expression, with increased expression in the middle topographic region of more advanced eyes, compared to eyes with forme fruste KTCN.<h4>Conclusions</h4>Inter-eye variability implicates TFRC as a component of the KTCN severity signature, thus adding the element to the mechanisms underlying KTCN cone formation.

Also flagged:inseminationmatinghydroxyapatiteextracellularossificationmineral
Journal Article 2025-10-01 No Snippets Sirovica S, Morrell AP, Addison O, Martin RA, Watkins AJ.
Show Full Abstract

Our bone health as an adult is defined by patterns of development in early life, with perturbed growth during fetal and neonatal periods predisposing individuals to poor bone health in adulthood. Studies have identified poor maternal diet during pregnancy as a critical factor in shaping offspring bone development, with significant impacts on adult bone structure and health. However, the association between a father's diet and the bone health of his offspring remains poorly defined. To address this knowledge gap, we fed male C57BL/6 mice either a control normal protein diet (NPD; 18% protein) or an isocaloric low-protein diet (LPD; 9% protein) for a minimum of 8 wk. Using these males, we generated offspring through artificial insemination, in combination with vasectomized male mating. Using this approach, we derived offspring from either NPD or LPD sperm but in the presence of NPD or LPD seminal plasma. Using micro-computed tomography and synchrotron X-ray diffraction, we observed significant changes in offspring femur morphology and hydroxyapatite crystallographic parameters from just 3 wk of age in offspring derived from LPD sperm or seminal plasma. We also observed that differential femur morphology and hydroxyapatite crystallographic parameters were maintained into adulthood and into a second generation. Analysis of paternal sperm identified a down regulation of 26 osteogenic genes associated with extracellular matrix levels and maintenance, transcription and growth factors, and bone ossification. These observations indicate that poor paternal diet at the time of conception affects offspring bone development and morphology in an age and generation specific manner.

SUDS3
Also flagged:CorepressorSEED DORMANCY 4-LIKEGeneExpression2DIG2
Journal Article 2025-10-01 ✓ 1 Snippet Lu B, Go D, Shan J, Song L.
In-Text Gene Mentions

…physically interacts withpolycomb repressiverepressive complex (PRC)-inter…

Show Full Abstract

Development is a series of decision-making events. Success of seed plants at individual and population levels strongly depends on the timing of germination and the rapidness of seedling establishment. Arabidopsis thaliana SEED DORMANCY 4-LIKE (AtSDR4L) and its paralog Dynamic Influencer of Gene Expression 2 (DIG2) are transcriptional corepressors that promote seed-to-seedling phase transition. Their regulatory roles in promoting germination at the temporal and tissue-specific scales remain elusive. We show that strong germination arrest of Atsdr4l dig2 is alleviated by ABA antagonists. Isolated mutant embryos develop faster than intact seeds but still exhibit delayed growth. Atsdr4l dig2 seeds show extensive changes in gene expression in both the seed coat and the embryo, with a subset of the genes differentially expressed tissue-specifically. MIKC-type MADS-box genes are the top-enriched transcription factor family among upregulated genes in both seed compartments of Atsdr4l dig2, and AGAMOUS-LIKE44 (AGL44) is a direct target of both AtSDR4L and DIG2. Many hormonal genes and hypoxia-responsive genes are misregulated in the double mutant seeds, accompanied by an overaccumulation of abscisic acid, auxin, and their derivatives, as well as the immediate precursor of ethylene. Together, these results provide mechanistic insights into how AtSDR4L and DIG2 work in concert to coordinate multiple pathways and prepare seeds for germination.

HFE
Also flagged:hepatitis B surface antigenchronic hepatitis Baspartate aminotransferaseASTalanine aminotransferaseALT
Journal Article 2025-10-01 ✓ 1 Snippet Li J, Li M, Sun H, Yu YT, Zhou YH, Fu F, Yan L.
In-Text Gene Mentions

…liver diseases includinghemochromatosisor Wilson’s disease,…

Show Full Abstract

<h4>Background</h4>The relationship between hepatitis B surface antigen (HBsAg) concentrations, hepatitis B virus (HBV) DNA levels, and hepatic function in individuals with chronic hepatitis B (CHB) remains incompletely characterized.<h4>Aim</h4>To examine the association of serum HBsAg concentrations with HBV DNA levels and hepatic function parameters in patients with CHB.<h4>Methods</h4>A total of 110 individuals with CHB admitted to Kunming Third People's Hospital between January 2023 and January 2025 were enrolled as the observation group, whereas 70 age- and sex-matched healthy individuals served as the control group. Fasting peripheral venous blood (5 mL) was collected from all participants. Serum HBsAg and HBV DNA levels (in the observation group), along with hepatic function markers, including total bilirubin (TBIL), aspartate aminotransferase (AST), and alanine aminotransferase (ALT), were measured in both groups. Pearson correlation analysis was used to assess the association between serum HBsAg levels and HBV DNA, TBIL, AST, and ALT levels in patients with CHB. Receiver operating characteristic (ROC) curve analysis was conducted to determine optimal cutoff values of HBsAg for predicting high viral load (HBV DNA ≥ 10<sup>5</sup> IU/mL) and significant liver injury (ALT ≥ 2 × upper limit of normal [ULN]).<h4>Results</h4>HBsAg levels differed significantly across CHB phases: Immune tolerance (IT) phase (4.62 ± 1.51 lgIU/mL), immune clearance (IC) phase (3.84 ± 1.16 lgIU/mL), low replication (LR) phase (2.99 ± 0.66 lgIU/mL), and HBV e antigen-negative hepatitis (ENH) phase (3.40 ± 0.69 lgIU/mL). Corresponding HBV DNA levels were highest in the IT phase (7.41 ± 1.83 log copies/mL), followed by the IC phase (6.03 ± 1.92 log copies/mL), ENH phase (3.89 ± 1.23 log copies/mL), and LR phase (2.55 ± 1.00 log copies/mL). All hepatic function parameters in patients with CHB were significantly elevated compared to the healthy controls. Pearson correlation analysis showed significant positive associations between serum HBsAg levels and HBV DNA, TBIL, AST, and ALT levels. ROC analysis revealed that an HBsAg cutoff > 4.09 lgIU/mL predicted HBV DNA ≥ 10<sup>5</sup> IU/mL (high viral load) with 88.57% sensitivity, 78.67% specificity, and an area under the curve (AUC) of 0.868 (<i>P</i> < 0.001), while a cutoff > 4.07 lgIU/mL predicted ALT ≥ 2 × ULN (significant liver injury) with 69.70% sensitivity, 90.91% specificity, and an AUC of 0.821 (<i>P</i> < 0.001).<h4>Conclusion</h4>Serum HBsAg, a noninvasive serological marker, holds significant clinical value in CHB management by aiding in the stratification of viral burden and the prediction of hepatic impairment.

Also flagged:gene expressiongallbladder cancerbiliary tract cancergallstone diseasecholecystitiscancer
Journal Article 2025-10-01 No Snippets Choudhury S, Maiti A, Bandopadhyay A, Tripathi A, Sikdar N.
Show Full Abstract

Gallbladder cancer (GBC) is a lethal biliary tract malignancy, which is infrequent in most developed countries, but common in many developing countries in specific geographical regions of the world. Non-specific symptoms leading to late diagnosis is one of the primary factors contributing to poor prognosis in GBC. An understanding of the complex relationship between molecular genetics and epidemiological variances in the incidence rates of GBC is thus of utmost importance. Present review summarizes recent updates on population-specific dysregulated genetic expressions in the genesis of GBC, highlighting the pattern of ethno-geographic variations and on advances in targeted therapies conducted till date; points out the lacunae that deserve further attention and suggest possible new directions for future clinical trials in GBC. The review calls for the need of genetic screening of each GBC patients and for more extensive clinical trials on targeted therapies to move towards the goal of personalized medicine, bringing about more favourable survival outcomes.

HFE
Also flagged:Liver diseasesCirrhosishepatocellular carcinomaFibrosisportal hypertensionvasoconstriction
Journal Article 2025-10-01 ✓ 1 Snippet Armillotta MG, Lizzi L, Massimi M.
In-Text Gene Mentions

…caused by obesity,hemochromatosis, and Wilson’s disease),…

Show Full Abstract

Liver diseases are among the most insidious and life-threatening conditions due to their progressive nature and late symptom onset. Cirrhosis and hepatocellular carcinoma account for most liver-related deaths, often following the progression from fibrosis. Fibrosis creates a hostile microenvironment, characterized by portal hypertension, vascular capillarization, intrahepatic vasoconstriction, and extracellular matrix deposition, which severely limits drug efficacy. Advances in pharmaceutical science have prompted efforts to develop liver-targeted drug delivery systems to prevent or reduce the progression of fibrosis, a central feature of many liver diseases. Fibrosis often reduces the <i>in vivo</i> efficacy of both approved and experimental drugs, underscoring the need for improved delivery strategies focused on stability, controlled release, and precise targeting. Nanoparticle (NP)-based systems show promise, either by delivering therapeutic agents, or in some cases, by contributing directly to the therapeutic effects. This review summarizes the main types of NPs explored for liver disease treatment, especially those aiming to reverse fibrosis or prevent its progression, a critical therapeutic target in chronic liver diseases. Additionally, it examines gene delivery and ultrasound-guided microbubble strategies, which can be combined with NPs to improve cell-specific targeting and boost therapeutic effects. Together, these approaches have the potential to address current therapeutic challenges and accelerate the development of liver-targeted treatments for clinical application.

HFE
Also flagged:hereditary haemochromatosisHaemochromatosisironanxietydiabetesliver disease
Journal Article 2025-10-01 ✓ 2 Snippets Waqar M, El Asmar ML, Gray D, Immanuel A, Shearman J, Ramage JK.
In-Text Gene Mentions

…defect in theHFEgene[ 2 ,…

…by identifying theHFEgene and the…

Show Full Abstract

Haemochromatosis is the most common genetic condition among people of European descent, resulting in iron overload and multi-organ dysfunction. Despite early detection and treatment advances, affected individuals experience significant morbidity impacting their quality of life (QoL). To scope the literature for QoL issues and rank them in order of relevance by professional bodies. A literature search was conducted using PubMed, EMBASE, and MEDLINE in addition to a grey literature search against the eligibility criteria up to July 2023. Inclusion criteria included original articles with data concerning symptoms and QoL in patients with haemochromatosis. Nineteen issues were identified from 47 articles and scored by a haemochromatosis special interest group using a scale of 1 to 10 (10 = highest importance). Mean scores were then calculated for each issue. Fatigue, joint pain and sexual issues were key factors associated with impaired QoL. The least relevant were weight changes and abdominal pain. Other issues raised were anxiety, the development of diabetes, and concerns about genetics and family. This is the first scoping review examining common symptoms affecting QoL of patients with hereditary haemochromatosis. Further studies, including patient interviews and a randomised controlled trial, will inform a validated QoL questionnaire.

BTN3A3
Also flagged:efferocytosisovarian cancerOCcancergene expressionreverse transcription
Journal Article 2025-10-01 ✓ 5 Snippets Yuan X, Hu Y, Li N, He P, Wang D, Liu Y, Luo Y.
In-Text Gene Mentions

…key genes, FCGBP,BTN3A3, WDR91, SLC25A45, and…

…SLC25A45, ciclopirox toBTN3A3, and irinotecan to…

… R:5′-CGAAGGGCAGCCAAGTCATA-3’;BTN3A3: F:5′-TGAAGGTTGCAGAGTGGAGG-3′…

…characteristic genes (FCGBP,BTN3A3, WDR91, SLC25A45, and…

…groups of FCGBP,BTN3A3, WDR91, SLC25A45, and…

Show Full Abstract

The study aimed to investigate the prognostic significance of efferocytosis-related genes in ovarian cancer (OC) with regard to cancer development, progression, invasion, and metastasis. OC cohorts were assembled from bioinformatics repositories. Utilizing consensus clustering analysis, distinct clusters were delineated based on the intersection of OC-related genes and efferocytosis-related genes. A prognostic signature specific to efferocytosis in OC was developed using data from The Cancer Genome Atlas, validated against the gene expression omnibus database, and subjected to independent prognostic analysis. Subsequently, a nomogram model was formulated. Moreover, investigations encompassed the immune microenvironment, immunotherapy, mutation profiling, drug sensitivity assessments, drug prediction models, and molecular docking analyses. Finally, quantitative reverse transcription polymerase chain reaction (qRT-PCR) assays were employed to ascertain the mRNA expression levels of key genes. Five key genes, FCGBP, BTN3A3, WDR91, SLC25A45, and BTNL3, were identified as significantly associated with OC. Both datasets and qRT-PCR demonstrated elevated expression levels of FCGBP and WDR91 in OC. Notably, AFLATOXIN B1 exhibited strong binding affinity to SLC25A45, ciclopirox to BTN3A3, and irinotecan to WDR91. The risk score, age, and stage were identified as independent prognostic factors, with the nomogram displaying efficacy in predicting OC patient survival. Variations in the immune cell infiltration profiles, including naive B cells, and expression levels of 6 immune checkpoint genes, such as CTLA4, were notable. High tumor mutation burden scores were associated with improved survival outcomes. Additionally, significant differences in the IC50 values of 123 anticancer drugs were observed between the 2 risk groups. This findings of this study highlight the efficacy of the efferocytosis-associated risk model in predicting the survival outcomes of OC patients, thus providing a novel reference for prognostic prediction in OC patients.

DDX27
Also flagged:BRD4Colorectal CancerMAPKcancerbromodomain-containing protein 4BRD4-S
Journal Article 2025-10-01 ✓ 3 Snippets Wang C, Hong H, Zhou L, Chu F, Chen X.
In-Text Gene Mentions

…Cancer Progression viaDDX27-Regulated Splicing and MAPK…

…DEAD-box helicase 27 (DDX27) interacted with Serine…

…defines a novelDDX27-SRSF6-BRD4-S-MAPK/ERK signali…

Show Full Abstract

<h4>Background</h4>As a major contributor to cancer-associated deaths, advanced colorectal cancer (CRC) has a constrained range of effective treatment options. The short isoform of bromodomain-containing protein 4 (BRD4-S) has recently been implicated as a potential oncogenic driver; however, its regulatory mechanisms and functional role in CRC remain incompletely understood.<h4>Methods</h4>BRD4-S expression, regulation, and function in CRC were investigated through bioinformatics analyses of the Cancer Genome Atlas (TCGA) datasets, <i>in vitro</i> studies using CRC cell lines (HT29, SW620), and <i>in vivo</i> xenograft models in nude mice. Experimental approaches included quantitative real-time PCR (qRT-PCR), Western blotting, co-immunoprecipitation, RNA immunoprecipitation, immunofluorescence, colony formation, Cell Counting Kit-8 (CCK-8), and scratch assays. Gene enrichment and interaction analyses were performed to identify relevant pathways and molecular partners.<h4>Results</h4>BRD4-S was markedly upregulated in CRC tissues and cell lines, and elevated BRD4-S expression correlated with poorer patient survival. Silencing BRD4-S, but not BRD4-L, significantly impaired CRC cell proliferation, migration, and tumor growth <i>in vivo</i>. Mechanistically, the RNA helicase DEAD-box helicase 27 (DDX27) interacted with Serine and Arginine Rich Splicing Factor 6 (SRSF6) to promote alternative splicing of BRD4 pre-mRNA toward the BRD4-S isoform. Inhibition of SRSF6 phosphorylation suppressed BRD4-S production and blocked activation of the mitogen-activated protein kinase (MAPK)/extracellular regulated protein kinases ERK signaling pathway, identified as a key downstream effector of BRD4-S.<h4>Conclusions</h4>This study defines a novel DDX27-SRSF6-BRD4-S-MAPK/ERK signaling axis that drives CRC progression. These findings underscore the therapeutic potential of targeting BRD4 isoform switching and its regulatory splicing machinery in CRC.

SOX6
Also flagged:Osteoporosissystemic skeletal diseasemineralcorticosteroidtype 2 diabetesmajor depressive disorder
Journal Article 2025-10-01 ✓ 2 Snippets Qian 钱雨 Y, Xia 夏江威 J, Wang 王萍玉 P, Xie C, Lin 蔺红丽 HL, Li GH, Yuan 袁丞达 CD, Qiu 邱模昌 MC, Fang 方义湖 YH, Yu 余春富 CF, Cai 蔡祥春 XC, Khederzadeh S, Zhao 赵翩翩 PP, Yang 杨梦圆 MY, Zhong 钟家栋 JD, Li 李鑫 X, Guan 管彭霖 PL, Gu 顾家煊 JX, Gai 盖思睿 SR, Yi 依香叫 XJ, Tao 陶建国 JG, Chen 陈祥 X, Miao 缪毛毛 MM, Chen 陈国波 GB, Xu 徐林 L, Xie 谢书阳 SY, Tian 田梗 G, Yue 岳华 H, Li 李光飞 G, Xiao 肖文金 W, Karasik D, Xu 徐又佳 Y, Yang 杨柳 L, Cheung CL, Huang 黄飞 F, Zhang 章振林 Z, Zheng 郑厚峰 HF.
In-Text Gene Mentions

…for rs10832558 withinSOX6; H4 =…

…ocalization (rs10832558 withinSOX6and rs11187838 within…

Show Full Abstract

The ultimate goal of a genome-wide association study (GWAS) is to translate its discoveries into clinical practice. To explore the clinical use of GWAS findings in the bone field, we conducted a GWAS of dual-energy X-ray absorptiometry (DXA)-derived bone mineral density (BMD) traits at 11 skeletal sites, within over 30,000 European individuals from the UK Biobank. A total of 91 unique and independent loci were identified for 11 DXA-derived BMD traits and fractures, including 5 novel loci (harboring the genes ABCA1, CHSY1, CYP24A1, SWAP70, and PAX1) for 6 BMD traits. These loci exhibited evidence of association in both males and females, which could serve as independent replication. We demonstrated that each polygenic risk score (PRS) was independently associated with fracture risk. Although incorporating multiple PRSs (i.e., metaPRS) with clinical risk factors from the Fracture Risk Assessment Tool (FRAX) yielded the highest predictive performance, the improvement was modest in fracture prediction. Additionally, we uncovered genetic correlation and shared polygenicity between head BMD and intracranial aneurysm (IA). Finally, by integrating gene expression and GWAS datasets, we prioritized genes (e.g., ESR1 and SREBF1) encoding druggable human proteins along with their respective inhibitors/antagonists. In conclusion, this comprehensive investigation reveals a new genetic basis for BMD and its clinical relevance to fracture prediction. More importantly, it suggests that head BMD is genetically correlated with IA. The prioritization of genetically supported targets implies the potential repurposing of drugs [e.g., omega-3 polyunsaturated fatty acid (PUFA) supplements] for the prevention of osteoporosis.

NEGR1
Also flagged:extracellularheart failureTGF-β1cytokineIGFBP6insulin-like growth factors
Journal Article 2025-10-01 ✓ 2 Snippets Cheng S, Wang Y, Li K, Wu X, Zhao Q, Tong T, Shi J, Xue Y, Yang J, Wang D.
In-Text Gene Mentions

early growth regulator 1growth regulator 1…

…directly interacted withearly growth regulator 1growth regulator 1…

Show Full Abstract

<b>Rationale:</b> The transition of fibroblasts into activated myofibroblasts is a pivotal driver of collagen deposition and adverse cardiac remodeling. Insulin-like growth factor-binding protein 6 (IGFBP6), a critical modulator of cellular growth and metabolism via its regulation of IGF-II activity, has been implicated in immune and fibrotic responses. However, its specific role in fibroblast-mediated cardiac remodeling, particularly in the regulation of myofibroblast transition, remains incompletely understood. <b>Methods:</b> We analyzed IGFBP6 expression in ischemic cardiomyopathy-associated cardiac fibrosis using Gene Expression Omnibus (GEO) dataset. Serum IGFBP6 levels in patients with chronic myocardial infarction (MI) were quantified via ELISA. Cardiac fibroblast and myofibroblast-specific IGFBP6 knockout mice were generated by crossing IGFBP6 floxed (IGFBP6<sup>f/f</sup>) mice with tamoxifen-inducible Col1a2-Cre and Postn-MerCreMer mice. Cardiac function, tissues morphology, and molecular alterations were analyzed following MI or isoproterenol (ISO) challenge. The mechanisms underlying the regulation of fibroblast-to-myofibroblast transition (FMT) by IGFBP6 were elucidated using LC-MS/MS and RNA sequencing. <b>Results:</b> IGFBP6 expression was significantly upregulated in cardiac fibroblasts isolated from murine fibrotic hearts and was responsive to TGF-β1 stimulation. The elevated serum IGFBP6 levels were correlated with the incidence of chronic MI. Conditional knockout of IGFBP6 in cardiac fibroblasts and myofibroblasts markedly attenuated post-MI fibrotic remodeling, ventricular dysfunction, and ISO-induced cardiac hypertrophy and fibrosis. IGFBP6 silencing abolished TGF-β1-triggered FMT. Mechanistically, TGF-β1 stimulation facilitated the translocation of IGFBP6 in cardiac fibroblasts, where its N-terminal domain directly interacted with early growth regulator 1 (EGR1). This interaction enhanced EGR1 binding to the promoter of microfibril-associated protein 4 (MFAP4), a pro-fibrotic mediator. Overexpression of MFAP4 significantly reversed the protective effects by IGFBP6 knockout in cardiac fibroblast transition and adverse remodeling post-MI. <b>Conclusion:</b> Our study identifies fibroblast-derived IGFBP6 as a novel regulator of cardiac fibrosis through the EGR1-MFAP4 signaling axis, driving myofibroblasts differentiation and adverse remodeling. Targeting this pathway may offer therapeutic potential for cardiac remodeling disorders.

STAU1
Also flagged:Lung CancercancerlocalizationCellularCell migrationwound healing
Journal Article 2025-10-01 ✓ 1 Snippet Lan D, Liu Y, Zhang Y, Nie S, Sun Z, Chen W, Zhao J.
In-Text Gene Mentions

…TLN1, TUBB, SRSF3,STAU1, ICAM1 ( Fig.…

Show Full Abstract

<h4>Background</h4>Lung cancer (LC) remains the leading cause of cancer-related mortality. Circular RNAs (circRNAs) are emerging as important regulators in cancer biology.<h4>Objectives</h4>This study investigated the functional role and therapeutic potential of circFNIP1 (hsa_circ_0073858) in LC.<h4>Materials and methods</h4>The expression of circFNIP1 in multiple lung cancer cell lines was quantified using quantitative real-time PCR, and its subcellular localization was determined by fluorescence in situ hybridization. To investigate function, circFNIP1 was silenced in PC-9 and SPC-A1 cells using siRNA-mediated knockdown. Cellular proliferation was measured by CCK-8 and colony formation assays, while apoptosis was evaluated via flow cytometry. Cell migration and invasion capacities were assessed using wound healing and transwell assays. In vivo tumorigenic potential was examined by establishing subcutaneous xenografts in nude mice, followed by intratumoral administration of antisense oligonucleotides targeting circFNIP1. Bioinformatics analyses, including interrogation of circRNA and miRNA databases and protein-protein interaction networks, were performed to predict circFNIP1-associated miRNAs and downstream targets. All experiments were conducted in triplicate, and statistical analyses were performed to determine significance.<h4>Results</h4>CircFNIP1 was highly expressed in LC cells and localized to both the nucleus and cytoplasm. Knockdown of circFNIP1 significantly reduced proliferation, colony formation, migration, and invasion in vitro, and suppressed tumor growth in a mouse xenograft model. Bioinformatics predicted miR-1231 and miR-657 as key targets, with ICAM1 identified as a downstream effector of miR-657.<h4>Conclusions</h4>CircFNIP1 functions as an oncogenic circRNA in LC and represents a promising target for RNA-based therapeutic strategies. These findings provide a basis for the development of circFNIP1-targeted interventions in LC management.

HFE
Also flagged:Hepatocellular Carcinomaliver cancerCBSELF3SPP2RPL8
Journal Article 2025-10-01 ✓ 2 Snippets Yang C, Ju S, Li Y, Chen Y, Fan X, Li H, Wang C, Li L.
In-Text Gene Mentions

…antitrypsin deficiency, andhemochromatosismay also be…

…patients caused byhemochromatosis, metabolic syndrome or…

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC) is a heterogeneous liver cancer with poor prognosis and diverse etiologies, yet molecular mechanisms across different causes remain unclear.<h4>Objective</h4>To identify key gene expression patterns and pathways associated with HCC progression from diverse pathological backgrounds using integrated bioinformatics analysis.<h4>Materials and methods</h4>Seven HCC-related GEO datasets totaling 1219 samples were analyzed. Differentially expressed genes (DEGs) were identified, followed by pathway enrichment, survival analysis, and immunohisto-chemistry validation.<h4>Results</h4>We identified DEGs such as CBS, ELF3, SPP2, and RPL8 correlated with patient survival. Enrichment analysis highlighted the PI3K-Akt signaling pathway as a central route in liver cirrhosis and tumor progression. A 47-gene set was proposed as a potential regulatory 'brake' during benign-to-malignant transformation. These findings were consistent with recent studies emphasizing PI3K-Akt and metabolic dysregulation in HCC pathogenesis.<h4>Conclusions</h4>Our integrative analysis reveals critical genes and pathways involved in HCC development, providing potential prognostic biomarkers and therapeutic targets. The study underscores the importance of cirrhosis in HCC progression and highlights the PI3K-Akt pathway's pivotal role. Further functional validation and larger cohort studies are warranted.

RABGAP1LARFGEF2
Also flagged:Kv1.3 Channelcalciumvoltage-activated Kv1.3 channelBiotin ligasebeta-integrinsStat1
Journal Article 2025-10-01 ✓ 2 Snippets Kour D, Bowen CA, Srivastava U, Nguyen HM, Kumari R, Kumar P, Brandelli AD, Bitarafan S, Tobin BR, Wood LB, Seyfried NT, Wulff H, Rangaraju S.
In-Text Gene Mentions

…e.g. PLIN3, GANAB,ARFGEF2) ( Fig. 4C…

…( e.g. PRR12,RABGAP1L, MAPT) and ulcerative…

Show Full Abstract

<h4>Background/aims</h4>Potassium channels regulate membrane potential, calcium flux, cellular activation and effector functions of adaptive and innate immune cells. The voltage-activated Kv1.3 channel is an important regulator of T cell-mediated autoimmunity and microglia-mediated neuroinflammation. Kv1.3 channels, via protein-protein interactions, are localized with key immune proteins and pathways, enabling functional coupling between K+ efflux and immune mechanisms.<h4>Methods</h4>To gain insights into proteins and pathways that interact with Kv1.3 channels, we applied a proximity-labeling proteomics approach to characterize protein interactors of the Kv1.3 channel in activated T-cells. Biotin ligase TurboID was fused to either N or C termini of Kv1.3, stably expressed in Jurkat T cells, and biotinylated proteins in proximity to Kv1.3 were enriched and quantified by mass spectrometry.<h4>Results</h4>We identified over 1,800 Kv1.3 interactors including known interactors (beta-integrins, Stat1), although the majority were novel. We found that the N-terminus of Kv1.3 preferentially interacts with protein synthesis and protein trafficking machinery, while the C-terminus interacts with immune signaling and cell junction proteins. T-cell Kv1.3 interactors we found consisted of 335 cell surface proteins, including T-cell receptor complex, mitochondrial, calcium and cytokine-mediated signaling pathway, and lymphocyte migration proteins. 178 Kv1.3 interactors in T-cells also represent genetic risk factors for T cell-mediated autoimmunity, including STIM1, which was further validated using co-immunoprecipitation.<h4>Conclusion</h4>Our studies revealed novel proteins and molecular pathways that interact with Kv1.3 channels in adaptive (T-cell) and innate (microglia) immune cells, providing a foundation for understanding how Kv1.3 channels may regulate immune mechanisms in autoimmune.

HFE
Also flagged:ironbeta-thalassemiab-thalassemiaTransferrinTRFmetabolism
Journal Article 2025-10-01 ✓ 1 Snippet Liang Y, Zhang X, Huang B, Huang Y, Liao L, Huang Y, Huang K, Lao J, Feng X, Lin B, Long X, Liu Z, Zhu W, Yu L, Tang D, Zhong T, Ye Y, Xu X.
In-Text Gene Mentions

…levels unrelated toHFEgene mutations [22]…

Show Full Abstract

<h4>Background</h4>Serum ferritin (SF) monitors secondary iron overload in beta-thalassemia (b-thalassemia). Transferrin (TRF) has been shown to reverse iron accumulation in experimental models, but its role in transfusion-dependent beta-thalassemia (TDT) patients remains unclear. This study aims to explore the relationship between TRF and SF in TDT patients and to reveal the unique connection between specific genotypes and iron metabolism, providing potential therapeutic targets for clinical practice.<h4>Methods</h4>This cross-sectional study includes 817 TDT patients (b0/b0 genotype: n=560; b0/b+ genotype: n=257). We use genotype-phenotype analysis and employ logistic regression and restricted cubic spline (RCS) curves to assess the association between TRF and SF.<h4>Results</h4>Significant differences were observed between the b0/b0 and b0/b+ genotypes in terms of age at first transfusion, transfusion requirements, chelation initiation age, reticulocyte count, red blood cell count, red cell distribution width-coefficient of variation (RDW-CV), fetal haemoglobin (HbF) level, splenomegaly, and SF. b0/b0 patients presented with more severe clinical phenotypes. SF was significantly associated with TRF, HbF, RDW-CV, and chelation therapy. RCS analysis revealed a dose-response relationship with a negative linear correlation between TRF and SF (OR=0.26, P&lt;0.001), indicating that higher TRF levels are linked to lower SF risk.<h4>Conclusions</h4>This study systematically confirms for the first time a significant negative correlation between high TRF levels and high SF risk in TDT patients. This new finding may help clinicians more effectively manage iron overload, especially in patients with different genotypes.

Also flagged:AutophagyFerroptosisLung cancerpathogenesisnuclear receptor coactivator 4NCOA4
Journal Article 2025-10-01 No Snippets Jiang C, Cui X, Zheng L, Deng C, Huang R, Hou B, Wang J.
Show Full Abstract

Lung cancer remains a life-threatening malignancy with complex pathogenesis. This paper provides a systematic review of autophagy and ferroptosis-related signaling pathways, key regulatory factors, and their associated mechanisms, including the nuclear receptor coactivator 4 (NCOA4)-mediated ferritin autophagy-ferroptosis axis, mitochondrial autophagy, lipid droplet autophagy, circadian autophagy, chaperone-mediated autophagy, etc.. The review elucidates the roles of the tumor microenvironment and non-coding RNAs in autophagy-ferroptosis processes in lung cancer. Furthermore, it explores the potential of modern drugs and active components from traditional Chinese medicine to improve lung cancer outcomes by targeting autophagy and ferroptosis, proposing that targeting their interactive pathways could offer novel therapeutic strategies for lung cancer.
.

HFE
Also flagged:CarboxymaltoseIron Deficiency Anemiaferric carboxymaltoseIDAHbnutritional deficiency
Journal Article 2025-10-01 ✓ 1 Snippet Sali M, Sali D, Varpe A, Kulkarni K, Gundu S, Suryawanshi S.
In-Text Gene Mentions

…overload conditions (e.g.,hemochromatosis, hemosiderosis), a history…

Show Full Abstract

<h4>Introduction</h4>More than half of Indian rural women (pregnant and non-pregnant) are anemic. Limited evidence exists on the effectiveness and tolerability of ferric carboxymaltose (FCM) in Indian rural and tribal women.<h4>Aims and objectives</h4>The primary objective was to assess the effectiveness of intravenous (IV) infusion of FCM in iron deficiency anemia (IDA) in rural and tribal women. Secondary objectives included evaluating changes in hematological parameters from baseline and assessing tolerability.<h4>Materials and methods</h4>A prospective, open-label, observational, real-world, single-center study was conducted at Getwell Multispecialty Hospital, Manchar, Pune. Female patients with IDA (Pregnant: Hb 6 to <11 g/dL, non-pregnant: Hb: 6 to <12 g/dl) were recruited. FCM was administered as an IV infusion, and patients were followed up at 6 weeks. Change in Hb, other haematological parameters from baseline were assessed. Adverse effects related to FCM were monitored.<h4>Results</h4>Fifty-five patients completed the study; 7.27% were pregnant and 92.73% were nonpregnant. A significant increase in Hb of 3.64 g/dL was recorded at 6 weeks. All pregnant women achieved the target Hb of 11 g/dL, whereas 58.82% of nonpregnant women reached 12 g/dL; there was a significant increase in hematocrit, mean corpuscular volume, mean corpuscular hemoglobin (MCH), and MCH concentration (<i>P</i> < 0.05 for all) as compared to baseline. FCM infusion was well tolerated.<h4>Conclusions</h4>FCM IV infusion significantly increased Hb levels and other hematological parameters at 6 weeks. FCM appears to be an effective and well-tolerated treatment for IDA in pregnant and non-pregnant women in rural and tribal area.

SOX6
Also flagged:Hemoglobinopathiesβ-Thalassemiasickle cell diseaseβ-globinsynthesisα-globin
Journal Article 2025-10-01 ✓ 3 Snippets Taebi S, Eskandari F, Kohandani M, Manoochehrabadi T, Nasiri H.
In-Text Gene Mentions

…FOG1, SRY-box 6 (SOX6), DNA methyltransferase 1…

…mutation into theSOX6binding site via…

SOX6SRY-box 6…

Show Full Abstract

β-hemoglobinopathies rank among the most prevalent inherited blood disorders globally. Traditional management strategies are primarily palliative and often associated with significant challenges, including iron overload and limited long-term efficacy. Allogeneic hematopoietic stem cell transplantation (HSCT) is a potentially curative option for transfusion-dependent patients, but its broader applicability is constrained by factors that limit its use. Utilizing viral vectors and gene-editing tools, particularly CRISPR-Cas9 technology, researchers have developed therapies that target the root causes of these disorders. These innovative approaches have demonstrated substantial therapeutic potential, accompanied by favorable safety profiles, in clinical settings. Since the initial investigations, the genome editing tool has rapidly advanced for genetic abnormalities, particularly monogenic blood diseases, including β-hemoglobinopathies. This method suggests an approach with lower concerns in viral gene integration and insertional mutagenesis issues. This review comprehensively surveys the therapeutic strategies for β-thalassemia and sickle cell disease (SCD) currently in preclinical and clinical development, with a focus on the evolving treatment paradigm. Looking forward, critical research priorities include optimizing the efficiency and specificity of gene-editing platforms and pioneering novel delivery systems to guarantee both therapeutic efficacy and clinical safety.

Also flagged:Systemic lupus erythematosusSLEchronic autoimmune diseaseautoantibodiesChildhood-onsetcSLE
Journal Article 2025-10-01 No Snippets de Aquino BM, Mazzola TN, Julio PR, Silva RM, Sepresse SR, Niewold TB, Appenzeller S.
Show Full Abstract

<h4>Introduction</h4>Systemic lupus erythematosus (SLE) is a multisystem disease with a heterogenous pathophysiological mechanisms that lead to a variety of clinical, immunological, and neuropsychiatric manifestations.<h4>Areas covered</h4>In this review, we will summarize the current understanding of molecular pathways involved in SLE and neuropsychiatric manifestations, focusing on genetic and epigenetic mechanisms and the implications of these findings in differences observed in treatment response.<h4>Expert opinion</h4>Great progress has been made in understanding the heterogeneity in SLE, which may help direct therapy. However, neuropsychiatric manifestations still are a challenge in clinical practice, and future studies are needed to identify relevant diagnostic and prognostic biomarkers.