Also flagged:neuropsychiatric disordersketamineglutamateopioid receptorlactateto
Journal Article2025-11-30No SnippetsBoucherie DE, Reneman L, Booij J, Immink R, Hollmann MW, Schrantee A.
Show Full Abstract
Neuroimaging techniques offer valuable insights for understanding pharmacological treatment effects in neuropsychiatric disorders. Here, we present a novel approach that simultaneously assesses hemodynamic and neurometabolic brain responses to psychotropic drugs using interleaved pharmacological magnetic resonance imaging (phMRI) and pharmacological magnetic resonance spectroscopy (phMRS). This method was tested using a double-dose, placebo-controlled, randomized, crossover design using S-ketamine as the pharmacological agent. We acquired 7 Tesla phMRI and phMRS data to evaluate time- and dose-dependent effects of S-ketamine in 32 healthy controls. S-ketamine elicited robust phMRI responses in the dorsofrontal, cingulate, and insular cortices, which correlated with glutamate and opioid receptor maps and subjective dissociation scores. These hemodynamic changes were paralleled by increases in glutamate and lactate, especially at higher doses. Furthermore, accuracy in predicting received condition (placebo, a low, or a high S-ketamine dose) increased when combining both techniques. Here, we show for the first time that concurrent phMRI and phMRS assessments provide important complementary insights into the functional brain response to pharmacological interventions.
Also flagged:G-protein-coupled inwardly rectifying potassiumGIRK) channelsnociceptionirritable bowel syndromevoltage-gated calcium and potassium channelsG protein-coupled receptors
Journal Article2025-11-30No SnippetsBrizuela M, Bony AR, Garcia-Caraballo S, Adams DJ, Brierley SM.
Show Full Abstract
Chronic visceral pain is a key symptom of irritable bowel syndrome. Modulation of voltage-gated calcium and potassium channels by G protein-coupled receptors plays a key role in dampening nociceptive transmission. Both baclofen and the analgesic peptide α-conotoxin Vc1.1 activate GABA<sub>B</sub> receptors (GABA<sub>B</sub>R), resulting in inhibition of Ca<sub>V</sub>2.2 and Ca<sub>V</sub>2.3 calcium channels to reduce colonic nociception. Recent studies have also shown that GABA<sub>B</sub>R activation potentiates G-protein-coupled inwardly rectifying potassium (GIRK)-1/2 channels in mammalian sensory afferent neurons. In this study, we investigated the expression of these ion channel targets in rodent and human dorsal root ganglion (DRG) neurons, including those innervating the colon. We examined how Ca<sub>V</sub>2.2 and GIRK channel antagonists, as well as a GIRK channel activator, influence the passive and active electrical properties of adult mouse DRG neurons. We also assessed the effects of α-conotoxin Vc1.1 on neuronal excitability in the presence of the selective Ca<sub>V</sub>2.2 antagonist ω-conotoxin CVIE and the GIRK channel activator ML297. We further evaluated the impact of the GIRK channel antagonist tertiapin-Q on excitability in mouse colonic DRGs and afferents and explored the role of hyperpolarization-activated cyclic nucleotide-gated (HCN) channels. Our findings demonstrate that both Ca<sub>V</sub>2.2 inhibition and GIRK channel potentiation reduce excitability in mouse DRGs, likely mediating the antinociceptive effects of Vc1.1 and baclofen observed in vivo. However, GIRK channel potentiation appears to play only a limited role in modulating excitability in colon-innervating DRGs and colonic afferents. These findings suggest that neurons innervating different body regions use distinct mechanisms to regulate excitability and nociceptive signalling.
Journal Article2025-11-30✓ 1 SnippetLee L, Richards AL, Reddy N, Beers B, Golden L, Kong R.
In-Text Gene Mentions
Abstract)
…bioavailable, small moleculeHTTgene splicing modifier…
Show Full Abstract
Votoplam is a novel, orally bioavailable, small molecule HTT gene splicing modifier that is being developed for the treatment of Huntington's disease. This was a single dose, open-label, two-period, crossover food effect study that evaluated the effect of high- and low-fat meals on 20 mg votoplam in healthy participants. There was a washout of 21 days between the two periods. Twenty-six participants completed the study. There were minimal changes in the bioavailability and pharmacokinetics of votoplam following administration of a single dose of 20 mg votoplam when taken with low-fat and high-fat meals relative to fasted condition. The mean C<sub>max</sub>, AUC<sub>0-last</sub>, and AUC<sub>0-inf</sub> for votoplam following administration of a single dose of 20 mg votoplam were 1.4-fold, 1.2-fold, and 1.1-fold higher, respectively, in high-fat fed conditions, and were 1.3-fold, 1.1-fold, and 1.1-fold higher, respectively, in the low-fat fed conditions, when compared to fasted conditions. There were no relevant safety findings in any of the treatment groups. Votoplam can be administered with or without food in patients.
Also flagged:osteoporosislactationbone formationWNTCOL1A1COL1A2
Journal Article2025-11-30No SnippetsLynch L, Shea PR, Vena N, Chung WK, Shane E, Kamanda-Kosseh M, Barry J, El-Najjar D, Agarwal S, Kondapalli A, Colon I, Bucovsky M, Cohen A.
Show Full Abstract
Pregnancy- and lactation-associated osteoporosis (PLO) describes a fragility fracture presentation around pregnancy/lactation. Presentation often includes multiple vertebral fractures, but can also involve hip, sacral/pelvic, or other fractures. Substantial bone structural deficits and low bone formation rate have been documented. Most have no known secondary cause. Many have a history of childhood fracture and/or family history of osteoporosis. These characteristics, together with early onset and disease severity, lead to the hypothesis that genetic factors may contribute to PLO. We enrolled 110 women with PLO (mean #fractures = 6, vertebral fractures in 88 %) in an exome sequencing (ES) study. Analyses identified rare (<1 % allele frequency in gnomAD) predicted deleterious variants (RPDV) in 33/110 (30 %) women. All were heterozygous; two participants had multiple RPDV. No RPDV in COL1A1/COL1A2 were identified. 28/110 (25 %) had RPDV in genes related to WNT signaling, critical to bone formation: LRP5 (n = 19), LRP6 (n = 6), WNT1 (n = 2) or WNT1&LRP5 (n = 1). Seven had RPDV related to renal/calcium handling (SLC34A1, SLC34A3, SLC9A3), or other osteoporosis mechanisms (PLS3 (n = 3), HGD (n = 1)). Those with RPDV did not differ from those without in terms of BMD, fracture characteristics, and most clinical characteristics. Among 110 PLO women, exome sequencing analyses identified a potential genetic osteoporosis contribution in 30 %, suggesting that many genetic contributors to PLO have yet to be elucidated. The finding of variants related to WNT signaling in 25 % of the cohort is consistent with the predominantly low bone formation phenotype of PLO and may have implications for prognosis and treatment response.
Also flagged:thyroid disordershormonecancersadrenal disordersmetabolic disordersimmune system disorders
Journal Article2025-11-29No SnippetsEngelhardt J, Struwe N, Jansson A, Kos VM, Larsson M, Weiss JM.
Show Full Abstract
Humans are chronically exposed to mixtures of environmental contaminants. Exposure to endocrine-disrupting chemicals (EDCs) contributes to increased health impairment observed globally. This study aimed to evaluate the endocrine-disruptive and oxidative stress potential of a human-relevant, complex chemical mixture in vitro. By testing chemical class subgroup mixtures, the identity of toxicological drivers and mixture additivity could be investigated. A 50-component mixture was compiled based on Swedish human blood concentrations (xHBC), consisting of six subgroup mixtures: polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (PCB mixture), brominated flame retardants (BFR mixture), per- and polyfluoroalkyl substances (PFAS mixture), pesticide mixture, synthetic phenolic contaminants (phenol mixture), and phthalate mixture. These were tested in four chemically activated luciferase gene expression (CALUX) assays: dioxin responsive (DR-), estrogen receptor α (ERα-), androgen receptor. (AR-), and nuclear factor erythroid 2-related factor 2 (Nrf2)-CALUX, along with an adipocyte cell assay. The total mixture caused significant agonistic activity in DR- and ER-, and antagonistic activity in AR-CALUX at 0.1-15 xHBC, depending on the assay. Mixture additivity was assessed in ERα-, DR-, and anti-AR-CALUX using subgroup mixtures and the concentration addition (CA) model. The total mixture followed the CA model in ERα-, anti-AR- and DR-CALUX. The toxicological drivers of these activities were mainly the PCB and phenol mixture. A significant increase in differentiated adipocytes was observed at 100 xHBC. These results raise concerns regarding potential health effects on the endocrine system. The additive effects at human-relevant concentrations observed in this study motivate considering mixtures in regulatory contexts to protect the well-being of future generations.
Also flagged:cancerrectal cancercell cyclenecroptosisirontumor
Journal Article2025-11-29✓ 3 SnippetsLiu X, Lei X, Feng J, Xu L, Luo Y, Wang X, Wang N, Huang Y, Luo Y, Tian H, Liu B, Wang S, Huang L, Xu Z, Hu H, Liu C, Lang J, Liu D.
<h4>Background & aims</h4>The quiescence-activation transition of cancer stem cells regulated by environmental stimuli has been shown to potentially contribute to cancer maintenance and regrowth after therapy. However, little is known about how the neoplastic niche couples with neighboring signals to control the activation of quiescent rectal cancer stem cells during radiotherapy.<h4>Methods</h4>Lineage-tracing experiments were performed usingHopx<sup>CreERT2</sup>;Rosa<sup>tdTomato</sup> mice and organoids to visualize the dynamics and radioresistance ofHopx-expressing cells in vivo. BrdU pulse-chase assays and cell cycle analysis were used to identify whether Hopx<sup>+</sup> stem cells were label-retaining cells (LRCs). The paracrine pro-survival effect of radiotherapy-induced dying cancer cells on neighboring Hopx<sup>+</sup> quiescent stem cells was analyzed in the context of both apoptosis and necroptosis blockade. Human rectal cancer organoids and patient-derived xenografts (PDXs) were used to assess the radiotherapy-enhanced efficacy of Hopx targeting.<h4>Results</h4>Lineage tracing experiments revealed that Hopx<sup>+</sup> quiescent stem cell subpopulation exhibited an enhanced regeneration, which functionally drove the recurrence of rectal cancer after irradiation. Mechanistically, iron released from radiotherapy-induced tumor cell death triggered a Stat3-dependent pro-survival program in neighbor-surviving Hopx<sup>+</sup> quiescent stem cells. Interestingly, we demonstrated activated Hopx<sup>+</sup> cancer stem cells antagonized ferroptosis that should be caused by iron-overload via the inhibition of de novo lipid synthesis.<h4>Conclusions</h4>Collectively, quiescent cancer stem cells could establish a new dependency on anti-apoptotic programs in their dying neighbors. This study highlights targeting and regulating Hopx<sup>+</sup> quiescent stem cells could be a promising therapeutic approach to overcome the refractoriness of human rectal cancer.
Also flagged:RKIPcancerRaf kinase inhibitor proteinMAPKNF-κBPI3K
Journal Article2025-11-29No SnippetsMcWhorter R, Chouaib S, Bonavida B.
Show Full Abstract
The Raf kinase inhibitor protein (RKIP) functions as both a metastasis suppressor and immune enhancer, exerting its influence over several key oncogenic signaling pathways, including the MAPK, NF-κB, and PI3K pathways. Recent studies have highlighted a potential interplay between RKIP and hypoxia-inducible factors (HIFs), particularly in the hypoxic tumor microenvironment (TME). Hypoxia is known to reprogram cellular metabolism, enhance angiogenesis, and facilitate immune escape. Through analysis of cross-talk signaling pathways between RKIP and HIFs, we establish the presence of a dysregulated RKIP-hypoxia axis in cancer. Notably, many cancers simultaneously express low levels of RKIP and high levels of HIFs an expression pattern that strongly correlates with the emergence of immune evasion mechanisms. Herein, we report on the mechanisms by which this dysregulated axis mediates immune evasion. These include the molecular regulations of RKIP and HIFs expressions, and the low expression of RKIP and high expression of HIFs in several cancers. We report on the mechanisms underlying immune evasion by the RKIP-hypoxia axis by examining various factors intimately involved in immune evasion, such as the upregulation of PD-L1, matrix metalloproteinases (MMPs), anti-apoptotic molecules, CD47, and the enhanced frequencies of regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), tumor-associated macrophage (TAM) polarization, and decreased antigen presentation. Thus, hypoxia-induced repression of RKIP establishes a feedforward loop that sustains immune evasion and tumor aggressiveness. Therapeutically, we propose that targeting the RKIP-hypoxia axis offers a new strategy to restore immune surveillance and counteract tumor progression. We present various means to target the inhibition of hypoxia as well as the induction of RKIP. Elucidating the molecular crosstalk between RKIP and hypoxic stress responses opens a new paradigm for strategies that enhance the efficacy of immunotherapies and overcome tumor resistance.
Also flagged:glycolysisPostmenopausal osteoporosisestrogendeficiencybone remodelingbone resorption
Journal Article2025-11-29No SnippetsWu Q, Miao J, Chen Y, Yang Y, Liang H, Yu C, Wang C, Tu Y, Wu Y, Xu Y, Yang X, Kwan KYH, Shi C, Wang X, Xu J, Jin H.
Show Full Abstract
Postmenopausal osteoporosis (PMOP) arises from estrogen deficiency, which disrupts bone remodeling by shifting the balance toward bone resorption over osteogenesis. Glycolytic regulation has emerged as a critical mechanism governing osteoclast differentiation and resorptive activity. Blocking lactate transport through monocarboxylate transporters (MCTs) suppresses glycolysis, thereby attenuating these processes and highlighting MCT inhibition as a potential therapeutic target. The MCT inhibitor AZD3965 blocks lactate transport, thereby downregulating NF-κB/MAPK signaling, increasing intracellular lactate levels, and ultimately suppressing osteoclast formation and bone resorption in vitro. To achieve targeted delivery and reduce off-target effects, a bone-targeted, reactive oxygen species (ROS)-responsive nanocarrier (PH/DPA@A) was engineered by integrating a bone-affinitive DSPE-PEG-Asp<sub>8</sub> (DPA) ligand with a ROS-cleavable phenylboronic acid pinacol ester-hyaluronic acid (PH) shell to encapsulate AZD3965. The nanoparticles exhibited a mean diameter of ∼179 nm, well-defined ROS-triggered drug release kinetics, and high in vivo bone-targeting efficiency. In vitro, PH/DPA@A inhibited osteoclast formation and resorptive activity at levels comparable to free AZD3965, indicating preserved pharmacological potency. In ovariectomized (OVX) mice, systemic PH/DPA@A administration increased femoral bone mineral density and improved trabecular number, thickness, and connectivity, as confirmed by micro-computed tomography. These findings demonstrate that the bone-targeting, ROS-responsive design enables efficient in vivo delivery and metabolic modulation in osteoporotic bone, supporting PH/DPA@A as a multifunctional nanoplatform with translational potential for postmenopausal osteoporosis therapy.
Also flagged:neurotransmittersynapsesCas9ethanolbindingnucleotide
Journal Article2025-11-28✓ 5 SnippetsMüller F, Neuser S, Shrestha G, Neupane NP, Götze KJ, Brunetti-Pierri N, Terrone G, Reymond A, van Gassen KL, Brilstra E, Steindl K, Begemann A, Rauch A, Rips J, Fahham D, Barakat TS, Patat O, Mortreux J, Chau MHK, Rosenfeld JA, Mizerik E, Srivastava S, Luo X, Dahse AK, Scholz N, Das J, Roman G, Langenhan T, Abou Jamra R, Mrestani A, Ljaschenko D.
In-Text Gene Mentions
Abstract)
…regions encoding knownUNC13Cdomains caused a…
Title)
…nucleotide variants inUNC13Cassociated with neurodevelopme…
UNC13s are presynaptic proteins essential for neurotransmitter release at chemical synapses. In this study, we present eleven patients from nine families with severe neurodevelopmental impairments, who carry rare, biallelic <i>UNC13C</i> single-nucleotide variants (SNVs). Six missense variants, each identified in compound heterozygosity in one of three of these patients, were introduced into the <i>Drosophila melanogaster</i> ortholog <i>unc13</i> using a previously established CRISPR/Cas9-based method for rapid and scarless genomic modifications, hypothesising that they underlie the observed clinical manifestations. However, none of the introduced mutations influenced Mendelian ratios, negative geotaxis, or lifespan of the fruit flies. Interestingly, two variants located outside the gene regions encoding known UNC13C domains caused a decreased ethanol sensitivity in <i>Drosophila</i>, while the Thr1729Met substitution within the C<sub>1</sub> domain resulted in increased ethanol sensitivity. Molecular dynamics simulations of the latter mutant gene product suggested that the altered protein conformation enhances exposure of the ethanol-binding site, thereby increasing sensitivity to ethanol. These findings reinforce previous evidence highlighting the critical role of the C<sub>1</sub> domain in ethanol sensitivity. Given the involvement of the C<sub>1</sub> domain in synaptic plasticity this result might implicate an influence of the Thr1729Met on synaptic function.
Also flagged:globinβ-hemoglobinopathiesγ-globinBCL11Agene expressionCOUP-TFII
Journal Article2025-11-27✓ 2 SnippetsFrigo C, Pastori V, Zambanini G, Fabiano M, Ahmed S, Citterio E, Cantù C, Ronchi AE.
In-Text Gene Mentions
Discussion)
…target repressed bySOX6, 29 a known…
Discussion)
…parallel increase inSOX6, during the fetal…
Show Full Abstract
The reactivation of fetal globin genes is the most promising treatment for β-hemoglobinopathies. This implies the reversal of the naturally occurring hemoglobin switching. Here, we show that expression of the orphan nuclear receptor COUP-TFII in adult HUDEP2 erythroid precursor cells activates γ-globin (HbF) at the expense of β-adult globin by specific occupation of the 'adult' δ-β-region within the β-locus. Notably, although COUP-TFII and the main γ-globin repressor BCL11A-XL share a similar DNA binding consensus and a large number of chromatin targets, including the locus control region of the β-locus itself, they bind differentially to the γ and β promoters, eliciting an opposite transcriptional outcome. In addition, we find that COUP-TFII activates Lin28B, a known post-transcriptional repressor of BCL11A-XL. Our work identifies a molecular mechanism that could be leveraged to increase γ-globin levels in patients affected by β-hemoglobinopathies.
Also flagged:gene expressionTissuenucleusGATA4ZBTB11nitrogen
Journal Article2025-11-27✓ 1 SnippetChen L, Li H, Teng J, Wang Z, Qu X, Chen Z, Cai X, Zeng H, Bai Z, Li J, Pan X, Yan L, Wang F, Lin L, Luo Y, Sahana G, Lund MS, Ballester M, Crespo-Piazuelo D, Karlskov-Mortensen P, Fredholm M, Clop A, Amills M, Loving C, Tuggle CK, Madsen O, Li J, Zhang Z, Liu GE, Jiang J, Fang L, Yi G.
In-Text Gene Mentions
Results)
…high levels ofOLFM4and LGR5 and…
Show Full Abstract
The systematic characterization of cellular heterogeneity among tissues and cell-type-specific regulation underlying complex phenotypes remains elusive in pigs. Within the Pig Genotype-Tissue Expression (PigGTEx) project, this work presents a single-cell transcriptome atlas of adult pigs encompassing 229 268 high-quality nuclei from 19 tissues, annotated to 67 major cell types. Besides cellular heterogeneity within and across tissues, this work further characterizes prominent tissue-specific features and functions of muscle, epithelial, and immune cells. Through deconvoluting 3921 bulk RNA-seq samples from 17 matching tissues, this work dissects thousands of genetic variants with cell-type interaction effects on gene expression (ieQTL). By colocalizing these ieQTL with variants associated with 268 complex traits, new insights into the cellular mechanisms behind these traits are provided. Moreover, this work highlights that orthologous genes with cell-type-specific regulation in pigs exhibit significant heritability enrichment for some human complex phenotypes. Altogether, this work provides a valuable resource and highlights novel insights in cellular regulation of complex traits for accelerating pig precision breeding and human biomedical research.
Also flagged:Liver Injuryhepatic disordersicterushyperbilirubinemiaDILI-induced liver injury
Journal Article2025-11-27✓ 1 SnippetDevadkar A, Kanitkar S.
In-Text Gene Mentions
Discussion)
…Wilson’s disease, andhemochromatosisshould be ruled…
Show Full Abstract
<h4>Abstract</h4>Drug-induced liver injury (DILI) is a diagnostic dilemma, often mimicking other hepatic disorders and posing a significant clinical challenge. While pharmaceuticals are well-documented culprits, herbal and traditional medications, widely perceived as harmless, increasingly contribute to hepatotoxicity, particularly in the eastern parts of the world, where their use is prevalent yet unregulated. We present the case of a 58-year-old female with a 10-day history of jaundice and new-onset abdominal discomfort, with no identifiable risk factors, the only notable detail being her intake of Ayurvedic herbal preparations for joint pains, 3 months before the onset of symptoms. Physical examination revealed icterus, while laboratory work showed hyperbilirubinemia and elevated liver enzymes, which was suggestive of hepatic dysfunction with a cholestatic pattern (R ratio: 1.6). Extensive evaluation for viral, autoimmune, and metabolic causes was negative. Liver biopsy revealed focal hepatocellular necrosis, eosinophilic infiltration, and microvesicular steatosis, which are features of DILI. Applying the Roussel Uclaf Causality Assessment Method (RUCAM), the patient scored 7, indicating a probable link to the herbal medication. Supportive care was initiated, and liver function improved steadily, allowing for a safe discharge within a week. This case highlights the potential hepatotoxicity of certain alternative and traditional herbal medications and drugs, as these preparations may contain undisclosed or poorly regulated ingredients. Hence, thorough history-taking, awareness, and clinical suspicion coupled with structured causality tools like RUCAM can aid in the early diagnosis and timely intervention of DILI.
Also flagged:gene transferclustered regularly interspaced short palindromic repeatsCasCRISPR-Casgenetic diseasesCRISPR
Journal Article2025-11-27No SnippetsKantor B, Duke L, Bhide PG.
Show Full Abstract
The gene therapy landscape has evolved substantially in recent years, beginning with the approval of the first adeno-associated virus-based gene therapy, Luxterna, in 2017. Since then, the US FDA has approved nearly 30 new viral gene therapy programs, with notable examples including Zolgensma, Spinraza, Hemgenix, Zynteglo, Lyfgenia, Kymriah, Skysona, and Tecelra. Remarkably, all these products rely on delivery via adeno-associated vectors (AAVs) and lentiviral vectors (LVs). Improvements in viral-mediated gene transfer efficiency and clinical-scale manufacturing, together with immense commercial interest, have greatly propelled the clinical adoption of gene therapy products. In recent years, clustered regularly interspaced short palindromic repeats (CRISPR) and its related Cas proteins (CRISPR-Cas) have made significant advances in gene therapy, offering next-generation approaches for curative gene editing to treat genetic diseases and disorders. In this review, we examine the range of these therapeutics and their viral carriers, focusing primarily on LVs and AAVs. We provide a snapshot of the current status of the field and highlight some of the current challenges in the clinical application of gene therapy, with particular emphasis on viral CRISPR-Cas-based technologies and their future potential.
Also flagged:aschronic immune-mediated inflammatory disordersulcerative colitisinflammatory bowel diseaserheumatoid arthritispathogenesis
Journal Article2025-11-26✓ 1 SnippetMódos D, Thomas JP, Brooks-Warburton J, Poletti M, Bohar B, Liu Y, Madgwick M, Csabai L, Kang WX, Alexander-Dann B, Zoufir A, Sudhakar P, Cozzetto D, Fazekas D, Samarajiwa S, Carding SR, Powell N, Verstockt B, Bender A, Korcsmaros T.
In-Text Gene Mentions
Results)
…fibroblasts and LGR5+OLFM4+ stem cells in…
Show Full Abstract
Genome-wide association studies have identified numerous susceptibility loci in complex diseases, such as chronic immune-mediated inflammatory disorders (IMIDs), yet their impact on pathomechanisms remains poorly understood. Low effect sizes, polygenicity, and predominance within non-coding genomic regions remain major challenges to the functional interpretation of IMID-associated single-nucleotide polymorphisms (SNPs). To address this, we present a novel systems genomics approach which models the cumulative impact of non-coding SNPs on downstream cellular signalling and gene regulatory networks. Applying this to the prototypical chronic IMIDs of Crohn's disease (CD) and ulcerative colitis (UC), both forms of inflammatory bowel disease (IBD), we individually analysed 2,636 patient genomes. Signals from non-coding SNPs were found to propagate towards well-established and novel CD- and UC-associated pathogenic pathways through the signalling and gene regulatory layers. The SNP-propagated gene regulatory networks stratified CD and UC patients into distinct clusters corresponding to cell type-specific gene dysregulation and potential therapeutic response. This approach bridges the gap between genotype and phenotype, laying the foundations for accelerating precision medicine in complex diseases.
Also flagged:TirzepatideLiver Injurytype 2 diabetes mellitusobesitysemaglutideliraglutide
Journal Article2025-11-26✓ 1 SnippetSpaeth LD, Jordan KM, Barlow MP, Cottrell DA.
In-Text Gene Mentions
Discussion)
…titis, acetaminophen toxicity,hemochromatosis, Wilson disease, α-1-antitryp…
Show Full Abstract
<h4>Background/objective</h4>Tirzepatide is widely prescribed and generally considered safe. The objective of this report is to describe a patient with tirzepatide-induced liver injury and increase awareness of this rare complication.<h4>Case report</h4>A 60-year-old woman with type 2 diabetes mellitus and obesity presented with epigastric pain 21 days after starting tirzepatide 2.5 mg weekly. She previously received semaglutide and liraglutide (total 7 years) without hepatotoxicity. Isolated right upper quadrant abdominal tenderness was present. Alanine transaminase and aspartate transferase rose from mildly elevated to 1562 U/L and 1466 U/L (normal 0-35 U/L), respectively, in 24 hours, disproportionately versus alkaline phosphatase and bilirubin. Abdominal/pelvic computed tomography scan showed a mildly dilated common bile duct post cholecystectomy. Right upper quadrant ultrasound demonstrated fatty infiltration, confirmed by magnetic resonance cholangiopancreatography. Acute hepatitis panel, acetaminophen level, ceruloplasmin, liver/kidney microsome type 1 Ab, antimitochondrial antibody, α-1-antitrypsin, and alpha-fetoprotein tumor marker were normal. Following drug discontinuation, liver enzymes normalized after 24 days. Home medications were resumed except for tirzepatide, and aminotransferases remained normal at 3 months.<h4>Discussion</h4>Presentations of tirzepatide-induced liver injury include asymptomatic elevation of aminotransferases, nausea, vomiting, and abdominal pain, or, although extremely rare, hepatic failure. Risk factors and pathogenesis are undetermined.<h4>Conclusion</h4>This case documents hepatocellular injury specific to tirzepatide despite previous tolerance of glucagon-like peptide-1 receptor agonist therapy. Clinician awareness is important since initial symptoms may be mild and attributed to common gastrointestinal side effects associated with tirzepatide. Early diagnosis and drug discontinuation resulted in resolution. If unrecognized, although rare, severe hepatic dysfunction with associated complications can result.
Also flagged:DDGPM6Bbehavioralsubstance use disordersbehavioral addictionsgambling disorder
Journal Article2025-11-25✓ 2 SnippetsThorpe HHA, Cupertino RB, Pakala SR, Fontanillas P, Jennings MV, Yang J, Meredith JJ, Greenwood T, Bianchi SB, Vilar-Ribó L, Niarchou M, 23andMe Research Team, Elson SL, Ideker T, Davis LK, MacKillop J, deWit H, Gustavson DE, Mallard TT, Palmer AA, Sanchez-Roige S.
In-Text Gene Mentions
Text
…MMS22L…
Text
…POU3F2…
Show Full Abstract
Delay discounting (DD), a person's preference for smaller immediate rewards over larger delayed rewards, is a heritable trait that is associated with psychiatric and physical outcomes, yet the biological mechanisms underlying these links are not known. We performed a GWAS of DD using 134,935 23andMe research participants and identified 11 genome-wide significant loci. We did not replicate our previously reported association with rs6528024 (chrXq13.3, GPM6B; P = 5.30 × 10<sup>-02</sup>). The SNP-heritability of DD was 9.85 ± 0.57%. We observed genetic correlations between DD and 73 behavioral, physical, and neuroimaging traits, many of which persisted even after accounting for educational attainment, intelligence, and executive function. Network analysis revealed that the associations between DD and certain traits were explained by both overlapping and trait-specific biological processes. In a hospital-based cohort (N = 66,917), DD polygenic scores were associated with 212 medical conditions. These results demonstrate that DD has a pleiotropic and polygenic common variant architecture, and is genetically associated with numerous outcomes, making it a promising endophenotype for psychiatric and physical health.
Also flagged:tumorwaxdegradationgold nanoparticlessynthesisgadolinium
Journal Article2025-11-25No SnippetsUliss P, Gkouzioti V, Hanggai W, Kahler F, Aprea E, Jia Q, Frimat JP, Brück E, Boutry CM.
Show Full Abstract
Magnetothermal stimulation is key in biomedical applications like tumor ablation, drug delivery, and regenerative therapies. A common method involves injecting magnetic particles that heat under an alternating magnetic field (AMF). However, uncontrolled heating can damage healthy tissues. Maintaining temperatures below 45 °C is critical. Using materials with a Curie temperature (T<sub>c</sub>) near this limit offers a self-regulating solution, as magnetization-and thus heating-drops sharply at T<sub>c</sub>. This study explores Mn<sub>0.65</sub>Fe<sub>1.30</sub>P<sub>0.65</sub>Si<sub>0.37</sub> (MCM), a magnetocaloric material composed of non-toxic elements and featuring a tunable T<sub>c</sub>. It is engineered to exhibit a T<sub>c</sub> of 43 °C, close to the safe physiological threshold. MCM particles are encapsulated in a wax matrix to form a composite that responds to AMF exposure. Heat generated by MCM particles triggers the wax phase transition, while the obtained T<sub>c</sub> enables the composite to achieve self-limiting thermal regulation under magnetic field exposure. Biocompatibility tests using human umbilical vein endothelial cells (HUVECs) show over 90% cell viability in direct and indirect contact. Stability tests in phosphate buffers at 37 °C confirm controlled degradation over 28 days. These results demonstrate that MCM is a promising, burn-free magnetic material for safe, localized heating, supporting its use in self-regulating, temperature-responsive biomedical systems.
Also flagged:Cancerscancerovarian cancerlung cancercolorectal cancercolorectal cancers
Journal Article2025-11-25✓ 2 SnippetsWang M, Jin B, Dai X, Huang H, Liu Q, Zhu J, Ju H, Chen Q, Song Y, Tan W, Liu Y.
In-Text Gene Mentions
Methods)
…PROS1), and antithrombin‐III (SERPINC1) were purchased from…
Results)
…LC1‐FN1, LC3‐FGA, and LC4‐SERPINC1for lung cancer.…
Show Full Abstract
Clinical in vitro diagnosis is essential in early diagnosis and prognostic assessment, yet antibody-based assays face limitations in multiplexity and scalability. To address the growing demand for modern molecular diagnostics, a multivalent aptamer corona platform for high-throughput is introduced and multiplexed multi-cancer diagnosis. With clinical serum samples, ovarian cancer-, lung cancer-, and colorectal cancer-based aptamer coronas are obtained through several rounds of alternating positive and negative systematic evolution of ligands by exponential enrichment (SELEX). Leveraging a de novo ProteoFish-SELEX strategy, which integrates nanoparticle-protein corona technology, a multivalent aptamer corona is evolved. Proteomic profiling of protein coronas revealed cancer-associated protein signatures, while aptomic profiling of aptamer coronas identified high-affinity cancer-specific aptamers. With these aptamers, high diagnostic accuracy is demonstrated in multiplexed multi-cancer detection using clinical cohorts. Multivalent aptamer corona's outstanding diagnostic performance, multiplexed detection capability, and sequencing-enabled high-throughput potential position it as a promising versatile tool for novel biomarker discovery and a transformative advancement in precision oncology.
Also flagged:ischemiastrokebehavioralprotein synthesispolymerasetranslational
Journal Article2025-11-25No SnippetsPuente-Sanz A, Herrero-González A, Pérez-Rodríguez D, Gonzalo-Orden JM, Letek M, Anuncibay-Soto B, Fernández-López A.
Also flagged:coppercuproptosispathogenesismetabolismdeathbinding
Journal Article2025-11-25No SnippetsDu W, Wu T, Fan Y, Zhao M.
Show Full Abstract
Copper is an essential cofactor for neuronal metabolism, enzymatic functions, and neurotransmission. However, copper dyshomeostasis-induced redox activity makes the brain vulnerable to oxidative and proteostatic stress. Cuproptosis, a recently characterized form of programmed cell death, is triggered by copper binding to lipoylated enzymes of the tricarboxylic acid cycle, resulting in proteotoxic stress, mitochondrial dysfunction, and cell death. Given that mitochondria are central to copper handling and the primary site of cuproptosis, we examine mitochondrial pathways and key cuproptosis-related genes. We also assess disease-specific signatures of copper imbalance. In Alzheimer's disease, excess copper binds to amyloid-β, promoting aggregation and neurotoxicity. In Parkinson's disease, copper-bound α-synuclein fosters aggregation, while copper-driven redox cycling elevates reactive oxygen species. Cuproptosis worsens mitochondrial vulnerability in Parkinson's disease and impairs cellular stress responses in Huntington's disease. In amyotrophic lateral sclerosis, superoxide dismutase 1-related defects compromise antioxidant defenses alongside copper-dependent mitochondrial dysfunction. In prion diseases, copper facilitates prion protein misfolding and toxicity. Across these disorders, common features include mitochondrial dysfunction and cuproptosis hallmarks-such as enhanced protein lipoylation, elevated reactive oxygen species, impaired electron transport chain activity, fragile Fe-S clusters, and increased reliance on the tricarboxylic acid cycle-which collectively increase neuronal susceptibility to copper dyshomeostasis. Clarifying and understanding the critical roles of copper metabolism not only elucidates the pathogenesis of neurodegenerative diseases but also offers alternative therapeutic strategies. This review uniquely integrates the mitochondria-centered cuproptosis axis with copper dyshomeostasis across Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and prion diseases, mapping convergent vulnerabilities to mechanism-grounded interventions and outlining testable translational routes.
Also flagged:irontumordisulfidehydrogenIg-like C1cancer
Journal Article2025-11-24✓ 1 SnippetIslam MS, Tanha TH, Zarin N, Haque S, Shiddiky MJA, Lam AK, Gopalan V.
In-Text Gene Mentions
Abstract)
…strongly associated withhemochromatosis, an autosomal recessive…
Show Full Abstract
Mutations in the <i>HFE</i> gene, especially non-synonymous single-nucleotide polymorphisms (nsSNPs), are strongly associated with hemochromatosis, an autosomal recessive disorder characterized by intracellular iron overload, a key feature of tumor development. This study examined the structural and functional effects of deleterious nsSNPs in the <i>HFE</i> gene using bioinformatics tools, gene interaction analyses, molecular docking, molecular dynamics (MD) simulations, and assessments of clinical relevance. Functional analyses identified nine deleterious nsSNPs, including C282Y, L183P, and Q283P, which disrupted disulfide bonds, hydrogen bonds, and hydrophobic interactions, destabilizing the protein. Conservation analysis revealed these mutations occur in highly conserved regions, emphasizing their structural and functional importance. Notably, five nsSNPs (R224Q, R224W, I235T, C282Y, Q283P) within the Ig-like C1-type domain were associated with cancer. Gene interaction analyses showed <i>HFE</i>-related genes are linked to immunity and iron balance. Variants in interacting genes, such as <i>HJV, TFR2, TFRC,</i> and <i>B2M</i>, may influence iron disorders, infection risk, and inflammation. Molecular docking showed reduced interface interactions for the C282Y mutant and altered binding to transferrin receptor 1 (TfR1), potentially destabilizing the HFE-TfR1 complex. MD simulations highlighted key differences, with the mutant showing higher RMSD, decreased compactness (Rg), increased flexibility (RMSF), and greater solvent exposure (SASA), confirming destabilization. Furthermore, <i>HFE</i> expression varied across cancers, with elevated levels in twelve tumor types. Higher expression correlated with better survival in breast and gastric cancers but poorer outcomes in lung cancer. These findings highlight how deleterious nsSNPs, especially C282Y, disrupt <i>HFE</i> structure and function, offering insights into disease mechanisms and guiding therapeutic strategies.
Also flagged:waterFluoresceinsulforhodamine BdextranFluor 488silane
Journal Article2025-11-24No SnippetsBreitfeld M, Strutt R, Fröhlich L, Dietsche CL, Bargfrede S, Dittrich PS.
Show Full Abstract
Liquids are dense repositories of information, challenged only by how well their compositions are defined, preserved, accessed, or measured. The precise spatial patterning of solutes within a bulk liquid is challenging since diffusion disperses local concentrations and thereby attenuates functionality. Herein, a new concept is introduced for writing and preserving information in the liquid state through liquid-in-liquid microdroplet array printing. This technology produces fine resolution, 2D liquid structures, composite of indexed water-in-oil droplet pixels each with a precise composition, a high spatial resolution and a tight inter-pixel pitch. With extreme control over droplet composition and by applying standard and custom encoding schemes, various forms of information are written biochemically such as images, QR codes, text characters and words. As a composite material, reversible phase transitions between dissolved liquid and crystallized solid states control information encryption and decryption. Compared to current liquid printing and chemical encoding paradigms, ours introduces a fundamentally new precedent for deterministically programming information release, exchange or decay without stimuli or physical processing. Further computational principles such as error correction and information storage are demonstrated. These micro-liquid patterns are relevant to any application based on precise liquid handling such as information theory, materials design and biological assays.
Also flagged:ADdementiaAPOE4glucoselipidmetabolism
Journal Article2025-11-24No SnippetsDi Lucente J, Rutkowsky JM, Errico Provenzano A, Persico G, Zhou Z, Jin LW, Ramsey JJ, Montgomery CB, Kim K, Giorgio M, Maezawa I, Cortopassi GA.
Show Full Abstract
The ε4 allele of apolipoprotein E (APOE4) is the strongest genetic risk factor for Alzheimer's disease (AD), increasing AD risk about fourfold in ~ 34 million American and ~ 75 million European females. APOE4 carriers exhibit cerebral metabolic deficits decades before clinical onset. We previously demonstrated that ketogenic diet (KD), a low-carbohydrate, high-fat diet promoting ketone metabolism, confers cognitive benefits in aged C57BL/6 mice, and in the PS1/APP mouse model of early-onset AD. Here, we evaluated the effects of KD in a humanized APOE4 AD mouse model. KD significantly improved composite cognitive performance and spatial working memory, with pronounced effects in females. Synaptic plasticity, measured via long-term potentiation (LTP), was likewise enhanced exclusively in females. Transcriptomic and protein analyses revealed KD-induced activation of CREB pathway, marked by increased phosphorylation of ERK and CREB in female brains. Moreover, KD selectively reduced pro-inflammatory cytokine levels in females. These findings demonstrate sex-specific neuroprotective effects of KD in APOE4 mice and suggest its potential therapeutic role in mitigating AD risk in APOE4-positive women.
Journal Article2025-11-24No SnippetsNeely M, Mongodin E, Whitson BA, Hachem RR, Anderson MR, Frankel C, Oyster ML, Shaver CM, Morrell ED, Aversa M, Damman AM, Christie J, Palmer SM, Lung Transplant Consortium Investigators and Steering Committee.
Show Full Abstract
The Lung Transplant Consortium (LTC), sponsored by the National Heart, Lung, and Blood Institute (NHLBI) is a 20-center collaboration among lung transplant programs in North America conducting both smaller multicenter projects and one consortium-wide prospective observational cohort study called the Prospective Multicenter Research on Donor and Recipient Management Strategies to Improve Lung Transplant Outcomes (PROMISE) Lung Study-for more information about the LTC, visit their website: https://lungtransplantconsortium.org/. The LTC conducted a meeting in April 2025 to strategize how to maximize the benefits of the PROMISE study to advance the field of lung transplant. This paper summarizes the key themes that emerged from the meeting: leveraging PROMISE data elements, including biomarkers, imaging, and PROs; clinical syndrome and consensus definitions; variation in management and management strategies; and future interventional trials leveraging the PROMISE consortium. The PROMISE study will serve as the platform for establishing best practices in lung transplant, inform the validity of newly identified syndromes, and support analysis of patient-reported outcomes, image data, and biosamples. The PROMISE study and LTC create a critically needed research platform and multicenter collaborative structure that may be adapted to conduct future multicenter clinical trials that will advance lung transplant medicine.
Also flagged:ExtracellularVesicleExtracellular vesiclesneurotrophic factorsneural stem cell differentiationcalcium
Journal Article2025-11-23No SnippetsMiller RC, Kang S, Wang J, Huang KY, Lee J, Kim YJ, Han HS, Kong H.
Show Full Abstract
Stem cell-derived neuron-glia models provide a robust platform for studying brain physiology, developing therapeutics, and exploring biocomputation. Extracellular vesicles (EVs) containing neurotrophic factors, also derived from stem cells, have the capacity to facilitate the formation of neural networks within these systems. However, their bioactivity is often compromised by the propagation of oxidative stress between cells during their manufacture, limiting reproducibility. Here, the Cellular Redox Spreading Shield (CROSS) is introduced as a droplet microfluidic-assembled antioxidant crystal-loaded microgel that sustains antioxidant activity for up to 6-7 days in stem cell cultures. In mesenchymal stromal cell (MSC) cultures, CROSS mitigates oxidation propagation and preserves potent neurotrophic EV production. These EVs, specifically enriched with neurotrophic microRNAs, enhance neural stem cell differentiation into neuron-glia networks, characterized by increased synaptic density and functional connectivity, as determined by calcium transient imaging combined with graph theory. In contrast, EVs from untreated, oxidatively stressed MSCs impair neural stem cell differentiation and network formation. This work highlights the importance of CROSS in stabilizing cellular production of neurotrophic EVs, with broad implications for neural tissue regeneration and biohybrid technologies.
Also flagged:hepatocellular carcinomatumorNotch1cancerICAM1YY1
Journal Article2025-11-21✓ 1 SnippetZhu K, Zhang FP, Qin C, Song ZX, Yang CN, Lin SS, Yu XH, Wu WR, Liu CQ, Liu C, Xu LB.
In-Text Gene Mentions
Results)
…, ANXA1 ,TNFSF4, ZP3 ,…
Show Full Abstract
Immunotherapy has shown a modest clinical benefit in advanced hepatocellular carcinoma (HCC), probably due to tumor immunosuppressive functions. Although Notch1 signaling has been implicated in tumor immune escape, its underlying mechanism is unclear. Here, Notch1 signaling is established as a determinant of immunotherapy efficacy in HCC. Studies showed that high Notch1 expression correlates with poor progression-free survival and worse immunotherapeutic response in recurrent HCC patients, while Notch1 overexpression promotes cancer cell escape by inhibiting CD8<sup>+</sup> T cell activation. Mechanistically, Notch1 overexpression upregulates the expression of transcriptional factor YY1 (Yin-Yang 1), which in turn represses ICAM1 expression to prohibit CD8<sup>+</sup> T cell-derived granzyme-driven cancer cell pyroptosis and cytotoxicity. Finally, co-administration of a PD-L1 antibody with PEI-siYY1 represses HCC tumor growth without causing severe adverse effects, as observed with the Notch1 inhibitor DAPT. The results establish that targeting Notch1-YY1-ICAM1 signaling axis may enhance immunotherapy efficacy by activating CD8<sup>+</sup> T cell-driven cancer cell pyroptosis, providing a safe and effective treatment strategy for HCC patients.
In fishes and aquatic-stage amphibians, mechanosensory neuromasts are arranged in characteristic lines in the skin of the head and trunk, with afferent innervation from anterior or posterior lateral line nerves. In electroreceptive non-teleost jawed fishes and amphibians, fields of electrosensory ampullary organs flank some or all of the cranial neuromast lines, innervated by the anterior lateral line nerve. Like the mechanosensory hair cells found in neuromasts and the inner ear, electroreceptor cells in ampullary organs across vertebrates form specialised ribbon synapses with afferent nerve terminals. Ribbon synapses in hair cells are distinct from other glutamatergic synapses, including the ribbon synapses in photoreceptors: In hair cells, synaptic vesicles are loaded with glutamate by vGlut3 and otoferlin is the Ca<sup>2+</sup> sensor for synaptic vesicle exocytosis. We previously showed that the genes encoding vGlut3 and otoferlin are expressed by ampullary organs as well as neuromasts in a chondrostean ray-finned fish, the Mississippi paddlefish (Polyodon spathula), suggesting that electroreceptor ribbon synapses are very similar to those in hair cells. In this study, we selected additional synapse-related candidate genes from our previously published dataset of putatively lateral line organ-enriched genes from late-larval paddlefish, and examined their expression in developing lateral line organs in a more experimentally tractable chondrostean, the sterlet sturgeon (Acipenser ruthenus). We found that sterlet ampullary organs express genes encoding vGlut3 (as expected from paddlefish) and the high-affinity glutamate re-uptake transporter EAAT1 (GLAST). Sterlet ampullary organs also express Otof (also expected from paddlefish, though we identified one Otof transcript variant maintained in ampullary organs but not neuromasts) and two other hair cell synapse-associated genes, Apba1 (Mint1) and Rab3a. Genes encoding the presynaptic cell adhesion molecule Nrxn3, the calcium-independent synaptotagmin Syt14, the calmodulin regulator protein PCP4 (PEP-19) and cell adhesion molecule DSCAML1 were expressed in both neuromasts and ampullary organs. In contrast, Cbln18, encoding a secreted trans-synaptic scaffolding protein, was only expressed in neuromasts and Tulp1, encoding tubby-related protein 1 (required for the development and function of photoreceptor ribbon synapses), was only expressed in ampullary organs. Overall, our results support electroreceptor ribbon synapses in non-teleost ray-finned bony fish being glutamatergic and suggest further commonalities, but also some differences, with hair cell ribbon synapses.
Also flagged:clubfootnucleotideDMPKPIEZO2TRPV4PTPN11
Journal Article2025-11-21✓ 1 Snippetde Vries JM, Arduç A, Waisfisz Q, B Tan-Sindhunata M, Faas BH, van Leeuwen E, Linskens IH, Pajkrt E.
In-Text Gene Mentions
Results)
…pathogenic variant inSERPINC1(Table 2b ).…
Show Full Abstract
This study evaluates the diagnostic genetic yield in fetuses sonographically suspect of having isolated clubfoot. We conducted a retrospective study on all fetuses with apparently isolated clubfoot on initial ultrasound, examined between January 2021 and December 2024. Clubfoot was classified as isolated when no additional structural anomalies were observed on initial imaging. Among 218 cases, 140 (64%) were classified as isolated. Prenatal genetic testing was performed in 64 of these cases (46%), of which 61 (95%) underwent both copy number variant (CNV) and single nucleotide variant (SNV) analysis. In 38 of the 61 (62%) cases targeted investigation of the DMPK gene was carried out too. Pathogenic or likely pathogenic causative variants were identified in six of the 61 (9.8%) pregnancies: two of the 26 tested (7.7%) with unilateral clubfoot and four of the 35 tested (11.4%) with bilateral clubfoot. These include SNVs in TRPV4, PTPN11, BBS2, and MED13L (4/61 = 6.6%) and two CNVs, a de novo 22q11.23 deletion, and a de novo 5q21.1q31.1 deletion (2/61 = 3.3%). One case remained unsolved due to the identification of a variant of uncertain significance (VUS) in PIEZO2. Three cases revealed unsolicited findings unrelated to the indication for testing. Our findings highlight the diagnostic yield of prenatal CNV- and SNV-testing in cases of suspected isolated clubfoot, but does not support systemic testing for DMPK. Although broad genetic testing can support diagnosis and counseling, challenges remain in interpreting results and managing unsolicited findings.
Also flagged:Endometriosisestrogeninflammatory disorderco-localisationIL-6inflammatory responses
Journal Article2025-11-20✓ 2 SnippetsWarren A, Andreou D, Warren D, Wieland J, Mantzouratou A.
In-Text Gene Mentions
Discussion)
…factors; ZNF701, SOX4,SOX6, FOXD3 and SOX11,…
Discussion)
…exposure increases SOX4,SOX6, and SOX11 […
Show Full Abstract
Endometriosis is a chronic, estrogen-driven inflammatory disorder affecting approximately 10% of reproductive-aged women globally. Despite increasing genomic insights into advanced-stage disease, the genetic underpinnings of early-stage endometriosis remain poorly understood, limiting opportunities for timely diagnosis and intervention. This study explores the contribution of regulatory variants, including those derived from ancient hominin introgression, and their interaction with modern environmental exposures in shaping endometriosis susceptibility. We conducted a dual-phase literature review to identify genes implicated in endometriosis pathophysiology and endocrine-disrupting chemical (EDC) sensitivity. Five genes (IL-6, CNR1, IDO1, TACR3, and KISS1R) were selected based on tissue expression, pathway involvement, and EDC reactivity. Whole-genome sequencing (WGS) data from the Genomics England 100,000 Genomes Project were analysed in nineteen females with clinically confirmed endometriosis. Variant enrichment, co-localisation, and linkage disequilibrium analyses were conducted, and functional impact was evaluated using public regulatory databases. Six regulatory variants were significantly enriched in the endometriosis cohort compared to matched controls and the general Genomics England population. Notably, co-localised IL-6 variants rs2069840 and rs34880821-located at a Neandertal-derived methylation site-demonstrated strong linkage disequilibrium and potential immune dysregulation. Variants in CNR1 and IDO1, some of Denisovan origin, also showed significant associations. Several of these variants overlapped EDC-responsive regulatory regions, suggesting gene-environment interactions may exacerbate risk. These findings propose a novel perspective of endometriosis susceptibility, in which ancient regulatory variants and contemporary environmental exposures converge to modulate immune and inflammatory responses. This integrative approach identified new potential biomarkers for early-stage detection of endometriosis.
Also flagged:brain injuryCRE2CRE3CRE4CRE6neurogenesis
Journal Article2025-11-19No SnippetsChen J, Takamiya M, Hendriks A, Beil T, Várnai C, Diotel N, Rastegar S.
Show Full Abstract
Zebrafish is a powerful animal model for studying nervous system regeneration due to its remarkable regenerative abilities and the availability of diverse molecular tools. After telencephalic brain injury, neural stem cells (NSCs) in the ventricular zone (VZ) become activated, proliferate, and generate new neurons essential for brain repair. However, the molecular mechanisms regulating these processes remain unclear. Here, we investigate the transcriptional regulation of midkine-a (mdka), a heparin-binding growth factor gene encoding the secreted protein Midkine-a (Mdka), which is upregulated after injury in radial glial cells (RGCs), the bona fide NSCs of the adult zebrafish telencephalon. Using genome-wide bioinformatic analysis, we identified six putative cis-regulatory elements (CREs) associated with mdka. Transgenic assays revealed that these CREs coordinate mdka expression during both development and regeneration. In the zebrafish embryo, CRE2, CRE3, CRE4, and CRE6 are required for EGFP expression in the nervous system, with CRE3 showing the strongest activity. In the adult telencephalon, CRE2, CRE4, and CRE6 are active in NSCs, with CRE2 best mimicking mdka expression at the ventricular zone. Importantly, individual CREs could not fully reproduce endogenous mdka expression, especially under regenerative conditions. In contrast, a combined CRE2346 construct closely recapitulated mdka expression in both the embryo and adult telencephalon under homeostatic conditions. These results suggest that mdka expression is controlled by a modular and cooperative cis-regulatory architecture that enables precise gene regulation during development, telencephalon homeostasis, and regeneration.
Also flagged:oxygenorganellestransportersironsuperoxideaging
Journal Article2025-11-19✓ 1 SnippetKeele GR, Dzieciatkowska M, Hay AM, Vincent M, O'Connor C, Stephenson D, Reisz JA, Nemkov T, Hansen KC, Page GP, Zimring JC, Churchill GA, D'Alessandro A.
In-Text Gene Mentions
Results)
…(CAT), peroxiredoxin 6 (PRDX6), and glutathione peroxidase…
Show Full Abstract
Red blood cells (RBCs) transport oxygen but accumulate oxidative damage over time, reducing function in vivo and during storage, critical for transfusions. To explore the genetics of RBC resilience, we profiled proteins, metabolites, and lipids from fresh and stored RBCs from 350 genetically diverse mice. Our analysis identified over 6,000 quantitative trait loci (QTLs). Compared to other tissues, the prevalence of trans genetic effects over cis ones reflects the absence of de novo protein synthesis in anucleated RBCs. QTL hotspots at Hbb, Hba, Mon1a, and (storage-specific) Steap3 linked ferroptosis to hemolysis. Proteasome QTLs clustered at multiple loci, underscoring the importance of degrading oxidized proteins. Post-translational modification (PTM) QTLs mapped predominantly to hemoglobins, including cysteine residues. The loss of reactive C93 in humanized mice (hemoglobulin beta [HBB] C93A) disrupted redox balance, glutathione pools, glutathionylation, and redox PTMs. These findings highlight genetic regulation of RBC oxidation, with implications for transfusion biology and oxidative-stress-dependent hemolytic disorders.
Also flagged:Steroid hormonesagingsteroidflutamidetestosteronemitochondrial
Journal Article2025-11-19No SnippetsDavis LK, Anders MM, Guerin SP, Khoury SE, Thompson LM, Darling JS, Gore AC, Fonken LK.
Show Full Abstract
Microglia, the resident immune cell of the central nervous system (CNS), contribute to a range of physiological processes across the lifespan. Microglia exhibit notable sex differences in morphology, reactivity, and transcriptomic profiles. Steroid hormones in early life are believed to elicit sex differences in many cells, including microglia, in the CNS. However, few studies have examined how neonatal hormone environment impacts microglial morphology and function across the lifespan. Therefore, here we used steroid hormones to manipulate the early hormone environment to assess the appearance and persistence of sex differences in a rat model of healthy aging. Rat pups were dosed with steroid hormones on postnatal day (P)0 and 1: females received testosterone to "masculinize" them and males received flutamide, an androgen antagonist, to "feminize" them. Brain tissue was then collected at three distinct developmental timepoints: adolescence (P30), adulthood (P150), and aging (P700) for immunohistochemistry and ex vivo microglial stimulation. Transcriptomic changes in hippocampal tissue of aged animals were also assessed using 3'UTR biased transcriptome sequencing (Tag-seq). We report that testosterone treatment in females leads to lifelong alterations in body size and vaginal morphology and results in microglia that display a more "masculinized" phenotype compared to controls. Flutamide had more moderate effects on microglia morphology in males, contributing to a more "feminized" phenotype in the hippocampus in adult and aged males. Testosterone treatment also resulted in greater transcriptomic changes in the aged hippocampus compared to flutamide treatment, especially in genes related to mitochondrial function and inflammation. These results indicate that (1) early hormone environment is critical for the induction of sex differences in microglial morphology and (2) sex differences in microglial morphology reverse during aging, and this reversal is also recapitulated with early hormone treatment.
Also flagged:autoantibodiestumour-associated antigensprostate cancerimmune responseTumour-
Journal Article2025-11-18✓ 2 SnippetsQiu C, Wang X, Francia G, Casiano CA, Zhang JY.
In-Text Gene Mentions
Results)
…P53, PDIA1, PIK3CA,PRDX6, PTEN, ROA2, and…
Results)
…and HNRDL withPRDX6(Fig. 4b ).…
Show Full Abstract
<h4>Background</h4>Genomic alterations can drive tumorigenesis, and understanding the immune response to those alterations may aid in developing new targets for diagnosis and therapy. Tumour-associated antigens (TAAs) are self-antigens that are abnormally expressed in tumours. Autoantibodies (AAbs) triggered by TAAs have been considered reporters of early carcinogenesis. This study aimed to profile AAbs to overexpressed or driver gene-related proteins (DRPs) in prostate cancer (PCa).<h4>Methods</h4>Twenty-nine targets including 14 overexpressed proteins and 15 DRPs were screened via serological proteome analysis and bioinformatics analysis, respectively. ELISA was then performed to assess their corresponding AAbs in 293 serum samples. Immunohistochemistry (IHC) was used to determine the tissue expression of TAAs.<h4>Results</h4>Nineteen AAbs showed significantly higher serum levels in PCa patients than in normal controls. A panel with four AAbs (PIK3CA, SPOP, IF4H, HSP60) was developed, showing an AUC of 0.901. A differential AAb response to these four TAAs was observed in three distinct PCa populations. The panel was evaluated across six other common cancers including 445 serum samples, showing potential for multi-cancer detection. High expression of the four TAAs targeted by AAbs was found in PCa tissues by IHC.<h4>Conclusions</h4>These findings suggest that overexpressed proteins or DRPs may have altered immunogenicity, leading to the production of corresponding AAbs.
Also flagged:placentitisNPamino acidcarbohydratemetabolismmucoid placentitis
Journal Article2025-11-18✓ 2 Snippetsvan Heule M, Verstraete M, Norris JK, Graniczkowsa KB, Scoggin KE, Ali HE, Ball BA, De Spiegelaere W, Daels P, Weimer BC, Dini P.
In-Text Gene Mentions
Results)
…( PML ,ZNFX1, IFI44L ,…
Discussion)
…including PML ,ZNFX1, IFI44L ,…
Show Full Abstract
<h4>Background</h4>Nocardioform placentitis (NP) is an understudied form of equine placentitis historically attributed to nocardioform bacteria, yet it remains uncertain whether these organisms are the sole pathogens involved.<h4>Objectives</h4>To elucidate the pathophysiology of NP and the host-pathogen interaction.<h4>Study design</h4>In vivo clinical multi-omics study.<h4>Methods</h4>Dual RNA sequencing was performed to profile transcriptionally active microbial communities and concurrent placental transcriptome responses in samples from 31 placentas with and without NP. Untargeted metabolomics was performed to study the associated metabolites in the placenta.<h4>Results</h4>The most abundant microbial transcripts belonged to Amycolatopsis, Crossiella, Lentzea, Enterococcus, and Mycobacterium. Bacterial gene expression in NP-affected placentas was enriched in pathways related to ribosomal activity and metabolic processes involving amino acid, carbohydrate, and glycosphingolipid metabolism. Concurrently, placental transcripts demonstrated significant upregulation of inflammatory pathways and downregulation of pathways associated with blood vessel formation. Untargeted metabolomics highlighted an elevated abundance of metabolites such as beta-D-fucose, nervonic acid, and zymostenol in the placentitis samples. Significant correlations were found between microbial genes (mraW, rlmB, amy, afuA, and cysC) and host inflammation genes (CXCL14, IL15RA, TASL, and IFIH1). Additionally, elevated beta-D-fucose, a microbe-specific metabolite, showed a strong correlation with microbial genes involved in stress-adaptive metabolism and DNA repair (ydhP, ybgC, serC, puuE, and radA). The bacterial enzymes involved in beta-D-fucose were notably upregulated and predominantly expressed by Amycolatopsis and Lentzea.<h4>Main limitations</h4>Classification based on RNA abundance limited the number of Crossiella cases (n = 3).<h4>Conclusions</h4>Both nocardioform and non-nocardioform bacteria are involved in NP-diagnosed cases, challenging the current generalisation of the term 'nocardioform placentitis' and supporting the need to broaden diagnostic protocols for mucoid placentitis. Multi-omics profiling revealed potential host-microbe interactions mediated by microbial metabolites, offering mechanistic insights and opportunities for improved diagnostic strategies.
Also flagged:pythium brain infectioninfectionhydrocephalusneoplasmmeningoencephalitissilver
Journal Article2025-11-17✓ 1 SnippetAlhamoud A, BinHussain I, Arishi H, Alqassimi H, Maashi T, Matabi S, Majrashi M, Mobarki M, Qumayri M, Dhayhi N.
In-Text Gene Mentions
Discussion)
…disease and secondaryhemochromatosis, and a 57-year-old…
Show Full Abstract
Human pythiosis, caused by <i>Pythium insidiosum</i>, is a rare and often fatal infection that carries high morbidity, particularly when the central nervous system is affected. We describe a severe case in a 2-year-old boy from Saudi Arabia who was previously healthy and presented with a two-week history of intermittent fever, diplopia, and abnormal limb movements, which progressed to generalized seizures and rapidly worsening neurological deficits. Initial imaging demonstrated space-occupying lesions in the basal ganglia and thalamus with extensive edema and hydrocephalus, raising suspicion for neoplasm or meningoencephalitis. Surgical intervention with craniotomy and external ventricular drain insertion was performed. Histopathological examination revealed necrotizing granulomatous inflammation containing rare fungal hyphae demonstrated by silver staining, while microbiological studies confirmed <i>Pythium</i> species. Despite antifungal therapy and intensive supportive care, the patient's condition deteriorated, and he died due to extensive brain involvement. Review of published literature indicates that central nervous system pythiosis is exceedingly rare, typically associated with rapid progression and uniformly poor outcomes, even with combined surgical and medical management. This case emphasizes the importance of maintaining clinical suspicion in children with unusual space-occupying brain lesions, the need for rapid histopathological and molecular confirmation, and the limitations of currently available treatment options. Early recognition and development of more effective therapies are urgently required to improve survival in pediatric patients with this devastating condition.
Also flagged:NMNAT2nicotinamide adenine dinucleotideproteinopathieschromosometranscription factorsSOX11
Journal Article2025-11-16✓ 1 SnippetChang YC, Yang S, Cho M, Nho K, Baizabal JM, Lu HC.
In-Text Gene Mentions
Discussion)
…CACNA1Eencodes calcium voltage‐gated…
Show Full Abstract
Nicotinamide/nicotinic acid mononucleotide adenylyltransferase 2 (NMNAT2) is a crucial enzyme for synthesizing nicotinamide adenine dinucleotide (NAD) and plays a vital role in neuronal health. NMNAT2 mRNA levels correlate positively with cognitive function in older adults but decline after injuries or proteinopathies. In this study, we used chromosome conformation capture followed by high-throughput sequencing (4C-seq) to unbiasedly identify NMNAT2 regulatory regions throughout the human genome. Using various bioinformatics analyses with these genomic regions, referred to as interactomes, we identified NMNAT2-associated genes and putative transcription factors (TFs). NMNAT2 transcription increases in SH-SY5Y cells when they differentiate into a neuron-like state. Excitingly, our 4C-seq data revealed distinct sets of interactomes interacting with the NMNAT2 promoter in undifferentiated versus neuron-like SH-SY5Y cells. Using the Religious Orders Study and the Rush Memory and Aging Project (ROSMAP) snRNA-seq data, we showed that the expression levels of many NMNAT2-associated genes are significantly correlated with NMNAT2 transcription in human neurons. Our biological validation studies confirmed the requirement of two specific genomic regions and four TFs, including cyclic AMP-dependent transcription factor ATF4, cyclic AMP-dependent transcription factor ATF-6 alpha (ATF6), transcription factor SOX11, and heat shock factor protein 1 (HSF1), in NMNAT2 transcription. ATF4 has been identified as an injury-responsive TF, whereas HSF1 is modulated by protein stress. Together, our study identifies distinctive genomic loci containing NMNAT2 regulatory elements in undifferentiated versus neuron-like SH-SY5Y cells, NMNAT2-associated genes, and putative NMNAT2-TFs.
Also flagged:coagulopathymulti‐organ failuredeathtraumametabolic acidosishemostasis
Journal Article2025-11-16✓ 3 SnippetsSingh K, Shoara AA, Peng HT, Prifti V, Moes K, McGuinness C, Bonnici T, Shiu M, Selvakumar SC, Andrisani P, Dion PM, Miller D, Vuong S, Kretz CA, Wallace PJ, Rhind SG, Sullivan-Kwantes W, Beckett AN.
In-Text Gene Mentions
Methods)
…lasminogen, antithrombin III (ATIII), protein S, and…
Results)
…FV, FVII, plasminogen,ATIII, and protein C…
Discussion)
…levels, FV, FVII,ATIII, and protein S.…
Show Full Abstract
<h4>Background</h4>Dried plasma offers a practical alternative for remote damage control resuscitation, providing hemostatic support and volume replacement. The Arctic presents challenges that necessitate the need for blood-based resuscitation to extend the "golden hour." To address this, we evaluated the hemostatic and thermal stability of dried plasma following exposure during military Arctic operations.<h4>Study design and methods</h4>OctaplasLG powder kits were deployed with Canadian Armed Forces medical providers during three Arctic operations. Dried plasma was subjected to substantial temperature fluctuations (-35.2 to 26.5°C) and multiple freeze-thaw cycles. Upon return, dried plasma was reconstituted and evaluated using hemostatic/coagulation panels and differential scanning calorimetry (DSC).<h4>Results</h4>Arctic-exposed dried plasma retained visual integrity and protein concentration consistent with controls. Hemostatic function, including prothrombin time, activated partial thromboplastin time, fibrinogen, D-dimer, factor V, factor VIII, plasminogen, antithrombin III, protein C, ADAMTS13, and viscoelastic profiles remained within normal ranges, with protein S activity below the lower limit. However, von Willebrand factor antigen levels were elevated in both dried plasma groups, though distribution remained normal and unlikely to be clinically significant for resuscitation. DSC thermograms revealed five characteristic thermal transitions consistent with controls, indicating preserved structural integrity. Enthalpy analysis demonstrated a strong correlation with fibrinogen concentration, suggesting its role in plasma stability.<h4>Conclusion</h4>Dried plasma retains its hemostatic and thermal stability following Arctic deployment, supporting remote damage control resuscitation in the absence of whole blood. Nonetheless, field implementation is challenged by the propensity of the diluent to freeze and the logistical requirement for warmed infusion.
Also flagged:Oxygencardiovascular diseaseinflammatory bowel diseasecoronary artery diseasepathogenesisfluoromisonidazole
Journal Article2025-11-15No SnippetsUbert CS, Petryakov SV, Kmiec MM, Daniel NJ, Kheirollah A, O'Connell RC, Kassey VB, Hoopes PJ, Kuppusamy P.
Show Full Abstract
<h4>Purpose</h4>Electron paramagnetic resonance (EPR) spectroscopy enables quantitative measurement of tissue oxygen levels. The conventional single-loop EPR resonator designs limit the oxygen measurements to superficial tissues within 1-3 cm depth and inadequately address clinical requirements for deep-tissue oxygen monitoring in anatomically complex regions and confined body cavities. The aim of this study was to develop a flexible RF coil-based sensor (OxyTrack) designed for real-time oxygen measurements in complex anatomical environments that are typically inaccessible to conventional rigid coil configurations.<h4>Methods</h4>The RF coil configuration of the OxyTrack included a catheter-like, flexible design that incorporates the OxyChip (oxygen sensor) in the resonant loop. A modified coaxial cable arrangement with braided shielding was used for cavity measurements. The constructed coil/sensor was evaluated for power saturation thresholding, oxygen sensitivity (calibration), mechanical stability, and integrity of the coil under various stress conditions. Biological validation studies were performed to test dynamic oxygen variations in the gastrointestinal tract (GI) of murine subjects.<h4>Results</h4>The flexible OxyTrack exhibited an oxygen sensitivity of 14.8 mG/mmHg with a linear response across physiological ranges (0-160 mmHg), maintaining signal integrity under various mechanical stresses. In vivo validation experiments in mice GI tracts demonstrated statistically significant discrimination of rectal tissue oxygenation between normoxic (0.52 ± 0.04 mmHg) and hyperoxic conditions (6.43 ± 0.24 mmHg) with p < 0.001. Pre-clinical imaging compatibility established the absence of significant artifacts.<h4>Conclusion</h4>This flexible RF coil sensor enables minimally invasive, real-time oxygen monitoring in complex anatomical locations, with implications for pre-clinical research and potential clinical translation in oxygen-related pathophysiology assessment.
Journal Article2025-11-15✓ 3 SnippetsSun M, Li S, Liu Y, Li F.
In-Text Gene Mentions
Results)
…including Fas2 ,ZNFX1, Gyc76c ,…
Discussion)
…including Fas2 ,ZNFX1, Gyc76C ,…
Discussion)
…ZNFX1, an interferon-inducible dsRN…
Show Full Abstract
<h4>Introduction</h4>The evolution of lymphoid organs is a complex topic in the animal kingdom. A presumptive invertebrate lymphoid organ (Oka) was previously reported in shrimp based on its morphological and histological observations. However, whether it truly functions as a lymphoid organ akin to those in vertebrates remains uncertain.<h4>Objective</h4>This study aims to characterize the cell composition of Oka at single-cell resolution and its function similarity with vertebrate lymphoid organs.<h4>Methods</h4>Single-nucleus RNA-seq and cross-species analysis were conducted to identify the major cell types in Oka of the whiteleg shrimp L. vannamei. The spatial expressions of the key genes were detected by in-situ hybridization and immunohistochemical analyses. Cytotoxic activity against heterologous cells was examined using fluorescence microscopy and flow cytometry.<h4>Results</h4>Oka comprised diverse cell types including ECM-producing cells, macrophage-like cells, lymphocyte precursor-like cells, capsular cells, hemocytes, SLC-rich cells, epithelial cells and progenitors. Notably, typical vertebrate macrophage markers (NLRP3, LAMP2 and LGMN) and ZAP-70, a marker of T lymphocytes/natural killer (NK) cells were expressed in the macrophage-like cells. The lymphocyte precursor-like cells, characterized by the expression of YBX3 and SOX4, were further distinguished by the up-regulated expression of CD39, CD49d, and CD133 homologues following WSSV infection. These two cell types were observed to migrate into the lymphoid organ spheroid during structural remodeling of the Oka following WSSV infection. Functionally, Oka cells of shrimp also exhibited cytotoxic activity against heterologous cells.<h4>Conclusion</h4>The presence and WSSV infection-induced aggregation of ZAP-70 positive cells in Oka of shrimp and its cytotoxic activity against heterologous cells suggest that shrimp Oka might perform similar function as the lymphoid organ in vertebrates. The present results will not only provide evidence to confirm the function of Oka in shrimp, but also greatly widen the knowledge about the origin and evolution of lymphoid organ in the animal kingdom.
Also flagged:metabolismstem‐cell differentiationhydrogenperoxidecysteinenucleoprotein reductase
Journal Article2025-11-14No SnippetsWang Y, Yang Y, Wang A, Shen C, Tan S, Liu C, Zhao Y, Qu X.
Show Full Abstract
Reactive oxygen species (ROS)-triggered oxidative eustress can stimulate regenerative signaling, yet its therapeutic window remains narrow. Mitochondrial respiratory complexes and superoxide dismutase (SOD) are canonical enzymatic sources of intracellular H<sub>2</sub>O<sub>2</sub>. Here we report a biomimetic polyphenol-amino acid nanozyme (PEAs) that couples the semiquinone radical of coenzyme Q (ubiquinone) with the Arg143 residue of Zn/Cu-SOD1. Through self-assembling epigallocatechin gallate (EGCG) and L-arginine (L-Arg), PEAs enable O<sub>2</sub> adsorption and activation with controlled H<sub>2</sub>O<sub>2</sub> generation. The H<sub>2</sub>O<sub>2</sub> output is finely tuned by modulating the nitrogen (N) content from L-Arg. Integrated experimental and computational analyses reveal that the N-sites introduced by L-Arg promote semiquinone electron delocalization, increase semiquinone abundance, thereby strengthening O<sub>2</sub> adsorption, facilitating electron/proton transfer, and lowering the reaction barrier for H<sub>2</sub>O<sub>2</sub> synthesis. Using the genetically encoded H<sub>2</sub>O<sub>2</sub> sensor HyPerion, this work validates the sustained intracellular modulation of H<sub>2</sub>O<sub>2</sub> by PEAs. In a mouse model of telogen effluvium, controlled H<sub>2</sub>O<sub>2</sub> delivery activates the follicular niche via Wnt/β-catenin upregulation and Ca<sup>2+</sup>/calcineurin/NFAT downregulation, resulting in robust follicle activation and a non-pharmacological approach to alopecia therapy. This polyphenol-amino acid nanozyme therefore provides a safe and effective strategy for in vivo pro-oxidative modulation, offering a tunable H<sub>2</sub>O<sub>2</sub>-based platform to harness beneficial oxidative stress for tissue renewal.
Also flagged:Intraperitonealintestinal obstructioninfertilityadhesionscoagulationextracellular
Journal Article2025-11-14No SnippetsPlaeke P, De Man J, Hong GS, de Bruyn M, De Meester I, Jorens PG, Augustyns K, Kalff JC, Wehner S, Hubens G, De Winter B.
Show Full Abstract
<h4>Purpose</h4>Intraperitoneal adhesions, a major cause of post-surgical intestinal obstruction, arise from an imbalance between proteases of the coagulation and fibrinolysis pathways. This study aimed to reduce early adhesion formation by using the protease inhibitors, nafamostat mesylate (NFM), UAMC-00050, enoxaparin, and GM6001, in the cecal ligation and puncture (CLP) model and the ischemic button (IB) model in mice.<h4>Methods</h4>Mice subjected to CLP received NFM (1, 10, or 20 mg/kg), UAMC-00050 (1 or 5 mg/kg), enoxaparin (1, 5, or 10 mg/kg), or GM6001 (100 mg/kg) in preventive, delayed, and combined setups. Adhesion severity was assessed 48 h post-CLP based on the extent, tenacity, and surgical access time. NFM and enoxaparin were tested further for 7 days in the IB model. Protease activity and gene expression were analyzed in NFM-treated mice.<h4>Results</h4>CLP induced adhesions more strongly than the sham procedure. Preventive NFM reduced the adhesion extent by 49.8%. Repeated enoxaparin administration reduced the extent, tenacity, and access time (-46%). UAMC-00050 and GM6001 had no effect. In the IB model, enoxaparin, but not NFM, reduced the adhesion surface area and tenacity.<h4>Conclusions</h4>Enoxaparin and NFM reduced adhesions effectively, suggesting that coagulation inhibition plays a key role. These findings suggest that selective protease inhibitors, when administered in a timely manner, could reduce intraperitoneal adhesions.
Also flagged:SIRT3honokiolphenolpoly-honokiolmitochondrial deacetylaseSOD2
Journal Article2025-11-14No SnippetsQiao X, Wang D, Zhu H, Zhang B, Sun H, Wang J, Tan G, Jiang L, Peng X, Zhang L, Wang L, Han S, Meng L, Duan W.
Show Full Abstract
<h4>Introduction</h4>Thoracic aortic dissection (TAD) is a life-threatening cardiovascular emergency with limited pharmacological treatment options.<h4>Objectives</h4>Building on the strong correlation between TAD and SIRT3 observed in our preliminary studies, we aim to leverage pharmacological interventions to enhance the clinical translation of this mechanism.<h4>Methods</h4>Based on the SIRT3 activator honokiol, we synthesized a highly efficient, pH-responsive and biodegradable poly-honokiol prodrug synthesized via a metal-free phenol-yne click polymerization strategy, achieving an unprecedented drug-loading content of 83.65%, and subsequently investigated its pharmacological activity and underlying mechanisms using a β-aminopropionitrile (BAPN)-induced TAD model.<h4>Results</h4>Compared with honokiol, poly-honokiol markedly improved survival and reduced TAD incidence in mice by preventing vascular smooth muscle cell (VSMC) loss. Mechanistic investigations reveal that poly-honokiol activates the mitochondrial deacetylase SIRT3, which induce the deacetylation of both the antioxidant enzyme SOD2 and the key ferroptosis regulator COX2, thereby reducing ferrous ion (Fe<sup>2+</sup>) accumulation and reactive oxygen species (ROS) levels while suppressing mitochondrial permeability transition pore (mPTP) opening, ultimately attenuating ferroptosis-induced VSMC loss.<h4>Conclusion</h4>Collectively, these findings demonstrate that poly-honokiol is a potent preventive candidate for TAD, offering both high drug-loading efficiency and targeted mitochondrial protection.
Also flagged:lactationgene expressiongestationmetabolismimmune responsecell junction
Journal Article2025-11-14✓ 1 SnippetPeng Y, Xuan B, Tian J, Guo Y, Cao J, Zhang L, Xuan R.
In-Text Gene Mentions
Results)
…VDR , andRC3H1exhibited stage-specific expre…
Show Full Abstract
<h4>Objective</h4>Mammary development and lactation are vital for piglet survival, but gene expression profiles from gestation to early involution (W2) in sows remain unclear. This study profiles key transcriptomic changes to reveal molecular features.<h4>Methods</h4>Mammary gland tissue samples were collected from hybrid half-sibling sows (Danish Landrace×Yorkshire) at five physiological stages: mid-gestation (MG), late gestation (LG), early lactation (EL), peak lactation (PL), and W2 (day 2 after weaning). Transcriptome sequencing (RNA-seq) was performed on 30 samples (n = 6 per stage). Differential expression analysis and clustering were conducted to identify expression patterns. Functional enrichment, pathway analysis, and weighted gene co-expression network analysis (WGCNA) were used to identify stage-specific regulatory networks and hub genes involved in mammary gland development, metabolism, immune response, and structural remodeling.<h4>Results</h4>Transcriptome profiling yielded over 61,000 expressed transcripts, with 27,244 shared across all stages. A total of 12,239 transcripts were differentially expressed, with the greatest transcriptomic shift occurring between PL and W2 (4,829 differentially expressed transcript [DETs]). DETs were grouped into five expression clusters, each showing stagespecific enrichment in biological processes. W2-associated transcripts were enriched in pathways related to cell junction integrity and apoptosis, while MG and LG stages were associated with proliferation and metabolic pathways. EL and PL stages showed enrichment in immune and lipid metabolism pathways. WGCNA identified nine gene modules, with modules linked to gestational growth (brown, blue), lactation (green, turquoise), and involution (yellow, turquoise). Key regulatory genes such as EGF, AKT1, SRC, GATA3, STAT6, TNFSF11, and NFKB1 were identified as central hubs within six major functional networks.<h4>Conclusion</h4>This study constructed a time-resolved transcriptomic atlas of porcine mammary gland development, lactation, and involution. It reveals gene expression dynamics, identifies candidate pathways, and delineates molecular signatures associated with structural and functional changes in the mammary gland. The findings offer potential targets and a theoretical framework for improving sow lactation performance and regulating mammary function.
Alopecia is a physical and mental health problem affecting all age groups, aesthetically or psychologically. Among its subtypes, androgenetic alopecia (AGA) is the most prevalent. This androgen-dependent, polygenic disease is hereditary and can occur as early as adolescence. Currently available therapies remain largely palliative and are often accompanied by adverse side effects. Here, we constructed a multifunctional system based on tetrahedral framework nucleic acids (tFNAs), in which quercetin was embedded within tFNAs to form a complex termed tFNAs-Que (TQC). We performed multimodal analysis, combined with transcriptomic analysis, to explore the activation and sustainable changes in the hair follicle cycle after TQC treatment. Our results showed that TQC maintained the stability of the epithelial structure and enhanced the regeneration of functional hair follicles by regulating both hair follicle stem cells (HFSCs) and dermal papilla cells (DPCs). Additionally, we identified a catalytic role of tFNAs. Overall, this study developed a dual-regulated nucleic acid nanoparticle, opening up new avenues for clinical translation in activating, stabilizing, and sustaining the hair cycle.
Also flagged:protein synthesisselenoproteinsseleniumpolypeptidesserineselenocysteine
Journal Article2025-11-14No SnippetsXia C, Wu Y, Zhang H, Qin L, Hu Y, Fu C.
Show Full Abstract
Selenoproteins represent a distinct class of proteins that incorporate selenocysteine (Sec), whose biosynthesis and translational integration are dependent on selenium availability and the presence of a selenocysteine insertion sequence (SECIS). These proteins are indispensable for redox regulation, antioxidant defense, and thyroid hormone metabolism, among other vital biological processes. Remarkably, selenoproteins act as critical regulators of cellular fate decisions, a function that hinges on Sec-a residue whose biosynthesis and translational incorporation into protein involve machinery far more intricate than that of canonical amino acids. This evolutionary adaptation, whether arising from stochastic mutational events or as an obligatory trade-off for functional precision, underscores the sophisticated molecular regulatory strategies in living organisms. In this review, we comprehensively outline the uptake and metabolic pathways of selenoamino acids in eukaryotes, with particular emphasis on the biosynthetic mechanism of Sec and its unique translational incorporation into selenoproteins. We systematically elucidate the multi-layered regulatory networks that govern these biological processes within cells. Furthermore, we present a taxonomic classification and functional synthesis of eukaryotic selenoproteins, accompanied by an in-depth analysis of their molecular roles in various pathological states. Special emphasis is placed on the glutathione peroxidase (GPX) family, especially GPX4, in ferroptosis regulation and its sophisticated control mechanisms. Additionally, this review summarizes key challenges in current selenoproteins research and explores potential therapeutic strategies for cancer treatment by targeting selenoproteins.
Also flagged:breast cancercancerdeathtumorregulation of gene expressionchromatin
Journal Article2025-11-13No SnippetsCuy Saqués A, Martinez-Mendez A, Crown J, Eustace A.
Show Full Abstract
Breast cancer's global prevalence underscores a critical need for novel biomarkers to guide treatment and improve patient outcomes. Biomarker discovery historically focused on mutations in protein coding regions, comprising merely 1% of the genome. However, with advances in whole-genome sequencing, the functional significance of the noncoding genome-comprising the remaining 99%-has become increasingly evident. Noncoding regions play a vital role in regulating gene expression, and mutations within these regions have been associated with cancer risk, progression, and treatment response. This Review compiles and synthesizes current knowledge on cis-regulatory alterations (promoters/enhancers) and long noncoding RNAs (lncRNAs) in breast cancer. Key examples include promoter mutations [e.g., rs2279744 (Mouse double minute 2 homolog gene; MDM2)], enhancer mutations [e.g., rs4784227 (thymocyte selection-associated high mobility group box family member 3 gene; TOX3)], and lncRNAs [e.g., HOX transcript antisense intergenic RNA (HOTAIR)] linked to progression, metastasis, and poor survival. Integrating preclinical (in vitro, in vivo) and clinical findings, we emphasize the biomarker and therapeutic potential of these noncoding alterations. This Review also critically identifies the pressing need for more specific functional validation studies to fully elucidate their mechanistic roles. This emerging field offers promising opportunities to advance personalized medicine and refine prognostic/predictive strategies for breast cancer patients.
Also flagged:-induced liver injuryDILIglutathionefatty acidcarnitinemetabolism
Journal Article2025-11-13✓ 1 SnippetDing X, Liu H, Qiu Q, Zhu K, Zhu X, Zhao R, Hu T, Sun Y, An Z.
In-Text Gene Mentions
Methods)
…fatty liver disease,hemochromatosis, Wilson disease, antitrypsin…
Show Full Abstract
Drug-induced liver injury (DILI) represents a major adverse drug reaction with significant clinical implications. The diversity of causative drug agents, incomplete understanding of pathogenic mechanisms, and absence of specific diagnostic biomarkers pose substantial challenges for DILI diagnosis and clinical management. This study aimed to characterize the metabolic heterogeneity across different types of DILI and identify high-specificity metabolic biomarkers for DILI classification. A multicenter targeted metabolomics study was conducted on 516 serum samples collected from 200 patients with DILI and 221 healthy controls. We characterized the metabolic dynamics throughout DILI progression, with significant disruptions presented in glutathione, fatty acid, and carnitine metabolism. By characterizing and comparing the metabolic profiles among antibiotics-, herbs-, non-steroidal anti-inflammatory drugs-, and statins-DILI patients, we constructed four drug-specific metabolic networks of DILI based on the metabolic coordination between metabolites. Notably, the elevated long-chain acylcarnitines (such as C18:1 Car and C16:2 Car) distinctively underlie herb-DILI's pathological progression. In monocrotaline-induced liver injury mouse models, hepatic carnitine acyltransferase II (Cpt2) mRNA expression was suppressed. Further, two-sample Mendelian randomization supported a causal relationship between C18:1 Car and total bilirubin levels. Finally, we developed a 10-metabolite classifier to distinguish between different DILI subtypes using machine learning algorithms, yielding accuracies of 0.915 and 0.904 on two independent test sets. These findings enhance the understanding of the metabolic heterogeneity in DILI and provide evidence supporting the use of responsive metabolic traits for the clinical diagnosis and treatment of DILI.
Also flagged:Transferrin ReceptorEsophageal Squamous Cell CancerESCCTfRirontumor
Journal Article2025-11-11✓ 2 SnippetsIkenaga N, Takahashi T, Tanaka K, Serada S, Fujimoto M, Momose K, Yamashita K, Makino T, Saito T, Yamamoto K, Kurokawa Y, Nakajima K, Fujii T, Morii E, Naka T, Eguchi H, Doki Y.
In-Text Gene Mentions
Introduction)
…the treatment ofhemochromatosis, are gaining interest…
Discussion)
…and efficacy inhemochromatosis, with optimal doses…
Show Full Abstract
Despite recent advancements in multimodal therapies for esophageal squamous cell cancer (ESCC), the prognosis remains poor. Identifying suitable biomarkers for predicting prognosis and exploring new therapeutic targets are essential to improving treatment outcomes in ESCC. In this study, we utilized proteomic technology to identify the transferrin receptor (TfR), the main cellular iron importer, as a novel tumor antigen in ESCC. The clinicopathological characteristics of TfR were evaluated by immunohistochemistry using ESCC specimens, revealing that high TfR expression was associated with poor prognosis. Knockdown of TfR in ESCC cell lines resulted in a decrease in intracellular iron levels and suppressed the proliferation of ESCC cell lines, inducing cell cycle arrest in the G0/G1 phase by inhibiting cyclin D, cyclin E, and cyclin-dependent kinase 2. Furthermore, the administration of deferoxamine (DFO), an oral iron chelator, induced a decrease in intracellular iron and suppressed the proliferation of ESCC cell lines and an increase in caspase 3 and 7 activity, indicating the induction of apoptosis. In an ESCC xenograft mouse model, the DFO-treated group exhibited decreased serum iron levels and reduced tumor size. Finally, we confirmed that the deficiency of iron in ESCC cell lines induced an increase in TfR expression via upregulation of iron regulatory protein 2. These findings suggest that TfR is an independent prognostic factor in ESCC and that targeting iron metabolism may be a promising therapeutic approach for improving ESCC treatment outcomes.
Also flagged:autoimmune diseasessystemic autoimmune diseasessystemic autoimmune diseaseHLArheumatic diseasessystemic lupus erythematosus
Journal Article2025-11-11No SnippetsRadziszewski M, Tessneer KL, Lessard CJ.
Show Full Abstract
Sjögren's disease (SjD) is the second most common systemic autoimmune disease in the United States. SjD patients are predominantly women 30-50 years of age and exhibit heterogeneous clinical manifestations, including symptoms of extensive dryness, chronic fatigue, and joint pain, and various major organ involvement. Late onset, clinical heterogeneity, and limited mechanistic understanding of its etiology frequently lead to delayed or misdiagnosis. Although the etiology of SjD is unclear, candidate gene studies and population-based genome-wide association studies suggest that SjD results from an interplay between genetics and environment. Defining the genetic susceptibility of SjD remains an important research focus to improve the understanding of SjD etiology and the development of diagnostic and treatment options. Unfortunately, the genetic understanding of SjD lags far behind that of other related autoimmune diseases. This review provides a brief history of key milestones in the field of SjD genetics and highlights several areas of future research that will bolster the discovery power of ongoing genetic studies and define the underlying mechanisms that drive disease etiology.
Also flagged:nanofiberdissectionaneurysmaortic dissectionpolytetrafluoroethylenepolyester
Journal Article2025-11-11No SnippetsShahbad R, Zermeno E, Razian SA, Maleckis K, Jadidi M, Desyatova A.
Show Full Abstract
The aortic elasticity plays a vital role in buffering pulsatile blood flow, propelling blood to distal organs and the heart, and reducing cardiac workload. Aortic repair with a stent-graft can reduce this elasticity and hinder the aorta's ability to effectively perform its function. Conventional stent-grafts are associated with increased arterial stiffness, elevated pulse wave velocity (PWV), and adverse hemodynamic changes. This is largely driven by stiffness mismatch between the stent-graft and the native aortic wall, which alters mechanical compliance and hemodynamic response. This study evaluates a novel compliant nanofiber stent-graft (NF-SG) developed to closely mimic native aortic mechanics. Using a bench-top physiological flow circuit, we assessed the hemodynamic impacts of stent-graft stiffness and length on arterial parameters, including PWV, pulse pressure (PP), and distensibility in vitro, and compared these effects with conventional stent-grafts. Stent-graft stiffness significantly affected PWV, PP, and distensibility. Conventional stent-grafts showed 14 %-52 % increase in PWV depending on stent-graft length (p < 0.001), 5 %-32 % increase in PP, and 82 % reduction in mid-graft distensibility. In contrast, NF-SGs maintained PWV and PP near baseline levels with marginal effect of the stent-graft length. Distensibility in the mid-graft was reduced by 13 %-20 %, depending on the stent-graft length. The NF-SG's superior compliance and reduced hemodynamic perturbation were attributed to its mechanically optimized fabric and skeleton design. These findings underscore the clinical potential of the compliant stent-grafts to significantly mitigate long-term cardiovascular complications and preserve aortic functionality post-intervention.
Also flagged:FSGSpathogenesisPrimary FSGScardiotrophin-like cytokine factor 1urokinase-type plasminogen activator receptorCD40
Journal Article2025-11-10✓ 2 SnippetsSchmidt J, Sopel N, Rist C, Ohs A, Dawid L, Simm S, Catanese L, Rupprecht H, Jobst-Schwan T, Lehmann J, Daniel C, Kalkhof S, Schiffer M, Müller-Deile J.
In-Text Gene Mentions
Results)
…as SERPINA1 ,SERPINC1, SERPINA6 ,…
Discussion)
…, SERPINA6 ,SERPINC1, and SERPINAF2…
Show Full Abstract
<h4>Key points</h4>Serum proteomics reveals reduced serpin family A member 1 (SERPINA1) in primary FSGS, distinguishing it from other proteinuric kidney diseases. Serpina1 knockdown in zebrafish causes proteinuria and edema, supporting its functional relevance in glomerular disease. SERPINA1 may exert compartment-specific functions, and its decrease may permit protease activity to contribute to podocyte injury in primary FSGS.<h4>Background</h4>Primary FSGS (pFSGS) is caused by circulating permeability factors. Despite extensive efforts, no single causative factor or biomarker signature has been identified that reliably predicts disease or therapeutic outcomes across all patients. By using liquid chromatography-mass spectrometry-based proteomics on serum samples from patients with pFSGS, compared with controls, we aimed to identify disease-specific protein signatures.<h4>Methods</h4>Liquid chromatography-mass spectrometry-based proteomics analysis was performed on 103 serum samples from 36 patients with pFSGS, 33 patients with other proteinuric diseases, and 34 healthy controls. Selected proteins found to be dysregulated in pFSGS were tested in cell culture experiments in immortalized human podocytes. Knockdown experiments were performed in zebrafish larvae, which were screened for proteinuria, edema, and podocyte marker expression. Immunofluorescent staining on zebrafish sections and patients' kidney biopsies was used to confirm findings.<h4>Results</h4>Mass spectrometry of sera from patients revealed a set of 27 proteins specifically affected in pFSGS, including a dysbalance of proteases and protease inhibitors. A subset of younger pFSGS patients with frequent relapses showed a distinct serum protein profile based on 23 dysregulated proteins. From proteomics results, serpin family A member 1 (SERPINA1; α-1-antitrypsin) was selected for further investigations. Urinary SERPINA1 increased across nephrotic syndromes, whereas serum SERPINA1 reduction was specific to pFSGS, suggesting a distinct underlying pathophysiology involving immune modulation, increased protease activity, or systemic depletion. Glomerular SERPINA1 expression was selectively increased in sclerotic lesions, likely reflecting a local compensatory response to protease stress. Podocytes constitutively secreted SERPINA1, with limited adaptive response under protease stress. Finally, systemic Serpina1 knockdown in zebrafish induced edema, proteinuria, and loss of slit diaphragm markers.<h4>Conclusions</h4>Our findings support a causal and compartment-specific role of SERPINA1 and suggest that reduced circulating protease inhibitors may shift the local protease-antiprotease balance, potentially facilitating podocyte injury in pFSGS.
Also flagged:Chronic kidney diseasediabeteshypertensioncardiovascular disorderskidney fibrosisextracellular
Journal Article2025-11-10No SnippetsKanlaya R, Nonthawong K, Suntivichaya M, Yoodee S, Thongboonkerd V.
Show Full Abstract
Snail1, encoded by <i>SNAI1</i> gene, is an essential protein that regulates epithelial-mesenchymal transition, which leads to extracellular matrix accumulation and kidney fibrosis, but with unclear cellular and molecular mechanisms. This study compared the cellular proteome of <i>SNAI1</i>-overexpressed renal tubular cells with that of vector-control cells by label-free quantitative proteomics, followed by functional assessments using various assays. A total of 233 proteins showed significant changes in their levels by ectopic <i>SNAI1</i> expression. Of these, immunoblotting confirmed the decreases in HSP60 and HSP70 and the increase in DDX1. Bioinformatic analyses revealed the top 10 transcription factors as key upstream regulators of the altered cellular proteome, and translational regulation, ribosome, cell cycle regulation, and cellular senescence were primarily associated with these altered proteins. Gene ontology enrichment showed that focal adhesion, the structure where cells maintain their interior-extracellular matrix interactions, was one of the major affected cellular components. Experimental validations demonstrated that <i>SNAI1</i>-overexpressed cells displayed increases in nucleophosmin, nucleolar organizer regions, cell size, granularity, p21, γH2AX, MMP-9 secretion, and paxillin expression, confirming the bioinformatic predictions. This study has broadened our knowledge of Snail1 functions beyond its established role as the epithelial-mesenchymal transition regulator. In addition to alterations in the cellular proteome, ectopic <i>SNAI1</i> expression induced nucleolar stress, ribosome biogenesis, senescence, and DNA damage response in renal tubular cells. Moreover, Snail1 also affected the dynamics of focal adhesion, which is imperative for cell migration, by regulating paxillin expression. These findings may offer new therapeutic targets related to Snail1-dependent mechanisms for effective management of kidney fibrosis.
Also flagged:mitochondrialpyroptosisferroptosisfatty acidsNLRP3autophagy
Journal Article2025-11-09No SnippetsFu W, Wang J, Lu N, Guo Z, Ong SB, Gao Y, Zhou H, Chang X, Meng M.
Show Full Abstract
Mitochondrial quality control (MQC) impairment plays a central role in driving the pathogenesis of metabolism-associated steatotic liver disease (MASLD). Specifically, this is manifested as reduced mitophagy; increased mitochondrial fission and decreased fusion; and impaired mitochondrial biogenesis. Key pathological mechanisms of MASLD, such as hepatocyte apoptosis, pyroptosis, and ferroptosis, are activated under the influence of factors including free fatty acids (FFAs), oxidative stress, NLRP3 inflammasome activation, and gut microbiota imbalance. Meanwhile, the letter also lists novel potential therapeutic strategies targeting these pathways, including autophagy enhancers, mitochondrial dynamics regulators, biogenesis promoters, and ferroptosis inhibitors.
Genome sequencing (GS) has emerged as the gold standard for diagnosing patients with rare diseases. As with many emerging technologies, equitable access remains a concern. To evaluate the feasibility and diagnostic impact of expanding access to GS, we report our experience implementing CincyKidsSeq, a prospective study offering GS as a "proband-first" test. Participants of all ages with at least one symptom were referred by genetics or non-genetics healthcare providers, or alternatively, were self-referred from February 2024 to February 2025. This diverse referral structure was evaluated for diagnostic yield while maintaining clinical oversight through a hybrid model in which reportable variants are delivered through genetic providers. The overall diagnostic yield of GS on 313 participants was 22% in the unstratified cohort. Self-referred patients had a higher diagnostic yield (11/33; 33%), compared with patients referred by a non-genetics provider (27/98; 27%), or genetics provider (32/182; 18%). Self-referred individuals were older, more likely to be female, frequently test-naïve, and utilized fewer human phenotype ontology (HPO) terms (p value = 0.0016). Self-referral may serve as an effective and complementary pathway for improving access to GS. Empowering families to initiate GS may be a reasonable pathway for an alternative model for genetic service delivery.
Also flagged:phosphoruscarbonatephoDalkaline phosphatasecalciummagnesium
Journal Article2025-11-07No SnippetsLiao X, Zhao J, Magura T, Zhang W, Pan F, Hu P, Xiao D, Li J, Wang K.
Show Full Abstract
<h4>Introduction</h4>The phosphorus (P) mobilization capacity of plants and microbes is hierarchically constrained by climatic drivers, land-use types, lithological properties, and consumer-mediated trophic cascades.<h4>Objectives and methods</h4>We established a latitudinal transect across contrasting lithologies (carbonate vs. siliciclastic sedimentary rocks) in subtropical southwest China to investigate how multitrophic biodiversity and trophic interactions affect soil P mobilization during cropland-to-forest succession.<h4>Results</h4>Cropland conversion into forest significantly increased soil labile P fractions by 43.8% in karst regions, but decreased soil moderately labile and stable P fractions by 62.6-79.1% and 34.8-36.6%, respectively, in both karst and non-karst regions. Multitrophic biodiversity and P mobilization capacity were significantly greater in karst than non-karst regions. Climate warming amplified trophic cascading effects on soil P mobilization capacity mediated by phoD-harboring bacteria in forests via increasing alkaline phosphatase activity. Karst forests developed efficient P mobilization-uptake coordination to overcome calcium/magnesium-induced P chelation constraints through tightly coupled multitrophic interactions. The multitrophic network relationships are conducive to plant P uptake, but vulnerable to species losses caused by anthropogenic disturbances (e.g., tillage and deforestation) in karst ecosystems.<h4>Conclusion</h4>Our findings provide a framework linking lithology-mediated P mobilization with trophic interactions to alleviate P limitation in subtropical ecosystems under global change.
RNA-binding proteins (RBPs) are essential for post-transcriptional gene regulation, including for RNA modification such as N<sup>6</sup>-methyladenosine (m<sup>6</sup>A), splicing, polyadenylation, localization, translation and decay. Dysregulation of RBPs has been causally linked to a wide array of human diseases, including cancer, neurodegenerative diseases, metabolic disorders and tissue differentiation abnormalities. Although RBPs have traditionally been studied through their RNA, protein and post-translational interactions, growing evidence shows that small biomolecules (SBMs) such as sugars, nucleotides, metabolites such as S-adenosylmethionine (SAM) and NAD(P)H, and drugs can directly bind RBPs and modulate their structure, localization and RNA-binding activity. These context-dependent and concentration-dependent interactions link RBP regulation to cellular metabolism and are a key focus of current research. In this Review, we discuss the expanding landscape of SBM-binding RBPs and the functions of these RBPs in condensate formation, RNA localization, processing and translation. We highlight the molecular principles that underlie these interactions and their functional relevance to human diseases. We also examine recent advances in the identification of SBM-RBP interactions and the innovative methodologies that are driving discoveries in this rapidly advancing field. Together, these insights underscore the potential of SBMs to modulate RBPs and inform novel therapeutic strategies.
Also flagged:liver injurycholestasisGamma-Glutamyl TransferaseGGT
Journal Article2025-11-06No SnippetsNguyen HA, Le NV, Le NT, Do HTT, Dao NB, Nguyen TN, Duong DMT, Tran DHN, Huynh TQ, Nguyen HL, Luong MH, Le MT, Huynh CK, Nguyen TTH, Vu HT, Tran P, Nguyen PH, Thao NP.
Show Full Abstract
<h4>Ethnopharmacological relevance</h4>The global rise in herbal medicine (HM) utilizes as an alternative treatment has corresponded with a rise in herb-induced liver injury (HILI). Although numerous systematic reviews existed, their generalizability is limited, and factors associated with HILI remain unclear.<h4>Aim of the study</h4>To comprehensively summarize HILI cases reported in English language literature and to investigate the association between potential factors related to HM use and the severity of liver injury.<h4>Materials and methods</h4>A total of 643 patients from 382 studies were included. Global HILI cases rose markedly between 2002 and 2011. Weight management was the most common reason for HM use. Single-herb product users were more likely to develop mild injury compared with mixed-product users. Supplementary product use was associated with higher chances for having cholestasis. Females (64.9 %) were generally older at onset and had longer herb use durations, while males showed higher Gamma-Glutamyl Transferase (GGT) levels. Older patients tended to have less severe injury, though with elevated GGT and prolonged herb use. Race significantly influenced International Normalized Ratio, total bilirubin, and overall severity.<h4>Conclusion</h4>This study highlights sex, age, race, usage patterns, liver function markers (GGT, INR, TBL), and HM type (herbal preparations and constituents) as key factors in HILI diagnosis and management. Further studies are warranted to confirm these associations.
Also flagged:Ferroptosisironapoptotic cell deathphospholipidmembranedeath
Journal Article2025-11-06✓ 4 SnippetsLuo N, Xiao Y, Zhai Y, Li J, Lv L, Yin H, Lin F, Wan B, Zhang K, Hu J, Liu J, Dang Y, He Y, Zhao Y, Zhang Z, Nie S, Yuan HX.
In-Text Gene Mentions
Methods)
…, RXRB ,PRDX6and TXNRD1 were…
Methods)
…sgPRDX6: ATCCTCTACCCAGCTACCAC, GAAACG…
Results)
…we prioritized ACSL3,PRDX6, and TXNRD1 based…
Results)
…on ACSL3, asPRDX6-or TXNRD1-deficient cells mai…
Show Full Abstract
In our screening campaign for novel ferroptosis inhibitors, we identified that vitamin A (VA) and its metabolite all-<i>trans</i> retinoic acid (ATRA) exhibited potent ferroptosis-suppressing activity. Notably, through a combination of biochemical and pharmacological assays, we demonstrated that the anti-ferroptotic effects of VA and ATRA are independent of both antioxidative mechanisms and the canonical RAR/RXR signaling pathway. This conclusion was corroborated by a series of newly synthesized VA analogues. Furthermore, VA and its structural derivatives significantly alleviated ferroptosis-associated pathological phenotypes in murine models. Intriguingly, we discovered a novel function of VA and its analogues, which directly target acyl-CoA synthetase long-chain family member 3 (ACSL3) and enhance its enzymatic activity. This ACSL3-dependent mechanism increases the MUFA/PUFA ratio in phospholipids, thereby preventing lipid peroxidation. Strikingly, we further demonstrated that VA and its analogue D3 [(2<i>E</i>,4<i>E</i>,6<i>E</i>,8<i>E</i>)-<i>N</i>,3,7-trimethyl-9-(2,6,6-trimethylcyclohex-1-en-1-yl)nona-2,4,6,8-tetraenamide] extend the lifespan of <i>C. elegans</i> in a manner dependent on ACSL3, highlighting the physiological relevance of this pathway in aging. Collectively, our findings unveil a previously unrecognized role for VA and its analogues in modulating lipid metabolism, thereby providing a theoretical basis for their potential application in treating ferroptosis-related diseases and possibly enhancing longevity.
Recent findings suggest that neurodevelopment plays a critical role in Huntington's Disease (HD) pathogenesis. This review integrates data from human studies of children and young adults at risk for HD (the Kids-HD study) with the theory of antagonistic pleiotropy (AP), which posits that genes promoting early-life advantages may confer late-life risks. Longitudinal imaging of gene-expanded (GE) children and adolescents shows that mHTT is associated with larger cortical volumes, enhanced surface morphology, and superior cognitive performance-decades before clinical onset. However, this early benefit is paired with accelerated striatal decline, suggesting that mHTT drives an early "ability" that transitions into a "liability." Vertex-wise analyses reveal cortical enlargement in regions with dense glutamatergic projections to the striatum, implicating excitotoxicity as a mechanism linking development to degeneration. This pleiotropic pattern parallels evolutionary models, where genes like HTT may have an evolutionary trade-off where genes supporting growth and reproduction are favored over those that serve long-term somatic maintenance, leaving cells with diminished repair capacity and resulting in an accelerated aging process. Altogether, these findings support a novel framework in which mHTT accelerates both brain maturation and neurodegeneration, offering new insights into HD biology and therapeutic targets.
Also flagged:haemochromatosis arthropathyHAhaemochromatosisarthropathyironosteoarthritis
Journal Article2025-11-04✓ 1 SnippetKiely PD, Finzel S, Farisogullari B, Carroll GJ, McCarthy G, Stack J, Parisi S, Porto G, Richette P, Nagy G, Weidl M, Rosenthal A, Guggenbuhl P, Banaszkiewicz KJ, Engelhardt S, Shearman JD, Mitchell D, Barker J, Brueton V, Butzeck B, Coathup P, Don H, Dowsett J, Duncan M, Dunleavy T, Fish I, Hoggarth A, McKinnon M, Minter J, Osborne T, Smith M, Wright C, Machado PM.
In-Text Gene Mentions
Abstract)
…with C282Y homozygousHFEgene mutation, joint…
Show Full Abstract
<h4>Objectives</h4>This study aims to develop classification criteria for haemochromatosis arthropathy (HA).<h4>Methods</h4>A task force was convened per European Alliance of Associations for Rheumatology standardised operating procedures, including physicians experienced in genetic haemochromatosis and its arthropathy and patient research partners. Candidate classification criteria items were selected via systematic literature review, consensus, and Delphi process. Derivation cohorts of patients with C282Y homozygous HFE gene mutation, joint pain, and iron loading, along with disease mimics (primary generalised osteoarthritis or calcium pyrophosphate deposition disease), were recruited from routine care and assessed against candidate items. Group comparison and diagnostic performance analyses identified variables with the greatest discriminatory capacity. A subset of these variables, agreed upon by consensus (considering both statistical results and the HA disease construct), was modelled using multivariable logistic regression and receiver operating characteristic curve analysis to develop classification criteria models. The final model was agreed upon through discussion, voting, and consensus, taking both statistical performance and disease Gestalt (face validity) into account.<h4>Results</h4>A derivation cohort of 154 patients with HA and 120 patients with disease mimics was recruited. A point-based classification model was developed using 8 variables covering age of symptom onset, clinical, and radiographic features at the metacarpophalangeal, distal interphalangeal, and ankle joints, and surgery of hips or ankles. A score ≥5 out of 11 provides 93.3% specificity and 71.4% sensitivity for classifying HA.<h4>Conclusions</h4>An international multicentre task force has developed the first classification criteria for HA from a unique derivation cohort using rigorous methodology. Criteria should be used to include patients in research studies and await external validation in separate cohorts.
Also flagged:Geranylgeranyl Transferasemucus secretionGGTi-2133mucus-bone metastasesmetastatic breast cancer
Journal Article2025-11-04✓ 1 SnippetMcGinness K, Al-Anbaky Q, Larrey EK, Cholia RP, Rotenberry M, Cook H, Pineda EN, Du R, Boerma M, Pathak R.
In-Text Gene Mentions
Text
…OLFM4…
Show Full Abstract
<h4>Purpose</h4>The risk of large volume single radiation exposure from accidents, malicious activities, or therapeutic hemi-body irradiation is growing. Such exposures cause large-field irradiation or partial-body irradiation (PBI) that can damage the intestine. No medical countermeasures, referred to as radiation mitigators, are available to suppress intestinal radiation damage when administered after radiation exposure.<h4>Methods and materials</h4>We investigated the efficacy of geranylgeranyl transferase inhibitors (GGTis), specifically GGTi-2133 (hereafter GGTi), to mitigate intestinal radiation injury in C57BL/6J mice after exposure to 12 or 13 Gy γ-rays with both hind limbs shielded. Starting 24 hours after PBI and every 48 hours thereafter, we administered either vehicle or GGTi via intraperitoneal injection and collected intestinal tissues on days 3.5 or 14 after 12 Gy PBI from male mice and on day 14 after 13 Gy PBI from female mice. Additionally, the effects of GGTi on endothelial cells after fractionated exposure and on primary intestinal organoids after single exposure were assessed.<h4>Results</h4>GGTi treatment increased the number of surviving crypts on day 3.5 after PBI in male mice. In addition, in both sexes, GGTi mitigated intestinal structural damage on day 14. Additionally, GGTi mitigated manifestations of PBI-induced intestinal injury including crypt proliferation; a decrease in the number of mucus-secreting cells and mucus secretion; alterations in stem cell markers at mRNA and protein levels; changes in intestinal neutrophil, lymphocyte, and macrophage counts; and alterations in intestinal vascular endothelial cell markers on day 14 after 12 Gy PBI in male mice. Finally, ex vivo mechanistic studies revealed that GGTi prevents suppression of key beneficial molecules in the human primary endothelial cells and upregulates key molecules essential for intestinal homeostasis and maintenance of intestinal stem cells in the murine intestinal organoids following irradiation.<h4>Conclusions</h4>Altogether, our study demonstrates that GGTi is a potent mitigating agent against intestinal radiation toxicity by modifying multiple cell types.
Also flagged:HydrocephalusMovement Disordernormal pressure hydrocephalusnormalcognitive impairmentcognition
Journal Article2025-11-03No SnippetsCampo-Caballero D, Ash E, Fasano A, Martino D, Tullberg M, Alonso Canovas A, Krauss JK.
Show Full Abstract
<h4>Background</h4>The pathophysiology of idiopathic normal pressure hydrocephalus (iNPH) remains poorly understood. While it is commonly accepted that iNPH has an insidious onset, little is known about its preclinical and early stages and its development over time.<h4>Objectives</h4>To gain more insight into how iNPH becomes manifest clinically and radiologically, and how its major clinical symptoms evolve in non-shunted patients.<h4>Methods</h4>For this critical review a literature search was performed using specific search terms concerning the evolution of iNPH. Manuscripts were categorized according to their content providing information on different domains including the early manifestation of clinical features, the evolution of the three major clinical symptoms, and the development of radiological findings.<h4>Results</h4>Gait disturbance in general, is the earliest clinical symptom of iNPH. There is a gradual but variable decline within the first years resulting in a change of phenotype. Cognitive impairment varies widely depending on co-morbidities. Urinary dysfunction evolves from urinary urgency to incontinence. Radiological features of iNPH such as ventricular enlargement, enlarged subarachnoid spaces, and flattening of sulci at the parasagittal high convexity are present in the preclinical stage of iNPH, but the sequence of their appearance remains unclear as well as the impact of white matter lesions.<h4>Conclusions</h4>The evolution of iNPH shows remarkable heterogeneity. While there is a need to define distinct clinical stages, it is also important to better identify the preclinical stages of iNPH. Assessment of treatment outcomes needs to consider the stage of the disease at the time of intervention.
Also flagged:ActinCytoskeletonglomerular filtrationkidney diseasesfoot processmembrane-associated guanylate kinase inverted 2
Journal Article2025-11-03✓ 1 SnippetIda M, Yamada H, Shirata N, Makino SI, Ichimura K, Miyaki T, Okunaga I, Yamasaki K, Yoshimura Y, Yokoi H, Mukoyama M, Iwamura C, Hirahara K, Taguchi A, Asanuma K.
Also flagged:organizationNptx1Aldh1l1segmentationgene expressiondeath
Journal Article2025-11-03✓ 1 SnippetHuizing GJ, Samaran J, Capocefalo D, Audit A, Peyré G, Cantini L.
In-Text Gene Mentions
Results)
…Additionally, we identifySOX6, MYCN and REST,…
Show Full Abstract
In dynamic biological processes such as development, spatial transcriptomics is revolutionizing the study of the mechanisms underlying spatial organization within tissues. Inferring cell fate trajectories from spatial transcriptomics profiled at several time points has thus emerged as a critical goal, requiring novel computational methods. Wasserstein gradient flow learning is a promising framework for analyzing sequencing data across time, built around a neural network representing the differentiation potential. However, existing gradient flow learning methods face challenges in analyzing spatially resolved transcriptomic data. Here, we propose STORIES, a method that uses an extension of Optimal Transport to learn a spatially informed potential. We benchmark our approach using three large Stereo-seq spatiotemporal atlases and demonstrate superior spatial coherence compared to existing approaches. Finally, we provide an in-depth analysis of axolotl neural regeneration and mouse gliogenesis, recovering gene trends for known markers such as Nptx1 in neuron regeneration and Aldh1l1 in gliogenesis and additional putative drivers.
Also flagged:Tyrosine kinasecancersFacial Tumour 1Devil Facial Tumour 2ERBBPDGFRA
Journal Article2025-11-03No SnippetsSchönbichler A, Orlova A, Kreindl C, Endler L, Wilson R, Kosack L, Hofmann A, Viczenczova C, Darby J, Erdogan F, Patchett AL, Koren A, Kubicek S, Müller M, Flies AS, Bergthaler A, Moriggl R.
Show Full Abstract
Two transmissible cancers, Devil Facial Tumour 1 (DFT1) and Devil Facial Tumour 2 (DFT2), have caused a significant decline in the Tasmanian devil population. DFT1 is driven by ERBB, while DFT2 is driven by PDGFRA. We show that DFT cancer cells exhibit distinct kinase phosphorylation profiles that dictate their responses to tyrosine kinase inhibitors. Upon long-term treatment, both DFT cell lines develop resistance, with DFT1 cells rapidly evading ERBB inhibition without major copy number alterations or significant changes in phosphorylation, suggesting signalling plasticity and engagement of alternative oncogenic drivers. In contrast, DFT2 cells exhibit a slowed development of resistance to imatinib, a selective kinase inhibitor with known activity against PDGFRs. Moreover, DFT2 cell resistance is accompanied by copy number alterations and an activation of ERBB and JAK/STAT signalling with MHCI downregulation, resembling DFT1 signalling. Dual targeting of ERBB and PDGFR shows synergistic effects in DFT1 and may prevent resistance emergence. These findings provide critical insight into the adaptive capacity of transmissible cancers and inform conservation strategies. Moreover, they highlight broader principles of kinase-driven resistance relevant to human cancers with high pathway plasticity.
Also flagged:PDE4PDE4Bischemic strokeStrokedeathPhosphodiesterase 4
Journal Article2025-11-03✓ 1 SnippetPonsaerts L, Alders L, Schepers M, Kemps H, Pirlet E, Willems E, De Bondt M, Jacobs R, Brullo C, Bruno O, Fedele E, Ricciarelli R, Prickaerts J, Somers V, Vandenbosch M, Vanmierlo T, Bronckaers A.
In-Text Gene Mentions
Text
…linker histone cluster member H14…
Show Full Abstract
Stroke remains the second leading cause of death worldwide, highlighting the urgent need for novel treatment options. Phosphodiesterase 4 (PDE4) inhibition has been shown to reduce neuroinflammation and improve neurological outcomes in several neurodegenerative diseases, such as multiple sclerosis. Especially the PDE4B gene is known to contribute to the inflammatory reaction. Therefore, we investigated the effects of PDE4 and PDE4B inhibition in ischemic stroke. We used the distal middle cerebral artery occlusion (dMCAO) mouse model to assess inflammatory cell infiltration and lesion size, and complemented the data with in vitro studies on neutrophils. Our results show that prophylactic PDE4 and PDE4B inhibition reduced the lesion size and neutrophil infiltration in vivo, whereas post-stroke administration of these inhibitors did not show an effect. In vitro, neutrophil activation was decreased following PDE4 and PDE4B inhibition. Furthermore, spatial proteomics analysis of the ischemic brain identified C1QBP as a potential contributing factor to the beneficial effects of prophylactic PDE4B inhibition. Taken together, our research provides evidence for a potential role of prophylactic, but not acute PDE4 and PDE4B inhibition in ischemic stroke treatment, especially for patients at risk of recurrent stroke.
<h4>Introduction</h4>Breast Cancer (BCa) remains the leading cause of cancer-related mortality among women, underscoring the need for developing more effective novel biomarkers. This study investigated the role of Growth Arrest-Specific 2 (GAS2) and its co-expressed genes in breast cancer.<h4>Methods</h4>RNA-Seq data from 60 matched normal and malignant breast tissue samples (GSE183947) were analyzed. Expression values were normalized using FPKM, and GAS2 co-expression networks were constructed with SUM Lasso and linear regression. Gene-gene interaction networks were examined using Gephi software.<h4>Results</h4>GAS2 expression was significantly reduced in tumors compared with normal tissues (<i>P</i><0.01). Distinct sets of GAS2-associated genes were identified in cancer versus normal tissues, with tumor-associated partners (TAS2R14, PHF21B, CNTN5, UGT2B15) linked to drug metabolism and signaling, and normal-associated partners (DCC, STAT5A, ZCRB1) linked to transcriptional and cytoskeletal regulation. Network analysis revealed substantial differences in gene expression patterns between tumor and normal tissues, indicating GAS2's involvement in cancer-specific signaling pathways.<h4>Conclusion</h4>GAS2 displays context-dependent gene interactions and reduced expression in BCa, suggesting potential relevance to tumor biology. While these findings support its value as a candidate biomarker, experimental validation is required before translational applications can be established.
Also flagged:lipid dropletsenvelopemembraneschloroplastsplastidchloroplast plastoglobule-associated proteins
Journal Article2025-11-01No SnippetsYing S.
Show Full Abstract
Plastid-localized plastoglobules (PGs) are monolayer lipid droplets typically associated with the outer envelope of thylakoid membranes in chloroplasts. The size and number of PGs can vary significantly in response to different environmental stimuli. Since the early 21st century, a variety of proteins attached to the surface of PGs have been identified and experimentally characterized using advanced biotechnological techniques, revealing their biological functions. This article aims to assess the latest discoveries regarding PG-associated proteins and explore their dynamics under both single and combined abiotic stress conditions, providing insights into the critical role of plastid lipid droplets in plant adaptation to global climate-related challenges.
Also flagged:Gadoliniumcationhydroxyapatitecollagenproteoglycans
Journal Article2025-11-01No SnippetsFretellier N, Idée JM, Rasschaert M, Factor C, Van der Molen AJ.
Show Full Abstract
Over the past 15 years, significant advancements have been made in understanding the pharmacology and toxicology of gadolinium-based contrast agents (GBCAs), widely used in magnetic resonance imaging (MRI). This review focuses on the fate of gadolinium cation (Gd 3+ ) in bone tissues. The evidence indicates that Gd 3+ can persist in bone for extended periods, with higher retention observed for GBCAs with linear ligand structures as opposed to macrocyclic ones. The prolonged presence of Gd, with a significant proportion in species other than the initial intact injected GBCA form, raises concerns about potential toxicological effects, although no direct clinical consequences on bone physiology have been reported so far. This review discusses the complex interactions between Gd 3+ and bone matrix components, such as hydroxyapatite, collagen, and proteoglycans, which might contribute to the mechanisms of Gd retention. It also explores the potential for Gd to interfere with bone remodelling processes and cellular functions, as suggested by in vitro studies, and in comparison with that known for other rare earth elements (REE).
Also flagged:DLBCLCD19lymphomachimeric antigen receptordiffuse large B-cell lymphomaCD20
Journal Article2025-11-01✓ 1 SnippetLüönd F, Whalen J, Song Y, Schriefer K, Newcombe R, Orlando EJ, Choi SM, Ruella M, Fraietta JA, Schuster SJ, Brogdon JL, Niederst MJ, Treanor LM.
In-Text Gene Mentions
Results)
…, WRNIP1 ,B4GALT5, and COA3…
Show Full Abstract
Current understanding of lymphoma cell-intrinsic mechanisms of relapse following chimeric antigen receptor (CAR) T-cell treatment of diffuse large B-cell lymphoma (DLBCL) include antigen loss and apoptosis resistance. Herein, CD19 CAR T-cell response and resistance were modeled, and it was identified that treatment-naïve CD19 expression does not correlate with CAR T-cell sensitivity, but resistance is frequently accompanied by reversible downregulation of CD19 that once restored is not paralleled with restored sensitivity to CAR T cell-mediated killing. Profiling a suite of DLBCL cell lines to CD19 CAR T-cell sensitivity reveals that DLBCL cells become nonresponsive to CAR T cell-killing, including to alternative antigen targeting of CD20 or CD22. Leveraging these resistant models, we identified gene signatures present in the CAR T cell-resistant DLBCL cell lines that correlate with patient response to CTL019 in two independent clinical trials. Finally, we show that combination strategies to overcome this resistance, including up-front dual-antigen targeting and combined treatment with an Mcl-1 inhibitor, improve CAR T-cell responses.<h4>Significance</h4>We demonstrate that DLBCL cells surviving CD19 CAR T-cell treatment develop a resistance phenotype with a "resistance signature" predictive of clinical CAR T-cell response, mediating cross-resistance between CAR T cells targeting different antigens. Our findings suggest that up-front dual-antigen targeting and combination therapies could improve clinical outcomes.
Also flagged:cytokinecytokine receptormyositisinflammatory myopathiescytokine receptorsimmune-mediated necrotizing myopathy
Journal Article2025-11-01No SnippetsKirou RA, Pinal-Fernandez I, Casal-Dominguez M, Pak K, Preusse C, Dari D, Del Orso S, Naz F, Islam S, Gutierrez-Cruz G, Naddaf E, Liewluck T, Stenzel W, Selva-O'Callaghan A, Milisenda JC, Mammen AL.
Show Full Abstract
<h4>Objective</h4>Myositis is a heterogeneous family of inflammatory myopathies. We sought to define the differential expression of cytokines, cytokine receptors and immune checkpoint genes in muscle biopsies from patients with different forms of myositis in order to characterize patterns of inflammation in each.<h4>Methods</h4>Bulk RNA-sequencing was performed on muscle biopsy samples from 669 patients, including 105 with DM, 80 with immune-mediated necrotizing myopathy (IMNM), 65 with anti-synthetase syndrome, 53 with IBM, 19 with anti-PM/Scl myositis, 310 with other inflammatory or genetic myopathies and 37 controls with normal tissue (NT). Myositis clinical groups and autoantibody subgroups were analysed separately. Expression data were analysed for 338 genes encoding cytokines, cytokine receptors and immune checkpoints. Myositis group-specific genes were identified from this list by finding genes that were specifically differentially expressed in one group compared with all samples and compared with NT (α < 0.001).<h4>Results</h4>IBM patients had the most differentially overexpressed genes (71) among all clinical groups, including 37 that were IBM-specific. Among the top genes were several involved in type 1 inflammation, including CCL5, CXCR3, CCR5, CXCL9 and IFNG. Anti-Jo1 and anti-PM/Scl patients exhibited differential overexpression of a similar set of genes, while DM patients exhibited differential overexpression of a different set of genes involved in type 1 inflammation. IMNM patients had the least number of differentially overexpressed genes with no predominant inflammatory pattern.<h4>Conclusion</h4>Each myositis clinical group and autoantibody subgroup had differentially overexpressed inflammatory mediators, including a strong type 1 inflammatory gene signature in IBM.
Also flagged:Circadian rhythmsATXN3ataxin-3MJDcircadian rhythmnucleus
Journal Article2025-11-01✓ 1 SnippetRibeiro RFN, Pereira D, Lopes SM, Reis T, Silva P, Lobo DD, Gaspar LS, Durães J, Fernandes AR, Ferreira-Marques M, Carvalhas-Almeida C, Peça J, Álvaro AR, Santana I, Santana MM, Silva MMC, Pereira de Almeida L, Cavadas C.
In-Text Gene Mentions
Discussion)
…the entire humanHTTgene).…
Show Full Abstract
Machado-Joseph disease (MJD) is caused by an abnormal CAG repeat expansion in the ATXN3 gene, leading to the expression of a mutant ataxin-3 (mutATXN3) protein. Patients with MJD exhibit a wide range of clinical symptoms, including motor incoordination. Emerging evidence highlights circadian rhythm disruptions as early indicators and potential risk factors for the progression of neurodegenerative conditions. Circadian rhythms are regulated by internal clocks, with the suprachiasmatic nucleus (SCN) acting as the master pacemaker to synchronize timing across the body's behavioural and physiological functions. While sleep disturbances have been observed in MJD, the role of clock regulation in its pathophysiology remains largely unexplored in spinocerebellar ataxias. This study aimed to investigate circadian rhythms, characterize associated disruptions and uncover the mechanisms underlying clock dysregulation in patients and preclinical models of MJD. Circadian activity in MJD patients was assessed over 2 weeks using actigraphy, while in a YAC-MJD transgenic mouse model, circadian rhythms were examined through: (i) wheel-running experiments; (ii) telemetry-based monitoring of core body temperature; (iii) immunohistochemical analysis of the neuropeptides arginine vasopressin (AVP) and vasoactive intestinal polypeptide (VIP) in the SCN and paraventricular nucleus (PVN); and (iv) quantitative real-time PCR evaluation of clock gene expression in the cerebellum. The impact of mutATXN3 on clock mechanisms was further investigated using Bmal1/Per2-luciferase reporters. MJD patients exhibited a progressive decline in robustness of behavioural rhythms, demonstrated by negative correlations between the circadian function index, rest-activity fragmentation and sleep efficiency with MJD clinical scales. YAC-MJD mice exhibited reduced activity levels and increased behavioural fragmentation, and they required three additional days to re-entrain after a jet lag protocol compared to controls. Disrupted core body temperature rhythms were observed, including a phase advance and elevated temperature (∼1°C) at the onset of the active period. Furthermore, transgenic mice showed reduced levels of VIP and AVP in the SCN and PVN and decreased clock gene expression in the cerebellum. Lastly, we found new mechanistic evidence that wild-type ATXN3 activates the promoters of Bmal1 and Per2, whereas mutATXN3 loses the capacity to drive Per2 upon polyglutamine expansion. Overall, our findings indicate that central clock dysfunction in MJD is associated with impaired clock gene expression and disruptions in activity and temperature rhythms. This study provides the first robust evidence of circadian rhythm dysregulation and underlying mechanisms in MJD, paving the way for identifying new biomarkers and developing novel circadian-based interventions to tackle MJD and possibly other spinocerebellar ataxias.
Also flagged:Chronic Hepatitis InfectionHLAAflatoxintumoralcoholHCV infection
Journal Article2025-11-01✓ 1 SnippetGuo Y, Jiang L, Alkali M, George SHL, Jones PD, Leng S, Ye F.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>Aflatoxin remains an underrecognized hepatocellular carcinoma (HCC) risk factor in the United States, where the permissible food limit (20 ppb) is fivefold higher than in Europe.<h4>Methods</h4>We analyzed 350 The Cancer Genome Atlas HCC cases with whole-exome sequencing, RNA sequencing, and clinical data. Aflatoxin burden was quantified by single-base substitution signature 24. HLA diversity was quantified from RNA sequencing reads using the Shannon diversity index. Multivariable Cox models estimated HRs for disease-specific survival (DSS) with aflatoxin-virus interactions, adjusting for tumor stage, age, sex, race, alcohol use, fatty liver disease, aristolochic acid signature, and HLA diversity. Linear regression evaluated the association between HLA diversity and aflatoxin burden.<h4>Results</h4>Higher aflatoxin burden was associated with poorer DSS (adjusted HR = 1.16; 95% confidence interval, 1.01-1.33). Among hepatitis C virus (HCV)-positive patients, hepatitis B virus (HBV) infection was associated with improved DSS at low aflatoxin levels; however, this association was reversed at aflatoxin levels exceeding 30 units. HCV infection was consistently associated with worse DSS across aflatoxin levels. Asian American and Black/African American patients carried higher aflatoxin burdens than Whites (P = 0.016 and 0.014). Greater HLA diversity was independently associated with lower aflatoxin burden (P < 0.001), suggesting a protective effect.<h4>Conclusions</h4>Somatic aflatoxin exposure, both independently and synergistically with HBV/HCV infection, adversely affects HCC prognosis, whereas greater HLA diversity may mitigate the detrimental effects of aflatoxin. Aflatoxin exposure disproportionately affected Asian American and Black/African American patients (other minority groups not represented).<h4>Impact</h4>Tightening US aflatoxin food limits and expanding HBV vaccination coverage in high-risk communities could reduce HCC disparities and improve patient survival.
Also flagged:Pancreatic ductal adenocarcinomaPD-1CTLA-4tumorLAG-3CSF1R
Journal Article2025-11-01No SnippetsStone ML, Herrera VM, Li Y, Coho H, Xue Y, Graham K, Ratmansky J, Delman D, O'Brien S, Beatty GL.
Show Full Abstract
Pancreatic ductal adenocarcinoma (PDA) is characterized by a myeloid-enriched microenvironment and has shown remarkable resistance to immune checkpoint blockade (e.g., anti-PD-1 and anti-CTLA-4). In this study, we sought to define the role of myeloid immunosuppression in immune resistance in PDA. We report that although depletion of CSF1R+ myeloid cells in combination with anti-PD-1 and chemotherapy triggers T-cell infiltration into PDA, it also causes compensatory remodeling of the myeloid compartment with limited tumor control. Combination therapy against multiple myeloid targets, including CSF1R, CCR2/5, and CXCR2, was insufficient to overcome treatment resistance. High-dimensional single-cell analyses performed on T-cell infiltrates in human and mouse PDA revealed upregulation of multiple immune checkpoint molecules, including PD-1, LAG-3, and CTLA-4. Combinatorial blockade of PD-1, LAG-3, and CTLA-4 along with chemotherapy and anti-CSF1R was necessary to trigger activation of peripheral CD4+ and CD8+ T cells and led to deep, durable, and complete tumor responses, with each immune checkpoint blockade agent contributing to efficacy. Our findings indicate that a comprehensive approach targeting both negative regulatory signals controlling T-cell function and the myeloid compartment will be fundamental to unveiling the potential of immunotherapy in PDA.
Journal Article2025-11-01✓ 1 SnippetKilani Y, Aldiabat M, Sirilan KYT, Nasir AB, Madi MY, Syn WK.
In-Text Gene Mentions
Results)
…toxic liver injury,hemochromatosis, Wilson disease, Budd…
Show Full Abstract
<h4>Introduction</h4>Despite the growing recognition of autoimmune hepatitis (AIH)-metabolic dysfunction-associated steatotic liver disease (MASLD) overlap, studies today are limited by small sample sizes. The aim of this study was to investigate the impact of MASLD on the outcomes of patients with AIH using large-scale real world data.<h4>Methods</h4>This cohort study used the TriNetX research network to identify US adults (≥18 years) with AIH. Patients were stratified into those with MASLD (AIH-MASLD cohort) and controls (AIH without MASLD). Propensity score matching (1:1) between AIH-MASLD and controls accounted for demographics, comorbidities, and treatments. Outcomes were classified as short-term (within 1 year after diagnosis) or long-term (within 10 years) outcomes.<h4>Results</h4>Among 4,798 records with AIH, 1,440 AIH-MASLD patients were propensity matched with 1,440 controls. AIH-MASLD patients demonstrated reduced 1-year risks of all-cause mortality (hazard ratio [HR] 0.66, 95% confidence interval [CI] 0.44-0.98) and immunosuppressive medication use (HR 0.69, 95% CI 0.63-0.76), along with increased 10-year risks of cirrhosis (HR 1.22, 95% CI 1.06-1.40) and hepatocellular carcinoma (HR 2.03, 95% CI 1.09-3.78) compared with controls.<h4>Discussion</h4>In summary, our study using real-world evidence showed a significant association between MASLD and worse clinical outcomes in patients with AIH. Future efforts should be targeted toward facilitating early detection and management of MASLD in patients with AIH.
Also flagged:bindingdsRNA-binding proteinsnucleotidetriphosphateprotein synthesisinterferon
Journal Article2025-11-01✓ 5 SnippetsJeon J, Kim Y.
In-Text Gene Mentions
Introduction)
…humans, two homologs,STAU1and STAU2, exist.…
Introduction)
…Moreover,STAU1is widely expressed…
Introduction)
…HumanSTAU1and STAU2 both…
Introduction)
…Dimerization ofSTAU1and STAU2 is…
Introduction)
…BothSTAU1and STAU2 homodimers…
Show Full Abstract
Long double-stranded RNAs (dsRNAs) are recognized by innate immune response proteins, thereby initiating the integrated stress response. As these RNAs adopt an A-form helical structure, immune sensors recognize dsRNAs primarily based on their structural features, such as the length of the doublestranded stretch and the triphosphate at the 5' end, rather than on specific sequences. This structure-dependent, sequenceindependent mode of RNA recognition is also characteristic of many dsRNA-binding proteins (dsRBPs). Consequently, multiple dsRBPs share a common pool of dsRNA substrates, leading to a complex regulatory network in which proteins modulate each other's activation status and signaling activities. With the development of advanced analytical techniques capable of studying RNA sequences and structures at single-nucleotide resolution, research into dsRNA-protein interactions has advanced significantly. This review discusses the long dsRNAinteracting dsRBPs encoded in the human genome, their RNA substrates, recognition mechanisms, and the downstream effects of protein-RNA interactions, with the aim of deepening our understanding of dsRNA recognition and signaling. [BMB Reports 2025; 58(11): 451-466].
Also flagged:ketosisphosphorylationPPARamino aciddegradationfatty acid
Journal Article2025-11-01No SnippetsTang T, Zhou J, Shao J, Wang M, Xia S, Sun W, Jia X, Wang J, Lai S.
Show Full Abstract
<h4>Background</h4>The muscle tissue of dairy cows is a site of β-hydroxybutyrate (BHBA) metabolism. The mechanisms underlying the changes in proteins and metabolites in the muscle tissue of cows with ketosis remain unclear.<h4>Objectives</h4>To elucidate the metabolic and physiological molecular adaptation mechanisms in the muscle tissue of cows with ketosis through metabolomics and proteomics.<h4>Animals</h4>Six cows diagnosed with ketosis (CK, BHBA ≥ 2.4 mM) and six apparently healthy cows with BHBA < 1 mM (Con), all 1 week postpartum.<h4>Methods</h4>Prospective cohort observational study. The content of BHBA in whole blood was detected by WST-1 and TNN methods. HE staining was used to observe the physiological changes in the muscle tissue of cows with ketosis. Metabolomic analysis, proteomic analysis, and WB experiments were employed to identify differential metabolites and proteins.<h4>Results</h4>The 685 metabolites and 356 proteins were identified to be differentially expressed in the CK group. In the muscle tissue of cows with ketosis, significant changes were observed in processes such as oxidative phosphorylation, PPAR signaling pathway, TCA cycle, amino acid degradation, and fatty acid oxidation. At the protein level, SDHA, SDHB, QCR6, QCR7, and IDH2 were significantly downregulated, while metabolites such as pyruvate were downregulated and BHBA was upregulated.<h4>Conclusions and clinical importance</h4>The TCA cycle and mitochondrial respiratory chain in the muscle tissue of cows with ketosis might be impaired. These results provide valuable insights into the metabolic mechanisms of muscle tissue in cows with ketosis.
Also flagged:Crohn's DiseaseUlcerative Colitischronic inflammatory bowel diseasessodium dodecyl sulfatedithiothreitolacetone
Journal Article2025-11-01No SnippetsShajari E, Gagné D, Bourassa F, Malick M, Roy P, Noël JF, Gagnon H, Delisle M, Boisvert FM, Brunet M, Beaulieu JF.
Show Full Abstract
<h4>Introduction</h4>Crohn's disease (CD) and ulcerative colitis (UC) have overlapping symptoms, but they differ in pathology and treatment. Currently, distinguishing between these diseases involves invasive procedures such as colonoscopy and histopathology. Fecal proteins, stable and in direct contact with inflammation, offer a noninvasive alternative. This study focuses on using high-throughput data-independent acquisition mass spectrometry and machine learning to develop an accurate biomarker signature from complex stool samples.<h4>Methods</h4>Stool samples obtained from 69 active patients were analyzed. Analysis of the stool proteome led to the identification and quantification of approximately 1,250 proteins. The samples were divided into training and testing groups. After data processing, various feature selection algorithms were applied on the training group to determine proteins that were significantly different between the CD and UC groups. In addition, 6 machine learning algorithms were evaluated to identify the best-performing classifiers.<h4>Results</h4>Sixteen proteins were selected based on several feature selection algorithms, and 6 models were trained based on them. According to the performance metrics of each algorithm on the training data set, the Naive Bayes model was selected. For performance validation, the final predictive model was applied to 16 blind prospective samples as the test data set. Notably, the model achieved an area under the curve of 0.96 on both the training and test data sets, highlighting its robustness and stability.<h4>Discussion</h4>This study demonstrates the potential of combining multiple stool protein biomarkers through high-throughput data-independent acquisition mass spectrometry and machine learning tools to develop a predictive model for efficiently distinguishing CD from UC.
Also flagged:oligonucleotidespairinggene expressiongenetic diseasesbindingcoagulation
Journal Article2025-11-01✓ 5 SnippetsKuijper EC, van der Graaf L, Pepers BA, Guimarães Ramos M, Korhorn S, Toonen LJA, Cats D, Buijsen RAM, Mina E, Mei H, van Roon-Mom WMC.
In-Text Gene Mentions
Introduction)
…, ATXN3 orHTT( Fig. 1A…
Introduction)
…modification of theHTTprotein is hypothesized…
Methods)
…, ATXN3 andHTTas well as…
Results)
…the APP-AON andHTT-AON.…
Results)
…the ATXN3-AON andHTT-AON ( Fig. 2B…
Show Full Abstract
Antisense oligonucleotides (AONs) are small pieces of chemically modified DNA or RNA that bind to RNA in a sequence-specific manner based on Watson-Crick base-pairing. Splice-switching AONs are designed to modulate pre-mRNA splicing, thereby for instance restoring protein expression or modifying the eventual protein to restore its function or reduce its toxicity. Given the current lack of in silico methods that adequately predict off-target splicing events, assessment of off-target effects of AONs in human cells using RNAseq could be a promising approach. The identification and prioritization of potential off-target effects for validation and further investigation into the biological relevance would contribute to the development of safe and effective AONs. In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, we identified differential splicing events of which only a minority could be explained by hybridization, illustrating the difficulty of predicting off-target effects based on sequence homology. The main splicing events could all be validated with RT-PCR. Furthermore, from the three AONs studied, one AON induced considerably more changes in gene expression and splicing compared to the two other AONs assessed, which was confirmed in a validation experiment. Our study demonstrates that interpretation of short read RNAseq data to determine off-target effects is challenging. Nonetheless, valuable results can be obtained as it allows the comparison of toxicity between different AONs within an experiment and identification of AON-specific off-target profiles.
Also flagged:orofacial cleftcleftcleft lipcleft palateorofacial cleftsLHX8
Journal Article2025-11-01✓ 1 SnippetDack K, Ludwig KU, Stergiakouli E, Sandy J, Aryee S, Davey Smith G, Davies A, Wren Y, Sharp GC, Humphries K, Mangold E, Goudswaard L, Ho K, Dudding T, Lewis SJ.
In-Text Gene Mentions
Discussion)
…these regions (UNC13C(15q21.3) and PCTP…
Show Full Abstract
Several genome wide association studies (GWASs) of orofacial cleft have been conducted. However only a few such studies to date have combined all cleft cases, focused on subtypes other than non-syndromic cleft lip with/without cleft palate, or investigated subtype heterogeneity. We conducted a GWAS of orofacial clefts within 2268 cases from the Cleft Collective and 7913 population-based controls; we performed analyses of all orofacial clefts, plus 7 subgroups. We replicated our findings in a meta-analysis of independent samples and investigated patterns of correlation across subgroups. We identified 27 regions at genome-wide significance, 8 of which were novel. We also conducted the first GWAS of Pierre Robin Sequence, despite the small sample size (n cases = 237), we found one genome wide significant SNP (P < 5 × 10-8), and another 21 suggestive associations (P < 10-5). Novel loci include those mapping to LHX8 and TSBP1 (combined clefts), ARHGEF18 and ARHGEF19 (cleft lip with/without palate), FBN2 (cleft lip only), SLC35B3 (cleft palate only), CASC20 (Pierre Robin Sequence) and CHRM2 (non-syndromic cleft palate only). Several novel hits were in regions previously associated with facial morphology in GWAS or were in regions involved in key developmental processes, including neural crest cell migration and craniofacial development. We identified genetic loci with similar effects across all subgroups and some loci which were subtype specific, we also identified 3 loci with opposing effects on cleft lip and Pierre Robin sequence. Our findings highlight the merit of including all orofacial cleft subtypes in GWAS studies and investigating heterogeneity of effects across subtypes.
Also flagged:RRM2BmitochondriaHDpathogenesischromosomeneurodegenerative disorder
Journal Article2025-11-01✓ 1 SnippetLee K, Shin B, Kim M, Lee SW, Oh YM, Kim KH, Jiang A, Ko K, Gillis T, Lucente D, Lee R, Kwak S, Lee JM, Wheeler VC, Yoo AS, Gusella JF, MacDonald ME, Seong IS.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is driven by somatic expansion of the HTT CAG repeat, with onset modified by genetic factors. One such modifier, 8AM1, maps to chromosome 8 near RRM2B, a gene not directly involved in the machinery that lengthens the repeat. To investigate this locus, we performed capture sequencing and identified variants at both the 5' and 3' ends of RRM2B with expected minor allele frequencies. A polymorphic frameshift variant (rs1037699) in an alternate exon 1 disrupts expression of a previously uncharacterized RRM2B isoform 2, but not isoform 1. Functional analyses in RRM2B knock-out cells and 8AM1 heterozygous LCLs suggest that isoform 2 may function at mitochondria. Several 3' variants, including a 21 bp 3'UTR deletion (rs200678743) and peak tag-SNV (rs79136984), act as cis expression quantitative trait loci. Analysis of HD onset data (n = 12,982) revealed that 5' and 3' variants contribute independently to the 8AM1 modifier effect, with full impact observed only in the absence of the frameshift variant. Knockdown of both isoforms increased neurodegeneration in HD neurons derived from pre-symptomatic patient fibroblasts, supporting an intersection of RRM2B biology and HD pathogenesis. We conclude that the 8AM1 haplotype, present in ~ 14% of Europeans, modifies RRM2B expression in a cell- and context-dependent manner, thereby accelerating HD onset in mutation carriers.
Also flagged:Clear Cell Renal Cell CarcinomaPIWIccRCCcancerdeathcardiovascular diseases
Journal Article2025-11-01✓ 2 SnippetsKasik M, Iliev R, Vychytilova P, Rybecka S, Radova L, Stanik M, Fedorko M, Dolezel J, Slaby O, Bohosova J.
In-Text Gene Mentions
Discussion)
…delta isomerase 2 (ECI2), an enzyme involved…
Discussion)
…ECI2has been shown…
Show Full Abstract
<h4>Background/aim</h4>The incidence of cancer continues to rise, highlighting the urgent need for reliable, non-invasive biomarkers to support early diagnosis and improve treatment outcomes. In addition to circulating microRNAs, circulating PIWI-interacting RNAs (cir-piRNAs) have emerged as promising candidates. Although the biological functions of piRNAs are not yet fully understood, they are known to suppress transposable elements and may regulate structural genes involved in tumorigenesis. In this two-phase study, we aimed to identify serum piRNAs with diagnostic potential for clear cell renal cell carcinoma (ccRCC).<h4>Materials and methods</h4>A total of 238 serum samples from ccRCC patients and 208 healthy controls were analyzed. In the exploratory phase, next-generation sequencing (NGS) was performed on pooled samples representing different clinical stages of ccRCC and healthy controls.<h4>Results</h4>We identified 35 piRNAs with significantly different expression (<i>p</i><0.01) between groups. Based on statistical significance, read abundance, and fold change, six piRNAs were selected for the training phase and subsequently, three piRNAs, piR-24672, piR-27140, and piR-28876, were selected for validation. Validation by RT-qPCR in an independent cohort confirmed significantly reduced levels of all three piRNAs in ccRCC patients. ROC analysis demonstrated that piR-28876 is a superior diagnostic biomarker, reaching AUC=0.787, with 85.0% specificity and 66.3% sensitivity in distinguishing ccRCC patients from healthy controls.<h4>Conclusion</h4>Circulating piRNAs, particularly piR-24672, piR-27140, and piR-28876, may serve as potential non-invasive biomarkers for the early detection of ccRCC.
Also flagged:16S rRNA18S rRNAClostridium perfringens infectioninfectionsclostridial myonecrosisgas gangrene
Journal Article2025-11-01✓ 1 SnippetHan H, Li Y, Wang L, Jin Z, Zhou W, Zhang B, Jia C, Zhang W, Wang Y, Qiu L, Bing S, Wang S, Ren Z.
In-Text Gene Mentions
Results)
…rabbits, NR1D1 ,RABGAP1L, ARHGDIB and…
Show Full Abstract
Clostridium perfringens is a multi-host opportunistic pathogen whose plasmid-encoded toxins cause gas gangrene, necrotic enteritis and enterotoxemia, resulting in substantial economic losses in animal husbandry. In light of antibiotic bans and the need for alternatives, we employed reverse network pharmacology to screen and in vitro validate artemisinin (ART), then assessed its efficacy in murine and rabbit infection models challenged with C. perfringens type F. ART treatment did not significantly affect body weight change or intestinal histopathological damage. However, it significantly modulated inflammatory cytokines and antioxidant parameters in a tissue- and species-dependent manner. Specifically, ART increased serum TNF-α in mice, decreased IL-1β in rabbits and elevated IL-10 in multiple tissues. In addition, ART enhanced hepatic SOD and T-AOC in mice and reduced hepatic MDA in rabbits. Microbiota analysis revealed limited and subtle shifts in community structure following ART intervention. Transcriptomic analysis further indicated that ART treatment induced marked changes in hepatic gene expression, particularly involving detoxification, lipid metabolism and stress response pathways, with notable species-specific differences in enrichment profiles. While correlation analysis suggested associations of Anaerotruncus with hepatic detoxification genes and Bacteroides with inflammation-regulatory genes, these genus-level findings are based on correlation only and should be interpreted with caution given the lack of significant changes in overall microbial community structure. Collectively, these results indicate that ART can modulate host inflammatory and antioxidant responses, but its impact on gut microbiota composition in C. perfringens infection models appears limited, and the biological significance of observed genus-level associations remains to be elucidated.
<h4>Aims</h4>Autoscopic phenomena (AP) are distinct manifestations of epileptic seizure semiology and are also identified in diverse psychiatric disorders. Our study aimed to map the brain AP network and characterize its multimodal signatures.<h4>Methods</h4>By performing lesion network mapping using the human connectome dataset (n = 1000), we investigated the brain AP network derived from 25 cases of AP caused by distributed focal brain lesions (n = 19) and direct electrical stimulation (DES) (n = 6). We further studied the multimodal signatures of the AP network, including exploring spatial correlation with human cortical developmental and evolutionary expansions, neurotransmitters, and electrophysiological rhythms.<h4>Results</h4>We mapped a common AP network primarily involving the bilateral angular gyrus, posterior medial cortex, intraparietal sulcus, cuneus, fusiform and insula. Specifically, the bilateral thalamic pulvinar were identified as subcortical hubs. We further found a significant negative correlation between the AP network and developmental and evolutionary expansions. Particularly, the spatial density of norepinephrine transporter and the alpha frequency band power were significantly positively correlated with the AP network.<h4>Conclusion</h4>Our study identified a common brain AP network and uncovered its multimodal signatures. These findings may clarify the network mechanisms underpinning AP, providing novel insights into bodily self-consciousness.
Also flagged:ZincAscitesRefractorycirrhosishepatic encephalopathyimmune dysfunction
Journal Article2025-11-01✓ 1 SnippetNamisaki T, Shibamoto A, Iwai S, Takami M, Masuda H, Tsuji Y, Fujinaga Y, Takaya H, Inoue T, Sato S, Kitagawa K, Nishimura N, Kaji K, Mitoro A, Asada K, Yoshiji H.
In-Text Gene Mentions
Introduction)
…factors, such asantithrombin-III, factor VII, and…
Show Full Abstract
<h4>Background/aim</h4>Zinc (Zn) deficiency is common among patients with cirrhosis and is associated with hepatic encephalopathy, immune dysfunction, and sarcopenia. In Japan, cell-free and concentrated ascites reinfusion therapy (CART) is widely employed for refractory ascites, effectively restoring albumin (ALB) and coagulation factors. However, its effect on trace elements has not been investigated. This retrospective study aimed to assess Zn concentration changes in ascitic fluid before and after CART in patients with cirrhotic refractory ascites.<h4>Patients and methods</h4>Data from 24 patients with decompensated cirrhosis who underwent CART at Nara Medical University Hospital between June 2022 and May 2024 were analyzed. The concentrations of Zn and ALB in original and processed ascitic fluid were measured.<h4>Results</h4>Among the cohort (mean age, 66.3±13.7 years, 69.6% men), 75.0% had Child-Pugh class C cirrhosis. The mean volume of drained ascitic fluid was 5,947.2±2,345.9 ml, whereas that of processed ascitic fluid was 350.6±167.6 ml. Positive correlations were observed between serum Zn and serum albumin (ALB) levels as well as ascitic Zn and ascitic ALB levels. The Zn concentration significantly increased from 12 μg/dl in the original ascitic fluid to 119 μg/dl in the processed ascitic fluid (<i>p</i><0.001). The calculated recovery rates for Zn and ALB, based on the ratio of total Zn and ALB content in processed <i>versus</i> original fluid, were approximately 70% and 80%, respectively.<h4>Conclusion</h4>CART markedly increases Zn concentration in ascitic fluid, which may contribute to the restoration of micronutrient levels in patients with cirrhosis. Further studies should determine whether reinfusion of Zn-rich processed ascitic fluid increases serum Zn levels and enhances clinical outcomes.
Also flagged:organellesmetabolismprotein synthesistransport granulesstress granulesprocessing
Journal Article2025-11-01No SnippetsNóbrega-Martins R, Barros-Santos B, Papadimitriou G, Sotiropoulos I, Wolozin B, Silva JM.
Show Full Abstract
RNA granules are dynamic, membraneless organelles essential for the spatial and temporal regulation of mRNA metabolism, particularly in neurons, where local protein synthesis supports synaptic plasticity and function. This review explores the diverse types of RNA granules (e.g., transport granules, stress granules, and processing bodies), their formation mechanisms, molecular composition, and relevance to synaptic physiology. We focus on the central role of RNA-binding proteins (RBPs) in orchestrating granule dynamics and their fine-tuning of synaptic responses under both physiological and stress conditions. Mounting evidence implicates the dysfunction of RNA granules in neurodegenerative diseases. Altered phase separation, RBP aggregation, and persistent stress granules contribute to the formation of pathological RNA granules that interfere with local translation and synaptic maintenance. Key RBPs, including TDP-43, FUS, and TIA-1, are frequently misregulated in disease contexts. Furthermore, Tau is a multifunctional protein traditionally associated with microtubule stabilization but is increasingly recognized for its role in the translational stress response, which includes RBP mislocalization and RNA granule disruption. We examine how chronic stress can exacerbate these mechanisms, acting as an environmental trigger of synaptic vulnerability associated with neurodegeneration. In summary, we explore a conceptual framework connecting RNA granule dysregulation, Tau pathology, and local translation disruption, three processes that converge on synaptic impairment, a central feature of many neurodegenerative diseases characterized by abnormal Tau. Investigating this triad presents a promising avenue for understanding disease mechanisms and identifying novel therapeutic targets that aim to restore RNA metabolism, prevent toxic Tau interactions, and preserve synaptic health.
Also flagged:inflammatory bowel diseasepneumomediastinumsteroidsacute gastroenteritispulmonary embolismlactic acidosis
Journal Article2025-11-01✓ 2 SnippetsAl Noumani J, Al Balushi WA, Ambusaidi ZA, Lal J.
In-Text Gene Mentions
I A O 0000613)
…was 450, andhemochromatosisgene analysis (HFE)…
I A O 0000613)
…emochromatosis gene analysis (HFE) was negative.…
Show Full Abstract
BACKGROUND Inflammatory bowel disease is commonly associated with recurrent abdominal pain and bloody diarrhea, with or without systemic involvement. Here, we report a very rare presentation of inflammatory bowel disease with pneumomediastinum, which is important for healthcare workers to be aware of because pneumomediastinum can present with rapid symptoms onset. Previous reported cases were mainly noted after long-term steroids use or scope-induced perforation. CASE REPORT We present a case a 23-year-old woman with a 14-day history of constipation followed by diarrhea (sometimes bloody), with vomiting, abdominal pain, and fever. She was initially managed as having acute gastroenteritis, but due to persist unexplained tachycardia, a chest CT was done, which incidentally showed a pneumomediastinum along with pulmonary embolism. The patient deteriorated significantly on the same day of chest imaging and developed severe lactic acidosis with hypoglycemia and severe hepatic injury. After extensive assessment by imaging and scopes for biopsy, she was diagnosed with fulminant Crohn's disease, causing severe liver injury, colitis, and pneumomediastinum. She improved significantly with steroids and was discharged home. On follow-up, immunosuppressive agents were initiated. CONCLUSIONS Pneumomediastinum is a rare manifestation of inflammatory bowel disease, which could be reflective of severe colitis and should be considered in patients presenting with chest symptoms regardless of procedure, scope exposure, or long-term steroids use. Attention to early instability signs like tachycardia and tachypnea can help reveal early complications.
Also flagged:SchizophreniaHbnucleusorganizationneuropsychiatric disordersanxiety disorders
Journal Article2025-11-01✓ 1 SnippetYalcinbas EA, Ajanaku B, Nelson ED, Garcia-Flores R, Eagles NJ, Montgomery KD, Stolz JM, Wu J, Divecha HR, Chandra A, Bharadwaj RA, Bach SV, Rajpurohit A, Tao R, Pertea G, Shin JH, Kleinman JE, Hyde TM, Weinberger DR, Huuki-Myers LA, Collado-Torres L, Maynard KR.
In-Text Gene Mentions
Text
…ANKRD45…
Show Full Abstract
<h4>Objective</h4>The objective of this study was to define the molecular neuroanatomy of the human habenula (Hb) and identify transcriptomic differences between brains of individuals with schizophrenia and nonpsychiatric control brains.<h4>Methods</h4>This study utilized Hb-enriched postmortem human brain tissue. Single-nucleus RNA sequencing (snRNA-seq) was conducted to identify molecularly defined Hb cell types (N=7 donors), and single-molecule fluorescent in situ hybridization (smFISH) was performed to validate cell types and map their spatial locations (N=5 independent donors). Bulk RNA sequencing (RNA-seq) (schizophrenia, N=35; nonpsychiatric control, N=33) and cell type deconvolution were used to identify differentially expressed genes (DEGs), which were then compared to dorsolateral prefrontal cortex, hippocampus, and caudate schizophrenia DEGs. Expression quantitative trait loci (eQTLs) and schizophrenia risk colocalization analyses were performed.<h4>Results</h4>snRNA-seq identified 17 cell type clusters across 16,437 nuclei, including three medial and seven lateral Hb populations, several of which were conserved in rodents. smFISH validated snRNA-seq Hb cell types and depicted their spatial organization. Bulk RNA-seq analyses yielded 173 schizophrenia-associated DEGs (false discovery rate<0.1), of which 129 (75%) were unique to Hb-enriched tissue. eQTL analysis identified 717 independent single-nucleotide polymorphism (SNP)-gene pairs (false discovery rate<0.05). Of these, 16 pairs included a SNP that is a schizophrenia risk variant, and seven different pairs included a schizophrenia DEG. eQTL and schizophrenia risk colocalization analysis identified 16 colocalized genes, nine of which have not been previously identified.<h4>Conclusions</h4>These results identify topographically organized cell types with distinct molecular signatures in the human habenula and demonstrate unique genetic differences associated with schizophrenia, thereby providing novel molecular insights into the role of the habenula in neuropsychiatric disorders.
Also flagged:Alzheimer's diseaseADcognitive impairmentamyloid betataudementia
Journal Article2025-11-01✓ 1 SnippetBangs MC, Gadhavi J, Carter EK, Ping L, Duong DM, Dammer EB, Wu F, Shantaraman A, Fox EJ, Johnson ECB, Lah JJ, Levey AI, Seyfried NT.
In-Text Gene Mentions
Results)
…CAT) and peroxiredoxins (PRDX6, PRDX2).…
Show Full Abstract
<h4>Introduction</h4>Alzheimer's disease (AD) shows clinical and molecular heterogeneity shaped by demographic and genetic factors.<h4>Methods</h4>To resolve this heterogeneity, we performed a network-based proteomic analysis of cerebrospinal fluid (CSF) from 431 individuals, including 111 African Americans, to identify protein co-expression modules and define AD subtypes.<h4>Results</h4>Ten co-expression modules reflecting diverse pathways and cell types were identified, many linked to demographics and AD biomarkers. One subtype, enriched in African Americans and males, showed low CSF tau, elevated plasma proteins, and reduced synaptic proteins, features consistent with blood-brain barrier (BBB) dysfunction. This subtype also showed the highest levels of thrombin activity, capable of cleaving tau. Introducing plasma into CSF ex vivo recapitulated the BBB subtype signature, supporting a causal role for plasma proteases in tau and synaptic protein depletion.<h4>Conclusion</h4>These findings link BBB dysfunction and plasma proteases to CSF tau loss and highlight the need for diversity in AD-biomarker research.<h4>Highlights</h4>Race and sex correlate with key AD proteomic network modules. We identify six proteomic subtypes with distinct demographic and AD biomarker profiles. Subtype 3 demonstrates an A+/T- phenotype and a profile suggestive of BBB dysfunction. Low CSF tau and neuronal proteins may stem from infiltrating plasma protease cleavage. Plasma spike-in experiments show decreased endogenous CSF tau and neuronal proteins.
Also flagged:gene expressiongestationinterferonphosphorylationimmune responseprotein modification
Journal Article2025-11-01No SnippetsThompson L, van Helvoort PG, Duijn M, Reinders DD, Murphy EM, McDonald M, Crowe AD, Butler ST, Lonergan P, Rabaglino MB.
Show Full Abstract
Harnessing information from maternal blood to predict fetal growth is an emerging area of research in livestock production, offering a noninvasive tool to monitor development. This study aimed to investigate temporal changes in blood gene expression during cow gestation through a bioinformatic approach and to determine the association between transcriptomic modifications in maternal blood at day 63 of gestation and calf birth weight (BW). Publicly available gene datasets from gestational days 0, 21, 42, 56, 63, and 105 were integrated to investigate maternal gene expression changes across gestation. Coexpression clustering identified four clusters, with three enriched for relevant biological processes, including interferon response genes from day 0 to 21, oxidative phosphorylation at day 42, and immune response genes by day 105. Additionally, maternal blood samples from 20 recipient cows carrying female fetuses derived from in vitro-produced embryos were subjected to RNA sequencing. Unsupervised weighted gene co-expression network analysis of these data identified four modules of coexpressed genes correlated with calf BW (p < 0.05). Supervised analysis revealed 189 differentially expressed genes (DEG; FDR < 0.05) associated with calf BW. The 106 positively associated DEG enriched phosphorylation and protein modification, while the 83 negatively associated DEG enriched immune processes. Biomarker genes were best determined using genes affected by gestational age and DEG, yielding 26 and 17 biomarkers, respectively, with R<sup>2</sup> values of 0.88 and 0.75 for predicting calf BW. In conclusion, transcriptomic analysis of the maternal blood identified biomarkers associated with calf BW and may have application in other species.
Also flagged:ophthalmopathyhyperthyroidismlipidmetabolismextracellularcalcium-activated nucleotidase 1
Journal Article2025-11-01✓ 1 SnippetLi R, Zhang H, Yang L, Pan Y, Wei Y, Sun J, Zhou H.
In-Text Gene Mentions
Results)
…C member 1 (SERPINC1and antithrombin III),…
Show Full Abstract
<h4>Purpose</h4>Thyroid eye disease (TED) is the most common extrathyroidal manifestation of Graves' disease (GD). Despite its clinical significance, the pathogenic mechanisms and reliable diagnostic biomarkers for TED remain incompletely defined. Tear fluid offers a noninvasive window into disease-related molecular changes.<h4>Methods</h4>Tear samples were collected using Schirmer strips from 20 patients with TED, 20 patients with GD without ocular involvement, and 14 healthy controls (HCs). Proteomic profiling was performed using a novel pressure cycling technology-pulse data-independent acquisition mass spectrometry (PCT-PulseDIA-MS) workflow.<h4>Results</h4>A total of 5966 tear proteins were quantified. Differentially expressed proteins (DEPs) were identified through pairwise group comparisons. Patients with TED showed the most extensive tear proteomic alterations among the studied groups. One hundred seventy-four DEPs were associated with ophthalmopathy, 14 with autoimmunity, and 13 with hyperthyroidism. The ophthalmopathy-related DEPs were enriched in immune regulation, lipid metabolism, vascular function, and extracellular matrix remodeling. Several key DEPs showed significant correlations with clinical, laboratory, and imaging variables. A three-protein panel comprising calcium-activated nucleotidase 1 (CANT1), insulin-like growth factor-binding protein 7 (IGFBP7), and caspase 14 (CASP14) achieved excellent diagnostic performance in distinguishing TED from GD, with an area under the curve (AUC) of 0.971.<h4>Conclusions</h4>Tear proteomics reveals distinct molecular signatures shaped by the combined influences of ophthalmopathy, autoimmunity, and hyperthyroidism throughout the pathogenesis of TED, underscoring the potential of tear proteins as early, noninvasive biomarkers for disease diagnosis.
Also flagged:neuropsychiatric disorderstranslationalpathogenesisbrain disordersautismschizophrenia
Journal Article2025-11-01No SnippetsMargolis MP, Tang M, Gagliardi M, Wen C, Wu Y, Wray NR, Ziller MJ, Gandal MJ.
Show Full Abstract
Genome-wide association studies (GWASs) have identified thousands of variants associated with neuropsychiatric disorders (NPDs), including autism spectrum disorder (ASD), schizophrenia (SCZ), and Alzheimer's disease (AD). However, deciphering the "causal" biological mechanisms and pathways through which these variants act remains a major obstacle that hinders translational understanding of NPD pathogenesis. NPDs are highly polygenic with contributions from pleiotropic variants across the allelic spectrum, most of which reside within large haplotype blocks in non-coding regions of the genome. Successful mechanistic insight requires identifying disease-relevant cell types and states, mapping variant-to-gene effects, and integrating findings across loci, at scale, to pinpoint pathways of polygenic convergence. Here, we discuss functional genomic, machine learning, and experimental approaches to address each step of this daunting challenge. Ultimately, the convergence of results-across methodologies and within key underlying disease pathways-will be essential to realizing the promise of clinical translation for common, complex brain disorders.
Dementia rates are rising globally, with the burden increasing most rapidly in low- to middle-income countries. Despite this, research into Alzheimer's disease and related dementias (ADRD) among African populations remains limited, with existing models based on Western cohorts that overlook sex-, gender-, and ancestry-specific factors. The Female Brain Health and Endocrine Research in Africa (FemBER-Africa) project, hosted at the Brain and Mind Institute, Aga Khan University, Kenya, will establish a deeply phenotyped cohort of 250 African individuals across the ADRD spectrum. It will assess sex-specific risk factors linked to ethnicity, lifestyle, and endocrinological variables using fluid-based biomarkers (blood and saliva), neuroimaging (magnetic resonance imaging and positron emission tomography), and culturally adapted cognitive tests. By comparing data with Western and diasporic cohorts, the study aims to identify ancestry-specific and shared mechanisms driving ADRD risk and progression. The findings will support targeted, culturally relevant prevention and intervention strategies, addressing the underrepresentation of African populations in global dementia research. HIGHLIGHTS: By 2030, > 78 million individuals are expected to have dementia, with the highest burden among women in low- to middle-income countries. Despite this, African populations remain underrepresented in Alzheimer's disease and related dementias (ADRD) research. Existing ADRD risk models fail to account for the unique influence of sex, gender, and ancestry on dementia risk. Female-specific reproductive and hormonal factors, including menopause transition and hormone therapy use, are poorly integrated into current models. The Female Brain Health and Endocrine Research in Africa (FemBER-Africa) project is the first large-scale study to examine sex- or gender-specific and endocrine contributors to ADRD in an African population, using advanced diagnostic, biomarker, and culturally adapted cognitive assessments. The study will assess how biological (hormonal, metabolic), lifestyle (physical activity, diet), and socio-cultural (education, health-care access) factors interact to influence ADRD risk in African women. Insights from FemBER-Africa will inform the development of sex- and gender-specific, culturally adapted ADRD prevention strategies, enhancing the precision and equity of dementia mitigation efforts globally.
Also flagged:obesitytype 2 diabetes mellituspathogenesisviral hepatitismetabolic syndromeaflatoxins
Journal Article2025-11-01No SnippetsHussain MM, Feng B, Wang JM, Zhai AQ, Li FY, Li FY, Hu HJ.
Show Full Abstract
<h4>Background</h4>Hepatocellular carcinoma (HCC) is the most common primary liver malignancy and a leading cause of cancer-related deaths worldwide. Despite advancements in antiviral therapies for hepatitis B (HBV) and hepatitis C (HCV), HCC incidence continues to rise due to metabolic dysfunction-associated steatotic liver disease (MASLD), obesity, type 2 diabetes mellitus (T2DM), and emerging environmental and genetic risk factors. Understanding the evolving landscape of HCC pathogenesis is crucial for improved prevention and treatment strategies.<h4>Objective</h4>This review consolidates recent insights into established and emerging HCC risk factors, highlighting epidemiological trends, molecular mechanisms, and global disparities. It also explores novel therapeutic and preventive strategies aimed at reducing HCC burden and improving patient outcomes.<h4>Methods</h4>A systematic literature review was conducted, incorporating epidemiological studies, molecular research, and clinical trials on HCC risk factors. The interplay between viral hepatitis, metabolic syndrome, environmental toxins, and gut-liver axis dysregulation was analyzed to provide a comprehensive understanding of HCC development.<h4>Results</h4>While HBV and HCV remain significant drivers of HCC, metabolic risk factors-including MASLD, obesity, insulin resistance, and T2DM-are increasingly prevalent, particularly in Western populations. Environmental exposures such as aflatoxins, alcohol, smoking, and air pollution further exacerbate disease progression. Gut microbiota dysbiosis has also emerged as a key modulator of hepatic carcinogenesis. Advances in precision medicine, including tyrosine kinase inhibitors (sorafenib, lenvatinib), immune checkpoint inhibitors (nivolumab, pembrolizumab), and gut microbiota-targeted therapies, are transforming HCC management. Early detection is improving through biomarker-driven surveillance and AI-enhanced imaging techniques.<h4>Conclusion</h4>The shifting epidemiology of HCC necessitates a multidisciplinary approach to prevention, early detection, and treatment. Integrating genomic profiling, biomarker-based risk stratification, and equitable healthcare access will be critical to reducing the global burden of HCC.
Also flagged:Psoriasisinflammatory skin diseaseironC-reactive proteinmetabolismsystemic disease
Journal Article2025-11-01✓ 1 SnippetZhang P, Song Q, Hu Z, Liu L, Cao Y, Liao F, Zhou C.
In-Text Gene Mentions
Introduction)
…conditions such ashemochromatosis, leads to the…
Show Full Abstract
Psoriasis is a chronic, complex, inflammatory skin disease that significantly impacts the quality of life of patients. Research has found excessive accumulation of iron in the skin tissue of psoriasis patients. However, no clinical studies have reported the relationship between serum ferritin (SF) and psoriasis. This cross-sectional study aimed to explore the correlation between SF levels and psoriasis. The study was conducted from June 2020 to December 2023 at the affiliated hospital of Jiujiang University, involving 105 psoriasis patients and 52 controls. Mild and severe disease was defined based on the Psoriasis Area Severity Index. Fasting SF levels were analyzed in blood samples. Compared with the control group, SF levels were significantly elevated in psoriasis patients. In severe psoriasis patients, SF levels were even higher. SF was positively correlated with Psoriasis Area Severity Index, C-reactive protein, and disease duration, with statistically significant differences. In the receiver operating characteristic curve analysis, the optimal cutoff value (area under the curve, sensitivity, specificity) for SF was 216.1 (0.74, 63.98%, 75.00%). High SF levels are associated with the severity of psoriasis. Dysregulation of iron metabolism may play a role in the development of psoriasis. SF levels serve as markers for the severity and duration of psoriasis. By measuring ferritin levels early in the disease process, we can adopt preventive strategies to better manage and improve the survival and quality of life of psoriasis patients.
Also flagged:methylationVenous thromboembolismcardiovascular disordermethyladenosinetranscription factorTF
Journal Article2025-11-01✓ 1 SnippetLin B, Cheng X, Zhang K, Li H, Wang J.
In-Text Gene Mentions
Introduction)
…study also identifiedSERPINC1, PROS1, and PROC…
Show Full Abstract
Venous thromboembolism (VTE) is a prevalent cardiovascular disorder globally. Although current research has established the intricate role of N(6)-methyladenosine (m6A) RNA methylation in various diseases, its association with VTE remains unclear. This study investigated the potential molecular mechanisms of m6A-related genes in VTE to provide new theoretical insights for its treatment. We retrieved VTE-related datasets (GSE19151 and GSE48000) from public databases. Differentially expressed genes were identified through differential expression analysis, while key m6A-related module genes were determined using weighted gene co-expression network analysis. The top 10 genes from 6 algorithms in Cytoscape were intersected to identify candidate biomarkers, which were then validated through expression analysis in the GSE48000 dataset. Furthermore, these biomarkers underwent nomogram construction, functional enrichment analysis, immune infiltration analysis, and the development of a transcription factor (TF) regulatory network. Clinical validation was performed using reverse transcription-quantitative polymerase chain reaction. FAU (Finkel-Biskis-Reilly murine sarcoma virus [FBR-MuSV] ubiquitously expressed) and RPS18 were identified as biomarkers, with their expression significantly upregulated in the VTE group of the GSE19151 dataset (P < .05). Calibration curve results (P = .181) and the nomogram model demonstrated excellent predictive accuracy. Enrichment analysis revealed that both biomarkers were co-enriched in the tight junction and Wnt signaling pathways, among others. Immune infiltration analysis showed that FAU had the strongest positive correlation with naive CD4+ T cells, while RPS18 was most strongly correlated with activated memory CD4+ T cells. Additionally, 20 TFs in the TF regulatory network were found to regulate both FAU and RPS18. Reverse transcription-quantitative polymerase chain reaction results confirmed significant upregulation of FAU and RPS18 in the VTE group. This study identifies FAU and RPS18 as key biomarkers in the pathogenesis of VTE through comprehensive bioinformatics approaches, offering a novel avenue for VTE management.
Condensins are large protein complexes that play a central role in mitotic chromosome assembly in eukaryotes. Our previous mutational analyses of condensin I, combined with Xenopus egg cell-free extracts, provided evidence that dynamic condensin-condensin interactions, triggered by a contact between the CAP-D2 and SMC4 subunits, underlie proper chromosome assembly and shaping. To examine whether and how the hypothesized condensin-condensin interactions contribute to chromosome assembly, here we employed a rapamycin-inducible FKBP-FRB dimerization system to artificially tether CAP-D2 and SMC4 either between different complexes (inter-complex tethering) or within single complexes (intra-complex tethering). The ability of the resulting complexes to assemble mitotic chromosomes was then assessed in Xenopus egg extracts. We found that inter-complex tethering enhances condensin I loading and facilitates mitotic chromosome assembly, whereas intra-complex tethering restricts its function. Moreover, deficiencies in the D2-SMC4 contact caused by an SMC4 W-loop mutation were partially compensated by inter-complex tethering. Together, these findings provide direct evidence that condensin-condensin interactions facilitate mitotic chromosome assembly.
…in the huntingtin (HTT) gene, typically involving…
Show Full Abstract
The most significant breakthrough in gene editing is the advent of the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system. This innovative technology enables scientists to insert or delete genes using specific enzymes, facilitating modifications to genomes that can influence an organism's phenotype. The Cas9 enzyme is the most widely used within the CRISPR framework and has already received approval for treating sickle cell disease, with many other applications likely to follow. As this rapidly evolving field continues to advance, it holds great promise for addressing genetic disorders and diseases. This article will explore the various enzymes available in the CRISPR system, the range of diseases and conditions that could be treated using this technology, alternative gene therapy methods, and the ethical considerations surrounding its use.
Also flagged:Mitochondrial Aspartyl‐tRNA‐Synthetasemitochondrial tRNA ligaseconjugationaspartic acidwound healingbacterial infections
Journal Article2025-11-01✓ 5 SnippetsJohnson BS, Cornwell A, Farkas D, Yurtsever I, Joseph JA, Pradhan A, Farkas L, Londino JD, Bednash JS, Mallampalli RK.
In-Text Gene Mentions
Introduction)
…ial Aspartyl‐tRNA‐Synthetase (DARS2) is a mitochondrial…
Introduction)
…Additionally,DARS2is known to…
Introduction)
…with other tRNA‐synthetases,DARS2is secreted from…
Introduction)
…mechanism by whichDARS2is secreted remains…
Introduction)
…mitochondrial family member,DARS2, acting in this…
Show Full Abstract
Aminoacyl-tRNA Synthetases (aaRS) are important regulators of cytokine signaling. Multiple cytoplasmic aaRS family members have been observed to be secreted in response to various stimuli to modulate downstream responses, however, agonist-induced cellular release of aaRS from mitochondria has not been described. In particular, TNFα is a potent mediator of aaRS release. BEAS-2B cells were utilized to study the release of mitochondrial Aspartyl-tRNA Synthetase (DARS2) in response to various cytokines. The role of DARS2 in paracrine signaling was evaluated using adoptive media transfer from BEAS-2B to recipient THP1 cells. To identify pathways governing DARS2 secretion, blocking antibodies chemical inhibitors and siRNA technology was employed. Herein, we describe DARS2 as the first mitochondrial aaRS released in response to TNFα from airway epithelia. Once secreted, DARS2 binds to macrophages, is internalized, thereby inducing an M1-like phenotype in recipient macrophages. DARS2 release from airway epithelia is in part, TNFα-receptor 1 dependent, and requires the endosomal sorting complex required for extracellular transport.
Also flagged:Alzheimer's diseaseADneurodegenerative diseaseneurofibrillaryamyloid betaAβ
Journal Article2025-11-01✓ 2 SnippetsKim BH, Seo SW, Kim J, Nho K, Alzheimer's Disease Neuroimaging Initiative#.
In-Text Gene Mentions
Results)⭐ same-sentence co-mention
…by neurons (e.g.,NEGR1, FLRT3, and CA10),…
Results)⭐ same-sentence co-mention
…NEGR1, FLRT3, andCA10), microglia (e.g., IRF1,…
Show Full Abstract
<h4>Introduction</h4>We investigated longitudinal cognitive trajectories in relation to cerebrospinal fluid (CSF) proteomics in Alzheimer's disease (AD).<h4>Methods</h4>Differential protein abundance analysis of proteomics (SomaScan 7K) data was performed for composite scores for domain-specific cognitive functions (memory [MEM], executive function [EF], and language [LAN]) and their longitudinal changes in AD. This was followed by co-abundance network analysis, functional enrichment analysis, and machine learning to identify co-abundant protein modules, associated biological pathways, and prediction models of cognitive trajectories.<h4>Results</h4>We identified proteins and pathways associated with composite scores for domain-specific cognitive functions and their longitudinal changes. Proteins related to MEM and EF were primarily enriched in microglia and oligodendrocytes, respectively. The prediction model for the trajectories of cognitive decline achieved an area under the curve of up to 0.79.<h4>Discussion</h4>Our findings suggest protein signatures and their functional pathways associated with longitudinal changes for cognitive decline, providing molecular insights into longitudinal cognitive trajectories in AD.<h4>Highlights</h4>Altered cerebrospinal fluid (CSF) protein levels were associated with cognitive functions at baseline. Altered CSF protein levels were associated with changes of cognitive decline. Proteins associated with memory were primarily enriched in microglia. Proteins associated with executive function were enriched in oligodendrocytes. The prediction performance for cognitive trajectories was improved up to 30.9%.
Also flagged:Extracellularvesiclesmembranecell surfacemultiple sclerosisMS
Journal Article2025-11-01✓ 1 SnippetJank L, Kumar MKS, Ryu T, Thapa R, Gololobova O, Niepokny TD, Calabresi PA, Witwer K, Dutta R, Na CH, Bhargava P.
In-Text Gene Mentions
Results)
…and serpins (SERPINA3,SERPINC1) that were not…
Show Full Abstract
Extracellular vesicles (EVs) are increasingly recognized as mediators of central nervous system (CNS) function and pathologies, including multiple sclerosis (MS). While plasma-derived EVs have been explored as biomarkers in MS, little is known about EVs in CNS tissue. Here, we characterize EVs from postmortem normal-appearing white matter (NAWM) of MS and control brains. EVs were separated by differential centrifugation followed by size exclusion chromatography and characterized using nanoflow cytometry, single-particle reflectance imaging sensing (SP-IRIS) and transmission electron microscopy. EV size, yield and morphology did not differ significantly between MS and control samples. Despite the small sample size (n = 4 per group), proteomic analyses revealed downregulation of synaptic and mitochondrial proteins and upregulation of complement and inflammatory proteins and pathways in MS NAWM EVs. This suggests that EVs reflect ongoing synaptic pathology, metabolic dysfunction and CNS-compartmentalized inflammation and that they may actively contribute to these pathological processes. Deconvolution analyses suggest a shift in EV cellular origin, with an increased astrocytic and decreased neuronal EV contribution in MS. Several proteomic changes we observed in CNS-derived EVs have also been reported in circulating EVs of people with MS, establishing this CNS tissue EV study as a valuable resource for identifying biomarker candidates for brain-derived plasma EV studies.
Also flagged:visionpigmentationmetabolismhistonebindingtranscription factors
Journal Article2025-11-01No SnippetsLal M, Bhattacharya J, Sandhu KS.
Show Full Abstract
The Mexican cavefish, Astyanax mexicanus, is a captivating model for probing cave adaptations, showcasing pronounced divergence in traits like vision, brain morphology, behavior, pigmentation, metabolism, and hypoxia tolerance compared to its surface-dwelling counterpart. However, only a small number of protein-coding variants have been found in cave-morphs, leaving the vast phenotypic gap between the two morphs largely unexplained. We aligned the genomes of five closely related teleosts and identified 46,914 conserved noncoding elements, of which 473 were specifically lost in cave-morphs. These conserved noncoding elements, confirmed in Zebrafish, displayed activating histone modifications, possessed binding sites of neuronal transcription factors, and interacted with cognate genes through chromatin loops. Genes crucial for eye and nervous system development were located adjacent to conserved noncoding elements lost in cave morphs. Notably, the flanking genes were gradually downregulated during embryonic development of cave-morphs, contrasting with surface morphs. These insights underscore how dampened developmental pathways, stemming from the loss of distal regulatory elements, may have contributed to the evolutionary regression of phenotypes in cave morphs.
Also flagged:gene expressionribosometranslation initiationtranslation initiation factorsneurological diseasesRAN
Journal Article2025-11-01No SnippetsLin SJ, Rosas E, Fuchs G, Shorrock HK.
Show Full Abstract
Eukaryotic gene expression is strictly controlled and regulated during translation. For eukaryotic mRNAs, canonical cap-dependent translation is the preferred pathway to synthesize proteins and starts with the recruitment of eukaryotic initation factors and the ribosome to the 5' m<sup>7</sup>G cap structure of the mRNA, followed by ribosome scanning and AUG recognition. Canonical translation can however be impaired during cellular responses to certain environmental factors, including stress, viral infection, and hypoxia. In response to these conditions, cells shut down the canonical translation initiation pathway and utilize alternative translation initiation mechanisms some of which are heavily dependent on RNA secondary structures. One such non-canonical initiation mechanism is mediated through Internal Ribosome Entry Sites (IRESs), found in viral and cellular mRNAs, which directly recruit the ribosome and do not require all translation initiation factors. Repeat-associated non-AUG (RAN) translation is another form of non-canonical translation initiation shown to heavily rely on RNA structure: this mode of translation initiation is relevant in the context of a subset of neurological diseases. This review focuses on the role of RNA structure in noncanonical translation initiation mechanisms, with a focus on IRES-mediated and RAN translation. This article is categorized under: Translation > Mechanisms Translation > Regulation RNA Structure and Dynamics > RNA Structure, Dynamics and Chemistry.
Also flagged:Methylene Blue3-Nitropropionic Acidneurodegenerative diseaseHuntingtinmitochondriaHD
Journal Article2025-11-01✓ 5 SnippetsHale HK, Elias KM, Ho S, Kwakye GF.
In-Text Gene Mentions
Introduction)
…Huntingtin gene (HTT) found on…
Introduction)
…The mutatedHTTsequence features an…
Introduction)
…function of theHTTprotein [ 2…
Introduction)
…HTTis ubiquitously expressed…
Introduction)
…of the mutatedHTTprotein, which results…
Show Full Abstract
There are no disease-modifying treatments available for Huntington's disease (HD), a neurodegenerative disease caused by a genetic mutation in the Huntingtin gene. Previous research suggests that disruptions in the bioenergetics of the mitochondria and increased oxidative stress are potential inducers of HD. Therapies that enhance antioxidant pathways intend to target and attenuate the overproduction of reactive oxygen species associated with mitochondrial dysfunction. We have investigated the effect of Methylene Blue (MB) as a potential therapy for HD. MB is a small molecule demonstrated to exhibit neuroprotective effects in other neurodegenerative disease models, including Parkinson's and Alzheimer's, by attenuating the oxidative stress pathways implicated in their pathophysiology. We used an established striatal cell model of HD expressing wild-type (ST<i>Hdh</i><sup>Q7/Q7</sup>) or mutant (ST<i>Hdh</i><sup>Q111/Q111</sup>) HTT and a chemical inducer of HD, 3-Nitropropionic acid (3-NPA), to determine the HD-specific mechanisms regulated by 3 h of MB pre-treatment. Upon 24 h of exposure to 3-NPA, mutant HD cells exhibited a significant concentration-dependent decrease in cell survival and a concomitant increase in cell death compared to wild-type, confirming that 3-NPA exacerbates mutant HTT neurotoxicity. Examination of mitochondrial membrane potential and mitochondrial function in the striatal cells by JC-1 and ATP assays, respectively, revealed MB mediated neuroprotection against 3-NPA-induced reduction in mitochondrial activity. Immunoblotting analysis revealed that MB restores baseline expression of oxidative-stress-related proteins, including HO1 and p62, in both wild-type and mutant cells exposed to 3-NPA. Our findings establish a novel neuroprotective role of MB in both genetic and pharmacological models of HD, suggesting that MB might be a promising therapeutic candidate for altering the underlying pathophysiology of HD by improving mitochondrial function.
Also flagged:hematological cancershematological malignanciesautophagycell cyclediseasesacute and chronic leukemias
Journal Article2025-11-01No SnippetsTian Y, Ni B, Cai D, Wang J, Zhou J, Song M, Zhang X, Jiang J.
Show Full Abstract
Hematological malignancies are complex clonal disorders that pose a significant threat to human health. Current treatment modalities, including radiotherapy, chemotherapy, immunotherapy, and bone marrow transplantation, have demonstrated efficacy but are often limited by side effects, drug resistance, and suboptimal cure rates. Natural medicines, as key elements of complementary and alternative medicine, exhibit considerable potential in combating hematological cancers. Particularly when used in combination with conventional therapies, they can enhance treatment efficacy and reverse drug resistance. This review comprehensively summarizes the mechanisms of action of bioactive natural compounds, extracts, and derivatives against hematological malignancies, with a focus on their roles in apoptosis induction, proliferation suppression, autophagy regulation, cell cycle arrest, and chemosensitization. We also consolidate evidence from preclinical studies and clinical cases supporting their combined use with standard treatments. By elucidating the therapeutic potential and mechanistic insights of natural medicines, this review aims to provide a foundation for developing more effective and safer treatment strategies, facilitating the translation of natural product-based therapies into clinical practice for hematological malignancies.
Also flagged:Alzheimer's diseaseADagingLateonset ADLOAD
Journal Article2025-11-01✓ 1 SnippetVenkatesh R, Cardone KM, Bradford Y, Moore AK, Kumar R, Moore JH, Shen L, Kim D, Ritchie MD.
In-Text Gene Mentions
Discussion)
…also associated withMRPL39(an ADVP gene).…
Show Full Abstract
<h4>Introduction</h4>Alzheimer's disease (AD) is a complex neurodegenerative disorder with heterogeneous genetic and molecular underpinnings. Polygenic scores (PGS) capture little of this complexity.<h4>Methods</h4>We conducted genome-, transcriptome-, and proteome-wide association studies (G/T/PWAS) on 15,480 individuals from the Alzheimer's Disease Sequencing Project R4 (ADSP) to identify AD-associated signals, followed by pathway enrichment analysis. Integrative risk models (IRMs) were developed using genetically regulated components of gene and protein expression and clinical covariates. Elastic-net logistic regression and random forest classifiers were evaluated using standard metrics and compared against baseline PGS.<h4>Results</h4>Known and novel signals were identified via G/T/PWAS. Enrichment analyses highlighted cholesterol and immune signaling pathways. The best-performing IRM, random forest with transcriptomic and covariate features, achieved area under the receiver operating characteristic (AUROC) of 0.703 and area under the precision-recall curve (AUPRC) of 0.622, significantly outperforming PGS and baseline models.<h4>Discussion</h4>Integrating univariate discovery approaches with multivariate modeling enhances AD risk prediction and offers novel insights into underlying biological processes.<h4>Highlights</h4>Identified novel contributions to Alzheimer's disease (AD) from a multi-omics perspective. Integrated genome-wide association studies (GWAS), transcriptome-wide association studies (TWAS), and proteome-wide association studies (PWAS) in a unified association study framework. Developed a method for predicting heritable risk of late-onset AD. Demonstrated that ancestry-aware modeling improves AD risk prediction accuracy.
Also flagged:TRBMybhistonetelomereAtPot1alocalization
Journal Article2025-11-01No SnippetsKusová A, Holá M, Petrová IG, Rudolf J, Zachová D, Skalák J, Hejátko J, Klodová B, Přerovská T, Lyčka M, Sýkorová E, Bertrand YJK, Fajkus J, Honys D, Schrumpfová PP.
Show Full Abstract
Telomere repeat binding (TRB) proteins are plant-specific proteins with a unique domain structure distinct from telomerebinding proteins in animals and yeast. While extensively studied in seed plants, their role in early-diverging plant lineages remains largely unexplored. Here, we investigate TRB proteins in a model moss, Physcomitrium patens, to assess their evolutionary conservation and functional significance. Functional analysis using single knockout mutants revealed that individual PpTRB genes are essential for normal development, with mutants exhibiting defects in the two-dimensional (protonemal) stage, and more prominently, in the formation of three-dimensional (gametophore) structures. Some double mutants displayed telomere shortening, a phenotype also observed in TRB-deficient seed plants, indicating a conserved role for TRBs in telomere maintenance. Transcriptome profiling of TRB mutants revealed altered expression of genes associated with transcriptional regulation and stimulus response in protonema. Subcellular localization studies across various plant cell types confirmed that PpTRBs, like their seed plant counterparts, localize prevalently to the plant nucleus and mutually interact. In bryophytes, TRBs form a monophyletic group that mirrors the species phylogeny, whereas in seed plants, TRBs have diversified into two distinct monophyletic groups. Our findings provide the first comprehensive characterization of TRB proteins in non-vascular plants and demonstrate their conserved roles in telomere maintenance, with additional implications for plant development and gene regulation across land plant lineages.
Also flagged:RALBbreast hypertrophyRAS Like Proto-Oncogene Bfrictional dermatitiskyphosisanxiety
Journal Article2025-11-01No SnippetsGu J, Chen J, Hu Z, Luo H.
Show Full Abstract
Breast hypertrophy is a pathological condition characterized by abnormal enlargement of the breasts due to excessive glandular and adipose tissue proliferation. It is associated with physical discomfort and reduced quality of life. However, its underlying genetic basis remains largely unexplored. We conducted a cross-tissue transcriptome-wide association study (TWAS) using the UTMOST framework, integrating expression quantitative trait locus data from GTEx and GWAS summary statistics from the FinnGen database (7272 cases, 258,508 controls). Additional validation was performed using single-tissue TWAS (FUSION), gene-level association testing (Multi-marker Analysis of GenoMic Annotation (MAGMA)), fine-mapping (FOCUS), and conditional and joint analyses. Key candidate genes were subjected to Mendelian randomization (MR) and Bayesian colocalization analyses to investigate causality. A total of 44 genes were significantly associated with breast hypertrophy in cross-tissue TWAS (false discovery rate < 0.05), and 4 were replicated in whole blood via FUSION. Fine-mapping identified RAS Like Proto-Oncogene B (RALB) as the most probable causal gene (PIP = 0.98), supported by MAGMA, conditional analyses, and colocalization (PPH4 = 0.922). Mendelian randomization confirmed a significant causal relationship between elevated RALB expression and increased risk of breast hypertrophy (odds ratio = 1.26; 95% confidence interval: 1.17-1.35; P < .001). Our integrative genomic analyses identified RALB as a robust susceptibility gene for breast hypertrophy. These findings provide novel insights into the genetic etiology of breast hypertrophy and may facilitate future development of molecular diagnostics or targeted therapies.
Also flagged:deleted incolorectal cancerchromosomeRAD51DNAL4NTN1
Journal Article2025-11-01✓ 5 SnippetsCao GH, Zhang AQ, Dong Y, Fan LL, Yin JY, Tang LL, Li YL.
In-Text Gene Mentions
Introduction)
…colorectal cancer (DCC) gene located…
Introduction)
…TheDCCgene, situated on…
Introduction)
…Mutations within theDCCgene have been…
Introduction)
…the association betweenDCCand this neurodevelopmental…
Introduction)
…in individuals withDCCmutations exceeds the…
Show Full Abstract
<h4>Abstractrationale</h4>Mirror movements (MRMVs) are quite common in young children and typically diminish before the age of 10. However, congenital MRMVs often persist into adulthood. MRMV1 is a rare neurodevelopmental disorder characterized by involuntary movements mirroring intentional actions on the opposite side of the body. Recent research has confirmed an intrinsic connection between congenital agenesis of the corpus callosum (ACC) and MRMV1, which is associated with mutations in the deleted in colorectal carcinoma (DCC) gene.<h4>Patient concerns</h4>The proband was a fetus, which was prenatally diagnosed with congenital ACC; multiple adult males in the proband's family were affected by MRMVs.<h4>Diagnoses</h4>The fetus had congenital ACC, and the affected adult males in the family had MRMV1 (congenital mirror movement disorder type 1).<h4>Interventions</h4>Genomic analysis was conducted, including whole-exome sequencing and Sanger sequencing. Given that the proband's family jointly opted for abortion, no other interventions were employed.<h4>Outcomes</h4>A novel severe mutation in DCC (NM_0005215.3, c.1789C > T/p.Arg597*) was discovered, predicted to be a deleterious mutation through bioinformatics analysis. Sanger sequencing confirmed the segregation of the DCC mutation with the disease phenotype, establishing it as the cause of the familial genetic anomaly.<h4>Lessons</h4>These findings expand the spectrum of DCC mutations associated with MRMV1 and ACC, contributing to genetic counseling and prenatal diagnosis for MRMV patients, and shedding light on the role of DCC in neurodevelopment.
Also flagged:antibodiesinfectionantibodyinfectionsinfluenzalike
Journal Article2025-11-01✓ 1 SnippetRahman M, Uyeki TM, Peiris M, Cardwell JM, Nguipdop-Djomo P, Kim M, Alamgir ASM, Muraduzzaman AKM, Sarkar S, Giasuddin M, Hoque MA, Torremorell M, Rahman M, Fournié G, Pfeiffer DU, Flora MS, Mangtani P.
In-Text Gene Mentions
Methods)
…A cross‐sectional survey was conducted in 702 randomly selected LBM workers recruited from 42 LBMs inDhaka City Corporation (DCC)from January to May 2017.…
Show Full Abstract
<h4>Background</h4>Avian influenza A viruses (AIVs) are endemic among poultry in Bangladesh sold at live bird markets (LBMs). We assessed virologic and serologic evidence of exposure to AIVs among LBM workers.<h4>Methods</h4>A cross-sectional study recruited 702 randomly sampled workers from 42 LBMs in Dhaka, Bangladesh, during 2017. Nasal and throat swabs collected from workers and air samples from LBMs were tested for influenza A virus by RT-PCR with positives subtyped for A(H5), A(H7), and A(H9). Baseline sera from 695 workers and follow-up sera from 89 workers with influenza A positive respiratory specimens were tested by microneutralization assay for antibodies to A(H5N1) clade 2.3.2.1a and A(H9N2) G1 lineage viruses circulating in poultry. A seropositive result was defined as a neutralizing antibody titer ≥ 1:40.<h4>Results</h4>Most LBM workers reported slaughtering (93.3%) and defeathering (84.5%) poultry. Ninety-nine (14.1%) had ≥ 1 respiratory specimen that tested influenza A positive but negative for A(H1) and A(H3). Of these 99, subtyping identified 28 (28.3%) A(H9), 2 (2%) A(H5), 3 (3%) both A(H5) and A(H9), and 66 (66.7%) A (nonsubtypeable). Influenza A viruses were detected in air samples at 25 LBMs (59.5%), including A(H9) only in 10 LBMs (40%), A(H5) only in one (4%), both A(H5) and A(H9) in 13 (52%), and one A (nonsubtypeable) (4%). None of the participants were seropositive for AIVs.<h4>Conclusions</h4>LBM workers had extensive exposure to AIVs, but none had serologic evidence of infection with A(H5N1) or A(H9N2) viruses circulating among poultry in Bangladesh. Ongoing surveillance of AIVs in LBMs and poultry workers is needed.
Journal Article2025-11-01✓ 2 SnippetsFeng Y, Chen X, Zhang Y, Lei R, Lu S, Wu J, Li Z, Peng X, Mei S.
In-Text Gene Mentions
Abstract)
…identified in theSOX6, CACNA1H, FOXP4, EFNA3…
Abstract)
…were found betweenSOX6gene and sperm…
Show Full Abstract
Semen quality is the most crucial indicator for evaluating the reproductive capacity of boars. Semen traits, including semen volume, sperm density, motility and abnormality rate, exhibit low to moderate heritability, making genetic improvement through conventional breeding challenging. Advances in genome sequencing have enabled GWAS to identify genetic markers for economically important traits. In this study, 172 Large White boars with 56,427 phenotypic records across seven semen quality traits were subjected to 15× whole-genome resequencing. GWAS was performed using the FarmCPU model, identifying 2824 significant SNPs and annotating 573 candidate genes associated with seven semen traits. After linkage disequilibrium (LD)-based clumping (r<sup>2</sup> < 0.1, 1 Mb window), 916 independent genomic loci were identified as significantly associated with the seven semen quality traits. Functional analysis revealed key biological processes, including growth regulation, extrinsic apoptotic signalling pathway and the TOR signalling pathway. In an expanded population, six SNPs associated with semen quality traits were identified in the SOX6, CACNA1H, FOXP4, EFNA3 and ITGA9 genes. Significant associations were found between SOX6 gene and sperm abnormality rate, CACNA1H gene and semen volume, sperm density, motility, and abnormality rate, FOXP4 gene and sperm density, EFNA3 gene and semen volume, sperm density, ITGA9 gene and semen volume, sperm density, motility, and abnormality rate. These findings enhance understanding of the genetic architecture of boar semen quality and provide molecular markers for genetic selection, facilitating improved breeding strategies.
Also flagged:cell adhesionParkinson's diseasePDdeathoxygendopamine D2 receptor
Journal Article2025-11-01✓ 5 SnippetsKim LY, Jeon SH, Heo Y, Kang EJ, Hong DK, Kang SS, Lee M, Ahn EH.
In-Text Gene Mentions
Abstract)
…in colorectal cancer (DCC) generated by activated…
Introduction)
…in Colorectal Cancer (DCC), functions not only…
Introduction)
…Notably,DCCis enriched in…
Introduction)
…studies suggest that Netrin‐1/DCCsignaling may support…
Introduction)
…he interplay between Netrin‐1/DCCsignaling and DRD2‐mediated…
Show Full Abstract
<h4>Background</h4>Netrin-1 is stably expressed in mature neurons, where it regulates synaptic plasticity, promotes neuronal survival, and modulates cell adhesion and migration. However, the molecular link between Netrin-1 and the pathogenesis of Parkinson's disease (PD) has not yet been clearly elucidated.<h4>Aims</h4>In this study, we investigated the neuroprotective effects of Netrin-1 against dopaminergic neuronal death associated with PD pathology.<h4>Results</h4>Here, we show that in a rotenone-induced cellular model, Netrin-1 treatment significantly reduced reactive oxygen species (ROS) production, α-synuclein phosphorylation, and subsequent apoptosis. Moreover, Netrin-1 suppressed the expression of pro-inflammatory cytokines, including IL-6, TNF-α, and IL-1β, and promoted the activation of dopamine D2 receptor (DRD2) signaling, which is crucial for dopaminergic neuron survival. Of note, in the Netrin-1 conditional knockout mouse model, we observed significant dopaminergic neuronal loss, accompanied by increased α-synuclein hyperphosphorylation at Ser129 and elevated levels of the truncated form of deleted in colorectal cancer (DCC) generated by activated caspase-3, a marked depletion of DRD2 expression, and hyperphosphorylation of GSK3β at Tyr216. In contrast, these pathological features were attenuated in Netrin-1 wild-type (WT) mice. Additionally, the aging process in α-synuclein (SNCA) transgenic (Tg) mice was characterized by reduced levels of Netrin-1 and DRD2, alongside increased α-synuclein accumulation, proinflammatory cytokines, and caspase-3 activation.<h4>Conclusion</h4>These findings suggest that Netrin-1 protects dopaminergic neurons by regulating neuroinflammation, preserving DRD2 signaling, and inhibiting phosphorylation of GSK3β at Tyr216, thereby offering potential as a therapeutic agent for dopaminergic neurodegeneration.
…two children with PICALM-MLLT10-positive acute leukemia…
Show Full Abstract
A retrospective analysis was conducted on the clinical course of two children with <i>PICALM-MLLT10</i>-positive acute leukemia treated at Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, between July 2021 and July 2023. The patients were diagnosed with acute T-lymphoblastic leukemia with central nervous system involvement and high-risk acute myeloid leukemia, respectively. Both achieved bone marrow complete remission after conventional chemotherapy combined with venetoclax. Following conversion to molecular negativity, they underwent sequential allogeneic hematopoietic stem cell transplantation. At the latest follow-up, both patients were alive and in good clinical condition. These observations suggest that proceeding to hematopoietic stem cell transplantation after venetoclax-based chemotherapy may improve the long-term survival of children with <i>PICALM-MLLT10</i>-positive leukemia.
Also flagged:Crohn's diseaseantigen presentationchemokine motif ligand (CCL)3CCL4interferon-γIFN-γ
Journal Article2025-11-01✓ 1 SnippetLi JC, Mao XL, Zhao R, Zhang Y, Chen YX, Zuo ZG, Shi LY, Chen XR, Huang XL, Yan LL, Chen QW, Lu MM, Zhong CY, Wu F.
In-Text Gene Mentions
Abstract)
…superfamily member 4 (TNFSF4) were higher in…
Show Full Abstract
<b>Objective:</b> To investigate the interaction between type 3 innate lymphoid cells (ILC3) and regulatory T cells (Treg) in patients with fibrostenotic Crohn's disease (CD) using single-cell sequencing analysis. <b>Methods:</b> The clinical data of patients diagnosed with fibrostenotic CD were retrospectively collected from the Department of Gastroenterology, the First Affiliated Hospital of Wenzhou Medical University (Wenzhou group) and the Department of Gastroenterology, Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (Ruijin group) between January 31, 2023, and June 30, 2024. Fresh intestinal fibrotic tissue samples and non-fibrotic intestinal tissue samples were obtained from each patient for single-cell RibonucleicAcid sequencing (scRNA-seq), differential gene enrichment analysis, etc. <b>Results:</b> The Wenzhou group included 1 patient (male, 29 years old). The Ruijin group included 6 patients [4 males, 2 females, with a median age of 41 (27-52) years]. All cells from the intestinal tissues of both groups were categorized into the following 9 major types: T lymphocytes/innate lymphoid cells (ILC), B lymphocytes, plasma cells, macrophages, epithelial cells, fibroblasts, mast cells, neutrophils, and glial cells. Co-analysis of cell types in the intestinal tissues from both groups revealed that the proportion of ILC3 was lower in fibrotic tissue compared to non-fibrotic tissue (0.71% vs 3.26%, <i>P</i>=0.042). Furthermore, in fibrotic tissues, the expression levels of genes related to antigen presentation, including chemokine motif ligand (CCL)3, CCL4, interferon-γ (IFN-γ), interleukin-2 receptor subunit alpha (IL2RA), regulator of calcineurin 2 (RCAN2), and tumor necrosis factor superfamily member 4 (TNFSF4) were higher in ILC3 compared to non-fibrotic tissues. In the Wenzhou group's intestinal tissues, interactions were observed between ILC3 and Treg, epithelial cells and neutrophils. In the Ruijin group's intestinal tissues, interactions were observed between ILC3 and Treg cells. <b>Conclusion:</b> ILC3 disrupts the intestinal immune microenvironment through interactions with Treg cells, thereby promoting the progression of fibrostenotic CD.
Also flagged:PCOSandrogens11-ketotestosteronetestosteronedihydrotestosteronelipid droplet
Journal Article2025-11-01No SnippetsYuan Y, Steenbergen J, de Oliveira Santos Goulart A, Sabaté-Pérez A, Visser JA.
Show Full Abstract
<h4>Context</h4>Women with polycystic ovary syndrome (PCOS) and PCOS animal models have diminished brown adipose tissue (BAT) activity, potentially contributing to metabolic dysfunction. Besides classical androgens, adrenal 11-oxygenated androgens are elevated in women with PCOS. However, it remains unknown whether these 11-oxygenated androgens affect BAT metabolism.<h4>Objective</h4>To study the effects of 11-ketotestosterone (KT) and 11-ketodihydrotestosterone (KDHT) on BAT metabolism.<h4>Methods</h4>The female mouse brown adipocyte cell line T37i was treated with increasing concentrations (0.1-10 µM) of testosterone (T), dihydrotestosterone (DHT), KT, or KDHT during or after differentiation. In addition, female mice received a daily injection of vehicle, DHT, KT, or KDHT (100 µg) for 1 day or 1 week. Adipose depots were collected for RNA sequencing (RNAseq) analysis and Gene Set Enrichment Analysis (GSEA).<h4>Results</h4>During differentiation, T, KT, DHT, and KDHT treatment of T37i cells dose-dependently reduced lipid droplet accumulation, and downregulated mRNA expression of adipogenic markers by up to 50%, with KDHT having the weakest effect. In mature T37i cells, only the high concentrations of these androgens exhibited inhibitory effects. RNAseq analysis revealed that DHT exposure induced the most differentially regulated genes in BAT, followed by KT and KDHT treatment. GSEA indicated that 1-day treatment with DHT and KT, but not KDHT, resulted in the downregulation of metabolic pathways in BAT.<h4>Conclusion</h4>11-Oxygenated androgens at high concentrations directly inhibit brown adipocyte differentiation in vitro and KT acutely downregulates BAT metabolic transcriptome in vivo, a result not observed with KDHT. These findings suggest that elevated 11-oxygenated androgens may impair BAT function, contributing to metabolic complications associated with hyperandrogenic conditions, including PCOS.
The inducible biosynthesis of chlorophylls d and f enables a subset of specialised cyanobacteria to perform oxygenic photosynthesis under far-red light-in the absence of visible wavelengths-via a process termed far-red light photoacclimation. These pigments, like the more common chlorophylls a and b, typically carry an ethyl substituent at the C8 position of the macrocycle, formed by reduction of a vinyl group by an 8-vinyl reductase enzyme. Here, we disrupted the gene encoding BciB, an 8-vinyl reductase found in the majority of cyanobacteria, in Chroococcidiopsis thermalis PCC 7203, a model organism for studying far-red light photoacclimation. Disruption of bciB results in the synthesis of 8-vinyl chlorophyll a when cells are grown in white light; upon switching to far-red light, 8-vinyl forms of chlorophylls d and f, which have not been detected in nature, are synthesised in this strain. The bciB mutant exhibits sensitivity to high irradiance under both light regimes. Pigment analysis and whole-cell absorption and fluorescence spectroscopy reveal decreased synthesis of far-red absorbing chlorophylls, reduced photosystem assembly and an impaired acclimation to far-red light, and transmission electron microscopy demonstrates altered thylakoid membrane morphology in the mutant when compared to the wild type. These results demonstrate the importance of 8-vinyl group reduction for acclimation to far-red light.
The development of inflammatory bowel disease is driven by transcriptional and epigenetic regulators of the nucleic acid-binding proteome (NABPome). However, comprehensive analysis of NABPome composition and dynamics remains challenging due to the lack of an in-depth proteomics strategy. Here, we developed an NABP-DIA methodology that integrates NABPome capture with data-independent acquisition (DIA)-based proteomics. Using NABP-DIA with an experimentally generated spectral library, we achieved a 2.1-fold increase in NABP identification, with improved quantification accuracy and specificity. Applying this method to a colitis model, we identified 118 and 25 differentially expressed NABPs in the mouse spleen and thymus, respectively. Among them, spleen proteins associated with histone methylation were significantly elevated in the colitis group. Further experiments demonstrated that inhibition of H3K27me3 histone methylation reduced the release of inflammatory factors, suggesting that epigenetic modulation may represent a promising therapeutic approach for colitis.
…associations: in migraine,SERPINC1, ZKSCAN8P1, C12orf76, and…
Abstract)
…migraine with aura,SERPINC1, ALMS1, ZKSCAN8P1, PAM,…
Abstract)
…C12orf76, GPATCH4, PAM,SERPINCwere found as…
Results)
…−4 ), andSERPINC1(OR(95% CI) =…
Show Full Abstract
<h4>Objective</h4>To identify contraindicated medications and corresponding target genes for migraine and its subtypes.<h4>Method</h4>Utilizing the Genome-Wide Association Studies (GWAS) for 14 medication-use categories from UK Biobank and GWAS for migraine and its subtypes from FinnGen, our study revealed potential contraindicated drugs for the chronic paroxysmal neurological disorder based on Mendelian randomization (MR). Then we applied the Transcriptome-wide association study (TWAS) within the framework of Omnibus Transcriptome Test using Expression Reference Summary data (OTTERS) and cross-referenced three drug databases to determine the targeted genes of the identified contraindicated medications. Moreover, Summary-data-based Mendelian Randomization (SMR) and INtegration of TWAS And ColocalizaTion (INTACT) were used as sensitivity analyses to further validate the associations and strengthen causal inference. We also performed brain-tissue TWAS across 13 regions to confirm the tissue-specific associations of the hub genes with migraine and its subtypes.<h4>Results</h4>MR analysis revealed that the diuretics and agents that act on the renin-angiotensin system were discovered to be associated with an increased risk of migraine and migraine with aura. By intersecting the results from TWAS and drug databases, 37 and 22 target genes of contraindicated medications were identified for migraine and migraine with aura, respectively. SMR and INTACT confirmed the validity of BLM, C12orf76, GPATCH4, PAM, SERPINC1 for migraine, and ALMS1, GPATCH4, NCF2, SLC12A1, ZKSCAN8P1 for migraine with aura. At the brain-tissue level, we further validated hub gene associations: in migraine, SERPINC1, ZKSCAN8P1, C12orf76, and PAM were significant across brain regions; in migraine with aura, SERPINC1, ALMS1, ZKSCAN8P1, PAM, and NCF2 were significant.<h4>Conclusion</h4>We identified the diuretics and agents that act on the renin-angiotensin system as the contraindicated medications for migraine and migraine with aura, and BLM, C12orf76, GPATCH4, PAM, SERPINC were found as the targeted genes of contraindicated drugs for migraine and ALMS1, GPATCH4, NCF2, SLC12A1, ZKSCAN8P1 for migraine with aura, providing new clues for the preventive strategies for migraine and its subtypes.
Also flagged:BACE1APPamyloid precursor protein) cleavage enzyme 1β‐secretasepeptideAβ
Journal Article2025-11-01✓ 1 SnippetZhou J, Antic SD, Das B, He W, Tran DM, Hu X, Fernández-Chacón R, Yan R.
In-Text Gene Mentions
Discussion)
…Netrin 1 receptorDCC(Deleted in colorectal…
Show Full Abstract
BACE1 is an indispensable enzyme for the production of β-amyloid peptides by initiating the cleavage of amyloid precursor protein at the β-secretase site. Targeting BACE1 inhibition is therefore a therapeutic strategy for treating patients with Alzheimer's disease. However, several clinical trials using brain-penetrable BACE1 inhibitors have failed due to a lack of efficacy. Previous studies, including our own, have shown that both global and neuron-specific BACE1 inhibition in mice leads to impairments in synaptic strength and spine density. In this study, we investigate the effects of BACE1 inhibition on activity-dependent synaptic vesicle exocytosis and endocytosis using a synapto-pHluorin mouse model. Our results demonstrate impaired synaptic release in BACE1-deficient mice. Furthermore, transcriptomic analysis reveals a significant downregulation of genes related to synapse structure and function. Pathway analysis suggests that BACE1 deficiency significantly downregulates neurexin-neuroligin pathway, which can modulate docking and release of synaptic vesicles at the presynaptic compartment. Our findings suggest that BACE1 inhibition may lead to deficits in synaptic vesicle exocytosis due to the downregulation of key synaptic proteins.
<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is a prevalent chronic liver condition linked to metabolic syndrome. Recent studies suggest that metabolites in cerebrospinal fluid (CSF) may play a role in NAFLD development; however, the specific causal relationship between the two remains unclear.<h4>Methods</h4>This bidirectional two-sample Mendelian randomisation (MR) study analysed the causal relationships between 337 CSF metabolites and NAFLD. We used genome-wide association study (GWAS) datasets from the OpenGWAS and FinnGen databases. MR analysis was mainly conducted through the inverse-variance weighted method from the 'TwoSampleMR' R package, and sensitivity analyses were conducted to validate findings.<h4>Results</h4>A total of 24 CSF metabolites were found to have significant causal relationships with NAFLD, with 13 identified in the discovery group and 13 in the validation group. These metabolites predominantly include amino acids, amino acid derivatives, esters, lipids, lipid derivatives, nucleotides, organic acids, carbohydrates and vitamins. Notably, metabolites of lipid derivatives such as 7-alpha-hydroxy-3-oxo-4-cholestenoate (7-HOCA) exhibited a consistent positive causal effect on NAFLD, and nucleotide metabolites uracil showed a consistent inverse causal effect on NAFLD both in the discovery and validation groups. Sensitivity analyses showed robust results without significant pleiotropy or heterogeneity.<h4>Conclusion</h4>This study reveals significant causal associations between specific CSF metabolites and NAFLD, emphasising the importance of the brain-liver axis in NAFLD pathogenesis. These findings provide a scientific basis for developing early diagnostic biomarkers and personalised therapeutic strategies targeting CSF metabolites, potentially improving NAFLD management and patient outcomes.
Also flagged:waterphytostimulationsynthesisphytohormonesgibberellins1
Journal Article2025-11-01No SnippetsSilva TD, Ferrarezi RS, Selari PJRG, da Silva JLB, da Silva MV, Mesquita M, de Oliveira HFE.
Show Full Abstract
The use of microorganisms is a promising technique in agriculture to provide greater water and nutrient efficiency for crops. The objective of this study was to evaluate the effects of microbial inoculation on plant growth, fruit yield and fruit quality of cherry tomatoes (Solanum lycopersicum var. cerasiforme) in a protected environment. The experiment was arranged in a randomized block design with three treatments: (i) inoculation with Bacillus subtilis ATCC 23858; (ii) inoculation with Burkholderia seminalis TC3.4.2R3; and (iii) non-inoculation, with eight replications. The data were subjected to ANOVA using the F-test followed by the Tukey test (p < 0.05) and multivariate statistical analysis for principal component analysis. B. seminalis led to a higher germination rate, increased fruit yield (FY) by 4.3% and soluble solids content (SSC) of 12.33% compared to the non-inoculation treatment. B. subtilis increased plant height (PH) and root mass, FY by 9.56% and SSC by 9.25%. Inoculation increased the mechanical resistance of fruits in terms of compression and puncture. The results of this work indicated that the initial growth of cherry tomatoes was increased by inoculation with B. subtilis and B. seminalis, bringing new possibilities for the sustainable production of this crop since inoculation promoted plant growth, increased FY and improved fruit quality. The study suggests that inoculation with specific strains of B. subtilis and B. seminalis can be beneficial for cherry tomato cultivation in protected environments, highlighting the use of microorganisms in agriculture and their potential for sustainable and efficient crop management.
Also flagged:Colorectal Cancercanceroligonucleotidesbindingantibodiestranslational
Journal Article2025-11-01No SnippetsLobo-Castañón MJ, Díaz-Fernández A.
Show Full Abstract
Colorectal cancer (CRC) remains a leading cause of cancer-related morbidity and mortality worldwide, with patient outcomes highly dependent on early and accurate diagnosis. However, existing diagnostic methods, such as colonoscopy, fecal occult blood testing, and imaging, are often invasive, costly, or lack sufficient sensitivity and specificity, particularly in early-stage disease. In this context, aptamers, which are synthetic single-stranded oligonucleotides capable of binding to specific targets with high affinity, have emerged as a powerful alternative to antibodies for biosensing applications. This review provides a comprehensive overview of aptamer-based strategies for CRC detection, spanning from biomarker discovery to clinical translation. We first examine established and emerging CRC biomarkers, including those approved by regulatory agencies, described in patents, and shared across multiple cancer types. We then discuss recent advances in aptamer selection and design, with a focus on SELEX variants and in silico optimization approaches tailored to CRC-relevant targets. The integration of aptamers into cutting-edge sensing platforms, such as electrochemical, optical, and nanomaterial-enhanced aptasensors, is highlighted, with emphasis on recent innovations that enhance sensitivity, portability, and multiplexing capabilities. Furthermore, we explore the convergence of aptasensing with microfluidics, and wearable technologies to enable intelligent, miniaturized diagnostic systems. Finally, we consider the clinical and regulatory pathways for point-of-care implementation, as well as current challenges and opportunities for advancing the field. By outlining the technological and translational trajectory of aptamer-based CRC diagnostics, this review aims to provide a roadmap for future research and interdisciplinary collaboration in precision oncology.
Also flagged:histone chaperoneCAF-1replication forkRad52proliferating cell nuclear antigenreplication forks
Journal Article2025-11-01No SnippetsFutami H, Yamaji T, Katayama Y, Arata N, Nagura M, Kobayashi T, Sasaki MM.
Show Full Abstract
DNA replication-coupled chromatin assembly is crucial to maintain genome integrity. Here, we demonstrate that the absence of the budding yeast histone chaperone CAF-1 induces the production of extrachromosomal ribosomal RNA gene (rDNA) circles (ERCs), accompanied by chromosomal rDNA copy number changes, in a manner dependent on Fob1-mediated DNA replication fork arrest in the rDNA, the homologous recombination (HR) protein Rad52, and its interaction with proliferating cell nuclear antigen. In the caf-1 mutant, ERC production is triggered partly by increased transcription from the regulatory promoter E-pro, but is also affected by defects independent of E-pro misregulation. Absence of CAF-1 accumulates resected DNA double-strand breaks (DSBs) formed at arrested replication forks, repair of which leads to enhanced ERC formation. CAF-1 deficiency causes partial defects in lagging strand synthesis coupled to nucleosome spacing in the rDNA. Our findings suggest that CAF-1 suppresses HR-mediated rDNA instability during repair of replication-coupled DSBs.
Also flagged:inflammatory bowel diseasepathogenesistranscription factorsTLR2IFNGCD163
Journal Article2025-11-01✓ 2 SnippetsRahman SA, Khatun MT, Singh M, Biswas VK, Hoque F, Zaman NN, Parvin A, Uddin MKM, Sheikh MMI, Begum MM, Arya R, Faruquee HM.
In-Text Gene Mentions
Discussion)
…FOXC1 (Forkhead Box C1Box C1) plays…
I A O 0000606)
…receptor 2 FOXC1Forkhead Box C1Box C1 GABPA…
Show Full Abstract
<h4>Background</h4>Ulcerative colitis (UC), a chronic and relapsing form of inflammatory bowel disease (IBD), arises from a multifactorial interplay of genetic predisposition, immune dysregulation, and environmental triggers. Despite advances in understanding UC pathogenesis, the identification of reliable biomarkers and key regulatory genes remains essential for unraveling disease mechanisms. Such insights are crucial for improving diagnostic precision and developing personalized therapeutic strategies.<h4>Methods</h4>In this study, gene expression profiles from publicly available microarray and RNA-sequencing datasets were systematically analyzed using advanced bioinformatics tools. Differentially expressed genes (DEGs) were identified through statistical comparisons, and functional enrichment analyses were performed to explore their biological relevance. A total of 141 overlapping DEGs were extracted from three GEO datasets, and 20 key DEGs were further prioritized via protein-protein interaction (PPI) network construction. Hub genes, relevant signaling pathways, associated transcription factors (TFs), and microRNAs (miRNAs) linked to disease progression were identified. Potential therapeutic compounds were also predicted through computational drug-gene interaction analysis.<h4>Results</h4>The analysis revealed a panel of novel biomarkers-TLR2, IFNG, CD163, CXCL9, CCL4, PRF1, TLR8, ARG1, LILRB2, FPR2, and PPARG-that function as key hub genes implicated in ulcerative colitis (UC) pathogenesis. These genes were associated with critical biological processes including signal transduction, inflammatory and immune responses, proteolysis, lipid transport, and cholesterol/triglyceride homeostasis. Furthermore, transcription factors (FOXC1, GABPA, GATA2, SUPT5H) and microRNAs (hsa-miR-34a-5p, hsa-miR-335-5p, hsa-miR-24-3p, hsa-miR-23a-5p, hsa-miR-26a-5p) revealed key regulatory networks influencing post-transcriptional gene regulation. Molecular docking analysis predicted Apremilast and Golotimod as promising therapeutic candidates for UC intervention.<h4>Conclusions</h4>In conclusion, this study enhances our understanding of ulcerative colitis pathogenesis by identifying key biomarkers and therapeutic targets, paving the way for future advancements in personalized diagnosis and treatment strategies.
Athletic performance results from complex interactions between genetic and environmental factors. This review compiles and synthesizes available literature on polymorphic genes associated with endurance, power, and strength performance, as well as their links to injury susceptibility and chronic metabolic diseases. Endurance performance is modulated by <i>ACE</i>, <i>PPARGC1A</i>, <i>HFE</i>, <i>UCP2</i>, <i>UCP3</i>, <i>CDKN1A</i>, and <i>PPARA</i>, regulating mitochondrial biogenesis, oxygen utilization, and muscle fiber composition. Power performance involves <i>ACTN3</i>, <i>MCT1</i>, <i>IGF1</i>, <i>AMPD1</i>, <i>AGT</i>, and <i>AGTR2</i>, affecting anaerobic metabolism, lactate clearance, and fast-twitch fiber recruitment. Strength performance is influenced by <i>AR</i>, <i>PPARG</i>, <i>ARK2N</i>, <i>MMS22L</i>, <i>LRPPRC</i>, <i>PHACTR1</i>, and <i>MTHFR</i>, related to androgen signaling, muscle hypertrophy, and recovery. Injury-related genes (<i>COL1A1</i>, <i>COL5A1</i>, <i>IL6</i>, <i>VEGFA</i>, <i>NOG</i>) and metabolic risk genes (<i>FTO</i>, <i>PPARG</i>, <i>ADRB3</i>) further highlight the clinical relevance of genomics. Collectively, these insights support the application of genetic information to personalize training, enhance performance, prevent injuries, and guide exercise interventions to mitigate metabolic disease risk.
<h4>Background</h4>Obesity, a critical public health issue, is linked to numerous metabolic and cardiovascular disorders. Natural products may present a safer and more holistic approach to weight management. A standardized extract of Cyperus rotundus (CRE), containing 6% to 8% stilbenes (scirpusin A, scirpusin B, and piceatannol) was effective in reducing adipogenesis and weight gain in preclinical studies. This study aimed to assess the efficacy and safety of CRE combined with the bioavailability enhancer piperine (CREP), as a natural supplement for managing weight in obese individuals.<h4>Methods</h4>A randomized, double-blind, placebo-controlled trial was conducted over 90 days involving 96 obese participants. Subjects received oral supplementation of 500 mg CRE with 5 mg piperine (CREP) twice daily, alongside a prescribed exercise and diet regimen. Primary outcomes included anthropometric measures such as body weight, body mass index, waist circumference, hip circumference, and waist-hip ratio. Secondary outcomes assessed included serum lipid parameters, Apolipoprotein B-100, calorie intake, physical activity, and safety evaluations.<h4>Results</h4>CREP supplementation led to significant reductions in body weight, body mass index, waist, and hip circumference compared to placebo. Improvements in serum lipid profiles and Apolipoprotein B-100 levels were also observed in the CREP group. No adverse events were reported, and all laboratory parameters remained within normal ranges.<h4>Conclusion</h4>The findings demonstrate that CREP is a safe and effective natural supplement for reducing abdominal obesity and improving lipid profiles. The observed benefits surpassed those of lifestyle management alone, supporting the potential development of CREP as a natural therapeutic option for weight management in obese individuals.
Also flagged:endometrial cancerFerroptosiscancerTumorgynecological tumorsgynecological
Journal Article2025-11-01✓ 1 SnippetMurakami H, Wang J, Yu H.
In-Text Gene Mentions
Results)
…TNFRSF4, TNFRSF8, andTNFSF4between the 2…
Show Full Abstract
Ferroptosis plays an important role in various cancer processes and is regulated by microRNAs. This study aimed to establish a prognostic model based on ferroptosis-related microRNAs (FermiRNAs) to predict the prognosis of endometrial cancer (EC). Tumor transcriptomes and corresponding clinical data of 544 EC patients were downloaded from the cancer genome atlas database, and the ferroptosis database (FerrDb) was used to identify ferroptosis-related genes (mRNAs). FermiRNAs in EC were selected based on their correlation with ferroptosis-related genes. Univariate and multivariate Cox regression analyses were conducted to construct a prognostic model based on the miRNA signature. EC patients were grouped into high- and low-risk categories based on the risk score of the prognostic model. Kaplan-Meier survival analysis and time-dependent receiver operating characteristic (ROC) curves were used to evaluate the prognostic value of risk scores. A predictive nomogram was then established. Finally, we compared the proportion of infiltrating immune cells and the expression of potential immune checkpoints between the 2 groups to understand the tumor immune microenvironment associated with signature FermiRNAs. A prognostic model based on the 2 FermiRNAs (miR-4635 and miR-3131) was developed. Kaplan-Meier survival analysis indicated that patients with high-risk scores had worse overall survival (P < .001). ROC curves showed that the area under curve values of the prognostic model were 0.621, 0.712, and 0.696 for 1, 3, and 5 years, respectively, indicating good predictive ability. ROC curves also indicated that the prognostic model had a better capability to predict the prognosis of patients with EC than the other clinical factors. A predictive nomogram suggested that the risk model could offer independent prognostic evaluation with high accuracy. The tumor immune microenvironment, including infiltrating immune cells and immune checkpoints, showed several differences between patients with high- and low-risk scores. In an external validation cohort (213 EC patients from the clinical proteomic tumor analysis consortium dataset), 2 FermiRNAs were confirmed to be associated with EC prognosis in the same manner. A novel ferroptosis-related miRNA prognostic model is useful for predicting the prognosis of patients with EC.
Also flagged:Inflammatory responsesglial activationcoronavirus disease 2019COVID-19pathogenesismetabolism
Journal Article2025-11-01No SnippetsLi J, Xu S, Guo S.
Show Full Abstract
Inflammatory responses including glial activation, and upregulated inflammatory factors occurred after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infected central nervous system. Blood-brain barrier (BBB) disruption has been implicated in coronavirus disease 2019 (COVID-19) pathogenesis and may predispose to the long-lasting neurological damage even after the epidemic ends. The BBB is a highly selective dynamic interface to protects the brain from neurotoxins and the elimination of byproducts of brain metabolism via efflux transporters. The COVID-19 pandemic has introduced new challenges in managing neurological conditions, and understanding SARS-CoV-2 journey through BBB and the interconnections between the members of BBB is crucial. This review aims to summarize and elucidate the damage to the main constituent cells of BBB, including brain microvascular endothelial cells, astrocytes, and microglia and its contribution to COVID-19. Further understanding of these interactions may facilitate the development of improved treatment options and preventative measures of central nervous system injury due to COVID-19.
Also flagged:cancerpancreatic ductal adenocarcinomaPDACdistal cholangiocarcinomacancerscervical cancer
Journal Article2025-11-01✓ 5 SnippetsMenso JE, Bruna CL, Ali M, Bonsing B, Bosscha K, Brosens LAA, Busch OR, Crobach ASLP, Daams F, Derksen W, Dewulf MJL, Doukas M, Fariña Sarasqueta A, Festen S, Abu Hilal M, de Hingh IHJT, Homs MYV, Kazemier G, Lips DJ, Luyer MDP, de Meijer VE, Mieog JSD, Te Riele WW, van Santvoort HC, van der Schelling GP, Stommel M, Verheij J, de Wilde RF, Wilmink JW, Molenaar IQ, Groot Koerkamp B, van der Geest LG, Besselink MG.
<h4>Background</h4>Robot-assisted pancreatoduodenectomy (RPD) aims to enhance postoperative recovery compared to open pancreatoduodenectomy (OPD). Although recent randomized trials confirmed the short-term safety of RPD, they did not confirm superiority or assess oncological safety. This nationwide observational cohort study compares oncological outcome after RPD versus OPD in patients with resectable pancreatic ductal adenocarcinoma (PDAC) and distal cholangiocarcinoma (DCC) without vascular contact.<h4>Methods</h4>All consecutive patients undergoing RPD and OPD for upfront resectable PDAC and DCC without vascular contact on preoperative imaging in the Netherlands were included. Data were obtained from the Netherlands Cancer Registry (2016-2023). Primary outcomes were overall survival (OS) and R0-resection rate.<h4>Results</h4>Overall, 1675 patients after pancreatoduodenectomy for upfront resectable PDAC and DCC were included (375 RPD; 1300 OPD). Adjusted median OS was 23 months after RPD versus 22 months after OPD, with comparable 5-year survival rate (23.3% versus 22.4%, HR 0.96 [0.82-1.14], P = 0.665). The R0-resection rate was comparable (57.1% versus 59.7%, P = 0.368). RPD was associated with a shorter hospital stay (median 9 versus 11 days, P < 0.001) and comparable in-hospital/30-day (3.1% versus 2.6%, P = 0.618) and 90-day mortality rate (7.7% versus 6.2%, P = 0.276). In patients with PDAC, no differences in receipt (58.2% versus 58.7%, P = 0.900), time to start (median 54 versus 58 days, P = 0.107), or completion of adjuvant chemotherapy (30.4% versus 30.4%, P = 0.999) were observed.<h4>Conclusions</h4>In this nationwide study, oncological outcome including 5-year survival was comparable between patients undergoing RPD and OPD for upfront resectable PDAC and DCC without vascular contact without differences in the use of adjuvant therapy for PDAC.
Also flagged:NirmatrelvirbindingnitrileProteasefluorovinylsulfone
Journal Article2025-11-01No SnippetsMartins FCP, Lang J, Rocho FDR, Wang X, Bonatto V, Lameira J, Klein C, Montanari CA.
Show Full Abstract
The COVID-19 pandemic underscored the urgent need for effective antiviral agents, particularly against coronaviruses, which pose a continuing threat of future outbreaks. Targeting the main protease (M<sup>pro</sup>), a key enzyme in viral replication, represents a promising therapeutic strategy. This study investigates structural modifications to known M<sup>pro</sup> inhibitors, focusing on substitutions at the P2 position to explore alterations in both inhibitory potency and metabolic stability. Computational modeling and biochemical assays revealed that incorporating large, hydrophobic, and π-rich groups, such as the 4-phenylproline, significantly enhances binding affinity. Additionally, we evaluated warheads that have not yet been explored in the context of SARS-CoV-2 M<sup>pro</sup> inhibition. Among these, fluoro-vinylsulfone and nitrile groups demonstrated superior inhibitory activity. A fragment-merging strategy combining an optimized P2 substituent with the nitrile warhead yielded a hybrid molecule with binding affinity comparable to nirmatrelvir. However, other analogs incorporating individual warhead optimizations displayed similar potency. These findings generate valuable insights into the design of robust M<sup>pro</sup> inhibitors and support their potential development as broad-spectrum antiviral agents.
Also flagged:Brucellosiszoonotic infectionspontaneous abortionorchitisepididymitisinfertility
Journal Article2025-11-01✓ 2 SnippetsChen WB, Wang CL, Wan SC, Luo X, Yang DH, Zhang MF, Wu WP, Li N, Han B, Zhu HJ, Yu HS, Hua JL.
In-Text Gene Mentions
Results)
…Homo sapiens ]),PRDX6, ATP5J2 ,…
Results)
…as ATP5J2 ,PRDX6, and PARK7…
Show Full Abstract
Brucellosis, a zoonotic disease caused by <i>Brucella</i> infection, poses a major threat to both global health and livestock productivity. Although reproductive impairment is well established, the molecular mechanisms driving testicular immunopathology remain poorly understood. In this study, single-cell RNA sequencing was used to delineate transcriptional changes in goat testicular tissues under physiological and <i>Brucella</i>-infected conditions, revealing dynamic immunological remodeling of the testicular microenvironment. Infection induced marked shifts in T cell and macrophage phenotypes, with T cells exhibiting pronounced hyperactivation linked to CD45-mediated signaling cascades. Thioredoxin-interacting protein ( <i>TXNIP</i>), a gene strongly up-regulated in response to infection, emerged as a potential immunotherapeutic target. Intercellular communication networks were significantly disrupted in infected testes, with CD39- and JAM-dependent signaling pathways implicated in the erosion of immune privilege. Regulon analysis further identified GATA3, IRF5, SEMA4A, and HCLS1 as transcriptional regulators associated with T cells and macrophages in infected testes. These findings provide novel insights into the molecular mechanisms driving testicular immunopathology during <i>Brucella</i> infection and highlight candidate targets for immunomodulatory intervention in disease control and livestock reproductive health.
<h4>Introduction</h4>Breast cancer (BC) is a devastating condition with high morbidity and mortality rates in females. Autophagy is an early-stage cell response against stressful conditions. Emerging data have revealed the autophagy-angiogenesis interaction in terms of tumor development and metastasis.<h4>Methods</h4>Here, the angiogenesis behavior of human MDA-MB-231 cells was monitored after modulation of autophagy response in the presence of free 3-methyladenine (3-MA), metformin (Met), or drug-loaded exosomes (3-MA@Exos and Met@Exos). Orthotopic transplantation was done using human BC cell-laden alginate/gelatin (Alg/Gel) microspheres in mice after treatment with Met and/or 3-MA.<h4>Results</h4>Met, and/or Met@Exos increased the cell migration rate and promoted human endothelial cell migration compared to the control cells (<i>P</i><0.05). However, these features were blunted in 3-MA and 3-MA@Exos groups (<i>P</i><0.05). Flow cytometry analysis revealed that the drug loading into Exos did not influence internalization capacity or cell survival (<i>P</i>>0.05). ELISA revealed that vascular endothelial growth factor (VEGF) levels were reduced in Met and 3-MA-treated cells, with more pronounced reductions in the free 3-MA groups. Real-time PCR analysis showed diminished expression of several angiogenesis-related genes, except for platelet endothelial cell adhesion molecule-1 (PECAM-1) in the Met@Exos, 3-MA, and 3-MA@Exos groups. Met treatment increased the metastasis and tumor formation in mice mammary glands after orthotopic transplantation of BC tumoroids.<h4>Conclusion</h4>These data indicate that autophagy modulation can alter the angiogenesis and metastatic behavior of human BC cells <i>in vitro</i> and <i>in vivo</i>. Exos are valid bio-shuttles for the delivery of autophagy modulators in CSC-targeted therapies.
This article presents a comprehensive dataset examining the preparedness of high school educators in Vietnam for the digital transformation of their teaching and professional practices. The investigation evaluates readiness across ten critical dimensions: (1) Content Knowledge, (2) Technological Knowledge, (3) Technological Pedagogical Knowledge, (4) Teacher Perceptions and Expectations of Technology Application, (5) Perceived Ability to Use Technology, (6) Social Influence, (7) Facilitating Conditions, (8) Behavioral Intention to Utilize Technology, and (9) Actual Technology Use Behavior. Data was collected between May 15 and May 31, 2025, through an online survey utilizing Google Forms, yielding responses from 11,448 high school teachers across five provinces and cities (Bac Giang, Hung Yen, Nghe An, Can Tho, and Ho Chi Minh City)- representing Vietnam's three primary regions. To maintain confidentiality and streamline analysis, the data has been anonymized and coded. This dataset aims to elucidate the key factors influencing teacher readiness, providing valuable insights for research, comparative studies, and the formulation of digital education policies and teacher training initiatives in the context of Vietnam's educational digital transformation and beyond].
Also flagged:rotaxanescatenaneolefinsolefinrotaxane 6rotaxane
Journal Article2025-11-01✓ 1 SnippetCetin MM, Mazumdar A, Cordes DB, Fidan VG, Yang Z, Mayer MF.
In-Text Gene Mentions
Introduction)
…DCCmechanisms are typically…
Show Full Abstract
Efficient routes to [2]rotaxanes are often compromised by formation of irrecoverable, non-interlocked byproducts. Herein, we report a thermodynamically steered, atom-economical strategy that couples a Cu(i)-templated, low-strain Sauvage-type [2]catenane with di-stoppered olefin <i>via</i> ring-opening double cross-metathesis (RO-DCM), implementing dynamic covalent chemistry to bias the system toward the most stable interlocked architecture. The transformation proceeds through ring opening of the metalated [2]catenane and its <i>in situ</i> "insertion" into the axle, engaging internal olefins on both partners. Optimization of metathesis parameters (Grubbs II, DCM, 40 °C) identified the stoichiometry of the di-stoppered olefin as the key lever; using ten equivalents furnished the metalated [2]rotaxane 6 in up to 88% isolated yield while suppressing mono-stoppered byproducts. Subsequent demetalation cleanly delivered [2]rotaxane 9. Analytical size-exclusion chromatography across the full component set provided diagnostic retention times, confirming product identity and the absence of catenane contamination. No dethreading of macrocycle 1 from 9 was detected under conventional heating in DCM or DMSO over 12-48 hours, underscoring kinetic persistence of the mechanical bond. Overall, this RO-DCM platform minimizes non-interlocked waste streams while providing a concise, high-yield entry to [2]rotaxanes from metathesis-addressable, copper-templated interlocks. Beyond the single-molecule level, the approach establishes a general ring-chain equilibration blueprint that should translate to sequence-defined, mechanically interlocked oligomers and polymers.
Also flagged:Hereditary hemochromatosisHHgenetic disorderironcontact dermatitissteroids
Journal Article2025-11-01✓ 5 SnippetsCrippen A, Parekh A, Yuan R.
In-Text Gene Mentions
Abstract)
…unusual presentation ofhemochromatosis.…
Abstract)
…group seen inhemochromatosis.…
Title)
…Rash Revealing HiddenHemochromatosis: A Case Study…
Introduction)
…Hemochromatosispresents more frequently…
Introduction)
…mutation in theHFEgene.…
Show Full Abstract
Hereditary hemochromatosis (HH) is an autosomal recessive genetic disorder characterized by excessive iron accumulation in tissues. This case highlights a 29-year-old man with an unusual presentation of hemochromatosis. Persistent symptoms led to bloodwork that revealed iron overload, prompting further genetic analysis. The 29-year-old Caucasian man presented to his primary care provider (PCP) with complaints of an erythematous and pruritic rash across his chest and abdomen. It was thought to be irritant contact dermatitis in congruence with his past medical history. He was treated with steroids with temporary improvement. He was also referred to dermatology, where he was started on dupilumab injections for eczema. Two weeks later, the patient visited the emergency department, presenting with an erythematous and pustular rash diffusely throughout both feet. His rash was assumed to be eczematous, and he was given steroids and antibiotics due to a few open sores observed. Upon returning to his PCP for follow-up, his routine labs revealed an elevated iron level of 208. In conjunction with his skin irritation, a cheek swab was ordered to check for the C282Y gene. This prompted his new diagnosis of HH. Upon this result, he was referred to hematology for further work-up. Magnetic resonance imaging (MRI) of the abdomen showed evidence of diffuse iron deposition in the liver. An echocardiogram and thyroid-stimulating hormone (TSH) levels were found to be normal in this patient. Treatment was explained, and he consented to start weekly phlebotomy to reduce total body iron stores. This case highlights an initial presentation that deviates from the typical rash and age group seen in hemochromatosis. Recognizing such manifestations may facilitate earlier diagnosis, and physicians should consider iron studies in patients with eczema or irritant dermatitis that is resistant or persistent despite standard therapies.
Climate and land use change have increased human-wildlife interactions, potentially reducing wild species density and prompting behavioral adaptations to urbanized environments. It is still debated if behavioral responses are mainly the result of phenotypic plasticity or if they were driven by anthropic selective pressures, especially in small populations where genetic drift is strong. Our study focused on the small Apennine brown bear population (Ursus arctos marsicanus), which has coexisted with humans in Central Italy for millennia. We characterized genomic diversity and identified adaptation signals distinctive to this population by comparing newly generated and published whole-genome resequencing data from Apennine, Central European, and North American brown bears. Apennine brown bears exhibited reduced genomic diversity, higher inbreeding, and larger realized genetic load compared to other brown bears. We showed that Apennine brown bears possess a unique genomic diversity pattern including selective signatures at genes associated with reduced aggressiveness (eg DCC, SLC13A5). Within these genes, most of the newly discovered variants were located in noncoding regions and some of them were predicted to alter splicing factor binding sites, highlighting the contribution of noncoding variation in shaping complex phenotypes. Our results support the hypothesis that human-induced selection has promoted behavioral changes even in small- and long-isolated populations, reducing conflicts and contributing to the long-term persistence of a large mammal species and its coexistence with humans.
…rombin time, antithrombin III(ATIII), plasminogen, serum calcium(…
Abstract)
…decrease in PLT,ATIIIand Ca levels…
Abstract)
…PASS, vWF:Ag, PT,ATIII, D-D and Ca…
Abstract)
…efficacy, followed byATIIIand PT; vWF:Ag…
Abstract)
…the levels ofATIIIand Ca are…
Show Full Abstract
<h4>Objective</h4>To examine the relationship between acute pancreatitis (AP) severity and both coagulation function and serum calcium levels.<h4>Methods</h4>This is a retrospective study. A total of one hundred patients with AP admitted to our hospital from July 2022 to January 2024. Fifty patients with severe AP(SAP) were assigned to the experimental group, fifty patients with mild-to-moderate AP were assigned to the control group. The pancreatitis activity score system(PASS) score, platelet(PLT) count, von Willebrand factor antigen(vWF:Ag), prothrombin time(PT), activated partial prothrombin time, fibrinogen, thrombin time, antithrombin III(ATIII), plasminogen, serum calcium(Ca) and D-dimer(D-D) were compared. The independent risk factors for predicting AP severity were analysed. The prognostic predictive value and diagnostic efficacy of these independent risk factors were assessed.<h4>Results</h4>The experimental group exhibited a statistically significant increase in the PASS score, vWF:Ag, PT and D-D levels and a significant decrease in PLT, ATIII and Ca levels compared with the control group(P< 0.001). Logistic regression analysis showed that PASS, vWF:Ag, PT, ATIII, D-D and Ca were independent risk factors for predicting the severity of AP; Ca levels had the highest diagnostic efficacy, followed by ATIII and PT; vWF:Ag was the least effective. The levels of vWF:Ag, PT, and D-D are positively correlated with PASS scores, the levels of ATIII and Ca are negatively correlated.<h4>Conclusion</h4>The levels of vWF:Ag, PT, D-D, ATIII, and Ca in AP patients are correlated with the severity of the condition, and Ca levels may more accurately and early assess the severity of AP patients.
Also flagged:muscular diseasesmyostatinMSTNinflammatory myopathyantibodiesOligonucleotide
Journal Article2025-11-01✓ 2 SnippetsFakih HH, Lochmann C, Gagnon R, Summers A, Caiazzi J, Buchwald JE, Tang Q, Maru B, Hildebrand SR, Abideen MZUI, Furgal RC, Gross KY, Yang YS, Cooper D, Monopoli KR, Echeverria D, Shim JH, Yamada K, Alterman JF, Khvorova A.
In-Text Gene Mentions
Results)
…and huntingtin (Htt), for which…
Results)
…50% silencing ofHttin the quadriceps,…
Show Full Abstract
Small interfering RNAs (siRNAs) hold promise for treating cardiac and muscular diseases, but robust and scalable delivery remains a hurdle. While biologic-siRNA conjugates (e.g. antibodies) are in clinical development, their manufacturing is complex. Lipophilic siRNAs are readily chemically synthesized at scale and support effective heart and muscle delivery. Here, we refine siRNA chemical design for enhanced potency and durability to support clinically relevant silencing. Targeting myostatin (MSTN), a key gene in muscle-wasting, a single subcutaneous dose in mice achieved potent silencing (80% inhibition up to 6 weeks, 30% up to 14 weeks). Biweekly dosing led to over 95% MSTN reduction for half-a-year with no observed toxicity. This resulted in muscle growth, increased lean mass, and improved grip strength. Phenotypical benefits extended beyond direct target silencing, suggesting prolonged effects. The siRNA scaffold was effective across multiple muscle groups, with its modularity confirmed by three additional targets. Optimized dosing extended durability to 20 weeks without compromising phenotypic outcomes. As a proof of concept, MSTN inhibition with siRNAs successfully combated muscle wasting in an inflammatory myopathy model (cardiotoxin). These findings pave the way for long-lasting gene modulation in heart and muscle, offering new therapeutic strategies for muscular diseases.
Also flagged:chromosomechromosomesgenomeautosomessplice junctioncentromere
Journal Article2025-11-01No SnippetsStanek TJ, Leung W, Shaffer CD, Genomics Education Partnership, Olaveja I, Laughlin A, Hester J, Garrido D, Oh EK, Volski M, Panda N, Mo M, Cordes E, Dalling M, Kershaw K, Arnott M, Daly S, Valenzuela SG, Thompson P, Hastert KL, Sabb D, Karpinski K, Arora MN, Rius N, LoBello L, Jaramillo S, Sonavane O, Herrmann A, Reed LK, Elgin SCR, Arrigo C, Ellison CE.
Show Full Abstract
Genome size varies widely, even among closely related species, yet much less is known about chromosome size variation. Here we use the fourth chromosome of Drosophila, also known as the "Muller F element" or "dot chromosome", as a model to investigate chromosome-specific size expansion. The F element of most Drosophila species is small (∼1.3 Mb) and almost entirely heterochromatic, yet harbors approximately 80 protein-coding genes. Here, we study D. kikkawai, D. takahashii, D. ananassae, and D. bipectinata, whose F elements are 2- to 15-fold larger in size compared to D. melanogaster. Through manual gene curation and comparative genomic analysis, we find that their F elements have expanded primarily via accumulation of transposable elements (TEs) in introns and intergenic regions. Natural selection appears less efficient on these expanded F elements: they have smaller effective population sizes and their genes exhibit reduced usage of optimal codons, compared to D. melanogaster. We propose that F element size variation is driven by differences in F element recombination rates. The ultra-long (∼20 Mb) F elements of D. ananassae and D. bipectinata display high rates of rearrangement and sequence evolution and exhibit independent TE-driven expansions. Our results suggest that F elements of most Drosophila species likely recombine enough to prevent size expansion, while F element recombination in D. ananassae and D. bipectinata is either absent or rare enough to allow TEs and other deleterious mutations to accumulate via Muller's ratchet; thus, these chromosomes evolve more like a Y chromosome than a typical Drosophila F element.
Also flagged:nucleotidesgene expressionnucleotidelocalizationNucleic acid-
Journal Article2025-11-01No SnippetsSafari F, Tree JJ, Vafaee F.
Show Full Abstract
Machine learning is a powerful approach for analysing RNA sequences, particularly for understanding the function and regulation of noncoding RNAs. A critical step in this process is feature extraction, which transforms biological sequences into numerical representations that allow computational models to capture and interpret complex biological patterns. Despite its central role, the field of RNA feature extraction remains broad and fragmented, with limited standardization and accessibility hindering consistent application. In this comprehensive review, we address the fragmentation of the field by systematically organizing over 25 feature extraction strategies into sequence- and structure-based approaches. We further conduct a comparative analysis highlighting how the choice of feature sets impacts model performance, reinforcing the importance of integrated feature engineering. To facilitate practical adoption, it also provides a curated list of publicly available tools and software packages. By consolidating methodologies and resources, this work seeks to improve reproducibility, scalability, and interpretability in machine learning-driven RNA research.
Also flagged:sickle cell anaemiablood disorderβ-globinhaemoglobinopathiesβ-thalassaemiaBCL11A
Journal Article2025-11-01✓ 1 SnippetShrivastava M, Bathri R, Shafqat N, Das S, Agrawal A.
In-Text Gene Mentions
Discussion)
…ANK1, PKLR, CDAN1,HFE) reflected the complex…
Show Full Abstract
Background & objectives Sickle cell anaemia (SCA) is a serious inherited blood disorder caused by mutations in the β-globin gene, leading to abnormal haemoglobin (HbS). Understanding the genetic diversity of SCA is important for improving diagnosis, treatment, and public health planning. Our aim was to systematically review and summarise the genetic variations associated with SCA in various populations, and to explore how these differences affect clinical outcomes and inform public health responses. Methods A systematic search was conducted across databases, including PubMed, Scopus, Cochrane, and Science Direct, for studies published between 1990 and 2025. A total of 62 studies were included, covering populations with a high prevalence of haemoglobinopathies. Results Significant genetic heterogeneity was identified. Common coinherited conditions included α- and β-thalassaemia, particularly in Saudi Arabia, Iran, and Sub-Saharan Africa, influencing haemoglobin levels and disease severity. Specific βS haplotypes (e.g. Benin, Bantu, Senegal) were regionally dominant, with some (e.g. Senegal) linked to higher foetal haemoglobin levels and milder symptoms. Genetic modifiers such as BCL11A and MYH9 variants were also found to affect disease expression. Public health screening programmes in countries like the UAE and India have achieved high coverage, but diagnostic and treatment challenges persist due to ongoing genetic and environmental variation. The Quantitative findings include regional dominance of βS haplotypes: Benin (29%), Bantu (3%), Senegal (1%), with the Senegal haplotype linked to higher foetal haemoglobin (HbF) levels (average 14.6%) and the Arab Indian haplotype (6.7%). Co-inheritance of β-thalassaemia was notably common in Saudi Arabia, Iran, and Sub-Saharan Africa. Interpretations & conclusions Tailored, genomically informed public health strategies are needed to address the diverse genetic landscape of SCA. Clinicians should incorporate genetic profiling and culturally appropriate counselling to improve care in affected populations. Variability in study design, sample size, and genetic reporting limited the ability to perform direct comparisons across regions.
<h4>Objective</h4>Leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL) is a rare autosomal recessive leukodystrophy caused by pathogenic variants in the <i>DARS2</i> gene. Although the clinical phenotype of LBSL involves a wide spectrum, presentations predominantly characterized by exercise intolerance remain infrequently documented.<h4>Case report</h4>A 24-year-old woman presented with exercise-induced fatigue as the initial and predominant symptom. Neurological examination revealed mild resistance in the bilateral lower limbs, slightly hyperactive patellar and Achilles tendon reflexes (grade 2), and absent Babinski signs, with no evidence of cognitive impairment or sensory deficits. Laboratory tests showed an elevated serum lactate level (2.5 mmol/L) following 4-h fasting and 10 min of moderate-intensity exercise. Brain and spinal magnetic resonance imaging (MRI) revealed extensive symmetric white matter abnormalities and long-segment spinal cord involvement. Molecular analysis confirmed the presence of compound heterozygous <i>DARS2</i> mutations (NM_018122.5:c.228-16C>A and c.521G>A), thereby confirming the diagnosis. Familial genetic testing indicated that each pathogenic variant was inherited from a different parent.<h4>Conclusions</h4>This case highlights the need to include LBSL in the differential diagnosis of young patients presenting with unexplained exercise intolerance, particularly when neuroimaging reveals characteristic white matter and spinal cord involvement. Early identification and genetic confirmation are critical for accurate diagnosis, genetic counseling, and clinical management.
Also flagged:Mouth DiseaseCA6HandFoot, and Mouth Diseaseenterovirus infectionsencephalitis
Journal Article2025-11-01✓ 1 SnippetHuang S, Luo X, Yu D.
In-Text Gene Mentions
Methods)
…for CA6 andCA10was started in…
Show Full Abstract
<h4>Background</h4>We aimed to analyze the etiological composition of Hand, Foot, and Mouth Disease (HFMD) in Yuyao from 2010 to 2023, and to provide scientific decision and basis for the development of preventive and control measures for HFMD.<h4>Methods</h4>Employing descriptive epidemiological methods, we analyzed the etiological results of mild cases of HFMD monitored from 2010 to 2023.<h4>Results</h4>From 2010 to 2023, 4,294 samples from HFMD patients in Yuyao, China were analyzed, with 2,362 (55.01%) testing positive for enteroviruses. The most common serotypes were EV71 (30.57%), CA16 (25.91%), and CA6 (8.26%). There was a significant variation in positivity rates over the years, with the lowest in 2023 (22.61%) and the highest in 2012 (95.45%). EV71 was the dominant serotype before 2018, but other serotypes became more prevalent afterward, with CA6 emerging as the primary strain post-2018. HFMD cases occurred year-round, with a clear seasonal pattern peaking from April to October, especially in May. This period accounted for 81.63% of all cases. The disease affected individuals of all ages, but the majority (83.74%) were children under six. Males had a higher detection rate than females, with a significant difference between the genders.<h4>Conclusion</h4>Between 2010 and 2023, the composition of pathogens causing HFMD in Yuyao underwent significant changes. These observations not only deepened the understanding of the epidemic trends and etiological evolution of the disease in the area but also provided scientific support for the development of more targeted prevention and control measures.
bioRxiv2025-11-01Preprint (No Snippets API)Liu Y, Reisbitzer A, Dorešić D, Hasenauer J, Krauß S, Tchumatchenko T.
Show Full Abstract
RNA-binding proteins (RBP) are important regulators of RNA metabolism. In neurode-generative disorders such as Huntington’s Disease (HD), disrupted RBP-RNA interactions contribute to neuronal dysfunction. One such RBP, Midline 1 (MID1), has been shown to aberrantly associate with mutant huntingtin ( Htt ) RNA, enhancing its translation, yet the mechanism driving this effect remains unknown. Here, we develop a computational model to understand the role of MID1. Based on previously published data, our model predicts that MID1 increases the stability of the Htt RNA. We experimentally validate this prediction, showing that overexpression of MID1 significantly prolongs the half-life of mutant Htt RNA. Furthermore, we evaluate model refinements, including clustering of MID1-bound RNA, which allow capturing all key observations in the data. Together, we provide a data-driven framework that underlines the importance of RBP-RNA interaction in post-transcriptional regulation. This framework also shows how individual molecular reactions jointly determine RNA stability and protein levels in HD.